(TV-AFB1D) in Engineering Pichia Pastoris GS115 and Application in AFB1 Degradation in AFB1-Contaminated Peanuts

toxins

Article Recombinant Expression of Trametes versicolor Aﬂatoxin B1-Degrading Enzyme (TV-AFB1D) in Engineering Pichia pastoris GS115 and Application in AFB1 Degradation in AFB1-Contaminated Peanuts

Peizhou Yang 1,*, Wei Xiao 1, Shuhua Lu 1, Suwei Jiang 2, Zhi Zheng 1, Danfeng Zhang 1, Min Zhang 1, Shaotong Jiang 1 and Shuying Jiang 1

1 Anhui Key Laboratory of Intensive Processing of Agricultural Products, College of Food and Biological Engineering, Hefei University of Technology, 420 Feicui Road, Shushan District, Hefei 230601, China; [email protected] (W.X.); [email protected] (S.L.); [email protected] (Z.Z.); [email protected] (D.Z.); [email protected] (M.Z.); [email protected] (S.J.); [email protected] (S.J.) 2 School of Biological, Food and Environment Engineering, Hefei University, 158 Jinxiu Avenue, Hefei 230601, China; [email protected] * Correspondence: [email protected]

Abstract: Aflatoxins seriously threaten the health of humans and animals due to their potential carcinogenic properties. Enzymatic degradation approach is an effective and environmentally friendly alternative that involves changing the structure of aflatoxins. In this study, Trametes versicolor aflatoxin B1-degrading enzyme gene (TV-AFB1D) was integrated into the genome of Pichia pastoris Citation: Yang, P.; Xiao, W.; Lu, S.; GS115 by homologous recombination approach. The recombinant TV-AFB1D was expressed in Jiang, S.; Zheng, Z.; Zhang, D.; Zhang, engineering P. pastoris with a size of approximately 77 kDa under the induction of methanol. The M.; Jiang, S.; Jiang, S. Recombinant maximum activity of TV-AFB1D reached 17.5 U/mL after the induction of 0.8% ethanol (v/v) for 84 h Expression of Trametes versicolor ◦ at 28 C. The AFB1 proportion of 75.9% was degraded using AFB1 standard sample after catalysis Aflatoxin B1-Degrading Enzyme for 12 h. In addition, the AFB1 proportion was 48.5% using AFB1-contaminated peanuts after the (TV-AFB1D) in Engineering ◦ catalysis for 18 h at 34 C. The recombinant TV-AFB1D would have good practical application value Pichia pastoris GS115 and Application in AFB1 degradation in food crops. This study provides an alternative degrading enzyme for the in AFB1 Degradation in AFB1- degradation of AFB in aflatoxin-contaminated grain and feed via enzymatic degradation approach. Contaminated Peanuts. Toxins 2021, 1 13, 349. https://doi.org/10.3390/ toxins13050349 Keywords: aflatoxin B1; Pichia pastoris GS115; peanuts; Trametes versicolor; degradation enzyme

Received: 7 April 2021 Key Contribution: The recombinant TV-AFB1D expressed in Pichia pastoris GS115 could effectively Accepted: 6 May 2021 degrade AFB1 from AFB1-contaminated peanuts. Published: 13 May 2021

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in 1. Introduction published maps and institutional affil- Aflatoxins are pathogenic fungal toxins produced by Aspergillus flavus and A. para- iations. siticus [1]. Aflatoxins and their producing bacteria are usually present in food products, feedstuffs, and agricultural raw materials [2]. Aflatoxins are a real threat to human and ani- mal health due to their carcinogenicity and teratogenicity [3]. Among more than 20 kinds of aflatoxin derivatives, AFB1 possesses the highest toxicity of liver cancer and immune Copyright: © 2021 by the authors. system damage. AFB1 causes carcinogenesis in the presence of the double bond of AFB1 Licensee MDPI, Basel, Switzerland. furan ring by inhibiting RNA synthesis [4]. The lactone ring of AFB1 is the main toxicity This article is an open access article site. The cleavage of lactone ring reduces the biological activity of AFB1 with the formation distributed under the terms and of non-fluorescent compound [5]. In addition, a highly reactive AFB1-8,9-epoxide capable conditions of the Creative Commons of reacting with DNA is produced under the activation of cytochrome P450 system [6,7]. Attribution (CC BY) license (https:// Aflatoxins mainly pollute cereals, oils, and their products [8]. As an important agricul- creativecommons.org/licenses/by/ tural raw material, peanut is directly in touch with A. flavus and A. parasiticus in the soil [9]. 4.0/).

Toxins 2021, 13, 349. https://doi.org/10.3390/toxins13050349 https://www.mdpi.com/journal/toxins Toxins 2021, 13, x FOR PEER REVIEW 2 of 12

Aflatoxins mainly pollute cereals, oils, and their products [8]. As an important agricultural raw material, peanut is directly in touch with A. flavus and A. parasiticus in the soil [9]. Peanut is highly susceptible to the contamination of aflatoxins. Aflatoxin-contaminated peanuts pollute the environment and cause the serious economic damage [10]. De- spite remarkable improvements in the technologies of harvesting and storage processing, the contamination of aflatoxins is still a problem to be solved in the peanut industry [11]. Various physical, chemical, and biological methods have been developed to solve the problem of aflatoxin pollution [12]. The physical approach mainly includes heating treatment [13], UV radiation [14], high temperature [15], and adsorption [16]. The main disadvantages are long treatment time and low degradation rate [17,18]. The chemical methods Toxins 2021, 13, 349 include oxidant treatment and acid–base method by destroying the2 of 11structure of aflatoxins [19,20]. Further, both the physical and chemical methods could reduce the quality of nu-

tritionPeanut is by highly changing susceptible the to characteristics the contamination of of raw aflatoxins. materials Aflatoxin-contaminated [21]. peanutsCurrently, pollute the the environment enzymatic and causedegradation the serious approach economic damage has been [10]. developed Despite for its high spec- ificityremarkable and improvements efficiency of in catalysis the technologies [22]. ofLaccase harvesting [23], and peroxidase storage processing, [24], and the reductase [25] have contamination of aflatoxins is still a problem to be solved in the peanut industry [11]. Vari- beenous physical, proved chemical, to be andcapable biological of methodsdegrading have beenaflatoxins. developed The to solve edible the problemvegetable oils are vulnera- bleof aflatoxin to aflatoxin pollution pollution [12]. The physical in the approach production mainly includesprocess heating due treatmentto the raw [13], materials and pro- cessingUV radiation properties. [14], high temperatureAflatoxin [B151 ],is and one adsorption of the most [16]. Thecommon main disadvantages toxic substances in edible veg- are long treatment time and low degradation rate [17,18]. The chemical methods include etableoxidant treatmentoil. Recently, and acid–base the quality method and by destroying safety of the edible structure vegetable of aflatoxins oils [19,20 has]. attracted great at- tentionFurther, both of China the physical State and Council chemical and methods the could State reduce Food the and quality Drug of nutrition Administration. by The govern- mentchanging is theconcentrating characteristics ofR&D raw materialsefforts [to21 ].solve the problem of aflatoxin pollution. Currently, the enzymatic degradation approach has been developed for its high specificity andTrametes efficiency versicolor of catalysis is [ 22a ].common Laccase [23 polypore], peroxidase mushroom [24], and reductase found [25 throughout] have the world and isbeen also proved a well-known to be capable of traditional degrading aflatoxins. medicinal The edible mushroom, vegetable oilsone are that vulnerable is found growing on tree trunks.to aflatoxin We pollution cloned in AFB the production1-degrading process enzyme due to the gene raw materialsfrom Trametes and processing versicolor (TV-AFB1D) ac- properties. Aflatoxin B1 is one of the most common toxic substances in edible vegetable cording to Genbank accession number txid717944 in NCBI. TV-AFB1D was expressed in oil. Recently, the quality and safety of edible vegetable oils has attracted great attention engineeringof China State Council E. coli and BL21(DE3) the State Food with and TV-AFB Drug Administration.1D activity Theof 9.3 government U/mL (not is reported). To fur- therconcentrating investigate R&D efforts the effectiveness to solve the problem of expression, of aflatoxin pollution. we integrated TV-AFB1D into the genome Trametes versicolor is a common polypore mushroom found throughout the world of P. pastoris GS115 in this study. In addition, the application of TV-AFB1D for degradation and is also a well-known traditional medicinal mushroom, one that is found growing on 1 1 wastree trunks. also Weinvestigated cloned AFB1-degrading in AFB -contaminated enzyme gene from Trametespeanuts. versicolor This(TV-AFB study 1providesD) a new AFB - degradingaccording to Genbankenzyme accession for application number txid717944 in enzymatic in NCBI. TV-AFBdegradation1D was expressed in the food and feed industry.in engineering E. coli BL21(DE3) with TV-AFB1D activity of 9.3 U/mL (not reported). To further investigate the effectiveness of expression, we integrated TV-AFB1D into the genome of P. pastoris GS115 in this study. In addition, the application of TV-AFB1D for 2.degradation Results was also investigated in AFB1-contaminated peanuts. This study provides a new AFB1-degrading enzyme for application in enzymatic degradation in the food and 2.1.feed industry.TV-AFB1D Cloning and Evolutionary Tree Analysis

1 1 2. ResultsAflatoxin B -degrading enzyme TV-AFB D from T. versicolor was cloned by using the 1 designed2.1. TV-AFB 1primersD Cloning andwith Evolutionary RT-PCR Tree technique Analysis (Figure 1). The size of TV-AFB D was 2100 bp

accordingAflatoxin to B1 electrophoresis-degrading enzyme TV-AFBanalysis1D fromand T.se versicolorquencingwas confirmation. cloned by using the The evolutionary tree analysisdesigned primers of TV-AFB with RT-PCR1D with technique AFB (Figure1 degradation1). The size enzymes of TV-AFB1 Dfromwas 2100other bp species is shown in according to electrophoresis analysis and sequencing confirmation. The evolutionary tree Figure 2. TV-AFB1D had closer genetic distance with Trametes coccinea than other aflatoxin- analysis of TV-AFB1D with AFB1 degradation enzymes from other species is shown in degradingFigure2. TV-AFB enzymes1D had closer from genetic Dichomitus distance with squalensTrametes, Polyporus coccinea than arcularius other aflatoxin-, Lentinus tigrinus, and Laetiporusdegrading enzymes sulpbureus from Dichomitus. All the aflatoxin-degrading squalens, Polyporus arcularius enzymes, Lentinus from tigrinus Trametes, and genus belonging Laetiporus sulpbureus. All the aflatoxin-degrading enzymes from Trametes genus belonging to familyfamily Polyporaceae Polyporaceae speculated speculated that aflatoxin-degrading that aflatoxin-degrading enzymes would have enzymes common would have com- montraits according traits according to the result to of evolutionarythe result treeof evolutionary analysis. tree analysis.

Figure 1. 1.RT-PCR RT-PCR ampliﬁcation amplification of TV-AFB of1D. TV-AFB Note: lane1D. 1: control;Note: lanelane 2: 1: TV-AFB control;1D. lane 2: TV-AFB1D.

Toxins 2021, 13, x FOR PEER REVIEW 3 of 12

ToxinsToxins2021 2021, 13, 13, 349, x FOR PEER REVIEW 3 ofof 1112

Figure 2. Evolutionary tree analysis of TV-AFB1D with other AFB1-degrading enzymes. Figure 2. Evolutionary tree analysis of TV-AFB D with other AFB -degrading enzymes. Figure 2. Evolutionary tree analysis of TV-AFB1 1D with other AFB1 1-degrading enzymes. 2.2. Expression Vector Construction of TV-AFB1D 2.2. Expression Vector Construction of TV-AFB1D TV-AFB1D2.2. was Expression integrated Vector into Construction pPIC9K-His of vector TV-AFB by1D double digestion techniques. TV-AFB1D was integrated into pPIC9K-His vector by double digestion techniques. The constructedThe recombinant constructedTV-AFB1D plasmidwas recombinant integrated was identified plasmid into pPIC9K-His wasby the identified double vector bydigestion by the double double of Snadigestion digestion B I techniques. of Sna B and Not I. TwoIThe andbands constructedNot afterI. Two digestion recombinant bands possessed after digestionplasmid the size was possessed of identified approximately the by size the of9300 double approximately and digestion 2100 9300of Sna and B I bp (Figure 3A).and The Not confirmed I. Two bands recombinant after digestion vector waspossessed named the pPIC9K-His-AFB size of approximately1D after 9300 and 2100 2100 bp (Figure3A). The confirmed recombinant vector was named pPIC9K-His-AFB 1D confirmation byafterbp gene (Figure confirmation sequencing 3A). The by (Figure confirmed gene sequencing 3B). recombinant (Figure vector3B). was named pPIC9K-His-AFB1D after confirmation by gene sequencing (Figure 3B).

Figure 3. VectorFigure pPIC9K-His-TV-AFB 3. Vector pPIC9K-His-TV-AFB1D construction.1D construction. (A) Double-restriction (A) Double-restriction digestion of vector digestion pPIC9K-His-TV-AFB of vector 1D by SnaB I and NotpPIC9K-His-TV-AFBI. Note: lanesFigure 1, 2:1 pPIC9k-TV-AFBD 3. by Vector SnaB IpPIC9K-His-TV-AFB and1 NotD. ( BI.) Note: Schematic lanes1D diagram1, construction. 2: pPIC9k-TV-AFB of constructed (A) Double-restriction1D. pPIC9k-TV-AFB (B) Schematic digestion 1D. of vector diagram of constructedpPIC9K-His-TV-AFB pPIC9k-TV-AFB1D by1D. SnaB I and Not I. Note: lanes 1, 2: pPIC9k-TV-AFB1D. (B) Schematic 2.3.diagram Transformation of constructed of TV-AFB pPIC9k-TV-AFB1D into P.1D. pastoris GS115 2.3. Transformation Theof TV-AFBP. pastoris1D intotransformants P. pastoris GS115 were cultured on the plates with MD media after trans- The P. pastorisformation.2.3. Transformation transformants The transformants of were TV-AFB cultured1D were into on transferredP. the pastoris plates GS115 with to the MD plates media equipped after trans- with MM media formation. The(Figure transformantsThe4). P. The pastoris transformants were transformants transfer werered wereto identiﬁed the cultured plates with equipped on the thedesigned plates with with MM primers MD media media for TV-AFB after trans-1D + + (Figure 4). Theampliﬁcation.formation. transformants TheP. pastoristransformantswere identifiedGS115 transformantswere with transfer the designedred with toHis theprimersMut plates typefor equipped TV-AFB for methanol 1withD MM utilization media amplification.were P.(Figure pastoris integrated 4). GS115 The bytransformants transformants pPIC9K-His-AFB were with 1identifiedHisD according+Mut+ type with to for the methanol growthdesigned onutilization primers the plates forcontaining TV-AFB1D were integratedMDamplification. by and pPIC9K-His-AFB MM media. P. pastoris1D GS115 according transformants to the growth with on His the+Mut plates+ type containing for methanol utilization MD and MM media.were integrated by pPIC9K-His-AFB1D according to the growth on the plates containing MD and MM media.

Toxins 2021, 13, 349 4 of 11 ToxinsToxins 2021 2021, 13, ,13 x ,FOR x FOR PEER PEER REVIEW REVIEW 4 of4 of12 12

FigureFigureFigure 4. 4. Phenotype4.Phenotype Phenotype screening screening screening of of ofrecombinant recombinantrecombinant P. P.pastoris pastoris GS115. GS115. (A ()A( AScreening) )Screening Screening with with with MD MD MDmedia; media; media; (B,C) recombinant P. pastoris screening with His+ +Mut+ + phenotype using MM (B) and MD (C) plates. ((B,,C)) recombinant recombinant P. pastorispastoris screeningscreening withwith HisHis+Mut+ phenotypephenotype using using MM MM (B) (B) and and MD MD (C) (C) plates. plates.

2.4.2.4.2.4. Recombinant Recombinant Recombinant TV-AFB TV-AFB TV-AFB11DD1 DExpression Expression Expression in in inP. P. P.pastoris pastoris GS115 GS115

TheTheThe recombinant recombinant recombinant TV-AFB TV-AFB1DD1 Dwas was was expressed expressed expressed by by by engineering engineering engineering P.P. P.pastoris pastoris GS115 GS115 with with the the sizesizesize of ofapproximately approximately 77 77 kDa kDa under under the the induction induction of of 0.8% 0.8% methanol.methanol. methanol. No No TV-AFB TV-AFB11D1 D was was detecteddetecteddetected by by by the the the wild-type wild-type wild-type P.P. P.pastoris pastoris GS115 GS115 according according according to to toSDS-PAGE SDS-PAGE SDS-PAGE analysis analysis analysis (Figure (Figure (Figure 55).). 5). TheThe highest highest activity activity of of TV-AFB TV-AFB11D1 D was was 17.5 17.5 U/mLU/mL U/mL after after after the the the induction induction of of 0.8% 0.8% methanol methanol ◦ ((v/(vv)/) vfor for) for 84 84 84 h h ath at at30 30 30 °C. C.°C. No No No TV-AFB TV-AFB TV-AFB11DD1 Dactivity activity activity of of ofthe the the fermentation fermentation fermentation broth broth broth from from from the the the wild-type wild-type wild-type P. P. pastoris pastoris GS115 GS115 was was detected detected under under the the same same treatment treatment conditions conditions (Figure (Figure 66).). 6). Therefore,Therefore, Therefore, TV-AFB D1 P. pastoris thethethe recombinant recombinant recombinant TV-AFB TV-AFB1D Dcouldcould could express express express in in inengineering engineering engineering P. P.pastoris pastoris GS115. GS115.

FigureFigure 5. SDS-PAGE5. SDS-PAGE analysis analysis of ofrecombinant recombinant TV-AFB TV-AFB1D.1D. Lane Lane 1: wild-type1: wild-type P. P.pastoris pastoris expression; expression; Figure 5. SDS-PAGE analysis of recombinant TV-AFB1D. Lane 1: wild-type P. pastoris expression; laneslanes 2 and 2 and 3: expression3: expression of ofthe the recombinant recombinant TV-AFB TV-AFB1D.1D. lanes 2 and 3: expression of the recombinant TV-AFB1D.

2.5. Effect of Methanol Concentration and Time on the TV-AFB1D Expression

The effects of induction time and methanol concentration on TV-AFB1D activity were investigated (Figure7). The highest activities of TV-AFB 1D expressed by the recombinant P. pastoris GS115 were achieved after induction for 84 h and in the presence of 0.8% methanol (v/v). In particular, the activities of TV-AFB1D were substantially decreased with the addition of 1.2% and 0.5% of methanol. Therefore, the optimum methanol concentration and treatment time were 0.8% and 84 h for the inducible expression of TV-AFB1D, respectively.

Toxins 2021, 13, x FOR PEER REVIEW 5 of 12

Toxins 2021,, 13,, 349x FOR PEER REVIEW 5 5of of 12 11

Figure 6. Expression of TV-AFB1D from the transformants and wild-type P. pastoris.

2.5. Effect of Methanol Concentration and Time on the TV-AFB1D Expression

The effects of induction time and methanol concentration on TV-AFB1D activity were investigated (Figure 7). The highest activities of TV-AFB1D expressed by the recombinant P. pastoris GS115 were achieved after induction for 84 h and in the presence of 0.8% methanol (v/v). In particular, the activities of TV-AFB1D were substantially decreased with the addition of 1.2% and 0.5% of methanol. Therefore, the optimum methanol concentration and treatment time were 0.8% and 84 h for the inducible expression of TV-AFB1D, respec-

tively. Figure 6. Expression of TV-AFB1D from the transformants and wild-type P. pastoris. Figure 6. Expression of TV-AFB1D from the transformants and wild-type P. pastoris.

2.5. Effect of Methanol Concentration and Time on the TV-AFB1D Expression

The effects of induction time and methanol concentration on TV-AFB1D activity were investigated (Figure 7). The highest activities of TV-AFB1D expressed by the recombinant P. pastoris GS115 were achieved after induction for 84 h and in the presence of 0.8% methanol (v/v). In particular, the activities of TV-AFB1D were substantially decreased with the addition of 1.2% and 0.5% of methanol. Therefore, the optimum methanol concentration and treatment time were 0.8% and 84 h for the inducible expression of TV-AFB1D, respectively.

Figure 7. Effect of time and methanol concen concentrationtration on the activity of TV-AFB11D.

2.6. Effect of Temperatures and Treatment Time on the Expression of TV-AFB1D 2.6. Effect of Temperatures and Treatment Time on the Expression of TV-AFB1D The effects of temperatures and treatment time on TV-AFB1D expression are shown The effects of temperatures and treatment time on TV-AFB1D expression are shown in Figure8. The TV-AFB 1D activities reached the highest after induction for 84 h. The in Figure 8. The TV-AFB1D activities reached the highest◦ after induction for 84 h. The highest activity of TV-AFB1D was 16.5 U/mL at 28 C among all the set temperatures highest activity of TV-AFB1D was 16.5 U/mL at 28 °C among all the set temperatures of of 25–32 ◦C. Therefore, the optimum temperature and time were 28 ◦C and 84 h for the 25–32 °C. Therefore, the optimum temperature and time were 28 °C and 84 h for the in- inducible expression of TV-AFB1D in engineering P. pastoris GS115, respectively. ducible expression of TV-AFB1D in engineering P. pastoris GS115, respectively. 2.7. Product Formation of AFB -Contaminated Peanuts Catalyzed by TV-AFB D 1 1 HPLC method was used to determine the product formation of AFB1 catalyzed by Figure 7. Effect of time and methanol concentration on the activity of TV-AFB1D. the recombinant TV-AFB1D. As the control group, the AFB1 standard possessed a special peak after running for 45 min at a wavelength of 365 nm (Figure9). The proﬁles of catalytic 2.6. Effect of Temperatures and Treatment Time on the Expression of TV-AFB1D products were determined by HPLC after the catalysis of AFB1-contaminated peanuts by The effects of temperatures and treatment time on TV-AFB1D expression are shown the recombinant TV-AFB1D. With the exception of the AFB1 standard, another peak was indetected Figure under8. The a TV-AFB wavelength1D activities of 210 nm reached after running the highest for 22 after min. induction The result indicatedfor 84 h. The that highest activity of TV-AFB1D was 16.5 U/mL at 28 °C among all the set temperatures of new product was formed under the catalysis of TV-AFB1D with AFB1 as substrate. 25–32 °C. Therefore, the optimum temperature and time were 28 °C and 84 h for the inducible expression of TV-AFB1D in engineering P. pastoris GS115, respectively.

Toxins 2021, 13, x FOR PEER REVIEW 6 of 12

Toxins 2021, 13, 349 6 of 11 Toxins 2021, 13, x FOR PEER REVIEW 6 of 12

Figure 8. Effect of temperature on the activity of TV-AFB1D.

2.7. Product Formation of AFB1-Contaminated Peanuts Catalyzed by TV-AFB1D

HPLC method was used to determine the product formation of AFB1 catalyzed by the recombinant TV-AFB1D. As the control group, the AFB1 standard possessed a special peak after running for 45 min at a wavelength of 365 nm (Figure 9). The profiles of catalytic products were determined by HPLC after the catalysis of AFB1-contaminated peanuts by the recombinant TV-AFB1D. With the exception of the AFB1 standard, another peak was detected under a wavelength of 210 nm after running for 22 min. The result indicated that new product was formed under the catalysis of TV-AFB1D with AFB1 as substrate. FigureFigure 8.8. EffectEffect ofof temperaturetemperature onon thethe activityactivity ofof TV-AFBTV-AFB11D.D.

2.7. Product Formation of AFB1-Contaminated Peanuts Catalyzed by TV-AFB1D

Figure 9. Determination ofof catalyticcatalytic productsproducts of of AFB AFB1 1catalyzed catalyzed by by TV-AFB TV-AFB1D1D using using HPLC HPLC approach. ap- Note:proach. a andNote: b representa and b represent HPLC proﬁles HPLC beforeprofiles and before after and catalysis, after catalysis, respectively. respectively.

2.8. Effect of Time on the Residue of AFB11 Standard Sample

The effecteffect ofof catalysis catalysis time time on on the th residuale residual proportion proportion of the of AFBthe AFB1 standard1 standard sample sample was ◦ investigatedwas investigated at 32 atC 32 (Figure °C (Figure 10). The 10). proportion The proportion of AFB of1 residueAFB1 residue substantially substantially decreased de- fromcreased 100% from to 100% 27.8% to for 27.8% 5 h of for catalysis 5 h of catalysi with thes with degradation the degradation rate of 72.2%. rate of During 72.2%. the During next catalysisthe next catalysis for 5–12 h,for the 5–12 proportion h, the proportion of residual of AFBresidual1 decreased AFB1 decreased slowly. The slowly. proportion The pro- of residual AFB standard sample was 24.1% after catalysis for 12 h with the degradation rate portion of residual1 AFB1 standard sample was 24.1% after catalysis for 12 h with the deg- ofradation 75.9%. rate of 75.9%. Figure 9. Determination of catalytic products of AFB1 catalyzed by TV-AFB1D using HPLC approach. Note: a and b represent HPLC profiles before and after catalysis, respectively. 2.9. Effect of Time on the Proportion of AFB1 Residue in Peanuts

The effect of treatment time on the proportion of AFB1 residue in AFB1-contaminated 2.8. Effect of Time on the Residue◦ of AFB1 Standard Sample peanuts was investigated at 32 C (Figure 11). Within the initial 10 h, the proportion of AFB1 The effect of catalysis time on the residual proportion of the AFB1 standard sample residue decreased rapidly from 100% to 55.7%. After treatment for 18 h, the proportion was investigated at 32 °C (Figure 10). The proportion of AFB1 residue substantially de- of AFB1 residue in AFB1-contaminated peanuts gradually decreased to 51.5% with the degradationcreased from rate 100% of 48.5%.to 27.8% Therefore, for 5 h of the catalysi recombinants with the TV-AFB degradation1D could rate effectively of 72.2%. catalyze During 1 AFBthe next1 in AFBcatalysis1-contaminated for 5–12 h, peanuts. the proportion of residual AFB decreased slowly. The proportion of residual AFB1 standard sample was 24.1% after catalysis for 12 h with the degradation rate of 75.9%.

Toxins 2021, 13, x FOR PEER REVIEW 7 of 12

Toxins 2021, 13, 349 7 of 11 Toxins 2021, 13, x FOR PEER REVIEW 7 of 12

Figure 10. Effect of time on the concentration of AFB1 standard sample by TV-AFB1D.

2.9. Effect of Time on the Proportion of AFB1 Residue in Peanuts

The effect of treatment time on the proportion of AFB1 residue in AFB1-contaminated peanuts was investigated at 32 °C (Figure 11). Within the initial 10 h, the proportion of AFB1 residue decreased rapidly from 100% to 55.7%. After treatment for 18 h, the proportion of AFB1 residue in AFB1-contaminated peanuts gradually decreased to 51.5% with the degradation rate of 48.5%. Therefore, the recombinant TV-AFB1D could effectively cata- Figure 10. Effect of time on the concentration of AFB1 standard sample by TV-AFB1D. Figurelyze AFB 10.1 inEffect AFB1-contaminated of time on the peanuts. concentration of AFB1 standard sample by TV-AFB1D.

2.9. Effect of Time on the Proportion of AFB1 Residue in Peanuts

Figure 11. Effect of time on the concentration of AFB1 in AFB1-contaminated peanuts by TV- Figure 11. Effect of time on the concentration of AFB in AFB -contaminated peanuts by TV-AFB D. AFB1D. 1 1 1

2.10.2.10. Effect Effect of Temperature of Temperature on the onProportion the Proportion of AFB1 Residue of AFB in 1PeanutsResidue in Peanuts TheThe effect effect of temperature of temperature on the onproportion the proportion of AFB1 residue of AFB in AFB1 residue1-contaminated in AFB 1-contaminated peanutspeanuts was was investigated investigated after catalysis after catalysisfor 5 h (Figure for 12). 5 h In (Figure the range 12 of). 26In to 42 the °C, range the of 26 to 42 ◦C, proportion curve of AFB1 residue was in the shape of a “V”. The proportion of AFB1 resi- the proportion curve of AFB1 residue was in the shape of a “V”. The proportion of due gradually decreased during the temperatures of 26 to 34 °C and increased during the◦ Figure 11. Effect of time on the concentration of AFB1 in AFB1-contaminated peanuts by TV- AFBtemperatures1 residue of 34 gradually to 42 °C. Th decreasede lowest concentration during the of temperaturesAFB1 residue in AFB of 261-contami- to 34 C and increased AFB1D. ◦ duringnated peanuts the temperatures was 52.1% at 34 of°C 34with to a 42degradationC. The lowestrate of 47.9%. concentration Too low and oftoo AFB high1 residue in AFB1- ◦ temperatures were not conducive to the degradation of AFB1 by TV-AFB1D in AFB1-con- 2.10.contaminated Effect of Temperature peanuts on the was Proportion 52.1% of at AFB 341 ResidueC with in Peanuts a degradation rate of 47.9%. Too low and tootaminated high peanuts. temperatures were not conducive to the degradation of AFB by TV-AFB D in Toxins 2021, 13, x FOR PEER REVIEW The effect of temperature on the proportion of AFB1 residue in AFB1-contaminated8 of 121 1 peanutsAFB1-contaminated was investigated after peanuts. catalysis for 5 h (Figure 12). In the range of 26 to 42 °C, the proportion curve of AFB1 residue was in the shape of a “V”. The proportion of AFB1 residue gradually decreased during the temperatures of 26 to 34 °C and increased during the temperatures of 34 to 42 °C. The lowest concentration of AFB1 residue in AFB1-contaminated peanuts was 52.1% at 34 °C with a degradation rate of 47.9%. Too low and too high temperatures were not conducive to the degradation of AFB1 by TV-AFB1D in AFB1-contaminated peanuts.

Figure 12. Effect of temperature on the concentration of AFB1 in AFB1-contaminated peanuts. Figure 12. Effect of temperature on the concentration of AFB1 in AFB1-contaminated peanuts. 3. Discussion Although the physical and chemical methods have been applied in the detoxification of aflatoxins, these approaches are difficult to meet the requirement of clean, safe, and environmentally friendly production [26]. Currently, the enzymatic degradation has been applied in the degradation of aflatoxins for its safety and specificity [27]. A large number of studies have been reported on the enzymes related to aflatoxin degradation (Table 1). Enzymes related to aflatoxin degradation include various catalytic properties of F420H2- dependent reductase [25], laccase [23], and peroxidase [24]. In addition, aflatoxin-detoxifizyme (ADTZ) [28], AFB1-horse radish peroxidase (HRP) [29], Myxobacteria aflatoxin degradation enzyme (MADE) [30], Bacillus aflatoxin-degrading enzyme (BADE) [31], and Pantoea aflatoxin degradation enzyme (PADE) [32] also possess the capability of aflatoxin degradation. In the previous report, the catalytic performances of enzymes were identified by using AFB1 standard sample as catalytic substrate. These enzymes were rarely used for degradation of aflatoxins in food and feed. In this study, T. versicolor aflatoxin B1- degrading enzyme gene was expressed in engineering P. pastoris. AFB1 standard sample and AFB1-contaminated peanuts were used to detect the degradation effect of AFB1. The AFB1 proportions of 75.9% and 48.5% were degraded using AFB1 standard sample and AFB1-contaminated peanuts as substrates, respectively.

Table 1. Aflatoxin-degrading enzymes and catalysis performances.

Microbial Sources and Enzymes Conditions Catalytic Efficiency and Time Mycobacterium smegmatis, F420H2-dependent reductase [25] 20 mM Tris-HCl, pH 7.5 63%, 4 h Myxococcus fulvus, MADE [30] pH 6 96% Armillariella tabescens, ADTZ [28] 0.02 M PBS, pH 6 80% Phanerochaete sordida, peroxidase [33] 50 mM PBS, pH 6 86%, 48 h Pleurotus ostreatus, peroxidase [34] pH 4.5 90%, 48 h Bacillus subtilis, BsCotA laccase [35] 50 mM Tris–HCl, pH 7.0 98%, 10 h Pleurotus pulmonarius, laccase [36] 1 mM sodium acetate, pH 5 90%, 72 h Aspergillus flavus, HRP [29] 1mM sodium acetate, pH 5 42%, 1 h Bacillus shackletonii, BADE [31] 50 mM PBS, pH 7.0 47.5%, 72 h Pseudomonas aeruginosa, PADE [32] 0.02 M PBS, pH 7 72.5%, 12h T. versicolor, TV-AFB1D, in this study AFB1 standard sample 75.9%, 12 h T. versicolor, TV-AFB1D, in this study AFB1-contaminated peanuts 48.5%, 18 h

Toxins 2021, 13, 349 8 of 11

3. Discussion Although the physical and chemical methods have been applied in the detoxification of aflatoxins, these approaches are difficult to meet the requirement of clean, safe, and environmentally friendly production [26]. Currently, the enzymatic degradation has been applied in the degradation of aflatoxins for its safety and specificity [27]. A large number of studies have been reported on the enzymes related to aflatoxin degradation (Table1). Enzymes related to aflatoxin degradation include various catalytic properties of F420H2-dependent reductase [25], laccase [23], and peroxidase [24]. In addition, aflatoxin- detoxifizyme (ADTZ) [28], AFB1-horse radish peroxidase (HRP) [29], Myxobacteria aflatoxin degradation enzyme (MADE) [30], Bacillus aflatoxin-degrading enzyme (BADE) [31], and Pantoea aflatoxin degradation enzyme (PADE) [32] also possess the capability of aflatoxin degradation. In the previous report, the catalytic performances of enzymes were identified by using AFB1 standard sample as catalytic substrate. These enzymes were rarely used for degradation of aflatoxins in food and feed. In this study, T. versicolor aflatoxin B1-degrading enzyme gene was expressed in engineering P. pastoris. AFB1 standard sample and AFB1-contaminated peanuts were used to detect the degradation effect of AFB1. The AFB1 proportions of 75.9% and 48.5% were degraded using AFB1 standard sample and AFB1-contaminated peanuts as substrates, respectively.

Table 1. Aﬂatoxin-degrading enzymes and catalysis performances.

Microbial Sources and Enzymes Conditions Catalytic Efﬁciency and Time

Mycobacterium smegmatis,F420H2-dependent reductase [25] 20 mM Tris-HCl, pH 7.5 63%, 4 h Myxococcus fulvus, MADE [30] pH 6 96% Armillariella tabescens, ADTZ [28] 0.02 M PBS, pH 6 80% Phanerochaete sordida, peroxidase [33] 50 mM PBS, pH 6 86%, 48 h Pleurotus ostreatus, peroxidase [34] pH 4.5 90%, 48 h Bacillus subtilis, BsCotA laccase [35] 50 mM Tris–HCl, pH 7.0 98%, 10 h Pleurotus pulmonarius, laccase [36] 1 mM sodium acetate, pH 5 90%, 72 h Aspergillus ﬂavus, HRP [29] 1mM sodium acetate, pH 5 42%, 1 h Bacillus shackletonii, BADE [31] 50 mM PBS, pH 7.0 47.5%, 72 h Pseudomonas aeruginosa, PADE [32] 0.02 M PBS, pH 7 72.5%, 12h T. versicolor, TV-AFB1D, in this study AFB1 standard sample 75.9%, 12 h T. versicolor, TV-AFB1D, in this study AFB1-contaminated peanuts 48.5%, 18 h

4. Conclusions

In this study, the recombinant TV-AFB1D with a size of 77 kDa was effectively expressed by engineering P. pastoris. The optimal temperature and methanol concentration ◦ were 28 C and 0.8% for the inducible expression of TV-AFB1D, respectively. The proportion of residual AFB1 standard sample was 24.1% after catalysis for 12 h with a degradation rate of 75.9%. In addition, the proportion of AFB1 residue in AFB1-contaminated peanuts decreased to 51.5% with a degradation rate of 48.5% after treatment for 18 h at 34 ◦C. This study provided an alternative TV-AFB1D degradation enzyme for the removal of AFB1 in food products and agricultural raw materials.

5. Materials and Methods 5.1. Materials and Reagents

Vector pPIC9K-His, TV-AFB1D gene, P. pastoris GS115, and T. versicolor were stored in the Experimental Center of Hefei University of Technology. Gene sequencing and primer synthesis were performed by Sangon Biotech. Taq polymerase, Stu I, Not I, and SnaB I were from NEB Company. Gel imaging systems, sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE), polymerase chain reaction (PCR) amplification, and electrophoresis devices were manufactured by Bio-RAD Company. ProteinIsoNi-IDA resin and AFB1 immunoaffinity column were from Transgen Biotech and Welch Company, respectively. Toxins 2021, 13, 349 9 of 11

5.2. Construction of pPIC9K-His-TV-AFB1D Vector

TV-AFB1D encoding aflatoxin degradation enzyme was cloned by reverse transcrip- tion PCR (RT-PCR) technique according to Genbank accession number txid717944 in the National Center for Biotechnology Information (NCBI). The sequences of restriction endonuclease SnaB I and Not I were added in the corresponding primers for the 0 amplification of TV-AFB1D. The corresponding primers were designed as follows: F: 5 - GGGAAATACGTAATGGCTCGCGCGAAGTACTC-30 (SnaB I); R: 50-GGGAAAGCGGCCGC TTAAAGCTTCCGCTCTATGA30 (Not I). Both the product of amplification and pPIC9K-His vector were double digested by SnaB I and Not I. The recovered gene was ligated by T4 ligase to produce vector pPIC9K-His-AFB1D. pPIC9K-His-AFB1D was confirmed by PCR amplification, double-enzyme digestion identification, and gene sequencing.

5.3. Transformation of pPIC9K-His-TV-AFB1D into P. pastoris GS115

The linearized pPIC9K-His-AFB1D was digested by Stu I and integrated into P. pastoris GS115 by electroporation transformation method [37]. P. pastoris GS115 had a mutation in histidine dehydrogenase (his4) and could not synthesize histidine. pPIC-9K-His contained his4 gene that was complementary to the host. The transformants were screened on the plate equipped with histidine-free medium. The recombinant P. pastoris with His+Mut+ phenotype grew on minimal methanol medium (MM) plates in the presence of methanol. The transformants were screened out using the solid plates containing minimal dextrose medium (MD) and MM. The true transformants were further conﬁrmed by PCR identiﬁca- tion and gene sequencing.

5.4. Inducible Expression and Condition Optimizations of TV-AFB1D The His+Mut+ phenotype-positive clones were incubated with the shaking speed of 200 rpm at 30 ◦C. The collected cells of recombinant P. pastoris were mixed with methanol- complex buffer medium. The transformants were incubated at 30 ◦C with the shaking speed of 200 rpm. The fermentation broth was added with 0.8% methanol (v/v) every 24 h for the induction of recombinant TV-AFB1D. The parameters of temperatures, methanol concentrations, and time were optimized to enhance the inducible expression of TV-AFB1D.

5.5. Purification of Recombinant TV-AFB1D and Definition of Activity 2+ The recombinant TV-AFB1D was purified by pre-equilibration with Ni -chelate affinity chromatography column and elution with imidazole eluent with ProteinIso Ni-IDA resin. The profile of TV-AFB1D protein was analyzed by SDS-PAGE. The unit of TV-AFB1D activity was defined as the amount of enzyme that catalyzed the consumption of 1 nmoL AFB1 per minute. The activity of TV-AFB1D was calculated by using the formula of (M0 − M1)/(312 × t × V), where M0,M1, t, and V represent the AFB1 weight in the control and experimental groups (µg), reaction time (min), and enzyme amount (mL), respectively; 312 indicates the molecular weight of AFB1.

5.6. Measurement of AFB1 Content and Degradation Products

The content of AFB1 was detected by HPLC using the following process parameters: methanol-to-water ratio of 40/60, isocratic elution, ultraviolet (UV) detector, C18 Shim- pack VP-ODS (5 µm, 250 mm × 4.6 mm), C18 reverse column, 0.7 mL/min of ﬂow rate, ◦ 190–400 nm of detection wavelength, and 30 C of column temperature. The signal of AFB1 was detected by the UV detector at a wavelength of 365 nm. The amount of AFB1 was calculated on the basis of the peak areas with the AFB1 standard sample as the control.

5.7. Application in the AFB1 Degradation of AFB1-Contaminated Peanuts

The AFB1-contaminated peanuts were immersed in the solution containing the recombinant TV-AFB1D from engineering P. pastoris GS115. After incubation for 12 h, the recovered peanuts were soaked with methanol solution containing 40% of water (v/v). Then, the supernatant was puriﬁed through the AFB1 immunoafﬁnity column with the Toxins 2021, 13, 349 10 of 11

flow rate of 2 drops per second. The collected eluate was further purified by the filtration with 0.22 µm size of filter membrane. The effects of treatment time and temperature on the degradation efficiency of AFB1-contaminated peanuts by TV-AFB1D were investigated.

5.8. Data Analysis The data were statistically given with three replicates. Origin and SPSS software were used to analyze the data with mean ± standard deviation.

Author Contributions: Conceptualization, P.Y; formal analysis, W.X.; investigation, S.L. and M.Z.; resources, S.J. (Suwei Jiang); data curation, Z.Z.; writing—original draft preparation, W.X. and S.J. (Shuying Jiang); writing—review and editing, P.Y.; visualization, D.Z.; supervision, S.J. (Shaotong Jiang); project administration and funding acquisition, P.Y. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Natural Science Foundation of Anhui Province (CN) (grant number 1908085MC80), Major Science and Technology Projects of Anhui Province (grant number 202003c08020001), Fundamental Research Funds for the Central Universities of China (grant number PA2020GDSK0058), The APC was funded by Natural Science Foundation of Anhui Province (CN)”. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: The data in this study are available in the manuscript. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Hanvi, M.D.; Lawson-Evi, P.; Bouka, E.C.; Eklu-Gadegbeku, K. Aflatoxins in maize dough and dietary exposure in rural populations of Togo. Food Control 2021, 121, 107673. [CrossRef] 2. Fouche, T.; Claassens, S.; Maboeta, M. Aflatoxins in the soil ecosystem: An overview of its occurrence, fate, effects and future perspectives. Mycotoxin Res. 2020, 36, 303–309. [CrossRef][PubMed] 3. Pecorelli, I.; Guarducci, N.; von Holst, C.; Bibi, R.; Pascale, M.; Ciasca, B.; Logrieco, A.F.; Lattanzio, V.M.T. Critical comparison of analytical performances of two immunoassay methods for rapid detection of aflatoxin M-1 in milk. Toxins 2020, 12, 270. [CrossRef][PubMed] 4. Han, C.; Yu, T.; Qin, W.; Liao, X.; Huang, J.; Liu, Z.; Yu, L.; Liu, X.; Chen, Z.; Yang, C.; et al. Genome-wide association study of the TP53 R249S mutation in hepatocellular carcinoma with aflatoxin B1 exposure and infection with hepatitis B virus. J. Gastrointest. Oncol. 2020, 11, 1333–1339. [CrossRef][PubMed] 5. Lee, L.S.; Dunn, J.J.; DeLucca, A.J.; Ciegler, A. Role of lactone ring of aflatoxin B1 in toxicity and mutagenicity. Experientia 1981, 37, 16–17. [CrossRef][PubMed] 6. Vanhoutte, I.; Audenaert, K.; De Gelder, L. Biodegradation of Mycotoxins: Tales from Known and Unexplored Worlds. Front. Microbiol. 2016, 7, 20. [CrossRef] 7. Guengerich, F.P.; Johnson, W.W.; Ueng, Y.F.; Yamazaki, H.; Shimada, T. Involvement of cytochrome P450, glutathione S-transferase, and epoxide hydrolase in the metabolism of aflatoxin B1 and relevance to risk of human liver cancer. Environ. Health Perspect. 1996, 104 (Suppl. S3), 557–562. [CrossRef][PubMed] 8. Schrenk, D.; Bignami, M.; Bodin, L.; Chipman, J.K.; del Mazo, J.; Grasl-Kraupp, B.; Hogstrand, C.; Hoogenboom, L.; Leblanc, J.C.; Nebbia, C.S.; et al. Risk assessment of aflatoxins in food. EFSA J. 2020, 18, 1–112. [CrossRef] 9. Ji, J.M.; Xie, W.L. Removal of aflatoxin B-1 from contaminated peanut oils using magnetic attapulgite. Food Chem. 2021, 339, 128072. [CrossRef] 10. Javanmardi, F.; Khodaei, D.; Sheidaei, Z.; Bashiry, M.; Nayebzadeh, K.; Vasseghian, Y.; Khaneghah, A.M. Decontamination of aflatoxins in edible oils: A comprehensive review. Food Rev. Int. 2020, 17, 1–17. [CrossRef] 11. Magagnoli, S.; Lanzoni, A.; Masetti, A.; Depalo, L.; Albertini, M.; Ferrari, R.; Spadola, G.; Degola, F.; Restivo, F.M.; Burgio, G. Sustainability of strategies for Ostrinia nubilalis management in Northern Italy: Potential impact on beneficial arthropods and aflatoxin contamination in years with different meteorological conditions. Crop Prot. 2021, 142, 105529. [CrossRef] 12. Adeyeye, S.A.O. Aflatoxigenic fungi and mycotoxins in food: A review. Crit. Rev. Food Sci. Nutr. 2020, 60, 709–721. [CrossRef] 13. Kabak, B. The fate of mycotoxins during thermal food processing. J. Sci. Food Agric. 2009, 89, 549–554. [CrossRef] 14. Mao, J.; He, B.; Zhang, L.X.; Li, P.W.; Zhang, Q.; Ding, X.X.; Zhang, W. A Structure Identification and Toxicity Assessment of the Degradation Products of Aflatoxin B-1 in Peanut Oil under UV Irradiation. Toxins 2016, 8, 332. [CrossRef][PubMed] 15. Samarajeewa, U.; Sen, A.C.; Cohen, M.D.; Wei, C.I. Detoxification of Aflatoxins in Foods and Feeds by Physical and Chemical Methods 1. J. Food Prot. 1990, 53, 489–501. [CrossRef][PubMed] Toxins 2021, 13, 349 11 of 11

16. Desheng, Q.; Fan, L.; Yanhu, Y.; Niya, Z. Adsorption of aflatoxin B-1 on montmorillonite. Poult. Sci. 2005, 84, 959–961. [CrossRef] [PubMed] 17. Pankaj, S.K.; Shi, H.; Keener, K.M. A review of novel physical and chemical decontamination technologies for aflatoxin in food. Trends Food Sci. Technol. 2018, 71, 73–83. [CrossRef] 18. Guo, Y.; Zhao, L.; Ma, Q.; Ji, C. Novel strategies for degradation of aflatoxins in food and feed: A review. Food Res. Int. 2021, 140, 109878. [CrossRef] 19. Mendez-Albores, A.; Martinez-Bustos, F.; Gaytan-Martinez, M.; Moreno-Martinez, E. Effect of lactic and citric acid on the stability of B-aflatoxins in extrusion-cooked sorghum. Lett. Appl. Microbiol. 2008, 47, 1–7. [CrossRef] 20. Ismail, A.; Goncalves, B.L.; de Neeff, D.V.; Ponzilacqua, B.; Coppa, C.; Hintzsche, H.; Sajid, M.; Cruz, A.G.; Corassin, C.H.; Oliveira, C.A.F. Aflatoxin in foodstuffs: Occurrence and recent advances in decontamination. Food Res. Int. 2018, 113, 74–85. [CrossRef] 21. Rushing, B.R.; Selim, M.I. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem. Toxicol. 2019, 124, 81–100. [CrossRef] 22. Adebo, O.A.; Njobeh, P.B.; Gbashi, S.; Nwinyi, O.C.; Mavumengwana, V. Review on microbial degradation of aflatoxins. Crit. Rev. Food Sci. Nutr. 2017, 57, 3208–3217. [CrossRef] 23. Guo, Y.P.; Qin, X.J.; Tang, Y.; Ma, Q.G.; Zhang, J.Y.; Zhao, L.H. CotA laccase, a novel aflatoxin oxidase from Bacillus licheniformis, transforms aflatoxin B-1 to aflatoxin Q(1) and epi-aflatoxin Q(1). Food Chem. 2020, 325, 126877. [CrossRef][PubMed] 24. Loi, M.; Renaud, J.B.; Rosini, E.; Pollegioni, L.; Vignali, E.; Haidukowski, M.; Sumarah, M.W.; Logrieco, A.F.; Mule, G. Enzymatic transformation of aflatoxin B-1 by Rh_DypB peroxidase and characterization of the reaction products. Chemosphere 2020, 250, 126296. [CrossRef] 25. Li, C.H.; Li, W.Y.; Hsu, I.N.; Liao, Y.Y.; Yang, C.Y.; Taylor, M.C.; Liu, Y.F.; Huang, W.H.; Chang, H.H.; Huang, H.L.; et al. Recombinant aflatoxin-degrading F420H2-dependent reductase from Mycobacterium smegmatis protects mammalian cells from aflatoxin toxicity. Toxins 2019, 11, 259. [CrossRef][PubMed] 26. Xu, H.W.; Wang, L.Z.; Sun, J.D.; Wang, L.P.; Guo, H.Y.; Ye, Y.L.; Sun, X.L. Microbial detoxification of mycotoxins in food and feed. Crit. Rev. Food Sci. Nutr. 2021, 1, 1–19. [CrossRef] 27. Brana, M.T.; Sergio, L.; Haidukowski, M.; Logrieco, A.F.; Altomare, C. Degradation of aflatoxin B-1 by a sustainable enzymatic extract from spent mushroom substrate of Pleurotus eryngii. Toxins 2020, 12, 49. [CrossRef][PubMed] 28. Qiu, Y.X.; Wu, X.Y.; Xie, C.F.; Hu, Y.D.; Liu, D.L.; Ma, Y.; Yao, D.S. A rational design for improving the trypsin resistance of aflatoxin-detoxifizyme (ADTZ) based on molecular structure evaluation. Enzym. Microb. Technol. 2016, 86, 84–92. [CrossRef] 29. Huang, B.; Xiao, H.L.; Zhang, J.; Zhang, L.F.; Yang, H.L.; Zhang, Y.; Jin, J. Dual-label time-resolved fluoroimmunoassay for simultaneous detection of aflatoxin B1 and ochratoxin A. Arch. Toxicol. 2009, 83, 619–624. [CrossRef] 30. Zhao, L.H.; Guan, S.; Gao, X.; Ma, Q.G.; Lei, Y.P.; Bai, X.M.; Ji, C. Preparation, purification and characteristics of an aflatoxin degradation enzyme from Myxococcus fulvus ANSM068. J. Appl. Microbiol. 2011, 110, 147–155. [CrossRef] 31. Xu, L.; Ahmed, M.F.E.; Sangare, L.; Zhao, Y.J.; Selvaraj, J.N.; Xing, F.G.; Wang, Y.; Yang, H.P.; Liu, Y. Novel aflatoxin-degrading enzyme from Bacillus shackletonii L7. Toxins 2017, 9, 36. [CrossRef][PubMed] 32. Xie, Y.L.; Wang, W.; Zhang, S.J. Purification and identification of an aflatoxin B-1 degradation enzyme from Pantoea sp. T6. Toxicon 2019, 157, 35–42. [CrossRef] 33. Wang, X.L.; Qin, X.; Hao, Z.Z.; Luo, H.Y.; Yao, B.; Su, X.Y. Degradation of four major mycotoxins by eight manganese peroxidases in presence of a dicarboxylic acid. Toxins 2019, 11, 566. [CrossRef][PubMed] 34. Yehia, R.S. Aflatoxin detoxification by manganese peroxidase purified from Pleurotus ostreatus. Braz. J. Microbiol. 2014, 45, 127–133. [CrossRef][PubMed] 35. Wang, X.L.; Bai, Y.G.; Huang, H.Q.; Tu, T.; Wang, Y.; Wang, Y.R.; Luo, H.Y.; Yao, B.; Su, X.Y. Degradation of aflatoxin B-1 and zearalenone by Bacterial and fungal laccases in presence of structurally defined chemicals and complex natural mediators. Toxins 2019, 11, 609. [CrossRef][PubMed] 36. Loi, M.; Fanelli, F.; Zucca, P.; Liuzzi, V.C.; Quintieri, L.; Cimmarusti, M.T.; Monaci, L.; Haidukowski, M.; Logrieco, A.F.; Sanjust, E.; et al. Aflatoxin B1 and M1 degradation by lac2 from Pleurotus pulmonarius and redox mediators. Toxins 2016, 8, 245. [CrossRef] [PubMed] 37. Yu, P.; Yang, J.; Gu, H. Expression of HpaI in Pichia pastoris and optimization of conditions for the heparinase I production. Carbohydr. Polym. 2014, 106, 223–229. [CrossRef]