Metabolic Effects of Apolipoprotein A-I in Pancreatic Β-Cell Dysfunction

Metabolic Effects of Apolipoprotein A-I in Pancreatic β-cell Dysfunction

Liming Hou

A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy

~ UNSW AUSTRALIA

School of Medical Sciences Faculty of Medicine

December 2016

The University of New South Wales

PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet

Surname or Family name: Hou

First name: Liming Other name/s:

Abbreviation for degree as given in the University calendar: PhD

School: Medical Sciences Faculty: Medicine

Title: Metabolic effects of apolipoprotein A-I in pancreatic β-cell dysfunction

Abstract 350 words maximum: (PLEASE TYPE) b-cell dysfunction is central to the onset and progression of type 2 diabetes (T2D). Causes of b-cell dysfunction and T2D progression include prolonged exposure of islets to high fatty acid levels and elevated islet cholesterol levels. Loss -of-function mutations in the Abca1/ABCA1 gene increase islet cholesterol levels and cause pancreatic β-cell dysfunction in mice and humans. Insulin secretion is impaired and glucose metabolism is adversely affected in mice with conditional deletion of Abca1 in β-cells and in Abcg1 knockout mice. These effects are exacerbated in Abcg1 knockout mice with conditional Abca1 deletion in β-cells.

This thesis is concerned with mice that have conditional deletion of ABCA1 and ABCG1 in β-cells (ABCA1β-cell-/- /ABCG1β-cell-/- DKO mice). The Cre-loxP system was used to generate ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (Chapter 3). Islet cholesterol levels, glucose tolerance and β-cell function were assessed in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (Chapters 4 and 5). These mice had impaired glucose tolerance, impaired insulin secretion and increased islet cholesterol content. Moreover, glucose stimulated insulin secretion was decreased in islets from ABCA1β-cell-/-/ABCG1β- cell-/- DKO (β-DKO) mice relative to islets from Abca1fl/flAbcg1fl/fl (control) mice. Genes in key β-cell metabolic and signal transduction pathways regulated by ABCA1 and ABCG1 were identified by microarray analysis of isolated ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets (Chapter 6). These results indicated that ABCA1 and ABCG1 regulate genes involved in cholesterol metabolism, glucose metabolism and inflammation pathways in β-cells.

Previous studies have shown that high density lipoproteins (HDLs) and their major apolipoprotein A-I (apoA-I), increase insulin synthesis and insulin secretion in vitro. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were treated with apoA-I to determine whether apoA-I treatment can also improve β-cell insulin synthesis and secretion in vivo. The results showed that apoA-I treatment improved glucose tolerance and increased insulin secretion in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets under high glucose conditions.

In conclusion, the results in this thesis show that the ABCA1 and ABCG1 in β-cells have important roles in regulating islet cholesterol levels and whole body glucose homeostasis. They further establish that apoA-I treatment improves β- cell function in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice by a mechanism that is distinct from processes involved in the regulation of cholesterol homeostasis.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award: COPYRIGHT STATEMENT

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis to dissertation.’

Signed ……………… ……......

Date ………………………………………..

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ………… …………......

Date … ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ………… …………

Date … TABLE OF CONTENTS

ACKNOWLEDGEMENTS ………………………….…………………………………………..………...... vii

PUBLICATIONS ARISING FROM THIS THESIS …………………………………………………………..viii

CONFERENCES PRESENTATIONS ……………..…………………………………..……………...... viii

AWARDS ……………………………………………………………………………………………………...... ix

LIST OF ABBREVIATIONS ……………………………...………………………………………………...... x

LIST OF FIGURES ………………………………..……………………………..………………………...... xiii

LIST OF TABLES …………………………………………………………………………………………...... xvii

ABSTRACT …………………………………………………………………………….…………………...... xviii

CHAPTER 1 Literature Review ..……………………………………..…………………………………….1

1.1 Introduction …………………………………………………………………………………………………….…2

1.2 Pancreatic Islets and β-cells ……………………………………………………….…………………….…3

1.2.1. Islet architecture …………………………………………………………………………………….……….…4

1.2.2. Structure and function of β-cells …………………………………………………….…………….……6

1.2.3. Structure and function of insulin …………………………………………………………….…….……9

1.2.4. β-cell dysfunction of and diabetes ………………………………………………………..……..……11

1.3 High density lipoproteins and apolipoprotein A-I ….……………………………………………15

1.3.1. Lipoproteins ………………………………………………………….…………………………………………15

1.3.2. Structure of HDLs ……………………………………………………………………………….…………….16

1.3.3. Properties of HDLs …………………………………………………………………………….……………..19

1.3.4. Structure of apoA-I …………………………………………………………………………….…….………19

1.3.5. Functions of apoA-I ……………………………………………………………………………….…………20

i 1.3.5.1. Effects of apoA-I on atherosclerosis ……………………………………………………20

1.3.5.2. Effects of apoA-I on glucose metabolism ……………………………….……………21

1.4 ABCA1 and ABCG1 …………………………………………………………..……………………………….23

1.4.1. ABCA1 ……………………………………………..………………………………………………………………23

1.4.2. ABCG1 …………………………………………………..…………………………………………………………24

1.5 Disorders of cholesterol metabolism and β-cell dysfunction …………………..………….25

1.6 Effect of HDLs and apoA-I on pancreatic β-cell function …………………………….……….26

1.7 Scope of this thesis ……………………………………………………………….………………………….27

CHAPTER 2 General Methods …………………………………………………………………….………28

2.1 Mouse procedures ……………………………………………………………………………..…….………29

2.1.1. General husbandry and diets ……………………………………………..……………….……………29

2.1.2. Breeding of ABCA1β-cell-/-/ABCG1β-cell-/- mice …………………………..…………….……………29

2.1.3. Mice genotyping by genomic PCR ………………………………………………………..……………29

2.1.4. Body weight and food intake ……………………………………………………………………………32

2.1.5. Cardiac puncture and plasma collection …………………………..………………….……………32

2.1.6. Tissue harvest ………………………………….………………………………………………………………32

2.1.7. Isolation of mouse pancreatic islets ……………………………………..…………….……………33

2.2 HDL isolation and apoA-I purification …………………………………………….………….………34

2.2.1. HDL isolation ……………………………………………………………………………………………………34

2.2.2. ApoA-I purification ………………………………………………………………….………….……………35

2.2.3. ApoA-I assay ……………………………………………………………………………………….……………35

2.3 Biochemical and enzymatic assay ……………………………………………….…………….………36

2.3.1. Bicinchoninic acid (BCA) protein assay ………………………………………..……….……………36 ii

2.3.2. Total and free cholesterol assay ……………………………………..………………….……….……36

2.3.3. Free cholesterol assay ………………………………………………………….…………….…….………36

2.3.4. Triglyceride assay ………………………………….……………………………………………….…………37

2.3.5. HDL-cholesterol extraction and quantification ………………..………………….……………37

2.4 Statistical analysis …………………………………………………………………………………….………37

2.5 Chemicals and materials ……………………………………………….………………………….………38

CHAPTER 3 Generation and preliminary characterization of mice with conditional pancreatic β-cell deletion of ABCA1 and ABCG1 ………………………………………………………41

3.1 Introduction ………………………………………………………………………………………..…..………42

3.2 Methods ………………………………………………………………………………………..…………………45

3.2.1. Genotyping ………………………………….…………………………………………………………..………45

3.2.2. Western blotting of islets and tissue homogenates ………………………………….………45

3.2.3. Food intake and body weight determinations ……………………………………..……………48

3.2.4. Magnetic resonance imaging (MRI) ………………………………….………………………………48

3.2.5. EchoMRI ………………………………….……………………………………………………………….………49

3.2.6. Lipid profile and Fast Protein Liquid Chromatography (FPLC) ……………….……………49

3.2.7. Statistical analysis ……………………………………………………………………………….……………49

3.3 Results ……………………………………………………………………………………….…………….………50

3.3.1. Generation of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice ……………………………….………….50

3.3.2. ABCA1 and ABCG1 protein expression in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets ………………………………………………………………………………..………………………………………..53

3.3.3. ABCA1 and ABCG1 protein levels in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse tissues ………………………………………………………………………………..……………………………………..55 iii

3.3.4. Conditional deletion of ABCA1 and ABCG1 in pancreatic β-cells does not affect body weight, but increases adiposity and deceases muscle mass in chow fed mice ……..57

3.4 Discussion ………………………………………………………………………………….…………….………64

CHAPTER 4 Effect of apoA-I treatment on cholesterol homeostasis in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice ………………………………………………………………………………….………66

4.1 Introduction …………………………………………………………………………….……………….………67

4.2 Methods ………………………………………………………………………………….……………….………69

4.2.1. ApoA-I treatment and plasma lipid levels ………………………..………………….……………69

4.2.2. Determination of islet cholesterol levels ………………………….………………….……………71

4.2.3. Statistical analysis ………………………………….……………………….………………………..………71

4.3 Results ……………………………………………………………………………………………….…….………72

4.3.1. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice have comparable plasma lipids levels …………………………………………………….…………….……………72

4.3.2. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have increased islet cholesterol levels ………………………………….……………………………………………………………………………..………74

4.3.3. ApoA-I treatment does not affect plasma and islet cholesterol levels in ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mice ……………………………………………………………………………….……………76

4.4 Discussion …………………………………………………………………………….………………….………81

CHAPTER 5 Effect of apoA-I treatment on glucose homeostasis in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice ………………………………………………………………………………….………83

5.1 Introduction ……………………………………………………………………………………….…….………84

5.2 Methods …………………………………………………………………………………………….…….………86 iv

5.2.1. Determination of plasma insulin levels ……………………………………………….…………… 86

5.2.2. Intraperitoneal glucose and insulin tolerance tests ……………………………………………86

5.2.3. Islet morphology and b-cell mass measurement ………………………………….……………87

5.2.4. GSIS assay ………………………………….………………………………………………………….…………88

5.2.5. Insulin radioimmunological assay (RIA) ……………………………………………….……………88

5.2.6. Statistical analysis ……………………………………………………………………………….……………89

5.3 Results ………………………………………………………………………………………………….….………91

5.3.1. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have impaired glucose tolerance ………………91

5.3.2. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have impaired insulin secretion, but normal insulin sensitivity ………………………………….……………………………………………………………………94

5.3.3. Effects of apoA-I treatment on glucose tolerance in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice ……………………………………………………………………………………………………………..……………97

5.3.4. Effects of apoA-I treatment on ex vivo GSIS in isolated islets from ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice ……………………………………………………………………………..….……………99

5.4 Discussion ………………………………………………………………………………………………………102

CHAPTER 6 Effect of apoA-I treatment on islet gene expression in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice ……………………………………………….……………………………….………104

6.1 Introduction ………………………………………………………………….……………………….………105

6.2 Methods ………………………………………………………………………………………….…….………107

6.2.1. RNA extraction ………………………………….…………………………………………………..………107

6.2.2. Whole genome microarrays ……………………………………………………….…….……………107

6.2.3. Reverse transcription ……………………………………………………………………….……………108

6.2.4. Real-time polymerase chain reaction (RT-PCR) ………………………………….……………108

6.2.4.1. Primer design …………………………………………………………………….….…………108

6.2.4.2. Real-time PCR …………………………………………………………………….……………108

6.2.5. Statistical analysis ………………………………….…………………………………………….…………109

6.3 Results ………………………………………………………………………………………………..….………111

6.3.1. General results of microarray study ……………………………………………….….……………111

6.3.2. Changes in expression of genes involved in cholesterol metabolism in ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mouse islets ………………………………….…………………………….….…………114

6.3.3. Changes in expression of genes involved in glucose metabolism in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mouse islets ………………………………….…………………………….………………117

6.3.4. Changes in expression of genes involved in inflammation in ABCA1β-cell-/-/ABCG1β- cell-/- DKO mouse islets ………………………………….………………………………………….………….……120

6.3.5. Effect of apoA-I treatment on gene expression on ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets ………………………………….…………………………………………………….……………..……123

6.4 Discussion …………………………………………………………………………………………..….………127

CHAPTER 7 General discussion and future perspectives …………………..……….………132

7.1 General discussion ………………………………………………………………………………….………133

7.2 Limitation of the study and future directions ……………………………….………….………135

REFERENCES ………………………………………………………………………………………………………..140

ACKNOWLEDGMENTS First and foremost, I would like to express my sincere gratitude to my supervisor, Professor Kerry-Anne Rye. Thank her for her guidance and patience throughout my PhD studies. I am very honored to be her student and be a member of her research group, which has been a great opportunity for me to learn while progressing in the medical research field. I really appreciate for her enthusiasm and passion for science as well as professional knowledge and vision, all of which have been inspiring and has encouraged me to advance in my studies.

I would like to thank my co-supervisor, Dr. Fatiha Tabet, for her continuous support, encouragement and guidance in gene expression studies. Special thanks to Dr. Blake Cochran for his kind guidance, generosity and willingness to assist on animal studies and provide valuable feedback on my research findings.

I would also like to than my other colleagues in Professor Rye’s lab, especially Professor Philip Barter, for his constant encouragement, motivation and kindness. Thanks to Dr. Ben Wu, for his guidance and advice on histology studies; to Dr. Kwok Ong Leung, for his kind advice and comments on data analysis; to Dr. Shudi Tang, for her help on animal experiments.

I would also like to thank Luisa Cuesta Torres, Miii Patel and Sudichhya Shrestha for their support in the lab.

Finally, I would like to express my gratitude to my family, especially my parents and my son, who always there with inspiration and encouragement.

vii

PUBLICATIONS ARISING FROM THIS THESIS

Hou L, Cochran B, Westerterp M, Tall A, Barter P, Tabet F and Rye KA. Regulation of pancreatic β-cell gene expression by ABCA1 and ABCG1 (Under preparation)

Cochran BJ, Hou L, Manavalan A, Moore BM, Sultana A, Tang S, Shrestha S, Senanayake

P, Patel M, Ryder WJ, Bongers A, Maraninchi M, Wasinger VC, Westerterp M, Tall AR,

Barter PJ, Rye KA. Impact of perturbed pancreatic β-cell cholesterol homeostasis on adipose tissue and skeletal muscle metabolism, Diabetes. 2016 65(12): 3610-3620

CONFERENCE PRESENTATIONS

Hou L, Tabet F, Cochran B, Westerterp M, Tall A, Barter P and Rye KA. Regulation of pancreatic β-cell gene expression by ABCA1 and ABCG1 (Oral), Annual Scientific Meeting of the Australian Atherosclerosis Society, Fremantle, WA, Australia, 2015

Hou L, Tabet F, Cochran B, Westerterp M, Tall A, Barter P and Rye KA. Regulation of pancreatic β-cell gene expression by ABCA1 and ABCG1 (Oral), Islet Society and AISG

Annual Meeting, Sydney, NSW, Australia, 2015

Hou L, Tabet F, Cochran B, Westerterp M, Tall A, Barter P and Rye KA. Regulation of pancreatic β-cell gene expression by ABCA1 and ABCG1 (Poster), Annual Meeting of the

Arteriosclerosis, Thrombosis, and Vascular Biology Peripheral Vascular Disease, San

Francisco, CA, USA, 2015

viii

AWARDS

Australian Postgraduate Award (2013-2016), Australian Government

Postgraduate Research Support Scheme Conference Travel Fund (2015), Graduate

Research School, UNSW

SoMS Postgraduate Student Travel Award (2015), School of Medical Sciences, UNSW

AAS Student International Travel Grant (2015), Australian Atherosclerosis Society

AAS Student Award (2015), Australian Atherosclerosis Society

LIST OF ABBREVIATIONS

ABCA1 ATP-binding cassette transporters A1 ABCG1 ATP-binding cassette transporters G1 ADP Adenosine diphosphate Akt1 Thymoma viral proto-oncogene 1 AMPK AMP-activated protein kinase ApoA-I Apolipoprotein A-I ApoB Apolipoprotein B ATF6 Activating transcription factor 6 ATP Adenosine triphosphate AUC Area under the curve BCA Bicinchoninic acid DKO Double knockout ER Endoplasmic reticulum FADH2 Flavidine adenine dinucleotide Fans Fatty acid synthase FFA Free fatty acid Foxa2 Forkhead box A2 FoxO1 Forkhead box protein O1 FPLC Fast protein liquid chromatography Gbp11 Guanylate binding protein 11 GDM Gestational diabetes GK Glucokinase GLUT1 Glucose transporter 1 GLUT2 Glucose transporter 2 Glut4 Glucose transporter 4 GSIS Glucose-stimulated insulin secretion HBP Hexose biosynthetic pathway HDLs High-density lipoproteins Hmgcr 3-hydroxy-3-methylglutaryl-Coenzyme A reductase

HOMA-IR Homeostasis model assessment of insulin resistance HPLC High performance liquid chromatography HRP horseradish peroxidise IAPP Islet amyloid polypeptide IFN-g Interferon-gamma IL-1b Interleukin-1b IL-6 Interleukin-6 ILLUMINATE Lipid Level Management to Understand its Impact in Atherosclerotic Events iNOS Inducible nitric oxide synthase Insig1 Insulin induced gene 1 IPGTT Intraperitoneal glucose tolerance tests IPITT Intraperitoneal insulin tolerance tests IRE1 Inositol requiring 1 Irs1 Insulin receptor substrate 1 JNK Jun N-terminal kinase KRBHr Krebs-Ringer Bicarbonate HEPES LCAT Lecithin-cholesterol acyltransferase Ldlr Low density lipoprotein receptor LDLs Low density lipoproteins LPL Lipoprotein lipase MRI Magnetic resonance imaging MβCD Methyl-β-cyclodextrin NADH Nicotinamide adenine dinucleotide NF-kB Nuclear factor-kB nNOS Neuronal nitric oxide OAA Oxaloacetate PBS Phosphate buffered saline PC Pyruvate carboxylase PCA principal component analysis PDH Pyruvate decarboxylase

PDX-1 Pancreatic and duodenal homeobox 1 PERK PKR-like ER kinase Pik3r1 Phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 PKA Protein kinase A Ppargc1a Peroxisome proliferator activated receptor gamma coactivator 1 a Prkg1 Protein kinase cGMP-dependent, type I RER Rough endoplasmic reticulum rHDLs Reconstituted HDLs RIA assay Radioimmunological assay RIPA Radioimmunoprecipitation assay RT-PCR Real-time polymerase chain reaction Sftpd Surfactant associated protein D Srebf-1c Sterol regulatory element-binding factor 1 Srebf2 Sterol regulatory element binding factor 2 T1DM Type 1 diabetes mellitus T2DM Type 2 diabetes mellitus TAE Tris-acetate-EDTA TBST Tris buffered saline with Tween TCA cycle Tricarboxylic acid cycle TG Triglycerides TNF-a Tumour necrosis factor-alpha UCP-2 Uncoupling protein 2 UPR Unfolded protein response VLDLs Very low density lipoproteins WHO World Health Organization

xii

LIST OF FIGURES

Figure 1.1. Glucose stimulated insulin secretion pathway.

Figure 1.2. Formation of insulin.

Figure 1.3. Multifactorial origin of β-cell dysfunction.

Figure 1.4. Heterogeneity of HDL subpopulations.

Figure 1.5. Structure of apoA-I.

Figure 3.1. Generation of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Figure 3.2. Breeding strategy for the generation of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Figure 3.3. Genotyping of Ins2-Cre, Abca1fl/fl/Abcg1fl/fl and ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice.

Figure 3.4. ABCA1 and ABCG1 protein levels in pancreatic islets from ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice.

Figure 3.5. Western blot analysis of ABCA1 and ABCG1 levels in tissue homogenates from

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice.

Figure 3.6. Pancreatic β-cell-specific ABCA1 and ABCG1 deficiency does not influence body weight in chow-fed mice.

Figure 3.7. Pancreatic β-cell-specific ABCA1 and ABCG1 deficiency increases adiposity.

Figure 3.8. Adipose tissue mass is increased in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Figure 3.9. Skeletal muscle mass is decreased in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

xiii

Figure 3.10. Lipoprotein cholesterol distribution in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice,

Abca1fl/fl/Abcg1fl/fl mice and Ins2-Cre mice.

Figure 4.1. Experimental details of apoA-I treatment of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice.

Figure 4.2. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/fl/Abcg1fl mice have comparable plasma lipid levels.

Figure 4.3. Islet total cholesterol levels in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were increased relative to Abca1fl/fl/Abcg1fl/fl mice.

Figure 4.4. ApoA-I treatment does not affect plasma lipid levels in Abca1fl/fl/Abcg1fl/fl mice.

Figure 4.5. ApoA-I treatment does not affect plasma lipid levels in ABCA1β-cell-/-/ABCG1β- cell-/- DKO mice.

Figure 4.6. ApoA-I treatment does not affect islet total cholesterol levels in

Abca1fl/fl/Abcg1fl/fl mice.

Figure 4.7. ApoA-I treatment does not affect islet total cholesterol levels in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice.

Figure 5.1. Fed and fasting blood glucose and insulin levels in ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice, Abca1fl/flAbcg1fl/fl mice and Ins2-Cre mice.

Figure 5.2. Glucose tolerance is impaired in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Figure 5.3. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have impaired insulin secretion, but

xiv normal insulin sensitivity.

Figure 5.4. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have normal islet morphology and b-cell mass.

Figure 5.5. ApoA-I treatment improves glucose tolerance in ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice.

Figure 5.6. Insulin secretion is impaired in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice relative to islets from Abca1fl/flAbcg1fl/fl mice.

Figure 5.7. ApoA-I treatment increases GSIS in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

Figure 6.1. Islet 3D principal component analysis (PCA) plots for Abca1fl/flAbcg1fl/fl mice and ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Figure 6.2. A volcano plot of differentially up-regulated and down-regulated genes in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to Abca1fl/flAbcg1fl/fl mice.

Figure 6.3. Validation of array results for changes in expression of genes related to cholesterol metabolism.

Figure 6.4. Validation of array results for changes in expression of islet genes related to glucose metabolism.

Figure 6.5. Validation of array results for changes in expression of islet genes related to inflammation.

Figure 6.6. ApoA-I treatment does not affect expression of genes involved in cholesterol metabolism in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

Figure 6.7. ApoA-I treatment does not affect expression of genes involved in insulin signaling and glucose metabolism in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

Figure 6.8. ApoA-I treatment does not affect expression of genes involved in inflammation in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

xvi

LIST OF TABLES

Table 1.1. Endocrine cell types in the adult human and mouse in pancreas.

Table 2.1. List of primer sequences used for genotyping PCR.

Table 2.2. PCR reaction mix for genomic PCR.

Table 2.3. PCR cycling conditions for amplifying Abca1, Abcg1 and Cre alleles.

Table 3.1. Antibodies used for western blotting.

Table 5.1. List of sample mixtures for insulin RIA assay.

Table 6.1. List of gene primers used for quantitative real-time PCR analysis.

Table 6.2. Changes in expression of genes related to cholesterol metabolism in ABCA1β- cell-/-/ABCG1β-cell-/- DKO mouse islets from microarray data.

Table 6.3. Changes in expression of genes related to glucose metabolism in ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mouse islets from microarray data.

Table 6.4. Changes in expression of genes related to inflammation in islets from ABCA1β- cell-/-/ABCG1β-cell-/- DKO mice from microarray data.

xvii

ABSTRACT b-cell dysfunction is central to the onset and progression of type 2 diabetes (T2D).

Causes of b-cell dysfunction and T2D progression include prolonged exposure of islets to high fatty acid levels and elevated islet cholesterol levels. Loss-of-function mutations in the Abca1/ABCA1 gene increase islet cholesterol levels and cause pancreatic β-cell dysfunction in mice and humans. Insulin secretion is impaired and glucose metabolism is adversely affected in mice with conditional deletion of Abca1 in β-cells and in Abcg1 knockout mice. These effects are exacerbated in Abcg1 knockout mice with conditional

Abca1 deletion in β-cells.

Genes in key β-cell metabolic and signal transduction pathways regulated by ABCA1 and

ABCG1 were identified by microarray analysis of isolated ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets (Chapter 6). These results indicated that ABCA1 and ABCG1 regulate genes involved in cholesterol metabolism, glucose metabolism and inflammation pathways in

β-cells.

xviii

Previous studies have shown that high density lipoproteins (HDLs) and their major apolipoprotein A-I (apoA-I), increase insulin synthesis and insulin secretion in vitro.

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were treated with apoA-I to determine whether apoA-I treatment can also improve β-cell insulin synthesis and secretion in vivo. The results showed that apoA-I treatment improved glucose tolerance and increased insulin secretion in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets under high glucose conditions.

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice by a mechanism that is distinct from processes involved in the regulation of cholesterol homeostasis.

xix

CHAPTER 1

Literature Review

CHAPTER 1

1.1 Introduction

Diabetes mellitus (DM) is one of the most common and rapidly increasing chronic diseases in the world. According to the World Health Organization (WHO), more than

400 million people were living with diabetes worldwide in 2014. This number is expected to reach 552 million by 2030 [1, 2]. Based on the pathogenesis of the disease, DM is classified into four categories: Type 1 DM (T1DM), Type 2 DM (T2DM), other specific types of diabetes and gestational diabetes (GDM) [3]. Population studies have shown that 90-95% of people with diabetes have T2DM [3].

T2DM is characterized by hyperglycaemia, insulin resistance and dyslipidaemia [4]. The onset of T2DM and its progression are mainly determined by the failure of b-cells in pancreatic islets to secrete insulin in amounts that are sufficient to meet metabolic demands [5, 6]. Early b-cell dysfunction is associated with mitochondrial dysfunction, oxidative stress, endoplasmic reticulum stress and glucolipotoxicity [5, 7]. Recent evidence has shown that high b-cell cholesterol content also cause b-cell dysfunction [8-

10].

Cholesterol is an essential component of all cell membranes. However, accumulation of excess cholesterol is toxic to cells [11]. Excess cholesterol induces loss of membrane fluidity, intracellular cholesterol crystal formation, generation of toxic oxysterols and triggering of apoptotic signalling pathways [12, 13]. However, the role of cholesterol in modulating b-cell dysfunction is unclear.

The ATP-binding cassette transporters A1 (ABCA1) and G1 (ABCG1), are the two most important regulators of cell cholesterol levels. ABCA1 exports cholesterol from

2 CHAPTER 1

peripheral cells to lipid-free apolipoprotein A-I (apoA-I) [14], while ABCG1 mediates cholesterol efflux to high-density lipoproteins (HDLs) [15]. Deletion or loss-of-function mutations in ABCA1 in humans or animal causes severe HDL deficiency, cholesterol accumulation in peripheral cells and accelerated atherosclerosis [16, 17]. Loss-of- function mutations in ABCG1 have not been reported in humans but that its deletion in mice causes dramatic accumulation of cholesterol in various tissues, including lung, liver, kidney and spleen [15, 18].

The effects of combined deletions of ABCA1 and ABCG1 tend to be greater than the effect of deletion of either transporter alone. Deletion of both ABCA1 and ABCG1 in macrophages greatly increase the expression of pro-inflammatory cytokines and enhances apoptotic responses, compared with deletion of either transporter alone [19-

21]. ABCG1 knockout mice with conditional deletion of ABCA1 in pancreatic b-cells show greatly exacerbated b-cell dysfunction compared to ABCG1 knockout mice or mice with conditional b-cell deletion of ABCA1 [8, 22, 23].

1.2 Pancreatic Islets and β-cells

The pancreas is located in the upper left part of the abdomen. It lies posterior to the stomach and extends from the duodenum, on the right, to the spleen, on the left [24].

The pancreas has exocrine and endocrine functions. It secretes digestive enzymes that break down carbohydrates, proteins and lipids [25], and produces several important hormones, including insulin, glucagon, somatostatin and pancreatic polypeptide (PP)

[26]. The endocrine cells in the pancreas are located in islets of Langerhans [27].

3 CHAPTER 1

1.2.1. Islet architecture

Islets of Langerhans (islets) were first described by Paul Langerhans in 1869 [28]. There are about 10-15 million islets in an adult pancreas that range in size from 500 to 700 μm

[29]. Human islets contain four major endocrine cell types: α-cells that secrete glucagon,

β-cells that secrete insulin, δ-cells that secrete somatostatin and PP cells that secret pancreatic polypeptide [30]. Islets also contain ε-cells that secrete ghrelin, which increases appetite [31]. The relative proportion of these endocrine cell types in the human islets can vary considerably. On average, β-cells make up 50-70% and α-cells contribute 20-40% of the total cells in human islets [32]. In humans, islet size and the number of β-cells increases progressively from birth to adulthood [33].

Human and mouse islets share some common architectural features and exhibit a similar pattern of distribution, however pancreas size and β-cell mass differ significantly between these two species [32]. About 1000 – 5000 islets exist in the pancreas of an adult mouse. The range of islet sizes in the mouse and humans is similar [29]. The adult mouse islet contains 60-80% β-cells, 10-20% α-cells, < 10% δ-cells and < 1% PP cells [34].

Table 1.1 shows endocrine cell types in the adult human and mouse in pancreas.

4 CHAPTER 1

Table 1.1 Endocrine cell types in the adult human and mouse in pancreas.

Cell Peptide Molecular Number of Volume % (adult) Ref. type hormone weight amino acids Human Mouse α- Glucagon 3,500 29 20-40 10-20 [35, 36] β- Insulin 5,800 51 50-70 60-80 [37-39] δ- Somatostatin 1,500 14 <10 <10 [35, 40] Pancreatic PP 4,200 36 <1 <1 [41] [42] polypeptide ε- Ghrelin 3,400 28 <1 <1 [31, 43]

5 CHAPTER 1

1.2.2. Structure and function of β-cells

β-cells form the bulk of the pancreatic endocrine cell mass. They secrete insulin, which is critically important for the regulation of glycemic control. After synthesis, insulin is repackaged in the β-cell Golgi complex and then stored as pro-insulin in immature secretory granules [44]. Every β-cell contains 10,000-13,000 insulin secretory granules

[45] and each insulin granule contains about 1.6 attomole (10-18 mol) of insulin [46].

An elevated blood glucose level is a key determinant of insulin release [47]. Briefly, glucose enters the β-cell via glucose transporter 2 (GLUT2) in the mouse [48]. Once inside the β-cell, glucose is phosphorylated to glucose-6-phosphate by the glucose sensor glucokinase (GK) [49] [50]. The ability of GK to phosphorylate glucose is the rate- limiting for glucose metabolism [51]. GK has a very high affinity for glucose (Km = 10 mM).

Expression of GLUT2 enables b-cells to respond to minor changes in glucose levels that are not detected by other cell types [51].

Glucose increases the overall rate of glycolysis by increasing b-cell expression of both

GLUT2 and GK [52]. The main product of glycolysis in the b-cell is pyruvate. Pyruvate enters the mitochondria where it acts as a substrate for pyruvate carboxylase (PC), generating oxaloacetate (OAA) and initiating gluconeogenesis. Pyruvate decarboxylase

(PDH) also acts on pyruvate, to generate acetyl-CoA. The tricarboxylic acid (TCA) cycle begins with OAA and acetyl-CoA. OAA reacts with acetyl CoA and H2O to yield citrate and CoA [53, 54]. The TCA cycle produces nicotinamide adenine dinucleotide (NADH) and flavidine adenine dinucleotide (FADH2), which activate the electron transport chain and generate adenosine triphosphate (ATP) from adenosine diphosphate (ADP). The

6 CHAPTER 1

increase in ATP closes ATP-sensitive K+ channels, which induces membrane depolarization and the opening of voltage-dependent calcium channels. This allows calcium to enter the cells, which increases the intracellular calcium concentrations and mediates the exocytosis of insulin-containing granules [55] (Figure 1.1). These events form the basis of glucose-stimulated insulin secretion (GSIS).

Glucose also upregulates insulin production by stimulating nuclear translocation of the transcription factor pancreatic and duodenal homeobox 1 (PDX-1) in β-cells [56, 57].

Non-nutrient secretagogues by contrast, mediate insulin secretion via neural stimuli including cholinergic and adrenergic pathways [58].

7 CHAPTER 1

A. Mouse pancreatic 13-cell Glucose • Glut 2 Insulin

Glucose Golgi ' Glucokinase

Glucose-6-phosphate ' calcium channel

Mitochondrion

potassium channel B. TCA cycle in 13-cell mitochondrion

Figure 1.1. Glucose stimulated insulin secretion pathway. (A) Glucose is taken up into β-cells through Glut2 and converted to glucose-6-phospate by glucokinase. The phosphorylated glucose is metabolized to pyruvate, which enters the mitochondria and is metabolized by the TCA cycle to generate ATP. (B) ATP is then transferred from mitochondria to the cytosol, raising the ATP/ADP ratio. Subsequently, closure of KATP channels depolarizes the cell membrane, which opens voltage-dependent Ca2+ channels and increases the cytosolic Ca2+ concentration, triggering insulin exocytosis [55].

8 CHAPTER 1

1.2.3. Structure and function of insulin

Insulin is a 51 amino acid, 5,802 Da anabolic peptide hormone [58]. It is synthesized as a dimer that consists of a 21 amino acid A chain and a 30 amino acid B chain, which are linked together by disulphide bonds between residues A7 and B7 and residues A20 and

B19 [59, 60] (Figure 1.2). An additional disulfide bond links residues A6 and A11 within the same chain [60]. Insulin is initially synthesized as a single polypeptide, preproinsulin, which is directed to the rough endoplasmic reticulum (RER) [61]. Preproinsulin is translated as a 110 amino acid molecule, that has an additional signal sequence of 23 amino acids that is important for its translocation to the lumen of the RER [62]. Once at the luminal edge of the ER, preproinsulin is converted to proinsulin by the removal of its signal peptide. Proinsulin is a single protein chain, with the A and B chains of mature insulin linked in a continuous sequence by the C (connecting)-peptide [63, 64]. Proinsulin is sorted within the Golgi complex into immature secretory granules [62] from which the

C-peptide is cleaved by the endoproteases, PC1 and PC2. Both insulin and the C-peptide are secreted in an equimolar ratio during exocytosis [65].

Insulin plays a critical role in glucose and energy metabolism. It regulates glucose uptake, glycogen synthesis and endogenous glucose production, as well as protein synthesis, proteolysis, triglyceride lipolysis and VLDL triglyceride secretion [66, 67].

9 CHAPTER 1

A. C-Peptide

A-Chain Preproinsulin "'------COOH

B-Chain NHr------Lumenal Signal sequence 1translocation C-Peptide B.

55 Proinsulin r,

Site PCl s s s s cleavage '\ 1Golgi - Granule Site PC2 cleavage

ss C. A6 All A7 A20 s s C-Peptide s s + B7 B19 Insulin

Figure 1.2. Formation of insulin. Adapted from Halban et al, 1991 [62].

(A) Preproinsulin, the insulin precursor, is transcribed on the endoplasmic reticulum

(ER). Upon translocation to the ER lumen, the insulin signal sequence is cleaved, generating proinsulin. (B) Proinsulin is folded and packaged into granules. (C) The connecting C-peptide is cleaved by PC1 and PC2 endopeptidases to generate mature insulin, consisting of covalently linked A and B chains. C-peptide and insulin are secreted from the granules in an equimolar ratio.

10 CHAPTER 1

1.2.4. β-cell dysfunction of and diabetes

Loss of β-cell function, and ultimately β-cell failure, is central to the development of

T2DM. Several conditions contribute b-cell failure. These include glucotoxicity, lipotoxicity, mitochondrial dysfunction, oxidative stress, ER stress and amyloid deposition [68-71] (Figure 1.3). Progressive hyperglycemia is also associated with other deleterious events in b-cells, such as inflammation and amyloid fibril formation, which leads to extensive apoptosis, and ultimately to T2DM [72].

Glucotoxicity

Glucotoxicity is caused by chronic exposure of b-cells to elevated glucose levels. This leads to progressive and irreversible b-cell damage [68]. Glucotoxicity impairs both insulin secretion and the action of insulin on cells. Exposure of pancreatic islets to intermittently high glucose levels can accelerate loss of b-cell function and decrease b- cell mass by inhibiting glucose-stimulated insulin secretion, activating apoptosis, modifying mitochondrial morphology and increasing b-cell nitrotyrosine levels [73].

Chronic hyperglycemia affects insulin secretion and insulin function by increasing glucose flux through the hexose biosynthetic pathway (HBP) [74]. Activation of the HBP pathway in b-cells increases apoptosis and impairs activation of the insulin receptor/insulin receptor substrate/PI3-kinase/Akt survival pathway [75].

11 CHAPTER 1

8 - P-cell

Figure 1.3. Multifactorial origin of β-cell dysfunction.

12 CHAPTER 1

Lipotoxicity

Chronically elevated plasma free fatty acid (FFA) levels, or lipotoxicity, adversely affect insulin secretion [76]. Long-term exposure of pancreatic b-cells to high saturated fatty acids levels leads to accumulation of malonyl-CoA and long-chain fatty-acyl-CoA, increased fatty acid oxidation and esterification, accelerated ceramide synthesis, fatty acid-induced apoptosis and activated ER stress [77]. Another pro-apoptotic effect of

FFAs is mediated by a marked decrease of Bcl-2, a member of a large family of apoptosis- regulating genes [78]. In addition, increased plasma FFA concentrations contribute to insulin resistance in peripheral tissues and enhance hepatic gluconeogenesis through induction of phosphoenolpyruvate carboxykinase and glucose-6-phosohatase [79].

Endoplasmic reticulum (ER) stress

There is increasing evidence that ER stress contributes to b-cell apoptosis during the progression to T2DM [80]. The high insulin secretory demand during progression to

T2DM makes b-cells susceptible to secretory pathway stress. Elevated protein flux through the ER and Golgi can result in misfolded proteins and activation of the unfolded protein response (UPR) [81]. Three ER transmembrane proteins, inositol requiring 1

(IRE1), PKR-like ER kinase (PERK) and activating transcription factor 6 (ATF6), are the sensors that trigger cellular adaptation responses, and ultimately b-cell apoptosis if the stress is not alleviated [82].

Mitochondrial dysfunction

Mitochondrial metabolism of glucose is crucial for triggering insulin secretion. As outlined in Section 1.2.2, increased blood glucose levels increase activity of the TCA cycle

13 CHAPTER 1

in b-cells. This generates a proton gradient across the mitochondrial membrane that promotes ATP formation [83]. This mitochondrial dysfunction is caused by fuel overload, which increases substrate influx through the metabolic mitochondria pathways, resulting in the generation of large amounts of high-energy metabolites and reactive oxygen species. Protein expression of mitochondrial uncoupling protein 2 (UCP-2), complex I and complex V of the respiratory chain, and nitrotyrosine levels are also increased in islets from people with T2DM [84]. Overexpression of UCP-2 reduces ATP production, thus decreasing the ATP/ADP ratio [85], and inhibits insulin production [55,

84].

Inflammation

T2DM is associated with chronic low-grade systemic inflammation that inhibits glucose homeostasis and contributes to the onset of diabetes [86]. Compared to normal pancreatic islets, islets in people with T2DM produce and release increased amounts of inflammatory agents, such as interleukin-1b (IL-1b), interferon-gamma (IFN-g), tumour necrosis factor-alpha (TNF-a), interleukin-6 (IL-6) and leptin [87, 88].

IL-1b, IFN-g and TNF-a act on b-cells synergistically to induce apoptosis [88] via activation of nuclear factor (NF)-kB, and upregulation of inducible nitric oxide synthase

(iNOS) [89]. Activation of Jun N-terminal kinase (JNK) and p38 MAPK pathways by IL-1b,

IFN-g and TNF-a also causes apoptosis [90].

Amyloid deposition

Islet amyloid deposition is a characteristic of T2DM [91]. Islet amyloid polypeptide (IAPP) is co-expressed and co-secreted with insulin in pancreatic β-cells [92, 93]. The co-

14 CHAPTER 1

secretion of IAPP with insulin means that in insulin-resistant states, where insulin secretion is increased, there is also an upregulation of IAPP production [94]. The accumulation of IAPP fibrils in b-cell causes both secretory dysfunction and apoptosis through destabilisation of the b-cell membrane [95, 96]. Accumulation of IAPP also actives NF-kB and increases ER stress, which leads to β-cells apoptosis [97].

1.3 High density lipoproteins and apolipoprotein A-I

1.3.1. Lipoproteins

Plasma lipoproteins are water-soluble macromolecules that contain lipids (triglycerides, unesterified cholesterol, esterified cholesterol and phospholipids) complexed with apolipoproteins [98]. Lipoproteins transport lipids in the circulation and regulate lipid synthesis and catabolism [99]. In order of increasing density and decreasing diameter, plasma lipoproteins have been classified as chylomicrons, very low density lipoproteins

(VLDLs), low density lipoproteins (LDLs) and high density lipoproteins (HDLs) [100]. HDLs are further subdivided into two main subfractions: HDL2 and HDL3 [101]. HDL2 are larger and less dense than HDL3.

Chylomicrons are the largest (75-1200 nm in diameter) and least dense (d ≤ 0.95 g/ml) of all lipoproteins. They are secreted by the intestine and consist of triglycerides (TG)

(85-92%), phospholipids (6-12%), esterified cholesterol (1-3%) and apolipoproteins (1-

2%) including apoB-48, apoA-I, apoA-IV, and the apoCs (C-I, C-II, C-III) [102, 103].

VLDLs are approximately 30-90 nm in diameter and have a density of 0.95- to 1.006 g/ml.

VLDLs are TG-rich lipoproteins that are asembled in and secreted from the liver. They

15 CHAPTER 1

contain several apolipoproteins, including apoB-100, apoC-I, apoC-II, apoC-III and apoE

[104].

LDLs are catabolic products of VLDLs. They are 24-26 nm in diameter and 1.019 to 1.055 g/ml in density [99]. LDLs contain a single molecule of apoB-100 and a neutral lipid core of cholesteryl esters [105]. LDLs bind to and are internalized by the LDL receptor [106,

107].

HDLs are the smallest (7.6-10.6 nm diameter) and densest (1.063-1.25 g/ml) of all the lipoproteins. They constitute a heterogeneous group of particles that vary in shape, density, size, protein composition and surface charge [108]. The four main apolipoproteins in human HDL, in order of decreasing abundance, are apoA-I, apoA-II, apoA-IV and apoE. Among these apoA-I and apoA-II comprise 70% and 20% of the total

HDL apolipoprotein content, respectively [109, 110].

1.3.2. Structure of HDLs

HDLs consist of a number of discrete subpopulations of particles that have a hydropobic core (mainly cholesteryl esters plus some triglyceride) surrounded by a surface monolayer of apolipoproteins, phospholipids and unesterified cholesterol.

HDLs are customarily divided into two main subfractions according to density: HDL2

(1.063

7.6 nm) particles [111].

16 CHAPTER 1

HDLs also contain several other apolipoproteins including apoA-IV [112], apoA-V [113], apoC-I [114], apoC-II [114], apoC-III [115], apoD [116], apoE [117], apoJ [118], apoL [119] and apoM [120].

According to their apolipoprotein composition, HDLs can also be classified into two major subpopulations: HDLs that contain both apoA-I and apoA-II in approximately a 2:1 molar ratio, and HDLs with apoA-I but no apoA-II [110, 121].

HDL can also be separated on the basis of surface charge by agarose gel electrophoresis into α-, pre-β- and γ-migrating particles [122-127]. Pre-β1 HDL are small, lipid-poor particles that contain a single molecule of apoA-I and are effective acceptors of cellular cholesterol [128]. Pre-β2-migrating HDL are larger, discoidal particles that contain two or three molecules of apoA-I and are the main substrates for lecithin:cholesterol acyltransferase (LCAT) [129]. LCAT esterifies cholesterol at the surface of HDL and the resulting cholesteryl esters partition into center of the HDL particle, converting discoidal

HDL into the spherical HDL that comprise most of the HDLs in human plasma. Most spherical HDL are α-migrating [130]. HDL with γ migration are spherical particles that contain apoE [131].

17 CHAPTER 1

Discoidal HDL Spherical HDL

Less dense More dense

(A-l}HDL (A-1)/(A-ll}HDL

D c:::,

Lipid-free apoA-1 (A-l}HDL c:::,

Figure 1.4. Heterogeneity of HDL subpopulations. Adapted from Rye et al. [108]

HDLs are classified according to their shape (A), density and size (B), apolipoprotein composition (C) and surface charge (D).

18 CHAPTER 1

1.3.3. Properties of HDLs

Evidences from human population studies have shown that plasma HDL levels are strongly and inversely related to atherosclerotic cardiovascular diseases risk [132]. HDLs have many well-characterized functional properties with the potential to protect against cardiovascular diseases. Reverse cholesterol transport is the one of better understood potentially cardioprotective roles of HDLs [133]. HDLs also have antioxidant [101, 134], anti-inflammatory [135] and anti-thrombotic properties [136].

1.3.4. Structure of apoA-I

ApoA-I is the most abundant HDL apolipoprotein, comprising approximately 70% of the total HDL protein mass. It consists of a 243 amino acid, 28 kDa single polypeptide chain

[98]. The major structural motif of apoA-I is the type A amphipathic a-helix which consists of a series of ten 22 amino acid repeats [137]. ApoA-I contains an N-terminal domain comprising amino acids 1 through 187 and a C-terminal domain comprising amino acids 188 through 243, which both have a relatively high affinity for lipid and facilitate binding to phospholipid [138]. When apoA-I associates with lipid, the hydrophobic face of its α-helices associate with phospholipid acyl esters, while the hydrophilic face orients towards the aqueous environment and confers water solubility on the particles [139, 140].

Up to 10% of the apoA-I in human plasma is present in a lipid-free or lipid-poor form

[138]. ApoA-I circulates mainly in a lipid-bound form, as a component of discoidal and spherical HDLs. ApoA-I-containing discoidal HDLs are secreted from the liver [141] or generated in the plasma when lipid-free apoA-I acquires phospholipids and cholesterol

19 CHAPTER 1

from cells that express with ABCA1 or from triglyceride-rich lipoproteins that are undergoing hydrolysis by LPL [142]. Most discoidal HDL particles contain two molecules of apoA-I that are located around the circumference of the particle in an antiparallel orientation, forming a ‘double belt’ [143] (Figure 1.5, Panel A). An alternative ‘hairpin’ model, has also been proposed, where each of the apoA-I molecules interacts with the discoidal HDL phospholipids in a ‘hairpin’ conformation (Figure 1.5, Panel B). This generates intramolecular interactions that are similar to what has been reported for the

‘double belt’ model [144, 145]. Cross-linking studies have established that the three molecules of apoA-I in spherical HDL are arranged as a ‘trefoil’ on the particle surface

[143]. This is a modification of the “double belt” model, in which the three apoA-I molecules are aligned in an antiparallel arrangement around the sphere (Figure 1.5,

Panel C).

1.3.5. Functions of apoA-I

Many of the cardioprotective properties of HDLs have been attributed to apoA-I. This apolipoprotein also plays an important role in the first step of the reverse cholesterol transport pathway by promoting cholesterol efflux from peripheral cells via the ATP binding cassette transporter, ABCA1 [146]. ApoA-I is also the main co-activator of LCAT, the enzyme that esterifies cholesterol in discoidal HDL in a process that converts the discoidal particles into spherical HDL [147].

1.3.5.1. Effects of apoA-I on atherosclerosis

Overexpression of apoA-I in mice increases plasma HDL levels and the reverse cholesterol transport pathway and inhibits atherosclerosis [148]. On the other hand,

20 CHAPTER 1

mice lacking apoA-I have increased plasma total cholesterol and triglyceride levels, but decreased HDL and HDL-C levels [149, 150]. These mice are more prone to atherosclerosis development than wild type mice [150].

In humans, loss-of-function mutations in ABCA1 cause Tangier disease [151], which is characterized by very low plasma HDL and apoA-I levels, and accumulation of cholesteryl esters in reticuloendothelial cells of tissues, including tonsils, thymus, lymph node, bone marrow, spleen, liver, gall bladder, and intestinal mucosa. Subjects with Tangier disease are at increased risk of developing atherosclerosis and coronary artery disease [151].

1.3.5.2. Effects of apoA-I on glucose metabolism

Studies have shown that apoA-I can improve glucose metabolism via AMP-activated protein kinase (AMPK) and increased glucose uptake in myocytes [152]. ApoA-I knockout mice show significantly increased fasting plasma glucose, increased insulin concentrations and impaired glucose tolerance [152]. Studies have also shown that apoA-I treatment improves glucose tolerance in insulin resistant mice [153], and that glycemic control is improved in people with type 2 diabetes in which plasma HDL cholesterol levels are increased by treatment with the CETP inhibitor, torcetrapib

[154].Details of the effect of apoA-I on b-cell function is described in detail in Section

1.6.

21 CHAPTER 1

A C

Figure 1.5. Structure of apoA-I. Adapted from Silva et al. [143]

(A) Lipid-associated apoA-I aligned in a ‘double belt’ pattern on discoidal HDL particles

[143]. (B) Lipid-associated apoA-I in a ‘hairpin’ pattern on discoidal HDL particles [145].

22 CHAPTER 1

1.4 ABCA1 and ABCG1

ABCA1 and ABCG1 utilize the energy of ATP to transport metabolites across cell membranes. Members of the ABC transporter family are organized as two groups: (1) full transporters that contain a pair of ATP-binding domains, two nucleotide binding domains and two transmembrane domains, such as ABCA1, and (2) half transporters such as ABCG1, which acts as a homodimer. ABCG5 and ABCG8 are half transporters that form heterodimers [155].

1.4.1. ABCA1

ABCA1 is a 2,201-amino-acid integral membrane protein that is highly expressed in the liver, intestine, adrenal glands, lung, and brain, as well as in macrophages [156, 157].

ABCA1 is a major regulator of cellar cholesterol and phospholipid homeostasis [158].

ABCA1 plays a critical role in HDL formation and the reverse cholesterol transport pathway by mediating the efflux of cholesterol and phospholipids from cell membranes to lipid poor apoA-I, apoA-II and apoE to form nascent, discoidal HDL [159, 160]. Mice that are deficient in ABCA1 have decreased cellular cholesterol efflux activity and HDL deficiency [161]. Over-expression of ABCA1, by contrast, increases plasma HDL levels and protects against atherosclerosis in mice [162]. Loss-of-function mutations in ABCA1 can cause Tangier disease and familial hypoalphalipoproteinemia in humans, which are characterized by almost absence of plasma HDL levels [163].

Recent evidence has shown that ABCA1 is also a key player in β-cell cholesterol homeostasis and insulin secretion [8, 22]. Mice with global deletion of ABCA1 have reduced levels of both total plasma and HDL cholesterol. Mice with conditional deletion

23 CHAPTER 1

of ABCA1 in β-cells, by contrast, have markedly increased islet cholesterol levels, but normal the plasma total and HDL cholesterol levels [8]. Despite the difference in plasma cholesterol levels, both of these animals have impaired glucose tolerance. The underlying reasons for this observation may be due to their elevated b-cell cholesterol levels nd increasing neuronal nitric oxide (nNOS) synthase dimerization which increases the binding of GK to insulin secretory granules, and inhibits GK activation [10].

The ability of ABCA1 to maintain normal islet cholesterol levels is also important for mediating the beneficial effects of thiazolidinediones in b-cells [8]. These findings suggest that the ability of HDL to promote cholesterol efflux via ABCA1 protects against b-cell dysfunction.

1.4.2. ABCG1

ABCG1, a homolog of the well-known Drosophila gene white, is a 638-amino-acid protein half transporter that consists of a single nucleotide binding domain and a single transmembrane domain [164]. ABCG1 is highly expressed in macrophages. It is also important for the regulation of cholesterol transport [165].

ABCG1 functions as a homodimer to mediate cholesterol efflux to mature HDLs, but not to lipid-free apoA-I [166]. Studies in animal models have shown that ABCG1 plays an important role in reverse cholesterol transport pathway by enhancing the efflux of cholesterol to different acceptors, including HDLs, LDLs, and phospholipid vesicles without increasing the binding of lipoproteins to cells [167]. Recent studies have shown that ABCG1 also mediates cholesterol efflux from β-cells [23]. ABCG1 knockout mice have dramatically increased tissue cholesterol levels [15], but normal islet cholesterol

24 CHAPTER 1

levels and normal plasma lipid profiles [23]. Despite their normal islet cholesterol homeostasis, insulin secretion in response to a glucose challenge is impaired in ABCG1 knockout mice, and they are glucose tolerant [23].

Furthermore, Kruit et al. have reported that islet cholesterol accumulation and glucose intolerance is evident in ABCG1 knockout mice with conditional β-cell deletion of ABCA1, and that these adverse effects are exacerbated compared to what is observed in ABCG1 knockout mice, or in mice with conditional β-cell deletion of ABCA1 only [22].

1.5 Disorders of cholesterol metabolism and β-cell dysfunction

It is important to note that plasma lipid profile abnormalities are apparent long before

T2DM develops in humans. In fact, dyslipidemia is considered as an independent risk factor for T2DM [168]. This may be because elevated serum cholesterol levels increase cholesterol levels in pancreatic islets, as has been observed in apoE knockout mice [10].

Moreover, as islet cholesterol levels directly and significantly inhibit GSIS [10], these observations suggest that intracellular accumulation of cholesterol is a pathogenic mechanism of β-cell dysfunction irrespective of whether the cholesterol accumulation is caused by increased uptake of LDLs via the LDL receptor, or by the absence or loss-of- function mutations in cholesterol transporters in β-cells.

Deletion of ABCA1 or ABCG1 in β-cells inhibits insulin secretion in vivo and in isolated islets ex vivo. Evidence that this is a direct consequence of intracellular cholesterol accumulation and impaired insulin granule exocytosis [8, 169] comes from studies oin which reducing islet cholesterol levels with methyl-β-cyclodextrin (MβCD) increases insulin secretion [10, 169].

25 CHAPTER 1

The situation is somewhat different in ABCG1 knockout mice in which ABCA1 expression is normal. Islet cholesterol levels are not affected in these animals but altered insulin secretory granule cholesterol composition and subcellular cholesterol distribution, leads to impaired exocytosis of insulin granules [23]. High-fat fed mice also have increased islet cholesterol accumulation, decreased insulin secretion, and decreased β-cell mass

[170]. These observations collectively support a role for perturbed intracellular cholesterol homeostasis in progressive β-cell dysfunction in T2DM.

1.6 Effect of HDLs and apoA-I in pancreatic β-cell function

Pancreatic β-cell dysfunction is a major pathophysiological characteristic of T2DM. This can be attributed to decreased β-cell mass and a reduced intrinsic ability to produce and secrete insulin [171]. Emerging evidence suggests that HDLs have novel actions on glucose metabolism, with both acute [172] and chronic [154] elevations in plasma HDL cholesterol levels improving glycemic control in patients with T2DM. Intravenous infusions of reconstituted HDLs (rHDLs) containing apoA-I complexed with soy bean phosphatidylcholine have been shown to reduce plasma glucose levels, increase plasma insulin levels and improve HOMA β-cell function [172]. In an Investigation of people with T2DM in the Lipid Level Management to Understand its Impact in Atherosclerotic

Events (ILLUMINATE) trial, in which plasma HDL levels were chronically increased by treatment with the CETP inhibitor, torcetrapib, plasma glucose and insulin levels decreased, and HOMA-IR (homeostasis model assessment of insulin resistance) was improved in people with T2DM [154].

26 CHAPTER 1

In vitro studies have further shown that HDLs and the main HDL apolipoprotein, apoA-I, increase the insulin secretory capacity of β-cells under both basal and high glucose conditions [173]. The mechanism of the increase in β-cell secretory capacity by HDL under basal glucose conditions is calcium-dependent and independent of glucose metabolism. Under high glucose conditions, the increase in insulin secretion is associated with KATP channel activation and is dependent on glucose metabolism and calcium mobilization. ApoA-I also increases insulin synthesis and secretion by activation of protein kinase A (PKA) and nuclear exclusion of the transcription factor forkhead box protein O1 (FoxO1) [174].

1.7 Scope of this thesis

The central hypothesis of this thesis is that treatment with apoA-I rectifies the adverse metabolic effects of increased pancreatic islet cholesterol levels in mice with conditional deletion of ABCA1 and ABCG1 in β-cells. The major novelty of this project is the use of a unique mouse model in which both ABCA1 and ABCG1 are deleted only in β-cells, and that the adverse effects of this genetic manipulation is corrected by treatment with apoA-I.

The aims of the studies in this thesis are:

• to generate mice with conditional deletion of ABCA1 and ABCG1 in β-cells;

• to determine how apoA-I affects cholesterol metabolism in mice with conditional

deletion of ABCA1 and ABCG1 in β-cells;

• to determine how apoA-I affects glucose metabolism in mice with conditional

deletion of ABCA1 and ABCG1 in β-cells.

CHAPTER 2

General Methods

CHAPTER 2

2.1 Mouse procedures

2.1.1. General husbandry and diets

All mice were housed and bred at the Australian BioResources (ABR, Moss Vale, NSW,

Australia) and shipped to the Biological Resource Centre (BRC, UNSW Australia) at 12 weeks of age. The mice were housed under 12 h light/dark cycles and were maintained on a normal chow diet at all times. All experiments were approved by the UNSW Animal

Care and Ethics Committee (ACEC #13/135B) and conducted in accordance with their guidelines.

2.1.2. Breeding of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice

Mice with conditional deletion of ABCA1 and ABCG1 in pancreatic β-cells were generated by crossing Abca1fl/flAbcg1fl/fl mice (a gift from Professor Alan Tall, Columbia

University, NY, USA) with Ins2-Cre mice (B6.Cg-Tg(Ins2-Cre)25Mgn/J, Jackson Laboratory,

Bar Harbor, ME, USA). The mice were genotyped by PCR as described in Section 2.1.3.

Cre-recombinase positive F1 mice were backcrossed with Abca1fl/flAbcg1fl/fl mice to generate ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

2.1.3. Mice genotyping by genomic PCR

Genomic DNA was obtained from 4 week old tail samples and genotyped by PCR. PCR amplification of the Abca1, Abcg1 and Cre genes was carried out using specific primers

(Table 2.1) according to the manufacturer’s instructions (PhireTM Animal Tissue Direct

PCR kit, Thermo Fisher Scientific, Waltham, MA, USA).

Mouse tail samples were incubated with 20 µl dilution buffer and 0.5 µl DNA release

29 CHAPTER 2

buffer for 2 min at 98 °C on a heating block. The diluted tail samples were added to the reaction mix (Table 2.2) and placed in the thermal cycler (Bio-Rad Laboratories, Hercules,

CA, USA). A PCR amplification cycling program was performed as shown in Table 2.3.

Agarose gel electrophoresis was performed to separate the PCR products according to fragment size. The gels were prepared by dissolving agarose (2 g) in 100 ml Tris-acetate-

EDTA (TAE) buffer containing 40mM Tris-base, 20 mM acetic acid and 1 mM EDTA-Na2, then heating the solution in a microwave until boiling. SYBR Safe DNA gel stain (0.01

µl/ml, Life Technologies, Carlsbad, CA, USA) was added to the cooled solution. The gel was cast in a 10 x 20 cm gel tray with a gel comb and allowed to set. The PCR amplified products and DNA hyperLadder (Bioline, Boston, MA, USA) were resolved by electrophoresis at 100 V for 30-40 mins in a horizontal tank containing TAE buffer.

Appropriate band sizes for Cre, WT Abca1, WT Abcg1, floxed Abca1 and floxed Abcg1 were verified by imaging (ImageQuant LAS 4000 Mini, GE Healthcare, Little Chalfont,

Bucks, UK).

30 CHAPTER 2

Table 2.1 List of primer sequences used for genotyping PCR.

Gene ID Direction Primer Sequence Forward 5’-GGTTGCCCCTACGGATTTAAG-3’ Abca1 Reverse 5’-GCAGTAGCCCATGTTCTGGT-3’ Forward 5’-CTGCCCCGTCCCCTTCTAAA-3’ Abcg1 Reverse 5’-GGCCACCAGCTCTCCACTGT-3’ Forward 5’-GGACATGTTCAGGGATCGCCAGGCG-3’ Cre Reverse 5’-GCATAACCAGTGAAACAGCATTGCTG-3’

Table 2.2 PCR reaction mix for genomic PCR.

Component Volume per sample Final concentration Milli Q water 8.4 µl - 2x PCR Buffer 10 µl 1X Forward Primer (100uM) 0.1 µl 0.5 µM Reverse Primer (100um) 0.1 µl 0.5 µM Phire Hotstart II DNA polymerase 0.4 µl - Tail sample 1 µl -

Table 2.3 PCR cycling conditions for amplifying Abca1, Abcg1 and Cre alleles.

Cycle Step Temperature Time Cycles Initial denaturation 98 °C 5 min 1 Denaturation 98 °C 5 sec Annealing 61 °C 5 sec 40 Extension 72 °C 20 sec (for Abcg1 and Cre) 40 sec (for Abca1)

Final extension 72 °C 1 min 1

31 CHAPTER 2

2.1.4. Body weight and food intake

Body weight and food intake were assessed twice per week in all mice from 12-16 weeks of age. Conventional scales were used for assessment of body weight. For food intake, mice were transferred to a new cage. Fresh food was added to the food hopper a day prior to food intake measurement. Food was weighed before being given to the animals.

After 24 h, the remaining food was weighed again. The difference in food weight was then defined as food intake.

2.1.5. Cardiac puncture and plasma collection

The mice were anaesthetized using isoflurane (5% in oxygen). A sciatic nerve reflex test was performed to confirm deep anesthesia. Briefly, a tweezer was used to pinch the paw of each mouse to check for a reflex reaction of the leg. When the reflex reaction had disappeared, the abdominal cavity was opened with an incision through the skin and abdominal wall. A 1 ml syringe with a 25-gauge needle was inserted into the heart, and blood (approximately 0.75 ml for a mouse weighing 25 g) was collected into a tube containing 10 μl of 200mM EDTA-Na2. The mice were then euthanized by cervical dislocation. The blood was centrifuged at 18,620 xg for 5 min at 4 °C to obtain plasma, which was stored at -80 °C until use.

2.1.6. Tissue harvest

After cardiac puncture, the liver, spleen, kidney, skeletal muscles, brain, white adipose tissue and brown adipose tissue were collected from each animal, immediately snap- frozen in liquid nitrogen and stored at -80 °C for future studies. The pancreas was either removed for histology, or injected with collagenase for islet collection.

32 CHAPTER 2

2.1.7. Isolation of mouse pancreatic islets

After euthanasia, the common bile duct was cannulated and its duodenal end occluded by clamping. A perfusion solution (0.25 mg/ml Liberase and 0.0075 mg/ml Thermolysin

(Roche, Basel, Switzerland) in Krebs-Ringer Bicarbonate HEPES buffer (KRBH) (136 mM

NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 5 mM NaHCO3, 1.2 mM MgSO4.7H2O, 1 mM CaCl2 and 10 mM HEPES, pH 7.4)) was injected into the common bile duct to distend the pancreas. This procedure was performed under a dissection microscope (Olympus,

Tokyo, Japan). The pancreas was excised, cleared of fat and lymph nodes, and incubated at 37 °C for 16 min. The digestion was terminated by adding 15 ml of quenching reagent

(10% (v/v) New Born Calf Serum (Life Technologies, Carlsbad, CT, USA) in KRBH buffer).

Undigested tissue was removed by filtering through a nylon mesh (pore size 500 μm)

(Sigma-Aldrich, St. Louis, MO, USA). The digest was washed by centrifugation at 233 xg for 1 min at 10 °C with 3 X 20 ml of the quenching reagent. The supernatant was removed and the tissue was re-suspended in Ficoll-Paque (30 ml, GE Healthcare), and overlayed with quenching reagent (10 ml). After centrifugation at 1350 xg for 22 min at

10 °C, the majority of the islets were found in the supernatant. The supernatant was passed through a 70 μm cell strainer (In Vitro Technologies, Lane Cove, NSW, Australia) and washed with quenching reagent (3 x 35 ml) to remove the Ficoll-Paque.

For RNA and cholesterol extraction, islets were washed with PBS (2 x 25 ml) and hand- picked under a microscope. The isolated islets were centrifuged at 380 xg for 2 min, the supernatant was removed and the pellet was stored at -80 °C until use.

For insulin secretion studies, the islets were washed with warm islet media (25 ml of 20

33 CHAPTER 2

mM L-glutamine (Life Technologies), 100 U/ml Penicillin (Life Technologies), 100 μg/ml

Streptomycin (Life Technologies) and 10% (v/v) FBS (Cell Applications, San Diego, CA,

USA) in RPMI 1640 medium, Thermo Fisher), hand-picked under a microscope then incubated overnight at 37 °C in islet media.

2.2. HDL isolation and apoA-I purification

2.2.1. HDL isolation

HDLs were isolated from pooled, autologously donated human plasma (Healthscope

Pathology, Adelaide, South Australia) by sequential ultracentrifugation (density range

1.063 g/ml < d < 1.21 g/ml) at 311,400 xg and 4 °C, using a 70Ti fixed angle rotor in an

Optima LE-90K Ultracentrifuge (Beckman Coulter, Brea, CA, USA) as described previously [175]. The plasma was initially adjusted to a density of 1.063 g/ml with solid potassium bromide (KBr) and ultracentrifuged for 16 h. The d>1.063 g/ml fraction was collected by tube slicing, adjusted to 1.21 g/ml with solid KBr and ultracentrifuged for

26 h. The d<1.21 g/ml fraction was collected by tube slicing and dialysed for 24 h against a 1.21 g/ml density solution. The d<1.21 g/ml fraction was then ultracentrifuged for a further 26 h. The d<1.21 g/ml fraction was collected by tube slicing, dialysed against 5 mM NH4HCO3/1 mM EDTA-Na2 buffer (3 x 5 L), then lyophilised for 5 h. The HDLs were delipidated with chloroform/ethanol/diethyl ether (1/3/15, v/v/v) as described [176].

The resulting apoHDLs were dried under nitrogen, dissolved in 20 mM Tris (pH 8.2) and lyophilised.

34 CHAPTER 2

2.2.2. ApoA-I purification

ApoA-I was isolated from the resulting apoHDLs by anion exchange chromatography on a Q Sepharose Fast Flow column (GE Healthcare) attached to an AKTA system (GE

Healthcare) [177]. The apoHDLs were dissolved in Q-Sepharose Buffer A (6 M Urea, 20 mM Tris, pH 8.5) and loaded onto a Q-Sepharose Fast Flow column that had been pre- equilibrated with Buffer A. Apolipoproteins were eluted at a flow rate of 3 ml/min using a discontinuous gradient of Buffer B (6 M Urea, 20 mM Tris, 0.5 M NaCl, pH 8.5; 0-40%

Buffer B over 5 min, 40-48% Buffer B over 70 min and 48-70% Buffer B over 110 min).

Fractions (9 ml) were collected.

An aliquot (10 µl ) of each fraction was electrophoresed on a homogeneous 20% SDS- polyacrylamide Phast Gel (GE Healthcare) and stained with Coomassie Blue R-350. The apoA-I-containing fractions were pooled and dialysed against 20 mM NH4HCO3 (3x 5L).

The resulting purified apoA-I was lyophilised and stored at -20 °C until use.

Prior to use, the lyophilised apoA-I was reconstituted in 10 mM Tris / 3 M Guanidine-HCl

(pH 8.2) and dialysed against 3x 1L endotoxin-free PBS (137 mM NaCl, 4.3 mM Na2HPO4,

2.7 mM KCl, 1.47 mM KH2PO4, pH 7.4). The resulting apoA-I appeared as a single band following electrophoresis on a homogeneous 20% SDS-polyacrylamide Phast Gel and

Coomassie R-350 staining. ApoA-I concentrations were determined as described in

Section 2.2.3.

2.2.3. ApoA-I assay

ApoA-I concentrations were quantified immunoturbidometrically in an AU480 autoanalyser (Beckman Coulter) as described [178] using a goat anti-human apoA-I

35 CHAPTER 2

antibody (Calbiochem, San Diego, CA, USA), apoA-I standards (0-500 µg/ml), and a pooled sample of normal human plasma as a quality control. The assay reagent was 0.9%

(w/v) NaCl, 40% (v/v) polyethylene glycol, 0.1% (v/v) Tween-20 and 0.025% (v/v) phosphate buffer (100 mM NaH2PO4). The concentration of apoA-I was determined from the linear relationship between the apoA-I standards and the sample absorbance.

2.3. Biochemical and enzymatic assay

2.3.1. Bicinchoninic acid (BCA) protein assay

Protein concentrations were measured using the bicinchoninic acid assay. Briefly, a solution of bicinchoninic acid (Sigma Aldrich) and Triton X-100 (1:100 (v/v), Buffer A) was combined with a copper (II) sulphate pentahydrate solution (4% (w/v), Buffer B) at a 50:1

(v/v) ratio. Standards (100-1000 μg/ml) were prepared using serial dilutions of a stock solution containing 1 mg/mL fatty-acid free BSA.

2.3.2. Total and free cholesterol assay

Total cholesterol levels were measured using a commercial kit (Roche). Standards (26 –

776 μmol/L) were prepared using the calibrator for automated systems (CFAS, Roche) diluted appropriately in TBS.

2.3.3. Free cholesterol assay

Free cholesterol was measured using the method of Stahler et al. [179]. Buffer A (pH 7.7) contained 41.9 μM Na2HPO4, 20 mM phenol, 7.5% methanol (v/v) and Buffer B (pH 7.7) contained 360 μM Na2HPO4, 41.9 μM Na2HPO4.2H2O, 2 μM 4-aminoantipyrene, 0.4% polyoxyethylene-9-laurel-ether (v/v) and 7.5% methanol (v/v). The enzymatic reagent

36 CHAPTER 2

contained 12 U/mL cholesterol oxidase, 8 U/mL peroxidase and 10 mM Tris-HCl. The final assay reagent contained Buffer A, Buffer B and enzyme reagent at a ratio of 1:1:0.01

(v/v/v).

2.3.4. Triglyceride assay

Triglyceride concentrations were measured using a commercial kit (Roche). The

Standards (80.5 – 805 mmol/L) were prepared using the calibrator for automated systems (CFAS, Roche) diluted in TBS.

2.3.5. HDL-cholesterol extraction and quantification

EDTA-treated mouse plasma was mixed with a polyethylene glycol (PEG)-6000 solution

(200mg/ml, 1:1, v/v) in a plastic centrifuge tube as described [180]. The mixture was placed on ice for 20 min to allow the LDLs/VLDLs to precipitate. The mixture was then centrifuged at 21,400 xg for 20 min in a microfuge to pellet the precipitate. The supernatant, which contained HDLs and plasma proteins, was removed and the total cholesterol concentration was determined as described in Section 2.4.2.2.

2.4. Statistical analysis

All statistical analyses were performed using GraphPad Prism Version 6 for Mac OSX

(GraphPad Software, San Diego California USA, www.graphpad.com). Non-linear fit analysis was performed on all time-course data. Comparisons were made as appropriate by one-way ANOVA with Tukey’s post-test, two-way ANOVA with Bonferroni’s post-test, or a paired, two-tailed Student’s t-test. A value of P<0.05 was considered as significant.

All results are presented as mean ± SEM unless otherwise specified.

37 CHAPTER 2

2.5. Chemicals and reagents

20% homogeneous PhastGelTM GE Healthcare, 17-0624-01

4-Aminoantipyrine Sigma, A4382

Acetic acid Merck, 199061

Agarose BioRad, 161-3101

Ammonium bicarbonate Sigma, A6141

Apolipoprotein AI antibody goat anti-human Calbiochem, 178463.1

Bicinchoninic Acid Solution Sigma, B9643

Bovine Serum Albumin Sigma, A6003

Calcium chloride Merck 010070.0500

Chloroform Sigma, C8106

Cholesterol, unesterified Sigma, C8667

Choline Oxidase Sigma, C5896

Coomassie Brilliant Blue R-350 BioRad, 161-0400

Copper (II) sulphate pentahydrate Sigma, C2284

Dako Envision System Mouse kit Dako Cytomation, K4011

Diethyl Ether Crown 1725-2.5L

DNA hyperLadder Bioline, BIO-33039

ECL Plus Western blotting detection reagent GE Healthcare, RPN2132

EDTA-Na2 Merck 1.08418.1000

Ethanol Merck, 100983

Ficoll-Paque PLUS GE Healthcare, 17-1440-03

38 CHAPTER 2

Guanidine hydrochloride Sigma, G4505

HEPES Life Tech., 15630-080

Hexane Sigma, 296090

iBlot Transfer Stack Invitrogen, IB3010-01

iQ SYBR green supermix BioRad, 1708882

IScript DNA synthesis kit BioRad, 1708891

Isopropyl alcohol Sigma, I-9030

Liberase T-Flex Research Grade Roche, 5989132-001

Low molecular weight SDS marker GE Healthcare, 17-0446-01

Methanol Merck, 113351

New born calf serum (NBCS) Life Tech., 16010-142

NuPage Tris-Acetate 3-8% SDS gels Invitrogen, EA0375

NuPage Tris-Acetate SDS buffer Invitrogen, LA0041

Peroxidase Roche Diagnostics, 413-470

Phenol Sigma, P5566

Phenylmethanesulfonyl fluoride (PMSF) Sigma, P7626

PhireTM Animal Tissue Direct PCR kit ThermoFisher Scientific, F-140WH

Phospholipase D Sigma, P8023

Potassium Bromide Lomb, 438660500

Potassium phosphate monobasic Sigma, P5379

Protease Inhibitor Cocktail Sigma, P8340

QSepharose FF beads GE Healthcare 17-0510-01

Rat Insulin radioimmunoassay Merck Millipore RI-13K

39 CHAPTER 2

RNeasy MiniKit Qiagen, 7401

RPMI-1640 Life Tech., 11879020

SDS buffer strips GE Healthcare 17-0516-01

SeeBlue Plus2 Prestained Standard Invitrogen, NP0004

Sodium Azide Sigma, S2002

Sodium bicarbonate Sigma, S5761

SYBR Safe DNA gel Stain Invitrogen, S33102

Tris-Base Sigma, T1378

Triton X-100 Merck, 648462

Tween 20 Sigma, P2287

Urea AppliChem A1049,5000

CHAPTER 3

Generation and Preliminary Characterization of Mice with Conditional Pancreatic β-cell Deletion of ABCA1 and ABCG1

CHAPTER 3

3.1 Introduction

ABCA1 and ABCG1 play critically important roles in regulating intracellular cholesterol homeostasis by effluxing cellular cholesterol to apolipoprotein and HDLs [167, 181]. Both

ABCA1 and ABCG1 are expressed in a wide range of cell types, including pancreatic β- cells [155]. Loss-of-function mutations in, or deficiency of, ABCA1 or ABCG1 leads to intercellular cholesterol accumulation that has a detrimental effect on cell function. [19,

182].

Emerging evidence has shown that lipid accumulation in the pancreas causes β-cell dysfunction [183]. Pancreatic β-cell dysfunction has also been reported in mice with deficiency of ABCA1 specifically in β-cells, and in ABCG1 knockout mice. These animals have impaired glucose tolerance and defective β-cell insulin secretion, but normal insulin sensitivity and hypothalamic function [8, 23]. However, as mice with global deletion of

ABCG1 do not become glucose intolerant or insulin resistant, even when challenged with a high fat diet, these animals do not provide a direct insight into how the absence of

ABCG1 affects β-cell function [8]. This issue is addressed in the present chapter, by assessing the phenotypic and metabolic consequences of conditional pancreatic β-cell deletion of ABCA1 as well as ABCG1 on body weight, adiposity and metabolism.

The Cre/LoxP site-specific recombination system was used to generate mice in which

ABCA1 and ABCG1 are deleted only in pancreatic β-cells (ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice). The Cre/LoxP system involves the cyclization recombination enzyme (Cre), or Cre recombinase, and its short DNA recognition sequence, loxP. The site-specific Cre recombinase excises a gene sequence flanked by loxP sites. Use of this targeting system

42 CHAPTER 3

allows the lethality and metabolic perturbations that can be associated with global gene inactivation to be circumvented.

The B6. Cg-Tg(Ins2-cre)25Mgn/J mice were from The Jackson Laboratory, Bar Harbor,

ME, USA and are on a C57BL6 background. The Abca1fl/flAbcg1fl/fl mice, which are also on a C57BL6 background, were generated as described [21]. The Abca1fl/fl mice were generated as described by Timmins et al. [184] and backcrossed onto the C57BL6 background for 10 generations [21].

For the current study, Ins2-Cre mice expressing Cre recombinase under the control of the mouse insulin promoter gene and Abca1fl/flAbcg1fl/fl mice were used to generate

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice. Abca1fl/flAbcg1fl/fl mice have loxP sites flanking exons 45-46 of the Abca1 gene and loxP sites flanking exon 3 of the Abcg1 gene. Crossing

Ins2-Cre mice and Abca1fl/flAbcg1fl/fl mice leads to deletion and degradation of the

Abca1 and Abcg1 genes only in pancreatic β-cells in the offspring (Figure 3.1). It does not affect ABCA1 or ABCG1 expression in other tissues.

This chapter focuses on the initial characterization of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice by:

(i) confirming that the Cre-mediated recombination and deletion of ABCA1 and ABCG1 in pancreatic β-cells was successful and that it does not decrease ABCA1 and ABCG1 protein levels in other tissues and

(ii) determining how deletion of ABCA1 and ABCG1 specifically in pancreatic β-cells affects body weight, skeletal muscle mass and adiposity.

43 CHAPTER 3

lns2-Cre mouse Abcalfl/Abcglfl mouse

Abcal

lns2 Cre - X Abcgl I

Figure 3.1. Generation of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

When Ins2-Cre mice are crossed with Abca1fl/fl/Abcg1fl/fl mice, Cre recombinase excises the Abca1 and Abcg1 exons flanked by loxP sites, thus deleting the Abca1 and

Abcg1 genes specifically in pancreatic β-cells.

44 CHAPTER 3

3.2 Methods

3.2.1. Genotyping

Tail samples from 4 week old Ins2-Cre mice, ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/fl/Abcg1fl/fl mice were used for genotyping. PCR amplification of the Cre, Abca1 and Abcg1 genes was carried out using the respective primers as described in Section

2.1.3.

3.2.2. Western blotting of islets and tissue homogenates

Islets were isolated from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/fl/Abcg1fl/fl mice as described in Section 2.1.7., washed with ice-cold PBS and lysed in RIPA buffer (pH 7.4) containing 50 mM Tris base, 150 mM NaCl, 1% (v/v) NP-40,

1% (w/v) deoxycholate, 1mM EDTA-Na2, 0.1% (w/v) SDS, the phosphatase inhibitor

Na3VO4 (1:500) and protease inhibitors (1:100). The samples were sonicated and centrifuged to remove cellular debris.

Tissue samples were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/fl/Abcg1fl/fl mice as described in Section 2.1.6. The samples were homogenized in ice cold RIPA buffer (500 μL) using a FastPrep24 homogenizer (MP Biolmedicals, Santa

Ana, CA, USA). Protein concentrations were determined as described in Section 2.4.2.1.

For western blotting of ABCA1, cell lysates and tissue homogenates were not denatured in order to prevent protein aggregation. The samples (30 μg of protein) were run on 3-

8% Tris-Acetate gels in Tris-Acetate SDS running buffer using the Novex Bolt Gel

Electrophoresis System at 100V for 2 h at 4 °C. The HiMark pre-stained protein ladder

45 CHAPTER 3

(30-460 kDa, Life Technologies) was used for molecular weight estimations.

For western blotting of ABCG1, the samples (30 μg of protein) were solubilised in 25%

(v/v) reducing agent (500 mM dithiothreitol) and 10% (v/v) SDS sample buffer (Life

Technologies), then denatured at 95 °C for 5 min. The denatured samples were loaded onto 4-12% Bis-Tris gels (Life Technologies) and electrophoresed for 2 h using the Novex

Bolt Gel Electrophoresis System (Life Technologies). The SeeBlue pre-stained protein ladder (4-250 kDa, Life Technologies) was used for molecular weight estimations.

The electrophoresed proteins were transferred onto nitrocellulose membranes using the iBlot system (Invitrogen, Carlsbad, CA, USA). Following transfer, the membranes were incubated for 1 h at room temperature in a blocking solution (5% (w/v) skim milk in TBS-

Tween (TBS-T) buffer). The membranes were then washed with three times TBS-T, and probed overnight at 4 °C with the appropriate primary antibodies using the dilutions shown in Table 3.1. The membranes were next washed three times with TBS-T, and re- probed with appropriate horseradish peroxidise (HRP)-conjugated secondary antibodies

(Table 3.1). Protein levels were quantified using β-actin as a loading control. The blots were developed by enhanced chemiluminescence (Amersham ECL kit, GE Healthcare) and imaged using an ImageQuant LAS-4000 Mini biomolecular imager (GE Healthcare).

Band intensities were quantified using ImageJ.

46 CHAPTER 3

Table 3.1. Antibodies used for western blotting

Primary antibody Source Company Dilution

ABCA1 Rat Novus Biologicals, Littleton, CO, USA 1:500

ABCG1 Rabbit Novus Biologicals, Littleton, CO, USA 1:200

β-actin Mouse Abcam. Cambridge, UK 1:2000

Secondary antibody Source Company Dilution

Anti-rat IgG-HRP Cell Signaling, Danvers, MA, USA 1:2000

Anti-rabbit IgG-HRP Abcam. Cambridge, UK 1:2000

Anti-mouse IgG-HRP Abcam. Cambridge, UK 1:5000

47 CHAPTER 3

3.2.3. Food intake and body weight determinations

Weight-matched Abca1fl/fl/Abcg1fl/fl mice, ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Ins2-Cre mice were allocated to receive a standard chow diet. Food intake and body weight were measured twice a week from 6 to 16 weeks of age. Mice were transferred to a new cage and fresh food was added to the food hopper one day prior to food intake measurement as described in Section 2.1.4.

3.2.4. Magnetic resonance imaging (MRI)

MRI was performed on 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/fl/Abcg1fl/fl mice. In vivo imaging was performed using a Bruker Biospec 9.4

Tesla MR scanner (94/20 USR, Bruker GMBH, Ettlingen, Germany) in the high field animal

MRI facility at the Biological Resources Imaging Laboratory (BRIL, UNSW, Australia). A circular polarized whole-body radio frequency 50 mm volume quadrature coil was used for radiofrequency transmission and reception. For all in vivo MRI procedures, general anesthesia was induced with 4% (v/v) isoflurane in oxygen (1 L/min) and maintained with

2-2.5% (v/v) isoflurane through a nose cone. The animals were placed prone on the animal bed frame, the head was stabilized with a tooth-bar and the liver region centered within the scanner. Respiratory motion was monitored during the imaging using a pressure sensitive pad. The monitoring signal was used to trigger all imaging procedures to minimize image artifacts from abdominal motion. Animal body temperature was maintained at 37 °C by a temperature controlled circulating water warming blanket.

Abdominal images covering the whole abdominal region were acquired in axial slice orientation using an optimized 2D T1w Rapid Acquisition with Relaxation Enhancement

48 CHAPTER 3

(TurboRARE) sequence. To selectively highlight and identify fat localization, two identically positioned MRI volumes were acquired subsequently with and without fat pre-saturation but with otherwise identical imaging parameters. A fat suppression scheme using a Gaussian pulse with Fat suppression BW = 140 Hz and 2 ms was used for the fat saturated scan.

3.2.5. EchoMRI

The percentage of body fat was determined with an EchoMRI-900 Body Composition

Analyzer (EchoMRI LLC, Houston, TX, USA). Fat mass was calculated as a ratio of fat mass to total (lean + fat) mass and expressed as a percentage.

3.2.6. Lipid profile and Fast Protein Liquid Chromatography (FPLC)

Plasma samples were collected as described in Section 2.1.5 and loaded (200 µl) onto two Superdex 200 columns (GE Healthcare) connected in series and attached to an AKTA system (GE Healthcare). The Superdex 200 columns were pre-equilibrated with PBS prior to sample loading.

Lipoproteins were resolved at a flow rate of 0.25ml/min. Fractions were collected at 1 min intervals. The total cholesterol and triglyceride concentrations of each fraction were quantified on an AU480 Auto-Analyzer (Beckman Coulter) as described in Section 2.4.

3.2.6. Statistical analysis

All data were presented as mean±SEM. Results were analysed using a Student’s t-test

(unpaired, two-tailed) or two-way ANOVA. A value of P<0.05 was considered significant.

49 CHAPTER 3

3.3 Results

3.3.1. Generation of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were generated by crossing Abca1fl/flAbcg1fl/fl mice with Ins2-Cre mice (Figure 3.1). The Cre-recombinase positive F1 mice were then backcrossed with Abca1fl/flAbcg1fl/fl mice to generate ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (Figure 3.2). Abca1fl/flAbcg1fl/fl mice were used as littermate controls throughout the study. Ins2-Cre were also included as controls in selected experiments.

Genotyping of tail samples from 4 week old mice confirmed that the Ins2-Cre mice contained Cre (300 bp), wild-type (WT) Abca1 (628 bp) and WT Abcg1 (644 bp) alleles, whereas the Abca1fl/flAbcg1fl/fl mice contained floxed Abca1 (1.8 kb) and floxed Abcg1

(790 bp) alleles (Figure 3.3). The presence of Cre, floxed Abca1 and floxed Abcg1 alleles confirmed the genotype of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (Figure 3.3).

50 CHAPTER 3

lns2-Cre mouse Abcalfl/flAbcglfl /fl mouse

FO ere•!? Abcai+I+ Abcg1•J+ X Cre-1-Abca1 fl/fl A beg 1 fl/f1

Cre•I-Abcal +/fl Abcgl +111 Fl Cre?f-Abca1 •Jfl Abcgi+ffl

Cre-1-Abca1 fl/ fl A beg 1 fl/ fl

Cre-1-Abca 1 +ff1Abcg1 +/fl

F2 Cre-1-Abca 1 flff1Abcg1 fl/f1

Cre•I-Abca 1 +ff1Abcg1 +/fl

Cre•I-Abca 1 flf11Abcg1 fl/fl

ABCA1P-cell-/·/ABCG1P-cell-/· DKO

Figure 3.2. Breeding strategy for the generation of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

51 CHAPTER 3

..___.. ~ Cre allele (300 bp)

~ Floxed Abca1 allele (1.8 kb)

~ WT Abca1 allele (628 bp)

~ Floxed Abcg1 allele (790 bp) ~ WT Abcg1 allele(644 bp)

Figure 3.3. Genotyping of Ins2-Cre, Abca1fl/fl/Abcg1fl/fl and ABCA1β-cell-/-/ABCG1β-cell-

/- DKO mice.

Tail samples from 4 week old Ins2-Cre (Cre), Abca1fl/flAbcg1fl/fl (fl/fl) and ABCA1β-cell-/-

/ABCG1β-cell-/- DKO (β-DKO) mice were genotyped by PCR, using primers for Cre, Abca1 and Abcg1 alleles. PCR products were separated by agarose gel electrophoresis. The floxed Abca1 and Abcg1 alleles are larger than the WT alleles due to the presence of loxP sites. A representative gel is shown.

52 CHAPTER 3

3.3.2. ABCA1 and ABCG1 protein expression in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

ABCA1 and ABCG1 protein expression in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice was reduced by 82.0 ± 5.1% and 84.4 ± 1.2%, respectively, compared to

Abca1fl/fl/Abcg1fl/fl mice (P<0.05) (Figure 3.4.). The residual ABCA1 and ABCG1 protein expression in islets from these mice is due to the presence of ABCA1 and ABCG1 in cells other than β-cells.

53 CHAPTER 3

-DKO fl/fl ABCA1

ABCG1 I ~-actin 1-- Islets

c :=;- 50 - ABCAl o- D ABCGl ·-Ill "'-- Illa, "'-- a~ 25 >< C W I ~ca. 0 - 0 Islets

Figure 3.4. ABCA1 and ABCG1 protein levels in pancreatic islets from ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice.

Islets were isolated from ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice and

Abca1fl/fl/Abcg1fl/fl (fl/fl) mice as described in Section 2.1.7, subjected to SDS-PAGE, immunoblotted for ABCA1 and ABCG1 and normalized to β-actin.

54 CHAPTER 3

3.3.3. ABCA1 and ABCG1 protein levels in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse tissues.

Western blotting on all other major tissues was performed to confirm the specificity of the ABCA1 and ABCG1 knockdown in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice as described in

Section 3.2.2. The results indicate that the levels of ABCA1 and ABCG1 in all tissues other than islets is comparable in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/fl/Abcg1fl/fl mice (Figure 3.5.)

55 CHAPTER 3

KO fl/fl fl/fl ABCA1 i:;.!-OKO

ABCG1 ..., 1 1 ~-actin

Brain Kidney Adipose Liver Intestine

• ABCA1 0 ABCG1 o--C: ·- c;: ~ e 100 QI 0 ~~ ~c so W'(!l.

~-0 0 Brain Kidney Adipose Liver Intestine

Figure 3.5. Western blot analysis of ABCA1 and ABCG1 levels in tissue homogenates from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice.

Tissues were collected from ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice and

Abca1fl/fl/Abcg1fl/fl (fl/fl) mice and western blotted for ABCA1 and ABCG1. Blots of brain, kidney, adipose, liver and intestine are shown. All data were normalized to β-actin.

56 CHAPTER 3

3.3.3. Conditional deletion of ABCA1 and ABCG1 in pancreatic β-cells does not affect body weight, but increases adiposity and deceases muscle mass in chow fed mice.

The food intake and body weight of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice,

Abca1fl/fl/Abcg1fl/fl mice and Ins2-Cre mice were monitored on a weekly basis from 6-

16 weeks of age. The body weights of the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice,

Abca1fl/fl/Abcg1fl/fl mice and Ins2-Cre mice were comparable when the animal were maintained on a standard chow diet. There was also no difference in food intake between the mouse strains (Figure 3.6).

The ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice developed extensive adiposity by 16 weeks of age (Figure 3.7). Abdominal and subcutaneous fat was increased in the ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice compared to Abca1fl/fl/Abcg1fl/fl mice (Figure 3.7.A. and B.).

EchoMRI scans showed that the 16 week ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice had

16.2±1.3% body fat compared to 10.5±0.9% for Abca1fl/flAbcg1fl/fl mice (Figure 3.8.A,

P<0.001). The increased percentage body fat in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice was due to adipocyte hypertrophy. The average adipocyte area in the ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice was 4445.7±514.3 µm2, compared to 3386±439.7 µm2 for the

Abca1fl/flAbcg1fl/fl mice (Figure 3.8.B, P<0.001). As the body weights of the ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice were comparable (Figure 3.6.), this suggested that the adipose tissue expansion may have been at the expense of a reduction in skeletal muscle mass.

This was confirmed by establishing that hind limb gastrocnemius muscle mass was decreased to 87.0±11.4 mg in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to

57 CHAPTER 3

123.8±17.6 mg in the Abca1fl/flAbcg1fl/fl mice (Figure 3.9.A and B, P<0.005).

Resolution of plasma lipoproteins by gel permeation chromatography showed no difference in the total cholesterol distribution of LDLs and HDLs in the ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice, Abca1fl/flAbcg1fl/fl mice and Ins2-Cre mice (Figure 3.10). TG levels were also measured in all the animals, but were below the level of detection (not shown).

58 CHAPTER 3

35 • fl/fl _ + lns2Cre 30 S O ~-DKO "E,25- ·o:; 3: 20

6 8 10 12 14 16 Week

0.20

~- 0.15 >- sc: ns ~ 0.10 o -t oS LL 0.05

0.00 fl/fl lns2Cre J3-DKO

Figure 3.6. Pancreatic β-cell-specific ABCA1 and ABCG1 deficiency does not influence body weight in chow-fed mice.

The bodyweight and food intake of ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice was comparable to that of Abca1fl/fl/Abcg1fl/fl (fl/fl) mice and Ins2-Cre mice (n=6/group).

59 CHAPTER 3

;. ll. I A , ~-

~.... · . ~ ' ,.\\ , . .._, .·~ . ~ ,t"~:i ~- ....,. . ~:' ' ' I •

fl/fl ~-DKO

Figure 3.7. Pancreatic β-cell-specific ABCA1 and ABCG1 deficiency increases adiposity.

(A) Images of visceral fat in 16 week old Abca1fl/fl/Abcg1fl/fl (fl/fl) mice and ABCA1β-cell-

/-/ABCG1β-cell-/- DKO (β-DKO) mice. (B) MRI images show increased visceral (red arrow) and subcutaneous (yellow arrow) adipose tissue and decreased hind limb muscle (blue arrow) size in 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice relative to

Abca1fl/fl/Abcg1fl/fl mice.

60 CHAPTER 3

A 020 • fl/fl o ~-DKO ~ **** ..., 15 u.C'CS >,.10 'tJ 0 5 aJ o,------6 12 16 Week

B 6,000 ...,NCl) - **** >. E CJ :::i. 4,000 o- Q. C'CS ·-'tJ a,I,. 2 , 000 <( C'CS fl/fl J3-DKO

Figure 3.8. Adipose tissue mass is increased in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

(A) Body fat percentage by EchoMRI in 6, 12 and 16 week old Abca1fl/fl/Abcg1fl/fl (fl/fl) mice and ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice. (n=6/group). (B) Quantification of adipocyte size in 16 week old fl/fl mice and β-DKO mice (n=8/group, 10 sections/animal).

**P<0.05, ****P<0.001. Values represent mean±SD.

61 CHAPTER 3

A ~-DKO

fl/fl

B -150 C) S100.., *** .c: .2> 50 Q) 3:: 0 J3-DKO

Figure 3.9. Skeletal muscle mass is decreased in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

(A) Images of skeletal muscle in dissected hind limb of 16 week old ABCA1β-cell-/-/ABCG1β- cell-/- DKO (β-DKO) mice and Abca1fl/flAbcg1fl/fl (fl/fl) mice. (B) Weight of isolated gastrocnemius muscle in 16 week old fl/fl mice and β-DKO mice. n=8/group, ***P<0.005.

Values represent mean±SD.

62 CHAPTER 3

0 ~-DKO 120 HDL D fl/fl

..J 6 Cre -:::::r 0 E -::::s 80 Bt 0... C1) 0 ~ ~ -"'C1) 0 0 LDL ~ .c 40 @ 0 co ~ ;§

0 0 20 40 60 80 100 120 140

Fraction No.

Figure 3.10. Lipoprotein cholesterol distribution in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice,

Abca1fl/fl/Abcg1fl/fl mice and Ins2-Cre mice.

Mouse blood was collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice, Abca1fl/fl/Abcg1fl/fl (fl/fl) mice and Ins2-Cre (Cre) mice as described in Section

2.1.5. Plasma was isolated by centrifugation, pooled and subjected to gel permeation chromatography as described in Section 3.2.6. (n=5 mice per pool).

63 CHAPTER 3

3.4 Discussion

To understand the combined roles of ABCA1 and ABCG1 in pancreatic β-cells, mice with

β-cell-targeted deletion of ABCA1 and ABCG1 (ABCA1β-cell-/-/ABCG1β-cell-/- DKO) were generated by crossing loxP-flanked Abca1 and Abcg1(Abca1fl/fl/Abcg1fl/fl) mice [185] with mice expressing Cre under the control of the β-cell-specific mouse insulin promoter

[186].

ABCA1 and ABCG1 protein expression in isolated islets from the ABCA1β-cell-/-/ABCG1β-cell-

/- DKO mice was markedly reduced compared to Abca1fl/fl/Abcg1fl/fl mice. ABCA1 and

ABCG1 protein levels were, by contrast, not decreased in other tissues, indicating that the Abca1 and Abcg1 genes had been selectively deleted from β-cells. ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice had normal body weight and food intake, but visceral and subcutaneous fat deposition was increased and skeletal muscle mass was decreased relative to Abca1fl/flAbcg1fl/fl mice.

These results differ from what has been reported previously for mice with β-cell-specific deletion of ABCA1 only or in ABCG1 knockout mice with β-cell-specific deletion of ABCA1

[8, 22], neither of which had differences in body composition relative to control mice. β- cell-specific deletion of ABCA1 alone is associated with a compensatory increase in islet

ABCG1 expression [8]. As cholesterol accumulation has been reported in islets of mice with β-cell-specific deletion of ABCA1 only [8], the compensatory increase in ABCG1 expression is likely not sufficient for maintaining intercellular cholesterol homeostasis in the absence of ABCA1. Increased islet cholesterol levels have also been reported in

ABCG1 knockout mice with β-cell-specific deletion of ABCA1. There is, by contrast, no evidence of cholesterol accumulation in islets of ABCG1 knockout mice [23]. This

64 CHAPTER 3

suggests that the absence of ABCG1 alone is not sufficient to cause cholesterol accumulation in islets, and that ABCA1 plays a more important role than ABCG1 in maintaining intercellular cholesterol homeostasis.

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have increased visceral and subcutaneous fat deposition. However, because they also have decreased skeletal muscle mass, there is no significant change in overall body weight. These changes in adopise tissue and skeletal muscle mass have now been attributed to a switch in glucose disposal from skeletal muscle to adipose tissue as evidenced by reduced glucose uptake in skeletal muscles and increased glucose uptake and fatty acid synthase activity in adipose tissue

[187]. The underlying mechanism for the change in body composition in these ABCA1β- cell-/-/ABCG1β-cell-/- DKO mice is not clear and present, but is the subject of current investigations.

Ins2-Cre mice were used as controls in all of the preliminary studies. However, as there was no difference between the Ins2-Cre mice and Abca1fl/flAbcg1fl/fl mice in terms of body weight, food intake, fed or fasting blood glucose levels, glucose tolerance and fasting insulin levels (see Chapter 5), the experiments in Chapter 4 and Chapter 6 were performed using only Abca1fl/flAbcg1fl/fl mice as controls.

CHAPTER 4

Effect of ApoA-I Treatment on Islet Cholesterol Homeostasis in ABCA1β-cell-/-/ABCG1β-cell-/- DKO Mice

CHAPTER 4

4.1 Introduction

Dyslipidemia, a common complication in T2DM, includes increased plasma triglyceride levels, increased synthesis of very low density lipoproteins (VLDLs), reduced circulating

HDL-cholesterol levels and elevated LDL-cholesterol levels [188, 189]. High plasma LDL- cholesterol levels are also associated with cholesterol accumulation in β-cells, and decreased β-cell insulin secretion in mice [10, 190].

Recent studies have established that the cholesterol transporters ABCA1 and ABCG1, play critically important roles in the maintenance of β-cell cholesterol homeostasis and insulin secretion [8, 22]. Islets from mice with conditional deletion of ABCA1 in β-cells have significantly increased cholesterol levels [8]. Moreover, acute depletion of intracellular cholesterol from β-cells that do not express ABCA1 rescues β-cell function by improving insulin granule exocytosis and insulin secretion [169]. Mice with global deletion of ABCA1 have normal islet cholesterol levels and reduced plasma total cholesterol and HDL-cholesterol levels.

ABCG1 knockout mice, by contrast, have dramatically increased tissue cholesterol levels

[15], but normal islet cholesterol and plasma total cholesterol and HDL-cholesterol levels [23]. There are no reports of mice in which ABCG1 is conditionally deleted in β- cells.

The expression of ABCA1 and ABCG1 are linked. For example, islet ABCG1 protein expression is upregulated in mice in with conditional deletion of Abca1 in β-cells [8]. This indicates that ABCG1 may provide a compensatory pathway whereby the excess cholesterol that accumulates in islets that do not express ABCA1 is exported to the

67 CHAPTER 4

extracellular space [8]. This is consistent with the report of Kruit et al., which indicated that cholesterol levels in islets lacking both ABCA1 and ABCG1 are significantly higher than islet cholesterol levels in ABCG1 knockout mouse islets, or in islets from mice with conditional β-cell deletion of ABCA1 [22].

Incubation with HDLs, lipid-free apoA-I or lipid-free apoA-II increases insulin secretion and synthesis in β-cells in vitro [173, 174], while infusions of reconstituted HDL (rHDL) preparations consisting of apoA-I complexed with soy bean phosphatidylcholine improve b-cell function in people with T2DM [172]. rHDL infusions also increase plasma insulin levels and decrease plasma glucose levels [172]. However, the underlying mechanisms responsible for these beneficial effects of HDLs and apoA-I, and whether they directly improve β-cell function, remains unknown.

The aims of this chapter are to determine whether:

(i) ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have normal plasma lipid levels.

(ii) ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have elevated islet cholesterol levels.

(iii) treatment with apoA-I affects plasma lipid levels and islet cholesterol levels in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

68 CHAPTER 4

4.2 Methods

4.2.1. ApoA-I treatment and plasma lipid levels

Mice were injected intraperitoneally with either apoA-I (8 mg/kg) or an equal volume of

PBS twice weekly from 12 - 16 weeks of age. At 24 hours after last injection, the mice were euthanased (Figure 4.1) and islets were isolated as described in Section 2.1.7.

Blood was collected from the euthanased mice as described in Section 2.1.5. Plasma total cholesterol, free cholesterol, triglyceride and HDL-cholesterol levels were determined by enzymatic assays as described in Section 2.4.2.

69 CHAPTER 4

Age 12 13 14 15 Weeks ....i-i____,i,---i-..-i ---i -i-i-- 24-h7-

______1 Euthanased f Injection of

Group 1 (13-DKO): apoA-1 (8 mg/kg) Group 2 (13-DKO): PBS Group 3 (fl/fl): apoA-1 (8 mg/kg) Group 4 (fl/fl): PBS

Figure 4.1. Experimental details of apoA-I treatment of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (β-DKO) mice and Abca1fl/flAbcg1fl/fl (fl/fl) mice.

70 CHAPTER 4

4.2.2. Determination of islet cholesterol levels

Islets were isolated by collagenase digestion of the pancreas in KRBH buffer as described in Section 2.1.7. Islets were hand-picked and isolated by centrifugation at 380 xg for 2 min at 4 °C in a microfuge (Beckman Coulter). The isolated islets were lysed with water

(100 µl), and homogenized by passing through a 1ml syringe with a 29-gauge needle.

Protein concentrations were determined by BCA assay as described in Section 2.4.2.

Equivalent amounts of protein (60 µg) were extracted with cold methanol (2.5 ml) and hexane (10 ml), and vortexed vigorously for 30 sec. The samples were centrifuged at 680 xg for 4 min at 4 °C using an Allegra X-15R centrifuge (Beckman Coulter). The hexane layer (8 ml) was removed, evaporated in a SpeedVac Concentrator (Thermo Fisher), then re-dissolved in high performance liquid chromatography (HPLC) eluent (130 µl acetonitrile/isopropanol, 30/70, v/v).

The resulting samples (100 µl) were injected onto an Ascentis® C18 HPLC Column (Sigma-

Aldrich) attached to an Agilent 1200 HPLC system (Agilent Technologies, Santa Clara, CA,

USA). The HPLC column was pre-equilibrated with acetonitrile/isopropanol (30/70 (v/v) prior to sample loading. The samples were eluted with acetonitrile/isopropanol (30/70

(v/v), 1 ml/min, 22 min/sample, 4 °C) and the absorbance at 204 nm was measured as described. [191]. The results were analysed with Chemstation software (Agilent

Technologies).

4.2.3. Statistical analyses

All data are presented as mean±SEM. Results were analysed using a Student’s t-test

(unpaired, two-tailed) or two-way ANOVA. A value of P<0.05 was considered significant.

71 CHAPTER 4

4.3 Results

4.3.1. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice have comparable plasma lipid levels.

Figure 4.1 shows the plasma lipid levels in 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice. Total cholesterol, triglyceride and HDL-cholesterol levels were not significantly different between ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/flAbcg1fl/fl mice. Although plasma free cholesterol levels tended to be higher in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to Abca1fl/flAbcg1fl/fl mice, the difference did not reach statistical significance.

72 CHAPTER 4

fl/fl D P-DKO ::J' ::J' 1. :::, :::, - 0 0 E E E .s ::::- 1 . 0...... 0 $ QI II> II> QI -QI 0 0 0. .c .c (.) u iii QI ...QI ~ LL. o.

::J' 1. :::, ~ 0 0 1. E E .s- 1 . .s ...0 QI QI "t:I 1. ·;:: II> -QI QI (.) 0 0. 0. .c -a; ~ ·;:: ...I I- 0 0. J: 0.

Figure 4.2. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/fl/Abcg1fl mice have comparable plasma lipid levels.

Plasma total cholesterol, free cholesterol, triglyceride and HDL-cholesterol levels in 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice and Abca1fl/fl/Abcg1fl (fl/fl) mice

(n=10/group) were quantified as described in Section 2.4.2.

73 CHAPTER 4

4.3.2. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have increased islet cholesterol levels

As ABCA1 and ABCG1 expression is a prerequisite for cholesterol efflux, the effect of β- cell-specific deletion of ABCA1 and ABCG1 on pancreatic β-cell cholesterol content was evaluated. As shown in Figure 4.2, islet total cholesterol levels in the ABCA1β-cell-/-

/ABCG1β-cell-/-DKO mice were increased relative to Abca1fl/fl/Abcg1fl/fl mice (19.2±1.9 vs 8.72±1.04 μg cholesterol/μg protein, P<0.05).

74 CHAPTER 4

30 * 0 '- ..,Q) .-.C • u, ·- Q) Q) 20 -0 ... 0 ..c ~ Ii (.) C. ca c, • ...0 ._::::L ... C, 10 • ... ::::L .Sil - ·l· .!!J. 0 fl/fl P-DKO

Figure 4.3. Islet total cholesterol levels in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were increased relative to Abca1fl/fl/Abcg1fl/fl mice.

Pancreatic islets were isolated from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice and Abca1fl/fl/Abcg1fl/fl (fl/fl) mice. The islet total cholesterol levels were quantified by HPLC. Data represent mean±SEM. n=4/group, *P<0.05.

75 CHAPTER 4

4.3.3. ApoA-I treatment does not affect plasma and islet cholesterol levels in ABCA1β- cell-/-/ABCG1β-cell-/- DKO mice.

Figures 4.3 and 4.4 show that plasma total cholesterol, free cholesterol and triglyceride levels were comparable in Abca1fl/fl/Abcg1fl/fl mice and ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice irrespective of whether they were, or were not, treated with apoA-I. Although apoA-I treatment tended to lower HDL-cholesterol levels in ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice, the difference did not reach statistical significance.

Islet cholesterol levels in apoA-I-treated Abca1fl/fl/Abcg1fl/fl mice were slightly decreased in islet from PBS-treated Abca1fl/fl/Abcg1fl/fl mice (11.97±1.98 μg vs

10.07±1.69 μg cholesterol/μg protein) (Figure 4.5) but the difference was not statistically significant.

Islet cholesterol levels in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice that were treated with apoA-I were modestly decreased relative to islet cholesterol levels in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice treated with PBS (20.53±1.44 μg vs 25.52±5.19 μg cholesterol/μg protein) but this did not reach statistical significance (Figure 4.6).

76 CHAPTER 4

- fl/fl PBS ~ 1. ~ fl/fl ApoA-1 0 E E ::::- 1. ...0 (I) VI -(I) :g 0. (.) (I) ...(I) u.. 0.

~ 1. 0 ~ E 1. e .§_ 1.0 .§. 0... ~ 1. 2 ·;: VI (I) .9! u o 0. ~ 0. .c ~ ~ C :I: 0.

Figure 4.4. ApoA-I treatment does not affect plasma lipid levels in

Abca1fl/fl/Abcg1fl/fl mice.

Abca1fl/fl/Abcg1fl/fl (fl/fl) mice (n=10/group) were treated with apoA-I or PBS as described in Section 4.2.1. Plasma total cholesterol, free cholesterol, triglyceride and

HDL-cholesterol levels were determined as described in Section 2.4.2. Data represent mean±SEM.

77 CHAPTER 4

CJ 13-DKO PBS ::r 2.0 m 13-DKO ApoA-1 ::r:::, :::, 0 0 E E .s 3 .s 1. 0... 0... GI GI VJ VJ ..9!- -GI 0 0 .c .c u 1 (..) 0. iii GI 0 ...GI I- 0 LI. 0.0

2. -1.s ~ 0 0 1. E E .S 1.0 .s 0... -8 1. GI ·;;: VJ -GI GI u 0 0. .c ~ 0. ~ ·;;: ...I I- C 0. J: 0.0

Figure 4.5. ApoA-I treatment does not affect plasma lipid levels in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice.

ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice (n=10/group) were treated with apoA-I or

PBS as described in Section 4.2.1. Plasma total cholesterol, free cholesterol, triglyceride and HDL-cholesterol levels were determined as described in Section 2.4.2. Data represent mean±SEM.

78 CHAPTER 4

e PBS 15 0 ApoA-1 I.. S u, .5 • Q) Q) -~0 0 .c: I.. CJ a.. -s :,C> .Sm C: •• -9:!-~ J!l. <>

fl/fl

Figure 4.6. ApoA-I treatment does not affect islet total cholesterol levels in

Abca1fl/fl/Abcg1fl/fl mice.

Pancreatic islets were isolated from 16 week old Abca1fl/fl/Abcg1fl/fl (fl/fl) mice following 4 weeks of treatment with apoA-I or PBS treatment (n=5/group) as described in Section 4.2.1. Islet total cholesterol levels were quantified by HPLC. Data represent mean±SEM.

79 CHAPTER 4

• PBS ApoA-1 0... • • -a, -s:: "'a, ·-a, -.s::0 -... 0 0 a. -m en ·I· -m0 :::1. ~-- :::1. •• JI),

J3- DKO

Figure 4.7. ApoA-I treatment does not affect islet total cholesterol levels in ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mice.

Pancreatic islets were isolated from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (β-DKO) mice following 4 weeks of treatment with apoA-I or PBS treatment (n=5/group) as described in Section 4.2.1. Islet total cholesterol levels were quantified by HPLC. Data represent mean±SEM.

80 CHAPTER 4

4.4 Discussion

The results in this chapter show that conditional β-cell deletion of ABCA1 and ABCG1 does not affect plasma total cholesterol and HDL-cholesterol levels in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice. Islet cholesterol levels, by contrast, were significantly increased in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice. These results indicate that the ABCA1 and ABCG1 in pancreatic β-cells does not contribute significantly to the regulation of plasma lipids levels.

The increased cholesterol levels in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets further indicates the other transporters such as ABCA12 and ABCB1 that are also expressed in β-cells, do not play a significant role in islet cholesterol homeostasis, and that cholesterol export from the β-cells in these animals is minimal.

The absence of ABCA1 in β-cells causes cholesterol accumulation at the plasma membrane, which impairs insulin granule exocytosis in vivo [169]. It is not known if loss of ABCG1 also results in defective exocytosis. ABCG1 does, however, play an important role in the regulation of the subcellular cholesterol distribution and maintenance of membrane cholesterol content in insulin secretory granules [23], which raises the possibility that the absence of ABCG1 may also inhibit insulin granule exocytosis in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

The fact that apoA-I treatment did not affect plasma lipid levels in ABCA1β-cell-/-/ABCG1β- cell-/- DKO mice could be a reflection of the low 8 mg/kg dose of apoA-I. It is also possible that the intraperitoneally injected apoA-I may have formed a depot that was slowly released into the circulation. This is distinct from the rapid spike in plasma apoA-I levels

81 CHAPTER 4

and the equally rapid clearance that occurs following an intravenous injection. It is also possible that the absence of change In plasma lipid levels in the apoA-I-treated mice may have been a consequence of the intraperitoneally injected lipid-free apoA-I being cleared as soon as it entered the circulation, rather than become incorporated into new

HDL particles, and thus increased HDL cholesterol levels.

The findings of the present study are nevertheless consistent with a previous in vitro study which showed no significant effect of incubation in the presence of apoA-I on cholesterol levels in Min6 cells under basal or under high-glucose condition [173].

In conclusion, the results in this chapter establish that ABCA1 and ABCG1 are essential for the maintenance of normal cholesterol homeostasis in β-cells. The absence of ABCA1 and ABCG1 in β-cells does not, however, affect plasma lipid levels. The results also indicate that there is little functional redundancy in the ABC transporter family, at least in β-cells, with expression of other transporters in the cells being unable to compensate for the loss of ABCA1 and ABCG1 and restore islet cholesterol levels to normal.

CHAPTER 5

Effect of ApoA-I Treatment on Islet Glucose Homeostasis in ABCA1β-cell-/-/ABCG1β-cell-/- DKO Mice

CHAPTER 5

5.1 Introduction

β-cell dysfunction can result in decreased insulin secretion, and lead to impaired glucose tolerance, hyperglycemia and hyperproinsulinemia. These effects, along with insulin resistance, are the hallmark features of T2DM [7, 192]. Recent evidence has established that elevated plasma and islet cholesterol levels contribute to β-cell dysfunction and impaired insulin secretion [10]. The cholesterol transporters, ABCA1 and ABCG1, also play critical roles in the maintenance of islet cholesterol homeostasis and insulin secretion in mice [23, 193]. In humans, loss-of-function mutations in the ABCA1 gene are associated with Tangier disease, which is characterized by hypercholesterolemia and an almost total absence of plasma HDL and apoA-I [151]. Subjects with loss-of-function mutations in the ABCA1 gene are also at increased risk of developing T2DM [194, 195].

ABCA1 knockout mice and ABCG1 knockout mice have normal fasting blood glucose levels and insulin sensitivity, but impaired glucose tolerance [8, 23]. Glucose-stimulated insulin secretion is also decreased in these animals [8, 23]. Interestingly, impaired glucose tolerance is more severe in mice with conditional deletion of ABCA1 in b-cells than in ABCA1 knockout mice.

Kruit et al. have further reported that ABCG1 knockout mice with conditional deletion of

ABCA1 in b-cells have increased fasting blood glucose levels, elevated islet cholesterol levels, impaired glucose tolerance and decreased glucose stimulated insulin secretion compared to mice with wild-type mice [22].

As described in Chapter 4, the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice that were developed for this project resemble ABCA1 knockout mice and ABCG1 knockout mice with

84 CHAPTER 5

conditional deletion of ABCA1 in b-cells in that they have increased islet cholesterol levels and normal plasma lipid levels. However, the effect of conditional b-cell deletion of ABCA1 as well as ABCG1 on glucose tolerance and insulin secretion is unknown.

As HDLs and apoA-I can increase insulin synthesis and increase insulin secretion without affecting b-cell cholesterol levels [173, 174], the question as to whether apoA-I treatment can improve glucose tolerance and insulin secretion in mice lacking ABCA1 and ABCG1 only in b-cells is also addressed.

The aims of this chapter are to determine whether ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice in which ABCA1 and ABCG1 are conditionally deleted in pancreatic β-cells have:

(i) impaired glucose tolerance,

(ii) impaired insulin secretion and

(iii) reduced glucose-stimulated insulin secretion (GSIS).

The ability of treatment with apoA-I to correct these defects is also addressed.

85 CHAPTER 5

5.2 Methods

5.2.1. Determination of plasma insulin levels

Sixteen week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice were fasted for 5 h and blood was obtained via tail clipping. Blood samples were drawn into heparinized microhematocrit capillary tubes (Themo Fisher Scientific), transferred to 1.5 mL tubes and placed immediately on ice. The tubes were centrifuged (9500 xg, 10 min,

4 °C) and plasma was collected and stored at -80 °C. Plasma insulin levels were determined with a mouse insulin ELISA kit (EZRMI-13K, Merk Millipore) according to the manufacturer’s instructions.

5.2.2. Intraperitoneal glucose and insulin tolerance tests

Intraperitoneal glucose tolerance tests (IPGTT) were performed in 16 week old ABCA1β- cell-/-/ABCG1β-cell-/- DKO mice, Abca1fl/flAbcg1fl/fl mice and Ins2-Cre mice. The mice were fasted for 5 h and a small blood sample was obtained via a tail clip for measurement of basal glucose levels (T=0 min). Glucose (2 g/kg, Sigma Aldrich) was prepared in ice cold saline and injected intraperitoneally into the mice. Blood samples were collected by reopening the tail wound at 15, 30, 45, 60, 90 and 120 min post-injection. Glucose levels were measured using a human ACCU-CHEK blood glucose monitor and test strips (Roche)

[196].

Intraperitoneal insulin tolerance tests (IPITT) were performed in 16 week old ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mice, Abca1fl/flAbcg1fl/fl mice and Ins2-Cre mice. The mice were fasted for 5 h and a small blood sample was obtained via a tail clip for measurement of basal glucose levels (T=0 min). Insulin (1 U/kg, Sigma Aldrich) was prepared in ice cold

86 CHAPTER 5

saline and injected intraperitoneally into the mice. Blood samples were collected by reopening the tail wound at 5, 10, 15, 30, 45 and 60 min post-injection. Blood glucose levels were measured using a human ACCU-CHEK blood monitor and test strips. The area under the curve (AUC) was calculated using the trapezoid rule in GraphPad Prism Version

6.0 (GraphPad Software, SanDiego, CA, USA).

5.2.3. Islet morphology and b-cell mass measurement

Extracted pancreata were removed, cleared of fat and lymph nodes, fixed overnight in

4% (v/v) cold paraformaldehyde, placed in 70% (v/v) ethanol and then embedded in paraffin wax. Sections (5 µM) were cut, mounted on glass slides and incubated overnight at 37 °C. The sections were dewaxed using xylene (2x 10 min at room temperature), rehydrated with decreasing concentrations of ethanol (2x 2 min 100% ethanol, 2x 2 min

95% ethanol, 1x 2 min 70% ethanol) then placed in water. The slides were placed in antigen retrieval buffer (10x Target Retrieval Buffer, pH 9.0, diluted 1:10 (v/v), Dako,

Glostrup, Denmark), incubated at 97 °C for 15 min, cooled to room temperature then placed in Tris buffered saline with Tween (TBST; 10 mM Tris, 150 mM NaCl, 0.05% (v/v)

Tween-20 (pH 7.4)). Endogenous peroxidase activity was inhibited by addition of peroxidase block (Envision Rabbit kit, Dako) and incubation for 20 min at room temperature. The sections were then rinsed with TBST (2 x 5 min) and incubated for 20 min at room temperature in 1% (v/v) BSA in TBST. A mouse anti-insulin antibody

(dilution 1:500) in 0.1% (v/v) BSA in TBST (Abcam, Cambridge, UK) was then added and the sections were incubated overnight at 4 °C. The slides were rinsed twice with TBST (2 x 5 min), incubated with a HRP-conjugated secondary antibody (Envision Rabbit Kit,

Dako) for 60 min at room temperature, rinsed with TBST (2 x 5 min) and visualized by

87 CHAPTER 5

incubation for 1-5 min with a 3,3-diaminobenzidine solution (Envision Mouse Kit, Dako).

The slides were then counterstained with haematoxylin and imaged using an upright light microscope (Olympus). Staining was quantified using Image-Pro Plus 6.0. b-cell mass was measured as described previously [197]. Briefly, sections were stained for insulin (Abcam) and the ratio of cross-sectional-cell area to total pancreatic area, was obtained using Adobe Photoshop (Adobe) and Image J (NIH). b-cell mass was determined by multiplying the cross-sectional-cell area to total pancreatic area ratio by the wet weight of the pancreas.

5.2.4. GSIS assay

Isolated islets were cultured overnight in media (20 mM L-glutamine, 100 U/ml Penicillin,

100 μg/ml Streptomycin and 10% (v/v) FBS in RPMI 1640 medium). The islets were then placed in 96-well plates (5 islets per well, 8 replicates) and pre-incubated for 30 min at

37 °C with KRBH containing 2.8 mmol/L glucose and 0.25% (w/v) BSA. After discarding the pre-incubation buffer, the islets were incubated at 37 °C for 1 h with either KRBH containing 2.8 mmol/L or 25 mmol/L glucose. The supernatants were collected and stored at -20 °C until use. The remaining islets were lysed in radioimmunoprecipitation assay (RIPA) buffer and kept at -20 °C for later measurement of the total insulin content.

5.2.5. Insulin radioimmunological assay (RIA)

Insulin levels in the cell culture media were assayed using an insulin RIA kit (Merck

Millipore, Billerica, MA, USA) according to the manufacturer’s instructions. Briefly, serial dilutions of insulin standards (0.1, 0.2, 0.5, 1, 2, 5, and 10 ng/ml) were prepared by diluting an insulin standard stock solution (10 ng/ml, provided in kit) with the assay

88 CHAPTER 5

buffer (provided in kit). Total counts, non-specific binding (NSB), reference (Bo), standards, quality control (QC) and sample tubes were prepared in duplicate with the assay buffer, the I125-insulin tracer and the insulin antibody. The mixtures (see Table 5.1) were vortexed, covered then incubated overnight at 4 °C. Cold (4 °C) precipitating reagent (1 ml/tube, provided in kit) was added to all tubes except the total count tubes.

The tubes were incubated at 4°C for 20 min, and then centrifuged at 3100 xg at 4°C for

20 min. The supernatant was discarded immediately after centrifugation. The radioactivity remaining in the pellets was quantified using a PerkinElmer, 2470 WIZARD

Automatic Gamma counter (PerkinElmer, Waltham, MA, USA).

5.2.5. Statistical analyses

All data were presented as mean±SEM. Results were analysed using the Student’s t-test

(unpaired, two-tailed) or two-way ANOVA. A value of P<0.05 was considered significant.

89 CHAPTER 5

Table 5.1. List of sample mixtures for insulin RIA assay.

Insulin Assay Buffer 125I-Insulin Tracer Standard/QC/Sample Antibody (μl/tube) (μl/tube) (μl/tube) (μl/tube) Total count --- 100 ------NSB 200 100 ------Bo 100 100 100 --- Standards 100 100 100 100 QCs 100 100 100 100 Samples 100 100 100 100

90 CHAPTER 5

5.3 Results

5.3.1. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have impaired glucose tolerance.

There were no differences in fed or fasting blood glucose levels in 6, 12 or 16 week old

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice, Abca1fl/flAbcg1fl/fl mice and Ins2-Cre mice (Figure

5.1.A.). Blood glucose levels in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were more variable, especially under fasting conditions. Both fed and fasting plasma insulin levels were significantly decreased in 6, 12 and 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to Abca1fl/flAbcg1fl/fl littermate controls. (Figure 5.1.B.)

Following an IPGTT, fasting blood glucose levels in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice increased ~3-fold by 30 min, and remained elevated for 60 min (Figure 5.2.A.).

Blood glucose levels in the Abca1fl/flAbcg1fl/fl and Ins2-Cre mice doubled by 15 min, and rapidly returned to baseline. The glucose area under the curve (AUC) for the ABCA1β- cell-/-/ABCG1β-cell-/- DKO mice was 1657.0±272.7, compared to 589.3±203.8 and

608.5±187.3 arbitrary units for the Abca1fl/flAbcg1fl/fl and Ins2-Cre mice, respectively.

(Figure 5.2.B).

91 CHAPTER 5

A • fl/fl ~ lns2Cre D B-DKO

:::::, (!)-

O 6 12 16 6 12 1 Fed Fasting

B • fl/fl D (3-DKO 2.0 *::: **** ****

**** ****- ****

:::::, -~ 0.5 o.o 6 12 16 6 12 1

Fed Fasting

Figure 5.1. Fed and fasting blood glucose and insulin levels in ABCA1β-cell-/-/ABCG1β-cell-

/- DKO, Abca1fl/flAbcg1fl/fl and Ins2-Cre mice.

(A) Fed and fasting blood glucose levels were measured in 6, 12 and 16 week old ABCA1β- cell-/-/ABCG1β-cell-/- DKO (b-DKO), Abca1fl/flAbcg1fl/fl (fl/fl) and Ins2-Cre mice. (B) Fed and fasting plasma insulin levels were measured in 6, 12 and 16 week old ABCA1β-cell-/-

/ABCG1β-cell-/- DKO (b-DKO) mice and Abca1fl/flAbcg1fl/fl (fl/fl) mice (n=6-8/group,

****P<0.001).

92 CHAPTER 5

A • fl/fl + lns2Cre o ~-DKO 40

-:E 30 E -~ 20 0 CJ

..2C) 10 o,-+------,-----, 0 30 60 90 120 Time (min)

B **** 2,500 **** -g 2,000 ~ 1,500 Q) 4 1/) 0 8 1,000 ~ • a 500 $ 0 • fl/fl lns2Cre P-DKO

Figure 5.2. Glucose tolerance is impaired in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Blood glucose levels (A) and the incremental area under the curve (B) were measured during an IPGTT in 5 h fasted, 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO),

Abca1fl/flAbcg1fl/fl (fl/fl) and Ins2-Cre mice. (n=6-8/group, ****P<0.001)

93 CHAPTER 5

5.3.2. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have impaired insulin secretion, but normal insulin sensitivity.

Fasting insulin levels were significantly lower in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to Abca1fl/flAbcg1fl/fl mice (0.67±0.19 versus 1.03±0.18 ng/mL, P<0.001)

(Figure 5.3.A). When subjected to an IPGTT, insulin levels in the Abca1fl/flAbcg1fl/fl mice increased from 1.11±0.17 ng/ml at baseline to 1.72±0.08 ng/ml at 5 min and returned to baseline by 15 min. Insulin levels in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice did not increase in response to glucose.

The reduction in blood glucose levels was comparable when ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice and Abca1fl/flAbcg1fl/fl mice were subjected to an ip insulin tolerance test.

(Figure 5.3.B)

Islet morphology and b-cell mass in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/flAbcg1fl/fl mice were also comparable. (Figure 5.4. A and B)

94 CHAPTER 5

A 2.0 ...J -E 1.5 -C) C ~1.0 ·-::::, ]0.5 0.0+------0 5 10 15 Time (min)

B • fl/fl + lns2Cre o ~-DKO

-:E §o

0+---...... --....----- 0 15 30 45 60 Time (min)

Figure 5.3. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have impaired insulin secretion, but normal insulin sensitivity.

(A) Plasma insulin levels during an IPGTT in 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO

(b-DKO) and Abca1fl/flAbcg1fl/fl (fl/fl) mice (n=7/group). (B) Blood glucose levels following an IPITT in 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO),

Abca1fl/flAbcg1fl/fl (fl/fl) and Ins2-Cre mice. (n=6-8/group)

95 CHAPTER 5

• fl/fl • - B-DKO - •.

B 1.5 C) -E ';; 1.0 tn m E ~ 0.5 y cQ.

fl/fl J3-DKO

Figure 5.4. ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have normal islet morphology and b- cell mass.

(A) Representative pancreatic sections from Abca1fl/flAbcg1fl/fl (fl/fl) mice and ABCA1β- cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice immunostained for insulin. Scale bar=1 mm. (B)

Quantification of b-cell mass in Abca1fl/flAbcg1fl/fl (fl/fl) mice and ABCA1β-cell-/-/ABCG1β- cell-/- DKO (b-DKO) mice.

96 CHAPTER 5

5.3.3. Effects of apoA-I treatment on glucose tolerance in ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice.

Treatment with apoA-I markedly improved glucose tolerance in ABCA1β-cell-/-/ABCG1β-cell-

/- DKO mice (AUC=2137±97.1) compared to PBS-treated ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (AUC=2649±93.8) (Figure 5.5A), but had no effect on glucose tolerance in

Abca1fl/flAbcg1fl/fl (fl/fl) mice (AUC=1520±72.16 (PBS treated fl/fl mice) vs

AUC=1437±65.29 (apoA-I treated fl/fl mice)) (Figure 5.5B.)

97 CHAPTER 5

A ~ p-DKO ApoA-1 + p-DKO PBS i:r fl/fl ApoA-1 + fl/fl PBS

-~ 20 E -Cl) "'0 g 10 (!)

0 l __ """'T-----:~--~9~0~-~12030 60 o Time (min}

* JA.• ----•

ApoA-1 + + 13. DKO fl/fl

Figure 5.5. ApoA-I treatment improves glucose tolerance in ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice.

12 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) and Abca1fl/flAbcg1fl/fl (fl/fl) mice received apoA-I or PBS twice weekly for 4 weeks as described in Section 4.2.1. At 24 h after the final injection the mice were fasted for 5 h and subjected to an IPGTT.

(n=7/group, *P<0.001)

98 CHAPTER 5

5.3.4. Effects of apoA-I treatment on ex vivo GSIS in isolated islets from ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice.

Insulin secretion was not affected when isolated islets from ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mice and Abca1fl/flAbcg1fl/fl mice were incubated in low glucose conditions

(2.8mmol/L). When isolated islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/flAbcg1fl/fl mice were incubated with 25mmol/L glucose, insulin secretion was decreased in islets from the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to islets from

Abca1fl/flAbcg1fl/fl mice (2.92±0.42% total insulin content vs 4.53±0.57% total insulin content, P<0.05), respectively (Figure 5.6).

Under low glucose conditions (2.8 mmol/L), there was no difference in insulin secretion in isolated islets from apoA-I- and PBS-treated ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

However, under high glucose conditions (25mmol/L), GSIS was increased in isolated islets from the apoA-I-treated ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to PBS- treated ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (7.229±1.13% of the total insulin content vs

2.918±0.423% of the total insulin content, P<0.001) (Figure 5.7.).

99 CHAPTER 5

- fl/fl D P-DKO 6 * -1: C: s 0 C: .:; 0 (1) (.) ... C: (.) (1) ·-- ti) ~ =C: ·-C: ~ ~ 2 C: 0

- ~- 0 - 0 2.8 mmol/L Glucose 25 mmol/L Glucose

Figure 5.6. Insulin secretion is impaired in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice relative to islets from Abca1fl/flAbcg1fl/fl mice.

Insulin secretion was measured under low (2.8 mmol/L glucose) and high glucose conditions (25 mmol/L glucose) in islets isolated from ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-

DKO) and Abca1fl/flAbcg1fl/fl (fl/fl) mice. Results were normalized to the total insulin content of the islets (n=5/group, *P<0.05).

100 CHAPTER 5

Cl 13-DKO PBS la j>-DKO ApoA-1 10 **** -C C ~ 8 0 C ;; 0 Cl) CJ ~ C CJ· Cl) - fl) ~ =CC ·- ::::, - fl) .5 .E .s 2 -0~ 2.8 mmol/L Glucose 25 mmol/L Glucose

Figure 5.7. ApoA-I treatment increases GSIS in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

Insulin secretion was measured under low (2.8 mmol/L glucose) and high glucose conditions (25 mmol/L glucose) in islets from apoA-I treated ABCA1β-cell-/-/ABCG1β-cell-/-

DKO (b-DKO) and Abca1fl/flAbcg1fl/fl (fl/fl) mice. Results were normalized to the total insulin content of the islets (n=5/group, ****P<0.001)

101 CHAPTER 5

5.4 Discussion

The major conclusions in this chapter are that conditional deletion of ABCA1 and ABCG1 in b-cells impairs glucose tolerance, decreases fed and fasting plasma insulin levels and reduces insulin secretion, but does not affect fasting plasma glucose levels or insulin sensitivity in mice. These findings are consistent with what has been reported by others.

For example, ABCA1 knockout mice and mice with conditional b-cell deletion of ABCA1 have impaired glucose tolerance, normal fasting glucose levels and impaired insulin secretion. ABCG1 knockout mice also have impaired glucose tolerance and insulin secretion, but, in contrast to wild-type mice have increased fasting blood glucose levels

[23]. Kruit et al. have further reported greater impairment of glucose-stimulated insulin secretion in ABCG1 knockout mice with b-cell-specific deletion of ABCA1 than in ABCA1 knockout mice or in ABCG1 knockout mice [22].

A direct link between elevated b-cell cholesterol levels and impaired glucose tolerance has not been established definitively. However, it has been suggested that in the absence of ABCA1 and ABCG1, cholesterol accumulates at the b-cell plasma membrane, and inhibits insulin exocytosis, leading to impaired insulin secretion [8, 23] and glucose intolerance. At this stage it is not clear exactly how the exocytotic machinery is affected, but it is possible that b-cell insulin secretion is impaired in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice subsequent to reduced translocation of GLUT2 to the b-cell membrane, or to alterations in the conformation of SNARE proteins that prevent fusion of insulin granules with the plasma membrane.

The major finding in this chapter is that treatment with apoA-I improves insulin secretion

102 CHAPTER 5

in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice under high glucose conditions. This is consistent with what has been reported in in vitro studies, where HDLs and the main HDL apolipoprotein, apoA-I, increased insulin secretion in pancreatic b-cells in an ABCA1,

ABCG1 and SR-B1-dependent manner [173]. As the b-cells in the mice that were used in this study are deficient in ABCA1 and ABCG1, this suggests that the observed improvement in glycemic control may be dependent on SR-B1.

The findings in this chapter are also consistent with a clinical study in which raising HDL levels by infusing rHDLs into people with T2DM decreased plasma glucose levels, increased plasma insulin levels and increased b-cell function as assessed by the homeostasis model assessment b-cell function index [172]. The results from that study also showed that HDLs and apoA-I increase glucose uptake in skeletal muscle by activating the AMP-activated protein kinase pathway [172].

In summary, the studies in this chapter establish that the absence of ABCA1 and ABCG1 affects glucose homeostasis and that apoA-I improves b-cell function by enhancing insulin secretion by a mechanism that remains to be elucidated. Follow up studies that extend this observation may provide insights into whether apoA-I or apoA-I mimetic peptides are a potential therapeutic option for reducing progression to T2DM by improving b-cell function.

103

CHAPTER 6

Effect of ApoA-I Treatment on Islet Gene Expression in ABCA1β-cell-/-/ABCG1β-cell-/- DKO Mice

CHAPTER 6

6.1 Introduction b-cell dysfunction is central to the onset and progression of T2DM [198]. Glucotoxcity and lipotoxicity are two important factors that lead to β-cell apoptosis and impairment of insulin secretion [199]. More recently, islet inflammation has emerged as an important contributor to T2DM [200]. However, the genetic basis of b-cell dysfunction in T2DM is not clearly understood.

Studies in mice with conditional deletion of ABCA1 in β-cells have shown that ABCA1 is important for the regulation of genes involved in islet cholesterol metabolism [8].

Conditional deletion of ABCA1 in β-cells leads to a compensatory increase in islet Abcg1 expression, and decreased expression of the HMG-CoA reductase (Hmgcr) and the LDL receptor (Ldlr) genes in response to the increase in b-cell cholesterol levels [201-203].

Expression of the sterol regulatory element-binding factor 1 (Srebf-1c) gene, which regulates fatty acid metabolism [204], was not changed in these animals. Sturek et al. have also reported that mRNA expression of the oxysterol-regulated genes, Abca1 and

Srebp-1c, and the cholesterol-regulated genes, Ldlr and Hmgcr, in ABCG1 knockout mice islets are not altered [23].

β-cell deletion of ABCA1 and ABCG1 also increases islet inflammation, with interleukin

1 beta (Il-1b) expression and macrophage infiltration being significantly increased in islets from ABCG1 knockout mice with β-cell-specific deletion of the Abca1 gene [22].

As β-cell deletion of ABCA1 and ABCG1 also affects the expression of genes related to cholesterol homeostasis, glucose homeostasis and inflammation, it was logical next step to investigate whether treatment with apoA-I, which is known to be anti-inflammatory

105 CHAPTER 6

and also impacts on glucose metabolism [152] and cholesterol homeostasis [205], alters expression of relevant genes in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets. This may provide an insight into how apoA-I improved glucose tolerance and increased insulin secretion in these mice in Chapter 5.

This chapter therefore aims to:

(i) identify the genes in key metabolic and signal transduction pathways that are dysregulated in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets and

(ii) determine how expression of these genes is affected by apoA-I treatment.

106 CHAPTER 6

6.2 Methods

6.2.1. RNA extraction

Islets were isolated as described in Section 2.1.7, washed with cold PBS, hand-picked and placed in sterile tubes, then centrifuged at 380 xg for 2 min at 4 °C in a Microfuge

(Beckman Coulter). Total RNA was extracted using RNeasy Mini Kits (Qiagen, Hiden,

Germany). Briefly, islets were lysed with cold lysis buffer (700 µl QIAzol, Qiagen), and homogenized by vortexing for 1 min. Chloroform (140 μl) was added to the lysates, followed by centrifugation at 9500 xg for 15 min at 4 °C. The upper phase was transferred to a new tube containing 100% ethanol (525 µl). The resulting solution was loaded onto Rneasy mini spin columns. RNA was bound to the silica membrane of the spin columns by centrifugation for 15 sec at 9500 xg in a microfuge. The bound RNA was washed with Buffer RWT (350μl, provided in the RNeasy Mini Kit), then washed with

Buffer RPE (500 μl, provided in the RNeasy Mini Kit) by centrifugation at 9500 xg for 15 sec. The purified RNA was then eluted in RNase-free water (30 μl) by centrifugation at

16,600 xg for 2 min. The concentration of RNA was quantified using a NanoDrop UV-Vis

Spectrometer (Thermo Scientific). The RNA was stored in -80 °C until use.

6.2.2. Whole genome microarrays

Gene expression profiling was carried out using Affymetrix GeneChip microarray assays according to the manufacturer’s protocol (Affymetrix, Santa Clara, CA, USA). Briefly, 1 µg of total RNA was reverse transcribed (T-7 dT primers), amplified, fragmented and biotin- labeled (Affymetrix IVT Labeling Kit). The samples were hybridized to Mouse GeneChip

2.0 ST arrays (a total of 35,240 genes reference sequence transcripts (Affymetrix)),

107 CHAPTER 6

washed, stained (Affymetrix Fluidics Station) and scanned (Affymetrix GeneChip

Scanner). The results were analyzed using the Partek Genomics Suite (Partek, Singapore) and pathway analyses were performed using Ingeunity Pathway Analysis (IPA) (Qiagen).

6.2.3. Reverse transcription

For reverse transcription (RT), 1 μl RNA (100 ng/μl) was mixed with iSCRIPT reverse transcriptase enzyme (0.5 μl), 5x iSCRIPT reaction mixture (2 μl) (iSCRIPT cDNA Synthesis

Kit, Bio-Rad) and nuclease-free water (6.5 μl). All RT reactions were carried out as four replicates in a thermal cycler (isCube, Integrated Science, Chatswood, NSW, Australia).

The resulting cDNAs were stored at -20 °C until use.

6.2.4. Real-time polymerase chain reaction (RT-PCR)

6.2.4.1. Primer design

Primers (18-22 bp) were designed to amplify a product less than 200 bp with a melting range between 50-60 °C , and a GC content of 40-60% (Primer BLAST, NCBI, Bethesda,

MD, USA). The efficiency of all primer sets was checked using serial dilutions of sample cDNA. The specificity of the primers was confirmed by melt-curve analysis, which showed tight clustering of the melt-temperature for the PCR products. The primers that were used in this project are shown in Table 6.1.

6.2.4.2. Real-time PCR

Real-time PCR was performed using the iQ SYBR Green Supermix (Bio-Rad). cDNA was amplified in triplicate using the following reaction mixture: 1.2 μl of cDNA, 7.5 μl iQ SYBR mastermix, 0.6 μl of the sense primer (20 pM), 0.6 μl of the antisense primer (20 Pm),

108 CHAPTER 6

and 5.1 μl of nuclease-free water. Amplifications were performed using the iCycler iQ

Real-Time thermocycler (Bio-Rad) (1 cycle at 95 °C for 3 min; 39 cycles at 95 °C for 10 sec, 1 cycle at 55 °C for 10 sec, and then 1 cycle at 72 °C for 30 sec). Following amplification, melt curve analysis was performed for 1 cycle at 95 °C, and 60 cycles at

65 to 95 °C, 0.5 °C / cycle, 5 sec hold.

Expression of genes of interest was quantified during thermal cycling by measuring the increase in fluorescence during the exponential phase of PCR for each sample. The threshold cycle (CT) was calculated from the amplification plot using the iCycler iQ Real-

Time PCR detection system software version 3.0A (Bio-Rad). Relative changes in the mRNA expression were determined as 2-(Ct[Gene of Interest]-Ct[GAPDH]) [206].

6.2.5. Statistical analyses

All data were presented as mean±SEM. Results were analysed using the Student’s t-test

(unpaired, two-tailed) or two-way ANOVA. A value of P<0.05 was considered significant.

The microarrary results were passed the cut off criteria after adjustment for a false discovery rate of P £ 0.05.

109 CHAPTER 6

Table 6.1. List of gene primers used for quantitative real-time PCR analysis.

Gene Sequence forward (5' > 3') Sequence reverse (5' > 3')

Abca1 GAACGGGTTACTATCTGACC GAGAAACACTGTCCTCCTTT

Abcg1 GGATGAATCAGCGAATGTTG CACACTTGGGTATTTTCTGC

Akt1 CCTGATGTTTTGTTTCTCGG GATAGTTTTCCTCCTGACCT

ApoB CCACACCTTCTTGATTCTGA CTTCCAGTTCCATCTTCCTC

Fasn GTCAGTGTGAAGAAGTGTCT ACCCATAAGTATCAGAGCCT

Foxa2 TAACTGTAACGGGGAGGG TGTTGCTCACGGAAGAGTA

GAPDH GTATGTCGTGGAGTCTACTG TTGCTGACAATCTTGAGTGA

Gbp11 CAGTGATTTCTTTGTGGACAG CAGTCTCTCATTTGCTCCTA

Glut1 TAGTCTTCACCTTGATTGGC TCGGTATTAGTGTGTCCTTG

Glut2 ATCATTGGCACATCCTACTT TTTGGTGACATCCTCAGTTC

Glut4 CCCCAGATACCTCTACATCA ACTTCCGTTTCTCATCCTTC

Hmgcr CGATAGAGATAGGAACCGTG ATCACAGTGCCACATACAAT

IL-1β CACCTTTTGACAGTGATGAGA CACAGCCACAATGAGTGATA

Insig1 GTGTCACAGTGGGAAACATA GACCAGTGTCTCTACATCCT

Irs1 GATCAGGCTATCTTCCTTGG GTGTTGAAAAACTGGGTGAG

Ldlr AAACGAAGCCATTTTCAGTG TTGTCTCACACCAGTTCAC

Pik3r1 GCAGTAAAATCAGACGACAG GTCCTTCTCAGCAACTTGT

Ppargc1a CAGTTCACTCTCAGTAAGGG CAGCACACTCTATGTCACTC

Prkg1 TAAACTGTGGAATCGTCCTC TGTGGTCCTATCCTGAAAGA

Scap TCTTGGACAGGAGGATTGTA CAGATGAGGAAGGAGAACTG

Scarb1 CAGGTGTGCTCTTCTAAATG GGGAACTAAGGCTTTCAGAC

Sftpd CGTGGACTAAGTGGACCTC GCCTTTTGCCCCTGTAGAT

Srebf2 TGATTGTCTTGAGCGTCTTT GGATAAGCAGGTTTGTAGGT

110 CHAPTER 6

6.3. Results

6.3.1. General results of microarray study

Using principal component analysis (PCA), islet gene clusters from Abca1fl/flAbcg1fl/fl mice (blue dots) and ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (red dots) (n=5/group) were compared (Figure 6.1). The gene clusters from both animal groups did not interact, which is consistent with differences in the gene expression profiles between the

Abca1fl/flAbcg1fl/fl mice and ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Volcano plot analysis (Figure 6.2) of the data showed multiple significantly up- and down-regulated genes in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared to islets from Abca1fl/flAbcg1fl/fl mice (fold change ³ 1.2, P<0.05, n=5/group). Each dot in the volcano plot represents the expression of one gene in the mouse GeneChip. The horizontal red line shows the cut off p-value (P<0.05) and the vertical red lines show fold change (fold change ³ 1.2). Based on these selection criteria, the gene array results showed that a total of 4216 genes (2,617 down-regulated genes and 1,599 up-regulated genes) were differentially expressed in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets compared to islets from the Abca1fl/flAbcg1fl/fl mice.

IPA showed that the differentially regulated genes were related to multiple different pathways, including cholesterol metabolism (Table 6.2), glucose metabolism (Table 6.3) and inflammation (Table 6.4). The microarray results were validated by confirming changes in expression of selected key genes by qPCR.

111 CHAPTER 6

• fl/fl • ~-DKO

-212 -11spc t HQ.7% -101 -ss -21 9 46 83

Figure 6.1. Islet 3D principal component analysis (PCA) plots for

Abca1fl/flAbcg1fl/fl (fl/fl) mice and ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

(n=5/group).

112 CHAPTER 6

.-. ~ 1·10 ·4 --~ If) > 0 ~ 0 1·10 ·3 I C!l.

Q) ::i ro > 1·10·2 a.I

0.05

1·10· 1

-32 -16 -8 -4 -2 -1.2 N/C 1.2 2 4 8 16 32

Fold-Change (f3- DKO vs fl/fl)

Figure 6.2. A volcano plot of differentially up-regulated and down-regulated

genes in ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice compared to

Abca1fl/flAbcg1fl/fl (fl/fl) mice. (fold change ³ 1.2, P<0.05, n=5/group)

113 CHAPTER 6

6.3.2. Changes in expression of genes involved in cholesterol metabolism in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets

Table 6.2. shows changes in the expression of selected genes related to cholesterol

metabolism obtained from microarray data. Validation of these genes by qPCR is

shown in Figure 6.3.

Comparison of islet mRNA levels of differentially regulated genes involved in

cholesterol metabolism in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

and Abca1fl/flAbcg1fl/fl (fl/fl) mice revealed a 58% decrease in Hmgcr expression

(0.06 ± 0.01 RQV for b-DKO vs 0.142 ± 0.01 RQV for fl/fl), a 52% decrease in Ldlr

expression (0.05± 0.01 RQV for b-DKO vs 0.10±0.003 RQV for fl/fl), a 45% decrease

in Abca1 expression (0.05 ± 0.004 RQV for b-DKO vs 0.09±0.01 RQV for fl/fl), a 55%

decrease in Insig1 expression (0.09±0.01 RQV for b-DKO vs 0.21±0.02 RQV for fl/fl),

a 57% decrease in Srebf2 expression (0.07±0.01 RQV for b-DKO vs 0.16±0.01 RQV

for fl/fl), a 35% decrease in Abcg1 expression (0.01± 3.7E-04 RQV for b-DKO vs 0.02±

6.1E-04 RQV for fl/fl) and a 35% decrease in Fasn expression (0.002±1.5E-04 RQV

for b-DKO vs 0.003±2.3E-04 RQV for fl/fl). There was a 258% increase in apoB

expression (0.004 ± 7.6E-04 RQV for b-DKO vs 0.001 ± 2.2E-04 RQV for fl/fl) (P<0.05

for all)(Fig 6.3.).

114 CHAPTER 6

Table 6.2. Changes in expression of genes related to cholesterol metabolism in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets from microarray data.

Gene Fold p-value Regulation Gene description Symbol Change 3-hydroxy-3-methylglutaryl- Hmgcr -1.66 1.50E-02 Down Coenzyme A reductase Ldlr -1.53 1.87E-02 Down Low density lipoprotein receptor ATP-binding cassette, sub-family A Abca1 -1.48 8.49E-03 Down (ABC1), member 1 Insig1 -1.45 4.01E-02 Down Insulin induced gene 1 Sterol regulatory element binding Srebf2 -1.39 4.04E-02 Down factor 2 ATP-binding cassette, sub-family G Abcg1 -1.34 2.27E-02 Down (WHITE), member 1 Fasn -1.21 1.49E-02 Down Fatty acid synthase ApoB 3.95 8.44E-03 Up Apolipoprotein B

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/flAbcg1fl/fl mice (n=5/group). Total RNA was extracted and subjected to

Affymetrix GeneChip Mouse Gene ST 2.0 analysis. Whole-genome microarray data

is presented. Fold change ≥1.2, P<0.05 are presented.

115 CHAPTER 6

0.20 0.15

~ 0.15 0::: ~ 0.10 0::: "5' 0.10 C) -.!::: ** "t:l ** E ..J 0.05 :::c 0.05

0.00 0.00 fl/fl P-DKO fl/fl P- DKO 0.15 0.25

> 0.20 > 0.10 a i 0::: 0.15 -....ca ** -.... ** (.) .21 0.10 .0 0.05 U) .E

0.00 0.00 fl/fl P-DKO fl/fl P-DKO 0.20 0.020

~ 0.15 ~ 0.015 0::: 0::: ** - 0.10 ;::' 0.010 C! ** C) .0 (.) e .0 U) 0.05

0.00 0.000 fl/fl P-DKO fl/fl P- DKO 0.004 0.005 * > 0.003 >0.004 a i * o::: 0.003 ~ 0.002 -a:i U) o 0.002 ca 0. LL 0.001

0.000 0.000 fl/fl P-DKO fl/fl P-DKO

Figure 6.3. Validation of array results for changes in expression of genes related

to cholesterol metabolism.

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

and Abca1fl/flAbcg1fl/fl (fl/fl) mice (n=5/group). Selected genes were validated by

RT-PCR. All data were normalized to GAPDH. Values represent the mean±SEM.

*P<0.05, **P<0.01.

116 CHAPTER 6

6.3.3. Changes in expression of genes involved in glucose metabolism in ABCA1β-

cell-/-/ABCG1β-cell-/- DKO mouse islets.

Changes in the expression of selected genes related to glucose metabolism

obtained from microarray results are shown in Table 6.3. Validation of these genes

by qPCR is shown in Figure 6.4.

For ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mouse islets compared to islets from

Abca1fl/flAbcg1fl/fl (fl/fl) mice, there was a 63% decrease in Ppargc1a expression

(0.001 ± 9.7E-05 RQV for b-DKO vs 0.003 ± 3.7E-04 RQV for fl/fl), a 61% decrease in

Prkg1 expression (0.002 ± 6.9E-05 RQV for b-DKO vs 0.004 ± 4.2E-04 RQV for fl/fl),

a 45% decrease in Glut2 expression (0.673 ± 0.039 RQV for b-DKO vs 1.229 ± 0.096

RQV for fl/fl) and a 37% decrease in Pik3r1 expression (0.08± 0.01 RQV for b-DKO vs

0.12 ± 0.01 RQV for fl/fl). There was a 76% increase in Akt1 expression (0.09 ± 0.003

RQV for b-DKO vs 0.05 ± 0.002 RQV for fl/fl) and a 88% increase in Glut1 expression

(0.02 ± 0.003 RQV for b-DKO vs 0.01 ± 0.001 RQV for fl/fl). P<0.05 for all) (Figure

6.4.).

Irs1 mRNA levels were decreased in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice compared

to Abca1fl/flAbcg1fl/fl mice, however, this difference did not reach statistical

significance. Islet Foxa2 and Glut4 mRNA levels were comparable in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice and Abca1fl/flAbcg1fl/fl mice. (Figure 6.4.)

117 CHAPTER 6

Table 6.3. Changes in expression of genes related to glucose metabolism in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets from microarray data.

Gene Fold p-value Regulation Gene description Symbol Change Peroxisome proliferator activated Ppargc1a -1.86 1.54E-03 Down receptor gamma coactivator 1 alpha Protein kinase cGMP-dependent, Prkg1 -1.77 6.37E-03 Down type I Glut2 -1.43 1.52E-03 Down Glucose transporter 2 Irs1 -1.28 9.78E-03 Down Insulin receptor substrate 1 Phosphatidylinositol 3-kinase, Pik3r1 -1.25 3.38E-03 Down regulatory subunit, polypeptide 1 Foxa2 -1.24 4.99E-03 Down Forkhead box A2 Glut4 1.22 3.30E-02 Up Glucose transporter 4 Akt1 1.29 3.64E-02 Up Thymoma viral proto-oncogene 1 Glut1 1.48 3.62E-02 Up Glucose transporter 1

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/flAbcg1fl/fl mice (n=5/group). Total RNA was extracted and subjected to

Affymetrix GeneChip Mouse Gene ST 2.0 analysis. Whole-genome microarray data

is presented. Fold change ≥1.2, P<0.05 are presented.

118 CHAPTER 6

0.004 0.006 1.5 ~ 0.003 > ~ ~ 0.004 O 1.0 ~ ~ ** ~ 0.002 .... N ei ** Cl ** C1I ~ 0.002 -o.5 a. a ~ 0.001

0.000 0.000 0.0 fl/fl 13-DKO fl/fl 13· DKO fl/fl 13· DKO

0.015 0.15 0.0006 > > ~ 0.010 [ 0.10 ** [0,0004 ~ "C N .... M C1I ~ 0.005 .II: 0.05 ~ 0.0002 a: u..

0.000 0.00 0.0000 fl/fl 13-DKO fl/fl 13· DKO fl/fl 13· DKO

0.0004 0.15 0.03 * $'0.0003 ** 0 ~ 0.10 ~ 0.02 It: It: ;-0.0002 ...... ~ '5 li: c( 0.05 - 0.01 ci 0.0001 a

0.0000 0.00 0.00 fl/fl 13-DKO fl/fl 13· DKO fl/fl 13· DKO

Figure 6.4. Validation of array results for changes in expression of islet genes

related to glucose metabolism.

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

and Abca1fl/flAbcg1fl/fl (fl/fl) mice (n=5/group). Selected genes were validated by

RT-PCR. All validation results were normalized to GAPDH. Values represent the

mean±SEM. *P<0.05, **P<0.01.

119 CHAPTER 6

6.3.4. Changes in expression of genes involved in inflammation in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mouse islets

Changes in the expression of islet genes related to inflammation obtained from

microarray results are shown in Table 6.4. Validation of these genes by qPCR is

shown in Figure 6.5.

There was a 136% increase in islet Il-1b expression (0.152 ± 0.012 RQV for b-DKO vs

0.064 ± 0.005 RQV for fl/fl) in ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

compared to Abca1fl/flAbcg1fl/fl (fl/fl) mice (Fig. 6.5). Sftpd expression was

increased 44082% in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice compared to

Abca1fl/flAbcg1fl/fl (fl/fl) mice (0.592 ± 0.035 RQV for b-DKO vs 0.001 ± 1.1E-04

RQV for fl/fl), while Gbp11 expression was increased by 83805% (0.096 ± 0.007 RQV

for b-DKO vs 1.1E-04 ± 3.6E-05 RQV for fl/fl) (P<0.01 for all).

120 CHAPTER 6

Table 6.4. Changes in expression of genes related to inflammation in islets from

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice from microarray data.

Gene Fold p-value Regulation Gene description Symbol Change

Il1b 1.56 4.79E-02 Up Interleukin 1 beta

Sftpd 6.79 1.98E-02 Up Surfactant associated protein D

Gbp11 10.56 2.18E-02 Up Guanylate binding protein 11

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice and

Abca1fl/flAbcg1fl/fl mice (n=5/group). Total RNA was extracted and subjected to

Affymetrix GeneChip Mouse Gene ST 2.0 analysis. Whole-genome microarray data

is presented. Fold change ≥1.2, P<0.05 are presented.

121 CHAPTER 6

0.20 0.8 ** ** > 0.15 so.s a a 0::: ~ 0.10 ;;o.4 .c C. - 0.05 =u, 0.2

0.00 0.0 fl/fl J3- DKO fl/fl J3- DKO

0.15 -> ** -~ 0.10 -C. -.c 0.05 (!)

0.00 fl/fl J3- DKO

Figure 6.5. Validation of array results for changes in expression of islet genes

related to inflammation.

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

and Abca1fl/flAbcg1fl/fl (fl/fl) mice (n=5/group). Selected genes were validated by

RT-PCR. All validation results were normalized to GAPDH. Values represent the

mean±SEM. **P<0.01.

122 CHAPTER 6

6.3.5. Effect of apoA-I treatment on gene expression on ABCA1β-cell-/-/ABCG1β-cell-/-

DKO mouse islets.

Treatment with apoA-I as described in Chapter 4 did not significantly change the

expression of any of the up- or down-regulated genes involved in cholesterol

metabolism (Figure 6.6), glucose metabolism (Figure 6.7) or inflammation (Figure

6.8) in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

123 CHAPTER 6

0.02 0.04

0.02 ~ > c::: a ... c::: -(J 0.01 en "C-= E ...J 0.01 :::c: 0.00

0.00 PBS ApoA-I PBS ApoA-I 0.02 0.04

0.01 > a> ~ c::: .... 0.01 -.... C'CI en (J .0 ·;;; <( C: 0.01

0.00 PBS ApoA-I PBS ApoA-1 0.03

>a ~ c::: ~ -N ....en -.0 (J ~ .0 en <(

0.0 PBS ApoA-I PBS ApoA-I

0.00 >a a> c::: et:: 0.00 -N C'CI -a:i >< 0 0 Q. LL <(

0.00 PBS ApoA-I PBS ApoA-I

Figure 6.6. ApoA-I treatment does not affect expression of genes involved in

cholesterol metabolism in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

treated with either apoA-I or PBS (n=5/group). Selected genes were validated by RT-

PCR. All validation results were normalized to GAPDH. Values represent the

mean±SEM.

124 CHAPTER 6

0.00 0.004 0.3 > [ 0.00 > > I'll [ [ u ... N e Cl ::::, I'll ~ - a. Cl. a Cl.

0.00 PBS ApoA-1 PBS ApoA-1 PBS ApoA-1 0.010 0.04 0.000

0.008 > 0.03 > 0.000 0.006 a ~ ~ ~ ~ ... 0.02 ;;;- 0.0002 ... 0.004 ... I'll M )( _gi ..:.:: 0 0.01 0.0001 0.002 ii: u.

0.000 0.00 0.000 PBS ApoA-1 PBS ApoA-1 PBS ApoA-1 0.004 0.05

0.04 0.003 0.01 > >a a ~ 0.03 ~ 0.002 ~ ~ '

0.000 0.00 PBS ApoA-1 PBS ApoA-1 PBS ApoA-1

Figure 6.7. ApoA-I treatment does not affect expression of genes involved in

insulin signaling and glucose metabolism in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse

islets.

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

treated with either apoA-I or PBS (n=5/group). Selected genes were validated by RT-

PCR. All validation results were normalized to GAPDH. Values represent the

mean±SEM.

125 CHAPTER 6

0.0025 0.25

0.0020 0.20 > 0 0.0015 0:::~ 0::: -,:, -.0 0.0010 C. 0.10 """" =en 0.0005

0.0000 0.00 PBS ApoA-1 PBS ApoA-1

o> -0::: 0.01

PBS ApoA-I

Figure 6.8. ApoA-I treatment does not affect expression of genes involved in

inflammation in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets.

Islets were collected from 16 week old ABCA1β-cell-/-/ABCG1β-cell-/- DKO (b-DKO) mice

treated with either apoA-I or PBS (n=5/group). Selected genes were validated by RT-

PCR. All validation results were normalized to GAPDH. Values represent the

mean±SEM.

126 CHAPTER 6

6.4 Discussion

This chapter explores the changes in gene expression caused by conditional deletion

of ABCA1 and ABCG1 in b-cells.

As expected, the loss of both ABCA1 and ABCG1 specifically in b-cells decreased

expression of a number of genes related to cholesterol metabolism. These included

Hmgcr, Ldlr, Insig-1, Fasn and Srebf2. The Hmgcr gene encodes for HMG-CoA

reductase, the rate-limiting enzyme in cholesterol biosynthesis. The Ldlr gene

encodes the low-density protein receptor, which regulates plasma LDL cholesterol

levels. The down-regulation of Hmgcr and Ldlr that was observed in the ABCA1β-cell-

/-/ABCG1β-cell-/- DKO mice is consistent with a previous report of mice with

conditional b-cell deletion of ABCA1 [8], and is expected as the Hmgcr and Ldlr, and

Insig-1 genes are known to be downregulated when cell cholesterol levels are

increased [203, 207, 208], as is the case in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Studies of transgenic and knockout mice have shown that SREBP-2 plays important

role in regulating total cholesterol synthesis and metabolism [209]. Activation of

SREBP-2 increases cell cholesterol levels by stimulating the transcription of its target

genes, including Hmgcr, Ldlr, Insig-1, Srebf2 and Fasn. However, high intracellular

cholesterol levels can cause SREBP-2 to be retained in the endoplasmic reticulum

and inhibit its transcription in a negative feed-back loop [210]. Therefore, the

observed reduction in expression of SREBP-2 in the current study could be a direct

consequence of the increased islet cholesterol content in the ABCA1β-cell-/-/ABCG1β-

cell-/- DKO mice, thus explaining why expression of its target genes (Hmgcr, Ldlr, Insig-

127 CHAPTER 6

1, Srebf2 and Fasn) was also down-regulated. However, the role of ABCG1 in the

regulation of these genes involved in cholesterol metabolism is not clear at present

and warrants further investigation.

The presence of Abca1 and Abcg1 in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets

is probably due to expression of the transporters in other cell types such as α-cells,

δ-cells, PP cells and ε-cells. As expression of the Abca1 and Abcg1 genes was

decreased by 45% and 35%, respectively, in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO

mouse islets, it follows that b-cells contribute about 55% and 65%, respectively, to

the total islet Abca1 and Abcg1 gene expression.

The present study shows that b-cell-specific deletion of ABCA1 and ABCG1

decreased islet expression of Ppargc1a, Prkg1, Glut2 and Pik3r1. The Ppargc1a gene

encodes peroxisome proliferator activated receptor gamma coactivator 1 alpha

(PGC-1alpha), which is a key regulator of mitochondrial genes. PGC-1alpha

enhances oxidative phosphorylation and ATP production in target tissues through

coactivation of nuclear receptors [211]. The mRNA level of PGC-1alpha in islets from

patients with T2DM and rat models of impaired insulin secretion is also decreased

and correlates with impaired insulin secretion [212].

The Prkg1 gene encodes for the cGMP-dependent protein kinase type I (PKG1),

which is involved in the nitric oxide/cGMP-dependent protein kinase type I (cGKI)

signaling pathway that plays a pivotal role in the pathogenesis of T2DM [213, 214].

Studies of type 1 and type 2 diabetic rat models showed that PKG1 is decreased in

aortic and vascular smooth muscle cells [215, 216]. Liu et al. have also reported that

128 CHAPTER 6

PRKG1 mRNA levels are decreased in vascular smooth muscle cells under high

glucouse conditions [217], possibly by increasing superoxide production in vascular

smooth muscle cells via the protein kinase C-dependent activation of NAD(P)H

oxidase [217].

GLUT2 is the major transporter of glucose into pancreatic β-cells in mice [218].

Impaired glucose signaling and reduced insulin biosynthesis and secretion are

evident in GLUT2 knockout mice [219]. These defects are restored by

overexpression of Glut2 [219]. However, b-cells in GLUT2 knockout mice have

normal GK expression, suggesting that GLUT2 is not essential for GK function [219].

This is consistent with the present study, which shows that GLUT2 expression is

significantly decreased, but GK expression is not affected in ABCA1β-cell-/-/ABCG1β-

cell-/- DKO mice.

The Pik3r1 gene encodes the p85a regulatory subunit of phosphatidylinositol 3-

kinase, which is involved in the development of T2DM [220]. Evidence shows that

reduced Pik3r1 gene expression in obese mice prevents insulin resistance and

macrophage accumulation in adipose tissue [221]. Deletion of Pik3r1 and

subsequent maintenance of PI3K function, bypasses the obesity- and inflammation-

mediated reductions in tyrosine activation of IRS1, which is a key regulator in the

insulin signaling pathway [221].

When considered together, the decreased expression of the Ppargc1a, Prkg1, Glut2

and Pik3r1 genes in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice that was

129 CHAPTER 6

observed in the present study may explain the impaired glucose tolerance and

insulin secretion that was observed in these mice (Chapter 5).

Deletion of ABCA1 and ABCG1 in b-cells increased Il-1β, Sftpd and Gbp11 gene

expression in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets. IL-1β is a pro-

inflammatory cytokine that contributes to glucotoxity in islets [222]. Increased

expression of this gene in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets may result in

islet inflammation, as has been reported for ABCG1 knockout mice with conditional

deletion of ABCA1 in b-cells [22].

Sftpd and Gbp11 are the two genes with greatest fold-increase in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mouse islets compared to control mice. Sftpd encodes for

surfactant pulmonary-associated protein D, which contributes to surfactant

homeostasis and pulmonary immunity [223]. The Gbp11 gene encodes for

guanylate-binding protein 11, which contributes to interferon (IFN) responses in a

variety of organisms [224]. However, there are no reports of the association of these

genes with inflammation in β-cells. Further examination of this relationship may

provide new insights into the origins of β-cell inflammation.

Treatment of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice with apoA-I did not affect the

expression of any of the aforementioned differentially regulated genes invovled in

glucose metabolism, cholesterol metabolism and inflammation. This may explain,

at least in part, why apoA-I treatment did not affect cholesterol homeostasis in the

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice in Chapter 4.

130 CHAPTER 6

However, given that apoA-I treatment increased insulin secretion and improved

glycemic control in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice (Chapter 5), It is possible

that apoA-I treatment affects the expression of genes involved in glucose

metabolism that were not investigated in the present chapter, or that it exerts its

beneficial effects in β-cells by other mechanisms such as post-translational

modification of regulatory proteins. These questions clearly warrant further

investigation.

131

CHAPTER 7

General Discussion and Future Perspectives

CHAPTER 7

7.1 General discussion

Progression towards T2DM is characterized by enhanced b-cell dysfunction and a gradual decline in insulin secretion in response to a glucose challenge. The role of the cholesterol transporters ABCA1 and ABCG1 in these processes has only recently been identified. These studies have shown that loss-of-function mutations in the ABCA1 gene in humans reduces HDL levels, causes hyperglycemia, and impairs insulin secretion [151].

In four subsequent animal studies of (i) ABCA1 knockout mice, (ii) mice with conditional deletion of ABCA1 in β-cells, (iii) ABCG1 knockout mice and (iv) ABCG1 knockout mice with conditional deletion of ABCA1 in β-cells all the animals had impaired glucose tolerance, impaired insulin secretion and elevated islet cholesterol levels [8, 22, 23].

However, the effects of specific deletion of both ABCA1 and ABCG1 only in β-cells, which is the focus of this thesis has not been investigated. The studies in this thesis have been further extended by examining the effect of apoA-I treatment on b-cell dysfunction in mice with specific deletion of both ABCA1 and ABCG1 in β-cells (ABCA1β-cell-/-/ABCG1β- cell-/- DKO mice).

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice were generated by crossing Ins2-Cre and

Abca1fl/flAbcg1fl/fl mice (Chapter 3). Knockdown of ABCA1 and ABCG1 in the b-cells of these mice was confirmed by genotyping.

The major objective of Chapter 4 was to investigate islet cholesterol homeostasis in

ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice. The results showed that islet cholesterol levels were increased in these animal, and that deletion of ABCA1 and ABCG1 specifically in b-cells does not affect plasma cholesterol levels. The results in Chapter 4 also showed that treatment of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice with apoA-I does not affect either islet

133 CHAPTER 7

or plasma cholesterol levels.

Glucose homeostasis in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets was investigated in

Chapter 5. These results showed that deficiency of both ABCA1 and ABCG1 in β-cells impairs glucose tolerance and decreases GSIS and that these effects are partly rectified by treatment with apoA-I. Ex vivo studies also showed that treatment with apoA-I improves GSIS in isolated islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

Insights into the underlying mechanisms responsible for the above perturbations in cholesterol and glucose homeostasis in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets were investigated by gene expression profiling using a whole genome microarray approach.

The results, as described in Chapter 6, show that deletion of the Abca1 and Abcg1 genes from β-cells alters the expression of key genes involved in cholesterol metabolism, including Hmgcr, Ldlr and Insig1. Expression of genes involved in glucose metabolism, such as Ppargc1a, Prkg1 and Glut2, and inflammation pathways, such as Il-1β were also altered in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice. Changes in expression of these genes may explain, at least in part, some of the results concerning cholesterol and glucose homeostasis observed in Chapters 4 and 5. However, treatment with apoA-I did not significantly affect expression of any of these genes in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mouse islets. This also explains the negative findings of the effect of apoA-I treatment on cholesterol homeostasis in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice observed in Chapter

In summary, the results in this thesis show that ABCA1 and ABCG1 expression in β-cells is important for regulating islet cholesterol levels, and whole body glucose homeostasis,

134 CHAPTER 7

thus confirming what has been reported previously for ABCA1 knockout mice, mice with conditional deletion of ABCA1 in β-cells, ABCG1 knockout mice and ABCG1 knockout mice with conditional deletion of ABCA1 in β-cell.

One of the most unexpected and interesting observations that has emerged from the present studies is that combined deletion of ABCA1 and ABCG1 only in β-cells increases asdiposity and reduces skeletal muscle mass. This is now known to be due to a switch in glucose disposal from skeletal muscle to adipose tissue [225]. The studies in this thesis further establish that apoA-I treatment improves β-cell function in ABCA1β-cell-/-/ABCG1β- cell-/- DKO mice by a mechanism that is distinct from processes involved in the regulation of cholesterol homeostasis.

7.2 Limitation of the study and future directions

There are several limitations in this study. First of all, isolated islets, rather than a homogeneous population of β-cells, were used for the ex vivo and gene sequencing studies. The other cell types that were present in these samples may have confounded the results. A possible solution to this dilution effect is to sort the islet cells prior to analysis and perform the studies on pure β-cell preparations. This could be done by using homogeneous populations of cytofluorometrically sorted β-cells from ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mouse islets [226]. However, there is no guarantee that sufficient numbers of β-cells would be obtained using this approach.

Secondly, only male mice were used for the studies. Female mice were not used to ensure that the results were not confouned by hormonal cycles, which could affect body fat distribution [227], and insulin sensitivity. It is important for future studies that female

135 CHAPTER 7

mice are also investigated to assess whether there is any gender difference in the effect of specific deletions of ABCA1 and ABCG1 in β-cells on cholesterol and glucose homeostasis.

One of most important outstanding issues from this study is that no insights have been obtained into how apoA-I treatment improves β-cell function in ABCA1β-cell-/-/ABCG1β-cell-

/- DKO mice. The results in Chapter 4 establish that the treatment with apoA-I did not reduce islet cholesterol levels in the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice, which was not surprising given that the b-cells in these animals are deficient in ABCA1 and ABCG1.

Furthermore, it is possible that other members of the ATP-binding cassette transporter family, such as ABCA12 and ABCG4, may compensate for the absence of ABCA1 and

ABCG1 in β-DKO mouse islets [228, 229]. However, microarray analysis showed that expression of the genes encoding for these transporters was not changed in β-DKO mice relative to Abca1fl/fl/Abcg1fl/fl mice. Given that potentially cardioprotective apoA-I mimetic peptides that also increase GSIS in the Ins-1E b-cell line (unpublished) are in development, it is especially important that this observation is further pursued.

Moreover, another possible issue in this study is that injecting human apoA-I into a mouse might set up an immune response.

The impact of apoA-I on insulin sensitivity in other organs such as liver, skeletal muscle and adipose tissue of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice also warrants further investigation. The liver is a major site of cholesterol synthesis and glycogen storage as well as one of the main target tissues of insulin. Cholesterol and glucose homeostasis can be investigated in the liver of ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice by studying the

136 CHAPTER 7

expression of related genes such as carbohydrate-responsive element-binding protein (ChREBP), insulin receptor substrate 2 (Irs2) and the glucose transporter 2

(Glut2). If regulation of any of these key genes is affected in the livers of ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice, it will establish for the first time the existence of a link between expression of ABCA1 and ABCG1 in b-cells and hepatic glucose metabolism.

A further limitation of the studies in this thesis is that only gene expression profiling was undertaken to identify genes involved in cholesterol homeostasis, glucose homeostasis and inflammation in islets from ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice. The protein levels of these genes also need to be quantified, as does the possibility that apoA-I treatment affects their expression and may possibly be promoted post-translation modifications.

Skeletal muscle is the major site of glucose disposal in the body [230]. Glucose uptake into skeletal muscle can be either insulin-dependent or insulin-independent. Emerging evidence shows that HDLs and apoA-I increase insulin-independent glucose uptake into skeletal muscle by activating the AMPK pathway and promoting GLUT4 translocation to the plasma membrane [152, 172, 231]. HDLs also increase glycogen synthesis in skeletal muscle [232]. As I have reported that ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice have decreased skeletal muscle mass [187], it would be worthwhile to investigate whether apoA-I treatment can reverse this detrimental effect and increase glucose uptake by skeletal muscle in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice.

The effect of apoA-I treatment on glucose uptake in adipose tissue is also worthy of further investigation. Adipose tissue, the major site for energy storage, secretes adipokines that have important regulatory roles in glucose homeostasis and insulin

137 CHAPTER 7

sensitivity. Studies that address this question would provide valuable information about the overall systematic effects of apoA-I treatment and its potential use as target therapy for type 2 diabetes. Asking whether apoA-I treatment affects the expression of GLUT-2, as well as other key proteins involved in the b-cell insulin secretory pathway in ABCA1β- cell-/-/ABCG1β-cell-/- DKO mice would also be worthwhile.

Exercise is an important lifestyle intervention for patients with type 2 diabetes because it is known to improve insulin sensitivity in skeletal muscle [233]. One of the most interesting questions to arise from this thesis is whether the loss of skeletal muscle mass and suboptimal plasma insulin levels in ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice is associated with a reduction in exercise capacity. The effect of exercise on glucose uptake in skeletal muscle, adipocytes, liver, and pancreatic islets should be also assessed in ABCA1β-cell-/-

/ABCG1β-cell-/- DKO mice with and without apoA-I treatment.

Global ABCG1 knockout mice with conditional ABCA1 deletion in β-cells have increased islet macrophage infiltration and IL-1β expression [22]. This is also likely to be the case for the ABCA1β-cell-/-/ABCG1β-cell-/- DKO mice that were used in this project, as they have elevated plasma IL-6 and MCP-1 levels [187]. This suggests that immune cell profiling of these animals is worthy of exploration, and that macrophage infiltration as well as cytokine and chemokine expression profiles should be determined in their islets. As apoA-I is known to be profoundly anti-inflammatory, the ability of this apolipoprotein to inhibit immune cell infiltration and production of cytokines and chemokines in ABCA1β- cell-/-/ABCG1β-cell-/- DKO mouse islets should also be the focus of further studies.

In summary, the studies outlined in this thesis confirm that the presence of ABCA1 and

138 CHAPTER 7

ABCG1 in b-cells is critically important for maintaining islet cholesterol homeostasis and systemic glycemic control. More importantly, the results establish for the first time that

ABCG1 expression in b-cells is a key determinant of glucose disposal in skeletal muscle and that apoA-I treatment has the potential to improve b-cell function in mice. It remains to be determined if this is also the case in humans.

139

References

REFERENCES

1. WHO, Global Report on Diabetes. 2016.

2. Whiting, D.R., et al., IDF diabetes atlas: global estimates of the prevalence of diabetes for 2011 and 2030. Diabetes Res Clin Pract, 2011. 94(3): p. 311-21.

3. American Diabetes, A., Diagnosis and classification of diabetes mellitus. Diabetes Care, 2014. 37 Suppl 1: p. S81-90.

4. Olokoba, A.B., O.A. Obateru, and L.B. Olokoba, Type 2 diabetes mellitus: a review of current trends. Oman Med J, 2012. 27(4): p. 269-73.

5. Cerf, M.E., Beta cell dysfunction and insulin resistance. Front Endocrinol (Lausanne), 2013. 4: p. 37.

6. Costes, S., et al., beta-Cell failure in type 2 diabetes: a case of asking too much of too few? Diabetes, 2013. 62(2): p. 327-35.

7. Weir, G.C. and S. Bonner-Weir, Five stages of evolving beta-cell dysfunction during progression to diabetes. Diabetes, 2004. 53 Suppl 3: p. S16-21.

8. Brunham, L.R., et al., Beta-cell ABCA1 influences insulin secretion, glucose homeostasis and response to thiazolidinedione treatment. Nat Med, 2007. 13(3): p. 340-7.

9. Ishikawa, M., et al., Cholesterol accumulation and diabetes in pancreatic beta- cell-specific SREBP-2 transgenic mice: a new model for lipotoxicity. J Lipid Res, 2008. 49(12): p. 2524-34.

10. Hao, M., et al., Direct effect of cholesterol on insulin secretion: a novel mechanism for pancreatic beta-cell dysfunction. Diabetes, 2007. 56(9): p. 2328- 38.

11. Feng, B., et al., The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages. Nat Cell Biol, 2003. 5(9): p. 781-92.

12. Bjorkhem, I., Do oxysterols control cholesterol homeostasis? J Clin Invest, 2002. 110(6): p. 725-30.

13. Tabas, I., Consequences of cellular cholesterol accumulation: basic concepts and physiological implications. J Clin Invest, 2002. 110(7): p. 905-11.

14. Oram, J.F., et al., ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages. J Biol Chem, 2000. 275(44): p. 34508-11.

15. Kennedy, M.A., et al., ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation. Cell Metab, 2005. 1(2): p. 121- 31.

141 REFERENCES

16. Oram, J.F. and A.M. Vaughan, ABCA1-mediated transport of cellular cholesterol and phospholipids to HDL apolipoproteins. Curr Opin Lipidol, 2000. 11(3): p. 253- 60.

17. Aiello, R.J., et al., Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol, 2002. 22(4): p. 630-7.

18. Meurs, I., et al., The effect of ABCG1 deficiency on atherosclerotic lesion development in LDL receptor knockout mice depends on the stage of atherogenesis. Atherosclerosis, 2012. 221(1): p. 41-7.

19. Yvan-Charvet, L., et al., Combined deficiency of ABCA1 and ABCG1 promotes foam cell accumulation and accelerates atherosclerosis in mice. J Clin Invest, 2007. 117(12): p. 3900-8.

20. Pagler, T.A., et al., Deletion of ABCA1 and ABCG1 impairs macrophage migration because of increased Rac1 signaling. Circ Res, 2011. 108(2): p. 194-200.

21. Westerterp, M., et al., Deficiency of ATP-binding cassette transporters A1 and G1 in macrophages increases inflammation and accelerates atherosclerosis in mice. Circ Res, 2013. 112(11): p. 1456-65.

22. Kruit, J.K., et al., Loss of both ABCA1 and ABCG1 results in increased disturbances in islet sterol homeostasis, inflammation, and impaired beta-cell function. Diabetes, 2012. 61(3): p. 659-64.

23. Sturek, J.M., et al., An intracellular role for ABCG1-mediated cholesterol transport in the regulated secretory pathway of mouse pancreatic beta cells. J Clin Invest, 2010. 120(7): p. 2575-89.

24. Drake, R.L., et al., Gray's basic anatomy. 2012, Elsevier/Churchill Livingstone,: Philadelphia. p. 1 online resource (xx, 610 p.) col. ill.

25. Gardner, J.D., Regulation of pancreatic exocrine function in vitro: initial steps in the actions of secretagogues. Annu Rev Physiol, 1979. 41: p. 55-66.

26. Kim, S.K. and M. Hebrok, Intercellular signals regulating pancreas development and function. Genes Dev, 2001. 15(2): p. 111-27.

27. Gepts, W. and P.M. Lecompte, The pancreatic islets in diabetes. Am J Med, 1981. 70(1): p. 105-15.

28. Ebling, F.J., Homage to Paul Langerhans. J Invest Dermatol, 1980. 75(1): p. 3-5.

29. Dolensek, J., M.S. Rupnik, and A. Stozer, Structural similarities and differences between the human and the mouse pancreas. Islets, 2015. 7(1): p. e1024405.

30. Gomori, G., Observations with differential stains on human islets of langerhans. Am J Pathol, 1941. 17(3): p. 395-406 3.

142 REFERENCES

31. Wierup, N., et al., The ghrelin cell: a novel developmentally regulated islet cell in the human pancreas. Regul Pept, 2002. 107(1-3): p. 63-9.

32. Kim, A., et al., Islet architecture: A comparative study. Islets, 2009. 1(2): p. 129- 36.

33. Meier, J.J., et al., Beta-cell replication is the primary mechanism subserving the postnatal expansion of beta-cell mass in humans. Diabetes, 2008. 57(6): p. 1584- 94.

34. Steiner, D.J., et al., Pancreatic islet plasticity: interspecies comparison of islet architecture and composition. Islets, 2010. 2(3): p. 135-45.

35. Samols, E., S. Bonner-Weir, and G.C. Weir, Intra-islet insulin-glucagon- somatostatin relationships. Clin Endocrinol Metab, 1986. 15(1): p. 33-58.

36. Gromada, J., I. Franklin, and C.B. Wollheim, Alpha-cells of the endocrine pancreas: 35 years of research but the enigma remains. Endocr Rev, 2007. 28(1): p. 84-116.

37. Lacy, P.E., The pancreatic beta cell. Structure and function. N Engl J Med, 1967. 276(4): p. 187-95.

38. Cabrera, O., et al., The unique cytoarchitecture of human pancreatic islets has implications for islet cell function. Proc Natl Acad Sci U S A, 2006. 103(7): p. 2334- 9.

39. Brissova, M., et al., Assessment of human pancreatic islet architecture and composition by laser scanning confocal microscopy. J Histochem Cytochem, 2005. 53(9): p. 1087-97.

40. Weir, G.C. and S. Bonner-Weir, Pancreatic somatostatin. Adv Exp Med Biol, 1985. 188: p. 403-23.

41. Floyd, J.C., Jr., Pancreatic polypeptide. Clin Gastroenterol, 1980. 9(3): p. 657-78.

42. Lonovics, J., et al., Pancreatic polypeptide. A review. Arch Surg, 1981. 116(10): p. 1256-64.

43. Broglio, F., et al., Ghrelin: from somatotrope secretion to new perspectives in the regulation of peripheral metabolic functions. Front Horm Res, 2006. 35: p. 102-14.

44. Goodge, K.A. and J.C. Hutton, Translational regulation of proinsulin biosynthesis and proinsulin conversion in the pancreatic beta-cell. Semin Cell Dev Biol, 2000. 11(4): p. 235-42.

45. Olofsson, C.S., et al., Fast insulin secretion reflects exocytosis of docked granules in mouse pancreatic B-cells. Pflugers Arch, 2002. 444(1-2): p. 43-51.

46. Rorsman, P. and E. Renstrom, Insulin granule dynamics in pancreatic beta cells. Diabetologia, 2003. 46(8): p. 1029-45.

143 REFERENCES

47. Henquin, J.C., Triggering and amplifying pathways of regulation of insulin secretion by glucose. Diabetes, 2000. 49(11): p. 1751-60.

48. De Vos, A., et al., Human and rat beta cells differ in glucose transporter but not in glucokinase gene expression. J Clin Invest, 1995. 96(5): p. 2489-95.

49. Prentki, M., F.M. Matschinsky, and S.R. Madiraju, Metabolic signaling in fuel- induced insulin secretion. Cell Metab, 2013. 18(2): p. 162-85.

50. German, M.S., Glucose sensing in pancreatic islet beta cells: the key role of glucokinase and the glycolytic intermediates. Proc Natl Acad Sci U S A, 1993. 90(5): p. 1781-5.

51. Matschinsky, F., et al., Glucokinase as pancreatic beta cell glucose sensor and diabetes gene. J Clin Invest, 1993. 92(5): p. 2092-8.

52. Gasa, R., M.E. Fabregat, and R. Gomis, The role of glucose and its metabolism in the regulation of glucokinase expression in isolated human pancreatic islets. Biochem Biophys Res Commun, 2000. 268(2): p. 491-5.

53. Maechler, P. and C.B. Wollheim, Mitochondrial signals in glucose-stimulated insulin secretion in the beta cell. J Physiol, 2000. 529 Pt 1: p. 49-56.

54. Akram, M., Citric acid cycle and role of its intermediates in metabolism. Cell Biochem Biophys, 2014. 68(3): p. 475-8.

55. Maechler, P. and C.B. Wollheim, Mitochondrial function in normal and diabetic beta-cells. Nature, 2001. 414(6865): p. 807-12.

56. Macfarlane, W.M., et al., Glucose stimulates translocation of the homeodomain transcription factor PDX1 from the cytoplasm to the nucleus in pancreatic beta- cells. Journal of Biological Chemistry, 1999. 274(2): p. 1011-6.

57. Petersen, H.V., et al., Glucose stimulates the activation domain potential of the PDX-1 homeodomain transcription factor. FEBS Letters, 1998. 431(3): p. 362-6.

58. Wilcox, G., Insulin and insulin resistance. Clin Biochem Rev, 2005. 26(2): p. 19-39.

59. Kitabchi, A.E., et al., Properties of proinsulin and related polypeptides. CRC Crit Rev Biochem, 1972. 1(1): p. 59-94.

60. Ryle, A.P., et al., The disulphide bonds of insulin. Biochem J, 1955. 60(4): p. 541- 56.

61. Patzelt, C., et al., Detection and kinetic behavior of preproinsulin in pancreatic islets. Proc Natl Acad Sci U S A, 1978. 75(3): p. 1260-4.

62. Halban, P.A., Structural domains and molecular lifestyles of insulin and its precursors in the pancreatic beta cell. Diabetologia, 1991. 34(11): p. 767-78.

63. Kitabchi, A.E., Proinsulin and C-peptide: a review. Metabolism, 1977. 26(5): p. 547-87.

144 REFERENCES

64. Steiner, D.F., et al., Proinsulin and the biosynthesis of insulin. Recent Prog Horm Res, 1969. 25: p. 207-82.

65. Malaisse, W.J., Insulin biosynthesis and secretion in vitro. In: Alberti KGMM, Zimet., P., Defronzo, R.A, Keen, H. (editors). International Textbook of Diabetes Mellitus (2nd ed) John Wiley and Sones, New York, 1997: p. 315-336.

66. Cornier, M., et al., The Metabolic Syndrome. Endocrine Reviews, 2008. 29(7): p. 777-822.

67. Soria, B., et al., Novel players in pancreatic islet signaling: from membrane receptors to nuclear channels. Diabetes, 2004. 53(1): p. S86-91.

68. Robertson, R.P., et al., Glucose toxicity in beta-cells: type 2 diabetes, good radicals gone bad, and the glutathione connection. Diabetes, 2003. 52(3): p. 581- 7.

69. Krauss, S., et al., Superoxide-mediated activation of uncoupling protein 2 causes pancreatic beta cell dysfunction. J Clin Invest, 2003. 112(12): p. 1831-42.

70. Ihara, Y., et al., Hyperglycemia causes oxidative stress in pancreatic beta-cells of GK rats, a model of type 2 diabetes. Diabetes, 1999. 48(4): p. 927-32.

71. Kaneto, H., et al., Role of oxidative stress, endoplasmic reticulum stress, and c- Jun N-terminal kinase in pancreatic beta-cell dysfunction and insulin resistance. Int J Biochem Cell Biol, 2006. 38(5-6): p. 782-93.

72. Maedler, K., et al., FLIP switches Fas-mediated glucose signaling in human pancreatic beta cells from apoptosis to cell replication. Proc Natl Acad Sci U S A, 2002. 99(12): p. 8236-41.

73. Del Guerra, S., et al., Gliclazide protects human islet beta-cells from apoptosis induced by intermittent high glucose. Diabetes Metab Res Rev, 2007. 23(3): p. 234-8.

74. Buse, M.G., Hexosamines, insulin resistance, and the complications of diabetes: current status. Am J Physiol Endocrinol Metab, 2006. 290(1): p. E1-E8.

75. D'Alessandris, C., et al., Increased O-glycosylation of insulin signaling proteins results in their impaired activation and enhanced susceptibility to apoptosis in pancreatic beta-cells. FASEB J, 2004. 18(9): p. 959-61.

76. Unger, R.H., Lipotoxicity in the pathogenesis of obesity-dependent NIDDM. Genetic and clinical implications. Diabetes, 1995. 44(8): p. 863-70.

77. Lupi, R. and S. Del Prato, Beta-cell apoptosis in type 2 diabetes: quantitative and functional consequences. Diabetes Metab, 2008. 34 Suppl 2: p. S56-64.

78. Lupi, R., et al., Prolonged exposure to free fatty acids has cytostatic and pro- apoptotic effects on human pancreatic islets: evidence that beta-cell death is

145 REFERENCES

caspase mediated, partially dependent on ceramide pathway, and Bcl-2 regulated. Diabetes, 2002. 51(5): p. 1437-42.

79. Savage, D.B., K.F. Petersen, and G.I. Shulman, Disordered lipid metabolism and the pathogenesis of insulin resistance. Physiol Rev, 2007. 87(2): p. 507-20.

80. Marchetti, P., et al., The endoplasmic reticulum in pancreatic beta cells of type 2 diabetes patients. Diabetologia, 2007. 50(12): p. 2486-94.

81. Oyadomari, S., E. Araki, and M. Mori, Endoplasmic reticulum stress-mediated apoptosis in pancreatic beta-cells. Apoptosis, 2002. 7(4): p. 335-45.

82. Fonseca, S.G., J. Gromada, and F. Urano, Endoplasmic reticulum stress and pancreatic beta-cell death. Trends Endocrinol Metab, 2011. 22(7): p. 266-74.

83. Supale, S., et al., Mitochondrial dysfunction in pancreatic beta cells. Trends Endocrinol Metab, 2012. 23(9): p. 477-87.

84. Anello, M., et al., Functional and morphological alterations of mitochondria in pancreatic beta cells from type 2 diabetic patients. Diabetologia, 2005. 48(2): p. 282-9.

85. Detimary, P., et al., The changes in adenine nucleotides measured in glucose- stimulated rodent islets occur in beta cells but not in alpha cells and are also observed in human islets. J Biol Chem, 1998. 273(51): p. 33905-8.

86. Muoio, D.M. and C.B. Newgard, Mechanisms of disease:Molecular and metabolic mechanisms of insulin resistance and beta-cell failure in type 2 diabetes. Nat Rev Mol Cell Biol, 2008. 9(3): p. 193-205.

87. Donath, M.Y. and S.E. Shoelson, Type 2 diabetes as an inflammatory disease. Nat Rev Immunol, 2011. 11(2): p. 98-107.

88. Donath, M.Y., et al., Islet inflammation in type 2 diabetes: from metabolic stress to therapy. Diabetes Care, 2008. 31 Suppl 2: p. S161-4.

89. Ortis, F., et al., Induction of nuclear factor-kappaB and its downstream genes by TNF-alpha and IL-1beta has a pro-apoptotic role in pancreatic beta cells. Diabetologia, 2008. 51(7): p. 1213-25.

90. Mandrup-Poulsen, T., beta-cell apoptosis: stimuli and signaling. Diabetes, 2001. 50 Suppl 1: p. S58-63.

91. Hoppener, J.W., B. Ahren, and C.J. Lips, Islet amyloid and type 2 diabetes mellitus. N Engl J Med, 2000. 343(6): p. 411-9.

92. Hull, R.L., et al., Islet amyloid: a critical entity in the pathogenesis of type 2 diabetes. J Clin Endocrinol Metab, 2004. 89(8): p. 3629-43.

146 REFERENCES

93. Kahn, S.E., S. Andrikopoulos, and C.B. Verchere, Islet amyloid: a long-recognized but underappreciated pathological feature of type 2 diabetes. Diabetes, 1999. 48(2): p. 241-53.

94. Gulli, G., L. Rossetti, and R.A. DeFronzo, Hyperamylinemia is associated with hyperinsulinemia in the glucose-tolerant, insulin-resistant offspring of two Mexican-American non-insulin-dependent diabetic parents. Metabolism, 1997. 46(10): p. 1157-61.

95. Zhang, S., et al., Fibrillogenic amylin evokes islet beta-cell apoptosis through linked activation of a caspase cascade and JNK1. J Biol Chem, 2003. 278(52): p. 52810-9.

96. Kayed, R., et al., Permeabilization of lipid bilayers is a common conformation- dependent activity of soluble amyloid oligomers in protein misfolding diseases. J Biol Chem, 2004. 279(45): p. 46363-6.

97. Haataja, L., et al., Islet amyloid in type 2 diabetes, and the toxic oligomer hypothesis. Endocr Rev, 2008. 29(3): p. 303-16.

98. Mahley, R.W., et al., Plasma lipoproteins: apolipoprotein structure and function. J Lipid Res, 1984. 25(12): p. 1277-94.

99. Smith, L.C., H.J. Pownall, and A.M. Gotto, Jr., The plasma lipoproteins: structure and metabolism. Annu Rev Biochem, 1978. 47: p. 751-7.

100. Morrisett, J.D., R.L. Jackson, and A.M. Gotto, Jr., Lipoproteins: structure and function. Annu Rev Biochem, 1975. 44: p. 183-207.

101. Kontush, A., S. Chantepie, and M.J. Chapman, Small, dense HDL particles exert potent protection of atherogenic LDL against oxidative stress. Arterioscler Thromb Vasc Biol, 2003. 23(10): p. 1881-8.

102. Hussain, M.M., A proposed model for the assembly of chylomicrons. Atherosclerosis, 2000. 148(1): p. 1-15.

103. Zilversmit, D.B., The surface coat of chylomicrons: lipid chemistry. J Lipid Res, 1968. 9(2): p. 180-6.

104. Brown, W.V., R.I. Levy, and D.S. Fredrickson, Studies of the proteins in human plasma very low density lipoproteins. J Biol Chem, 1969. 244(20): p. 5687-94.

105. Segrest, J.P., et al., Structure of apolipoprotein B-100 in low density lipoproteins. J Lipid Res, 2001. 42(9): p. 1346-67.

106. Brown, M.S., J.R. Faust, and J.L. Goldstein, Role of the low density lipoprotein receptor in regulating the content of free and esterified cholesterol in human fibroblasts. J Clin Invest, 1975. 55(4): p. 783-93.

107. Goldstein, J.L., R.G. Anderson, and M.S. Brown, Coated pits, coated vesicles, and receptor-mediated endocytosis. Nature, 1979. 279(5715): p. 679-85.

147 REFERENCES

108. Rye, K.A., et al., The metabolism and anti-atherogenic properties of HDL. J Lipid Res, 2009. 50 Suppl: p. S195-200.

109. Rye, K.A. and P.J. Barter, Regulation of high-density lipoprotein metabolism. Circ Res, 2014. 114(1): p. 143-56.

110. Cheung, M.C. and J.J. Albers, Characterization of lipoprotein particles isolated by immunoaffinity chromatography. Particles containing A-I and A-II and particles containing A-I but no A-II. J Biol Chem, 1984. 259(19): p. 12201-9.

111. Blanche, P.J., et al., Characterization of human high-density lipoproteins by gradient gel electrophoresis. Biochim Biophys Acta, 1981. 665(3): p. 408-19.

112. Green, P.H., et al., Human apolipoprotein A-IV. Intestinal origin and distribution in plasma. J Clin Invest, 1980. 65(4): p. 911-9.

113. Pennacchio, L.A., et al., An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing. Science, 2001. 294(5540): p. 169- 73.

114. Curry, M.D., et al., Quantitative determination of apolipoproteins C-I and C-II in human plasma by separate electroimmunoassays. Clin Chem, 1981. 27(4): p. 543-8.

115. Brewer, H.B., Jr., et al., The complete amino acid sequence of alanine apolipoprotein (apoC-3), and apolipoprotein from human plasma very low density lipoproteins. J Biol Chem, 1974. 249(15): p. 4975-84.

116. Curry, M.D., W.J. McConathy, and P. Alaupovic, Quantitative determination of human apolipoprotein D by electroimmunoassay and radial immunodiffusion. Biochim Biophys Acta, 1977. 491(1): p. 232-41.

117. Shore, V.G. and B. Shore, Heterogeneity of human plasma very low density lipoproteins. Separation of species differing in protein components. Biochemistry, 1973. 12(3): p. 502-7.

118. de Silva, H.V., et al., Apolipoprotein J: structure and tissue distribution. Biochemistry, 1990. 29(22): p. 5380-9.

119. Duchateau, P.N., et al., Apolipoprotein L, a new human high density lipoprotein apolipoprotein expressed by the pancreas. Identification, cloning, characterization, and plasma distribution of apolipoprotein L. J Biol Chem, 1997. 272(41): p. 25576-82.

120. Wolfrum, C., M.N. Poy, and M. Stoffel, Apolipoprotein M is required for prebeta- HDL formation and cholesterol efflux to HDL and protects against atherosclerosis. Nat Med, 2005. 11(4): p. 418-22.

121. Cheung, M.C. and J.J. Albers, Distribution of high density lipoprotein particles with different apoprotein composition: particles with A-I and A-II and particles with A-I but no A-II. J Lipid Res, 1982. 23(5): p. 747-53.

148 REFERENCES

122. Castro, G.R. and C.J. Fielding, Early incorporation of cell-derived cholesterol into pre-beta-migrating high-density lipoprotein. Biochemistry, 1988. 27(1): p. 25-9.

123. Asztalos, B.F., et al., Normolipidemic subjects with low HDL cholesterol levels have altered HDL subpopulations. Arterioscler Thromb Vasc Biol, 1997. 17(10): p. 1885-93.

124. Asztalos, B.F., et al., Two-dimensional electrophoresis of plasma lipoproteins: recognition of new apo A-I-containing subpopulations. Biochim Biophys Acta, 1993. 1169(3): p. 291-300.

125. Kunitake, S.T., K.J. La Sala, and J.P. Kane, Apolipoprotein A-I-containing lipoproteins with pre-beta electrophoretic mobility. J Lipid Res, 1985. 26(5): p. 549-55.

126. Sparks, D.L., S. Lund-Katz, and M.C. Phillips, The charge and structural stability of apolipoprotein A-I in discoidal and spherical recombinant high density lipoprotein particles. J Biol Chem, 1992. 267(36): p. 25839-47.

127. Huang, Y., et al., A plasma lipoprotein containing only apolipoprotein E and with gamma mobility on electrophoresis releases cholesterol from cells. Proc Natl Acad Sci U S A, 1994. 91(5): p. 1834-8.

128. Duong, P.T., et al., Characterization and properties of pre beta-HDL particles formed by ABCA1-mediated cellular lipid efflux to apoA-I. J Lipid Res, 2008. 49(5): p. 1006-14.

129. Krimbou, L., et al., Structural and functional properties of human plasma high density-sized lipoprotein containing only apoE particles. J Lipid Res, 2003. 44(5): p. 884-92.

130. Davidson, W.S., et al., The molecular basis for the difference in charge between pre-beta- and alpha-migrating high density lipoproteins. J Biol Chem, 1994. 269(12): p. 8959-65.

131. Huang, Y., et al., Effects of the apolipoprotein E polymorphism on uptake and transfer of cell-derived cholesterol in plasma. J Clin Invest, 1995. 96(6): p. 2693- 701.

132. Toth, P.P., et al., High-density lipoproteins: A consensus statement from the National Lipid Association. J Clin Lipidol, 2013. 7(5): p. 484-525.

133. Lewis, G.F. and D.J. Rader, New insights into the regulation of HDL metabolism and reverse cholesterol transport. Circ Res, 2005. 96(12): p. 1221-32.

134. Yoshikawa, M., et al., HDL3 exerts more powerful anti-oxidative, protective effects against copper-catalyzed LDL oxidation than HDL2. Clin Biochem, 1997. 30(3): p. 221-5.

135. Murphy, A.J., et al., The anti inflammatory effects of high density lipoproteins. Curr Med Chem, 2009. 16(6): p. 667-75.

149 REFERENCES

136. Mineo, C., et al., Endothelial and antithrombotic actions of HDL. Circ Res, 2006. 98(11): p. 1352-64.

137. Segrest, J.P., et al., The amphipathic alpha helix: a multifunctional structural motif in plasma apolipoproteins. Adv Protein Chem, 1994. 45: p. 303-69.

138. Davidson, W.S. and T.B. Thompson, The structure of apolipoprotein A-I in high density lipoproteins. J Biol Chem, 2007. 282(31): p. 22249-53.

139. Segrest, J.P., et al., The amphipathic helix in the exchangeable apolipoproteins: a review of secondary structure and function. J Lipid Res, 1992. 33(2): p. 141-66.

140. Mishra, V.K., et al., Interactions of synthetic peptide analogs of the class A amphipathic helix with lipids. Evidence for the snorkel hypothesis. J Biol Chem, 1994. 269(10): p. 7185-91.

141. Hamilton, R.L., et al., Discoidal bilayer structure of nascent high density lipoproteins from perfused rat liver. Journal of Clinical Investigation, 1976. 58(3): p. 667-80.

142. Vedhachalam, C., et al., Mechanism of ATP-binding cassette transporter A1- mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles. J Biol Chem, 2007. 282(34): p. 25123-30.

143. Silva, R.A., et al., Structure of apolipoprotein A-I in spherical high density lipoproteins of different sizes. Proc Natl Acad Sci U S A, 2008. 105(34): p. 12176- 81.

144. Brouillette, C.G. and G.M. Anantharamaiah, Structural models of human apolipoprotein A-I. Biochimica et Biophysica Acta, 1995. 1256(2): p. 103-29.

145. Bhat, S., et al., Intermolecular contact between globular N-terminal fold and C- terminal domain of ApoA-I stabilizes its lipid-bound conformation: studies employing chemical cross-linking and mass spectrometry. J Biol Chem, 2005. 280(38): p. 33015-25.

146. Wang, N. and A.R. Tall, Regulation and mechanisms of ATP-binding cassette transporter A1-mediated cellular cholesterol efflux. Arterioscler Thromb Vasc Biol, 2003. 23(7): p. 1178-84.

147. Sorci-Thomas, M.G., S. Bhat, and M.J. Thomas, Activation of lecithin:cholesterol acyltransferase by HDL ApoA-I central helices. Clin Lipidol, 2009. 4(1): p. 113-124.

148. Zhang, Y., et al., Overexpression of apolipoprotein A-I promotes reverse transport of cholesterol from macrophages to feces in vivo. Circulation, 2003. 108(6): p. 661-3.

149. Plump, A.S., et al., ApoA-I knockout mice: characterization of HDL metabolism in homozygotes and identification of a post-RNA mechanism of apoA-I upregulation in heterozygotes. J Lipid Res, 1997. 38(5): p. 1033-47.

150 REFERENCES

150. Voyiaziakis, E., et al., ApoA-I deficiency causes both hypertriglyceridemia and increased atherosclerosis in human apoB transgenic mice. J Lipid Res, 1998. 39(2): p. 313-21.

151. Oram, J.F., Tangier disease and ABCA1. Biochim Biophys Acta, 2000. 1529(1-3): p. 321-30.

152. Han, R., et al., Apolipoprotein A-I stimulates AMP-activated protein kinase and improves glucose metabolism. Diabetologia, 2007. 50(9): p. 1960-8.

153. Stenkula, K.G., et al., Single injections of apoA-I acutely improve in vivo glucose tolerance in insulin-resistant mice. Diabetologia, 2014. 57(4): p. 797-800.

154. Barter, P.J., et al., Effect of torcetrapib on glucose, insulin, and hemoglobin A1c in subjects in the Investigation of Lipid Level Management to Understand its Impact in Atherosclerotic Events (ILLUMINATE) trial. Circulation, 2011. 124(5): p. 555-62.

155. Dean, M., Y. Hamon, and G. Chimini, The human ATP-binding cassette (ABC) transporter superfamily. J Lipid Res, 2001. 42(7): p. 1007-17.

156. Klein, I., B. Sarkadi, and A. Varadi, An inventory of the human ABC proteins. Biochim Biophys Acta, 1999. 1461(2): p. 237-62.

157. Kielar, D., et al., Rapid quantification of human ABCA1 mRNA in various cell types and tissues by real-time reverse transcription-PCR. Clin Chem, 2001. 47(12): p. 2089-97.

158. Orso, E., et al., Transport of lipids from golgi to plasma membrane is defective in tangier disease patients and Abc1-deficient mice. Nat Genet, 2000. 24(2): p. 192- 6.

159. Tall, A.R., An overview of reverse cholesterol transport. Eur Heart J, 1998. 19 Suppl A: p. A31-5.

160. Wang, N., et al., ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J Biol Chem, 2001. 276(26): p. 23742-7.

161. Singaraja, R.R., et al., Increased ABCA1 activity protects against atherosclerosis. J Clin Invest, 2002. 110(1): p. 35-42.

162. Singaraja, R.R., et al., Both hepatic and extrahepatic ABCA1 have discrete and essential functions in the maintenance of plasma high-density lipoprotein cholesterol levels in vivo. Circulation, 2006. 114(12): p. 1301-9.

163. Hong, S.H., et al., ABCA1(Alabama): a novel variant associated with HDL deficiency and premature coronary artery disease. Atherosclerosis, 2002. 164(2): p. 245-50.

164. Croop, J.M., et al., Isolation and characterization of a mammalian homolog of the Drosophila white gene. Gene, 1997. 185(1): p. 77-85.

151 REFERENCES

165. Klucken, J., et al., ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc Natl Acad Sci U S A, 2000. 97(2): p. 817-22.

166. Vaughan, A.M. and J.F. Oram, ABCG1 redistributes cell cholesterol to domains removable by high density lipoprotein but not by lipid-depleted apolipoproteins. J Biol Chem, 2005. 280(34): p. 30150-7.

167. Wang, N., et al., ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci U S A, 2004. 101(26): p. 9774-9.

168. von Eckardstein, A., H. Schulte, and G. Assmann, Risk for diabetes mellitus in middle-aged Caucasian male participants of the PROCAM study: implications for the definition of impaired fasting glucose by the American Diabetes Association. Prospective Cardiovascular Munster. J Clin Endocrinol Metab, 2000. 85(9): p. 3101-8.

169. Kruit, J.K., et al., Islet cholesterol accumulation due to loss of ABCA1 leads to impaired exocytosis of insulin granules. Diabetes, 2011. 60(12): p. 3186-96.

170. Peyot, M.L., et al., Beta-cell failure in diet-induced obese mice stratified according to body weight gain: secretory dysfunction and altered islet lipid metabolism without steatosis or reduced beta-cell mass. Diabetes, 2010. 59(9): p. 2178-87.

171. Donath, M.Y., et al., Mechanisms of beta-cell death in type 2 diabetes. Diabetes, 2005. 54(2): p. S108-13.

172. Drew, B.G., et al., High-density lipoprotein modulates glucose metabolism in patients with type 2 diabetes mellitus. Circulation, 2009. 119(15): p. 2103-11.

173. Fryirs, M.A., et al., Effects of high-density lipoproteins on pancreatic beta-cell insulin secretion. Arterioscler Thromb Vasc Biol, 2010. 30(8): p. 1642-8.

174. Cochran, B.J., et al., Apolipoprotein A-I increases insulin secretion and production from pancreatic beta-cells via a G-protein-cAMP-PKA-FoxO1- dependent mechanism. Arterioscler Thromb Vasc Biol, 2014. 34(10): p. 2261-7.

175. Rye, K.A., K.H. Garrety, and P.J. Barter, Preparation and characterization of spheroidal, reconstituted high-density lipoproteins with apolipoprotein A-I only or with apolipoprotein A-I and A-II. Biochim Biophys Acta, 1993. 1167(3): p. 316- 25.

176. Osborne, J.C., Jr., Delipidation of plasma lipoproteins. Methods Enzymol, 1986. 128: p. 213-22.

177. Weisweiler, P., Isolation and quantitation of apolipoproteins A-I and A-II from human high-density lipoproteins by fast-protein liquid chromatography. Clin Chim Acta, 1987. 169(2-3): p. 249-54.

152 REFERENCES

178. Eugui, J., et al., Immunoturbidimetry of serum apolipoproteins A-I and B on the Cobas Bio centrifugal analyzer: method validation and reference values. Clin Biochem, 1994. 27(4): p. 310-5.

179. Stahler, F., et al., [A practical enzymatic cholesterol determination]. Med Lab (Stuttg), 1977. 30(2): p. 29-37.

180. Allen, J.K., et al., An enzymic and centrifugal method for estimating high-density lipoprotein cholesterol. Clin Chem, 1979. 25(2): p. 325-7.

181. Oram, J.F. and R.M. Lawn, ABCA1. The gatekeeper for eliminating excess tissue cholesterol. J Lipid Res, 2001. 42(8): p. 1173-9.

182. Wang, X., et al., Macrophage ABCA1 and ABCG1, but not SR-BI, promote macrophage reverse cholesterol transport in vivo. J Clin Invest, 2007. 117(8): p. 2216-24.

183. Tushuizen, M.E., et al., Pancreatic fat content and beta-cell function in men with and without type 2 diabetes. Diabetes Care, 2007. 30(11): p. 2916-21.

184. Timmins, J.M., et al., Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest, 2005. 115(5): p. 1333-42.

185. Westerterp, M., et al., Regulation of hematopoietic stem and progenitor cell mobilization by cholesterol efflux pathways. Cell Stem Cell, 2012. 11(2): p. 195- 206.

186. Postic, C., et al., Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J Biol Chem, 1999. 274(1): p. 305-15.

187. Cochran, B.J., et al., Impact of Perturbed Pancreatic beta-Cell Cholesterol Homeostasis on Adipose Tissue and Skeletal Muscle Metabolism. Diabetes, 2016. 65(12): p. 3610-3620.

188. Soro, A., et al., Determinants of low HDL levels in familial combined hyperlipidemia. J Lipid Res, 2003. 44(8): p. 1536-44.

189. Taskinen, M.R., Diabetic dyslipidaemia: from basic research to clinical practice. Diabetologia, 2003. 46(6): p. 733-49.

190. Kruit, J.K., et al., Cholesterol efflux via ATP-binding cassette transporter A1 (ABCA1) and cholesterol uptake via the LDL receptor influences cholesterol- induced impairment of beta cell function in mice. Diabetologia, 2010. 53(6): p. 1110-9.

191. Kritharides, L., et al., A method for defining the stages of low-density lipoprotein oxidation by the separation of cholesterol- and cholesteryl ester-oxidation products using HPLC. Anal Biochem, 1993. 213(1): p. 79-89.

153 REFERENCES

192. Porte, D., Jr. and S.E. Kahn, beta-cell dysfunction and failure in type 2 diabetes: potential mechanisms. Diabetes, 2001. 50 Suppl 1: p. S160-3.

193. Brunham, L.R., et al., Cholesterol in islet dysfunction and type 2 diabetes. J Clin Invest, 2008. 118(2): p. 403-8.

194. Villarreal-Molina, M.T., et al., The ATP-binding cassette transporter A1 R230C variant affects HDL cholesterol levels and BMI in the Mexican population: association with obesity and obesity-related comorbidities. Diabetes, 2007. 56(7): p. 1881-7.

195. Villarreal-Molina, M.T., et al., Association of the ATP-binding cassette transporter A1 R230C variant with early-onset type 2 diabetes in a Mexican population. Diabetes, 2008. 57(2): p. 509-13.

196. McGuinness, O.P., et al., NIH experiment in centralized mouse phenotyping: the Vanderbilt experience and recommendations for evaluating glucose homeostasis in the mouse. American journal of physiology. Endocrinology and metabolism, 2009. 297(4): p. E849-55.

197. Stamateris, R.E., et al., Adaptive beta-cell proliferation increases early in high-fat feeding in mice, concurrent with metabolic changes, with induction of islet cyclin D2 expression. Am J Physiol Endocrinol Metab, 2013. 305(1): p. E149-59.

198. Kahn, S.E., et al., The beta cell lesion in type 2 diabetes: there has to be a primary functional abnormality. Diabetologia, 2009. 52(6): p. 1003-12.

199. Poitout, V., et al., Glucolipotoxicity of the pancreatic beta cell. Biochim Biophys Acta, 2010. 1801(3): p. 289-98.

200. Donath, M.Y., et al., Islet inflammation impairs the pancreatic beta-cell in type 2 diabetes. Physiology (Bethesda), 2009. 24: p. 325-31.

201. Brown, M.S. and J.L. Goldstein, Expression of the familial hypercholesterolemia gene in heterozygotes: mechanism for a dominant disorder in man. Science, 1974. 185(4145): p. 61-3.

202. Brown, M.S., S.E. Dana, and J.L. Goldstein, Receptor-dependent hydrolysis of cholesteryl esters contained in plasma low density lipoprotein. Proc Natl Acad Sci U S A, 1975. 72(8): p. 2925-9.

203. Goldstein, J.L., R.A. DeBose-Boyd, and M.S. Brown, Protein sensors for membrane sterols. Cell, 2006. 124(1): p. 35-46.

204. Horton, J.D., J.L. Goldstein, and M.S. Brown, SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest, 2002. 109(9): p. 1125-31.

205. Tabet, F. and K.A. Rye, High-density lipoproteins, inflammation and oxidative stress. Clin Sci (Lond), 2009. 116(2): p. 87-98.

154 REFERENCES

206. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8.

207. Janowski, B.A., The hypocholesterolemic agent LY295427 up-regulates INSIG-1, identifying the INSIG-1 protein as a mediator of cholesterol homeostasis through SREBP. Proc Natl Acad Sci U S A, 2002. 99(20): p. 12675-80.

208. Dong, X.Y. and S.Q. Tang, Insulin-induced gene: a new regulator in lipid metabolism. Peptides, 2010. 31(11): p. 2145-50.

209. Horton, J.D., et al., Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A, 2003. 100(21): p. 12027-32.

210. Bommer, G.T. and O.A. MacDougald, Regulation of lipid homeostasis by the bifunctional SREBF2-miR33a locus. Cell Metab, 2011. 13(3): p. 241-7.

211. Lin, J., C. Handschin, and B.M. Spiegelman, Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab, 2005. 1(6): p. 361-70.

212. Ling, C., et al., Epigenetic regulation of PPARGC1A in human type 2 diabetic islets and effect on insulin secretion. Diabetologia, 2008. 51(4): p. 615-22.

213. Kaneko, Y., et al., Dual effect of nitric oxide on cytosolic Ca2+ concentration and insulin secretion in rat pancreatic beta-cells. Am J Physiol Cell Physiol, 2003. 284(5): p. C1215-22.

214. Smukler, S.R., et al., Exogenous nitric oxide and endogenous glucose-stimulated beta-cell nitric oxide augment insulin release. Diabetes, 2002. 51(12): p. 3450- 60.

215. Jacob, A., et al., MKP-1 expression and stabilization and cGK Ialpha prevent diabetes- associated abnormalities in VSMC migration. Am J Physiol Cell Physiol, 2004. 287(4): p. C1077-86.

216. Zanetti, M., et al., Dysregulation of the endothelial nitric oxide synthase-soluble guanylate cyclase pathway is normalized by insulin in the aorta of diabetic rat. Atherosclerosis, 2005. 181(1): p. 69-73.

217. Liu, S., et al., Glucose down-regulation of cGMP-dependent protein kinase I expression in vascular smooth muscle cells involves NAD(P)H oxidase-derived reactive oxygen species. Free Radic Biol Med, 2007. 42(6): p. 852-63.

218. Chen, L., et al., Regulation of beta-cell glucose transporter gene expression. Proc Natl Acad Sci U S A, 1990. 87(11): p. 4088-92.

219. Guillam, M.T., P. Dupraz, and B. Thorens, Glucose uptake, utilization, and signaling in GLUT2-null islets. Diabetes, 2000. 49(9): p. 1485-91.

155 REFERENCES

220. Barroso, I., et al., Candidate gene association study in type 2 diabetes indicates a role for genes involved in beta-cell function as well as insulin action. PLoS Biol, 2003. 1(1): p. E20.

221. McCurdy, C.E., et al., Attenuated Pik3r1 expression prevents insulin resistance and adipose tissue macrophage accumulation in diet-induced obese mice. Diabetes, 2012. 61(10): p. 2495-505.

222. Maedler, K., et al., Glucose-induced beta cell production of IL-1beta contributes to glucotoxicity in human pancreatic islets. J Clin Invest, 2002. 110(6): p. 851-60.

223. Kishore, U., et al., Surfactant proteins SP-A and SP-D: structure, function and receptors. Mol Immunol, 2006. 43(9): p. 1293-315.

224. Vestal, D.J. and J.A. Jeyaratnam, The guanylate-binding proteins: emerging insights into the biochemical properties and functions of this family of large interferon-induced guanosine triphosphatase. J Interferon Cytokine Res, 2011. 31(1): p. 89-97.

225. Cochran, B.J., et al., Impact of Perturbed Pancreatic beta-cell Cholesterol Homeostasis on Adipose Tissue and Skeletal Muscle Metabolism. Diabetes, 2016.

226. Clardy, S.M., et al., Rapid, high efficiency isolation of pancreatic ss-cells. Sci Rep, 2015. 5: p. 13681.

227. Blaak, E., Gender differences in fat metabolism. Curr Opin Clin Nutr Metab Care, 2001. 4(6): p. 499-502.

228. Vaughan, A.M. and J.F. Oram, ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL. J Lipid Res, 2006. 47(11): p. 2433-43.

229. Fu, Y., et al., ABCA12 regulates ABCA1-dependent cholesterol efflux from macrophages and the development of atherosclerosis. Cell Metab, 2013. 18(2): p. 225-38.

230. Berger, M., et al., Glucose metabolism in perfused skeletal muscle. Effects of starvation, diabetes, fatty acids, acetoacetate, insulin and exercise on glucose uptake and disposition. Biochem J, 1976. 158(2): p. 191-202.

231. Dalla-Riva, J., et al., Discoidal HDL and apoA-I-derived peptides improve glucose uptake in skeletal muscle. Journal of Lipid Research, 2013. 13: p. 13.

232. Zhang, Q., et al., High density lipoprotein (HDL) promotes glucose uptake in adipocytes and glycogen synthesis in muscle cells. PLoS One, 2011. 6(8): p. 19.

233. Stanford, K.I. and L.J. Goodyear, Exercise and type 2 diabetes: molecular mechanisms regulating glucose uptake in skeletal muscle. Adv Physiol Educ, 2014. 38(4): p. 308-14.

156