Netrin-1 Induces Apoptosis in Human Cervical Tumor Cells Via The

Research Article

Netrin-1 Induces Apoptosis in Human Cervical Tumor Cells via the TAp73A Tumor Suppressor Jean-Pierre Roperch,1 Karima El Ouadrani,1 Ann Hendrix,2,3 Shahin Emami,1 Olivier De Wever,1,2 Gerry Melino,4 and Christian Gespach1

1Institut National de la Sante et de la Recherche Medicale U673 Molecular and Clinical Oncology of Solid Tumors and Institut National de la Sante et de la Recherche Medicale U893; Universite´Pierre et Marie Curie-Paris 6, Faculte´deMe´decine, Hoˆpital Saint-Antoine, Paris, France; 2Laboratory of Experimental Cancerology and 3Department of Medical Oncology, Gent University Hospital, Gent, Belgium; and 4Medical Research Council, Toxicology Unit, Leicester University, Leicester, United Kingdom

Abstract loss of heterozygosity (LOH) of chromosome 18q, including the Netrins and their receptors deleted in colon cancer (DCC), DCC locus, has been described (1). Similarly, homozygous deletions neogenin, UNC5, and integrins are involved in axon guidance, and point mutations have been detected in colorectal, testicular, epithelial morphogenesis, vascular pattering, cancer cell and pancreatic cancers. Netrin receptors DCC and UNC5 family are survival, invasion, tumor angiogenesis, and metastasis. Here, down-regulated in over half of all colorectal cancers. In addition, we considered the possible contribution of the p53-related epigenetic inactivation of DCC and UNC5C genes has been apoptosis mediators p63and p73in the mechanisms described after promoter hypermethylation and gene silencing, underlying the antagonism between netrin-1 and DCC at the suggesting that they function as putative tumor suppressor genes cell death control. We have showed that ectopic expression in many tumor types, including human solid tumors and acute and external addition of netrin-1 in HeLa and HEK-293cells lymphoblastic leukemia (2–6). These genetic, epigenetic, and with inactive p53lead to impaired cell viability and induction molecular alterations are also found in brain, breast, urogenital, of apoptosis. These responses were associated with up- and digestive cancers (7). The tumor suppressive functions of DCC regulation of the proapoptotic protein TAp73A, decreased and UNC5H are linked to their ability to induce apoptosis when Bcl-2/Bax ratio, and caspase-3cleavage, with no change in they are not engaged with their ligands netrins (7, 8). The three protein levels of the antiapoptotic NH2-terminal–truncated secreted netrins-1, netrin-3, and netrin-4 in mammals belong to a #Np73A isoform, p73adapter Yap-1 and p73E3ubiquitin conserved family of guidance clues related to the matricellular ligase Itch, and p63, as well as the transcripts encoding protein laminin. The netrin signaling pathways are also initiated p63, TAp73A, and #Np73A. However, the proteasome inhi- through the transmembrane receptors neogenin and integrins, and bitor MG132 potentiated, while DCC counteracted, netrin- multiple downstream cascades using focal adhesion kinase (FAK), 1–induced TAp73A. Consistently, netrin-1 expression corre- src and Fyn tyrosine kinases, and the Rho-GTPases. Thus, netrins lated with stabilization of the TAp73A protein and lower levels signal via the simultaneous activation of several receptor subtypes of TAp73A ubiquitination that was conversely enhanced by and signal transduction pathways involved in critical cellular and DCC, in a netrin-dependent manner. Our data indicate that molecular mechanisms linked to tumor progression, including netrin-1 selectively up-regulates TAp73A by preventing its cancer cell survival, tumor angiogenesis, invasion, and metastasis ubiquitination and degradation. Targeted repression of p73A (9–14). by shRNA reversed TAp73A and the apoptosis induced by Despite intensive efforts to delineate the intracellular mecha- netrin-1, and exacerbated the growth of HeLa tumor xeno- nisms of netrin signaling in normal and transformed cells, little is grafts. Apoptosis induced by cisplatin was markedly enhanced known on the pathways underlying the antagonism between DCC in netrin-1 or DCC-expressing cells. Collectively, our data and netrin in cancer cell survival. Apoptosis induced by DCC is reveal that the transcriptionally active TAp73A tumor sup- dependent on caspase activation but independent of the intrinsic pressor is implicated in the apoptosis induced by netrin-1 in a mitochondrial and the extrinsic death receptor–mediated path- p53-independent and DCC/ubiquitin-proteasome dependent ways (7, 14). However, the possible implication of the p53 family manner. [Cancer Res 2008;68(20):8231–9] members in the netrin-1 and DCC pathways on these mechanisms has not been explored, until now. The p53 family members include Introduction the p63 and 73 tumor suppressor proteins involved in cell cycle regulation, DNA repair, apoptosis, and transcription of cell Alterations in the molecular integrity and expression of deleted proliferation and survival genes (15). In addition, structural in colorectal Cancer (DCC) and netrin-1 have been reported in homologies, as well as molecular interactions and permissive or several human cancers. In a large fraction of colorectal cancers, antagonistic regulations between these wild-type (wt) and mutated proteins are detected in several models (16–18). Similarly to p53, p73 can promote growth arrest or apoptosis when overexpressed in Note: Supplementary data for this article are available at Cancer Research Online certain p53-null tumor cells. All p53 family members contain the (http://cancerres.aacrjournals.org/). NH2-terminal transactivation (TA) domain for recruitment of core J-P. Roperch, K. El Ouadrani, O. De Wever, and G. Melino contributed equally to this work. transcriptional factors, a DNA-binding domain for recognition of Requests for reprints: Christian Gespach, Institut National de la Sante et de la promoter sequences, and an oligomerization domain for tetrame- Recherche Medicale, U673-U893, Hoˆpital Saint-Antoine, 75571 Paris Cedex 12, France. rization. Similarly to the TP63 gene, the TP73 encodes several Phone: 33-1-43453477; Fax: 33-1-49384694; E-mail: [email protected]. I2008 American Association for Cancer Research. NH2- and COOH-terminal isoforms with opposing functions and is doi:10.1158/0008-5472.CAN-08-1483 rarely mutated in human tumors (15). These additional motifs www.aacrjournals.org 8231 Cancer Res 2008; 68: (20). October 15, 2008

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. Cancer Research found in both p63 and 73, but not in p53, are created by a HEK-293 cells, human papillomavirus E6 in HeLa cells, as well as combination of two alternative promoters, leading to the synthesis SV40 large T, inactivate p53 by protein-protein interaction but do of NH2-terminal isoforms (TAp73 and DNp73), and alternative not seem to interact with p73 (23). splicing variants at the COOH-terminal exons 10 to 14. TAp73a is transactivation active and is proapoptotic, whereas DNp73a is not. Materials and Methods The COOH-terminal isoforms TAp73a are different according to Cell culture conditions, expression vectors, and transfections. the sterile a motif (SAM) domain and the transcription inhibitory Human cervical and kidney cell lines HeLa and HEK-293 cells were D a domain (17, 19). The NH2 terminally truncated Np73 proteins cultured at 37jC in DMEM without antibiotics (Invitrogen) supplemented interfere with the transactivation function of TAp73a and p53 in a with 10% FCS (PAA Laboratories). Ectopic expression of netrin-1 and dominant-negative manner, inhibiting apoptosis (20, 21). Moreover, DCC was achieved by transient transfection of HeLa and HEK-293 cells DNp73a is up-regulated in several cancers and is therefore (2.5 Â 105) using either the pcDNA3.1-Netrin-1 vector encoding myc-tagged associated with advanced pathologic states and poor prognosis chicken netrin, or the pCMV-DCC vector encoding the full-length human features in human colon and breast cancers and in patients DCC, and their combination, as described (14). The pcDNA3 vector suffering from neuroblastoma (19, 22). Because the TP53 tumor encoding E2F1 (24) was a generous gift from Dr. C. Prives, Columbia suppressor gene is frequently lost and invalidated by LOH and University, New York, NY. Empty pcDNA3.1 vector was used to keep the mutational alterations in human solid tumors, we decided to focus amount of DNA constant. Cells were transiently transfected for 6 h at 70% to 90% confluency, using the plasmid DNA (up to 2 Ag) mixed with the on the two p53 homologues p73 and p63, rarely mutated in cancer, Lipofectamine 2000 reagent (Invitrogen) at the DNA (Ag)/lipid (AL) ratio of investigating their potential role in the netrin-1 and DCC anta- 1:2.5. Transfected cells were then cultured in fresh medium for up to 24 to gonism on cell viability and apoptosis. For this purpose, we 48 h and harvested for transgene expression and other assays. Silencing of examined the relationships between netrin-1, cancer cell survival, p73 was performed with SureSilencing p73-shRNA plasmids (Super Array- and the p73 and p63 status in the p53-deficient HeLa and HEK-293 Bioscience Corporation) containing 4 pooled shRNA sequences to ensure an cell lines. Indeed, viral oncoproteins such adenovirus 5 E1B in effective depletion of the six p73 isoforms in HeLa and HEK-293 cells. Each

Figure 1. Impact of Netrin-1 and DCC on cell viability, apoptosis, and the cell cycle. HeLa cells were transiently transfected with expression vectors encoding either Netrin-1, DCC, and their combination (Net + DCC), and compared with control vector–transfected cells, as described in Materials and Methods. A, cell viability was evaluated by the MTT assay. Colorimetric evaluation was performed using a spectrophotometer at 570 nm. Data are expressed as the percentage of the control values measured in sham-transfected cells (control vector). B, distribution of HeLa cells along the cell cycle phases was quantified by FACS analysis in propidium iodide-stained cells after transient transfection of HeLa cells as indicated above. Data are expressed as the percentage of HeLa cells at the sub-G1 fraction (apoptotic cells, top) and those found at the other phases of the cell cycle (bottom); C, cell apoptosis was determined in the same experimental conditions by the TUNEL assay and FACS analysis to determine the percentage of apoptotic cells at the sub-G1 fraction. Data are means F SE of at least three separate experiments. Significant differences versus control vector were as follows: *, P < 0.05; **, P < 0.001 in A;*,P < 0.05 in B;*,P < 0.05; **, P < 0.01; ***, P < 0.001 in C; #, P < 0.001 versus DCC vector in C.

Cancer Res 2008; 68: (20). October 15, 2008 8232 www.aacrjournals.org

Figure 2. Induction of the TAp73a protein levels by Netrin-1 is associated with the divergent regulation of the apoptosis-related proteins Bcl-2 and Bax in p53-deficient cells. Comparative immunoblot analysis of the TAp73a, DNp73a, p63a, Bcl2, Bax, and caspase-3 proteins in HeLa cells (A) and HEK-293 cells (B) transiently transfected with control vector and expression vector encoding Netrin-1. Both HeLa and HEK-293 cells were harvested at 48 h posttransfection. Total cell lysates were analyzed by immunoblotting using the corresponding antibodies. Endogenous h-actin protein levels was used as loading control. C, expression levels of the transcripts encoding TAp73a, DNp73a, and Netrin-1, versus h-actin by semiquantitative RT-PCR in HeLa cells transiently transfected by the control and netrin vectors (left). Right, quantification of the endogenous levels of the TA- and DN73a transcripts by SYBR-Green qRT-PCR in HeLa cells transiently transfected with control and expression vectors encoding Netrin-1, DCC, and E2F-1 transcription factor as a positive control for P73a gene induction. Results of the real-time PCR are represented as CT values, where CT was defined as the threshold cycle number of PCRs at which amplified product was first detected. Changes in gene expression were calculated using relative quantification as follows: Ct = Cta À Ctb , where Ct is the cycle number at which amplification increases above the background threshold, Ct is the change in Ct between two test samples, a is the target gene, and b is the calibrator gene (h-actin). The amount of gene expression, present at the beginning of the reaction, was then calculated using 2ÀDDCt method. Significantly different at P < 0.01 (*) versus control vector–transfected cells.

vector expresses a short hairpin RNA (shRNA), under the control of the netrin-1, DCC, and E2F1 expression vectors. The real-time PCR reactions U1 promoter. The shRNA-p73 sequences are as follows: (+1474) typically contained 1 AL of each gene-specific primer (final concentration, 5¶-TGTCCAAACTGCATCGAGTAT-3¶; (+655) 5¶-GGCAATAATCTCTCGCAG- 0.5 Amol/L), 10 mL SYBR Green PCR Master Mix (2Â; from Roche Applied TAT-3¶; (+750) 5¶-CACCATCCTGTACAACTTCAT-3¶; (+178) Biosystems), and 2 mL of the diluted cDNAs (1:10) in a total volume of 5¶-TCTGTCATGGCCCAGTTCAAT-3¶, and GGAATCTCATTCGATGCATAC 20 mL. Primers for qRT-PCR analysis were as follows: TAp73a, 106 bp: for the scrambled control sequence (sh-CON). For stable transfection, HeLa forward 5¶ CCTCTGGAGCTCTCTGGAAC 3¶, reverse 5¶ GAAGACGTC- cells were selected for 2 wk in 1 mg/mL G418-containing medium. Two CATGCTGGAAT 3¶; DNp73a, bp107: forward 5¶ CAGCCAGTTGACAGAAC- control clones (sh-CON, clones 1 and 3) and two clones of p73-silenced TAAGG 3¶, reverse 5¶ AGAGGCTCCGCAGCTAGTGA 3¶; and Actin, 90 bp: HeLa cells (shRNA-p73, clones 1 and 2) were then further selected and forward 5¶ GGATGCAGAAGGAGATCACTG 3¶, reverse 5¶ CGATCCACACG- characterized. GAGTACTTG 3¶. The quantitative PCR reactions were performed in Semiquantitative and real-time quantitative reverse transcription duplicate using a LightCycler 480 Real-Time PCR Systems (Roche Applied PCR analysis. Total RNA was extracted from HeLa and HEK293 cells using Science). The thermal cycling conditions included an initial denaturation the RNAeasy Mini kit (Qiagen). For semiquantitative and qRT-PCR, total step at 95jC for 10 min, 40 cycles at 95jC for 15 s, and 63jC for 1 min. RNA (2–2.5 Ag) was reverse transcribed using the Superscript III First- Western blot analysis. Immunoblot analysis was performed essentially Strand Synthesis kit (Invitrogen). The relative levels of the h-actin and p73a as described (14). The blots were probed for 1 h at room temperature with isoforms transcripts were evaluated using a denaturation step at 95jCfor one of the after primary monoclonal (mAb) or polyclonal (pAb) antibodies: 5 min, followed by 30 cycles at 95jC for 30 s. Primers were as follows: the pAb directed against the SAM domain SAM of human p73a (1:2,000 forward 5¶-ACCAGACAGCACCTACTTCG-3¶, reverse 5¶-TCGAAGGTG- dilution) and p63a (1:1,000) as described (25); the pAb directed against GAGCTGGGTTG-3¶ (TAp73a, amplicon: 252 bp); forward 5¶-AAGC- phosphorylated p73a at Y-99 (1:1,000; Genescript Corporation); the pAbs GAAAATGCCAACAAAC-3¶, reverse 5¶-CACCGACGTACAGCATGGTA-3¶ against h-actin (1:1,000), human p63a (1:500), DCC (1:500), Yap-1 (1:250), (DN-p73a, 213 bp); forward 5¶-AACGTCACGCTCACACTGTC-3¶, reverse and Bax (1:250) are from Santa Cruz Biotechnology; the mAbs against 5¶-GAGTCGTCCTCGTTCTCGTC-3¶ (Netrin-1, 404 bp); forward 5¶- cleaved caspase-3 (1:500) and chicken netrin-1 (1:250) are from Cell AGAAAATCTGGCACCACACC-3¶, reverse 5¶-CCATCTCTTGCTCGAAGTCC- Signaling and R&D Systems, respectively; the Itch pAb (1:500) and the mAbs 3¶ (h-actin, 434 bp). The cDNAs used in quantitative PCR were synthesized against Bcl-2 (1:500) were from BD Transduction Laboratories. Membranes from 2 Ag total RNA extracted from 2 independent experiments using the were reprobed for 1 h with the appropriate peroxidase-conjugated www.aacrjournals.org 8233 Cancer Res 2008; 68: (20). October 15, 2008

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. Cancer Research secondary antibodies in blocking buffer (1:10,000; Santa Cruz Biotechnol- sample buffer, denatured for 5 min at 95jC, and loaded onto 10% ogy). Signals were visualized with the enhanced chemiluminescence polyacrylamide-SDS gels before being subjected to Western blotting with Western blotting detection system (GE Healthcare), and quantified by the p73a anti-SAM domain pAb (25). For the determination of TA-73a densitometric analysis, using ImageQuant software and digital scanning protein stability, HEK-293 cells were cotransfected for 24 h with a 1:5 ratio (Agfa). for the TAp73a/pcDNA3 and TAp73a/Netrin-1 plasmids (3 Ag total DNA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, apo- Cells were then treated with 50 Ag/mL cycloheximide (Sigma), and whole ptosis, and fluorescence-activated cell sorting analyses. HeLa and HEK- cell lysates were processed at the indicated time points for immunoblot 293 cells (2 Â 104 cells per well) transiently transfected for 24 h by the analysis. The relative amount of TA-p73a protein was evaluated by control vector and the netrin-1 and DCC expression vectors were treated for densitometry and normalized to h-actin signals. 48 h with either 10 Amol/L cisplatin or 0.6 Amol/L doxorubicin. Then, cultured cells were subjected to the 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay (Sigma). Cell cycle phase Results distribution and apoptosis in sub-G1 fractions were analyzed by flow cytometry of propidium iodide–labeled DNA content profiles, using a Netrin-1 affects cell death and survival. To examine the role of Becton Dickinson FACSCalibur. Labeling DNA breaks by the terminal netrin-1 on cell viability and cell cycle progression, we transfected deoxynucleotidyltransferase-mediated dUTP nick-end labeling (TUNEL) p53-deficient HeLa cancer cells with expression vectors encoding assay was performed using the Apo-BrdUrd kit. All assays were performed either netrin-1, wt-DCC, and their combination. We noted that in triplicates for each condition. Results are presented as means F SE. netrin-1 or DCC expression reduced HeLa cell viability by 30% Statistical analysis was performed using the Student’s t test. (Fig. 1A). This cellular response was attenuated by ectopic TAp73A ubiquitination assays and stability. HEK-293 cells were expression of both DCC and netrin-1, as expected. Our results transiently cotransfected with expression vectors encoding TA-p73a (26) suggested that netrin-1 reduces cancer cell survival while counter- and His6-c-Myc–tagged human ubiquitin (27), in the presence of the control, acting the established proapoptotic functions of the DCC tumor netrin-1, and DCC expression vectors. Transfected cells were cultured for suppressor. To further document this observation, we next 32 h in standard culture conditions, and then treated for 8 h with the proteasome inhibitor MG132 before harvesting (10 Amol/L; Stressgen). Cell examined the role of netrin-1 on cell cycle progression and extracts were prepared in NP40 lysis buffer and Myc-ubiquitin–conjugated apoptosis by fluorescence-activated cell sorting (FACS) analysis. proteins were separated by overnight incubation at 4jC, using Ni-NTA- Both netrin-1 and DCC induced, respectively, a 2.6- and 2.2-fold agarose beads (Qiagen). The beads were washed thrice with the NP40 lysis increase of the apoptotic cell fraction in cultured HeLa cells Â buffer, and the nickel-binding proteins were resuspended in 1 Laemmli (sub-G1 fraction) without any change in the distribution of HeLa

Figure 3. Impact of p73 silencing, DCC, and proteasome inhibition on TAp73a protein levels and apoptosis. A, HeLa cells were transiently transfected with the p73 shRNAs (shRNA-p73) versus scrambled shRNA sequences (sh-CON), in the presence or absence of the Netrin-1 vector. Forty-eight-hour posttransfection cells were harvested and subjected to Western blot analysis and TUNEL assay by flow cytometry. Top, endogenous TAp73a levels were detected by the anti-SAM domain p73a pAb. Netrin-1 and h-actin immunoblots were performed as controls for ectopic Netrin-1 expression and protein loading; bottom, depletion of TAp73a by RNA interference restricts Netrin-1–induced apoptosis. For the apoptosis determination, the corresponding cell pellets were fixed with PBS containing 1% paraformaldehyde and were stained for TUNEL-positive cells by FACS analysis. Columns, mean of three separate experiments; bars, SE. Significant differences at P < 0.05 (*) between scrambled sh-CON sequences F Netrin-1 and P < 0.01 (**) between shRNA-p73a and sh-CON in Netrin-1–transfected cells; B, HeLa cells were transiently transfected for 24 and 48 h with control empty vector and expression vectors encoding either Netrin-1 or wt-DCC. Cell extracts were prepared for Western blot analysis of DCC, TAp73a, Netrin-1, and h-actin, as described above. C, HeLa cells were transfected for 32 h with the Netrin-1, DCC, and control vectors or their combination. Then, transiently transfected cells were treated for 8 h with the proteasome inhibitor MG132 (10 Amol/L) or the control vehicle DMSO (0.1%). Whole-cell lysates were immunoblotted with the pAb and mAb directed against DCC, the p73a SAM domain, or Netrin-1. h-actin protein immunoblot was shown to demonstrate equal loading of the gels. Data are representative of another experiment.

Cancer Res 2008; 68: (20). October 15, 2008 8234 www.aacrjournals.org

Figure 4. Differential effect of Netrin-1 and DCC on the p73a ubiquitination levels. A, HEK-293 cells were cotransfected with the constant amount of the TA-p73a, h-gal, and pMyc-Ub expression vectors, in the presence or absence of the Netrin-1 and DCC vectors, as indicated (top). At 40 h posttransfection, cells were treated with MG132 (10 Amol/L) for 8 h. Cell lysates were then prepared, and total proteins were analyzed by direct Western blotting, using the same antibodies. Bottom, the ubiquitinated proteins were recovered from total cell lysates by immunoprecipitation with Ni-NTA-agarose beads, followed by immunoblotting with the anti-SAM domain p73a antibody. The h-galactosidase activity was measured to normalize the transfection efficiency. Data were quantified by densitometry as TA-p73a ubiquitination signals corresponding to the full-length and cleaved forms of TAp73a bands normalized according to the TAp73a protein detected by direct Western blot. Data are representative of another experiment. B, HEK-293 cells were transfected with TAp73a alone or together with Netrin-1 or control vectors. Top, at 24 h posttransfection, the cells were treated with 50 Ag/mL cycloheximide and harvested at the time points shown for TAp73a and h-actin immunoblot analysis. Bottom, densitometric analysis of the TAp73a bands relative to h-actin were measured and plotted on a graph. Data are representative of two separate experiments. cells at the successive transitions of the cell cycle (Fig. 1B). As apoptosis signature. This conclusion was further validated by the observed in the MTT assay, simultaneous expression of both detection of the cleaved caspase-3 protein in netrin-1–transfected netrin-1 and DCC neutralized their respective deleterious functions HEK-293 cells. As shown in Fig. 2B, the induction of the TAp73a on HeLa cell apoptosis. We subsequently confirmed these data protein by netrin-1 was confirmed and extended in the p53- using the TUNEL assay showing that netrin-1 increased the deficient HEK-293 cell line (3 F 0.7-fold increase; n =4 percentage of apoptotic cells 4-fold, DCC 6-fold, and their experiments). combination, only 2-fold (Fig. 1C). Implication of TAp73A in the apoptosis induced by netrin-1. Induction of TAp73A protein by netrin-1 expression. We We sought to determine whether TAp73a expression was essential next evaluated whether the p53-related proteins p73a and p63 were in the netrin-1 apoptotic function. Expression of the TAp73a involved in the apoptosis induced by netrin-1 in the p53-deficient isoform was inhibited by transient transfection of HeLa cells by cell lines HeLa and HEK-293. First, we investigated the effect of shRNA, and its reduced protein expression was tested by netrin-1 ectopic expression on the accumulation of their tran- immunoblot analysis. As shown in Fig. 3A, the p73 shRNA scripts and protein isoforms. As shown in Fig. 2A, netrin-1 reduced by 29% and 70% endogenous and netrin-1–induced selectively induced a robust accumulation of the TAp73a protein in TAp73a levels in HeLa cells, respectively (n = 3 experiments), HeLa cells (73 KD; 2.6 F 0.06-fold increase; n = 3), without any whereas the control scrambled RNA vector had no interference on significant change in the transcript levels of TAp73a and DNp73a the induction of TAp73a by netrin-1 in sh-CON cells (5.5 F 0.6- (Fig. 2C) by semiquantitative (left) and real-time reverse transcrip- fold increase). Results obtained in HeLa cells were confirmed in tion-PCR (RT-PCR; right). Our data indicate that netrin-1 is acting HEK-293 cells transfected by the netrin-1 vector in the presence on TAp73a expression through posttranscriptional mechanisms. and absence of the p73 shRNAs versus the scrambled sequences Consistently, ectopic netrin-1 failed to up-regulate DNp73a and (data not shown). Most importantly, the p73 shRNAs reversed the p63a proteins in HeLa cells (Fig. 2A). In keeping with our data on induction of the p73a protein by netrin-1 to control levels cell survival and apoptosis in HeLa cells (Fig. 1), netrin-1 down- (scrambled) and was able to reduce by 65% F 3.3% the netrin- regulated the anti-apoptotic protein Bcl-2 (5.3-fold) and up- 1–dependent apoptosis in HeLa cells (Fig. 3A). Our data imply regulated the proapoptotic protein Bax (1.4-fold) in HEK-293 cells that netrin-1 mediates apoptosis through induction of the TAp73a (Fig. 2A), resulting in a decreased Bcl-2/Bax ratio, an index of the proapoptotic form. www.aacrjournals.org 8235 Cancer Res 2008; 68: (20). October 15, 2008

Role of the netrin-1 receptor DCC in the induction of by direct Western blot (top). In two separate experiments, we TAp73A by netrin-1. We next examined the molecular status of observed that netrin-1 reduced by 62% and 63% the ubiquitination the DCC tumor suppressor gene in HeLa cells. Using combined levels of the full-length and cleaved forms of the TAp73a protein in PCR and sequencing methods to amplify and characterize the HEK-293 cells. Conversely, wt-DCC increased by 15% and 61% the molecular integrity of the DCC gene in this model, we detected an ubiquitination levels of the cleaved and wt forms of TAp73a, internal deletion of six bp within exon 26, leading to the RTV respectively. Upon cotransfection with netrin-1 + DCC, these two sequence in HeLa cells instead of RSQV in the wt-DCC protein ubiquinated bands were respectively reduced by 61% and 22%. sequence (Supplementary Fig. S1). Such a molecular alteration in We next examined the turnover of TAp73a in the presence and the DCC gene has been previously reported in the IMR-32 absence of ectopically expressed Netrin-1 (Fig. 4B). Twenty four neuroblastoma cell line (28). Taking into account the DCC hours posttranfection of HEK-293 cells with TAp73a and Netrin-1 or molecular status in our model, we next explored the effect of wt- control vectors, these cells were treated with the translation DCC on p73a protein levels after transient transfection of HeLa inhibitor cycloheximide for 0, 1, 2, 4, and 6 hours. TAp73a protein cells for 24 and 48 hours with the netrin-1 and DCC expression levels were monitored by Western blot and normalized to h-actin. vectors. As shown in Fig. 3B, reconstitution with wt-DCC in HeLa As shown in Fig. 4B, netrin-1 clearly stabilizes TAp73a protein cells failed to elevate endogenous p73a levels but instead decreased levels leading to a significant increase in protein half-life. by 15% and 32% the p73a levels induced by netrin-1 at the 24- and Netrin-1 and DCC selectively potentiate alterations of cell 48-hour time points. Of note, loss of the DCC signal observed at viability induced by cisplatin. Given that TAp73a is recognized 48 hours in the presence of netrin-1 is associated with amplification as an important mediator of the apoptosis induced by cisplatin, we of the TAp73a signal. As expected, simultaneous expression of next tested whether netrin-1 and DCC interfere with alterations of netrin-1 with wt-DCC decreased and abolished DCC levels in HeLa HeLa cell viability induced by cisplatin and doxorubicin, two cells at 24 and 48 hours, respectively, in agreement with previous chemotherapeutic drugs with different modes of action. As a reports showing that DCC is subjected to ubiquitin-dependent topoisomerase type II inhibitor and intercalating agent, the degradation after interaction with its ligand, netrin-1 (29). Con- anthracycline antibiotic doxorubicin induces breaks in the genomic sistently, the stability of the ectopic wt-DCC protein was greatly DNA and blocks DNA synthesis and transcription. The cytotoxicity enhanced by MG132 in HeLa cells (Fig. 3C). In contrast, endogenous of the DNA-damaging agent cisplatin is achieved in part through DCC was not detected in the presence and absence of this inhibition of DNA replication and transcription, and induction of proteasome inhibitor, suggesting that the resident DCC protein is the DNA damage response signaling pathways involved in the either (a) expressed at very low levels, (b) is expressed under a transduction of genotoxic stress signals to the p53 and p73 mutated/truncated form, as shown in HeLa cells, or (c)isnot expressed at all, due to other mutations or truncations in coding/ noncoding regions of the DCC gene. Because introduction of wt-DCC in HeLa and HEK-293 cells induced apoptosis, one can postulate that endogenous DCC is not functioning as a dominant-negative form of the transfected wt-DCC form. It is therefore likely that the endogenous DCC pathway is inactivated in these two models. Implication of the ubiquitin-proteasome pathway in the induction of p73A by netrin-1. Because p73a stability is regulated by the ubiquitin-proteasome pathway (30), we next examined whether the proteasome inhibitor MG132 affected TAp73a induced by netrin-1 in the presence and absence of wt-DCC. As shown in Fig. 3C, MG132 strongly potentiated TAp73a levels induced by netrin-1 in the presence and absence of the wt-DCC vector. In contrast, wt-DCC was ineffective in the induction of the TAp73a protein in HeLa cells incubated in the presence or absence of the proteasome inhibitor. DCC decreased netrin-1–induced TAp73a levels under both conditions, in spite of the depletion of wt-DCC protein induced by netrin-1. We found that netrin-1 had no effect on the expression levels of the p73 ubiquitin ligase Itch and p73 modular adapter protein Yap-1 in HeLa cells (data not shown). Both Yap-1 and Itch bind the same Figure 5. Netrin-1 and DCC cooperate with cisplatin-induced alterations PPPY motif of p73, resulting in stabilization of p73 by Yap-1 and of cell viability. Top, HeLa cells were incubated for 48 h with increasing concentrations of cisplatin (left) or doxorubicin (Dox; right). The inhibitory prevention of Itch-mediated ubiquitination of p73 (31). Our data potency (IC50) of each drug was measured according to the concentration giving favor the hypothesis that netrin-1 targets the activation status of half-maximal inhibition of cell viability, using the MTT test; bottom, HeLa cells p73 ubiquitin/deubiquitin ligases. were transfected with control vector alone (vector) and expression vectors encoding either Netrin-1, wt-DCC, or their combination (Net + DCC), as We therefore sought to determine the effect of netrin-1 and DCC indicated. At 24 h posttransfection, nontransfected cells (control) and transiently on the ubiquitination levels of p73a after cotransfection of HEK-293 transfected cells were treated for 48 h with the IC50 drug concentrations (cisplatin, 10 Amol/L; doxorubicin, 0.6 Amol/L), and cell viability was determined cells with expression vectors encoding His6-c-Myc–tagged human by MTT assay. Data are expressed as the percentage of the initial cell viability ubiquitin, h-galactosidase, and TAp73a (Fig. 4A). Quantification of measured in nontransfected control cells, resulting in f50% to 60% residual TAp73a ubiquitination (bottom) was performed by densitometry viability measured in the presence of each anticancer drug tested at their corresponding IC50. Columns, mean from three independent experiments, analysis of the wt-TAp73a protein (arrow) and its cleaved forms, each performed in triplicate; bars, SE. Significant differences at P < 0.001 (*) both normalized to the relative amounts of total TAp73a detected versus control vector.

Cancer Res 2008; 68: (20). October 15, 2008 8236 www.aacrjournals.org

Figure 6. Impact of stable expression of p73 shRNAs and Netrin-1 on HeLa cell viability, invasion, and tumorigenicity. A, validation of p73a stable silencing by SDS-PAGE and immunoblot analysis in HeLa cells stably transfected with the sh-CON (clones 1 and 3) or shRNA-p73 constructs (clones 1 and 2). Top, the sh-CON and shRNA-p73 clones were incubated for 48 h in the presence (+) or absence of 10 Amol/L cisplatin (À); effect of external addition of the Netrin-1 peptide on the expression levels of TA-p73a. Stably transfected cells were treated for 8 h with the proteasome inhibitor MG132 (10 Amol/L) and then exposed for 48 h in the presence (+) or absence of Netrin-1 in the presence of MG132 (À). B, effect of stable expression of shRNAs targeting p73 on collagen type I gel invasion and growth of HeLa tumor cell xenografts in immunodeficient mice. Top, collagen type I invasion assays were done as described (14) using stable transfectants of HeLa cells expressing p73 interferring shRNAs (shRNA-p73) or their control counterparts (sh-CON scrambled sequences). Invasive and superficial HeLa sh-CON and shRNA-p73a–silenced cells adherent to collagen type I gels were counted in 12 fields of 0.157 mm2 using an inverted microscope, representing a total of 250 to 300 cells examined and screened for each experimental condition. Invading cells were scored as described in the Materials and Methods section. Netrin-1 was ineffective to further increase the spontaneous invasive phenotype observed in sh-CON and shRNA-p73 HeLa cells (data not shown). Columns, mean from three independent experiments; bars, SE. Bottom, xenografts were induced by s.c. injections of 4 Â 106 cells (HeLa sh-CON, clone 1; shRNA-p73, clone 1) in female severe combined immunodeficient CB17 mice, 6 mice (6- to 8-wk-old, 6 mice per group). Tumor dimensions were measured every week, and the volume (V,mm3) calculated as V =(L 2 Â W)/6, L and W being the length and width of the tumor xenografts. All experiments were conducted in agreement with the guidelines of the Animal Care Committee. The growth of the HeLa-induced tumors was exacerbated by p73 silencing (*, P < 0.05). C, cell viability evaluated by the MTT assay in HeLa sh-CON (clone 1) and shRNA-p73 cells (clone 1) challenged for 48 h with cisplatin (10 Amol/L), Netrin-1, and their combination. Netrin-1 treatment (100 ng/mL) was repeated every 12 h. Data are from three separate experiments and are expressed as the percentage of the respective control values. Similar data are observed with the HeLa sh-CON clone 3 and the shRNA-p73 clone 2. Significant differences (*, P < 0.01) versus control conditions. regulators of cell cycle arrest and apoptosis. First, we established with no effect on the invasive potential of HeLa cells in collagen the inhibitory potency of cisplatin and doxorubicin in control type I gels (Fig. 6B) and in subcutaneous tumors (Supplementary HeLa cells (Fig. 5, top). We observed that 10 Amol/L cisplatin and Fig. S2B). In both groups, f75% of tumor xenografts were found 0.6 Amol/L doxorubicin induced a reduction of f50% in HeLa cell invasive. The percentage of Ki-67–positive tumors in p73-silenced viability. Both netrin-1 and DCC ectopic expression increased the cells (26.8%) was significantly higher than the percentage in the cytotoxicity of cisplatin (Fig. 5, bottom), compared with control corresponding control xenografts (7.6%; P < 0.01), whereas the vector-transfected cells (P < 0.001). It is noteworthy that when number of TUNEL-positive cells was higher in control versus p73- HeLa cells were transfected with the same netrin-1 and DCC- silenced cells (respectively, 22.4% and 3.1%; P < 0.01). Consistently, encoding vectors, we observed no change in cell viability over the stable silencing of p73a resulted in remarkable induction of the doxorubicin-only treatment. antiapoptotic protein Bcl-2 in sh-RNA-p73 HeLa cells (data not Effect of external addition of the netrin-1 peptide on shown). Taken together, our data support the functional validation TAp73A levels and HeLa cell viability. Further proof of the role of the p73a-silenced HeLa cells in the context of cancer cell of netrin-1 on TAp73a expression and cell viability was provided proliferation and apoptosis in vitro and in vivo. As shown in Fig. 6C, from HeLa cells stably transfected by expression vectors encoding the netrin-1 peptide and cisplatin induced a robust accumulation either p73 silencing shRNAs (sh-RNA-p73) or control sh-scrambled of TAp73a and compromised HeLa cell viability to similar extent in sequences (sh-CON). The effect of external addition of the netrin-1 sh-CON HeLa cells but not in silenced p73-shRNA cells. peptide was investigated on TAp73a protein and the MTT test. As shown in Fig. 6A, the robust induction of p73a protein levels by cisplatin, observed in the sh-CON HeLa cells, was alleviated by the Discussion p73 shRNAs, as expected from the validation of the silenced versus The implication of the p53, p63, and p73 family proteins on gene the scrambled control clones. In agreement, p73a silencing transcription and regulation of several effectors involved in cell exacerbates the growth of HeLa tumor xenografts in nude mice, cycle control, tumor progression, cancer cell survival, and apoptosis www.aacrjournals.org 8237 Cancer Res 2008; 68: (20). October 15, 2008

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. Cancer Research has been largely documented in the literature. In the present study, the proteasome inhibitor MG132. Of note, netrin-1 was ineffective we bring original data on the conditional regulation of apoptosis on the Tyr-99 phosphorylation levels of TAp73a targeted by the abl induced by netrin-1 and DCC in p53-deficient HeLa and HEK-293 tyrosine kinase (data not shown), and involved in the stability of cells. The pertinence of these two models for our study and p73. Implication of cyclin-Cdk complexes, acetylation-dependent objectives is validated by the observation that the TP53 tumor mechanisms, and ubiquitin-independent pathways using the 20S suppressor gene is commonly lost or mutated in human solid proteasome were also reported for regulating p73 stability and tumors. Deficiency of p53 disrupts anticancer drug–induced degradation (37–39). Another possibility is that netrin-1 regulates apoptosis and promotes resistance to chemotherapy and a more the translation of the p73a mRNA as recently illustrated by the malignant phenotype. In contrast, the p73 and p63 proteins are elegant study of Tsai showing that netrin-1 alleviated the Grb7- rarely mutated in human tumors and are mainly regulated via mediated translational repression of the n opioid receptor mRNA complex transcriptional and posttranscriptional mechanisms. via a netrin-1/integrin/FAK and Grb-7 pathway (40). Other key Because extensive crosstalk among the p53 family members and signaling molecules involved in cancer cell survival and progres- their isoforms has been reported, our approach therefore facilitates sion, including DCC and src, are potentially involved in this FAK the interpretation of our data under a relevant context of molecular scaffold (41). Consistent with this hypothesis, our data carcinogenesis. indicate that the cell death factor DCC is not competent to induce We showed that netrin-1 exerts two divergent functions on cell TAp73a protein levels but conversely counteracts netrin-induced survival by inducing apoptosis in the absence of DCC, and blocking TAp73a protein accumulation. Another divergent mechanism the apoptosis induced by the DCC tumor suppressor protein, underlying the apoptosis induced by netrin-1 and DCC is according to the dependence receptor hypothesis. Our data illustrated by the observation that DCC is highly efficient in indicate that the cell death pathways induced by netrin-1 and TAp73a ubiquitination. Additional mechanisms may include the DCC are mutually exclusive. Netrin-1 induced convergent delete- participation of microRNAs in regulating apoptosis sensitivity to rious signals against cancer cell viability and survival as evidenced netrin-1, DCC, and TAp73a (42). by the MTT test and determination of apoptosis in the sub-G1 The implication of the TAp73a signal on the apoptosis induced fraction by FACS analysis and TUNEL assay. Netrin-1 induced by netrin-1 was shown by transient and stable silencing the caspase-3 cleavage and decreased the Bcl-2/Bax ratio, underlying endogenous p73a protein levels. Our data therefore indicate that its capacity to induce apoptosis through the mitochondrial TAp73a is a relevant mediator of the apoptosis induced by netrin-1. pathway. Phenotypic effects of netrin-1 on viability and apoptosis Identification of the netrin signaling effectors and target genes were associated with the selective induction of the long TAp73a induced via TAp73a should provide more information on the protein isoform in HeLa and HEK-293 cells, suggesting that netrin- signaling networks involved in the apoptosis induced by netrin-1. 1 is a potential regulator of apoptosis and gene expression via This question is sustained by the positive cooperativity we have TAp73a.Indeed,theTAp73a isoform exhibits proapoptotic observed between netrin-1/DCC on the cisplatin cytotoxicity in functions and transactivates several p53 target genes involved in HeLa cells. Recent advances in the field indicate that TAp73a cell cycle arrest and apoptosis. In our study, however, the induction increases the sensitivity to chemotherapeutic drugs and oxidative of TAp73a protein by netrin-1 did not correlate with any change in stress and is involved in the limitation of anchorage-independent the distribution of HeLa cells within the different phases of the cell growth (43). cycle, suggesting a selective effect of netrin-1 on survival in cancer In the present study, we found that netrin-1 induced apoptosis in cells with compromised p53. In addition, no induction of the DCC-deficient HeLa cells. Emerging evidence underline the DNp73a short isoform was seen by qRT-PCR and immunoblotting molecular and functional diversity of the netrin ligands, receptors in netrin-1–expressing cells. The DNp73a short isoform is and coreceptors (DCC-adenosine A2B, UNC5A to 5D, neogenin, associated with cell survival, and functions as a dominant negative integrins/FAK, as well as unidentified netrin-1 receptors), and their competitor of TAp73a, due to inhibitory hetero-oligomer formation interplay or antagonism regarding angiogenesis, apoptosis, and (32). Consistently, the DN isoforms of p73 and p63 are frequently survival in cancer cells (35, 44–46). Another level of complexity is overexpressed in cancer. However, no effect on p63 protein levels illustrated by the formation of homodimers and heterodimers was detected after netrin-1 expression, thus showing selective between the cell death family netrin receptors, as shown during netrin-1 regulation at the p73 signaling network. This observation axon attraction and repulsion (47). We have shown that DCC- is compatible with the notion that p63 regulates progenitor cell deficient human colon cancer cells and tumors retain UNC5 netrin populations and morphogenesis at the proliferation-differentiation receptors A to B and C (14). In contrast, expression of the netrin-1 interface in the epithelial and mesenchymal cell lineages, as shown gene NTN1 is reduced or absent in brain and prostate cancers in p63 loss-of-function mouse models (33). Knockdown of p63 (48, 49), suggesting that cell death signals induced by netrin-1 can be expression by shRNA in mammary epithelial cells caused both cell abrogated during oncogenesis. Divergent biological roles of netrin-1 detachment and anoı¨kis associated with down-regulation of cell in attraction, retraction or repulsion of neuronal, endothelial, and adhesion-associated genes encoding h1, h4, and a6 integrins, as epithelial cells are also reported according to the cellular and well as laminin-g2 and fibronectin (34). Interestingly, both a6h4 signaling context (12, 46, 50). Therefore, different known or unknown and a3h1 integrins are now considered as functional netrin-1 netrin receptors can be sequentially and reciprocally activated, receptors (35). desensitized/internalized, or degraded. Recent data indicate that the In this report, we have shown that netrin-1 selectively up- dependence receptors UNC5A regulate naturally occurring apoptosis regulates TAp73a levels through posttranscriptional mechanisms, independently of netrin-1 and, therefore, do not provide support for including inhibition of p73a ubiquitination, stabilization of the the dependence ligand hypothesis (45). Netrins are secreted and p73a protein, with no change in the expression levels of the p73a diffusible molecules that are stored together with several growth ubiquitination effectors Itch and Yap-1 (31, 36). In agreement, the factors and matricellular proteins at the vicinity of cancer cells and induction of the TAp73a protein levels by netrin-1 synergizes with tumor stromal cells. These paracrine and autocrine factors have

Cancer Res 2008; 68: (20). October 15, 2008 8238 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. Netrin-1 and DCC, TAp73a, and Apoptosis potential long-lasting effect on the survival and spreading of cancer Acknowledgments cells in primary human solid tumors and their metastases, including Received 4/21/2008; revised 7/11/2008; accepted 7/29/2008. the modulation of cell death and DNA damage signals induced Grant support: Institut National de la Sante et de la Recherche Medicale, during cancer therapeutics. ARC n3765, IPSEN, the Fund for Scientific Research Flanders (Brussels, Belgium), and the Scientific Exchange Program between the Flemish community and France (Grant I. 2007.03). Disclosure of Potential Conflicts of Interest The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance No potential conflicts of interest were disclosed. with 18 U.S.C. Section 1734 solely to indicate this fact.

References differentiation and response to stress. Cell Death Differ 34. Carroll DK, Carroll JS, Leong CO, et al. p63 regulates 2006;13:962–72. an adhesion programme and cell survival in epithelial 1. Fearon ER, Cho KR, Nigro JM, et al. Identification of a 18. Rocco JW, Leong CO, Kuperwasser N, DeYoung MP, cells. Nat Cell Biol 2006;8:551–61. chromosome 18q gene that is altered in colorectal Ellisen LW. p63 mediates survival in squamous cell 35. Yebra M, Montgomery AM, Diaferia GR, et al. cancers. Science 1990;247:49–56. carcinoma by suppression of p73-dependent apoptosis. Recognition of the neural chemoattractant Netrin-1 by 2. Ogi K, Toyota M, Ohe-Toyota M, et al. Aberrant Cancer Cell 2006;9:45–56. integrins a6h4 and a3h1regulates epithelial cell adhe- methylation of multiple genes and clinicopathological 19. Domıńguez G, Garcıá JM, Penã C, et al. DTAp73 sion and migration. Dev Cell 2003;5:695–07. features in oral squamous cell carcinoma. Clin Cancer upregulation correlates with poor prognosis in human 36. Danovi SA, Rossi M, Gudmundsdottir K, Yuan M, Res 2002;8:3164–71. tumors: putative in vivo network involving p73 isoforms, Melino G, Basu S. Yes-associated protein (YAP) is a 3. Tamura G. Promoter methylation status of tumor p53, and E2F-1. J Clin Oncol 2006;24:805–15. critical mediator of c-Jun-dependent apoptosis. Cell suppressor and tumor-related genes in neoplastic and 20. Grob TJ, Novak U, Maisse C, et al. Human DNp73 Death Differ 2008;15:217–9. non-neoplastic gastric epithelia. Histol Histopathol regulates a dominant negative feedback loop for TAp73 37. Melino G, Lu X, Gasco M, Crook T, Knight RA. 2004;19:221–8. and p53. Cell Death Differ 2001;8:1213–23. Functional regulation of p73 and p63: development and 4. Carvalho AL, Chuang A, Jiang WW, et al. Deleted in 21. Petrenko O, Zaika A, Moll UM. DNp73 facilitates cell cancer. Trends Biochem Sci 2003;28:663–70. colorectal cancer is a putative conditional tumor- immortalization and cooperates with oncogenic Ras in 38. AsherG,TsvetkovP,KahanaC,ShaulY.A suppressor gene inactivated by promoter hypermethy- cellular transformation in vivo. Mol Cell Biol 2003;23: mechanism of ubiquitin-independent proteasomal deg- lation in head and neck squamous cell carcinoma. 5540–55. radation of the tumor suppressors p53 and p73. Genes Cancer Res 2006;66:9401–7. 22. Casciano I, Mazzocco K, Boni L, et al. Expression of Dev 2005;19:316–21. 5. Bernet A, Mazelin L, Coissieux MM, et al. Inactivation DNp73 is a molecular marker for adverse outcome 39. Paliwal P, Radha V, Swarup G. Regulation of p73 by of the UNC5C Netrin-1 receptor is associated with in neuroblastoma patients. Cell Death Differ 2002;9: Hck through kinase-dependent and independent mech- tumor progression in colorectal malignancies. Gastro- 246–51. anisms. BMC Mol Biol 2007;8:45. enterology 2007;133:1840–8. 23. Marin MC, Jost CA, Irwin MS, DeCaprio JA, Caput D, 40. Tsai NP, Bi J, Wei LN. The adaptor Grb7 links netrin-1 6. Taylor KH, Pena-Hernandez KE, Davis JW, et al. Large- Kaelin WG. Viral oncoproteins discriminate between signaling to regulation of mRNA translation. EMBO J scale CpG methylation analysis identifies novel candi- p53 and the p53 homolog p73. Mol Cell Biol 1998;18: 2007;26:1522–31. date genes and reveals methylation hotspots in acute 6316–24. 41. Li W, Aurandt J, Ju¨rgensen C, Rao Y, Guan KL. FAK lymphoblastic leukemia. Cancer Res 2007;67:2617–25. 24. Urist M, Tanaka T, Poyurovsky MV, Prives C. p73 and Src kinases are required for netrin-induced tyrosine 7. Arakawa H. Netrin-1 and its receptors in tumorigen- induction after DNA damage is regulated by checkpoint phosphorylation of UNC5. J Cell Sci 1998;119:47–55. esis. Nat Rev Cancer 2004;4:978–87. kinases Chk1 and Chk2. Genes Dev 2004;18:3041–54. 42. Park SM, Peter ME. microRNAs and death receptors. 8. Bernet A, Mehlen P. Dependence receptors: when 25. Sayan AE, Paradisi A, Vojtesek B, Knight RA, Melino Cytokine Growth Factor Rev 2008;19:303–11. apoptosis controls tumor progression. Bull Cancer 2007; G, Candi E. New antibodies recognizing p73: compar- 43. Beitzinger M, Hofmann L, Oswald C, et al. p73 94:E12–7. ison with commercial antibodies. Biochem Biophys Res poses a barrier to malignant transformation by 9. Shekarabi M, Kennedy TE. The netrin-1 receptor DCC Commun 2005;330:186–93. limiting anchorage-independent growth. EMBO J 2008; promotes filopodia formation and cell spreading by 26. De Laurenzi V, Costanzo A, Barcaroli D, et al. Two 27:792–803. activating Cdc42 and Rac1. Mol Cell Neurosci 2002;19:1– new p73 splice variants, g and y, with different 44. Park KW, Crouse D, Lee M, et al. The axonal 17. transcriptional activity. J Exp Med 1998;188:1763–8. attractant Netrin-1 is an angiogenic factor. Proc Natl 10. Meriane M, Tcherkezian J, Webber CA, et al. 27. Ward CL, Omura S, Kopito RR. Degradation of Acad Sci U S A 2004;101:16210–5. Phosphorylation of DCC by Fyn mediates Netrin-1 CFTR by the ubiquitin-proteasome pathway. Cell 1995; 45. Williams ME, Lu X, McKenna WL, et al. UNC5A signaling in growth cone guidance. J Cell Biol 2004;167: 83:121–7. promotes neuronal apoptosis during spinal cord devel- 687–98. 28. Reale MA, Hu G, Zafar AI, Getzenberg RH, Levine SM, opment independent of netrin-1. Nat Neurosci 2006;9: 11. Ren XR, Ming GL, Xie Y, et al. Focal adhesion kinase Fearon ER. Expression and alternative splicing of the 996–8. in netrin-1 signaling. Nat Neurosci 2004;7:1204–12. deleted in colorectal cancer (DCC) gene in normal and 46. LarriveéB, Freitas C, Trombe M, et al. Activation of 12. Wilson BD, Ii M, Park KW, et al. Netrins promote malignant tissues. Cancer Res 1994;54:4493–501. the UNC5B receptor by Netrin-1 inhibits sprouting developmental and therapeutic angiogenesis. Science 29. Kim TH, Lee HK, Seo IA, et al. Netrin induces down- angiogenesis. Genes Dev 2007;21:2433–47. 2006;313:640–4. regulation of its receptor, Deleted in Colorectal Cancer, 47. Hong K, Hinck L, Nishiyama M, Poo MM, Tessier- 13. Grady W. Making the case for DCC and UNC5C as through the ubiquitin-proteasome pathway in the Lavigne M, Stein E. A ligand-gated association between tumor suppressor genes in the colon. Gastroenterology embryonic cortical neuron. J Neurochem 2005;95:1–8. cytoplasmic domains of UNC5 and DCC family recep- 2007;133:2045–9. 30. Watson IR, Irwin MS. Ubiquitin and ubiquitin- tors converts netrin-induced growth cone attraction to 14. Rodrigues S, De Wever O, Bruyneel E, Rooney RJ, like modifications of the p53 family. Neoplasia 2006;8: repulsion. Cell 1999;97:927–41. Gespach C. Opposing roles of netrin-1 and the 655–66. 48. Meyerhardt JA, Caca K, Eckstrand BC, et al. Netrin-1: dependence receptor DCC in cancer cell invasion, 31. Levy D, Adamovich Y, Reuven N, Shaul Y. The Yes- interaction with deleted in colorectal cancer (DCC) and tumor growth and metastasis. Oncogene 2007;26: associated protein 1 stabilizes p73 by preventing Itch- alterations in brain tumors and neuroblastomas. Cell 5616–25. mediated ubiquitination of p73. Cell Death Differ 2007; Growth Differ 1999;10:35–42. 15. Melino G, De Laurenzi V, Vousden KH. p73: friend or 14:743–51. 49. Latil A, Cheˆne L, Cochant-Priollet B, et al. foe in tumorigenesis. Nat Rev Cancer 2002;2:605–15. 32. Slade N, Zaika AI, Erster S, Moll UM. DNp73 stabilises Quantification of expression of netrins, slits and their 16. Gaiddon C, Lokshin M, Ahn J, Zhang T, Prives C. A TAp73 proteins but compromises their function due to receptors in human prostate tumors. Int J Cancer 2003; subset of tumor-derived mutant forms of p53 down- inhibitory hetero-oligomer formation. Cell Death Differ 103:306–15. regulate p63 and p73 through a direct interaction with 2004;11:357–60. 50. Bartoe JL, McKenna WL, Quan TK, et al. Protein the p53 core domain. Mol Cell Biol 2001;21:1874–87. 33. Yang A, Schweitzer R, Sun D, et al. p63 is essential for interacting with C-kinase 1/protein kinase Ca-mediated 17. Murray-Zmijewski F, Lane DP, Bourdon JC. p53/p63/ regenerative proliferation in limb, craniofacial and endocytosis converts netrin-1-mediated repulsion to p73 isoforms: an orchestra of isoforms to harmonise cell epithelial development. Nature 1999;398:714–8. attraction. J Neurosci 2006;26:3192–205.

www.aacrjournals.org 8239 Cancer Res 2008; 68: (20). October 15, 2008

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. Netrin-1 Induces Apoptosis in Human Cervical Tumor Cells via the TAp73 α Tumor Suppressor

Jean-Pierre Roperch, Karima El Ouadrani, Ann Hendrix, et al.

Cancer Res 2008;68:8231-8239.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/68/20/8231

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2008/10/13/68.20.8231.DC1

Cited articles This article cites 50 articles, 18 of which you can access for free at: http://cancerres.aacrjournals.org/content/68/20/8231.full#ref-list-1

Citing articles This article has been cited by 4 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/68/20/8231.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/68/20/8231. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.