Suppression of Epithelial Differentiation by Foxi3 Is Essential for Molar Crown Patterning Maria Jussila1, Anne J

RESEARCH ARTICLE Suppression of epithelial differentiation by Foxi3 is essential for molar crown patterning Maria Jussila1, Anne J. Aalto1,*, Maria Sanz Navarro1,*, Vera Shirokova1, Anamaria Balic1, Aki Kallonen2, Takahiro Ohyama3, Andrew K. Groves4, Marja L. Mikkola1 and Irma Thesleff1,‡

ABSTRACT Tooth development begins with the formation of an epithelial Epithelial morphogenesis generates the shape of the tooth crown. thickening or placode. Tooth placodes consist of a basal cell layer This is driven by patterned differentiation of cells into enamel knots, facing the mesenchyme and several layers of suprabasal cells root-forming cervical loops and enamel-forming ameloblasts. Enamel covered by periderm. The basal and suprabasal cells differ in their knots are signaling centers that define the positions of cusp tips in a gene expression patterns (Palacios et al., 1995; Mitsiadis et al., tooth by instructing the adjacent epithelium to fold and proliferate. 1995, 2010; Fausser et al., 1998; Nieminen et al., 1998; Ohazama Here, we show that the forkhead-box transcription factor Foxi3 and Sharpe, 2007). The mechanism of suprabasal cell formation has inhibits formation of enamel knots and cervical loops and thus the not been studied extensively in tooth development. After induction, differentiation of dental epithelium in mice. Conditional deletion of placodal cells proliferate and form a bud that grows to the Foxi3 (Foxi3 cKO) led to fusion of molars with abnormally patterned underlying mesenchyme. The connection of the bud to the oral shallow cusps. Foxi3 was expressed in the epithelium, and its epithelium constricts and forms the dental cord, where only a thin expression was reduced in the enamel knots and cervical loops and in layer of suprabasal cells remains between the basal cells (Jussila and ameloblasts. Bmp4, a known inducer of enamel knots and dental Thesleff, 2012). At this time, the suprabasal cells become loosely epithelial differentiation, downregulated Foxi3 in wild-type teeth. Using organized in the center of the bud. These cells, called stellate genome-wide gene expression profiling, we showed that in Foxi3 cKO reticulum cells, resemble mesenchymal cells morphologically, there was an early upregulation of differentiation markers, such as while still maintaining an epithelial gene expression profile. p21, Fgf15 and Sfrp5. Different signaling pathway components that From the cap stage onwards, the basal epithelium is divided into are normally restricted to the enamel knots were expanded in the inner enamel epithelium (IEE), which faces the dental papilla epithelium, and Sostdc1, a marker of the intercuspal epithelium, was mesenchyme, and the outer enamel epithelium (OEE), which faces missing. These findings indicated that the activator-inhibitor balance the dental follicle mesenchyme. A signaling center called the regulating cusp patterning was disrupted in Foxi3 cKO. In addition, primary enamel knot (PEK) forms within the IEE and can be early molar bud morphogenesis and, in particular, formation of the identified histologically as a condensed group of epithelial cells. It suprabasal epithelial cell layer were impaired. We identified keratin 10 expresses several signaling molecules and is non-proliferative, as as a marker of suprabasal epithelial cells in teeth. Our results suggest demonstrated by the expression of genes such as the cyclin- ′ that Foxi3 maintains dental epithelial cells in an undifferentiated state dependent kinase inhibitor p21 (Cdkn1a) and absence of 5 -bromo- ′ and thereby regulates multiple stages of tooth morphogenesis. 2 -deoxyuridine (BrdU) incorporation (Jernvall et al., 1998; Keränen et al., 1998). The signals secreted by the PEK stimulate, KEY WORDS: Foxi3, Multituberculata, Epithelium, Morphogenesis, either directly or via mesenchyme, the flanking basal epithelium to Signaling center, Tooth development grow and form the cervical loops, which eventually form the roots. During subsequent morphogenesis of multicuspid molars, INTRODUCTION secondary enamel knots (SEKs) are induced at the sites of the Teeth develop from oral epithelium and underlying mesenchyme future cusp tips. Like the PEK, the SEKs secrete signaling through reciprocal interactions mediated by conserved signaling molecules that instruct the surrounding intercuspal IEE to molecules (Jussila and Thesleff, 2012). The shape of the tooth proliferate. These IEE cells will eventually differentiate into crown emerges during the morphogenesis of the epithelium via bud, ameloblasts. Mathematical modeling has shown that the pattern of cap and bell stages. Cell differentiation takes place towards the end the SEKs results from a balance of activating and inhibiting signals of morphogenesis, and tooth shape becomes fixed when the hard coupled with tissue growth (Salazar-Ciudad and Jernvall, 2002, tissues are deposited. 2010). Consequently, the local patterns of proliferation, instructed by the signaling centers, generate the shape of the tooth crown. The 1Research Program in Developmental Biology, Institute of Biotechnology, initiation of the second and third molars differs from the first molar University of Helsinki, Biocenter 1, PO Box 56, Helsinki 00014, Finland. 2Division of in that they do not arise from a placode, but from a posterior Materials Physics, Department of Physics, University of Helsinki, PO Box 64, Helsinki 00014, Finland. 3Department of Otolaryngology, Head & Neck Surgery and extension of the epithelium associated with the previously formed Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern tooth (Juuri et al., 2013). However, after initiation, their 4 California, 1501 San Pablo Street, Los Angeles, CA 90033-4503, USA. Program in morphogenesis proceeds in a similar manner to the first molar. Developmental Biology, Department of Molecular and Human Genetics and Department of Neuroscience, Baylor College of Medicine, BCM295, 1 Baylor Plaza, A heterozygous mutation in the Foxi3 transcription factor was Houston, TX 77030, USA. identified in hairless dogs, which have missing and abnormally *These authors contributed equally to this work shaped teeth (Drögemüller et al., 2008). Foxi3 belongs to the ‡ Author for correspondence ([email protected]) superfamily of Forkhead box transcription factors that act as transcriptional activators, repressors, pioneer factors or chromatin

Received 10 March 2015; Accepted 27 September 2015 modifiers (Benayoun et al., 2011; Lam et al., 2013). Foxi3 DEVELOPMENT

3954 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172 expression is restricted to the epithelium during the development of several ectodermal appendages, including teeth (Shirokova et al., 2013). Foxi3 is expressed in the dental epithelium at all stages of development, but is downregulated in the differentiated ameloblasts (Shirokova et al., 2013). Foxi3 knockout (KO) mice die at birth as a result of craniofacial malformations, which arise from the lack of branchial arch-derived structures (Edlund et al., 2014). Here, we show that conditional epithelial deletion of Foxi3 led to fusion of molars with abnormally patterned shallow cusps. Genome-wide expression profiling revealed upregulation of genes related to the differentiation of PEK and SEK and the cervical loop in Foxi3 mutants. During normal development, Foxi3 is expressed at high levels in IEE except for PEK and SEK signaling centers, tips of cervical loops and ameloblasts. Bmp4, a known inducer of PEK and SEK formation and ameloblast differentiation, inhibited Foxi3 expression. In situ analysis showed that markers normally restricted to SEKs were extended, which probably reflected the disrupted balance of activators and inhibitors regulating patterning and cusp formation. In addition, an earlier defect in the suprabasal epithelial −/floxed cell compartment and budding morphogenesis was evident. Our Fig. 1. Phenotype of K14cre43;Foxi3 (Foxi3 cKO) mice. (A-C) Molars results suggest that Foxi3 maintains epithelial cells in an of 5-week-old WT and two Foxi3 cKO mice showing fused molars in Foxi3 cKO. (D-L) Micro-CT scans showing occlusal (D-F), lingual (G-I) and anterior (J-L) − undifferentiated state and thereby regulates multiple stages of views of right molars of one Foxi3 /floxed and two Foxi3 cKO mice. Arrows point tooth morphogenesis. to an additional cusp-like row in Foxi3 cKO teeth. The remaining micro-CT- scanned samples are shown in Fig. S1. Scale bar: 1 mm (for A-C). bu, buccal; RESULTS cKO, conditional knockout; CT, computed tomography; li, lingual; M1, first Deletion of Foxi3 led to fusion of molars with an altered cusp molar; M2, second molar; M3, third molar; WT, wild type. pattern − − The Foxi3 / phenotype is embryonic lethal, with severely affected Epithelial morphogenesis was impaired in Foxi3 cKO mice development of branchial arch derivatives (Edlund et al., 2014), To determine the stage of molar morphogenesis when the Foxi3 precluding analysis of all mandibular teeth and maxillary molars. cKO tooth phenotype arises, we analyzed the histology of control We detected structures resembling upper incisors in Foxi3−/− and mutant molars from the M1 initiation onwards, as Foxi3 is embryos in an outbred ICR background, but when the mice were already expressed in the epithelium in the molar placode and bud maintained in an inbred C57Bl/6 background, no signs of tooth (Shirokova et al., 2013). At embryonic day (E) 12.5, the Foxi3 cKO development were observed (data not shown). placode was smaller compared with controls, and the suprabasal Conditional Foxi3 mutant mice (K14-cre43;Foxi3−/floxed; epithelium appeared especially poorly developed (Fig. 2A,B). At hereafter Foxi3 cKO) in a mixed ICR and NMRI background E13.0 and E13.5, budding morphogenesis was impaired in Foxi3 were viable and fertile, but often smaller than their littermates cKO (Fig. 2C-F). Both the dental cord and the stellate reticulum (Table S2). The adults had erupted molars, but their morphology were missing from Foxi3 cKO molars (Fig. 2E-J). Cervical loops and cusp pattern were dramatically altered. Furthermore, the first formed in Foxi3 cKO, but they were smaller in size than controls (M1) and second (M2) molars of Foxi3 cKO mice were fused, (Fig. 2G,H). At E16, the IEE did not show normal folding, and the third molar (M3) was sometimes missing or fused with indicating that the shape of the crown was not forming correctly anterior molars (Fig. 1A-C). Micro-computed tomography (micro- (Fig. 2I-L). At E18, some embryos showed normal M3 bud CT) scans on 5-week-old control and Foxi3 cKO lower jaws formation despite the fusion of M1 and M2 (Fig. 2M,N). (Fig. 1D-L; Fig. S1) revealed small cusps in two parallel rows. The Mesenchymal condensation and ameloblast differentiation transverse ridges connecting cusps in the wild-type teeth were appeared normal in Foxi3 cKO embryos (Fig. 2). In postnatal day missing from mutants. Shallow cusps were easily visible in a lingual (P) 8 molar crown, there was secreted enamel and dentin, and view (Fig. 1G-I). From an anterior view, it was obvious that the root formation had been initiated normally (Fig. 2O,P). We buccal side of the Foxi3 cKO molars was more affected (Fig. 1J-L). analyzed the efficiency of the Cre-driver used and noticed mosaic An additional row of cusps appeared to be forming on the buccal Foxi3 expression in the Foxi3 cKO molars at E12.5 (Fig. S2A-C). side of the mutant teeth. The morphologies of the roots of were also At later stages (E13.5 and E14.5), qRT-PCR and in situ affected (Fig. S1J,K) hybridization confirmed the downregulation of Foxi3 expression Molars were fused in 95% of the lower jaw halves (38/40) and in (Fig. 5A; Fig. S2D,E). In conclusion, loss of Foxi3 affects several 100% of the upper jaw halves (40/40). M3 was missing in 53% of epithelial cell populations in the developing molar and impairs tooth lower jaw halves (21/40) and in 17.5% of upper jaw halves (7/40). morphogenesis. Incisors were absent or small (the incisor phenotype will be described elsewhere). We did not observe any phenotype in Foxi3 expression was downregulated upon differentiation of heterozygous animals. Given that the hairless dogs having a dental epithelium and is regulated by several signaling severe tooth phenotype are heterozygotes for Foxi3, it is plausible pathways that mice have a compensatory mechanism for reduction in Foxi3 Next we examined the localization of Foxi3 protein (Fig. 3A-C). In levels that is not present in dogs. Taken together, the adult a similar manner to Foxi3 mRNA expression (Shirokova et al., phenotype of the Foxi3 cKO mice indicates that Foxi3 is an 2013), at E13.5 Foxi3 was strongly expressed on the lingual side of important regulator of tooth morphogenesis. the forming tooth, which grows faster when the epithelium proceeds DEVELOPMENT

3955 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

Fig. 2. Embryonic phenotype of Foxi3 cKO mice. (A-J) Frontal sections of control and Foxi3 cKO molars from E12.5 to E16. Arrows in A,B point to the suprabasal cells; asterisks in E,G,I mark the stellate reticulum; white open arrowheads in G,H point to the cervical loops; and arrows in G,I point to the dental cord. (K-N) Sagittal sections of control and Foxi3 cKO molars at E16 and E18. Asterisk in K marks the stellate reticulum; arrows in M,N point to M3. (O,P) Frontal sections of developing roots of control and Foxi3 cKO molars at P8. Arrowheads point to the tips of roots. D, dentin; E, enamel; IEE, inner enamel epithelium; M1, first molar; M2, second molar; M3, third molar. Lingual is on the right in A-J. Scale bars: 100 μm.

from bud to cap. At E14.5, double staining with Lef1 revealed that mesenchymal interactions. Therefore, we decided to explore which although Foxi3 was present in most epithelial cells, it appeared signaling molecules might regulate Foxi3 expression at this time by largely absent from the Lef1-positive PEK (Fig. 3B). At E16, Foxi3 using a hanging drop culture system, in which E13.5 molars are was present in the IEE and in the stellate reticulum, but only weakly exposed to a growth factor for 4 h before RNA collection for expressed in the Lef1-positive SEKs (Fig. 3C). In addition, the tips qRT-PCR. Activin A was previously shown to upregulate Foxi3 of the growing cervical loops were negative for Foxi3 staining in embryonic skin, and it stimulated Foxi3 in tooth epithelium by (Fig. 3C). These observations indicate that Foxi3 is excluded from 2.7-fold (Fig. 3D). Shh induced a 1.7-fold upregulation of Foxi3 the epithelial cells that have started to differentiate and acquire new (Fig. 3E). Bmp4, a known inducer of PEK (Jernvall et al., 1998), identities, such as enamel knots and the cervical loops. downregulated Foxi3 expression levels to half that of the control Downregulation of Foxi3 in IEE before their differentiation to samples (Fig. 3F). Fgf8 had no effect on Foxi3 expression, yet it ameloblasts was reported previously (Shirokova et al., 2013). induced its own target Dusp6 by over fivefold (data not shown). The morphogenesis of the tooth germ from bud to cap stage and These results suggest that Foxi3 is a target of Activin A, Shh and the induction of PEK are known to be regulated by epithelial- Bmp4. We have previously shown that ectodysplasin (Eda) also enhances Foxi3 expression at this stage in the tooth (Shirokova et al., 2013). However, after the bud stage Foxi3 expression is significantly broader than Eda receptor expression (Laurikkala et al., 2001), indicating that Foxi3 expression is regulated largely by other signals. All these pathways are known to target the dental epithelium (Jussila and Thesleff, 2012) and might therefore regulate Foxi3 directly.

Suprabasal cell population was reduced in the Foxi3 cKO molar In order to study more closely the defect in the early morphogenesis of Foxi3 mutant molars, we used E- and P-cadherin (cadherins 1 and 3, respectively) as markers of the suprabasal and basal epithelial cell populations (Palacios et al., 1995; Fausser et al., 1998). We measured the relative areas of the strongly E-cadherin-positive and weakly P-cadherin-positive suprabasal epithelia and the strongly P-cadherin-positive basal epithelia at E13.0, and found that the suprabasal cell population was smaller in the Foxi3 cKO molar (Fig. 4A-C). In control molars, the suprabasal epithelium Fig. 3. Foxi3 protein expression and upstream regulation. (A-C) Localization of Foxi3 protein together with Lef1 (B,C) in molar epithelium represented 35% of the total epithelial area, and in the Foxi3 cKO at E13.5, E14.5 and E16. Arrows point to enamel knots; white open only 28% (Fig. 4C; P=0.006). Overall, the area of the Foxi3 cKO arrowheads point to cervical loops. White line indicates the border between epithelium was smaller than in control embryos (Fig. S3). These epithelium and mesenchyme. Scale bars: 100 μm. (D-F) Relative expression observations raise the possibility that the defect in suprabasal cell of Foxi3 analyzed by qRT-PCR (mean±s.d.) in E13.5 wild-type molars in the layer and budding morphogenesis might be connected. presence or absence of a growth factor. Known target genes of each pathway A putative defect in suprabasal cells was supported by our were used as the positive controls. (D) Activin A induced Foxi3 2.7-fold and microarray analysis of E13.5 Foxi3 cKO and wild-type molar follistatin 5.4-fold (P=0.012, Wilcoxon signed-rank test), n=8. (E) Shh induced Foxi3 1.8-fold, Gli 2.9-fold and Ptch1 4.8-fold (P=0.028, Wilcoxon signed-rank epithelia (array results reported in detail below), which showed that test), n=6. (F) Bmp4 induced Foxi3 0.5-fold and Msx2 4.4-fold (P=0.018, Notch2, Krt10 and Krt1 were downregulated in the Foxi3 cKO

Wilcoxon signed-rank test), n=7. *P<0.05. molar. Notch2, together with Notch1 and 3, is expressed in the DEVELOPMENT

3956 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

We analyzed expression of K10, and observed few weakly K10- positive cells in control and Foxi3 cKO molars at E13.0 (data not shown). Twelve hours later, there were K10-positive cells in the suprabasal epithelium of control molars, and in addition, some basal cells expressed weaker K10 signal (Fig. 4I, Fig. S4A,B). In Foxi3 cKO molars, only few weakly K10-positive cells were scattered among the suprabasal cells (Fig. 4J, Fig. S4C). At E14.5, both K10- positive and K10-negative cells were present in the control molars, whereas in the Foxi3 cKO the K10-positive cells were largely absent (Fig. 4K,L). At E16, the lack of K10-positive cells in the suprabasal cell compartment (i.e. stellate reticulum) of the Foxi3 cKO tooth was striking compared with the control tooth (Fig. 4M,N). These results indicate that the K10-positive suprabasal cell population in the molars is decreased in the Foxi3 cKOs, consistent with the reduction of the stellate reticulum cell compartment. K10-positive cells associated with the stratification of oral epithelium were present in both control and Foxi3 cKO (Fig. 4N; data not shown).

Microarray analysis revealed alterations in multiple signaling pathway components in the Foxi3 cKO molar In order to identify putative Foxi3 downstream targets, we performed genome-wide profiling of differentially expressed genes in Foxi3 cKO and control molar epithelia at E13.5, the earliest stage displaying efficient Foxi3 deletion. Of the differentially expressed genes, 292 were downregulated and 431 upregulated (Table S3), but only 30 of the downregulated genes showed more than a 0.6-fold reduction of expression and only 54 upregulated genes showed more than a 1.2-fold difference. To validate the microarray results, we confirmed Foxi3 downregulation and assessed 16 other genes by qRT-PCR. With the exception of one gene, all showed a statistically significant change with qRT- PCR (Fig. 4D; Fig. 5). The Bmp4 target gene Msx2, as well as three Iroquois-family transcription factors (Irx2, Irx3 and Irx5) that are expressed in the molar epithelium (Houweling et al., 2001), were among the Fig. 4. Analysis of the suprabasal epithelium in Foxi3 cKO molars. downregulated genes (Fig. 5A). Interestingly, a striking number of (A,B) E- and P-cadherin double staining of control and Foxi3 cKO molars at the genes upregulated in the Foxi3 cKO in the microarray belonged E13.0. Arrows point to the suprabasal epithelium. White line indicates areas of to different signaling pathways, including Fgf, Shh, Wnt and Bmp. suprabasal and basal epithelium measured in C. (C) Relative ratios of Fgf15 and the Wnt inhibitor Sfrp5 were among the highest suprabasal and basal epithelial areas of the total epithelium in wild-type and upregulated genes in the microarray, and qRT-PCR showed about Foxi3 cKO molars at E13.0 (n=3). Total areas are shown in Fig. S4. (D) Relative expression of downregulated Notch2 (0.51-fold), Krt1 (0.32-fold) and Krt10 15- and 13-fold upregulation of Fgf15 and Sfrp5 transcripts, (0.16-fold) analyzed by qRT-PCR (mean±s.d.) in control and Foxi3 cKO molars respectively (Fig. 5B). In addition, we validated upregulation of the at E13.5 (P=0.029, Mann–Whitney U-test, n=4). (E,F) Expression of Notch2 in Fgf pathway target genes Dusp6 and Etv5 and the Shh pathway E13.5 control and Foxi3 cKO molars. (G,H) Expression of Notch1 in E13.5 genes Shh and Ptch1, whereas the difference in Gli1 expression was control and Foxi3 cKO molars. (I-N) Keratin 10 and P-cadherin (in I-L) staining not significant (Fig. 5C). Semaphorin 3E (Sema3e) was also of control and Foxi3 cKO molars at E13.5, E14.5 and E16. Arrows point to K10- upregulated in Foxi3 cKO (Fig. 5C). positive cells, open white arrowheads to K10-positive cells in the oral epithelium. White line in E-H indicates the border between epithelium and Subsequently, we localized some of the differentially expressed mesenchyme. Lingual is on the right. Scale bars: 100 μm. genes by RISH in sections of E13.5 control and Foxi3 cKO molars. In the control samples, Fgf and Bmp pathway genes were confined to the tip of the bud epithelium, but in Foxi3 cKO the expression of suprabasal epithelium throughout tooth development (Mitsiadis the Fgf pathway target Dusp6 and Fgf antagonist sprouty 2 (Spry2) et al., 1995). Keratin 10 (K10) is a type I keratin, which forms spanned the whole depth of the dental epithelium (Fig. 6A-D). intermediate filaments with the type II keratin 1 (K1). In skin, Bmp7, as well as the Bmp target Id1, showed a similar broad suprabasal cells express K1 and K10 both during embryogenesis expression in Foxi3 cKO (Fig. 6E-H). By contrast, Shh was expressed and in adulthood (Wallace et al., 2012). qRT-PCR validation in a patchy pattern compared with the focal signaling center present in showed a downregulation of Notch2 (0.51-fold), K1 (0.32-fold) and control teeth (Fig. 6I,J), and Wnt10a was more restricted to the basal K10 (0.16-fold) in the Foxi3 cKO bud stage epithelium (Fig. 4D). portion of the mutant molar epithelium (Fig. 6K,L). Msx2 showed a Radioactive in situ hybridization (RISH) revealed that Notch2 similar but weaker expression in the buccal epithelium in the Foxi3 expression was downregulated in the mutant epithelium (Fig. 4E,F), mutants compared with controls (Fig. 6M,N). Sema3e expression has but Notch1, which was not significantly changed in our microarray not been reported for developing molars, and unlike the control analysis, was expressed in a comparable manner in controls and teeth, Sema3e wasexpressedectopicallyintheFoxi3 cKO

Foxi3 cKO molars (Fig. 4G,H). epithelium (Fig. 6O,P). In conclusion, our microarray, qRT-PCR DEVELOPMENT

3957 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

Fig. 5. Validation of differentially expressed genes from the microarray by qRT-PCR. (A) Relative expression of Foxi3 (0.05-fold), Msx2 (0.5-fold), Irx2 (0.6-fold), Irx3 (0.5- fold) and Irx5 (0.5-fold) analyzed by qRT-PCR (mean±s.d.) in wild-type and Foxi3 cKO molars at E13.5 (mean±s.d., P=0.029, Mann–Whitney U-test, n=4). (B) Relative expression of Fgf15 (14.9-fold) and Sfrp5 (13.6-fold) in wild- type and Foxi3 cKO molars at E13.5 (mean±s.d., P=0.029, Mann–Whitney U-test, n=4). (C) Relative expression of Fgf9 (1.9-fold), Dusp6 (2.9-fold), Etv5 (2.7-fold), Shh (4.2-fold), Gli1 (1.5-fold), Ptch1 (2.4-fold) and Sema3e (3.0-fold) in wild- type and Foxi3 cKO molars at E13.5 (mean±s.d., Gli1 P=0.34, others P=0.029, Mann–Whitney U-test, n=4). ns, not statistically significant; *P<0.05.

and RISH data suggest that the defect in epithelial morphogenesis of precocious PEK formation (Fig. S5A,B). At E14.5, Lef1 and P- the Foxi3 cKO tooth was associated with incorrect localization and cadherin immunostaining revealed that the structure of the PEK was activity of signaling pathways, and in particular, the Fgf, Shh and abnormal in Foxi3 cKO (Fig. S5C-F). However, PEK marker genes Bmp pathways were stimulated. Shh and Dkk4 were expressed in a similar manner in control and Foxi3 cKO PEK, whereas Wnt10a seemed to be expressed more Foxi3 cKO dental epithelium displayed molecular signs of widely in Foxi3 cKO (Fig. S5G-L). precocious differentiation At E16, p21 was expressed in the SEKs of the control teeth, The PEK and the SEKs are marked by expression of the cyclin- whereas in the Foxi3 cKO p21 spanned the whole IEE (Fig. 7E,F). dependent kinase inhibitor p21 (Jernvall et al., 1998). p21 was The Wnt and Bmp inhibitor Sostdc1 has been linked to PEK upregulated in our microarrays, and RISH confirmed a strong formation and it is expressed in a mirror image with p21 (Laurikkala expression at E13.5 in the tip of Foxi3 cKO epithelium (Fig. 7A,B). et al., 2003; Kassai et al., 2005). Sostdc1 was downregulated in our At E14.5, there was p21 expression in the PEK and in the dental microarray, and RISH revealed a reduction of Sostdc1-expressing cord in control molars, but in the Foxi3 cKO p21 expression epithelium in the Foxi3 cKO at E13.5 and E14.5, whereas its spanned the whole epithelium (Fig. 7C,D). This prompted us to mesenchymal expression seemed unaffected (Fig. 7G-J). At E16, investigate other characteristics of the Foxi3 cKO PEK. Analysis of Sostdc1 was expressed in the stellate reticulum and in the IEE BrdU-negative cells at E14.0 revealed that, in contrast to weight- between the SEKs in the control tooth, but in Foxi3 cKO there was matched littermates, there was already a clear BrdU-negative area in no expression in the IEE (Fig. 7K,L). p21 and Sostdc1 showed the tip of the epithelial bud of the Foxi3 cKO molar, indicating mirror-image expression patterns in both the control and Foxi3 cKO

Fig. 6. Validation of differentially expressed genes from the microarray by in situ hybridization. (A-P) Expression of microarray hit genes in E13.5 control and Foxi3 cKO molars. White line indicates the border between epithelium and mesenchyme. Lingual is on the right. Scale bar: 100 μm. DEVELOPMENT

3958 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

Fig. 7. Expression of p21, Sostdc1, Fgf15 and Sfrp5 in Foxi3 cKO. (A-F) Expression of p21 in E13.5, E14.5 and E16 control and Foxi3 cKO molars. Arrows in E,F point to p21 expression in IEE. (G-L) Expression of Sostdc1 in E13.5, E14.5 and E16 control and Foxi3 cKO molars. Arrows in K,L point to IEE where Sostdc1 is expressed in control molars. (M-P) Expression of Fgf15 in E14.0 and E15 control and Foxi3 cKO molars. (Q-T) Expression of Sfrp5 in E14.5 and E15 control and Foxi3 cKO molars. IEE, inner enamel epithelium. White line indicates the border between epithelium and mesenchyme. Lingual is on the right. Scale bars: 100 μm.

epithelium at all stages studied. This suggests that in the Foxi3 cKO Crown patterning signals were misexpressed in the Foxi3 the intercuspal Sostdc1-positive IEE had undergone a change in cell cKO molar fate into SEK. The cusp phenotype of the adult Foxi3 cKO molars and the In the microarray, Fgf15 and Sfrp5 were significantly upregulated expression pattern of the SEK marker p21 at E16 (see above) in Foxi3 cKO at E13.5, but we could not detect their expression with indicated a dramatic defect in SEK patterning. Also, the expression RISH at this stage. At E14, however, Fgf15 was weakly expressed in of other SEK markers, such as Lef1, Dkk4 and Wnt10a, spanned the control molars and upregulated in the Foxi3 cKO epithelium entire IEE in Foxi3 cKO molars as evidenced by analysis in both (Fig. 7M,N). At E15, Fgf15 expression was present in the SEKs of sagittal (Fig. 8A-D) and frontal (Fig. 8E-H) sections. However, Fgf4 the control tooth, whereas in the Foxi3 cKO there was ectopic Fgf15 was expressed focally in the SEKs in both the control and in Foxi3 expression in the cervical loops (Fig. 7O,P). Sfrp5 was expressed in cKO molars (Fig. 8I,J). Thus, most but not all SEK markers both the control and Foxi3 cKO molars at E14.5 around the PEK and analyzed were ectopically expressed in the Foxi3 cKO IEE. in the cervical loops (Fig. 7Q,R). At E15 in the control molar, there was expression only in the cervical loops, but in the Foxi3 cKO there DISCUSSION was strong expression spanning from the cervical loops towards the We have shown that Foxi3 affects all major stages of tooth enamel knots (Fig. 7S,T). During normal development, Foxi3 is morphogenesis and has several different functions during tooth downregulated in the cervical loops at E16 (Fig. 3C). Taken development (Fig. 9). Early on, it controls the formation of K10- together, upregulation of differentiation markers, such as p21, positive suprabasal cells. Later on, Foxi3 acts as an inhibitor of Fgf15 and Srfp5, points to a precocious differentiation of the Foxi3 differentiation that prevents the epithelium from precociously cKO epithelium. acquiring the fates of cervical loops and enamel knots and In order to investigate whether the precocious epithelial probably also of ameloblasts. This kind of function has not been differentiation had an effect on ameloblasts, we localized expression suggested previously for any transcription factor expressed in the of the enamel protein ameloblastin. At E18 in control lower molars, dental epithelium (Bei, 2009). ameloblastin expression had started at the cusp tips and spread cervically in some sections, whereas in Foxi3 cKO lower molars Foxi3 regulates formation of suprabasal cells the expression covered a wider area and appeared more intense The earliest manifestation of the Foxi3 cKO molar phenotype was (Fig. S6A-D). In upper molars, there was no ameloblastin expression an abnormally shaped placode with a reduced suprabasal in controls, but in Foxi3 cKO the expression was evident (Fig. S6E,F). compartment. We saw a specific downregulation of Notch2 but These observations suggested an earlier onset of ameloblast not Notch1, which suggests that in addition to being fewer in differentiation in the Foxi3 mutants. However, owing to the restricted number, the suprabasal cells are abnormally specified. Little is number of samples the results should be considered preliminary. known about the cellular mechanism driving tooth placode DEVELOPMENT

3959 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

bud formation could be a result of altered adhesive properties of the epithelium. In support of this hypothesis, several adhesion molecules, such as cadherins and claudins, were differentially expressed in the microarray. The branchial arch phenotype of the Foxi3 KO has been speculated to result from a defect in cell adhesion (Edlund et al., 2014). In addition to Foxi3 cKO, the dental cord does not form in the molars of the conditional epithelial Shh KO (Dassule et al., 2000). In the Shh cKO, also the M1 and M2 fuse and the molars have shallow cusps with an abnormal pattern (Dassule et al., 2000). Deletion of other Shh pathway components, Smo or Evc, leads to milder molar fusion phenotypes (Gritli-Linde et al., 2002; Nakatomi et al., 2013). Our hanging drop induction experiment suggests that Foxi3 might be a downstream target of Shh, and therefore Foxi3 deletion could lead to a similar phenotype to the mutations in the Shh pathway components. Sostdc1 was downregulated in the Foxi3 cKO, and M1 and M2 are fused in the Sostdc1 knockouts (Kassai et al., 2005). However, their cusp Fig. 8. Expression of SEK markers in Foxi3 cKO. (A-D) Expression of Lef1 phenotype is different from Foxi3 cKO and their early molar and Dkk4 in sagittal sections of E16 control and Foxi3 cKO molars. morphogenesis appears normal. The molar fusion in Sostdc1 KO (E-J) Expression of Dkk4, Wnt10a and Fgf4 in frontal sections of E16 control was suggested to be caused by ectopic p21 expression, which we and Foxi3 cKO molars. Arrows point to focal expression in SEK signaling observed also in Foxi3 cKO. In general, the mechanism of molar centers. Lingual is on the right. Scale bars: 100 μm. fusion is poorly understood. The buds of M2 and M3 form sequentially from the posterior end of the previous molar, and the formation and the origin of the suprabasal cells. In the embryonic separation of molars requires epithelial downgrowth in a similar skin, asymmetric cell divisions of basal cells give rise to suprabasal manner to the growth of cusps in the tooth crown. We suggest that cells, which express differentiation markers, such as K1, while the molar fusion in Foxi3 cKO is related to the failure in the M1 bud remaining proliferative (Lechler and Fuchs, 2005), as do dental formation and to the impaired epithelial downgrowth, which is suprabasal cells. We observed K10 expression in some basal cells, necessary for proper separation of M2 from M1. Interestingly, Li suggesting that also in teeth, the K10-positive cells might originate et al. (2015) showed recently that the downgrowth of cervical loop from the basal layer. The lack of stellate reticulum and the epithelium in the molar depends on Shh signaling to regulate the downregulation of K1 and K10 in Foxi3 cKO would indicate maintenance of Sox2-expressing transient stem cells in the loops. It a failure in this process. However, K10 expression was detectable is possible that Foxi3 regulates cervical loop downgrowth as part of in developing teeth only after E13.0, whereas the reduction in this signaling network. suprabasal cell population was already noticeable at the placode stage, suggesting an alternative or additional explanation. Hair Foxi3 might function as an epigenetic regulator placodes arise from cell migration and intercalation (Ahtiainen et al., Our microarray revealed a large number of up- and downregulated 2014), and it is possible that a similar mechanism exists in teeth and is genes. They are likely to represent both direct and indirect targets impaired in the Foxi3 cKO. This could lead to a failure in the of Foxi3, the latter reflecting a deficiency in the suprabasal specification of the initial suprabasal cells. Further studies will be cell population and precocious enamel knot differentiation. We required to uncover the causative mechanism, but unfortunately, the validated by qRT-PCR downregulation of Irx2, Irx3 and Irx5 in inefficient deletion of Foxi3 prior to E13.5 hampers these efforts. Foxi3 cKO, and in addition, Irx1 was downregulated in the microarray. All four transcription factors have an overlapping Foxi3 regulates dental cord formation and prevents molar expression pattern with Foxi3 (Houweling et al., 2001), making fusion them good candidates for Foxi3 targets, but their function in tooth The cellular mechanisms that drive the narrowing of the neck of the formation is not known. The highest upregulated gene in the tooth bud, the dental cord, are not known. The defect in Foxi3 cKO microarray was the enamel knot marker Fgf15 (Kettunen et al.,

Fig. 9. Foxi3 inhibits epithelial differentiation and promotes suprabasal cell formation. Schematic illustration of the key findings in this article. At the bud stage at E13.5, loss of Foxi3 leads to a lack of suprabasal cells and upregulation of signaling pathway components in the epithelium. At E16, markers of SEKs and cervical loops become expanded. The key genes identified were Krt10 (K10), Krt1 (K1) and Notch2 in suprabasal cells and p21, Fgf15 and Sfrp5,in addition to several PEK and SEK markers, as indicators of differentiation. WT, wild type. DEVELOPMENT

3960 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

2011; Porntaveetus et al., 2011). Fgf15−/− mice have no phenotype intercuspal regions Foxi3 could prevent Bmp4 responses, such as (Porntaveetus et al., 2011), but it might act redundantly with other induction of p21 expression (Jernvall et al., 1998) and ameloblast Fgfs. Interestingly, it has been shown that Foxi3 binds to a specific differentiation (Wang et al., 2004). In addition to Bmp4, we oxidized form of methylated cytosines on the Fgf15 promoter, and identified several other signals that affected Foxi3 expression, this binding is linked to repression of transcription (Iurlaro et al., namely Shh, Activin and Eda. They have all been linked to 2013). This suggests that Foxi3 could normally repress genes such modulation of crown shape complexity (Harjunmaa et al., 2012); as Fgf15, and perhaps also other microarray hits, such as Sema3e therefore, changes in Foxi3 levels during evolution could be one and the Wnt inhibitor Sfrp5, which were also among the most highly way to modify the cusp pattern in different species. Interestingly, the upregulated genes. The winged helix domains of Fox factors have cusp pattern of Foxi3 cKO resembles the multituberculates, an structural similarity to linker histones, and some of them have been extinct clade of mammals, which had molars with longitudinal cusp shown to bind and modulate chromatin in order to induce changes in rows (Wilson et al., 2012). gene expression (Benayoun et al., 2011). If epigenetic regulation is In conclusion, based on the expression pattern of Foxi3 and the the main function of Foxi3 in dental epithelium, it is possible that a phenotype of the Foxi3 cKO, we propose that during tooth large amount of microarray targets exhibit this type of regulation. morphogenesis Foxi3 has a unique role as a transcription factor This might also explain why we did not see many genes being that keeps the dental epithelium in an undifferentiated state. Foxi3 strongly up- or downregulated. might execute its function partly through epigenetic regulation, and it regulates formation of the suprabasal cells and inhibits the Foxi3 is an inhibitor of epithelial differentiation differentiation of cervical loops and enamel knots. The microarray revealed a general upregulation of components of different signaling pathways, and in particular, PEK markers p21 MATERIALS AND METHODS and Fgf15 in the Foxi3 cKO tooth bud epithelium (Fig. 9). In Animals addition, Sfrp5, which marks the cervical loops initiating root Wild-type NMRI mice (The Jackson Laboratory) were used in hanging drop cultures. K14-cre43;Foxi3+/− males (Andl et al., 2004; Edlund et al., 2014) formation at late bell stage (E. Juuri and I.T., unpublished results), floxed/floxed was induced precociously at the bud stage in Foxi3 cKO (Fig. 9). were crossed with Foxi3 females (Edlund et al., 2014; Foxi3tm1.1Akg/J; The Jackson Laboratory stock 024843) to obtain K14- Foxi3 was expressed throughout the bud epithelium but became − cre43;Foxi3 /floxed mice (Foxi3 cKO). For analyzing the adult tooth downregulated during bud to cap stage transition from the PEK phenotype, cleaned skulls were used in micro-CT scan. For collecting signaling center. During subsequent tooth morphogenesis, Foxi3 embryonic samples, the day of the vaginal plug was counted as E0.5, and the was downregulated in the cervical loop epithelium. Together, these embryos were staged further according to limb and molar morphology. observations suggest that Foxi3 inhibits the dental epithelium from Foxi3+/floxed and Foxi3−/floxed animals were used as controls except in precocious differentiation towards PEK and cervical loop fates. microarray experiments where all controls were Foxi3+/floxed. All mouse Additionally, downregulation of Foxi3 in PEK and SEK might be a work has been carried out in accordance with the guidelines and approval prerequisite for their induction. The BrdU incorporation assay from Finnish National Board of Animal Experimentation. indicated that PEK induction was accelerated in Foxi3 mutants. Our preliminary data suggested that ameloblasts differentiated slightly Histology, in situ hybridization, immunohistochemistry and earlier in Foxi3 cKO compared with their littermates, supporting a immunofluorescence role for Foxi3 as an inhibitor of precocious differentiation. We For histology, radioactive in situ hybridization (RISH) and showed that exposure of bud stage teeth to Bmp4 downregulated immunohistochemistry, tissues were fixed overnight in 4% paraformaldehyde, dehydrated and embedded in paraffin. Sections 5-7 μm Foxi3 expression. Interestingly, Bmp4 has been shown to induce thick were cut in frontal and sagittal planes. Antigen retrieval for PEK formation (Jernvall et al., 1998) and ameloblast differentiation immunohistochemistry and immunofluorescence was performed by (Wang et al., 2004) and this, together with the downregulation of heating the slides in 10 mM sodium citrate buffer (pH 6.0). Each gene or Foxi3 in the PEK and ameloblasts, suggests that Foxi3 might protein was analyzed in two or three individuals. function as an inhibitor of dental epithelial differentiation. RISH was carried out according to a standard protocol. The following [35S]-UTP (Perkin Elmer)-labeled RNA probes were used to detect gene Balance of activating and inhibiting signals that regulate expression: Bmp7 (Åberg et al., 1997), Dkk4 (Fliniaux et al., 2008), Dusp6 crown patterning is perturbed in Foxi3 cKO (James et al., 2006), Fgf4 (Jernvall et al., 1994), Fgf15 (Kettunen et al., At a later stage, during SEK formation, most IEE took the SEK fate 2011), Foxi3 (Ohyama and Groves, 2004), Id1 (Rice et al., 2000), Lef1 in Foxi3 cKO mutants. This was manifested by the ectopic (Travis et al., 1991), Msx2 (Jowett et al., 1993), p21 (Jernvall et al., 1998), Sfrp5 (Witte et al., 2009), Shh (Vaahtokari et al., 1996a), expression of a number of SEK markers and the absence of Sostdc1 (Laurikkala et al., 2003), Sprouty2 (Zhang et al., 2001) and Sostdc1 from the intercuspal epithelium, supporting the idea of Wnt10a (Dassule and McMahon, 1998). Rat ameloblastin probe was a kind Foxi3 as an inhibitor of SEKs in addition to PEK. During crown gift from Jan C. Hu (University of Texas School of Dentistry, TX, USA). patterning, the cells respond to two types of signals, to activators A 645 bp fragment of the mouse Sema3e gene was amplified using the inducing SEK formation and to inhibitors. The inhibitors repress following primers: forward, ACATTGGATCAGCCTCTGCT; and reverse, differentiation and induce proliferation and they prevent new AGCCAATCAGCTGCAAGAAT. The PCR fragment was cloned into signaling centers from forming in close proximity to the existing pCRII-pTOPO vector (Invitrogen by LifeTechnologies) and sequenced to centers (Salazar-Ciudad and Jernvall, 2010). The spreading of SEK confirm fragment identity. markers in Foxi3 cKO suggests that there is a decreased level of To detect proliferating cells, BrdU (Amersham) was injected to pregnant inhibition in the mutant tooth. Thus, Foxi3 might either suppress the females at 10 µl/g, and embryos were collected after 2 h. BrdU was detected with anti-BrdU antibody at 1:1000 (mouse; Thermo Fisher Scientific), the responsiveness of the intercuspal epithelium to activators (such as M.O.M. immunodetection kit (Vector Laboratories) and DAB staining Bmp4) or promote their sensitivity to inhibitors (such as Shh). As (DAB Peroxidase Substrate Kit; Vector Laboratories). Bmp4 was able to inhibit Foxi3 expression in bud stage teeth, it For immunofluorescence, primary antibodies were used at the following could likewise also inhibit Foxi3 in the SEKs, allowing dilutions: Foxi3 1:150 (goat; Santa Cruz Biotechnology), E-cadherin differentiation of the signaling centers. At the same time, in 1:1000 (mouse; BD Biosciences), P-cadherin 1:100 (goat; R&D Systems), DEVELOPMENT

3961 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

Lef1 1:1000 (rabbit; Cell Signaling Technology) and keratin 10 1:200 Competing interests (rabbit; Abcam). Secondary antibodies, Alexa488 donkey anti-goat, The authors declare no competing or financial interests. Alexa568 goat anti-mouse and Alexa568 donkey anti-rabbit (Invitrogen by Life Technologies), were used at a dilution of 1:800. Author contributions All samples were imaged with a Zeiss Axio Imager M2 microscope M.J., M.L.M. and I.T. designed the study. M.J., M.S.N., A.A., V.S., A.B. and A.K. equipped with an Axio Cam HR camera (Zeiss) and processed in performed the experiments. M.J. and I.T. analyzed the data. A.G. and T.O. generated the Foxi3 mutant mice. M.J., M.L.M. and I.T. prepared the manuscript. Photoshop. Frontal images are oriented so that the lingual side is on the left. All authors commented on the manuscript. Quantification of the epithelial areas was done on E-cadherin- and P- cadherin-stained sections, and ten sections at the widest part of the molar Funding were chosen from three control and three Foxi3 cKO individuals. The whole This work was financially supported by the Academy of Finland; the Swiss National area of the epithelium, in addition to the basal (strong P-cadherin) and Science Foundation Sinergia [CRSI33_125459]; the Sigrid Juselius Foundation; the suprabasal areas (strong E-cadherin), was outlined manually using the Jane and Aatos Erkko Foundation and the Finnish Cultural Foundation. Zen2011 program (Zeiss). Student’s t-test was used for testing statistical significance, and a P-value of 0.05 was used as the significance threshold. Supplementary information Supplementary information available online at Hanging drop experiments http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.124172/-/DC1 Foxi3 induction was studied by treating E13.5 wild-type NMRI molars for 4 h in hanging drop culture with control media (Dulbecco’s minimal essential References Åberg, T., Wozney, J. and Thesleff, I. (1997). Expression patterns of bone medium supplemented with 10% fetal calf serum, glutamine and penicillin- morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles in streptomycin) or media containing the signaling molecule of interest at the morphogenesis and cell differentiation. Dev. Dyn. 210, 383-396. following concentrations: Activin A 0.5 µg/ml (Harrington et al., 2006), Shh Ahtiainen, L., Lefebvre, S., Lindfors, P. H., Renvoisé, E., Shirokova, V., 5 µg/ml (R&D Systems), Bmp4 0.1 µg/ml (R&D Systems) and Fgf8 1 µg/ml Vartiainen, M. K., Thesleff, I. and Mikkola, M. L. (2014). Directional cell (R&D Systems). A known signaling pathway target gene was used as a migration, but not proliferation, drives hair placode morphogenesis. Dev. Cell. 28, positive control. Left molars or right molars of two to three embryos were 588-602. Andl, T., Ahn, K., Kairo, A., Chu, E. Y., Wine-Lee, L., Reddy, S. T., Croft, N. J., pooled together for control and growth factor-treated samples, respectively. Cebra-Thomas, J. A., Metzger, D., Chambon, P. et al. (2004). Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential RNA extraction and quantitative reverse transcriptase- for tooth development. Development. 131, 2257-2268. polymerase chain reaction (qRT-PCR) Bei, M. (2009). Molecular genetics of tooth development. Curr. Opin. Genet. Dev. RNA from the hanging drop experiment samples or from the molar epithelia 19, 504-510. Benayoun, B. A., Caburet, S. and Veitia, R. A. (2011). Forkhead transcription collected for the microarray validation was extracted using the RNeasy mini factors: key players in health and disease. Trends Genet. 27, 224-232. kit (Qiagen) and reverse transcribed using 500 ng of random hexamers Dassule, H. R. and McMahon, A. P. (1998). Analysis of epithelial–mesenchymal (Promega) and Superscript II (Invitrogen by Life Technologies) following interactions in the initial morphogenesis of the mammalian tooth. Dev. Biol. 202, the manufacturers’ instructions. 215-227. qRT-PCR was performed using Lightcycler DNA Master SYBR Green I Dassule, H. R., Lewis, P., Bei, M., Maas, R. and McMahon, A. P. (2000). Sonic (Roche Applied Science) with the Lightcycler 480 (Roche Applied hedgehog regulates growth and morphogenesis of the tooth. Development 127, 4775-4785. Science). Gene expression was quantified by comparing the sample data Drögemüller, C., Karlsson, E. K., Hytönen, M. K., Perloski, M., Dolf, G., Sainio, against a dilution series of PCR products of each gene of interest. Data were K., Lohi, H., Lindblad-Toh, K. and Leeb, T. (2008). A mutation in hairless dogs analyzed with the manufacturer’s software and normalized against Ranbp. implicates FOXI3 in ectodermal development. Science 321, 1462. Data are shown as the mean±s.d. Wilcoxon signed-rank test was used for Edlund, R. K., Ohyama, T., Katarchi, H., Riley, B. B. and Groves, A. K. (2014). the paired hanging drop experiment samples and the Mann–Whitney U-test Foxi transcription factors promote pharyngeal arch development by regulating for the non-paired microarray validation samples for testing statistical formation of FGF signaling centers. Dev. Biol. 390, 1-13. Fausser, J.-L., Schlepp, O., Aberdam, D., Meneguzzi, G., Ruch, J. V. and Lesot, significance, and a P-value of 0.05 was used as the significance threshold. H. (1998). Localization of antigens associated with adherens junctions, Primers are listed in Table S1. desmosomes, and hemidesmosomes during murine molar morphogenesis. Differentiation 63, 1-11. Microarray experiments and data analysis Fliniaux, I., Mikkola, M. L., Lefebvre, S. and Thesleff, I. (2008). Identification of dkk4 as a target of Eda-A1/Edar pathway reveals an unexpected role of For identification of Foxi3 target genes, E13.5 molar epithelium was +/floxed ectodysplasin as inhibitor of Wnt signalling in ectodermal placodes. Dev. Biol. dissected from Foxi3 cKO and Foxi3 littermate embryos from six 320, 60-71. litters. Briefly, molar tooth germs were dissected under a microscope in Gritli-Linde, A., Bei, M., Maas, R., Zhang, X. M., Linde, A. and McMahon, A. P. Dulbecco’s PBS and transferred to 1:25 Dispase II in 10 mM NaAc pH 7.5 (2002). Shh signaling within the dental epithelium is necessary for cell (stock 5 U/ml; Sigma-Aldrich) and incubated at 4°C for 3-4 h. The proliferation, growth and polarization. Development 129, 5323-5337. ̈ ̈̈ separated epithelia of the two molars of each embryo were collected together Harjunmaa, E., Kallonen, A., Voutilainen, M., Hamalainen, K., Mikkola, M. L. and − Jernvall, J. (2012). On the difficulty of increasing dental complexity. Nature 483, and frozen in dry ice before storage at 80°C. 324-327. Molar epithelia from five embryos were pooled together, and the Harrington, A. E., Morris-Triggs, S. A., Ruotolo, B. T., Robinson, C. V., Ohnuma, microarray consisted of four biological replicates of control and Foxi3 cKO S.-i. and Hyvönen, M. (2006). Structural basis for the inhibition of activin samples. RNA extraction is described above. RNA quality was monitored signalling by follistatin. EMBO J. 25, 1035-1045. using a 2100 Bioanalyzer (Agilent Technologies). RNA processing and Houweling, A. C., Dildrop, R., Peters, T., Mummenhoff, J., Moorman, A. F. M., ̈ hybridization on Affymetrix Mouse Exon 1.0 ST arrays (Affymetrix) and Ruther, U. and Christoffels, V. M. (2001). Gene and cluster-specific expression of the iroquois family members during mouse development. Mech. Dev. 107, data analysis were carried out at the Biomedicum Functional Genomics Unit 169-174. (University of Helsinki, Finland). The data were processed using R/ Iurlaro, M., Ficz, G., Oxley, D., Raiber, E.-A., Bachman, M., Booth, M. J., Bioconductor and normalized with the RMA algorithm and CustomCDF- Andrews, S., Balasubramanian, S. and Reik, W. (2013). A screen for database probe annotations. Differentially expressed genes were searched hydroxymethylcytosine and formylcytosine binding proteins suggests functions using the Cyber-T algorithm. P-values were corrected using the Q-value in transcription and chromatin regulation. Genome Biol. 14, R119. ̈ method. Microarray data are available in Gene Expression Omnibus James, M. J., Jarvinen, E., Wang, X.-P. and Thesleff, I. (2006). Different roles of Runx2 during early neural crest-derived bone and tooth development. J. Bone (accession number GSE65725). Miner. Res. 21, 1034-1044. Jernvall, J., Kettunen, P., Karavanova, I., Martin, L. B. and Thesleff, I. (1994). Acknowledgements Evidence for the role of the enamel knot as a control centre in mammalian tooth We thank Jukka Jernvall for discussions and comments on the manuscript and Raija cusp formation: non-dividing cells express growth stimulating Fgf4 gene.

Savolainen, Merja Mäkinen and Riikka Santalahti for technical assistance. Int. J. Dev. Biol. 38, 463-469. DEVELOPMENT

3962 RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

Jernvall, J., Åberg, T., Kettunen, P., Keränen, S. and Thesleff, I. (1998). The life (2013). Evc regulates a symmetrical response to Shh signaling in molar history of an embryonic signalling center. BMP4 induces p21 and is associated development. J. Dent. Res. 92, 222-228. with apoptosis in the mouse tooth enamel knot. Development 125, 161-169. Nieminen, P., Pekkanen, M., Åberg, T. and Thesleff, I. (1998). A graphical WWW- Jowett, A. K., Vainio, S., Ferguson, M. W., Sharpe, P. T. and Thesleff, I. (1993). database on gene expression in tooth. Eur. J. Oral Sci. 106, 7-11. Epithelial-mesenchymal interactions are required for msx 1 and msx 2 gene Ohazama, A. and Sharpe, P. T. (2007). Expression of claudins in murine tooth expression in the developing murine molar tooth. Development 117, 461-470. development. Dev. Dyn. 236, 290-294. Jussila, M. and Thesleff, I. (2012). Signaling networks regulating tooth Ohyama, T. and Groves, A. K. (2004). Expression of mouse Foxi class genes in organogenesis and regeneration, and the specification of dental mesenchymal early craniofacial development. Dev. Dyn. 231, 640-646. and epithelial cell lineages. Cold Spring Harb. Perspect. Biol. 4, a008425. Palacios, J., Benito, N., Berraquero, R., Pizarro, A., Cano, A. and Gamallo, C. Juuri, E., Jussila, M., Seidel, K., Holmes, S., Wu, P., Richman, J., Heikinheimo, (1995). Differential spatiotemporal expression of E- and P-cadherin during mouse K., Chuong, C.-M., Arnold, K., Hochedlinger, K. et al. (2013). Sox2 marks tooth development. Int. J. Dev. Biol. 39, 663-666. epithelial competence to generate teeth in mammals and reptiles. Development Porntaveetus, T., Otsuka-Tanaka, Y., Basson, M. A., Moon, A. M., Sharpe, P. T. 140, 1424-1432. and Ohazama, A. (2011). Expression of fibroblast growth factors (Fgfs) in murine Kassai, Y., Munne, P., Hotta, Y., Penttilä, E., Kavanagh, K., Ohbayashi, N., tooth development. J. Anat. 218, 534-543. Takada, S., Thesleff, I., Jernvall, J. and Itoh, N. (2005). Regulation of Rice, D. P., Åberg, T., Chan, Y., Tang, Z., Kettunen, P. J., Pakarinen, L., Maxson, mammalian tooth cusp patterning by ectodin. Science 309, 2067-2070. R. E. and Thesleff, I. (2000). Integration of FGF and TWIST in calvarial bone and Keränen, S. V. E., Åberg, T., Kettunen, P., Jernvall, J. and Thesleff, I. (1998). suture development. Development 127, 1845-1855. Association of developmental regulatory genes with the development of different Salazar-Ciudad, I. and Jernvall, J. (2002). A gene network model accounting for molar tooth shapes in two species of rodents. Dev. Genes Evol. 208, 477-486. development and evolution of mammalian teeth. Proc. Natl. Acad. Sci. USA 99, Kettunen, P., Furmanek, T., Chaulagain, R., Hals Kvinnsland, I. and Luukko, K. 8116-8120. (2011). Developmentally regulated expression of intracellular Fgf11-13, hormone- Salazar-Ciudad, I. and Jernvall, J. (2010). A computational model of teeth and the like Fgf15 and canonical Fgf16, -17 and -20 mRNAs in the developing mouse developmental origins of morphological variation. Nature 464, 583-586. molar tooth. Acta Odontol. Scand. 69, 360-366. Shirokova, V., Jussila, M., Hytönen, M. K., Perälä, N., Drögemüller, C., Leeb, T., Lam, E. W.-F., Brosens, J. J., Gomes, A. R. and Koo, C.-Y. (2013). Forkhead box Lohi, H., Sainio, K., Thesleff, I. and Mikkola, M. L. (2013). Expression of Foxi3 is proteins: tuning forks for transcriptional harmony. Nat. Rev. Cancer 13, 482-495. regulated by ectodysplasin in skin appendage placodes. Dev. Dyn. 242, 593-603. Laurikkala, J., Mikkola, M., Mustonen, T., Åberg, T., Koppinen, P., Pispa, J., Travis, A., Amsterdam, A., Belanger, C. and Grosschedl, R. (1991). LEF-1, a Nieminen, P., Galceran, J., Grosschedl, R. and Thesleff, I. (2001). TNF gene encoding a lymphoid-specific protein with an HMG domain, regulates T-cell signaling via the ligand–receptor pair ectodysplasin and edar controls the function receptor α enhancer function [corrected]. Genes Dev. 5, 880-894. of epithelial signaling centers and is regulated by Wnt and activin during tooth Vaahtokari, A., Åberg, T., Jernvall, J., Keränen, S. and Thesleff, I. (1996). The organogenesis. Dev. Biol. 229, 443-455. enamel knot as a signaling center in the developing mouse tooth. Mech. Dev. 54, Laurikkala, J., Kassai, Y., Pakkasjärvi, L., Thesleff, I. and Itoh, N. (2003). 39-43. Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, and Wallace, L., Roberts-Thompson, L. and Reichelt, J. (2012). Deletion of K1/K10 SHH signals from the tooth enamel knot. Dev. Biol. 264, 91-105. does not impair epidermal stratification but affects desmosomal structure and Lechler, T. and Fuchs, E. (2005). Asymmetric cell divisions promote stratification nuclear integrity. J. Cell Sci. 125, 1750-1758. and differentiation of mammalian skin. Nature 437, 275-280. Wang, X.-P., Suomalainen, M., Jorgez, C. J., Matzuk, M. M., Werner, S. and Li, J., Feng, J., Liu, Y., Ho, T.-V., Grimes, W., Ho, H. A., Park, S., Wang, S. and Thesleff, I. (2004). Follistatin regulates enamel patterning in mouse incisors by Chai, Y. (2015). BMP-SHH signaling network controls epithelial stem cell fate via asymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev. Cell regulation of its niche in the developing tooth. Dev. Cell. 33, 125-135. 7, 719-730. Mitsiadis, T. A., Lardelli, M., Lendahl, U. and Thesleff, I. (1995). Expression of Wilson, G. P., Evans, A. R., Corfe, I. J., Smits, P. D., Fortelius, M. and Jernvall, J. Notch 1, 2 and 3 is regulated by epithelial-mesenchymal interactions and retinoic (2012). Adaptive radiation of multituberculate mammals before the extinction of acid in the developing mouse tooth and associated with determination of dinosaurs. Nature 483, 457-460. ameloblast cell fate. J. Cell Biol. 130, 407-418. Witte, F., Dokas, J., Neuendorf, F., Mundlos, S. and Stricker, S. (2009). Mitsiadis, T. A., Graf, D., Luder, H., Gridley, T. and Bluteau, G. (2010). BMPs and Comprehensive expression analysis of all Wnt genes and their major secreted FGFs target Notch signalling via Jagged 2 to regulate tooth morphogenesis and antagonists during mouse limb development and cartilage differentiation. Gene cytodifferentiation. Development 137, 3025-3035. Expr. Patterns 9, 215-223. Nakatomi, M., Hovorakova, M., Gritli-Linde, A., Blair, H. J., MacArthur, K., Zhang, S., Lin, Y., Itäranta, P., Yagi, A. and Vainio, S. (2001). Expression of Peterka, M., Lesot, H., Peterkova, R., Ruiz-Perez, V. L., Goodship, J. A. et al. Sprouty genes 1, 2 and 4 during mouse organogenesis. Mech. Dev. 109, 367-370. DEVELOPMENT

3963