Membrane Rafts 2 in Γ Receptor, Syk, and Phospholipase C Signaling

Swiprosin-1/EFhd2 Controls B Cell Receptor Signaling through the Assembly of the B Cell Receptor, Syk, and Phospholipase C γ2 in Membrane Rafts This information is current as of September 26, 2021. Carmen Kroczek, Christiane Lang, Sebastian Brachs, Marcus Grohmann, Sebastian Dütting, Astrid Schweizer, Lars Nitschke, Stephan M. Feller, Hans-Martin Jäck and Dirk Mielenz

J Immunol published online 1 March 2010 Downloaded from http://www.jimmunol.org/content/early/2010/03/01/jimmun ol.0903642 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2010/03/01/jimmunol.090364 Material 2.DC1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published March 1, 2010, doi:10.4049/jimmunol.0903642 The Journal of Immunology

Swiprosin-1/EFhd2 Controls B Cell Receptor Signaling through the Assembly of the B Cell Receptor, Syk, and Phospholipase C g2 in Membrane Rafts

Carmen Kroczek,* Christiane Lang,* Sebastian Brachs,* Marcus Grohmann,* Sebastian Du¨tting,* Astrid Schweizer,† Lars Nitschke,† Stephan M. Feller,‡ Hans-Martin Ja¨ck,* and Dirk Mielenz*

Compartmentalization of the BCR in membrane rafts is important for its signaling capacity. Swiprosin-1/EFhd2 (Swip-1) is an EF- hand and coiled-coil–containing adaptor protein with predicted Src homology 3 (SH3) binding sites that we identified in membrane rafts. We showed previously that Swip-1 amplifies BCR-induced apoptosis; however, the mechanism of this amplification was unknown. To address this question, we overexpressed Swip-1 and found that Swip-1 amplified the BCR-induced calcium flux Downloaded from in WEHI231, B62.1, and Bal17 cells. Conversely, the BCR-elicited calcium flux was strongly attenuated in Swip-1–silenced WEHI231 cells, and this was due to a decreased calcium mobilization from intracellular stores. Complementation of Swip-1 expression in Swip-1–silenced WEHI231 cells restored the BCR-induced calcium flux and enhanced spleen tyrosine kinase (Syk) tyrosine phosphorylation and activity as well as SLP65/BLNK/BASH and phospholipase C g2 (PLCg2) tyrosine phosphorylation. Furthermore, Swip-1 induced the constitutive association of the BCR itself, Syk, and PLCg2 with membrane rafts. Concomitantly, Swip-1 stabilized the association of BCR with tyrosine-phosphorylated proteins, specifically Syk and PLCg2, and enhanced the http://www.jimmunol.org/ constitutive interaction of Syk and PLCg2 with Lyn. Interestingly, Swip-1 bound to the rSH3 domains of the Src kinases Lyn and Fgr, as well as to that of PLCg. Deletion of the predicted SH3-binding region in Swip-1 diminished its association and that of Syk and PLCg2 with membrane rafts, reduced its interaction with the SH3 domain of PLCg, and diminished the BCR-induced calcium flux. Hence, Swip-1 provides a membrane scaffold that is required for the Syk-, SLP-65–, and PLCg2-dependent BCR- induced calcium flux. The Journal of Immunology, 2010, 184: 000–000.

urvival, activation, and negative selection of B lymphocytes cruited to the BCR, where it is phosphorylated by Syk (3–5). The

are controlled by BCR. The BCR consists of two covalently phosphorylated tyrosine residues of SLP-65 serve as docking sites by guest on September 26, 2021 S associated Ig m H chains (mHC) and IgL chains and the for Bruton’s tyrosine kinase (Btk) and phospholipase C g2 signaling molecules Iga and Igb (1). Upon BCR activation, the (PLCg2). Btk phosphorylates PLCg2, which activates PLCg2, protein kinases Lyn and spleen tyrosine kinase (Syk) phosphorylate resulting in phosphatidyl inositol diphosphate hydrolysis and the different tyrosine residues in the ITAMs of Iga/b, and Syk binds to generation of diacylglyerol and inositol-3,4,5-phosphate (IP3) (6). Iga (2). The adaptor protein SLP-65/BASH/BLNK is then re- IP3 binds IP3 receptors in the membrane of the endoplasmic reticulum (ER), which leads to the opening of calcium channels and calcium efflux from the ER into the cytosol (7). EF-hand–containing *Division of Molecular Immunology, Department of Medicine III, Nikolaus Fiebiger calcium-sensing proteins, such as stromal interaction molecules, † Center and Department of Biology, University of Erlangen-Nu¨rnberg, Erlangen, that reside in the ER membrane sense the decrease in the calcium Germany; and ‡Cell Signaling Group, Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom concentration of the ER and activate calcium channels in the Received for publication November 10, 2009. Accepted for publication January 29, plasma membrane (8, 9). Opening of plasma membrane calcium 2010. channels leads to influx of calcium from the extracellular medium, This work was supported by grants from the Interdisciplinary Clinical Research thereby generating a second wave of calcium (10). This process is Center Erlangen (Interdisziplina¨res Zentrum fu¨r Klinische Forschung, A7, to D.M. called store-operated calcium entry (SOCE) (7). The timing and and H.M.J.), the German Science Foundation (Deutsche Forschungsgemeinschaft, FOR832 [MI/939/2-1], to D.M.), a travel stipend from the Boehringer Ingelheim quantityofthe BCR-inducedincreaseinintracellular calcium governs Fund (to C.K.), and Deutsche Forschungsgemeinschaft Training Grant GRK592. activation of the calcium-dependent transcription factors NF-kBand Address correspondence and reprint requests to Dr. Dirk Mielenz, Division of Mo- NF-AT(11) and regulates B cell activation. Many calcium signals are lecular Immunology, Department of Medicine III, Nikolaus Fiebiger Center, Univer- transmitted by small EF-hand–containing proteins such as calm- sity of Erlangen-Nu¨rnberg, Glu¨ckstr. 6, Erlangen, Germany. E-mail address: [email protected] odulins (12). Upon the increase in the intracellular calcium concen- The online version of this article contains supplemental material. tration, the EF-hands of calmodulin bind calcium, and calmodulin undergoes conformational changes, enabling interactions with Abbreviations used in this paper: Btk, Bruton’s tyrosine kinase; CC, coiled-coil domain; CTB-FITC, cholera toxin subunit B coupled to FITC; DRM, detergent-resistant downstream proteins such as calcineurin (13). membrane; EF, EF-hand; ER, endoplasmic reticulum; HI-FBS, heat-inactivated FBS; DuringBCRsignaling,dynamic,temporal,andlocalassembliesof IP3, inositol-3,4,5-phosphate; mHC, Ig m H chain; LC, low complexity region; NP-40, Nonidet P-40; ORF, open reading frame; PLCg2, phospholipase C g2; PR, proline rich; signaling complexes are required (14, 15). For instance, Syk activity R, raft; S, soluble; shRNA, short hairpin RNA; SH3, Src homology 3; SOCE, store- alone after BCR activation is not sufficient to transduce signals operated calcium entry; Swip-1, Swiprosin-1/EFhd2; Syk, spleen tyrosine kinase; TfR, emanating from the BCR (16). In particular, the plasma membrane transferrin receptor; UTR, untranslated region; wt, wild-type. localization of regulatory enzymes is important (17). The plasma Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 membrane is not uniform, but contains cholesterol-dependent

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0903642 2 SWIPROSIN-1/EFhd2 IN B CELL RECEPTOR CALCIUM SIGNALING microdomains (membrane rafts) that are thought to function in many DPR 39, TTCAACCCCTACACCGAGTT and CTTGAACGTGGACTG- membrane-associated processes, such as immune receptor signaling CAGC. PCR was performed for 30 cycles at 59˚C annealing temperature (18). In that sense, the active open conformation of the BCR is with a mixture of Taq and Pfu polymerase in the presence of Q-solution (Qiagen, Hilden, Germany). 59 and 39 PCR products were purified, an- trapped in cholesterol-dependent regions of the plasma membrane nealed, filled up, and finally amplified with primer pair CGGGAATTC- with low lateral mobility just a few seconds before the BCR-induced GGATGGCCACGGACGAGTTG and GATCCAATTGCTACAGATCC- calcium signal (19), and association of BCR with membrane rafts TCTTCTGAGATGAGTTTTTGTTCCTTGAACGTGGACTGCAGC to en- (isolated as detergent-resistant membranes [DRMs]) precedes the gineer a Kozak consensus sequence to the 59 end and a Myc-tag to the 39 end. The resulting PCR product was cloned into pCR2.1, sequenced, and cloned into BCR-elicited calcium flux (20). pMSCV-Neo using EcoRI restriction sites. The retroviral vectors pCru-IRES- Swiprosin-1/EFhd2 (hereafter designated Swip-1), which we EGFP and pCru-Swip-1Myc-IRES-EGFP have been described previously (22). identified in DRM of the immature B cell line WEHI231 (21), consists of an N-terminal region harboring the predicted Src ho- Immunoprecipitation, pulldown, and Western blot analysis mology 3 (SH3) binding region (22) and functional phosphory- GST fusion proteins of the SH3 domains of Lyn, Yes, Fgr, and PLCg have lation sites (23–26), followed by two EF-hands and a coiled-coil been described previously (34). GST fusion proteins were expressed in domain. It has recently been shown to bind calcium (27). Because Escherichia coli Rosetta, purified, and dialyzed according to standard 2 Swip-1 colocalized with BCR and enhanced BCR-induced apo- procedures and stored at 70˚C. Cells were washed in ice-cold PBS and lysed in ice-cold buffer containing 150 mM NaCl, 1 mM EDTA, 1 mM ptosis (22), we hypothesized that Swip-1 controls proximal BCR EGTA, 25 mM Tris/HCl (pH 7.5), 2.5 mM sodium pyrophosphate, 1 mM signaling. In this study, we show that Swip-1 recruits the BCR, NaF, 1 mM sodium b-glycerophosphate, 1 mM PMSF, 1 mM sodium Syk, and PLCg2 to membrane rafts and positively regulates the vanadate, and 1% Nonidet P-40 (NP-40) or 1% digitonin. Equal amounts

BCR-induced intracellular calcium response. of protein were used for immunoprecipitation with Abs precoupled to Downloaded from protein A-Sepharose (Thermo Fisher Scientific, Waltham, MA) for 1 h on a rotating wheel at 4˚C, followed by two 1 ml washes with lysis buffer (0.1% detergent for digitonin lysis). For GST pulldowns, purified GST Materials and Methods fusion proteins were coupled to reduced glutathione-Sepharose (GE Abs and other reagents Healthcare, Freiburg, Germany), equilibrated with lysis buffer, and incubated with cell lysates for 2 h on a rotating wheel at 4˚C, followed by Anti–Swip-1 antiserum was described previously (21). Anti-actin and anti- two 1 ml washes with lysis buffer. GST pulldowns were performed in the cofilin were from Sigma-Aldrich (Deisenhofen, Germany). Rabbit anti Syk, presence of 1 mM DTT throughout the procedure. Proteins were separated http://www.jimmunol.org/ PLCg2, Lyn, Gb2, goat anti-CD45 and mouse anti-phosphotyrosine mAb by SDS-PAGE (35) followed by semidry transfer onto Protran nitrocellu- PY99 were obtained from Santa Cruz Biotechnology (Heidelberg, Germany); lose membranes (Schleicher & Schuell, Dassel, Germany), blocked, pro- goat anti-mouse IgM F(ab9)2 fragments, goat anti-mouse IgG (Fcg fragment bed, and developed as described previously (21). Densitometry was specific, conjugated with HRP), and goat anti-rabbit IgG (H+L) conjugated to performed with Scion image software. In brief, the optical densities of Cy5 were from Jackson ImmunoResearch Laboratories (distributed by Dia- bands of interest were normalized to a control protein or to the im- nova, Hamburg, Germany). Goat anti-rabbit IgG (H+L) coupled to HRP was munoprecipitated protein. To compare different blots, the percent intensity from Bio-Rad (Munich, Germany). Rat anti-IgM mAb (b.7.6) (28) and anti- of each band relative to the band with the highest intensity on the same blot Myc mAb 9E10 (29) were purified from hybridoma supernatants. Goat anti- was calculated. mHC coupled to FITC and goat anti-mHC Fab fragment coupled to Cy5 were from SouthernBiotech (Birmingham, AL) and diluted 1:500 or 1:2000, re- Detergent-resistant membranes spectively. Transferrin receptor mAb and oligonucleotides were ordered from by guest on September 26, 2021 Invitrogen (Ebersberg, Germany). Indo-1 and Pluronic were purchased from DRMs were prepared as previously described (21). Briefly, 108 cells were Invitrogen, and Ringer solution was purchased from the local clinical phar- washed with serum-free, otherwise complete, RPMI medium, resuspended macy (Universita¨tsklinikum Erlangen). Cholera toxin subunit B coupled to at a density of 107 cells/ml and incubated at 37˚C for 30–60 min. Cells FITC (CTB-FITC) was purchased from Sigma-Aldrich and used in even sat- were spun down and resuspended in 1 ml ice-cold TNEV buffer (150 mM urating concentrations posttitration. NaCl, 25 mM Tris/HCl [pH 7.4], 5 mM EDTA, 1 mM sodium orthova- nadate) containing 1% Triton X-100 (w/v), 1 mM PMSF, and 1 mM DTT. Cells and retroviral infection Cells were lysed on ice for 10 min and further homogenized in a glass/ Teflon homogenizer. Postcentrifugation at 800 3 g for 10 min, the su- Phoenix-E packaging cells were cultured in DMEM supplemented with pernatant was mixed in 14 3 89 mm polypropylene tubes (Beckman 10% heat-inactivated FBS (HI-FBS), 1 mM sodium pyruvate, 50 mM 2-ME, Coulter, Fullerton, CA) with an equal volume of 85% sucrose, overlaid and 100 mg/ml penicillin-streptomycin (all from Invitrogen) at 37˚C and with 6 ml 35% sucrose and finally 4 ml 5% sucrose in TNEV buffer. 7.5% CO2. WEHI231 cells (30), Bal17 cells (31), and CH12 cells (32) Sucrose gradients were centrifuged for 16 h at 38000 rpm in a SW 41.ti were cultured in RPMI 1640 medium supplemented with 10% HI-FBS, 2 swing-out rotor in a Beckman Coulter ultracentrifuge with full acceleration mM L-glutamine, 1 mM sodium pyruvate, 50 mM 2-ME, and 100 mg/ml and without brake. One-milliliter fractions were collected manually from penicillin-streptomycin (R10 medium) at 37˚C and 5% CO2. B62.1 cells the top, and the protein concentration was measured with the bicinchoninic (33) (kind gift of Dr. Christopher Paige, Division of Stem Cell and De- acid assay (Pierce, Rockford, IL). velopmental Biology, Ontario Cancer Institute, Toronto, Ontario, Canada) were kept in R10 medium supplemented with IL-7. WEHI231 cells in- Immunofluorescence fected with pMSCV constructs carrying a puromycin resistance gene were cultured in the presence of 0.4 mg/ml puromycin (Sigma-Aldrich), and Cells were attached to Teflon-coated coverslips (Roth, Karlsruhe, Germany) G418 was used at a concentration of 1.2 mg/ml. Stably Swip-1–silenced in serum-free medium for 30 min, stimulated, washed in ice-cold PBS, and cells (22) were cultured in the presence of puromycin. Viral supernatants fixed in 4% paraformaldehyde in PBS for 15 min at 4˚C. Cells were rinsed were obtained by standard methods. Then, 5 3 105 WEHI231 cells were in PBS, permeabilized in 0.2% NP-40 in PBS for 5 min, washed in PBS, incubated for 3.5 h with 10 mg/ml polybrene (Sigma-Aldrich) in 1 ml and blocked in 3% BSA in PBS. Cells were incubated with Abs in 3% retroviral supernatant at 1671 3 g and 33˚C. Postinfection, cells were BSA in PBS, washed in PBS, mounted in Mowiol (Hoechst, Frankfurt, cultured for 24 h in fresh medium. Single clones were obtained by limiting Germany), and analyzed with a Leica TCS confocal microscope (Leica dilution immediately postinfection and selected with G418. Cells were Microsystems, Wetzlar, Germany) postcalibration with isotype-matched stimulated with Abs for the indicated times, and stimulation was stopped control Abs. The mHC-positive membrane was defined, and Syk and by addition of excess ice-cold PBS. PLCg2 fluorescence contained in the membrane ring was quantified over total Syk and PLCg2 fluorescence using Leica software (Leica Micro- Eucaryotic expression constructs systems). For live-cell imaging, cells were seeded in serum-free RPMI 1640 on round coverslips (40 mm diameter, #1.5) and assembled in 800 ml The retroviral vector pMSCV-Neo was engineered to express Swip-1 with medium in an FSC2 live cell chamber (Bioptech, Butler, PA) at 26˚C. The a C-terminal Myc-tag by excising Swip-1Myc from pMSCV–Puro-Swip- chamber was then perfused with staining solution (CTB-FITC and anti- 1Myc (22). pMSCV–Puro-Swip-1Myc was used as a template to generate mHC Fab Cy5; 26˚C), cells were labeled for 15 min, and images were Swip-1Myc-DPR by fusion PCR with the following primer sets: DPR 59, taken with a Leica TCS confocal microscope (Leica Microsystems) using ATGGCCACGGACGAGTTG and GATCGCCCTGGTTGAGGTC; and a403 oil immersion objective. Images were calibrated using background The Journal of Immunology 3 subtraction (Leica TCS software, Leica Microsystems). Colocalization was assessed with ImageJ software (http://rsb.info.nih.gov/ij; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD) using a colocalization finder plugin (developed by Christophe Laummonerie, Jerome Mutterer, Institut de Biologie Moleculaire des Plantes, Strasbourg, France).

Analysis of intracellular calcium flux and flow cytometry Cells were centrifuged through a Ficoll cushion 24 h prestimulation and suspended in full RPMI 1640 without puromycin or G418. The day after, 5 3 106 or appropriate number of cells were incubated in 700 ml complete RPMI 1640 containing 5% HI-FBS, Pluronic F-127, and 1 ng/ml Indo-1 AM (dissolved in DMSO) for 25 min at 30˚C, an equal volume of RPMI 1640 containing 5% HI-FBS was added, and cells were incubated another 30 min at 37˚C. Cells were then washed twice in ice-cold Ringer-Krebs solution and kept on ice (15). Five minutes prestimulation, cells were warmed in a 37˚C water bath and stimulated with titrated maximal Ab concentrations [for each lot of b.7.6 or anti-mHC F(ab9)2]. For b.7.6, maximal stimulation was typically reached between 20 and 40 mg/ml. The baseline was recorded for 1 min, and cells were stimulated and recorded for another 4 min on a Becton Dickinson LSRII flow cytometer (BD Bi- osciences, San Jose, CA). Raw data were analyzed with FlowJo software

(Tree Star, Ashland, OR). Equal Indo-1 loading was routinely assessed by Downloaded from ionomycin stimulation (Supplemental Fig. 1).

Syk kinase assays Syk immune complex kinase assays were performed by immunoprecipi- tating Syk from 107 unstimulated or stimulated cells. Immunoprecipitates were washed three times in lysis buffer and once in 25 mM Tris/HCl (pH http://www.jimmunol.org/ 7.5), 1 mM sodium vanadate, and 5 mM MgCl2. Then, the beads were incubated for 30 min at 30˚C with GST or a GST-Iga fusion protein (2, 36– 38) in 25 mM Tris/HCl (pH 7.5), 1 mM sodium vanadate, 10 mM MgCl2,1 mM DTT containing 10 mCi g[32P]-ATP (3000 mCi/mM; Hartmann An- alytic, Braunschweig, Germany), and 10 mM ATP. Beads were boiled in 23 concentrated La¨mmli sample buffer, separated by 10% SDS-PAGE, and the gel was dried, exposed to a phosphor imager plate, and the plate read with a Fuji reader (Fujiﬁlm, Du¨sseldorf, Germany). Syk activity in cell lysates was assessed according to Li and coworkers (39), except that cells were lysed in 1% NP-40, 50 mM Tris/HCl (pH 7.5), 120 mM NaCl,

30 mM NaF, 2 mM EGTA, 5 mM b-glycerophosphate, 1 mM DTT, 1 mM by guest on September 26, 2021 PMSF, and 100 mM sodium vanadate. The substrate peptide, OMNIA-7, was purchased from Invitrogen. A total of 50 mg cellular protein was as- sayed in a volume of 50 ml in white flat-bottom 96-well plates (Corning Glass, Corning, NY) at 30˚C in a Tecan Genius fluorescence reader (Tecan Group, Ma¨nnedorf, Switzerland; excitation: 360 nm, emission: 465 nm). The reaction was started by the addition of ATP using a multichannel pipette and run with shaking every minute. Statistical analysis FIGURE 1. Swip-1 enhances and is required for the BCR-induced Variancies of data sets were calculated, and data sets were compared with calcium flux. A, Lysates of WEHI231 wt cells, WEHI231 cells transfected the two-tailed Student t test. A p value of ,0.05 was considered to be significant. with pSuperPuro vector (psp.2) or pSuperPuro expressing a Swip-1–specific shRNA (shSwip-1.2, shSwip-1.35), WEHI231 cells infected with pMSCV (pMSCV.33), or pMSCV encoding Myc-tagged Swip-1 (pSwip- Results 1Myc.64 and .72) were fractionated by 10% SDS-PAGE, blotted onto nitrocellulose, and analyzed with Abs depicted on the right. Molecular Involvement of Swip-1 in BCR-mediated calcium mobilization mass standards are indicated on the left. B, WEHI231.pMSCV.40 and in WEHI231 cells WEHI231pSwip-1Myc.64 cells were loaded with Indo-1, stimulated with Because Swip-1 colocalized with the BCR, enhanced BCR signals anti-IgM mAb b.7.6, and Ca2+ mobilization was recorded for 4 min by 2+ that lead to apoptosis (22), and can associate with DRM (21), we flow cytometry. Ca concentration is represented as ratio of bound hypothesized that Swip-1 is involved in proximal BCR signals, (Violet) to unbound (Blue) Indo-1. C, WEHI231 wt, WEHI231.psp.12, and one of which is the rapid increase in the intracellular calcium WEHI231.pshSwip-1.35 cells were loaded with Indo-1, stimulated with anti-IgM mAb b.7.6, and Ca2+ mobilization was recorded for 4 min by concentration (7). The BCR-induced increase in intracellular flow cytometry. D, BCR-induced calcium flux was measured in in- calcium is a sum of two waves: the first one originates from IP3, dependent experiments (n $ 12) with several clones obtained from each which results in calcium efflux from the ER, thereby inducing construct. Raw data were analyzed with FlowJo (Tree Star), and the peak a second wave of calcium through SOCE. These two waves cross maximum [Ca2+ concentration represented as ratio of bound (Violet) to over in WEHI231 cells, but we often observed that the first peak is unbound (Blue) Indo-1] obtained from the experiments is depicted as more pronounced (Fig. 1). To determine the effect of Swip-1 on mean 6 SEM. BCR-induced calcium mobilization, we used WEHI231 cells that either stably overexpress a Myc-tagged Swip-1 (Swip-1Myc) (22) Supplemental Table I. WEHI231 cells overexpressing Swip-1 or synthesize an ectopic Swip-1–specific short hairpin RNA showed a higher calcium peak after BCR stimulation compared (shRNA), resulting in a strong downregulation of Swip-1 (Fig. with control (pMSCV) cells (Fig. 1B). The first peak was en- 1A). An overview of the cell lines used in this study is provided in hanced, indicating that Swip-1 regulates calcium efflux from the 4 SWIPROSIN-1/EFhd2 IN B CELL RECEPTOR CALCIUM SIGNALING

ER. Similar results were obtained using WEHI231 cells stably controls, significant changes in the BCR-induced calcium flux expressing the Swip-1-EGFP fusion protein that colocalizes with were only observed when Swip-1 expression was ectopically the BCR (22) (data not shown). In contrast, Swip-1–silenced modulated. This was not due to altered surface expression of the WEHI231 cells (pshSwip-1) revealed a lower BCR-induced BCR or of positive or negative regulatory coreceptors, such as calcium flux when compared with vector control (pSp) or WE- CD19, CD22 (40), or FcgRIIB (41) (data not shown). Similar HI231 wild-type (wt) cells (Fig. 1C; see also a representative results were obtained using polyclonal anti-mHC F(ab9)2 frag- calcium flux in Swip-1–silenced cells in Fig. 2B). All experiments, the monoclonal anti-mHC Ab b.7.6 or deglycosylated ments are summarized in Fig. 1D. Compared to the vector b.7.6 that can no longer bind to Fc receptors (42) (data not Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021

FIGURE 2. Transient reconstitution of the BCR-induced calcium flux in Swip-1–silenced WEHI231 cells. A, Schematic of the Swip-1 complementation strategy. 1993-2012 indicates binding of the Swip-1 shRNA (not in scale) to the 39 UTR of the depicted 2.4-kb Swip-1 mRNA. B, Swip-1–silenced cells (pshSwip-1.54) were transiently transduced with an IRES-EGFP–expressing retroviral vector encoding for full-length Swip-1 (pCru-Swip-1Myc-IRES- EGFP), with an empty retrovirus (pCru-IRES-EGFP), or not infected. After 48 h, cells were loaded with Indo-1, stimulated with anti-IgM mAb b.7.6, and Ca2+ mobilization was recorded for 4 min by flow cytometry. Gates were set on living and green cells for pCru- and pCruSwip-1Myc–infected cells and on living cells for uninfected or mock-infected cells. The Ca2+-concentration is represented as ratio of bound (Violet) to unbound (Blue) Indo-1. C, Summary of transient reconstitution experiments. Peak maxima are expressed as mean 6 SEM. Unsorted cell samples from two experiments were lysed 48 h posttransduction, subjected to 10% SDS-PAGE and Western blotting, and analyzed for Swip-1 expression with polyclonal anti–Swip-1 Ab. Lyn served as loading control. Molecular mass standards are indicated on the left. D, Swip-1–silenced cells (WEHI231.pshSwip-1.35) or stable cell lines obtained from transduction of WEHI231.pshSwip-1.35 cells with either pMSCV or pSwip-1Myc were lysed. Lysates were subjected to 10% SDS-PAGE and analyzed by Western blotting with Abs indicated on the right. Molecular mass standards are indicated on the left. E, pshSwip-1/pSwip-1Myc.8 and pshSwip-1/pMSCV.9 WEHI231 cell lines were loaded with Indo-1, stimulated with anti-IgM mAb b.7.6, and Ca2+ mobilization was recorded for 4 min by flow cytometry. The intracellular Ca2+ concentration is represented as ratio of bound (Violet) to unbound (Blue) Indo-1. F, Summary of experiments performed with pshSwip-1/ pMSCV (n = 11), pshSwip-1/pSwip-1Myc (n = 13), and WEHI231 wt (Fig. 1; n = 13) cell lines. The peak maximum [maximal ratio of bound (Violet) to unbound (Blue) Indo-1] is displayed as mean 6 SEM. The lower panel depicts a representative Western blot of the Swip-1 expression in pshSwip-1/ pMSCV, pshSwip-1/pSwip-1Myc, and wt WEHI231 cells. Molecular mass standards are indicated on the left. ORF, open reading frame; TfR, transferrin receptor (loading control). The Journal of Immunology 5 Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021

FIGURE 3. Integration of Swip-1 into the BCR signaling pathway. A, BCR-induced release of intracellular Ca2+ of indicated WEHI231 cell lines was 2+ measured for 1.5 min in the presence of EGTA (0.5 mM). Subsequently, the extracellular Ca concentration was restored by addition of 1 mM CaCl2, and the Ca2+ ﬂux was recorded. The Ca2+ concentration is represented as ratio of bound (Violet) to unbound (Blue) Indo-1. Representative results of ﬁve independent experiments are shown. B, pshSwip-1/pSwip-1Myc and pshSwip-1/pMSCV WEHI231 cell lines were stimulated for 30 or 120 s with 10 mg/ml anti-mHC F(ab9)2 fragment and lysed. Equal amounts of protein loaded on a 10% SDS gel and blotted onto nitrocellulose. The blot was analyzed with Abs as depicted on the right. Data from two independent experiments with different clones are summarized as mean. Molecular mass standards are marked on the left. C, WEHI231 cells or WEHI231.shSwip-1 cells were left unstimulated or stimulated via the BCR for indicated time points. Lysates were immunoprecipitated with anti-Syk Ab (IP), and immunoprecipitates were subjected to an in vitro kinase assay with either GST-Iga or GST as substrate in the presence of g[32P]-ATP. Reactions were separated by 10% SDS-PAGE, and the dried gel was visualized on a phosphor imager plate. Representative of two experiments. D, WEHI231 shSwip-1/pMSCV cells and shSwip-1/pSwip-1Myc cells were left unstimulated or stimulated via the BCR for 0.5, 2, and 5 min. A total of 100 mg whole cell lysates were subjected for 5 min to a nonradioactive real-time Syk kinase assay. Basal Syk activity (time point 0) was set as zero activity and subtracted. Representative of three experiments. E, pshSwip-1/pSwip-1Myc.8 and pshSwip-1/pMSCV.13 WEHI231 cell lines were stimulated for 30 or 120 s with 10 mg/ml anti-mHC F(ab9)2 fragment and lysed. Equal amounts of protein were immunoprecipitated with polyclonal anti– SLP-65 Ab. Immunoprecipitates were washed, loaded on a 10% SDS gel, and blotted onto nitrocellulose. The blot was analyzed with Abs as depicted on the right (pTyr: PY99). Data from three independent experiments with different clones are shown as mean 6 SEM. F, pshSwip-1/pSwip-1Myc.9 and pshSwip-

1/pMSCV.9 WEHI231 cell lines were stimulated for 30 or 120 s with 10 mg/ml anti-mHC F(ab9)2 fragment and lysed. Equal amounts of protein were immunoprecipitated with polyclonal anti-PLCg2 Ab. Immunoprecipitates were washed, loaded on a 10% SDS gel, and blotted onto nitrocellulose. The blot was analyzed with Abs as depicted on the right (pTyr: PY99). Data from five independent experiments with different clones are shown as mean 6 SEM. 6 SWIPROSIN-1/EFhd2 IN B CELL RECEPTOR CALCIUM SIGNALING shown). Hence, Swip-1 is a positive regulator of the BCR-me- cells completely restored the BCR-induced calcium flux (Fig. 2B; diated intracellular calcium flux. compare to Fig. 1). A summary of the experiments and a docu- mentation of Swip-1 expression are given in Fig. 2C. To certify these Reconstitution of Swip-1 expression rescues the BCR-elicited results, we overexpressed Swip-1 by retroviral transduction also in calcium flux nontransformed immature B62.1 B cells (33) and the mature B cell lines Bal17 (31) (Supplemental Fig. 1) and CH12 (32) (not shown). To corroborate this finding and to exclude side effects of the shRNA we made use of the fact that the Swip-1–specific shRNA targets the 39 All cell lines exhibited an amplified BCR-induced calcium flux upon untranslated region (UTR) of the Swip-1 mRNA. To restore Swip-1 Swip-1 overexpression. Together, these results demonstrate that expression transiently with the Swip-1 cDNA lacking the 39 UTR Swip-1 amplifies the BCR-induced calcium flux. (Fig. 2A), we infected Swip-1–silenced cells (WEHI231.pshSwip- To address the function of Swip-1 in proximal BCR signaling 1.35) with the retrovirus pCru-Swip1-IRES-EGFP or the empty cascades, we established Swip-1–silenced WEHI231 clones stably retrovirus pCru-IRES-GFP (22). Swip-1–silenced cells as well as re-expressing Swip-1 (shSwip-1/pSwip-1Myc) or the empty con- pCru5-IRES-GFP–infected cells showed hardly a BCR-mediated trol vector, pMSCV (shSwip-1/pMSCV) (Supplemental Table I). calcium flux, whereas Swip-1 re-expression in Swip-1–silenced Western blotting confirmed Swip-1 expression in Swip-1– Downloaded from

FIGURE 4. Swip-1 forces membrane raft association of Syk and PLCg2and

the BCR mHC. A, pshSwip-1/pSwip- http://www.jimmunol.org/ 1Myc.9 and pshSwip-1/pMSCV.9 WE- HI231 cell lines were stimulated for 30 or 120 s with 10 mg/ml anti-mHC F(ab9)2 fragment, lysed, and lysates were subjected to sucrose density centrifugation. Fractions 4 and 5 as well as 11 and 12 were pooled and designated raft (R) and soluble (S) fractions. Fractions representing equal amounts of protein were subjected to 10% SDS-PAGE and by guest on September 26, 2021 Western blotting and analyzed with indicated Abs (on the right). Representa- tive of three experiments. B, pshSwip-1/ pSwip-1Myc and pshSwip-1/pMSCV WEHI231 cell lines were attached to glass coverslips, assembled in a live-cell imaging chamber, and stained with CTB-FITC and anti-mHC Fab fragment coupled to Cy5. Images containing 15– 25 cells were taken, and colocalization was assessed. The colocalization index is given as r2 from 8–11 images. Repre- sentative images are depicted, whereby dot blots represent one image containing 15–25 cells. Bar, 7.5 mm. C, pshSwip- 1/pSwip-1Myc and pshSwip-1/pMSCV WEHI231 cell lines were stimulated for 30 or 120 s with 10 mg/ml anti-mHC F

(ab9)2 fragment, lysed, and immunoprecipitated with anti-mHC Abs coupled to protein G-Sepharose. Immunopre- cipitates were dissolved by 10% SDS- PAGE, blotted onto nitrocellulose, and analyzed with Abs as depicted on the right. Molecular mass standards are indicated on the left. R, raft; S, soluble. The Journal of Immunology 7

BCR-induced tyrosine phosphorylation as a function of Swip-1 in WEHI231 cells devoid of Swip-1 or overexpressing Swip-1 (Supplemental Figs. 3, 4). This demonstrated that Swip-1 regulates early tyrosine phosphorylation of many proteins positively, suggesting that Swip-1 acts early in the BCR signaling pathway, presumably already on the level of protein tyrosine kinase activation.

Swip-1 is involved in the proximal BCR signaling cascade Because we observed early (30 s) effects of Swip-1 on the BCR- induced calcium flux (Figs. 1, 2), we hypothesized that Swip-1 regulates the Syk- and PLCg2-dependent early calcium efflux from the ER. In this case, the first calcium peak should remain reduced in Swip-1–silenced cells after depletion of extracellular calcium. Conversely, if Swip-1 regulated the calcium influx from the outside, depletion of extracellular calcium should lead to similar first calcium peaks in WEHI231 cells regardless of Swip-1

expression and to decreased secondary peaks in Swip-1–silenced Downloaded from cells upon addition of calcium. Stimulation of WEHI231.psp and WEHI231.pshSwip-1 cells in the absence of extracellular calcium revealed that the intracellular calcium ﬂux emanating from the ER was reduced in WEHI231.pshSwip-1 cells (Fig. 3A). Thus, Swip-1 controls the early calcium ﬂux but not SOCE.

Swip-1 enhanced tyrosine phosphorylation of many proteins that http://www.jimmunol.org/ FIGURE 5. Swip-1 stabilizes the interaction of Syk and PLCg2 with Lyn possibly represent essential regulators of the BCR-induced calcium and the plasma membrane. A, pshSwip-1/pSwip-1Myc.9 and pshSwip-1/ flux, such as SLP-65 or Syk (65 and 72 kDa, respectively) or PLCg2 pMSCV.9WEHI231 cell lines were stimulated for 30 or 120 s with 10 mg/ml (145 kDa) (Supplemental Fig. 4). We observed that Syk Y352 anti-mHC F(ab9)2 fragment and lysed. Equal amounts of protein were either phosphorylation that has recently been shown to be involved in Syk loaded directly on a 10% SDS gel (input) or subjected to immunoprecipi- activation (45) was enhanced 30 s after BCR crosslinking in Swip- tation (IP) with polyclonal anti-Lyn Ab. As control, anti-Lyn Ab precoupled to protein A-Sepharose was incubated with buffer only (mock). Immuno- 1–complemented cells (Fig. 3B). To examine whether Swip-1 precipitates were analyzed by Western blotting with Abs as depicted on the abundance regulates Syk activity, we performed Syk immune right. Molecular mass standards are marked on the left. Representative complex kinase assays with wt or Swip-1–silenced WEHI231 B of three experiments. B, pshSwip-1/pSwip-1Myc.9, pshSwip-1/pSwip- cells, before or after BCR stimulation (Fig. 3C). WEHI231. by guest on September 26, 2021 1Myc.8, pshSwip-1/pMSCV.9, and pshSwip-1/pMSCV.4 WEHI231 cell pshSwip-1 cells showed hardly any phosphorylation of the substrate lines were attached to glass slides, fixed, permeabilized, and stained with GST-Iga. In contrast, rapid phosphorylation of GST-Iga was ob- rabbit polyclonal anti-PLCg2, Syk, or normal rabbit IgG (not shown) Abs, served in WEHI231 wt cells, exhibiting a maximum after 2–5 min of followed by Cy5-coupled anti-rabbit Ab and FITC-coupled goat anti-mHC BCR stimulation (Fig. 3C). Additionally, an as yet not identified Ab. Confocal images were taken from different regions of the slides, and protein of ∼43 kDa became phosphorylated in anti-Syk im- membrane association of Syk and PLCg2 (defined as localization to the munoprecipitates from WEHI231 wt cells, but not from WEHI231. mHC-positive plasma membrane) was analyzed with the Leica software package (Leica Microsystems). Representative images are shown. Data are shSwip-1 cells. Because the phosphorylation kinetics of this protein presented as mean 6 SEM. were different, it could be a kinase itself, and we speculate that this protein is the catalytically active 40-kDa proteolytic fragment of Syk (46, 47). Howsoever, these data indicate that Swip-1 regulates complemented WEHI231.shSwip-1 cells (Fig. 2D) that led to the activity of Syk positively. To confirm these data, we analyzed complete replenishment of the BCR-induced calcium flux (Fig. a synthetic Syk substrate (39, 45) in total cell lysates (Fig. 3D). 2E). Detailed analyses revealed that Swip-1 elevated the calcium Swip-1–complemented shSwip-1 cells (pSwip-1Myc) or empty peak maximum significantly up to the level of WEHI231 wt cells vector complemented shSwip-1 cells (pMSCV) were stimulated for (Fig. 2F). Swip-1–silenced WEHI231 cells complemented with 0.5, 2, and 5 min, and Syk activity was assessed. Intriguingly, Syk Swip-1 express slightly more Swip-1 than the WEHI231 wt cells became rapidly activated after 30 s of BCR engagement in Swip-1– (Fig. 2F), resulting concomitantly in a nonsignificant tendency expressing cells (Fig. 3D, 30 s, white diamonds). Syk activity in- toward higher calcium peaks (Fig. 2F). Further analyses revealed creased over time and remained stable until 5 min (Fig. 3D, white that Swip-1 complementation increased the total intracellular squares and triangles). In stark contrast, Syk activity in non- calcium concentration over time (area under curve) and shortened complemented cells (pMSCV) showed a lag phase at 30 s (Fig. 3D, significantly the time to maximum calcium peak (Supplemental 30 s, black diamonds) and decreased already strongly after 120 s of Fig. 2). Likewise, the slope of the curve from the moment of BCR stimulation (black squares and triangles in Fig. 3D). Taken stimulation until the peak was reached was much steeper in the together, our data show that Swip-1 is required for rapid and max- presence of Swip-1 (Supplemental Fig. 2). The shortened peak imal Syk activation in response to BCR ligation. The adaptor protein time demonstrates that Swip-1 not only regulates the absolute SLP-65 is recruited to the BCR and phosphorylated by Syk after intracellular calcium concentration, but also accelerates the acti- BCR activation (3–5), thereby representing the prototypic in vivo vation kinetics of the enzymes responsible for the increase in in- Syk substrate. Concomitant with Syk activation, SLP-65 was tracellular calcium. BCR-induced phosphorylation of protein phosphorylated on tyrosine more rapidly and stronger in the pres- kinases and PLCg2 heads the increase in the intracellular Ca2+ ence of Swip-1 (Fig. 3E). The phosphorylated tyrosine residues of concentration (43, 44), and therefore, we analyzed alterations in SLP-65 serve as docking sites for PLCg2. In line with pronounced 8 SWIPROSIN-1/EFhd2 IN B CELL RECEPTOR CALCIUM SIGNALING

Syk and SLP65 tyrosine phosphorylation, we detected enhanced PLCg2 tyrosine phosphorylation in the presence of Swip-1 in WEHI231 cells (Fig. 3F). Hence, these data show that Swip-1 positively regulates the Syk-, SLP65-, and PLCg2-dependent first wave of the BCR-induced calcium flux. The BCR-induced calcium signal is strictly dependent on Syk (7), and if Swip-1 was indeed involved in the canonical BCR calcium signaling pathway, the BCR-induced calcium signal should be absolutely dependent on Syk activity in the presence of Swip-1. Experiments using the Syk-specific inhibitor BAY 61- 3606 (48) revealed that reconstitution of BCR-induced calcium signaling through re-expression of Swip-1 could be inhibited by BAY 61-3606 (data not shown). Assembly of ΒCR, Syk, and PLCg2 in the plasma membrane through Swip-1 We next asked how Swip-1 could regulate the rapid BCR-induced calcium response. Originally, we identified Swip-1 in DRM in two

B cell lines, WEHI231 and NYC31.1 (21). Because association of Downloaded from the BCR with membrane rafts precedes the BCR-induced calcium ﬂux (19, 20), we asked whether Swip-1 enhances DRM association of PLCg2 and Syk. Analogous to the previous experiments, Swip-1–complemented (pshSwip-1/pSwip-1Myc) and non- complemented (shSwip-1/pMSCV) WEHI231 cells were stimu-

lated for 30 s or 2 min via the BCR, and DRMs were analyzed by http://www.jimmunol.org/ Western blotting (Fig. 4A). Very interestingly, Syk, PLCg2, and the mHC of the BCR were already present in DRMs of unstimulated WEHI231.pshSwip-1/pSwip-1Myc cells, increased in abundance after 30 s of BCR stimulation, and decreased their membrane raft association after 2 min of BCR stimulation (Fig. 4A). In stark contrast, Syk, PLCg2, and the mHC associated with DRMs only after 30 s and 2 min of BCR stimulation in WE- HI231.pshSwip-1/pMSCV cells, and the association of Syk with

DRM was comparably weaker and transient. To corroborate these by guest on September 26, 2021 ﬁndings, we analyzed steady-state colocalization of the BCR, labeled with monomeric anti-mHC Fab fragments, with the membrane raft-associated glycosphingolipid GM1 (49) in live cells (Fig. 4B). Whereas we observed a clear colocalization of the BCR with GM1 in the presence of Swip-1, this was signiﬁcantly diminished in the absence of Swip-1 (Fig. 4B). Thus, Swip-1 forces membrane raft association of the BCR. To analyze BCR signaling complexes directly, we immunoprecipitated the BCR from unstimulated and stimulated cells out of digitonin lysates (50) (Fig. 4C). These experiments revealed that in the presence of Swip-1, the BCR associated more with many tyrosine-phosphorylated proteins before and after BCR stimulation in the presence of Swip-1 (Fig. 4C, top panel, tyrosine phosphorylation at 55 kDa). Notably, we detected more Syk and PLCg2 associated with the BCR in the presence of Swip-1 in unstimulated

FIGURE 6. The SH3-binding region of Swip-1 governs the BCR-induced calcium ﬂux. A, Schematic of Swip-1 and the Swip-1 deletion and pshS1/DPR.3 WEHI231 cell lines were lysed and subjected to sucrose mutant (DPR) lacking a predicted SH3-binding motif (http://elm.eu.org). density centrifugation. Fractions 4 and 5 as well as 11 and 12 of two Described serine phosphorylation sites are circled. B, WEHI231.pSwip- separate experiments were pooled and designated raft (R) and soluble (S) 1Myc cells or WEHI231.shSwip-1/DPR cells were lysed in the presence of fractions. Pooled fractions representing equal amounts of protein were protein phosphatase inhibitors (PPI) or in the absence of protein phos- subjected to 10% SDS-PAGE and Western blotting and analyzed with phatase inhibitors and addition of calf intestinal phosphatase (CIP) and indicated Abs (on the right). Molecular mass standards are shown on the

MgCl2. Lysates were incubated with equimolar amounts of GST or de- left. Representative of three experiments. D, pshSwip-1/pSwip-1Myc.8, picted GST-SH3-domain fusion proteins coupled to reduced glutathione pshSwip-1/pMSCV.9, and pshSwip-1/DPR.3 WEHI231 cell lines were beads, and beads were washed and, together with 2.5% of the input, loaded with Indo-1 and stimulated with anti-IgM mAb b.7.6 (20 mg/ml). subjected to Western blotting. The membrane was stained with Ponceau S Calcium flux was measured over time and is depicted as ratio of calcium- and then further processed. Positions of Swip-1 (upper arrow) and de- bound Indo-1 (Violet)-A versus non–calcium-bound Indo-1 (Blue)-A. CC, phosphorylated or mutated Swip-1 are marked on the right. Representative coiled-coil domain; EF, EF-hand; LC, low complexity region; R, raft; S, of two experiments. C, pshSwip-1/pSwip-1Myc.9, pshSwip-1/pMSCV.9, soluble. The Journal of Immunology 9 cells. In summary, we show in this study with three different bound better to the SH3 domain of PLCg. Taken together, the PR approaches that Swip-1 induces association of the BCR itself region of Swip-1 mediates binding of Swip-1 to the SH3 domain with signaling-competent membrane compartments. of Fgr and, to a lesser extent, the SH3 domain of PLCg. The SH3 In view of these findings, Swip-1 could bring Syk and PLCg2 domain of Lyn, on the other hand, does not bind to the PR region. in proximity to the Src family kinase Lyn, which is predominantly However, phosphorylation of an as yet not specified aa of Swip-1 associated with membrane rafts and can phosphorylate and activate appears to be required for Lyn SH3 binding to Swip-1. Syk (44). To test this possibility, Lyn was immunoprecipitated from Next, we analyzed DRMs prepared from WEHI231.pshSwip-1/ unstimulated and BCR-stimulated WEHI231.pshSwip-1/pMSCV pMSCV,WEHI231.pshSwip-1/pSwip-1Myc,andWEHI231.pshSwip- and WEHI231.pshSwip-1/pSwip-1Myc cells, revealing that Syk 1/DPR cells (Fig. 6C). Intriguingly, whereas Swip-1 assembled Syk and PLCg2 were in fact more associated with Lyn in cells expressing and PLCg2 in membrane rafts, DRM association of the DPR mutant Swip-1 (Fig. 5A). To corroborate these results, we analyzed the total was much weaker and, concomitantly, so was DRM association of Syk membrane association of Syk and PLCg2 by confocal microscopy and PLCg2. Thus, the PR region of Swip-1 targets Syk, PLCg2, and (Fig. 5B). These experiments revealed that cells expressing Swip-1 Swip-1 itself to membrane rafts. If a functional relationship between contained significantly more Syk and PLCg2 at the plasma mem- Swip-1–mediated membrane raft association of the Syk/PLCg2mo- brane than Swip-1–silenced cells. Taken together, these experi- dule and BCR-induced calcium flux existed, the DPR mutant should ments establish a new function of Swip-1 as a scaffold for the BCR, elicit a weaker calcium flux upon BCR stimulation. In fact, WEHI231. Syk, and PLCg2 at the plasma membrane. pshSwip-1/DPR cells displayed a reduced calcium response when compared with WEHI231.pshSwip-1/pSwip-1Myc cells (Fig. 6D, The predicted SH3-binding region in Swip-1 controls the Table I). The peak maximum (p = 0.00585), area under curve Downloaded from BCR-induced calcium flux (p = 0.00126), and slope (p = 0.00327) were significantly reduced, To address the mechanism for the observed scaffolding function of whereas the peak time was not significantly different (p = 0.0518). Swip-1, we analyzed the primary structure of Swip-1 by eukaryotic Thus, this region controls amplitude but not kinetics of the BCR- linear motif search (http://elm.eu.org), revealing two putative SH3- induced calcium flux, which appears to be regulated by other do- binding motifs that together encompass aa 72–82 of the murine mains in Swip-1. These experiments further demonstrate that

Swip-1 protein (Fig. 6A). We will refer to this region as proline DRM association of Swip-1 and the positive regulation of the http://www.jimmunol.org/ rich (PR). We generated a mutant lacking this region (DPR; Fig. BCR-induced calcium flux through Swip-1 are tightly connected. 6A) and complemented WEHI231.pshSwip-1 cells with it (WE- HI231.pshSwip-1/DPR). To test the functionality of the PR region, Discussion we performed GST-pulldown assays with purified GST, GST fu- We show in this study that Swip-1 is a positive regulator of the BCR- sion proteins of the SH3 domains of Lyn and PLCg, and, as ad- induced calcium flux that operates by assembling Syk, PLCg2, and ditional controls, those of the Src kinases Yes and Fgr. The SH3 the BCR in membrane rafts. This stimulation-independent relocali- domains of Lyn, Fgr, and PLCg bound to Myc-tagged Swip-1, but zation supports interactions of Syk and PLCg2 with Lyn and the BCR. not that of Yes or GST alone (Fig. 6B). Upon deletion of the PR Although Swip-1 targeted Syk, PLCg2, and the BCR constitutively to region of Swip-1, the binding of the Fgr SH3 domain was com- membrane rafts, we did not detect increased basal Syk activity, by guest on September 26, 2021 pletely abolished, whereas the binding of the PLCg SH3 domain PLCg2 tyrosine phosphorylation, or basal calcium flux in B cells was reduced and that of the Lyn SH3 domain was not affected. overexpressing Swip-1. Swip-1 enhanced only the BCR-induced, This indicated that the predicted motif is a functional ligand for Syk-dependent calcium flux. Thus, Syk targeted to the plasma the SH3 domain of Fgr (or others) and that the SH3 domain of Lyn membrane through Swip-1 keeps its autoinhibited conformation in binds to a different motif in Swip-1. We frequently observed up to the absence of BCR stimulation. Hence, Swip-1 serves as a BCR- three Swip-1 bands in Western blots that migrated close together, responsive scaffold for Syk and PLCg2. We propose therefore that the potentially representing different phosphorylated forms of Swip-1 function of Swip-1 is to assemble Syk, PLCg2, and maybe others (not shown). Published serine phosphorylation sites are serine constitutively at the membrane in close proximity to the BCR to fa- residues 74 and 76 (23–25), tyrosine phosphorylation at residue 83 cilitate Syk-, SLP-65–, and Btk-dependent assembly of the classical has been described (26), and other residues may be phosphory- primary calcium initiation complex (7). Because Swip-1 accelerated lated as well. Thus, we asked whether nonphosphorylated Swip-1 the velocity of the BCR-induced calcium flux and tyrosine phos- interacts differentially with SH3 domains compared with phosphorylation of Syk, SLP-65, and PLCg2, we believe that it rather acts phorylated Swip-1. GST-pulldown assays with dephosphorylated positively on positive regulators than negatively on negative regu- Swip-1 revealed that the phosphorylation of Swip-1 was indeed lators, such as CD22 and CD72 (40). important for its association with the SH3 domains of Lyn and Fgr Swip-1 targets PLCg2 and Syk to membrane rafts likely in an SLP- (Fig. 6B, middle panel). In contrast, dephosphorylated Swip-1 65–independent manner, although we cannot exclude involvement of

Table I. The BCR-induced calcium response in WEHI231.pshSwip-1/Swip-1DPR cells

Area Under Cell Line Peak Maximum Peak Time (s) Curve (3 106) Slope (60 s 2 Peak Maximum; 3 102) WEHI231.pshSwip-1/pMSCVa 34845 6 2468 129 6 6 6.9 6 0.26 2.95 6 0.088 (n = 11) WEHI231.pshSwip-1/Swip-1Myca 78036 6 6242 92 6 3 10.2 6 0.59 30 6 0.66 (n = 13) WEHI231.pshSwip-1/Swip-1DPR 50266 6 5885 110 6 7 7.7 6 0.34 6.5 6 1.94 (n =7) The BCR-induced calcium ﬂux in WEHI231.pshSwip-1/Swip-1 DPR cells is depicted as mean 6 SEM. Differences were calculated using WEHI231. pshSwip-1/Swip-1Myc cells as reference. p = 0.00585, p = 0.0518, p = 0.00126, and p = 0.00327 for peak maximum, peak time, area under curve, and slope, respectively. aData are also displayed in Fig. 2. 10 SWIPROSIN-1/EFhd2 IN B CELL RECEPTOR CALCIUM SIGNALING

SLP-65 in Swip-1–mediated membrane recruitment of Syk and PLCg2. lutionary conserved transcriptional signature and may help to However, we could not detect Swip-1 in SLP-65 immunoprecipitates or accelerate cellular activation (65). Accordingly, it is presumably vice versa (data not shown). Thus, Swip-1, Syk, and PLCg2aretar- important for the function of Swip-1 at which B cell differentia- geted to membrane rafts, or stabilized in vicinity of the BCR, by other tion stage Swip-1–interacting proteins are expressed, as this may means—for instance, cytoskeletal proteins or lipid binding of Swip-1. regulate membrane localization and function of Swip-1. Whereas One group has shown that dephosphorylation of the cytoskeletal protein Lyn is expressed throughout B cell development, Fgr is expressed Ezrin regulates late membrane raft association of the BCR (51), and in mature primary B cells, mantle zone B cells, and during another group identified Swip-1 in immunopurified caspase-9 com- myelomonocytic differentiation, but not in immature primary B plexes together with Ezrin (52). Swip-1 was found in the cytoskeletal cells (66, 67), which might regulate the subcellular localization fraction of NK-like cells (53), and it can possibly associate with mi- and function of Swip-1 in mature B cells. Interestingly, S74 and crotubule-associated tau proteins (27). In that sense, it has been sug- S76 of Swip-1 are Cdk1 phosphorylation sites (23). Cdk1 is ex- gested that a-andb-tubulin stably associate with RhoH, which, in turn, pressed and active during the G2/S phase of the cell cycle (for associates stably with Syk and PLCg2 (54), and Syk has been shown to review see Ref. 68); that is, in activated B cells—for instance, in associate with microtubules (55, 56). We therefore suggest that Swip-1 germinal centers (69). Thus, Swip-1 could be modified by phos- is a cytoskeleton-associated scaffold protein for the BCR. As 1) mem- phorylation to modulate BCR signals in cycling B cells where the brane rafts are sites for active actin nucleation in T lymphocytes (49); 2) BCR induces G1 arrest and apoptosis (70), both of which are the underlying actin cytoskeleton structures the plasma membrane (57); enhanced by Swip-1 (22). and 3) the actin cytoskeleton transduces the strength of BCR signals Apoptosis in lymphocytes is effectively controlled by the tran-

(58), Swip-1 may be connected to both membrane rafts and the cyto- scription factor NF- kB (for review see Ref. 71). With regard to the Downloaded from skeleton, possibly even inducing or aggregating membrane rafts, or Syk/ Swip-1–mediated increase of the BCR-induced calcium ﬂux, Swip- PLCg2-dependent microclusters (59). The latter possibility has not been 1 should contribute to the activation of the calcium-dependent analyzed in this study because we did not stimulate the BCR via transcription factors NF-kB and NF-AT and inﬂuence apoptosis in membrane-bound Ags. Although the precise role of membrane rafts in B lymphocytes (11). Whereas NF-AT has not been studied so far, we immune cell signaling is a matter of debate (60), biophysical experi- showed already that Swip-1 blocks expression of the antiapoptotic

ments revealed that the open conformation of the BCR is trapped in NF-kB target gene bclxL (22). An explanation could be that Swip-1 http://www.jimmunol.org/ regions of the membrane with low lateral mobility just a few seconds binds calcium directly (27) and is therefore part of a negative before the BCR-induced calcium flux (19). We showed in this paper that feedback loop. Because Swip-1 blocks NF-kB in WEHI231 cells Swip-1 is responsible for targeting BCR, PLCg2, and Syk to cellular (22), we propose that Swip-1 rather counteracts tonic BCR survival compartments that are detergent insoluble and of low density after lysis signaling (72), despite inducing constitutive membrane raft asso- (DRM). These fractions have been ascribed to membrane rafts (61), and ciation of Syk, PLCg2, and the mHC in WEHI231 cells. we corroborated our findings through live-cell imaging. Rolli et al. (2) reconstituted the minimal BCR signalosome in Both the BCR-induced calcium flux and membrane raft asso- Drosophila melanogaster S2 cells. S2 cells are immune-reactive ciation of Swip-1, Syk, and PLCg2 depend on aa 72–82 of the PR (73) and do express Drospophila Swip-1 (74). Murine Swip-1 and region of Swip-1 that interacts with the SH3 domain of Fgr. Direct Drosophila Swip-1 are 52% identical, and Drosphila Swip-1 ex- by guest on September 26, 2021 interactions of Swip-1 have also been demonstrated by us with the hibits in principle the same structure as murine Swip-1 (Supple- SH3 domains of Lyn and PLCg. These data suggest that Src mental Fig. 5). It is thus possible that Drosophila Swip-1 interacts kinases, such as Lyn or Fgr, regulate access of Swip-1 to mem- with eukaryotic signaling molecules. Drosophila Swip-1 is ex- brane rafts. In turn, engagement of Src SH3 domains by high- pressed in larvae from stage 9 on in the ventral head mesoderm affinity SH3 ligands can activate Src kinases (62), but we did not and at stage 10 in hemocytes of the head mesoderm (75). In detect significantly enhanced Src kinase autophosphorylation in analogy, Swip-1 is expressed in cells originating from the meso- the presence of Swip-1 in whole cell lysates (data not shown). In derm in mice and man, namely B and T lymphocytes, NK-like terms of the phosphorylation-dependent interaction of Swip-1 cells, and the monocytic cell line RAW264.7 (22, 54, 76, 77). with Lyn and Fgr, phosphorylation of murine and human Swip-1 Swip-1 becomes upregulated upon stimulation of RAW264 cells at serine residues 74 and 76 (23–25) and of tyrosine 83 (26) have with receptor activator for NF-kB ligand and TNF-a, conditions been described. In our hands, Swip-1 was not phosphorylated on that promote inflammation and osteoclast differentiation (77). The tyrosine before or after BCR engagement as judged by Western promiscuous expression pattern of Swip-1, its evolutionary con- blotting with the mAb PY99 (not shown). Thus, phosphorylation servation, and its involvement in the similarly promiscuous cal- of serine 74, 76, both, or others mediate binding of Swip-1 to the cium-signaling axis Syk/PLCg2 suggests that Swip-1 regulates SH3 domain of Fgr. The localization of the phospho-aas that calcium signals of other ITAM-containing receptors found in the mediate(s) binding to the SH3 domain of Lyn is still less clear, but above-mentioned cell types, such as the TCR, activating Fc re- these aas lie presumably outside the PR region of Swip-1. Aas 9– ceptors in macrophages and NK cells, or osteoclast-associated, Ig- 13 (KLSRR) and 57–61 (KLLRR) of Swip-1 could be novel un- like receptor in osteoclasts (78). Hence, Swip-1 may not only help conventional SH3 ligands (63) that contribute to binding of the to activate B cells but be a regulator of adaptive immunity. SH3 domains of Lyn or PLCg (Supplemental Fig. 5). The N-terminal part of Swip-1 is predicted to be of low complexity (i.e., flexible) (Fig. 6A), and thus, its structure as well as accessibility of Acknowledgments the putative SH3 binding regions (aa 9–13, aa 57–61) (63) may be We thank Dr. Athanasia Avramidou for compiling Swip-1 sequences and Dr. Jurgen Wittman for critical reading. We also thank Dr. Jurgen Wienands for controlled by phosphorylation. ¨ ¨ the SLP-65 antiserum and Dr. Michael Engelke for helpful discussions. Dr. Immature B cells exhibit higher BCR-induced calcium fluxes Christopher Paige is sincerely acknowledged for the kind gift of B62.1 cells. than mature B cells (64), and both Swip-1 and PLCg2 are more Dr. Falk Nimmerjahn and Anja Lux generously provided help and reagents. abundant in immature than in mature B cells (22, 64). As sug- gested by us, this might be important for induction of tolerance. Another function in vivo might be in memory B cells as well as in Disclosures CD4 and CD8 memory T cells, where Swip-1 is part of an evo- The authors have no financial conflicts of interest. The Journal of Immunology 11

References 30. Boyd, A. W., and J. W. Schrader. 1981. The regulation of growth and differentiation of a murine B cell lymphoma. II. The inhibition of WEHI 231 by anti- 1. Gold, M. R. 2002. To make antibodies or not: signaling by the B-cell antigen immunoglobulin antibodies. J. Immunol. 126: 2466–2469. Trends Pharmacol. Sci. receptor. 23: 316–324. 31. Mizuguchi, J., W. Tsang, S. L. Morrison, M. A. Beaven, and W. E. Paul. 1986. 2. Rolli, V., M. Gallwitz, T. Wossning, A. Flemming, W. W. Schamel, C. Zurn, and ¨ Membrane IgM, IgD, and IgG act as signal transmission molecules in a series of M. Reth. 2002. Ampliﬁcation of B cell antigen receptor signaling by a Syk/ B lymphomas. J. Immunol. 137: 2162–2167. ITAM positive feedback loop. Mol. Cell 10: 1057–1069. 32. Bishop, G. A., and G. Haughton. 1986. Use of the CH lymphomas as models of 3. Fu, C., C. W. Turck, T. Kurosaki, and A. C. Chan. 1998. BLNK: a central linker murine B cell differentiation. Immunol. Res. 5: 263–270. protein in B cell activation. Immunity 9: 93–103. 33. Milne, C. D., H. E. Fleming, and C. J. Paige. 2004. IL-7 does not prevent pro-B/ 4. Wienands, J., J. Schweikert, B. Wollscheid, H. Jumaa, P. J. Nielsen, and M. Reth. pre-B cell maturation to the immature/sIgM(+) stage. Eur. J. Immunol. 34: 2647– 1998. SLP-65: a new signaling component in B lymphocytes which requires ex- 2655. pression of the antigen receptor for phosphorylation. J. Exp. Med. 188: 791–795. 34. Oehrl, W., C. Kardinal, S. Ruf, K. Adermann, J. Groffen, G. S. Feng, J. Blenis, 5. Goitsuka, R., Y. Fujimura, H. Mamada, A. Umeda, T. Morimura, K. Uetsuka, T. H. Tan, and S. M. Feller. 1998. The germinal center kinase (GCK)-related K. Doi, S. Tsuji, and D. Kitamura. 1998. BASH, a novel signaling molecule protein kinases HPK1 and KHS are candidates for highly selective signal preferentially expressed in B cells of the bursa of Fabricius. J. Immunol. 161: transducers of Crk family adapter proteins. Oncogene 17: 1893–1901. 5804–5808. 35. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the 6. Kurosaki, T., A. Maeda, M. Ishiai, A. Hashimoto, K. Inabe, and M. Takata. 2000. head of bacteriophage T4. Nature 227: 680–685. Regulation of the phospholipase C-gamma2 pathway in B cells. Immunol. Rev. 36. Saouaf, S. J., S. Mahajan, R. B. Rowley, S. A. Kut, J. Fargnoli, A. L. Burkhardt, 176: 19–29. S. Tsukada, O. N. Witte, and J. B. Bolen. 1994. Temporal differences in the 7. Engelke, M., N. Engels, K. Dittmann, B. Stork, and J. Wienands. 2007. Ca(2+) activation of three classes of non-transmembrane protein tyrosine kinases fol- signaling in antigen receptor-activated B lymphocytes. Immunol. Rev. 218: 235– lowing B-cell antigen receptor surface engagement. Proc. Natl. Acad. Sci. U.S.A. 246. 91: 9524–9528. 8. Zhang, S. L., Y. Yu, J. Roos, J. A. Kozak, T. J. Deerinck, M. H. Ellisman, 37. Spalton, J. C., J. Mori, A. Y. Pollitt, C. E. Hughes, J. A. Eble, and S. P. Watson. K. A. Stauderman, and M. D. Cahalan. 2005. STIM1 is a Ca2+ sensor that ac- 2009. The novel Syk inhibitor R406 reveals mechanistic differences in the ini- tivates CRAC channels and migrates from the Ca2+ store to the plasma mem-

tiation of GPVI and CLEC-2 signaling in platelets. J. Thromb. Haemost. 7: Downloaded from brane. Nature 437: 902–905. 1192–1199. 9. Vig, M., and J. P. Kinet. 2009. Calcium signaling in immune cells. Nat. Immunol. 38. Mielenz, D., A. Ruschel, C. Vettermann, and H. M. Ja¨ck. 2003. Immunoglobulin 10: 21–27. mu heavy chains do not mediate tyrosine phosphorylation of Ig alpha from the 10. Feske, S., Y. Gwack, M. Prakriya, S. Srikanth, S. H. Puppel, B. Tanasa, ER-cis-Golgi. J. Immunol. 171: 3091–3101. P. G. Hogan, R. S. Lewis, M. Daly, and A. Rao. 2006. A mutation in Orai1 causes 39. Li, M., P. Luraghi, A. Amour, X. D. Qian, P. S. Carter, C. J. Clark, A. Deakin, immune deﬁciency by abrogating CRAC channel function. Nature 441: 179–185. J. Denyer, C. I. Hobbs, M. Surby, et al. 2009. Kinetic assay for characterization 11. Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, and J. I. Healy. 1997. Differential of spleen tyrosine kinase activity and inhibition with recombinant kinase and activation of transcription factors induced by Ca2+ response amplitude and crude cell lysates. Anal. Biochem. 384: 56–67. duration. Nature 386: 855–858. 40. Nitschke, L. 2005. The role of CD22 and other inhibitory co-receptors in B-cell http://www.jimmunol.org/ 12. Bhattacharya, S., C. G. Bunick, and W. J. Chazin. 2004. Target selectivity in EF- activation. Curr. Opin. Immunol. 17: 290–297. hand calcium binding proteins. Biochim. Biophys. Acta 1742: 69–79. 41. Jefferis, R., and J. Lund. 2002. Interaction sites on human IgG-Fc for Fcgam- 13. Liu, J., M. W. Albers, T. J. Wandless, S. Luan, D. G. Alberg, P. J. Belshaw, maR: current models. Immunol. Lett. 82: 57–65. P. Cohen, C. MacKintosh, C. B. Klee, and S. L. Schreiber. 1992. Inhibition of 42. Jefferis, R., J. Lund, and J. Pound. 1990. Molecular deﬁnition of interaction sites T cell signaling by immunophilin-ligand complexes correlates with loss of on human IgG for Fc receptors (huFc gamma R). Mol. Immunol. 27: 1237–1240. calcineurin phosphatase activity. Biochemistry 31: 3896–3901. 43. Lane, P. J., J. A. Ledbetter, F. M. McConnell, K. Draves, J. Deans, 14. Kulathu, Y., E. Hobeika, G. Turchinovich, and M. Reth. 2008. The kinase Syk as G. L. Schieven, and E. A. Clark. 1991. The role of tyrosine phosphorylation in an adaptor controlling sustained calcium signalling and B-cell development. signal transduction through surface Ig in human B cells. Inhibition of tyrosine EMBO J. 27: 1333–1344. phosphorylation prevents intracellular calcium release. J. Immunol. 146: 715– 15. Stork, B., K. Neumann, I. Goldbeck, S. Alers, T. Ka¨hne, M. Naumann, 722. M. Engelke, and J. Wienands. 2007. Subcellular localization of Grb2 by the

44. Takata, M., H. Sabe, A. Hata, T. Inazu, Y. Homma, T. Nukada, H. Yamamura, by guest on September 26, 2021 adaptor protein Dok-3 restricts the intensity of Ca2+ signaling in B cells. EMBO and T. Kurosaki. 1994. Tyrosine kinases Lyn and Syk regulate B cell receptor- J. 26: 1140–1149. coupled Ca2+ mobilization through distinct pathways. EMBO J. 13: 1341–1349. 16. Hsueh, R. C., A. M. Hammill, J. A. Lee, J. W. Uhr, and R. H. Scheuermann. 45. Tsang, E., A. M. Giannetti, D. Shaw, M. Dinh, J. K. Tse, S. Gandhi, H. Ho, 2002. Activation of the Syk tyrosine kinase is insufficient for downstream signal S. Wang, E. Papp, and J. M. Bradshaw. 2008. Molecular mechanism of the Syk transduction in B lymphocytes. BMC Immunol. 3: 16. activation switch. J. Biol. Chem. 283: 32650–32659. 17. Kurosaki, T., and M. Hikida. 2009. Tyrosine kinases and their substrates in B 46. Zioncheck, T. F., M. L. Harrison, C. C. Isaacson, and R. L. Geahlen. 1988. lymphocytes. Immunol. Rev. 228: 132–148. Generation of an active protein-tyrosine kinase from lymphocytes by proteolysis. 18. Harder, T., and K. R. Engelhardt. 2004. Membrane domains in lymphocytes - J. Biol. Chem. 263: 19195–19202. from lipid rafts to protein scaffolds. Traffic 5: 265–275. 47. Taniguchi, T., T. Kobayashi, J. Kondo, K. Takahashi, H. Nakamura, J. Suzuki, 19. Sohn, H. W., P. Tolar, T. Jin, and S. K. Pierce. 2006. Fluorescence resonance K. Nagai, T. Yamada, S. Nakamura, and H. Yamamura. 1991. Molecular cloning energy transfer in living cells reveals dynamic membrane changes in the initi- of a porcine gene syk that encodes a 72-kDa protein-tyrosine kinase showing ation of B cell signaling. Proc. Natl. Acad. Sci. U.S.A. 103: 8143–8148. high susceptibility to proteolysis. J. Biol. Chem. 266: 15790–15796. 20. Aman, M. J., and K. S. Ravichandran. 2000. A requirement for lipid rafts in 48. Nakashima, K., T. Kokubo, M. Shichijo, Y. F. Li, T. Yura, and N. Yamamoto. B cell receptor induced Ca(2+) flux. Curr. Biol. 10: 393–396. 2004. A novel Syk kinase-selective inhibitor blocks antigen presentation of 21. Mielenz, D., C. Vettermann, M. Hampel, C. Lang, A. Avramidou, M. Karas, and immune complexes in dendritic cells. Eur. J. Pharmacol. 505: 223–228. H. M. Ja¨ck. 2005. Lipid rafts associate with intracellular B cell receptors and 49. Harder, T., and K. Simons. 1999. Clusters of glycolipid and glyco- exhibit a B cell stage-specific protein composition. J. Immunol. 174: 3508–3517. sylphosphatidylinositol-anchored proteins in lymphoid cells: accumulation of 22. Avramidou, A., C. Kroczek, C. Lang, W. Schuh, H. M. Ja¨ck, and D. Mielenz. actin regulated by local tyrosine phosphorylation. Eur. J. Immunol. 29: 556–562. 2007. The novel adaptor protein Swiprosin-1 enhances BCR signals and con- 50. Leprince, C., K. E. Draves, R. L. Geahlen, J. A. Ledbetter, and E. A. Clark. 1993. tributes to BCR-induced apoptosis. Cell Death Differ. 14: 1936–1947. CD22 associates with the human surface IgM-B-cell antigen receptor complex. 23. Blethrow, J. D., J. S. Glavy, D. O. Morgan, and K. M. Shokat. 2008. Covalent Proc. Natl. Acad. Sci. U.S.A. 90: 3236–3240. capture of kinase-specific phosphopeptides reveals Cdk1-cyclin B substrates. 51. Gupta, N., B. Wollscheid, J. D. Watts, B. Scheer, R. Aebersold, and Proc. Natl. Acad. Sci. U.S.A. 105: 1442–1447. A. L. DeFranco. 2006. Quantitative proteomic analysis of B cell lipid rafts re- 24. Dephoure, N., C. Zhou, J. Villeń, S. A. Beausoleil, C. E. Bakalarski, veals that ezrin regulates antigen receptor-mediated lipid raft dynamics. Nat. S. J. Elledge, and S. P. Gygi. 2008. A quantitative atlas of mitotic phosphory- Immunol. 7: 625–633. lation. Proc. Natl. Acad. Sci. U.S.A. 105: 10762–10767. 52. Checin´ska, A., G. Giaccone, J. A. Rodriguez, F. A. Kruyt, and C. R. Jimenez. 25. Zanivan, S., F. Gnad, S. A. Wickstro¨m, T. Geiger, B. Macek, J. Cox, R. Fassler, 2009. Comparative proteomics analysis of caspase-9-protein complexes in un- and M. Mann. 2008. Solid tumor proteome and phosphoproteome analysis by treated and cytochrome c/dATP stimulated lysates of NSCLC cells. J. Proteo- high resolution mass spectrometry. J. Proteome Res. 7: 5314–5326. mics 72: 575–585. 26. Ballif, B. A., G. R. Carey, S. R. Sunyaev, and S. P. Gygi. 2008. Large-scale 53. Meng, X., and J. A. Wilkins. 2005. Compositional characterization of the cy- identification and evolution indexing of tyrosine phosphorylation sites from toskeleton of NK-like cells. J. Proteome Res. 4: 2081–2087. murine brain. J. Proteome Res. 7: 311–318. 54. Matsumoto, M., K. Oyamada, H. Takahashi, T. Sato, S. Hatakeyama, and 27. Vega, I. E., E. E. Traverso, Y. Ferrer-Acosta, E. Matos, M. Colon, J. Gonzalez, K. I. Nakayama. 2009. Large-scale proteomic analysis of tyrosine-phosphorylation D. Dickson, M. Hutton, J. Lewis, and S. H. Yen. 2008. A novel calcium-binding induced by T-cell receptor or B-cell receptor activation reveals new signaling protein is associated with tau proteins in tauopathy. J. Neurochem. 106: 96–106. pathways. Proteomics 9: 3549–3563. 28. Cambier, J. C., C. H. Heusser, and M. H. Julius. 1986. Abortive activation of B 55. Faruki, S., R. L. Geahlen, and D. J. Asai. 2000. Syk-dependent phosphorylation lymphocytes by monoclonal anti-immunoglobulin antibodies. J. Immunol. 136: of microtubules in activated B-lymphocytes. J. Cell Sci. 113: 2557–2565. 3140–3146. 56. Sulimenko, V., E. Dra´berova´, T. Sulimenko, L. Macurek, V. Richterova´, 29. Evan, G. I., G. K. Lewis, G. Ramsay, and J. M. Bishop. 1985. Isolation of P. Dra´ber, and P. Dra´ber. 2006. Regulation of microtubule formation in activated monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. mast cells by complexes of gamma-tubulin with Fyn and Syk kinases. J. Im- Cell. Biol. 5: 3610–3616. munol. 176: 7243–7253. 12 SWIPROSIN-1/EFhd2 IN B CELL RECEPTOR CALCIUM SIGNALING

57. Fujiwara, T., K. Ritchie, H. Murakoshi, K. Jacobson, and A. Kusumi. 2002. 68. Castedo, M., J. L. Perfettini, T. Roumier, and G. Kroemer. 2002. Cyclin-de- Phospholipids undergo hop diffusion in compartmentalized cell membrane. pendent kinase-1: linking apoptosis to cell cycle and mitotic catastrophe. Cell J. Cell Biol. 157: 1071–1081. Death Differ. 9: 1287–1293. 58. Hao, S., and A. August. 2005. Actin depolymerization transduces the strength of 69. Banerjee, S. K., A. P. Weston, M. N. Zoubine, D. R. Campbell, and R. Cherian. B-cell receptor stimulation. Mol. Biol. Cell 16: 2275–2284. 2000. Expression of cdc2 and cyclin B1 in Helicobacter pylori-associated gastric 59. Weber, M., B. Treanor, D. Depoil, H. Shinohara, N. E. Harwood, M. Hikida, MALT and MALT lymphoma : relationship to cell death, proliferation, and T. Kurosaki, and F. D. Batista. 2008. Phospholipase C-gamma2 and Vav co- transformation. Am. J. Pathol. 156: 217–225. operate within signaling microclusters to propagate B cell spreading in response 70. Yamashita, Y., K. Miyake, Y. Miura, Y. Kaneko, H. Yagita, T. Suda, S. Nagata, to membrane-bound antigen. J. Exp. Med. 205: 853–868. 60. Kenworthy, A. K. 2008. Have we become overly reliant on lipid rafts? Talking J. Nomura, N. Sakaguchi, and M. Kimoto. 1996. Activation mediated by RP105 Point on the involvement of lipid rafts in T-cell activation. EMBO Rep. 9: 531–535. but not CD40 makes normal B cells susceptible to anti-IgM-induced apoptosis: 61. Schroeder, R., E. London, and D. Brown. 1994. Interactions between saturated a role for Fc receptor coligation. J. Exp. Med. 184: 113–120. acyl chains confer detergent resistance on lipids and glycosylphosphatidylinositol 71. Sen, R. 2006. Control of B lymphocyte apoptosis by the transcription factor NF- (GPI)-anchored proteins: GPI-anchored proteins in liposomes and cells show kappaB. Immunity 25: 871–883. similar behavior. Proc. Natl. Acad. Sci. U.S.A. 91: 12130–12134. 72. Lam, K. P., R. Ku¨hn, and K. Rajewsky. 1997. In vivo ablation of surface im- 62. Lerner, E. C., and T. E. Smithgall. 2002. SH3-dependent stimulation of Src- munoglobulin on mature B cells by inducible gene targeting results in rapid cell family kinase autophosphorylation without tail release from the SH2 domain death. Cell 90: 1073–1083. in vivo. Nat. Struct. Biol. 9: 365–369. 73. Williams, M. J. 2007. Drosophila hemopoiesis and cellular immunity. J. Im- 63. Li, S. S. 2005. Speciﬁcity and versatility of SH3 and other proline-recognition munol. 178: 4711–4716. domains: structural basis and implications for cellular signal transduction. Bio- 74. Henikoff, S., J. G. Henikoff, A. Sakai, G. B. Loeb, and K. Ahmad. 2009. Ge- chem. J. 390: 641–653. nome-wide proﬁling of salt fractions maps physical properties of chromatin. 64. Benschop, R. J., E. Brandl, A. C. Chan, and J. C. Cambier. 2001. Unique sig- Genome Res. 19: 460–469. naling properties of B cell antigen receptor in mature and immature B cells: 75. Estrada, B., S. E. Choe, S. S. Gisselbrecht, S. Michaud, L. Raj, B. W. Busser, J. Immunol. implications for tolerance and activation. 167: 4172–4179. M. S. Halfon, G. M. Church, and A. M. Michelson. 2006. An integrated strategy 65. Haining, W. N., B. L. Ebert, A. Subrmanian, E. J. Wherry, Q. Eichbaum,

for analyzing the unique developmental programs of different myoblast sub- Downloaded from J. W. Evans, R. Mak, S. Rivoli, J. Pretz, J. Angelosanto, et al. 2008. Identification of an evolutionarily conserved transcriptional signature of CD8 memory dif- types. PLoS Genet. 2: e16. ferentiation that is shared by T and B cells. J. Immunol. 181: 1859–1868. 76. Vuadens, F., N. Rufer, A. Kress, P. Corthe´sy, P. Schneider, and J. D. Tissot. 2004. 66. Wechsler, R. J., and J. G. Monroe. 1995. Immature B lymphocytes are deficient Identification of swiprosin 1 in human lymphocytes. Proteomics 4: 2216–2220. in expression of the src-family kinases p59fyn and p55fgr1. J. Immunol. 154: 77. Nomiyama, H., K. Egami, N. Wada, K. Tou, M. Horiuchi, H. Matsusaki, 1919–1929. R. Miura, O. Yoshie, and T. Kukita. 2005. Identification of genes differentially 67. Link, D. C., and M. Zutter. 1995. The proto-oncogene c-fgr is expressed in expressed in osteoclast-like cells. J. Interferon Cytokine Res. 25: 227–231. normal mantle zone B lymphocytes and is developmentally regulated during 78. Datta, H. K., W. F. Ng, J. A. Walker, S. P. Tuck, and S. S. Varanasi. 2008. The

myelomonocytic differentiation in vivo. Blood 85: 472–479. cell biology of bone metabolism. J. Clin. Pathol. 61: 577–587. http://www.jimmunol.org/ by guest on September 26, 2021