DIFFERENTIAL CHANGES IN GENE EXPRESSION IN CULTURED HUMAN RETINAL PIGMENT EPITHELIAL CELLS AFTER BETA-AMYLOID STIMULATION
by
KHALIQ KURJI
B.Sc.H, Queen’s University, 2006
A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
in
The Faculty of Graduate Studies
(Neuroscience)
THE UNIVERSITY OF BRITISH COLUMBIA
(Vancouver)
DECEMBER 2008
© Khaliq Kurji, 2008 ABSTRACT:
Age related macular degeneration (AMD) is the most common cause of irreversible vision loss in the elderly. At present, there are an estimated one million people in Canada with some form of
AMD and this number is expected to double to two million by 2031. These estimates are sobering, and it is predicted that costs for treatment and care of individuals who suffer vision loss from AMD will have significant impact on the social and public health systems in Canada in the next two decades. There are treatments to slow the progression of vision loss, but unfortunately, there are currently no cures available for AMD. In order to develop effective second generation therapies and cures, further insights into how and why AMD develops are greatly needed.
Recent studies have provided novel insights into the role of inflammation in the pathogenesis of
AMD. Inflammation, or swelling of the retinal tissues, causes harmful processes that promote macular degeneration. The proposed studies will focus on the triggers of inflammation in the retina. It is hypothesized that macular degeneration may be slowed or stopped by eliminating the molecules that cause inflammation in the retina. This study will focus on amyloid beta (A), a toxic molecule that has been implicated in retinal inflammation, and the role that it may play in gene expression of the retinal pigment epithelial cell. Amyloid beta is a well studied peptide in another age related disorder, Alzheimer‟s disease. It is the major extracellular deposit in
Alzheimer‟s disease plaques, and has recently been discovered as a component of drusen, the hallmark extracellular deposits in the retina of patients with the „dry‟ form of AMD. These studies will allow the development of new treatment regimens that target retinal inflammation and thus minimize the processes that „trigger‟ the onset of macular degeneration. ii
TABLE OF CONTENTS
ABSTRACT ...... ii
TABLE OF CONTENTS ...... iii
LIST OF TABLES ...... v
LIST OF FIGURES ...... vi
ACKNOWLEDGEMENTS ...... vii
DEDICATION...... viii
CO-AUTHORSHIP STATEMENT ...... xi
CHAPTER 1 INTRODUCTION ...... 1 1.1 BACKGROUND ...... 1 1.1.1 What is AMD? ...... 1 1.1.2 Ocular structures affected by normal aging that may predispose a person to develop AMD ...... 2 1.1.3 Inflammation and the immune system ...... 3 1.1.4 Complement system ...... 4 1.1.5 Inflammation and AMD ...... 6 1.1.6 Amyloid beta...... 9 1.1.7 Amyloid beta 1-40 vs. Amyloid beta 1-42 ...... 11 1.1.8 structure: oligomers vs. fibrillar...... 12 1.1.9 AMD and other amyloid diseases ...... 13 1.1.10 Amyloid beta and inflammation ...... 14 1.2 INTRODUCTION TO PROJECT ...... 15 1.2.1 Amyloid beta, complement System, and AMD ...... 15 1.3 OBJECTIVES ...... 16 1.4 TABLES ...... 17 1.5 FIGURES ...... 18 1.6 REFERENCES ...... 22
CHAPTER 2 DIFFERNTIAL CHANGES IN GENE EXPRESSION OF INFLAMMATORY GNES IN CULTURED HUMAN RETINAL PIGMENT EPITHELIAL CELLS AFTER BETA-AMYLOID STIMULATION ...... 32 2.1 INTRODUCTION...... 33 2.2 METHODS ...... 35 2.2.1 Amyloid beta 1-40 (A40) oligomerization ...... 35 2.2.2 Atomic force microscopy (AFM) ...... 35 2.2.3 Dot blot assay...... 36 2.2.4 Cell culture of human RPE cells ...... 37 iii
2.2.5 Cell viability assay...... 37 2.2.6 Amyloid beta stimulation ...... 38 2.2.7 Extraction of total cellular RNA ...... 38 2.2.8 Microarray and data analysis ...... 39 2.2.9 Real-time PCR (RT-CPR) and data analysis ...... 40 2.2.10 Gene set enrichment analysis (GSEA) ...... 41 2.2.11 Elisa ...... 43 2.3 RESULTS ...... 43 2.3.1 Characterization of amyloid beta oligomers ...... 43 2.3.2 Cell viability of human RPE cells after stimulation with A ...... 44 2.3.3 Gene expression profile analysis of Atreated human RPE cells ...... 44 2.3.4 Confirmation of differentially expressed genes ...... 45 2.3.5 GSEA pathway analysis ...... 45 2.3.6 Cytokine and biomarker levels in cell supernatants ...... 46 2.4 DISCUSSION ...... 47 2.5 TABLES ...... 53 2.6 FIGURES ...... 70 2.7 REFERENCES ...... 81
CHAPTER 3 CONCLUSION ...... 90 3.1 OBJECTIVES ...... 90 3.1.1 Goal 1) Determine the effects of ...... 90 3.2 OVERALL SIGNIFICANCE ...... 91 3.3 STRENGTHS ...... 93 3.3.1 The use of primary cell culture of human RPE cell ...... 93 3.3.2 The use of agilent’s whole human oligo microarray ...... 93 3.3.3 The relevance of stimulating with oligomers ...... 94 3.4 WEAKNESSES ...... 94 3.4.1 Difficulty using different lengths of peptides ...... 94 3.4.2 The lack of an established in vivo model ...... 95 3.5 FUTURE WORK ...... 96 3.5.1 What role does CFI play in RPE cells? ...... 96 3.5.2 Is there an animal model that overexpresses in the RPE/BM complex? ...... 97 3.5.3 How is A produced and deposited in drusen? ...... 97 3.5.4 How does A enter the RPE cell? ...... 98 3.5.5 What is the relationship between interleukin and 8 and AMD? ...... 99 3.5.6 Are there potential ways to prevent A’s effect on RPE cells? ...... 100 3.6 CONCLUSION ...... 100 3.7 FIGURES ...... 102 3.8 REFERENCES ...... 104
APPENDICES ...... 112 4.1 Appendix I. Tables ...... 112 4.2 Appendix II. Figures ...... 122 4.3 Appendix III. Potential manuscript information ...... 125 iv
LIST OF TABLES
CHAPTER 1 Table 1.1 AMD related polymorphisms……….………………………………………………..17
CHAPTER 2
Table 2.1. Upregulation of differentially expressed genes in A treated RPE cells at 24 hours…….………………………………………………………………………………...... 53
Table 2.2. Downregulation of differentially expressed genes in A treated RPE cells at 24 hours.……………………………………………………………………………………...……..62
Table 2.3. RT-PCR primers.………………………………………………………………….....66
Table 2.4. Summary of GSEA analysis…………………………………….………………...…67
Table 2.5. Associated gene found in the NTHIPATHWAY gene set………………………...... 69
APPENDIX I
Table 4.1.1. Complete list of differentially expressed genes upregulated in A treated RPE cells at 6 hours…………………………………………………………………………………….....112
Table 4.1.2. Complete list of differentially expressed genes downregulated in A treated RPE cells at 6 hours…………………………………………………………………………...... 116
v
LIST OF FIGURES
CHAPTER 1 Figure 1.1. Drusen present in the retina…………….…. ……………………...………...……....18
Figure 1.2. Overview of the complement system.…………………………………….……...... 19
Figure 1.3. Proposed events in the pathogenesis of age-related macular degeneration.…...... 20
Figure 1.4. Amyloid precursor protein (APP) processing.……………………………………....21
CHAPTER 2
Figure 2.1 Confirmation of A 1-40 oligomers...…….………………………………………….70
Figure 2.2. Cell viability assay with A (1-40) stimulation...…………………………………...71
Figure 2.3 Microarray images……..…...………………………………………………………...72
Figure 2.4. Differential gene expression of 0.3 M A treated human RPE cells for 24 hours..……………………………………………………………………………………………76
Figure 2.5. Heat map of most upregulated and downregulated differentially expressed genes..…………………………………………………………………………………………....77
Figure 2.6. Cytokine levels in cell supernatants...……………………………………………….79
Figure 2.7. Proposed mechanism for pathogenesis of AMD………………………….……...... 80
CHAPTER 3
Figure 3.1. Summary of the pathogenesis of AMD..……………………..………………….....102
APPENDIX II
Figure 4.2.1. Photograph of passage 5 (P5) human RPE cells used for A stimulation study…….……………………………………………………………………………………...122
Figure 4.2.2. Cell viability assay with A(1-40) stimulation…………...….………...... 123
Figure 4.2.3. RNA quality analysis…..………………………………………………………...124
vi
ACKNOWLEDGEMENTS
My deepest gratitude goes to Dr. Joanne Matsubara for her supervision and guidance.
Furthermore, I would like to thank Jing Cui for her training and help with various experiments.
I would also like to thank Shiv Prasad and Luba Kojic for their help with various technical aspects of molecular biology and pathway analyses.
Lastly, I would also like to thank the staff at the Prostate Cancer Centre, specifically Anne
Haegert for her assistance with microarray experiments.
vii
DEDICATION
This dissertation is dedicated to my loving parents, my brother Hafeez, my girlfriend Ruhee and my many friends, specifically Dr. Ayisha Kurji and Naheed Bardai.
The workload of this Master‟s was extremely gruelling, stressful and tiring. If it were not for the love, support and patience of my family and friends, I can honestly say that I would not have been able to complete this program. Thank you all so much for everything!
viii
CO-AUTHORSHIP STATEMENT
The chapter that will be submitted for publication was initially the idea of Dr. Joanne Matsubara.
All experiments were carried out by myself, except for the following: Dr. Jing Cui grew and maintained the human retinal pigment epithelial cells. Anne Haegert assisted with the microarray experiments and analysis. Dr. Shiv Prasad and Dr. Luba Kojic assisted with real-time PCR and pathway analyses experiments. The enzyme-linked immunosorbent assay (ELISA) was carried out by Thermo-Fisher Scientific using their searchlight multiplex ELISA technology. This dissertation was edited primarily by Dr. Joanne Matsubara, as well as by my supervisory committee members.
ix
CHAPTER 1
INTRODUCTION
1.1 BACKGROUND
1.1.1 What is AMD?
AMD is a degenerative eye disease that causes the deterioration of the light sensing photoreceptors in the central part of the retina (macula), which ultimately leads to the loss of central vision1, 2. AMD can be classified into early and late stage AMD2 -4. Early AMD, where visual deterioration is subtle, is characterized by the altered pigmentation of the retina and the appearance of extracellular deposits known as drusen (Fig. 1.1). The accumulation of drusen, the hallmark lesions characteristic of the disease, between the basal lamina of retinal pigment epithelium (RPE) and the inner membrane of Bruch‟s Membrane (BM) can lead to the development of late-stage AMD2- 4. Late AMD, which is usually accompanied by severe visual loss, can be classified into two forms, „wet‟ and „dry‟ AMD. Although rare, occurring in approximately ten to fifteen percent of total cases, „wet‟ (also known as neovascular or exudative) AMD can cause more rapid vision loss. This form of AMD results from haemorrhages into the subretinal space by the choriocapillaris, the vascular system that innervates the retina. The haemorrhaging causes detachment of the neuroretina and disturbs the fine arrangement of the photoreceptors. As ischemic tissues release angiogenic growth factors causing new blood vessels grow, haemorrhaging continues, and scarring of the macula eventually occurs if untreated. The most common form of AMD, however, is the „dry‟ form, which is also referred to as geographic atrophy. „Dry‟ AMD, in which visual loss develops much slower than the „wet‟ form, is characterized by the appearance of drusen, RPE cell death and the
1
deterioration of the photoreceptors2- 4. Despite available treatments to slow the progression of vision loss, there are unfortunately no known cures available at the present to treat either form of
AMD. Thus further insights into the pathogenesis of AMD are greatly needed.
1.1.2 Ocular structures affected by normal aging that may predispose a person to develop
AMD
One of the primary risk factors in the development of AMD is increasing age2, 3, 5. Therefore, there are several age related changes to components of the outer retina that can predispose an individual to AMD. The RPE is the main structure implicated in the pathogenesis of the disease, and undergoes many changes with age. Located on the exterior of the retina, the RPE is a pigmented cell layer that is attached to the choroid5, 6. Several known functions of the RPE include: i) maintaining the configuration and preservation of both Bruch‟s membrane and the interphotoreceptor matrix, ii) transportation of materials between the choriocapillaris and photoreceptors, iii) the regeneration of visual pigments; iv) phagocytosis. 5 Phagocytosis of photoreceptor tips by the RPE is critical to the rejuvination of photoreceptors 7. However, with age, the RPE cell‟s functional capacity is diminished, and it can no longer handle the burden of increasing amounts of metabolic waste that accumulate over the years5. In addition, BM, which is located between the RPE and the choriocapillaris, also undergoes changes with increasing age.
As it ages, BM thickens and accumulates lipids, collagen and debris, resulting in a decrease in the membrane‟s fluid and nutrient transport ability5, 8, 9. Consequently, this decrease in BM permeability and its cell adhesion function, as well as the accumulation of extracellular deposits
2
and metabolic wastes, initiates chronic local inflammation and apoptosis of both the photoreceptors and RPE cells 5.
1.1.3 Inflammation and the immune system
The recent discovery of several inflammatory proteins as constituents of drusen has led to the theory that inflammation plays a role in the pathogenesis of AMD10- 12. The innate immune system, consisting of macrophages and neutrophils, comprises the body‟s first line of defence against foreign pathogens. This system is responsible for phagocytosis of foreign substances, and also plays a role in the initiation of the adaptive immune system. The adaptive immune system is comprised of lymphocytes, which are responsible for eliminating pathogens not cleared by the innate system. This process creates memory lymphocytes, which help the body recognize previous pathogens and protects the body from re-infection. The adaptive immune system, along with the cells of the innate system, function in unison to help provide the body with an efficient and versatile method to control invasion by foreign pathogens13.
The innate immune system is activated upon intrusion of a foreign substance through the epithelial surface of the body. Macrophages encounter these substances and initiate phagocytosis, which subsequently leads to the secretion of various proteins, cytokines and chemokines, initiating the process of inflammation. Cytokines are proteins that act on cells with receptors specific for them affecting the function of these cells. Chemokines, on the other hand, are another class of protein that are secreted by activated macrophages. They are responsible for
3
attracting cells with chemokine receptors, specifically leukocytes, such as neutrophils and monocytes, to the site of infection. Neutrophils, like macrophages, are responsible for clearing and destroying pathogens by phagocytosis. Monocytes, which are recruited closely after neutrophils, quickly differentiate into macrophages, in a sense creating a positive feedback loop.
Due to their phagocytic function, neutrophils and macrophages are deemed the inflammatory cells of the innate immune system13.
1.1.4 Complement system
Another facet of the innate immune system is the complement system. The complement system protects the body from invading pathogens by clearing cellular debris. This is accomplished by induction of cell lysis or by activation of phagocytosis by macrophages13, 17, 18. The complement system is comprised of more than thirty proteins that are primarily synthesized in the liver.
Cellular sites of complement protein synthesis outside of the liver that can be harmful and lead to local tissue damage include neurons, monocytes, and endothelial, glial and epithelial cells. The complement system is responsible for cellular activation, defence against microbes and pathogens, clearance of immune complexes, and regulating chemotaxis and inflammatory reactions17.
The complement system is comprised of three distinct pathways (Fig. 1.2): the classical pathway, the lectin pathway and the alternative pathway12, 13, 17, 18. The classical pathway is activated by the binding of complement component C1q to antigen-antibody complexes or directly to the pathogen surface. The lectin pathway is initiated by oxidative stress or carbohydrates interacting 4
via mannose-binding lectin. After activation, both pathways continue along their own cascade to cleave complement component 4 (C4) and complement component 2 (C2) to generate C4b and
C2b, which bind together to form C3 convertase. This enzyme is responsible for cleaving large amounts of complement component 3 (C3) to synthesize C3b, which is deposited on the surface of pathogens13, 18.
The alternative pathway is somewhat different from the aforementioned pathways in that it is initiated by the spontaneous cleavage of C313, 18. This cleavage allows the plasma protease Factor
B (CFB) to bind, which then enables Factor D to bind and cleave CFB. The most important cleavage product, Bb, then binds to form a complex with C3 and subsequently cleaves other plasma C3 to generate C3b. This C3b is either inactivated by hydrolysis or binds covalently to the surfaces of pathogens or host cells. C3b is then able to bind to CFB, which allows Factor D to come in and generate more Bb. The subsequent attachment of C3b and Bb generates the alternative pathway‟s C3 convertase13.
All three arms of the complement pathway eventually converge to become one distinct pathway upon the activation of complement component 3(C3) convertase13, 17, 18. This protease cleaves
C4, C3, and C5 to form either peptide mediators of inflammation and recruit phagocytes or C3b.
C3b can do one of two things: i) opsonizes pathogens, allowing for phagocytosis, or ii) binds to
C3 convertase. This forms C5 convertase, which then cleaves complement component 5 (C5) to generate C5b. C5b then anchors the attachment of several other complement proteins (C6, C7,
C8, C9) to form the membrane attack complex (C5b-9) that eventually leads to cell lysis13,17, 18. 5
Due to its potentially destructive effects, the complement system must be kept under tight physiological control. As a regulatory mechanism, complement components are quickly inactivated if they do not bind to the pathogens surface immediately after activation.
Furthermore, there are several regulatory proteins circulating in the blood that bind to complement components to prevent their activation. In the classical pathway, C1 inhibitor
(C1INH) binds to the activated C1q complex preventing its proteolytic activity. In the alternative pathway, these regulatory proteins bind to C3b, and prevent either the formation of the convertase, or cause its dissociation. Decay-accelerating factor (DAF) competes with CFB for binding to C3b on cell surfaces and can also displace Bb from an activated convertase. C3b can also be cleaved into an inactive form (iC3b) by Factor I. Complement Factor H (CFH), one of the more important regulatory proteins in the blood, competes with CFB for binding to C3b, and removes Bb from the alternative pathway‟s C3 convertase, disrupting the positive feedback loop of this pathway. There are also fluid-phase regulators such as clusterin and vitronectin that bind to C5b-9 complexes to prevent cell lysis13, 17, 18, 19.
1.1.5 Inflammation and AMD
Recent evidence suggests that AMD pathogenesis may be the result of chronic inflammatory processes11, 20, 21. Although the pathological mechanism of AMD is still not known, research suggests a mechanism by which a number of factors, such as aging, oxidative stress, and ultraviolet light appear to cause RPE activation. This activation of the RPE subsequently triggers an inflammatory/immune response. Due to genetic variants of several inflammatory genes, this inflammatory/immune response is then believed to result in RPE cell damage and death,
6
eventually leading to the appearance of clinical features associated with AMD, such as choroidal neovascularizaton and geographic atrophy10 (see Figure 1.3 for proposed mechanism).
Drusen are the characteristic lesions associated with AMD. They are defined as extracellular deposits that accumulate between the RPE and Bruch‟s membrane. It is not exactly known how drusen develop, but increasing evidence points to drusen formation as a result of the accumulation of non-phagocytosed material from RPE cells. Extensive analyses of the composition of drusen have been carried out in recent years to ascertain its molecular and cellular constituents. The results of several studies have shown that drusen are comprised predominantly a glycoprotein core and cellular by-products (of the eye), including various chaperone proteins, apolipoprotein E , crystallines, vitronectin, fragments of RPE cells, and several inflammatory proteins, including amyloid beta, amyloid p, C3, C5, and the membrane attack complex(C5b–9) 4, 23-25. The appearance of complement proteins in drusen has led many to believe that drusen are synthesized after injury to the RPE cells, which leads to a local inflammatory response, most likely involving the complement system17, 20- 25.
Nevertheless, the most compelling evidence for the role of the complement system and inflammatory proteins in AMD comes from several genetic studies, which have identified a strong association between the CFH gene and AMD26-29. CFH is a regulatory protein with a molecular weight of 155kD that is synthesized predominantly by the liver, but is also made by other cells, including neurons, glia, lymphocytes and glomerular mesangial cells17, 30. In terms of
AMD, CFH has been discovered to be locally produced in the RPE cells and to accumulate in 7
drusen. Genetic analyses of the CFH gene found several single-nucleotide polymorphisms
(SNPs) within several chromosome regions that have been thought to be potentially implicated in
AMD association, such as 1q32. The results of these analyses determined that a SNP change at residue 420 from tyrosine to histidine increased the chances for developing AMD (odds ratio of
7.4) 12, 26-29. In addition to the SNP resulting in the variant of the CFH gene, other SNPs result in variants of the C2, C3 and CFB gene, most likely resulting in dysfunctional proteins, preventing these proteins from carrying out their regulatory responsibilities. Furthermore, variants in Toll- like receptor 4 (TLR4), major histocompatibility complex class I (HLA) and chemokine receptor
1 (CX3CR1) have more recently been discovered to be associated with AMD susceptibility10, 31-
34. Of afflicted patients, fifty to seventy percent of all AMD cases are associated with variants of the aforementioned genes5, 26-29, 35 (see Table 1.1 for list of genes with SNPs).
The infiltration of the RPE layer by macrophages and lymphocytes associated with neovascular lesions is characterized as an inflammatory response36. Activated RPE cells have been shown to be located nearby to newly synthesized blood vessels within the subretinal space of wet AMD lesions36- 38. It is believed that along with inflammatory and endothelial cells, activation of RPE cells could potentially lead to the secretion of several inflammatory mediators, resulting in detrimental changes in the RPE layer and the retina36. For instance, interleukin- (IL-), a pro-inflammatory cytokine secreted directly by RPE cells39 could account for the inflammation associated with AMD36, 40-42. IL- is a powerful inflammatory cytokine of the innate immune system whose functions include cellular activation, differentiation and proliferation36, 43, 44.
Moreover, in addition to the ability to activate and recruit neutrophils for phagocytosis, IL-
8
has the ability to induce the secretion of interleukin-8 (IL-8), a chemokine that triggers the chemotaxis of leukocytes to the site of injury36, 45.
The ability of RPE cells to directly secrete IL- and IL-8 is well documented39, 46-50. The role of such inflammatory mediators in the pathology of AMD, however, remains elusive. Higgins et al.50 discovered that ingestion of oxidized bovine photoreceptor outer segments (POS) by RPE cells in vitro stimulated the expression of IL-8, which could explain the accumulation of immune cells (such as macrophages) in AMD lesions (CNV membranes and drusen). Along with macrophages, IL-8 itself has been observed to directly release pro-angiogenic factors, which could lead to neovascularisation and ultimately „wet‟ AMD46, 106, 107. Furthermore, IL- stimulation of human RPE cells in vitro causes release of reactive oxygen species (ROS)36 which promotes oxidative damage and is highly associated with AMD pathology51-55. Recently, genetic analyses found that carriers of the IL-8 +781 T allele56, and individuals homozygous for the IL-8
-251 AA genotype34 are at an increased risk for developing AMD. Such recent studies further support the concept that the inflammatory system is undoubtedly involved in the pathogenesis of
AMD through multiple mechanisms (Fig. 1.3).
1.1.6 Amyloid beta
Amyloid beta is a peptide made up of 39 to 42 amino acids that has been extensively researched for its role in several neurodegenerative diseases, namely Alzheimer‟s disease (AD)25, 57-60. fibrils have been found to be one of the main constituents of the amyloid plaques in post-mortem
9
AD brains58-62. The peptide is situated within the intramembrane domain of the amyloid precursor protein (APP). Intramembrane proteolysis of APP, a transmembrane protein consisting of two domains, a large extracellular and a small intracellular domain, liberates the peptide. There are two distinct pathways by which APP can undergo proteolytic cleavage (Fig.
1.4). The first is the non-amyloidogenic pathway mediated by -secretase, a membrane-bound protease, which cleaves APP within the domain to generate a short peptide fragment that is subsequently cleaved further by -secretase to form a small non-pathogenic peptide product. On the other hand, the amyloidogenic pathway generates the pathogenic peptide by the proteolytic cleavage of APP by another membrane-bound protease, -site-APP-cleaving-enzyme
(BACE or -secretase). Cleavage by BACE results in the shedding of APP‟s large ectodomain and a membrane bound C-terminal stub (CTF or C99). This 99 amino-acid C-terminal stub then undergoes a subsequent cleavage by a specific aspartyl protease, γ -secretase. γ -secretase is a complex comprised of presenilin 1 and 2, APH1, PEN2, and nicastrin, which are all necessary for the secretase‟s activity. The γ-secretase cleaves the middle of the stub, generating APP intracellular domain (AICD), and the peptide, which is released into surrounding fluid. The relative activity of - and - secretase proteins is important as they can shift the equilibrium to either the non-amyloidogenic or amyloidogenic pathways. For example, if the activity of one secretase decreases, the activity of the other increases and vice-versa58, 61, 62.
10
1.1.7 Amyloid beta 1-40 vs. Amyloid beta 1-42
The intramembrane proteolysis of APP to generate via BACE and -secretase is to some extent different. -secretase can cleave the membrane associated C-terminal stub generated by
BACE in several locations, leading to the production of various lengths of protein58, 61, 62.
The two most common forms of are the forty (40) and forty-two (42) length residue proteins58, 63. For the most part, 40 is the form that constitutes the majority of the found in healthy individuals, while the 42 form is only found in small amounts. The significance of this fact is that the longer form of is the more pathogenic product of the two. Therefore, the ratio of 42 to 40 circulating the cerebral spinal fluid (CSF) and plasma is of great importance to the pathogenesis of AD and other neurodegenerative diseases. In normal individuals, aging progressively leads to an increase in levels of both forms of the peptide.
However, in AD and other neurodegenerative disease, the levels of 42 decrease, due to the initial aggregation and deposition of this peptide into amyloid plaques 58, 64-66. In transgenic mice that overexpress , 40, which is also thought to be synthesized as a cellular antioxidant67 is subsequently deposited following the preliminary deposition of 4268. Moreover, mutations in
APP itself can lead to an increase in total , and in some cases solely an increase in the longer peptide. Furthermore, in transgenic mice overexpressing 0 only, elevated levels of 40 were able to prevent 42 associated amyloidosis and death105. Accordingly, there are many efforts to identify compounds that can decrease levels of Aβ42 to the less harmful pathogenic form, Aβ4058, 61.
11
1.1.8 structure: oligomers vs. fibrillar
The peptide is a natural product that is found in the CSF and brain of normal, healthy individuals. Its mere production does not lead to a diseased state. Rather, deposition triggered by neuronal injury that leads to protein misfolding and aggregation is thought to cause the pathogenesis of protein folding diseases, such as AD and type-II diabetes69-74. deposited plaques are generated from the original cleavage of soluble monomers from APP. After cleavage, these soluble monomers undergo a conformational change to form pre-fibrillar, -sheet containing structures or oligomers. These oligomers are subsequently converted to form the long amyloid fibrils (6 to 10nm) that make up the characteristic amyloid plaques that are referred to as the hallmark lesions of all amyloid diseases25, 74-76.
It was originally thought the toxicity of the deposits was due to the aggregation of proteins into fibrillar plaques. However, recent studies of several amyloid diseases have led to the idea that the key lethal agents involved in the pathogenesis of such disease are not the soluble amyloid monomers or insoluble amyloid fibrils, but rather the small 3-10nm spherical oligomers, which can damage cell membranes and eventually cause cell death78-82. More importantly, these studies have shown that the presence of amyloid oligomers in disease-affected tissues correlates with the degenerative and clinical symptoms associated with various amyloid diseases better than the amyloid fibrils77-82. Furthermore, substantial evidence for the oligomeric paradigms comes from animal experiments that show that the pathogenesis of various amyloid diseases still occurs in the absence of any amyloid fibrils83-85. Gong et.al. 86 also provided further clinical support to
12
the pathogenic role of amyloid oligomers by showing that the concentrations of these oligomers were markedly elevated in human AD brains.
1.1.9 AMD and other protein misfolding diseases (PMD)
Due to the numerous similarities with other PMD diseases such as Alzheimer‟s disease (AD),
Parkinson disease (PD) and type II diabetes, AMD is believed to follow a similar pathogenic pathway. First, AMD, like other PMD diseases, displays a strong correlation with increasing age. The most important and unique pathological feature that is common to all of these PMD diseases appears to the abnormal protein folding and aggregation that leads to the synthesis and accumulation of insoluble extracellular deposits25, 87. These protein deposits have been observed in several disease-affected tissues, and therefore there is reason to believe that these deposits may be responsible for the irreversible degenerative process that is seen in such disease-affected tissues. For example, in PD and AD brains there are extracellular protein deposits in the cortical area88, while in diabetes type II, protein deposits are found intracellularly in the pancreatic islets of affected patients89.
In AMD extracellular deposits are referred to as drusen. Drusen have been found to be similar in composition to the protein deposits observed in other PMD diseases that contain various lipids and proteins. Among the common proteins present in drusen and amyloid deposits are amyloid
P, apolipoprotein E (APOE), vitronectin, and A4, 23, 24. Although, drusen are found near
13
degenerated photoreceptors and RPE cells, it is not known what triggers their formation or what their role is in photoreceptor and RPE cell degeneration25, 90-92.
1.1.10 Amyloid beta and inflammation:
The complement system has been found to play a role in neurodegenerative diseases such as AD.
In AD, fibrillar has been known to trigger the activation of the classical complement pathway. In the presence of serum amyloid P and C-reactive protein (both activators of the classical pathway), binds to component 1 q (C1q), leading to antibody-dependent binding and activation of complement component 1 (C1) 93-96. Nonetheless, other groups have also determined that can activate the alternative arm of the complement pathway by forming complexes with C3 that have been discovered in the toxic deposits present in AD plaques93, 97-99.
Other in vitro experiments have shown that activation of the complement system by fibrils also leads to the generation of the complement component 5 (C5) cleavage product C5a
(inflammatory cytokine) and the assembly of the C5b-9 membrane attack complex (MAC) 97, 100.
Immunohistochemical analysis of AD brains with amyloid plaques positively stains for several critical components (Factor B, H, I and D) of the alternative pathways, further substantiating its involvement in the diseased process98. Furthermore, Strohmeyer et al. 98 have also shown that mRNA of both Factor B and its cleavage products, Bb and Ba, are all significantly elevated in
AD brains containing deposits. It is likely that both pathways play a role in AD, as several proteins from both pathways (C3, C5, C6, C7, C8, C9, C1q, C4, C5b-9 MAC) are found in plaques in diseased brains93, 99-102.
14
1.2 INTRODUCTION TO PROJECT
1.2.1 Amyloid beta, complement system, and AMD
One of the earliest hallmarks (signs) of AMD is the accumulation of extracellular deposits, or drusen, between the basal lamina of the RPE and BM. Extensive analysis of drusen to determine its composition has led to the discovery that drusen contains many proteins related to inflammation that are also present in amyloid deposits of AD. These are, namely, acute phase reactants, immunomodulators, and activated components and regulators of the complement system (including C5, C5b-9, and C3) 4, 11, 20-24. Along with the discovery that polymorphisms in complement protein genes (CFH, CFB,CFI and C2) increase the risk of developing AMD, these studies provide strong evidence for the hypothesis that inflammation plays a substantial role in the pathogenesis of the disease5, 26-29. The current working hypothesis in the field is that RPE and photoreceptor cell death are mediated by the complement system and other inflammatory events, supplying a chronic inflammatory stimulus that ultimately leads to AMD pathology11, 20-
22.
Recently, Aβ and its full length predecessor, amyloid precursor protein (APP), have both been discovered to be components of drusen and accumulate with age in the RPE cell21, 103.
Furthermore, Johnson et al. 21 showed that RPE cells can profusely supply APP mRNA, suggesting that the RPE is capable of locally synthesizing Furthermore, has been discovered to co-localize with activated complement components within drusen21. Subsequently, these findings have led to the hypothesis that amyloid beta is an activator of the complement
15
system leading to drusen formation and the pathogenic features associated with AMD. Evidence supporting this hypothesis comes from recent in vitro studies. Yoshida et al. 57 discovered that stimulation of human RPE cells with 40 resulted in altered expression of several angiogenic- related genes, including vascular endothelial growth factor (VEGF) and pigment epithelium derived factor (PEDF). These results suggest that accumulation results in RPE activation and the formation of basal deposits, leading to the development of AMD57. Despite the fact that has been found to be located in drusen and other AMD lesion sites, it was not until recently that the confirmation of in drusen was determined. Luibl et al. 25 with the use of an antibody specific to non-fibrillar oligomers (A11), discovered that A40 oliogomers were present in donor eyes containing drusen sites, but absent in donor eyes without drusen. Furthermore, recent studies have shown that A40 stimulation of human RPE cells inhibited the ability of
Complement Factor I (CFI) to cleave C3b into inactive iC3b, resulting in activation of the complement system104. Therefore, these recent discoveries provide increased support to the idea that amyloid beta, specifically amyloid beta oligomers, are directly involved in the underlying pathogenesis of AMD.
1.3 OBJECTIVES
The goal of this study is to determine the effects of amyloid beta stimulation on RPE cells in vitro. The hypothesis is that amyloid beta stimulation on RPE cells in vitro will result in the differential expression of inflammatory genes. It is further hypothesized that the gene expression changes will link amyloid beta, complement and inflammation to the pathogenesis of AMD.
16
1.4 TABLES
Gene Normal Gene Mechanism References
CFH The binding of complement factor H to heparin and C Edwards et al.28 reactive protein inhibits the activation of alternative complement pathway, therefore increasing affinity for Hageman et al.26 complement protein C3b. Haines et al.29
Klein et al.27
CFB & C2 Analogous to CFH; 2 protective & 1 risk haplotypes Gold et al.35
CFI Inactivates active complement component 3b (C3b), Fagerness et al. 108 inhibits activation of alternative complement pathway
CX3CR1 Specific receptor for fractalkine, expressed in neutrophils, Tuo et al.31 monocytes, microglia
TLR4 Part of innate immune system, plays a role in pathogen Zareparsi et al.32 recognition , and mediates proinflammatory cytokine signalling
HLA Immune response regulator, signals to CD4 helper and Goverdhan et al. 33 CD8 cytotoxic T lymphocytes.
IL-8 Chemokine, recruits neutrophils, microglia, monocytes Goverdhan et al. 34
Tsai et al.56
Table 1.1 AMD related polymorphisms. This table comprises a list of genes with known single nucleotide polymorphisms (SNP) that are associated with higher risks of developing AMD. The tyrosine to histidine SNP at residue 402 of the CFH gene is most strongly associated with AMD (refs) (modified from de Jong 5). [CFH- Complement Factor H, CFB- Complement Factor B, C2- Complement component 2, CFI – Complement Factor I, TLR4- Toll-like receptor 4, (HLA)- human leukocyte antigen, CX3CR1- chemokine receptor 1, IL-8- Interleukin-8]
17 1.5 FIGURES
Figure 1.1. Drusen present in the retina. This image was taken from the post-mortem eye of 69-year old female with early AMD. Drusen are observed between the basal lamina of retinal pigment epithelium (RPE) and Bruch‟s membrane (BM). (Image kindly provided by Dr. Valerie White (UBC Pathology and Laboratory Medicine, Vancouver, BC, Canada)).
18
Figure 1.2. Overview of the complement system. The classical, mannose binding (MB)-lectin, and alternative pathways make up the three arms of the complement system. All three pathways eventually converge to become one distinct pathway upon the formation of complement component 3 (C3) convertase. This protease cleaves C4, C3, and C5 to form either peptide mediators of inflammation or C3b. C3b either binds to the surface of pathogens or opsonizes them, allowing for phagocytosis or it can bind to C3 convertase. Activation of C5 convertase then cleaves complement component 5 (C5) to generate C5b, which binds to several other complement proteins (C6, C7, C8, C9) to form the membrane attack complex (C5b-9) and cause cell lysis (Adapted from Immunobiology, Janeway Jr. et al.13)
19
Figure 1.3. Proposed events in the pathogenesis of age-related macular degeneration. A number of factors (Aging, oxidative stress, ultraviolet light) and genetic variants of several genes appear to cause RPE activation, which activates the inflammatory/immune response. This inflammatory/immune response is believed to eventually progress to clinical features related to AMD (modified from Kanda et al. 10)[C3-Complement component 3, CFB – Complement Factor B, CFH- Complement Factor H, IL8 – Interleukin-8] .
20
Figure 1.4. Amyloid Precursor Protein (APP) processing. APP intramembrane proteolytic cleavage to form either short peptide fragments or a c-terminal stub (C99). Cleavage of APP by -secretase within the amyloid beta () domain generates the short peptide fragment that is subsequently cleaved further by -secretase to form a small non-pathogenic peptide product (red boxes). On the other hand, proteolytic cleavage by -site-APP-cleaving-enzyme (BACE or - secretase) results in the production of the membrane bound C-terminal stub (CTF or C99). This 99 amino-acid C-terminal stub subsequently undergoes further cleavage by a specific aspartyl protease, γ –secretase in the middle of the stub, generating APP intracellular domain (AICD), and the peptide (Blue boxes)
21 1.6 REFERENCES
1. Tezel TH, Bora NS, Kaplan HJ. Pathogenesis of age-related macular degeneration. Trends Mol.Med. 2004;10:417-420.
2. Fine SL, Berger JW, Maguire MG, Ho AC. Age-related macular degeneration. N.Engl.J.Med. 2000;342:483-492.
3. Nowak JZ. Age-related macular degeneration (AMD): Pathogenesis and therapy. Pharmacol.Rep. 2006;58:353-363.
4. Crabb JW, Miyagi M, Gu X, et al. Drusen proteome analysis: An approach to the etiology of age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:14682-14687.
5. de Jong PT. Age-related macular degeneration. N.Engl.J.Med. 2006;355:1474-1485.
6. Boyer MM, Poulsen GL, Nork TM. Relative contributions of the neurosensory retina and retinal pigment epithelium to macular hypofluorescence. Arch.Ophthalmol. 2000;118:27-31.
7. Young RW, Bok D. Participation of the retinal pigment epithelium in the rod outer segment renewal process. J.Cell Biol. 1969;42:392-403.
8. Hogan MJ, Alvarado J. Studies on the human macula. IV. aging changes in bruch's membrane. Arch.Ophthalmol. 1967;77:410-420.
9. van der Schaft TL, de Bruijn WC, Mooy CM, Ketelaars DA, de Jong PT. Is basal laminar deposit unique for age-related macular degeneration? Arch.Ophthalmol. 1991;109:420-425.
10. Kanda A, Abecasis G, Swaroop A. Inflammation in the pathogenesis of age-related macular degeneration. Br.J.Ophthalmol. 2008;92:448-450.
11. Hageman GS, Luthert PJ, Victor Chong NH, Johnson LV, Anderson DH, Mullins RF. An integrated hypothesis that considers drusen as biomarkers of immune-mediated processes at the RPE-bruch's membrane interface in aging and age-related macular degeneration. Prog.Retin.Eye Res. 2001;20:705-732.
12. Donoso LA, Kim D, Frost A, Callahan A, Hageman G. The role of inflammation in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2006;51:137-152.
13. Janeway Jr. CA, Travers P, Walport P, Shlomchik MJ. Immunobiology. 5th ed. New York, NY: Garland Publishing; 2001:14-114
22 14. Walport MJ. Complement. first of two parts. N.Engl.J.Med. 2001;344:1058-1066.
15. Walport MJ. Complement. second of two parts. N.Engl.J.Med. 2001;344:1140-1144.
16. Laufer J, Katz Y, Passwell JH. Extrahepatic synthesis of complement proteins in inflammation. Mol.Immunol. 2001;38:221-229.
17. Sivaprasad S, Chong NV. The complement system and age-related macular degeneration. Eye 2006;20:867-872.
18. Kijlstra A, La Heij E, Hendrikse F. Immunological factors in the pathogenesis and treatment of age-related macular degeneration. Ocul.Immunol.Inflamm. 2005;13:3-11.
19. Rodriguez de Cordoba S, Esparza-Gordillo J, Goicoechea de Jorge E, Lopez-Trascasa M, Sanchez-Corral P. The human complement factor H: Functional roles, genetic variations and disease associations. Mol.Immunol. 2004;41:355-367.
20. Johnson LV, Leitner WP, Staples MK, Anderson DH. Complement activation and inflammatory processes in drusen formation and age related macular degeneration. Exp.Eye Res. 2001;73:887-896.
21. Johnson LV, Leitner WP, Rivest AJ, Staples MK, Radeke MJ, Anderson DH. The alzheimer's A beta -peptide is deposited at sites of complement activation in pathologic deposits associated with aging and age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:11830-11835.
22. Anderson DH, Mullins RF, Hageman GS, Johnson LV. A role for local inflammation in the formation of drusen in the aging eye. Am.J.Ophthalmol. 2002;134:411-431.
23. Anderson DH, Talaga KC, Rivest AJ, Barron E, Hageman GS, Johnson LV. Characterization of beta amyloid assemblies in drusen: The deposits associated with aging and age-related macular degeneration. Exp.Eye Res. 2004;78:243-256.
24. Mullins RF, Russell SR, Anderson DH, Hageman GS. Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. FASEB J. 2000;14:835-846.
25. Luibl V, Isas JM, Kayed R, Glabe CG, Langen R, Chen J. Drusen deposits associated with aging and age-related macular degeneration contain nonfibrillar amyloid oligomers. J.Clin.Invest. 2006;116:378-385.
23 26. Hageman GS, Anderson DH, Johnson LV, et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2005;102:7227-7232.
27. Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related macular degeneration. Science 2005;308:385-389.
28. Edwards AO, Ritter R,3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005;308:421-424.
29. Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308:419-421.
30. Montes T, Goicoechea de Jorge E, Ramos R, et al. Genetic deficiency of complement factor H in a patient with age-related macular degeneration and membranoproliferative glomerulonephritis. Mol.Immunol. 2008;45:2897-2904.
31. Tuo J, Smith BC, Bojanowski CM, et al. The involvement of sequence variation and expression of CX3CR1 in the pathogenesis of age-related macular degeneration. FASEB J. 2004;18:1297-1299.
32. Zareparsi S, Buraczynska M, Branham KE, et al. Toll-like receptor 4 variant D299G is associated with susceptibility to age-related macular degeneration. Hum.Mol.Genet. 2005;14:1449-1455.
33. Goverdhan SV, Howell MW, Mullins RF, et al. Association of HLA class I and class II polymorphisms with age-related macular degeneration. Invest.Ophthalmol.Vis.Sci. 2005;46:1726-1734.
34. Goverdhan SV, Ennis S, Hannan SR, et al. Interleukin-8 promoter polymorphism -251A/T is a risk factor for age-related macular degeneration. Br.J.Ophthalmol. 2008;92:537-540.
35. Gold B, Merriam JE, Zernant J, et al. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nat.Genet. 2006;38:458-462.
36. Yang D, Elner SG, Bian ZM, Till GO, Petty HR, Elner VM. Pro-inflammatory cytokines increase reactive oxygen species through mitochondria and NADPH oxidase in cultured RPE cells. Exp.Eye Res. 2007;85:462-472.
24 37. Miller H, Miller B, Ryan SJ. The role of retinal pigment epithelium in the involution of subretinal neovascularization. Invest.Ophthalmol.Vis.Sci. 1986;27:1644-1652.
38. Sakamoto T, Sakamoto H, Murphy TL, et al. Vessel formation by choroidal endothelial cells in vitro is modulated by retinal pigment epithelial cells. Arch.Ophthalmol. 1995;113:512-520.
39. Planck SR, Huang XN, Robertson JE, Rosenbaum JT. Retinal pigment epithelial cells produce interleukin-1 beta and granulocyte-macrophage colony-stimulating factor in response to interleukin-1 alpha. Curr.Eye Res. 1993;12:205-212.
40. Eskan MA, Benakanakere MR, Rose BG, et al. Interleukin-1beta modulates proinflammatory cytokine production in human epithelial cells. Infect.Immun. 2008;76:2080-2089.
41. Eskan MA, Hajishengallis G, Kinane DF. Differential activation of human gingival epithelial cells and monocytes by porphyromonas gingivalis fimbriae. Infect.Immun. 2007;75:892-898.
42. Kinane DF, Shiba H, Stathopoulou PG, et al. Gingival epithelial cells heterozygous for toll-like receptor 4 polymorphisms Asp299Gly and Thr399ile are hypo-responsive to porphyromonas gingivalis. Genes Immun. 2006;7:190-200.
43. Dinarello CA. Biologic basis for interleukin-1 in disease. Blood 1996;87:2095-2147.
44. Yang J, Hooper WC, Phillips DJ, Talkington DF. Interleukin-1beta responses to mycoplasma pneumoniae infection are cell-type specific. Microb.Pathog. 2003;34:17-25.
45. Cohen J. The immunopathogenesis of sepsis. Nature 2002;420:885-891.
46. Yoshida A, Yoshida S, Khalil AK, Ishibashi T, Inomata H. Role of NF-kappaB-mediated interleukin-8 expression in intraocular neovascularization. Invest.Ophthalmol.Vis.Sci. 1998;39:1097-1106.
47. Jaffe GJ, Roberts WL, Wong HL, Yurochko AD, Cianciolo GJ. Monocyte-induced cytokine expression in cultured human retinal pigment epithelial cells. Exp.Eye Res. 1995;60:533-543.
48. Holtkamp GM, Van Rossem M, de Vos AF, Willekens B, Peek R, Kijlstra A. Polarized secretion of IL-6 and IL-8 by human retinal pigment epithelial cells. Clin.Exp.Immunol. 1998;112:34-43.
25 49. Elner VM, Elner SG, Standiford TJ, Lukacs NW, Strieter RM, Kunkel SL. Interleukin-7 (IL-7) induces retinal pigment epithelial cell MCP-1 and IL-8. Exp.Eye Res. 1996;63:297- 303.
50. Higgins GT, Wang JH, Dockery P, Cleary PE, Redmond HP. Induction of angiogenic cytokine expression in cultured RPE by ingestion of oxidized photoreceptor outer segments. Invest.Ophthalmol.Vis.Sci. 2003;44:1775-1782.
51. Rao NA. Role of oxygen free radicals in retinal damage associated with experimental uveitis. Trans.Am.Ophthalmol.Soc. 1990;88:797-850.
52. Winkler BS, Boulton ME, Gottsch JD, Sternberg P. Oxidative damage and age-related macular degeneration. Mol.Vis. 1999;5:32.
53. Beatty S, Koh H, Phil M, Henson D, Boulton M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2000;45:115-134.
54. Cai J, Nelson KC, Wu M, Sternberg P,Jr, Jones DP. Oxidative damage and protection of the RPE. Prog.Retin.Eye Res. 2000;19:205-221.
55. Truscott RJ. Age-related nuclear cataract: A lens transport problem. Ophthalmic Res. 2000;32:185-194.
56. Tsai YY, Lin JM, Wan L, et al. Interleukin gene polymorphisms in age-related macular degeneration. Invest.Ophthalmol.Vis.Sci. 2008;49:693-698.
57. Yoshida T, Ohno-Matsui K, Ichinose S, et al. The potential role of amyloid beta in the pathogenesis of age-related macular degeneration. J.Clin.Invest. 2005;115:2793-2800.
58. Findeis MA. The role of amyloid beta peptide 42 in alzheimer's disease. Pharmacol.Ther. 2007;116:266-286.
59. Lambert MP, Barlow AK, Chromy BA, et al. Diffusible, nonfibrillar ligands derived from Abeta1-42 are potent central nervous system neurotoxins. Proc.Natl.Acad.Sci.U.S.A. 1998;95:6448-6453.
60. Stine WB,Jr, Dahlgren KN, Krafft GA, LaDu MJ. In vitro characterization of conditions for amyloid-beta peptide oligomerization and fibrillogenesis. J.Biol.Chem. 2003;278:11612- 11622.
26 61. Haass C, Selkoe DJ. Soluble protein oligomers in neurodegeneration: Lessons from the alzheimer's amyloid beta-peptide. Nat.Rev.Mol.Cell Biol. 2007;8:101-112.
62. Ding JD, Lin J, Mace BE, Herrmann R, Sullivan P, Bowes Rickman C. Targeting age- related macular degeneration with alzheimer's disease based immunotherapies: Anti- amyloid-beta antibody attenuates pathologies in an age-related macular degeneration mouse model. Vision Res. 2008;48:339-345.
63. Klein AM, Kowall NW, Ferrante RJ. Neurotoxicity and oxidative damage of beta amyloid 1-42 versus beta amyloid 1-40 in the mouse cerebral cortex. Ann.N.Y.Acad.Sci. 1999;893:314-320.
64. Roher AE, Lowenson JD, Clarke S, et al. Beta-amyloid-(1-42) is a major component of cerebrovascular amyloid deposits: Implications for the pathology of alzheimer disease. Proc.Natl.Acad.Sci.U.S.A. 1993;90:10836-10840.
65. Gravina SA, Ho L, Eckman CB, et al. Amyloid beta protein (A beta) in alzheimer's disease brain. biochemical and immunocytochemical analysis with antibodies specific for forms ending at A beta 40 or A beta 42(43). J.Biol.Chem. 1995;270:7013-7016.
66. Iwatsubo T, Saido TC, Mann DM, Lee VM, Trojanowski JQ. Full-length amyloid-beta (1- 42(43)) and amino-terminally modified and truncated amyloid-beta 42(43) deposit in diffuse plaques. Am.J.Pathol. 1996;149:1823-1830.
67. Teng FY, Tang BL. Widespread gamma-secretase activity in the cell, but do we need it at the mitochondria? Biochem.Biophys.Res.Commun. 2005;328:1-5.
68. Terai K, Iwai A, Kawabata S, et al. Beta-amyloid deposits in transgenic mice expressing human beta-amyloid precursor protein have the same characteristics as those in alzheimer's disease. Neuroscience 2001;104:299-310.
69. Haass C, Schlossmacher MG, Hung AY, et al. Amyloid beta-peptide is produced by cultured cells during normal metabolism. Nature 1992;359:322-325.
70. Seubert P, Vigo-Pelfrey C, Esch F, et al. Isolation and quantification of soluble alzheimer's beta-peptide from biological fluids. Nature 1992;359:325-327.
71. Vigo-Pelfrey C, Lee D, Keim P, Lieberburg I, Schenk DB. Characterization of beta- amyloid peptide from human cerebrospinal fluid. J.Neurochem. 1993;61:1965-1968.
27 72. Ida N, Hartmann T, Pantel J, et al. Analysis of heterogeneous A4 peptides in human cerebrospinal fluid and blood by a newly developed sensitive western blot assay. J.Biol.Chem. 1996;271:22908-22914.
73. Walsh DM, Tseng BP, Rydel RE, Podlisny MB, Selkoe DJ. The oligomerization of amyloid beta-protein begins intracellularly in cells derived from human brain. Biochemistry 2000;39:10831-10839.
74. Walsh DM, Selkoe DJ. A beta oligomers - a decade of discovery. J.Neurochem. 2007;101:1172-1184.
75. Reixach N, Deechongkit S, Jiang X, Kelly JW, Buxbaum JN. Tissue damage in the amyloidoses: Transthyretin monomers and nonnative oligomers are the major cytotoxic species in tissue culture. Proc.Natl.Acad.Sci.U.S.A. 2004;101:2817-2822.
76. Kayed R, Sokolov Y, Edmonds B, et al. Permeabilization of lipid bilayers is a common conformation-dependent activity of soluble amyloid oligomers in protein misfolding diseases. J.Biol.Chem. 2004;279:46363-46366.
77. Hardy J, Selkoe DJ. The amyloid hypothesis of alzheimer's disease: Progress and problems on the road to therapeutics. Science 2002;297:353-356.
78. Kayed R, Head E, Thompson JL, et al. Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science 2003;300:486-489.
79. Walsh DM, Klyubin I, Fadeeva JV, et al. Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature 2002;416:535- 539.
80. Klein WL, Krafft GA, Finch CE. Targeting small abeta oligomers: The solution to an alzheimer's disease conundrum? Trends Neurosci. 2001;24:219-224.
81. Kirkitadze MD, Bitan G, Teplow DB. Paradigm shifts in alzheimer's disease and other neurodegenerative disorders: The emerging role of oligomeric assemblies. J.Neurosci.Res. 2002;69:567-577.
82. Caughey B, Lansbury PT. Protofibrils, pores, fibrils, and neurodegeneration: Separating the responsible protein aggregates from the innocent bystanders. Annu.Rev.Neurosci. 2003;26:267-298.
28 83. Mucke L, Masliah E, Yu GQ, et al. High-level neuronal expression of abeta 1-42 in wild- type human amyloid protein precursor transgenic mice: Synaptotoxicity without plaque formation. J.Neurosci. 2000;20:4050-4058.
84. Hsia AY, Masliah E, McConlogue L, et al. Plaque-independent disruption of neural circuits in alzheimer's disease mouse models. Proc.Natl.Acad.Sci.U.S.A. 1999;96:3228- 3233.
85. Moechars D, Dewachter I, Lorent K, et al. Early phenotypic changes in transgenic mice that overexpress different mutants of amyloid precursor protein in brain. J.Biol.Chem. 1999;274:6483-6492.
86. Gong Y, Chang L, Viola KL, et al. Alzheimer's disease-affected brain: Presence of oligomeric A beta ligands (ADDLs) suggests a molecular basis for reversible memory loss. Proc.Natl.Acad.Sci.U.S.A. 2003;100:10417-10422.
87. Soto C. Unfolding the role of protein misfolding in neurodegenerative diseases. Nat.Rev.Neurosci. 2003;4:49-60.
88. Anguiano M, Nowak RJ, Lansbury PT,Jr. Protofibrillar islet amyloid polypeptide permeabilizes synthetic vesicles by a pore-like mechanism that may be relevant to type II diabetes. Biochemistry 2002;41:11338-11343.
89. Ancolio K, Alves da Costa C, Ueda K, Checler F. Alpha-synuclein and the parkinson's disease-related mutant Ala53Thr-alpha-synuclein do not undergo proteasomal degradation in HEK293 and neuronal cells. Neurosci.Lett. 2000;285:79-82.
90. Klein R, Peto T, Bird A, Vannewkirk MR. The epidemiology of age-related macular degeneration. Am.J.Ophthalmol. 2004;137:486-495.
91. Johnson PT, Lewis GP, Talaga KC, et al. Drusen-associated degeneration in the retina. Invest.Ophthalmol.Vis.Sci. 2003;44:4481-4488.
92. Abdelsalam A, Del Priore L, Zarbin MA. Drusen in age-related macular degeneration: Pathogenesis, natural course, and laser photocoagulation-induced regression. Surv.Ophthalmol. 1999;44:1-29.
93. Akiyama H, Barger S, Barnum S, et al. Inflammation and alzheimer's disease. Neurobiol.Aging 2000;21:383-421.
29 94. Gewurz H, Ying SC, Jiang H, Lint TF. Nonimmune activation of the classical complement pathway. Behring Inst.Mitt. 1993;(93):138-147.
95. Webster S, Glabe C, Rogers J. Multivalent binding of complement protein C1Q to the amyloid beta-peptide (A beta) promotes the nucleation phase of A beta aggregation. Biochem.Biophys.Res.Commun. 1995;217:869-875.
96. Webster S, O'Barr S, Rogers J. Enhanced aggregation and beta structure of amyloid beta peptide after coincubation with C1q. J.Neurosci.Res. 1994;39:448-456.
97. Bradt BM, Kolb WP, Cooper NR. Complement-dependent proinflammatory properties of the alzheimer's disease beta-peptide. J.Exp.Med. 1998;188:431-438.
98. Strohmeyer R, Shen Y, Rogers J. Detection of complement alternative pathway mRNA and proteins in the alzheimer's disease brain. Brain Res.Mol.Brain Res. 2000;81:7-18.
99. Webster S, Lue LF, Brachova L, et al. Molecular and cellular characterization of the membrane attack complex, C5b-9, in alzheimer's disease. Neurobiol.Aging 1997;18:415- 421.
100. McGeer PL, Akiyama H, Itagaki S, McGeer EG. Activation of the classical complement pathway in brain tissue of alzheimer patients. Neurosci.Lett. 1989;107:341-346.
101. Rogers J, Cooper NR, Webster S, et al. Complement activation by beta-amyloid in alzheimer disease. Proc.Natl.Acad.Sci.U.S.A. 1992;89:10016-10020.
102. Shen Y, Li R, McGeer EG, McGeer PL. Neuronal expression of mRNAs for complement proteins of the classical pathway in alzheimer brain. Brain Res. 1997;769:391-395.
103. Dentchev T, Milam AH, Lee VM, Trojanowski JQ, Dunaief JL. Amyloid-beta is found in drusen from some age-related macular degeneration retinas, but not in drusen from normal retinas. Mol.Vis. 2003;9:184-190.
104. Wang J, Ohno-Matsui K, Yoshida T, et al. Altered function of factor I caused by amyloid beta: Implication for pathogenesis of age-related macular degeneration from drusen. J.Immunol. 2008;181:712-720.
105. Kim J, Onstead L, Randle S, et al. Abeta40 inhibits amyloid deposition in vivo. J.Neurosci. 2007;27:627-633.
30 106. Killingsworth MC, Sarks JP, Sarks SH. Macrophages related to bruch's membrane in age- related macular degeneration. Eye 1990;4 ( Pt 4):613-621.
107. Elner SG, Elner VM, Jaffe GJ, Stuart A, Kunkel SL, Strieter RM. Cytokines in proliferative diabetic retinopathy and proliferative vitreoretinopathy. Curr.Eye Res. 1995;14:1045-1053.
108. Fagerness JA, Maller JB, Neale BM, Reynolds RC, Daly MJ, Seddon JM. Variation near complement factor I is associated with risk of advanced AMD. Eur.J.Hum.Genet. 2008.
31 CHAPTER 21
DIFFENRENTIAL CHANGES IN GENE EXPRESSION OF INFLAMMATORY GENES
IN CULTURED HUMAN RETINAL PIGMENT EPITHELIAL CELLS AFTER BETA-
AMYLOID STIMULATION
______
1A version of this chapter will be submitted for publication. Kurji K, Cui J, Lin T, Harriman D, Prasad SS, Kojic L and Matsubara J. Differential changes in gene expression of inflammatory genes in cultured human retinal pigment epithelial cells after beta-amyloid stimulation.
32 2.1 INTRODUCTION
Age related macular degeneration (AMD) is the most common cause of irreversible vision loss in the elderly. The disease is characterized by extracellular deposits known as drusen, which are found between the basal lamina of the retinal pigment epithelium (RPE) and the inner layer of
Bruch‟s membrane (BM). Although, the presence of drusen is correlated with the development of AMD, the mechanisms underlying the pathogenesis of the disease remain elusive1-3.
Inflammation has been implicated in the pathogenesis of the disease4-7. Extensive biochemical analysis of drusen has revealed the presence of several proteins linked to inflammation and its associated consequences. Such proteins include, immunoglobulin, acute-phase molecules in response to inflammation (vitronectin, amyloid P, fibrinogen), complement related factors (C5,
C5b-9 terminal complexes), and complement regulatory molecules (clusterin (APOJ), complement receptor 1 (CR1)) 4, 8-12. Furthermore, several of these factors have been shown to be synthesized locally by the RPE, choroid and/or retina4, 8, 9, 11. Based on these findings, one current hypothesis proposes that the accumulation of RPE debris within the RPE layer and BM complex leads to the upregulation of local proinflammatory molecules. Consequently, these proinflammatory molecules activate the complement system, and contribute to the initiation of drusen formation 4, 5, 7, 9, 13.
RPE cells are regarded as a chief source of proinflammatory molecules in the retina14-16, 18, 19.
The secretion of such proinflammatory mediators may be responsible for the inflammatory response seen in AMD19. Interleukin-1 (IL-1) is a potent proinflammatory cytokine, which stimulates RPE cells to secrete other inflammatory mediators, including, IL-6, macrophage-
33 colony stimulating factor (MCSF), and IL-814-18. Recently, IL-1has been shown to induce human RPE cells to produce reactive oxygen species (ROS) both intracellularly and extracellularly19, inflammatory by-products which are also thought to play a role in AMD pathogenesis20-24. IL-8 is secreted by degenerating RPE cells and associated with drusen in
AMD12, 25. This chemokine functions as a chemoattractant for neutrophils and macrophages, inducing oxidative burst activity, degranulation, and phagocytosis26. Genetic analyses have shown that individuals with different single nucleotide polymorphisms (SNPs) in the IL-8 gene are at an increased risk of developing AMD27-28. Thus, it is apparent that proinflammatory mediators are likely to be strongly associated with the pathogenesis of AMD.
Although these studies suggest a correlative link between inflammation and AMD, it still remains unknown exactly what activates this inflammation. Amyloid beta (A), the toxic peptide that is linked to amyloid plaques in Alzheimer‟s disease29-31 has also been found to be a constituent of drusen5, 31, 32. Stimulation of human RPE cells with A in vitro modulates the expression of angiogenic-related factors, which could promote angiogenesis33. Genetically modified mice with increased A deposition display many of the traits consistent with human
AMD, such as the accumulation of sub-RPE deposits and RPE degeneration33. In addition, A oligomers have been found within drusen of AMD donor eyes3. Furthermore, stimulation of human RPE cells with A has shown that A inhibits the function of complement factor I (CFI) and thus activates the complement system13. These studies suggest that A may play a substantial role in the pathogenesis of AMD. The goal of this study is to investigate the effects of
A on RPE cells. We hypothesize that the stimulation of human RPE cells in culture with A
34 oligomers would result in changes in gene expression, promoting chronic retinal inflammation in the retina.
2.2 METHODS
2.2.1 Amyloid beta 1-40 (A40) oligomerization
A40 peptide was purchased from American Peptide (Sunnyvale, CA). The protocol used to synthesize Aoligomers was obtained from Invitrogen (Burlingtion, ON, Canada). A40 peptide was salt free and lyophilized from 0.1% TFA. Lyophilized A peptide was dissolved in
200 l hexafluoroisopropanol (HFIP) and sonicated for 30 seconds in a water bath. The HFIP solution was then transferred to a new 1.4 ml Eppendorf tube containing700 l of water with a
22-gauge syringe. A teflon-coated micro magnetic stirring bar was added, and the tube was closed with a perforated Eppendorf cap to allow HFIP to vent after evaporation. The tube was placed in a holder inside a fume hood on top of a stirring plate, and stirred at 300 RPM for 24 to
48 hours. Aliquots were taken at 48 hrs and analyzed for confirmation of A oligomers using atomic force microscopy (AFM), and dot blot assay.
2.2.2 Atomic force microscopy (AFM)
AFM was carried out as previously described 34, 35. Briefly, 40 samples were prepared for
AFM examination by placing 10 l of solution onto freshly cleaved mica (Ted Pella, Inc.,
Redding, CA). The sample was allowed to adhere to the mica surface for 10 minutes at room
35 temperature and subsequently washed with double-distilled water (ddH20) to eliminate contamination due to buffer and salts, and to help reduce background contrast. AFM images were captured using the "Bioscope" atomic force microscope with Nanoscope IIIa Controller
(Digital Instruments, Santa Barbara, CA, USA) using a "G" type scanner. Contact mode was employed for all images using DNP silicon nitride cantilevers (Digital Instruments). At least four regions of the mica surface were examined to ensure that similar structures existed throughout the sample.
2.2.3 Dot blot assay
A sample of A solution (3 l) was spotted and allowed to dry onto a nitrocellulose membrane.
The membrane was then blocked with 10% non-fat dry milk in Tris-buffered saline (TBS) containing 0.01% Tween 20 (TBST) solution overnight at 4oC. The membrane was then washed
3 times in full strength TBST for 5 minutes and incubated for 1 hour at room temperature with the anti-oligomer antibody (Invitrogen Corporation, Carlsbad, CA) (diluted 1:100 in 5% non-fat dry milk in TBST). The membrane was then washed 3 times in TBST for 5 minutes and incubated for 1 hour at room temperature with goat-anti rabbit IgG horseradish peroxidase conjugate (Promega) (diluted 1:2000 in 5% non-fat dry milk in TBST). The blots were finally washed 3 times in TBST for 5 minutes and developed by adding tetramethlybenzidine (TMB)
(Promega) solution to cover the membrane. The membrane was agitated for 20-30 minutes, or until the spot developed.
36 2.2.4 Cell culture of human RPE cells
The primary human RPE cells were obtained from donor tissues as described previously36, 37.
Human fetal donor eyes were used for research purpose under the guidelines and regulation of the IRB board at the University of British Columbia. The eyes were cut circumferentially, the vitreous removed and the retina gently detached from the RPE cell layer. The choroid/RPE layer was placed in 2% Dispase (Gibco, Madison, WI) in Hanks‟ balanced salt solution (HBSS)
(Invitrogen) for 25 min at 37 °C. The RPE layer was then removed in fragments and passed through 70-μm and 40-μm nylon mesh filters (Falcon Plastics, Oxnard, CA). Only the fragments that were left behind were retained. After centrifugation at 1500 rpm for 5 min, the fragments were gently dissociated and seeded on to laminin-coated 6-well plates (Falcon Plastics, Oxnard,
CA). RPE cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, GibcoBRL,
Grand Island, NY) containing 10% fetal bovine serum (FBS, Gibco), 100 μg/ml penicillin
(Sigma, St. Louis, MO), 100 μg/ml streptomycin (Sigma) and 2 mM l-glutamine (Invitrogen) at
37 °C in a humidified atmosphere of 95% air and 5% CO2. At confluence, the cells were detached using 0.05% trypsin/0.02% EDTA (Invitrogen), collected by centrifugation and expanded. In the following experiments, passage 5 cells were used, and RPE cells of the same passage and from the same donor were used for an individual experiment.
2.2.5 Cell viability assay
Human RPE cells (20 103 cells /well) were seeded in 200 l medium on a 96-well culture plate
(VWR, Canada) and incubated with DMEM containing 10% FCS, for 24 hours. The medium was then discarded and the cells were washed three times with phosphate buffered saline (PBS)
37 (Invitrogen). Next, human RPE cells were incubated in serum-free DMEM containing various concentrations of A (0.01, 0.3, 1.0, 5.0, 10.0 M) to a final volume of 200 l. Cell survival was determined 24 hours later using the MTT (3-[4, 5-dimethyl-thiazol-2-yl]-2, 5-diphenyl- tetrazolium bromide). After 4 hours of MTT incubation the supernatants were removed and 150
l of DMSO was added for a period of 20 minutes. Next, the plate was shaken for 10 minutes protected from light and was read in a micro-plate reader at 550nm. Two independent experiments in quadruplicate were performed in this study. The data were analyzed using mean
+ standard deviation (SD).
2.2.6 Amyloid beta stimulation
Human RPE cells (0.3 x 106/well) were seeded in 2 mL of culture medium in a 6-well plate for 4 days. Prior to stimulation, the cells were washed 3 times with PBS. RPE cells were then treated with A40 oligomers at a concentration of 0.3 M for 24 hours in 1 mL of serum-free DMEM.
Untreated RPE cells containing only serum-free DMEM were used as controls.
2.2.7 Extraction of total cellular RNA
TRIZOL reagent (Invitrogen) was utilized to isolate the total cellular RNA from cultured human
RPE cells according to manufacturer‟s recommendations. RNA samples were then subsequently treated with TURBO DNA-free (Ambion, Streetsville, ON, Canada) to remove any DNA contamination. Quantification of RNA was performed using the NanoDrop ND-1000 spectrophotometer (NanoDrop Products, Thermo Fisher Scientific, Wilmington, DE). Total
38 RNA integrity was confirmed using the Agilent 2100 bioanalyzer (Agilent Technologies) according to manufacturer‟s established protocols.
2.2.8 Microarray and data analysis
One µg of total RNA from all samples and from human universal reference RNA (Stratagen, La
Jolla, CA) was amplified and labelled with fluorescent dyes (Cy3 and Cy5) using the Low RNA
Input Linear Amplification Labelling kit (Agilent Technologies, Palo Alto, CA) following the manufacturer's protocol. The amount and specific activity of the resulting fluorescently labelled cRNA was assessed using a Nanodrop ND-100 spectrophotometer. Equal amounts of Cy3- labeled sample and Cy5-labeled universal human reference cRNA were co-hybridized to the
Agilent Whole Human Genome Oligo Microarray (Agilent Technologies, Inc., Palo Alto, CA), which comprises over 41,000 human genes and transcripts, for 18 hours prior to washing and scanning. Data was extracted from the resulting images using Agilent's Feature Extraction
Software (Agilent Technologies, Inc., Palo Alto, CA).
Red (Cy5 labelled cRNA) and green (Cy3 labelled cRNA) processed signals were entered into
GeneSpring 7.3.1 (Agilent Technologies, Palo Alto, CA) and normalized via Agilent's recommendations for 2-colour experiments as follows: per spot, divide by control channel; per chip, normalize to 50th percentile; per gene, normalize to median. The results represent the mean values from three independent experiments. Early-passage (P5) human RPE cells were harvested to generate the mRNA samples. The cDNA array image portraying the hybridization signals from one of the three independent experiments is shown in Fig. 2.3A. An example comparing
39 the signal intensities of control and treated samples are represented in a scatter plot (Fig.
2.3B). A list of differentially expressed genes was generated by applying a t-test with a p-value of 0.05 between the Atreated group and the untreated group, and by applying a fold change filter with a cut-off of + 1.5. Linearization of the ratio data by employing Log2 transformation was used to statistically compare ratios. Global functional analysis was carried out on the data set using Ingenuity Pathway Analysis (Ingenuity® Systems, www.ingenuity.com).
2.2.9 Real-time PCR (RT-PCR) and data analysis
RT-PCR and data analysis were carried out as previously described93. The fold changes of 23 differentially expressed genes of interest from microarray analysis were examined using quantitative RT-PCR. Reverse transcription reactions were carried out for each RNA sample using Superscript III reverse transcription reagents (Invitrogen Canada, Burlington, ON,
Canada). Each reaction tube contained 1 µg of total RNA in a volume of 20 µl containing 0.5 mM of dNTP, 2.5 M of oligo (dT)20 primer, 1X RT buffer, 5 mM MgCl2, 10 mM of DTT, 40 units of RNaseOUT, and 200 units of Superscript III Reverse Transcriptase.
Real-time PCR was performed with the ABI prism 7300 Sequence Detection System (Applied
Biosystems, Foster City, CA). SYBR Green PCR Master Mix (Applied Biosystems, Foster City,
CA) was used on cDNA samples in 96-well optical plates. Oligonucleotide primers for genes of interest and for housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were designed for real-time PCR using the Primer Express 2.0 software (Applied Biosystems, Foster
40 City, CA). All primers were purchased from Proligo (Proligo LL, Boulder, CO). For each 25 µl
SYBR Green PCR reaction, 2 µl cDNA, 0.75 µl of both 5‟- and 3‟- primers (10µM), 12.5 µl
SYBR green PCR Master Mix and 9.75 µl water were mixed together. The parameters were
95ºC for 10 min, 1 cycle, then 60ºC for 1 min, 95º for 15 sec for 40 cycles. To confirm the amplification of a specific cDNA, the dissociation temperature was examined and compared to the calculated melting temperature (Tm) for each amplified product.
Relative quantification of gene expression was performed using the fold change method as described previously92 and as recommended by the manufacturer of the ABI prism 7300
Sequence Detection System. Briefly, the normalized values for all amplification runs were calculated by subtracting threshold cycle (Ct) values of the target genes by those of GAPDH, as the endogenous control. The standard curve for each gene was constructed from the four serially diluted samples in duplicate, starting with a 1:20 dilution of cDNA and 1:20 diluted to 1:40,
1:80, and 1:160. The relative gene expression was represented by the difference between the normalized values of the experimental samples to that of corresponding sham-controls (ΔΔCt).
2- ΔΔCt for each product was used to calculate fold changes.
2.2.10 Gene set enrichment analysis (GSEA)
To test for sets of related genes that might be systematically altered in A treated human RPE cells, we performed analysis on sets of genes connected together on a particular functional pathway. To achieve this goal, Gene Set Enrichment Analysis (GSEA), a computational analysis was employed38. This analysis considers that even a modest change in the activity of several
41 genes could be more relevant in a molecular network than a strong change in expression of a single gene. In our study the extent to which a set of genes was enriched after the Atreatment of human RPE cells was analyzed. GSEA software implements a particular algorithm to determine if a ranked list of genes from microarray data set (based on their correlation to the control phenotype) contains a priori established gene set enriched with highly ranked genes. The predetermined gene sets have been derived from an extensive list of genes that represent a specific pathway, have common upstream cis-regulatory elements, or are localized on the same chromosomal location and that has been confirmed based on the literature. A total of 1,892 curated gene sets containing genes whose products are involved in specific metabolic and signalling pathways were obtained from pathway databases or from peer-reviewed published material. The gene sets were screened against the GSEA-ranked microarray data sets in order to calculate enrichment score (ES) for each gene set. An enrichment score reflects the degree to which a gene set is overrepresented at the extreme top or bottom of the ranked microarray data set list of genes. The curated gene sets were screened against the microarray data set and enrichment plots were generated for each gene set. An enrichment plot displays a running enrichment score as a function of the rank-ordered probes in the microarray data set. To adjust for multiple hypothesis testing, the ES for each gene was normalized to account for the size of the set, yielding a normalized enrichment score (NES). The proportion of false positives was controlled by calculating the false discovery rate (FDR) corresponding to each NES. The FDR is the estimated probability that a gene set with a given NES represents a false positive result.
42 2.2.11Elisa
Levels of IL-1, Il-8 and Tumor Necrosis Factor (TNF)-related apoptosis-inducing ligand
(TRAIL) in the supernatant samples were measured using SearchLight® proteome arrays
(Thermo Fisher Scientific, Woburn, MA). Samples were incubated for 1 hour on the array plates that were pre-spotted with capture antibodies specific for each protein biomarker. Plates were emptied and washed three times before the addition of a cocktail of biotinylated detection antibodies to each well, and incubated for 30 minutes. Incubation plates were then washed three times and incubated again for 30 minutes with streptavidin-horseradish peroxidase. All incubations were done at room temperature with shaking at 200 rpm. Plates were again washed before the addition of SuperSignal® Femto Chemiluminescent substrate. The plates were immediately imaged using the SearchLight imaging system, and data was analyzed using Array
Analyst software.
2.3 RESULTS
2.3.1 Characterization of amyloid beta oligomers
After incubation for 48 hours in the fume hood, A oligomers were examined with the use of
AFM and immunoDot blot assay. AFM analysis showed that these preparations were comprised predominately of small globular structures with a distinct lack of fibrils (Fig. 2.1A). These results were consistent with previous studies35, 39-41. ImmunoDot blot examination with the anti- oligomeric specific antibody (A11) further confirmed the presence of oligomeric structures as it
43 reacted positively with our Asamples (Fig. 2.1B). Furthermore, the A11 antibody did not react against a fibrillar sample of A, confirming the specificity of the antibody (Fig. 2.1B).
2.3.2 Cell viability of human RPE cells after stimulation with A
We examined the toxicity of Aoligomers on human RPE cells in vitro in order to determine a working concentration for A stimulation studies. A MTT reduction assay was employed to determine toxicity of A oligomers. We found that A40 oligomers were toxic to human primary RPE cells in culture at many dosages. We discovered, however, that Aoligomersat a concentration of 0.3 M displayed a time-dependent effect on cultured human RPE cells with
50% cell survival at 24 hours (Fig. 2.2.A). Dose response curve at the 24 hr time point demonstrated that toxicity of Alevelled off at dosages greater than 1.0 M (Fig. 2.2B)
2.3.3 Gene expression analysis of Atreated human RPE cells
Analysis of the gene expression response of the human RPE cells following A treatment using
Agilent whole genome Oligo array identified 99 upregulated genes and 34 downregulated genes that reached criteria as shown in Table 2.1 and Table 2.2 respectively. The results also show that the majority of the differentially expressed genes were inflammatory genes. In addition, apoptotic, angiogenic, extracellular matrix, transcription factors, growth factors, cell signalling, transmembrane, and cell cycle protein genes were also affected. Our results indicated that IL-1 exhibited the greatest fold change at 4.80 ± 0.08 (p-value <0.05).
44 2.3.4 Confirmation of differentially expressed genes
Real-time RT-PCR (RT-PCR) was performed to validate the identification of differentially expressed genes by microarray. In total, 23 genes of interest were selected that were differentially expressed following A treatment in the human RPE cells. As such, 23 RT-PCR specific primers were synthesized (Table 2.3). The amplified product for GAPDH gene was used as a normalizer and endogenous control. The RT-PCR validations of 17 of the 23 selected genes
(6 genes were not successfully validated by RT-PCR) are displayed in Fig. 2.4. The RT-PCR results were found to be similar to the microarray data, as their directions of differential expression were consistent. However, the levels of expression for some genes, as determined in the real-time RT-PCR differed from those of the microarray. For instance, the differential expression of IL-8 was 2.38 (p-value < 0.05) with microarray and 3.4 ± 0.44 with RT-PCR.
2.3.5 GSEA pathway analysis
Using the mRNA expression profiles of human RPE cells treated with A, we sought to determine functional gene sets correlated with our data. A heat map was generated from expression profiles displaying the most significantly expressed upregulated and downregulated genes (Fig. 2.5). Heat maps are grid-like illustrations that use the color of the grid elements to represent of the level in gene expression between different experimental groups42. In our heat map, the induced expression is indicated with intensities of red, and the reduced expression is indicated with intensities of blue. GSEA‟s Molecular Signatures Database contains 1,892 curated gene sets with genes involved in specific metabolic and signalling pathways, obtained from public pathway databases and peer-reviewed published material. GSEA analysis identified 50
45 gene sets significantly enriched with the genes induced after A treatment (FDR < 25%). Many of these gene sets are highly enriched with genes correlated with inflammation. Table 2.4 lists some of the top gene sets associated with inflammation, such as IFNA_UV-
CMV_COMMON_HCMV_6HRS_UP, IFNALPHA_NL_UP, and NTHIPATHWAY.
Complementary analysis was unable to identify any pathways significantly enriched with A downregulated genes.
In our experiment, A treatment induced strong activation of genes associated with the NF- signalling pathway involved in inflammatory processes (NES=2.04). Leading-edge analysis within GSEA was able to uncover a subset of genes within this gene set that was responsible for the total enrichment score. Examination of the leading-edge subset (members of a gene set that contribute the most significantly to the calculated enrichment score (ES)80) for the NF-B pathway shows that both IL- and IL-8 are found within the leading edge of this gene set
(Table 2.5).
2.3.6 Cytokine and biomarker levels in cell supernatants
Analysis of RPE cell culture supernatants was performed for the purpose of validating the differential expression profiles obtained from the microarray study. Of the three proteins (IL-8,
IL-1, TRAIL) tested, only IL-8 was detected in significant amounts in the supernatants of our samples. After stimulation with A for 24 hours, RPE cells secreted IL-8 at an increased level
46 compared to untreated RPE cells (Fig. 2.6). There were no detected levels of IL-1 or TRAIL in any of our A treated and control samples.
2.4 DISCUSSION
This study investigated genes differentially expressed in response to treatment with A.
Inflammation has been strongly implicated in the pathogenesis of AMD, but initiation of the associated inflammatory processes in the AMD is not well understood4-7. A is one candidate peptide that is implicated in the pathogenesis of AMD, as it has been identified in drusen5, 31, 32 and is known to activate the classic and alternative complement pathways in neuronal systems 43-
46. In this study, we found that the treatment of human RPE cells with A oligomers for 24 hours resulted in the upregulation of a number of inflammatory genes, including IL-1 and IL-8.
Furthermore, our ELISA data confirmed the presence of IL-8 in the RPE cell supernatants after treatment with . RPE cells have been shown to secrete proinflammatory cytokines such as IL-
, 47-50. IL- is known to regulate IL-8 expression in many cell types including RPE cells14, 19,
51, 52. Recently, IL- has also been shown to induce production of ROS in the RPE cells19. It is believed that ROS expression may promote secretion of IL-8 from RPE cells14, 53. Due to its chemotaxic abilities, IL-8 release may account for the observed accumulation of immune cells in regions of drusen formation14, 19, 25. Furthermore, IL-8 recruitment of macrophages and neutrophils (inflammatory molecules that possess proteinases to break down barriers and release angiogenic promoters) could subsequently trigger neovascularization and the wet form of
AMD25, 54, 55.
47 The other interleukin, IL- is known to stimulate interferon gamma (IFN-), a cytokine involved in the activation of macrophages56. IFN- induces the upregulation of interferon alpha- inducible protein 27 (IFI27) in several types of cell lines57. In our studies, IFI27 was upregulated following treatment and suggests that pathways associated with IFN may be activated in response to IL-1 and might be involved in the pathogenesis of AMD. Furthermore, Wu et al.58 showed that IFN-, along with oxidative stress, downregulated CFH, which could lead to increased complement activation, and subsequently AMD. Although, the mRNAs of both IL-1 and IL-8 were significantly expressed, ELISA only detected IL-8 and did not detect IL-in the supernatant. This may be due to the fact that the inactive IL-1 precursor protein has been shown to possess a short half life42.
In this study, we also observed increased gene expression of complement factor I (CFI), which is a known inhibitor of the complement system13, 59, 60. CFI inhibits complement activation by inactivating complement component 3b (C3b) and the dysregulation of CFI promotes uncontrolled complement activation 13, 59, 60. Recently, Fagerness et al.61 identified a variant in the CFI gene that is associated with an increased risk of developing AMD. Furthermore, Wang et al.13 discovered that A stimulation of human RPE cells resulted in the inability of CFI to cleave active C3b into its inactive form (iC3b). Although the mechanism remains unknown, A is thought to bind to CFI and consequently inhibits its regulatory function, causing unregulated complement activation13. Unregulated complement activation would suggest that in response to
ARPE cells are dying via complement mediated cell death11, 13. Further work is needed to examine these pathways for their potential role in mediated toxicity of human RPE cells.
48 Interestingly, Wang et al.13 did not report changes in CFI gene expression after A stimulation, while our results clearly demonstrated an upregulation in CFI. The differences between our results and those of Wang et al.13 may be due to differences in the species (oligomeric vs. fibrillar) of A used for stimulation. We stimulated RPE cells with the oligomeric form of A, rather than the fibrillar form used by Wang et al. 13. It is possible that the more toxic oligomeric form may cause stronger complement activation than the fibrillar form, and in fact other studies suggest that the fibrillar form is less toxic to many cell types, including neurons3. Future studies are required to determine how A promotes CFI overexpression and the interactions between A and CFI that may affect RPE function.
In addition to CFI, there is considerable evidence in the literature supporting a role of CFH and its known polymorphism in AMD68, 62-65. In both our study as well as Wang et al.13 however, no changes in the expression of CFH after stimulation were observed in human RPE cells
treated RPE cells were also observed to express several angiogenic-related genes. We observed an increased gene expression of somatostatin receptor 2 (SSTR2) and fibronectin (FN) in RPE cells following treatment with . Somatostatin is a neuropeptide with anti-proliferative effects in a variety of normal and cancerous cells66-70. Along with its receptor SSTR2, somatostatin has been identified in the RPE cells71, and has been demonstrated to inhibit VEGF mRNA expression. FN is an extracellular matrix (ECM) associated gene that may also play a role in angiogenesis. It is possible that altered levels of ECM genes, including fibronectin, can lead to abnormal RPE-choriocapillaris behaviour 11. Earlier, Yoshida et al.33 showed that
49 stimulation of human RPE cells with resulted in the altered expression of angiogenic genes, specifically vascular endothelial growth factor (VEGF). We did not observe changes in the levels of VEGF expression per say in our study. Differences may again be due to species, time course and dosages of used in each study.
The toxicity of oligomers on RPE cells was confirmed by MTT analyses. Several apoptotic genes were upregulated in the microarray study and support the findings from the MTT study.
RT-PCR studies showed increased gene expression of Tumour Necrosis Factor (TNF) related apoptosis-inducing ligand (TRAIL) and X-linked inhibitor of apoptosis (XIAP) associated factor
1 (XAF1). TRAIL, a member of the TNF superfamily, is expressed in several cell types including macrophages, and is activated by stimulation in neurons. It is believed that TRAIL expression likely leads to apoptotic cell death, as neutralization of TRAIL protects against toxicity in a human neuronal cell line72. It is possible that these mechanisms are at play in RPE cells as well. If so, neutralization of TRAIL may also protect RPE cells against A toxicity.
XAF1, another gene upregulated in our stimulation studies, interacts with XIAP to block its anti- caspase activity73. Accordingly, it has been shown that interferon-induced apoptosis is mediated by the overexpression of XAF1, which is believed to increase susceptibility to TRAIL-induced cytotoxicity74. Thus, in our studies, A toxicity to RPE cells may involve apoptotic mediated cell death via XAF1 activity. Our result also showed the increased gene expression of CYP2D6, a member of the cytochrome p450 family that is involved in the first line of defence against oxidative stress, detoxifying reactive oxygen species (ROS) 75. Since, IL- has been shown to induce the production ROS in the RPE cells19 , A toxicity of RPE cells in our study may also
50 involve ROS-induced signalling pathways, including stress activated protein kinases, such as the nuclear transcription factor NF-19, 76- 78. NF- been observed to be stimulated by IL-8, and subsequently has been implicated to play a part in retinal neovascularisation49, 79. GSEA pathway analysis provides an efficient and coordinated method to detect differences in gene function that play a part in common human diseases38. Interestingly, GSEA pathway analysis of our data identified a subset of genes within the NTHIPATHWAY gene set that appear to be involved in the NF- signalling pathway (Table 2.5). Among these subset of genes, IL- and IL-8 were the top ranked genes identified by leading edge analysis and thus potentially have the most biological impact80.
In conclusion, our studies lend further support to the hypothesis that promotes local inflammation associated with AMD3, 5, 33. Our findings that RPE cells produce IL-1 and IL-8 in response to Atreatment, presents a new explanation for the onset of chronic inflammation in the eye. A summary diagram depicting a potential mechanism by which may affect human
RPE cells is shown in Fig 2.7. We hypothesize that induced toxicity causes RPE cells to secrete proinflammatory cytokines IL- (and IL-8). IL- may further promote overexpression of IL-8 via several known mechanisms including ROS production14, 53. Subsequently, IL-8 expression, a known chemokine, may promote migration and activation of immune cells
(neutrophils, macrophages) towards the RPE26, 28, 78. The accumulation of immune cells may cause further pathogenetic changes in the RPE/BM complex, leading to AMD4, 11, 12, 77, 81.
Alternatively our results also suggest that, treatment causes increase CFI gene expression in
RPE. A„s interaction with CFI has been shown to abolish its complement regulatory
51 function13, 59. In the absence of a functioning CFI, unregulated complement activation would take place resulting in increased inflammation13. Furthermore, A could cause RPE cells to secrete
IL- to stimulate IFN . According to Wu et al. 58, IFN , along with oxidative stress, would consequently reduce CFH activity, increasing complement activation, inflammation and in due course AMD. Future experiments will be needed to address: i) how A disrupts CFI function ii) the receptor or the way enters the RPE cell, iii) in vivo confirmation of our findings, and iv) potential therapeutics for AMD targeting IL- and/or the A interaction with RPE cells.
52 2.5 TABLES
Gene Name Description Genbank Fold p-value change
Immune Response
IL-1 Homo sapiens interleukin 1, beta NM_000576 4.80 0.0022
Homo sapiens radical S-adenosyl methionine domain RSAD2* containing 2 NM_080657 2.58 0.0256
IL8* Homo sapiens interleukin 8 NM_000584 2.38 0.00177
LAIR1* Homo sapiens leukocyte-associated Ig-like receptor 1 NM_021706 2.32 0.0332
Homo sapiens myxovirus (influenza virus) resistance 1, MX1* interferon-inducible protein p78 (mouse) NM_002462 2.18 0.0187
OAS3 Homo sapiens 2'-5'-oligoadenylate synthetase 3, 100kDa NM_006187 1.99 0.000495
IFI44L* Homo sapiens interferon-induced protein 44-like NM_006820 1.98 0.00842
IFI27* Homo sapiens interferon, alpha-inducible protein 27 NM_005532 1.81 0.00436
Homo sapiens 2',5'-oligoadenylate synthetase 1, OAS1 40/46kDa NM_002534 1.80 0.0154
Homo sapiens mRNA, chromosome 1 specific transcript PRKCZ KIAA0505. AB007974 1.71 0.0186
CX3CL1* Homo sapiens chemokine (C-X3-C motif) ligand 1 NM_002996 1.71 0.00906
53 Gene Name Description Genbank Fold p-value change
LSP1 lymphocyte specific protein 1 W72519 1.68 0.00255
CXCL2* Homo sapiens chemokine (C-X-C motif) ligand 2 NM_002089 1.68 0.023
Homo sapiens tumor necrosis factor (ligand) TNFSF10* superfamily, member 10 (TRAIL) NM_003810 1.58 0.0149
OASL Homo sapiens 2'-5'-oligoadenylate synthetase-like NM_003733 1.57 0.016
Homo sapiens chromosome 9 open reading frame 26 IL33* (NF-HEV) (C9orf26) NM_033439 1.55 0.00679
GBP4 Homo sapiens guanylate binding protein 4 NM_052941 1.55 0.0332
Homo sapiens myxovirus (influenza virus) resistance 2 MX2 (mouse) NM_002463 1.54 0.0191
CFI* Homo sapiens I factor (complement) NM_000204 1.54 0.0234
SPN Homo sapiens sialophorin (gpL115, leukosialin, CD43) NM_003123 1.50 0.0138
Apoptosis
BIRC4BP Homo sapiens XIAP associated factor-1 NM_017523 2.10 0.0192
C8orf4 Homo sapiens chromosome 8 open reading frame 4 NM_020130 1.70 0.0152
Homo sapiens cDNA FLJ34435 fis, clone CECR2 HLUNG2000955 AK091754 1.65 0.0156
54 Gene Name Description Genbank Fold p-value change
Transcription regulation
ZNF175 Homo sapiens zinc finger protein 175 BC007778 1.92 0.00566
THC2317006 Q71RG2 (Q71RG2) FP2860, partial (26%) THC2317006 1.89 0.0222
FOXA2 Homo sapiens forkhead box A2 (FOXA2) NM_021784 1.76 0.0107
Tea domain family member 1 (SV40 transcriptional TEAD1 enhancement factor) CR594735 1.75 0.0169
Transporter
NXF3* Homo sapiens nuclear RNA export factor 3 NM_022052 1.86 0.0198
C14orf68 Homo sapiens chromosome 14 open reading frame 68 NM_207117 1.68 0.00185
Homo sapiens solute carrier family 30 (zinc transporter), SLC30A4* member 4 NM_013309 1.64 0.0303
Homo sapiens NPC1 (Niemann-Pick disease, type C1, NPC1L1 gene)-like 1 NM_013389 1.64 0.00187
PKD2L2 Homo sapiens polycystic kidney disease 2-like 2 NM_014386 1.55 0.0118
Cell proliferation
NPY Homo sapiens neuropeptide Y NM_000905 2.65 0.0252
55 Gene Name Description Genbank Fold p-value change
Homo sapiens metallothionein 3 (growth inhibitory MT3* factor (neurotrophic)) NM_005954 1.71 0.0056
Cell Signalling
STC1 Homo sapiens stanniocalcin 1 AI476245 1.99 4.14E-05
TSHB Homo sapiens thyroid stimulating hormone, beta NM_000549 1.52 0.0498
Metabolism
Homo sapiens cytochrome P450, family 2, subfamily D, CYP2D6* polypeptide 6 NM_000106 1.82 0.000452
SULT4A1 Homo sapiens sulfotransferase family 4A, member 1 NM_014351 2.02 0.00517
Signal transduction
PMCH Homo sapiens pro-melanin-concentrating hormone NM_002674 1.99 0.00127
SSTR2* Homo sapiens somatostatin receptor 2 NM_001050 1.51 0.00651
Miscellaneous Function
EGFL8 Brain development: EGF-like-domain, multiple 8 NM_030652 1.77 0.0248
RCAN3 Calcium-mediated signalling: RCAN family member 3 BM457392 2.00 0.00402
PACRG Cell death: PARK2 co-regulated NM_152410 1.55 0.0222
56 Gene Name Description Genbank Fold p-value change
FLCN Cell cycle: Folliculin AL831885 1.50 0.0199
Extracellular matrix: fibronectin type III domain FNDC5* containing 5 NM_153756 1.52 0.0299
Microtubule cytoskeleton organization: FLJ21659 fis, LOC221272 clone COL08743. AK025312 1.64 0.0174
Microtubule cytoskeleton organization: FLJ21272 fis, FLJ21272 clone COL01753. AK024925 1.56 0.0147
Phospholipid dephosphorylation: myotubularin related MTMR9 protein 9 AF339813 1.55 0.0394
DPP6 Proteolysis: dipeptidyl-peptidase 6 BX094874 1.54 0.0403
Synaptic transmission: pro-melanin-concentrating PMCHL2 hormone-like 2 NM_153381 2.36 0.00696
HERC5* Ubiqitin cycle: hect domain and RLD 5 NM_016323 1.73 0.000338
CLDN6 Cell-cell adhesion: claudin 6 NM_021195 1.82 0.0277
Calcium-ion binding: proline rich Gla (G- PRRG4 carboxyglutamic acid) 4 (transmembrane) NM_024081 2.19 0.00463
Calcium-ion binding: SPARC related modular calcium SMOC1 binding 1 NM_022137 1.51 0.0104
57 Gene Name Description Genbank Fold p-value change
FRMD3 Protein binding: FERM domain containing 3 BG216229 1.59 0.0138
LXN Enzyme inhibitor: latexin NM_020169 1.57 0.00212
Kinase: cytidine monophosphate (UMP-CMP) kinase 2, CMPK2 mitochondrial BG547557 2.10 0.00714
TRIM14 Metal-ion binding: tripartite motif-containing 14 NM_014788 1.53 0.0141
DSCR6 Protein binding: Down syndrome critical region gene 6 NM_018962 1.87 0.0213
C16ORF70 Protein binding: chromosome 16 open reading frame 70 BC008476 1.56 0.0419
AK123481 Protein binding: KIAA1377 AK123481 1.56 0.0034
BRD4 Protein binding: bromodomain containing 4 NM_014299 1.64 0.0341
RNA binding: ribonuclease, RNase A family, 1 RNASE1* (pancreatic) NM_198232 2.00 0.0026
Unknown function
WDR90 WD repeat domain AK126622 1.69 0.00286
AF014891 NADH dehydrogenase subunit 2 {Homo THC2364621 sapiens;} , partial (10%) THC2364621 1.95 0.000885
THC2355570 THC2355570 1.78 0.00603
58 Gene Name Description Genbank Fold p-value change
ALU1_HUMAN (P39188) Alu subfamily J sequence THC2397741 contamination warning entry, partial (10%) THC2397741 1.73 0.0487
C6ORF176 chromosome 6 open reading frame 176 CR618615 1.71 0.0131
LOC284570 Homo sapiens, clone IMAGE:4941949 BC040156 1.70 0.0447
GB|AB065479.1|BAC05733.1 seven transmembrane ENST000003 ENST00000360523 helix receptor 60523 1.69 0.031
ALU7_HUMAN (P39194) Alu subfamily SQ sequence THC2315555 contamination warning entry, partial (21%) THC2315555 1.67 0.00493
PREDICTED: Homo sapiens similar to MHC HLA-SX- ENST000003 ENST00000308384 alpha (LOC442203) 08384 1.64 0.0459
ENST000002 ENST00000283426 Homo sapiens mRNA for KIAA1909 protein, partial cds. 83426 1.63 0.00643
KIAA0889 Homo sapiens KIAA0889 protein NM_152257 1.62 0.0357
THC2348290 THC2348290 1.62 0.00129
LOC388231 PREDICTED: Homo sapiens hypothetical LOC388231 XM_373671 1.61 0.00343
ENST000002 ENST00000299415 99415 1.61 0.0354
THC2309258 THC2309258 1.61 0.000231
59 Gene Name Description Genbank Fold p-value change
AF227517 Homo sapiens sprouty-4C mRNA, complete cds. AF227517 1.61 0.00578
GP27_HUMAN (Q9NS67) Probable G protein-coupled receptor 27 (Super conserved receptor expressed in brain THC2434739 1), complete THC2434739 1.59 0.00634
HMG2L1 high-mobility group protein 2-like 1 THC2340734 1.59 0.0229
ALU1_HUMAN (P39188) Alu subfamily J sequence THC2431711 contamination warning entry, partial (19%) THC2431711 1.59 0.0113
ALU1_HUMAN (P39188) Alu subfamily J sequence THC2383841 contamination warning entry, partial (21%) THC2383841 1.58 0.0061
Q7PWX9 (Q7PWX9) ENSANGP00000004168 THC2278097 (Fragment), partial (73%) THC2278097 1.58 0.0247
nu30f08.y5 NCI_CGAP_Ov5 Homo sapiens cDNA clone IMAGE:1212231 similar to contains Alu repetitive AI791206 element;contains element MER37 repetitive element ;, AI791206 1.58 0.0102
Human endogenous retrovirus H protease/integrase- derived ORF1, ORF2, and putative envelope protein U88896 mRNA, complete cds. U88896 1.58 0.0033
AF070620 Homo sapiens clone 24694 mRNA sequence. AF070620 1.58 0.00276
THC2306396 Q6PIE2 (Q6PIE2) MGC9515 protein, partial (27%) THC2306396 1.55 0.0205
60 Gene Name Description Genbank Fold p-value change
Homo sapiens insulin-like growth factor 2 antisense IGF2AS (IGF2AS) NM_016412 1.55 0.00291
AL833330 Homo sapiens mRNA; cDNA DKFZp686H0133 AL833330 1.55 0.00114
THC2381061 THC2381061 1.53 0.000746
BC022074 C6orf102 protein {Homo sapiens;} , partial THC2381319 (6%) THC2381319 1.52 0.0124
THC2350023 THC2350023 1.51 0.0479
THC2413765 THC2413765 1.50 0.0402
Homo sapiens cDNA clone IMAGE:5271477, containing FLJ36166 frame-shift errors. [BC094802] BC094802 1.50 0.0138
Table 2.1. Upregulation of differentially expressed genes in A treated RPE cells at 24 hours. The data are presented as fold changes and log-transformed fold changes. The expression level of genes greater than 1.5 fold are considered upregulated (p-value <0.05). * Indicates genes that are selected for verification by RT-PCR.
61 Gene Name Description Genbank Fold p value change
Immune Response
Homo sapiens pregnancy specific beta-1- PSG8 glycoprotein 8 NM_182707 -1.64 0.0123
Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short SEMA4A cytoplasmic domain, (semaphorin) 4A NM_022367 -1.75 0.00761
IL9R* Homo sapiens interleukin 9 receptor (IL9R) NM_176786 -1.85 0.0407
Transporter
MFSD7 major facilitator superfamily domain containing 7 NM_032219 -1.52 0.0141
Homo sapiens solute carrier family 12 SLC12A3 (sodium/chloride transporters), member 3 NM_000339 -1.59 0.0158
Homo sapiens transient receptor potential cation TRPV5 channel, subfamily V, member 5 NM_019841 -1.61 0.0367
GLTPD1 glycolipid transfer protein domain containing 1 NM_001029885 -1.64 0.00111
Homo sapiens amiloride-sensitive cation channel 1, ACCN1 neuronal (degenerin) NM_183377 -1.69 0.00179
Metabolism
LYZL2 Homo sapiens lysozyme-like 2 NM_183058 -1.49 0.0139
62 Gene Name Description Genbank Fold p value change
Homo sapiens aldehyde dehydrogenase 1 family, ALDH1L1 member L1 NM_012190 -2.04 0.00838
Transcription regulation
Homo sapiens v-maf musculoaponeurotic MAFA fibrosarcoma oncogene homolog A NM_201589 -1.56 0.00821
Homo sapiens HFKH4 mRNA for fork head like FOXE1 protein. X94553 -1.64 0.0499
Miscellaneous Function
RNF36 Apoptosis: ring finger protein 36 NM_182985 -1.61 0.0192
THBS1* Cell motility: Thrombospondin 1 N48043 -1.64 0.000305
ACTL6B Cytoskeleton: actin-like 6B NM_016188 -2.22 0.00128
Intracellular signalling cascade: phosphatidylinositol-specific phospholipase C, X PLCXD2 domain containing 2 NM_153268 -1.52 0.0137
Protein phosphorylation: microtubule associated MASTL serine/threonine kinase-like THC2405366 -1.56 0.0208
GPR78 Signal transduction: G protein-coupled receptor 78 NM_080819 -1.69 0.000824
63 Gene Name Description Genbank Fold p value change
FIBIN Translation initiation factor: fin bud initiation factor NM_203371 -1.52 0.00345
Wnt receptor signalling: R-spondin 3 homolog RSPO3 (Xenopus laevis) NM_032784 -1.96 0.00811
Acid phosphatase activity: acid phosphatase, ACPP prostate NM_001099 -1.64 0.0189
Phospholipid binding: pleckstrin homology domain containing, family A (phosphoinositide binding PLEKHA3 specific) member 3 BC035471 -1.64 0.000975
Unknown Function
Homo sapiens cDNA FLJ36366 fis, clone ENST00000295 ENST00000295199 THYMU2007824. 199 -1.52 0.00471
Homo sapiens chromosome 22 open reading frame C22orf15 15 (C22orf15), mRNA NM_182520 -1.54 0.0472
UI-E-EJ0-ahl-c-18-0-UI.s1 UI-E-EJ0 Homo sapiens cDNA clone UI-E-EJ0-ahl-c-18-0-UI 5', mRNA LOC145853 sequence [ BM701491 -1.54 0.0275
Homo sapiens FLJ42875 protein, mRNA (cDNA FLJ42875 clone MGC:35434 IMAGE:5190167), complete cds. BC029785 -1.54 0.00241
THC2376198 THC2376198 -1.56 0.0128
64 Gene Name Description Genbank Fold p value change
ENST00000344 ENST00000344339 339 -1.59 0.0147
Homo sapiens cDNA FLJ35473 fis, clone LOC285458 SMINT2007433, weakly similar to Tektin A1 AK092792 -1.59 0.00418
FCHSD1 Homo sapiens FCH and double SH3 domains 1 NM_033449 -1.64 0.00286
RST1823 Athersys RAGE Library Homo sapiens BG182941 cDNA BG182941 -1.64 0.013
HUMGSTE beta 1,4-galactosyl-transferase THC2404941 precursor {Homo sapiens;} , partial (6%) THC2404941 -1.75 0.00551
TMEM35 Homo sapiens transmembrane protein 35 NM_021637 -2.13 0.0126
Homo sapiens full length insert cDNA clone AF086321 ZD53D02. AF086321 -2.13 0.0189
Table 2.2. Downregulation of differentially expressed genes in A treated RPE cells at 24 hours. The data are presented as fold changes and log-transformed fold changes. Decreased expression changes are expressed as –(treatment/control)-1. The expression levels of genes greater less than -1.5 fold are considered upregulated downregulated (p-value <0.05).* Indicates genes that are selected for verification by RT-PCR.
65 Gene Forward Primer Backward Primer Reference IL-8 AGGTGCAGTTTTGCCAAGGA TTTCTGTGTTGGCGCAGTGT IL-1 AAGCTGAGGAAGATGCTG ATCTACACTCTCCAGCTG CFI ATTGTGGAGACCAAAGTGATGAAC TGATACTGGCTTGGAATGCAAA CXCL2 GATAGAGGCTGAGGAATCCAAGAA ACATTTCCCTGCCGTCACA RSAD2 ACACAGGAATAATGACCCCAAAA TGAGCTAAATGTCAGGTCCTGTGTA MX1 GCCAGGACCAGGTATACAG GCCTGCGTCAGCCGTGC Leong et al.82 RNASE1 GAATCCCGGGCCAAGAAATTC GTGTCTCTCCTTCGGGCTGGT Landre et al.83 IFI44L CCAATTACACCTGAGCATTCTACTTTT AGACATAAGCCACACAGTGAATCCT IFI27 TGGCTCTGCCGTAGTTTTGC CACAGCCACAACTCCTCCAAT HERC5 GGGATGAAAGTGCTGAGGAG CATTTTCTGAAGCGTCCACA Kroismayr et al.84 MT3 ATGGACCCTGAGACCTGCCCCTGCCCT TCACTGGCAGCAGCTGCACTTCTCGCTTC Amoureux et al.85 SLC30A4 GGCTATCATCAAAATCACCAACCA CGGTGATGAGCATTATATCTCCATT Overbeck et al.86 IL-33 CACCCCTCAAATGAATCAGG GGAGCTCCACAGAGTGTTCC Carriere et al.87 THBS1 TGCACGAAGAAGGGAAAAACAT TCTCGGACCCGTGTTTCAG TRAIL ATGGCTATGATGGAGGTCCAG TTGTCCTGCATCTGCTTCAGC Komatsuda et al.88 XAF1 CCAGAAAATAAGTATTTCCACC TTATACTTCTTG TCTTTGGACG Kempkensteffen et al.89 CYP2D6 CCTACGCTTCCAAAAGGCTTT AGAGAACAGGTCAGCCACCACT Kojima et al.90 SSTR2 CCCCAGCCCTTAAAGGCATGT GGTCTCCAT TGAGGAGGGTCC Kumar et al.91 NXF3 CAACTAGTCCAACCCCTTAAAATTCA ACCTTGAGTAACTCTTCACCCTTCA IL9R CTTGTTGCTGTGTCCATCTTTCTC GTCTGGGCGACAGCTTGAAC CX3CL1 TGCAAGGGAGTGAGTTGATAGC TGGTCTCTGCTCTGCCCATT LAIR1 GGACCCACTCTCTGCCTTCAC GACACGTTTTCGTAGGTCCTGTT FN GACCACACCGCCCACAAC TCCTACATTCGGCGGGTATG GAPDH CATCCATGACAACTTTGGTATCGT CAGTCTTCTGGGTGGCAGTGA Wang et al.93
Table 2.3. RT-PCR primers. In total 23 genes were selected for validation by RT-PCR. Nearly, all expression patterns were comparable to the microarray data.
66 GENE SET Genes Found within Gene Set (Top 20 only) NES FDR q-val
OAS2, MX1, IFI44L, OAS1, CXCL2, TNFSF10, STC1, IFIT3, 1 DAC_BLADDER_UP STAT1, ICAM1, MMP1, IRF7, C1S, MX2, C3, IL13RA2, 2.38 0.000 TNFAIP3, HBEGF, NT5E, SLPI IFNA_UV- OAS2, RSAD2, MX1, IFI44L, OAS1, IFI27, OASL, TNFSF10, 2 2.37 0.000 CMV_COMMON_HCMV_6HRS_UP IFIT3, INDO, ISG20, C1ORF38, TDRD7, STX11, BAZ1A, SAMHD1, TLR3, IRF7, GCH1, MX2 3 DAC_IFN_BLADDER_UP OAS2, MX1, OAS1, CXCL2, TNFSF10, IFIT3, STAT1, ICAM1, 2.36 0.000 IRF7, C1S, MX2, C3, IL13RA2, TNFAIP3, SLPI, CCL5, CCL20 OAS2, RSAD2, MX1, IFI44L, OAS3, OAS1, CTSG, HERC5, 4 TAKEDA_NUP8_HOXA9_3D_UP IFI27, OASL, IFIT3, IFIT1, IFIT2, IFIH1, CCL18, INDO, PLSCR1 2.35 0.000 DDX58, EPSTI1, DST OAS2, RSAD2, MX1, IFI44L, OAS1, IFI27, OASL, TNFSF10, 5 IFNA_HCMV_6HRS_UP IFIT3, INDO, PLSCR1, ISG20, STAT1, TRIM22, IFIT5, C1ORF38, 2.32 0.000 TDRD7, STX11, ZBTB20, BAZ1A CMV_HCMV_TIMECOURSE_12HRS_ OAS2, RSAD2, MX1, OAS1, OASL, TNFSF10, IFIT3, ISG20, 6 2.28 0.000 UP CH25H, B4GALT5, IRF7, SOD2, PRPF19, MX2, GBP2, TNFAIP6, RARRES3, RHOB, CCL5, NR4A3 OAS2, RSAD2, MX1, IFI44L, OAS3, OAS1, CTSG, HERC5, 7 TAKEDA_NUP8_HOXA9_8D_UP IFI27, LXN, NR4A2, IFIT3, IFIT1, IFIT2, DHRS3, C20ORF103, 2.18 0.001 IFIH1, MTSS1, INDO, DDX58 OAS2, MX1, IFI44L, OAS1, OASL, TNFSF10, IFIT3, PLSCR1, 8 BENNETT_SLE_UP CAMP, STAT1, C2, TAP1, IFI35, TDRD7, IFITM3, IRF7, 2.14 0.002 APOBEC3C, MX2, SERPING1, LY6E OAS2, RSAD2, MX1, IFI44L, OAS3, OAS1, HERC5, DCAL1, 9 TAKEDA_NUP8_HOXA9_10D_UP IFI27, OASL, NR4A2, IFIT3, IFIT1, IFIT2, DHRS3, CD38, 2.12 0.003 C20ORF103, IFIH1, INDO, DDX58 RSAD2, MX1, IFI44L, IFI27, TNFSF10, PLSCR1, VCAM1, STAT1, 10 IFNALPHA_NL_UP IFITM1, UBE2D3, BST2, IRF7, CALR, MX2, HLA-E, PIAS4, 2.10 0.004 KIAA0409, UBE2L6, AKR7A2, PSME1
67 GENE SET Genes Found within Gene Set (Top 20 only) NES FDR q-val
IL8, OAS2, MX1, IFI44L, OAS3, OAS1, CXCL2, CX3CL1, IFIT1, 11 SANA_TNFA_ENDOTHELIAL_UP CXCL3, IFIH1, FLJ20035, PARP14, VCAM1, BIRC3, UBD, CCL2, 2.07 0.006 GBP1, OXR1, NFKBIA
OAS2, MX1, IFI44L, OAS1, TNFSF10, CX3CL1, NOD27, IFIH1, 12 SANA_IFNG_ENDOTHELIAL_UP INDO, IL18BP, FLJ20035, PARP14, TNCRNA, STAT1, UBD, 2.04 0.008 DTX3L, GBP1, LAP3, C17ORF27, CXCL9
IL1B, IL8, DUSP1, NFKBIA, NR3C1, EP300, CREBBP, TGFBR1, 13 NTHIPATHWAY IKBKB, MAP2K6, TLR2, RELA, MAPK14, MAPK11, TGFBR2, 2.04 0.008 CHUK, MAP3K7, NFKB1, MYD88, MAP2K3
IL1B, CXCL2, IL18RAP, IL1RN, PTGS2, PDGFB, LILRB4, 14 GALINDO_ACT_UP DUSP1, NFKBIA, IER3, FOSL1, CSF3, ICAM1, CCL3, RREB1, 2.04 0.008 TNFSF9, BCL3, UBC, TNFAIP2, CCL4
RSAD2, MX1, OASL, NR4A2, IFIT3, IL11, ZC3HAV1, RIPK1, CMV_UV- 15 PMAIP1, POLG2, ATF3, CREM, GCH1, C12ORF22, PSCD1, 2.03 0.007 CMV_COMMON_HCMV_6HRS_UP NR4A3, BTRC, SLC7A5, NR4A1
Table 2.4. Summary of GSEA analysis. GSEA analysis of the microarray results for “A treatment vs Control” helped us to identify gene sets correlated predominately with inflammation. Pathway 13, NTHIPATHWAY is identified as one of the inflammatory gene sets of particular interest, as IL-1 and IL-8 are the top ranked genes in this set. All gene sets can be accessed at the Molecular Signatures Database, http://www.broad.mit.edu/gsea/msigdb/index.jsp [online].
68 RANK RANK IN CORE PROBE METRIC RUNNING ES GENE LIST ENRICHMENT SCORE 1 IL1B 0 3.264 0.3542 Yes 2 IL8 8 2.035 0.5747 Yes 3 DUSP1 961 0.461 0.5703 Yes 4 NFKBIA 1052 0.439 0.6128 Yes 5 NR3C1 1116 0.428 0.6556 Yes 6 EP300 1747 0.320 0.6543 Yes 7 CREBBP 1812 0.311 0.6844 Yes 8 TGFBR1 2068 0.279 0.7002 Yes 9 IKBKB 3348 0.180 0.6466 No 10 MAP2K6 3627 0.165 0.6486 No 11 TLR2 4454 0.126 0.6151 No 12 RELA 4626 0.119 0.6182 No 13 MAPK14 5538 0.082 0.5750 No 14 MAPK11 5719 0.075 0.5729 No 15 TGFBR2 6135 0.058 0.5554 No 16 CHUK 6171 0.057 0.5596 No 17 MAP3K7 6989 0.029 0.5160 No 18 NFKB1 7241 0.020 0.5039 No 19 MYD88 8062 -0.006 0.4576 No 20 MAP2K3 10744 -0.094 0.3146 No 21 MAP3K14 12052 -0.142 0.2553 No 22 TNF 16472 -0.524 0.0597 No
Table 2.5. Associated gene found in the NTHIPATHWAY gene set. A detailed look into this gene set shows that IL- and IL-8 are the top ranked genes in our experimental Adataset. Genes that are found in the leading edge of this gene set are marked with a „Yes‟ in the core enrichment column. They are the genes that significantly contribute to the total enrichment score of NTHIPATHWAY gene set.
69 2.6 FIGURES
Figure 2.1 Confirmation of A 1-40 oligomers. (A) AFM examination of A (1-40) oligomeric solution at 48 hrs. The A (1-40) solution was applied to freshly cleaved mica and imaged according to Chromy et al.40. AFM image shows predominately small globular structures and a distinct lack of fibrils. B) Dot Blot with the use of the A11 or anti-oligomer antibody shows positive staining with the A (1-40) sample compared to no staining in both negative (neg.) and fibril (pos.) controls. The negative control contained no sample, whereas the fibril control was a preparation of A fibrils (Invitrogen). Primary and secondary (goat-anti rabbit IgG horseradish peroxidase conjugate) antibodies were diluted according to manufacturer‟s recommendations, 1:1000 and 1:2000 respectively.
70
Figure 2.2. Cell Viability Assay with A (1-40) Stimulation. (A) Post-confluent RPE cells were stimulated with 0.3M solutions of oligomeric A (1-40) at 3, 6, 12 and 24 hours. The graph depicts the means and standard error from three independent experiments. Two sample t- test assuming unequal variance were performed on the data, comparing the control group (serum- free DMEM) to the different concentrations of A (1-40) at each time point (*p-value <0.05). Aoligomersat a concentration of 0.3 M displayed a time-dependent toxicity to cultured human RPE cells with only 50% cell surviving at 24 hours. (B) Post-confluent RPE cells were stimulated with 0.01, 0.3, 1.0, 5.0, 10.0M solutions of oligomeric A (1-40) for 24 hours. The data depicts the means and standard error from three independent experiments. Data is represented as concentration (Log10 transformed) versus cell survival (percentage). A (1-40) toxicity appears to level off after concentrations higher than 1.0 M.
71
Caption for Figure 2.3 on page 75.
72
(B)
)
24hrs (Normalized 24hrs
Control
Treatment 24hrs (Normalized)
Caption for Figure 2.3 on page 75.
73
(C)
value)
-
(p
10
Log -
Log2 (Fold Change)
Caption for Figure 2.3 on page 75.
74 Figure 2.3 Microarray Images. (A) cDNA array image showing the hybridization signals as detected by fluorescent dyes (Cy3 and Cy5). The array consists of over 41,000 genes and transcripts encompassing the entire human genome. The mRNA samples were from passage 5 (P5) cultured human RPE cells (Cy5) and were co-hybridized with universal human reference RNA (Cy3). (B) Scatter plot of microarray data displaying normalized signals from one of three independent experiments. Each spot represents the normalized signals of a particular gene between the A treated RPE cells versus the control RPE cells. (C) Volcano plot of normalized mean intensities of A treated RPE cells. The plot simultaneously shows both differential gene expression (fold change) and statistically significant p-values (-log10 (p-value)) in A treated RPE cells. A fold-change threshold of 1.5 and p-value of 0.05 were utilized. Significant genes are shown as red dots.
75
Figure 2.4. Differential gene expression of 0.3 M A treated human RPE cells for 24 hours. Post-confluent human RPE cells were treated with 0.3 M A (1-40) oligomers for 24 hours. The cDNA was synthesized by reverse transcription. Differential gene expression was analyzed by gene microarray. Significant genes (p-value <0.05) that passed the + 1.5 fold-change threshold were quantified by real-time PCR. Several of the significant genes discovered were inflammatory genes, including IL-1 and IL8. Values are expressed as relative fold changes (log2) with respect to the corresponding controls. Data represent the mean of three independent experiments for microarray (p-value <0.05) and the mean ± SEM of three independent experiments for RT-PCR.
76 IL-1
IL-8
Caption for Figure 2.5 on page 78.
77 Figure 2.5. Heat map of most upregulated and downregulated differentially expressed genes. Using the mRNA expression profiles of human RPE cells treated with A a heat map was generate to look at the most significantly expressed upregulated and downregulated genes. Of particular interest were both IL-1 and IL-8, which were the first and the ninth most upregulated genes respectively.
78
Figure 2.6. Cytokine levels in cell supernatants. Human RPE cells challenged with 0.3 M A oligomers for 24 hours showed increased secretion of Interleukin-8 (IL-8) by ELISA. Compared to control cells, IL-8 secretion was increased in treated cells (p-value < 0.0001). Levels of Interleukin-1 beta (IL-1) and Tumor Necrosis Factor (TNF)-related apoptosis-inducing ligand (TRAIL) were not detected in both control and A treated samples Error bars indicate standard error of measurement.
79
Figure 2.7. Proposed mechanism for pathogenesis of AMD. Here we present a potential mechanism which summarizes our results (represented by solid filled arrows and lines) and other relevant research in the AMD field (represented by dashed arrows). stimulation causes RPE cell activation, resulting in increased expression of interleukin-1 beta (IL-. IL- then directly upregulates the expression of Interleukin-8 (IL-8). Subsequently, IL-8 may cause accumulation of immune cells in areas containing amyloid beta. The resulting accumulation of immune cells then initiates inflammation, which may ultimately lead to AMD. Alternatively, appears to increase complement factor I (CFI) gene expression levels, and has been shown to abolish its regulatory function13, 59. In the absence of a functioning CFI, unregulated complement activation would take place resulting in increased inflammation17. Our result also showed the increased gene expression of CYP2D6 (a member of the cytochrome p450 family) which is involved in the first line of defence against oxidative stress, detoxifying reactive oxygen species (ROS) 75. Furthermore, A could cause RPE cells to secrete IL- which could subsequently stimulate IFN (Interferon). Along with oxidative stress, IFN could potentially reduce CFH activity, increasing complement activation, inflammation and ultimately cause AMD. [ 1- Poleganov et al.56, 2- Yang et al.19, 3- Elner et al.14; Bian et al.53, 4- Wu et al.58, 5- Wu et al.52; Chen et al.65, 6 – Wang et al.13]
80 2.7 REFERENCES
1. Abdelsalam A, Del Priore L, Zarbin MA. Drusen in age-related macular degeneration: Pathogenesis, natural course, and laser photocoagulation-induced regression. Surv.Ophthalmol. 1999;44:1-29.
2. Johnson PT, Lewis GP, Talaga KC, et al. Drusen-associated degeneration in the retina. Invest.Ophthalmol.Vis.Sci. 2003;44:4481-4488.
3. Luibl V, Isas JM, Kayed R, Glabe CG, Langen R, Chen J. Drusen deposits associated with aging and age-related macular degeneration contain nonfibrillar amyloid oligomers. J.Clin.Invest. 2006;116:378-385.
4. Anderson DH, Mullins RF, Hageman GS, Johnson LV. A role for local inflammation in the formation of drusen in the aging eye. Am.J.Ophthalmol. 2002;134:411-431.
5. Johnson LV, Leitner WP, Rivest AJ, Staples MK, Radeke MJ, Anderson DH. The alzheimer's A beta -peptide is deposited at sites of complement activation in pathologic deposits associated with aging and age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:11830-11835.
6. McGeer PL, McGeer EG. Inflammation and the degenerative diseases of aging. Ann.N.Y.Acad.Sci. 2004;1035:104-116.
7. Donoso LA, Kim D, Frost A, Callahan A, Hageman G. The role of inflammation in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2006;51:137-152.
8. Johnson LV, Ozaki S, Staples MK, Erickson PA, Anderson DH. A potential role for immune complex pathogenesis in drusen formation. Exp.Eye Res. 2000;70:441-449.
9. Johnson LV, Leitner WP, Staples MK, Anderson DH. Complement activation and inflammatory processes in drusen formation and age related macular degeneration. Exp.Eye Res. 2001;73:887-896.
10. Hageman GS, Luthert PJ, Victor Chong NH, Johnson LV, Anderson DH, Mullins RF. An integrated hypothesis that considers drusen as biomarkers of immune-mediated processes at the RPE-bruch's membrane interface in aging and age-related macular degeneration. Prog.Retin.Eye Res. 2001;20:705-732.
81 11. Zarbin MA. Current concepts in the pathogenesis of age-related macular degeneration. Arch.Ophthalmol. 2004;122:598-614.
12. Qin S, Ni M, De Vries GW. Implication of S-adenosylhomocysteine hydrolase in inhibition of TNF-alpha- and IL-1beta-induced expression of inflammatory mediators by AICAR in RPE cells. Invest.Ophthalmol.Vis.Sci. 2008;49:1274-1281.
13. Wang J, Ohno-Matsui K, Yoshida T, et al. Altered function of factor I caused by amyloid beta: Implication for pathogenesis of age-related macular degeneration from drusen. J.Immunol. 2008;181:712-720.
14. Elner VM, Strieter RM, Elner SG, Baggiolini M, Lindley I, Kunkel SL. Neutrophil chemotactic factor (IL-8) gene expression by cytokine-treated retinal pigment epithelial cells. Am.J.Pathol. 1990;136:745-750.
15. Planck SR, Dang TT, Graves D, Tara D, Ansel JC, Rosenbaum JT. Retinal pigment epithelial cells secrete interleukin-6 in response to interleukin-1. Invest.Ophthalmol.Vis.Sci. 1992;33:78-82.
16. Elner VM, Scales W, Elner SG, Danforth J, Kunkel SL, Strieter RM. Interleukin-6 (IL-6) gene expression and secretion by cytokine-stimulated human retinal pigment epithelial cells. Exp.Eye Res. 1992;54:361-368.
17. Jaffe GJ, Van Le L, Valea F, et al. Expression of interleukin-1 alpha, interleukin-1 beta, and an interleukin-1 receptor antagonist in human retinal pigment epithelial cells. Exp.Eye Res. 1992;55:325-335.
18. Planck SR, Huang XN, Robertson JE, Rosenbaum JT. Retinal pigment epithelial cells produce interleukin-1 beta and granulocyte-macrophage colony-stimulating factor in response to interleukin-1 alpha. Curr.Eye Res. 1993;12:205-212.
19. Yang D, Elner SG, Bian ZM, Till GO, Petty HR, Elner VM. Pro-inflammatory cytokines increase reactive oxygen species through mitochondria and NADPH oxidase in cultured RPE cells. Exp.Eye Res. 2007;85:462-472.
27. Goverdhan SV, Ennis S, Hannan SR, et al. Interleukin-8 promoter polymorphism -251A/T is a risk factor for age-related macular degeneration. Br.J.Ophthalmol. 2008;92:537-540.
20. Rao NA. Role of oxygen free radicals in retinal damage associated with experimental uveitis. Trans.Am.Ophthalmol.Soc. 1990;88:797-850.
82 21. Winkler BS, Boulton ME, Gottsch JD, Sternberg P. Oxidative damage and age-related macular degeneration. Mol.Vis. 1999;5:32.
22. Beatty S, Koh H, Phil M, Henson D, Boulton M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2000;45:115-134.
23. Cai J, Nelson KC, Wu M, Sternberg P,Jr, Jones DP. Oxidative damage and protection of the RPE. Prog.Retin.Eye Res. 2000;19:205-221.
24. Truscott RJ. Age-related nuclear cataract: A lens transport problem. Ophthalmic Res. 2000;32:185-194.
25. Higgins GT, Wang JH, Dockery P, Cleary PE, Redmond HP. Induction of angiogenic cytokine expression in cultured RPE by ingestion of oxidized photoreceptor outer segments. Invest.Ophthalmol.Vis.Sci. 2003;44:1775-1782.
26. Cohen J. The immunopathogenesis of sepsis. Nature 2002;420:885-891.
27. Goverdhan SV, Ennis S, Hannan SR, et al. Interleukin-8 promoter polymorphism -251A/T is a risk factor for age-related macular degeneration. Br.J.Ophthalmol. 2008;92:537-540.
28. Tsai YY, Lin JM, Wan L, et al. Interleukin gene polymorphisms in age-related macular degeneration. Invest.Ophthalmol.Vis.Sci. 2008;49:693-698.
29. Mullins RF, Russell SR, Anderson DH, Hageman GS. Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. FASEB J. 2000;14:835-846.
30. Crabb JW, Miyagi M, Gu X, et al. Drusen proteome analysis: An approach to the etiology of age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:14682-14687.
31. Anderson DH, Talaga KC, Rivest AJ, Barron E, Hageman GS, Johnson LV. Characterization of beta amyloid assemblies in drusen: The deposits associated with aging and age-related macular degeneration. Exp.Eye Res. 2004;78:243-256.
32. Dentchev T, Milam AH, Lee VM, Trojanowski JQ, Dunaief JL. Amyloid-beta is found in drusen from some age-related macular degeneration retinas, but not in drusen from normal retinas. Mol.Vis. 2003;9:184-190.
83 32. Yoshida T, Ohno-Matsui K, Ichinose S, et al. The potential role of amyloid beta in the pathogenesis of age-related macular degeneration. J.Clin.Invest. 2005;115:2793-2800.
34. Stine WB,Jr, Snyder SW, Ladror US, et al. The nanometer-scale structure of amyloid-beta visualized by atomic force microscopy. J.Protein Chem. 1996;15:193-203.
35. Chromy BA, Nowak RJ, Lambert MP, et al. Self-assembly of abeta(1-42) into globular neurotoxins. Biochemistry 2003;42:12749-12760.
36. Wang XF, Cui JZ, Prasad SS, Matsubara JA. Altered gene expression of angiogenic factors induced by calcium-mediated dissociation of retinal pigment epithelial cells. Invest.Ophthalmol.Vis.Sci. 2005;46:1508-1515.
37. Gamulescu MA, Chen Y, He S, et al. Transforming growth factor beta2-induced myofibroblastic differentiation of human retinal pigment epithelial cells: Regulation by extracellular matrix proteins and hepatocyte growth factor. Exp.Eye Res. 2006;83:212-222.
38. Mootha VK, Lindgren CM, Eriksson KF, et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat.Genet. 2003;34:267-273.
39. Lambert MP, Barlow AK, Chromy BA, et al. Diffusible, nonfibrillar ligands derived from Abeta1-42 are potent central nervous system neurotoxins. Proc.Natl.Acad.Sci.U.S.A. 1998;95:6448-6453.
40. Lambert MP, Viola KL, Chromy BA, et al. Vaccination with soluble abeta oligomers generates toxicity-neutralizing antibodies. J.Neurochem. 2001;79:595-605.
41. Dahlgren KN, Manelli AM, Stine WB,Jr, Baker LK, Krafft GA, LaDu MJ. Oligomeric and fibrillar species of amyloid-beta peptides differentially affect neuronal viability. J.Biol.Chem. 2002;277:32046-32053.
42. Moors MA, Mizel SB. Proteasome-mediated regulation of interleukin-1beta turnover and export in human monocytes. J.Leukoc.Biol. 2000;68:131-136.
43. McGeer PL, Akiyama H, Itagaki S, McGeer EG. Activation of the classical complement pathway in brain tissue of alzheimer patients. Neurosci.Lett. 1989;107:341-346.
44. Webster S, Lue LF, Brachova L, et al. Molecular and cellular characterization of the membrane attack complex, C5b-9, in alzheimer's disease. Neurobiol.Aging 1997;18:415- 421.
84 45. Shen Y, Li R, McGeer EG, McGeer PL. Neuronal expression of mRNAs for complement proteins of the classical pathway in alzheimer brain. Brain Res. 1997;769:391-395.
46. Akiyama H, Barger S, Barnum S, et al. Inflammation and alzheimer's disease. Neurobiol.Aging 2000;21:383-421.
47. Jaffe GJ, Roberts WL, Wong HL, Yurochko AD, Cianciolo GJ. Monocyte-induced cytokine expression in cultured human retinal pigment epithelial cells. Exp.Eye Res. 1995;60:533-543.
48. Elner VM, Elner SG, Standiford TJ, Lukacs NW, Strieter RM, Kunkel SL. Interleukin-7 (IL-7) induces retinal pigment epithelial cell MCP-1 and IL-8. Exp.Eye Res. 1996;63:297- 303.
49. Yoshida A, Yoshida S, Khalil AK, Ishibashi T, Inomata H. Role of NF-kappaB-mediated interleukin-8 expression in intraocular neovascularization. Invest.Ophthalmol.Vis.Sci. 1998;39:1097-1106.
50. Holtkamp GM, Van Rossem M, de Vos AF, Willekens B, Peek R, Kijlstra A. Polarized secretion of IL-6 and IL-8 by human retinal pigment epithelial cells. Clin.Exp.Immunol. 1998;112:34-43.
51. Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines--CXC and CC chemokines. Adv.Immunol. 1994;55:97-179.
52. Hwang YS, Jeong M, Park JS, et al. Interleukin-1beta stimulates IL-8 expression through MAP kinase and ROS signaling in human gastric carcinoma cells. Oncogene 2004;23:6603- 6611.
53. Bian ZM, Elner SG, Yoshida A, Elner VM. Differential involvement of phosphoinositide 3-kinase/Akt in human RPE MCP-1 and IL-8 expression. Invest.Ophthalmol.Vis.Sci. 2004;45:1887-1896.
54. Killingsworth MC, Sarks JP, Sarks SH. Macrophages related to bruch's membrane in age- related macular degeneration. Eye 1990;4 ( Pt 4):613-621.
55. Heymans S, Luttun A, Nuyens D, et al. Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nat.Med. 1999;5:1135-1142.
85 56. Poleganov MA, Pfeilschifter J, Muhl H. Expanding extracellular zinc beyond levels reflecting the albumin-bound plasma zinc pool potentiates the capability of IL-1beta, IL-18, and IL-12 to act as IFN-gamma-inducing factors on PBMC. J.Interferon Cytokine Res. 2007;27:997-1001.
57. Gjermandsen IM, Justesen J, Martensen PM. The interferon-induced gene ISG12 is regulated by various cytokines as the gene 6-16 in human cell lines. Cytokine 2000;12:233- 238.
58. Wu Z, Lauer TW, Sick A, Hackett SF, Campochiaro PA. Oxidative stress modulates complement factor H expression in retinal pigmented epithelial cells by acetylation of FOXO3. J.Biol.Chem. 2007;282:22414-22425.
59. Sahu A, Isaacs SN, Soulika AM, Lambris JD. Interaction of vaccinia virus complement control protein with human complement proteins: Factor I-mediated degradation of C3b to iC3b1 inactivates the alternative complement pathway. J.Immunol. 1998;160:5596-5604.
60. Tsiftsoglou SA, Willis AC, Li P, et al. The catalytically active serine protease domain of human complement factor I. Biochemistry 2005;44:6239-6249.
61. Fagerness JA, Maller JB, Neale BM, Reynolds RC, Daly MJ, Seddon JM. Variation near complement factor I is associated with risk of advanced AMD. Eur.J.Hum.Genet. 2008.
62. Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related macular degeneration. Science 2005;308:385-389.
63. Edwards AO, Ritter R,3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005;308:421-424.
64. Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308:419-421.
65. Chen M, Forrester JV, Xu H. Synthesis of complement factor H by retinal pigment epithelial cells is down-regulated by oxidized photoreceptor outer segments. Exp.Eye Res. 2007;84:635-645.
66. Virgolini I, Yang Q, Li S, et al. Cross-competition between vasoactive intestinal peptide and somatostatin for binding to tumor cell membrane receptors. Cancer Res. 1994;54:690- 700.
86 67. Luo Q, Peyman GA, Conway MD, Woltering EA. Effect of a somatostatin analog (octreotide acetate) on the growth of retinal pigment epithelial cells in culture. Curr.Eye Res. 1996;15:909-913.
68. Patel YC. Somatostatin and its receptor family. Front.Neuroendocrinol. 1999;20:157-198.
69. Albers AR, O'Dorisio MS, Balster DA, et al. Somatostatin receptor gene expression in neuroblastoma. Regul.Pept. 2000;88:61-73.
70. Sall JW, Klisovic DD, O'Dorisio MS, Katz SE. Somatostatin inhibits IGF-1 mediated induction of VEGF in human retinal pigment epithelial cells. Exp.Eye Res. 2004;79:465- 476.
71. Lambooij AC, Kuijpers RW, van Lichtenauer-Kaligis EG, et al. Somatostatin receptor 2A expression in choroidal neovascularization secondary to age-related macular degeneration. Invest.Ophthalmol.Vis.Sci. 2000;41:2329-2335.
72. Cantarella G, Uberti D, Carsana T, Lombardo G, Bernardini R, Memo M. Neutralization of TRAIL death pathway protects human neuronal cell line from beta-amyloid toxicity. Cell Death Differ. 2003;10:134-141.
73. Liston P, Fong WG, Kelly NL, et al. Identification of XAF1 as an antagonist of XIAP anti- caspase activity. Nat.Cell Biol. 2001;3:128-133.
74. Leaman DW, Chawla-Sarkar M, Vyas K, et al. Identification of X-linked inhibitor of apoptosis-associated factor-1 as an interferon-stimulated gene that augments TRAIL Apo2L-induced apoptosis. J.Biol.Chem. 2002;277:28504-28511.
75. Esfandiary H, Chakravarthy U, Patterson C, Young I, Hughes AE. Association study of detoxification genes in age related macular degeneration. Br.J.Ophthalmol. 2005;89:470- 474.
76. Flohe L, Brigelius-Flohe R, Saliou C, Traber MG, Packer L. Redox regulation of NF- kappa B activation. Free Radic.Biol.Med. 1997;22:1115-1126.
77. Tezel TH, Bora NS, Kaplan HJ. Pathogenesis of age-related macular degeneration. Trends Mol.Med. 2004;10:417-420.
78. Fernandes AF, Zhou J, Zhang X, et al. Oxidative inactivation of the proteasome in RPE: A potential link between oxidative stress and upregulation of IL-8. J.Biol.Chem. 2008.
87 79. Elner SG, Elner VM, Jaffe GJ, Stuart A, Kunkel SL, Strieter RM. Cytokines in proliferative diabetic retinopathy and proliferative vitreoretinopathy. Curr Eye Res. 1995;14:1045–1053.
80. Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc.Natl.Acad.Sci.U.S.A. 2005;102:15545-15550.
81. Nowak JZ. Age-related macular degeneration (AMD): Pathogenesis and therapy. Pharmacol.Rep. 2006;58:353-363.
82. Leong WF, Tan HC, Ooi EE, Koh DR, Chow VT. Microarray and real-time RT-PCR analyses of differential human gene expression patterns induced by severe acute respiratory syndrome (SARS) coronavirus infection of vero cells. Microbes Infect. 2005;7:248-259.
83. Landre JB, Hewett PW, Olivot JM, et al. Human endothelial cells selectively express large amounts of pancreatic-type ribonuclease (RNase 1). J.Cell.Biochem. 2002;86:540-552.
84. Kroismayr R, Baranyi U, Stehlik C, Dorfleutner A, Binder BR, Lipp J. HERC5, a HECT E3 ubiquitin ligase tightly regulated in LPS activated endothelial cells. J.Cell.Sci. 2004;117:4749-4756.
85. Amoureux MC, Wurch T, Pauwels PJ. Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem.Biophys.Res.Commun. 1995;214:639-645.
86. Overbeck S, Uciechowski P, Ackland ML, Ford D, Rink L. Intracellular zinc homeostasis in leukocyte subsets is regulated by different expression of zinc exporters ZnT-1 to ZnT-9. J.Leukoc.Biol. 2008;83:368-380.
87. Carriere V, Roussel L, Ortega N, et al. IL-33, the IL-1-like cytokine ligand for ST2 receptor, is a chromatin-associated nuclear factor in vivo. Proc.Natl.Acad.Sci.U.S.A. 2007;104:282-287.
88. Komatsuda A, Wakui H, Iwamoto K, et al. Up-regulation of TRAIL mRNA expression in peripheral blood mononuclear cells from patients with active systemic lupus erythematosus. Clin.Immunol. 2007;125:26-29.
88 89. Kempkensteffen C, Hinz S, Schrader M, et al. Gene expression and promoter methylation of the XIAP-associated factor 1 in renal cell carcinomas: Correlations with pathology and outcome. Cancer Lett. 2007;254:227-235.
90. Kojima K, Nagata K, Matsubara T, Yamazoe Y. Broad but distinct role of pregnane x receptor on the expression of individual cytochrome p450s in human hepatocytes. Drug Metab.Pharmacokinet. 2007;22:276-286.
91. Kumar M, Liu ZR, Thapa L, Qin RY. Anti-angiogenic effects of somatostatin receptor subtype 2 on human pancreatic cancer xenografts. Carcinogenesis 2004;25:2075-2081.
92. Talaat AM, Howard ST, Hale W,4th, Lyons R, Garner H, Johnston SA. Genomic DNA standards for gene expression profiling in mycobacterium tuberculosis. Nucleic Acids Res. 2002;30:e104.
93. Wang XF, Cui JZ, Nie W, Prasad SS, Matsubara JA. Differential gene expression of early and late passage retinal pigment epithelial cells. Exp.Eye Res. 2004;79:209-221.
89 CHAPTER 3
CONCLUSION
3.1 OBJECTIVES
The study goal was to determine the effects of on RPE cells in vitro. Our hypothesis was that stimulation of human RPE cells in culture would result in gene expression changes that promote inflammation.
3.1.1 Goal 1: Determine the effects of
We were successfully able to examine the effect of 1-40 oligomers on human RPE cells.
However, we did initially run into some difficulties in synthesizing the oligomers (see section 3.5). Nevertheless, differential gene expression of treated RPE cells was examined by microarray and RT-PCR experiments. Our data showed increased expression of several inflammatory genes (Table 2.1) and the secretion of an inflammatory protein (Fig.2.6). These results confirmed our hypothesis that oligomers promote inflammatory gene expression changes in RPE. The discussions in Chapter Two and Section 3.5 provide insight into the implications of stimulation of human RPE cells in terms of AMD studies. Our findings enabled us to suggest methods to minimize retinal inflammation in AMD.
90 3.2 OVERALL SIGNIFICANCE
A summary figure outlining the following discussion is shown in Fig 3.1.
AMD is a degenerative eye disease that results in photoreceptor atrophy in the macular region of the eye, which ultimately leads to the loss of central vision. The disease is characterized by the accumulation of drusen between the basal lamina of RPE and BM. There are several known risk factors that increase the likelihood of developing AMD. These risk factors include aging, ultraviolet light exposure, genetic polymorphisms and oxidative stress1-8. All of these aforementioned risk factors affect the normal functions of the RPE. RPE activation has been shown to alter the expression of several angiogenic factors (VEGF, PEGF), which could lead to neovascularisation9. Several groups have observed the downregulation of CFH in activated RPE cells10, 11. Furthermore, activated RPE cells secrete both TNF-and IL-6, which are believed to cause inflammation12, 13. Consequently, this inflammation is believed to result in RPE cell death14, 15, which ultimately will result in one of three outcomes: i) CNV (wet AMD), ii) geographic atrophy (dry AMD), iii) additional drusen formation2, 3.
The results of this study add another factor to the pathogenesis of AMD. Amyloid beta is a constituent of drusen16-18 and its role in RPE activation was addressed in our study. We discovered that in vitro stimulation with caused RPE cells to express both IL- and IL-8.
RPE cells have been shown to secrete proinflammatory cytokines, such as IL-19-22. IL- is known to upregulate IL-8 expression in RPE cells13, 23-26. IL- has also been observed to induce
91 RPE production of ROS27. ROS expression is believed to be important in promoting IL-8 secretion in RPE cells23, 25. The expression IL-8, a known chemokine, likely mediates the activation of other inflammatory cells, including neutrophils and macrophages in the diseased retina. Subsequently, activation of these cells could lead to angiogenesis, promoting neovasularization and ultimately the neovascular form of AMD28-30.
In addition to the interleukins, we were able to show activation of the complement system in response to A stimulation. Specifically, we observed, the upregulation of a known inhibitor of the complement system, CFI31, 33. CFI inhibits complement activation by inactivating the active complement component 3 b (C3b) 31-33. Recently, Wang et al.31 discovered that A stimulation of human RPE cells resulted in the inability of CFI to cleave active C3b into its inactive form
(iC3b). The activation of CFI subsequently caused unregulated complement activation81.
Therefore, similar to Wang et al.31, our study suggests that A acts as a trigger of the complement system by exerting its effect on CFI. However, unlike Wang et al, 31 our study uncovered an upregulation of the CFI gene, rather than a change in the ability of CFI to cleave
C3b into its inactive form. At the present time, it is difficult to interpret these in vitro findings in terms of the behaviour of the RPE in vivo. Future studies in animal models in which RPE layer is stimulated by Amay allow us to understand the effects of CFI upregulation on the retina.
Although further experiments are needed, our research provides a novel and original finding that is important to our understanding of the pathogenesis of AMD.
92 3.3 STRENGTHS
3.3.1 The use of primary cell culture of human RPE cells
One of the key strengths of this study is the use of primary cell cultures of human RPE cells. The primary cell culture system is one of the closest in vitro models used to examine what may happen to regulatory and metabolic pathways in vivo 34, 35. One specific advantage of using primary cultures of human RPE cells is that they are known to maintain their regular physiological functions in comparison to human RPE cell lines. Such functions include phagocytosis of rod outer segments, polarizarization, and transportation of materials.36-39. Our experiments utilized early passage human RPE cells, which are preferable and recommended for investigating (human) disease processes over animal RPE cells43. Figure 4.2.2 illustrates the morphology of our primary cell cultures of human RPE used in this study. Note that the morphology of our human RPE cells is consistent to what robust RPE cells should look like.
Specifically, our cells were cobblestone and uniform in shape, consisted of tightly organized colonies and were confluent (i.e. touching each other)82.
3.3.2 The use of agilent’s whole human oligo microarray
Recently, the use of cDNA microarrays has become a more commonly used tool among molecular biologists. As such, several new and improved microarrays have surfaced (Agilent,
Affymetrix, Nimblegen, Applied Biosytems). Agilent's whole human genome oligo microarray consists of over 41,000 genes and transcripts based on the latest genomic information accessible.
As the whole human genome is analyzed on just one array, fewer reagents and handling steps are required. This reduces the variability in the data and provides greater reproducibility. Since
93 only one microarray is needed, fewer steps are required for subsequent data analysis. Agilent‟s microarray possesses high sensitivity, and thus only a small sample is required to carry out the experiment. The microarray gene probes have also been thoroughly validated by Agilent methodologies44.
3.3.3 The relevance of stimulating with oligomers
Extensive prior research indicated that it would be important to further understand the effect of
stimulation of RPE cells. The oligomeric form of was associated with activated complement components in drusen in AMD49, Furthermore, was known to activate inflammatory processes in other neurodegenerative diseases, namely Alzheimer‟s disease45, 47, 48,
67-70. Therefore, these earlier studies were the impetus for our study on the effects of AB stimulation of human RPE in vitro.
3.4 WEAKNESSES
3.4.1 Difficulty using different lengths of peptides
A1-42 oligomers are principally responsible for AD pathogenesis45-48 and therefore we initially decided to undertake stimulation studies with oligomeric 1-42. However, these initial studies with 0.3M 1-42 resulted in RPE cell death. Even stimulation with lower concentrations of
A1-42 (0.01M and 0.001M) caused significant cell death. We concluded that 1-42 was simply too toxic to human RPE cells to enable us to measure any gene expression changes.
94 Further analysis of the AMD literature indicated that, unlike the neuroscience literature, there was very little evidence implicating this particular form of amyloid beta in AMD pathogenesis10,
31, 49. Furthermore, previous A stimulation studies on human RPE cells have all stimulated with the 1-40 not 1-42 form of A10, 31, 49. Therefore, we then focused our attention to the shorter, less toxic form of 1-40.
3.4.2 The lack of an established in vivo model
Although our research has provided us with some important findings, we have yet to confirm these results in vivo. This is primarily because we do not yet understand the mechanism by which amyloid beta is deposited in drusen. Due to the similarities between AD and AMD, researchers have started to examine the possibility of using mouse models of AD for AMD research. The APP/PS1 transgenic mouse co-expresses a mutant human amyloid precursor protein (APP) and mutant human presenilin (PS1) transgene (Tg 2576 x Tg1). These mice have been shown to develop characteristic AD-like amyloid beta deposits in the brain50-54. Studies by
Ning et al.50 from our lab examined the eyes of the APP/PS1 mouse model of AD, and showed that amyloid deposits and neurodegeneration are present in the neuroretina, but the RPE cells displayed only a modest age-dependent overexpression of APP in the APP/PS1 mouse.
Furthermore, Yoshida et al.9 studied a different transgenic mouse with a disrupted nephrylisin gene. However, although this model showed the accumulation of A between RPE and the BM this accumulation was not localized in drusen sites. Ambati et al.55 has also established another mouse model of AMD in which mice deficient in either monocyte chemoattractant-protein 1
(CCL2) or C-C chemokine receptor-2 (CCR-2) present with several characteristic features of
95 AMD, including drusen beneath the RPE layer, CNV and photoreceptor degeneration. To our knowledge, the drusen observed in these mice have yet to be analyzed for the overexpression of
APP and the presence of deposits.
3.5 FUTURE WORK
In Chapter 2, several proposed experiments that could further our understanding of the basic mechanisms underlying RPE activation and inflammation were discussed.
3.5.1 What role does CFI play in RPE cells?
Stimulation of human RPE cells with 0.3 M for twenty-four hours resulted in activation of the complement system. We observed an increased gene expression of CFI, an inhibitor of the complement system31-33. Recently, Wang et al.31 discovered that A stimulation of human RPE cells resulted in the inability of CFI to cleave active C3b into its inactive form (iC3b). Other studies have suggested that the activation of CFI may subsequently cause unregulated complement activation 32. However, besides the recent work by Wang et al., not much is known about the role of CFI in terms of AMD. Rather, most research in the field has focused on CFH and its known polymorphisms10, 11, 56-58. Nevertheless, along with Wang et al.31, we suggest a link between CFI, A and AMD.
96 Understanding the downstream effects of upregulation of CFI by RPE in the retina will be important to identifying links between CFI, A and AMD. It will also be important to understand whether the interactions between A and CFI seen in vitro are also present in vivo.
3.5.2 Is there an animal model that overexpresses A in the RPE/BM complex?
In section 3.3.5, we discussed the lack of an established mouse model for AMD that expresses amyloid beta deposits within drusen. However, the AMD model mouse system generated by
Ambati et al.55 already shows several of the cardinal features of AMD including photoreceptor atrophy and CNV. However, more important to us is the fact that these mice contain drusen beneath the RPE layer. One future study would be to isolate and identify the constituents of the drusen in this mouse model as previous described by Crabb et al.17
Alternatively, it is also possible to study normal mice after subretinal injections of oligomeric
AIt is even perhaps preferable to study normal mice after subretinal injections of oligomeric
A as transgenic mice may possess unknown genetic changes that could potentially obscure the true results.
3.5.3 How is A produced and deposited in drusen?
Although has been discovered to be a component of drusen71, 72, it remains unknown as to how arises in drusen. Recently, Glotin et al.73 showed that stimulation of ARPE-19 cells with
97 oxidative stress (tert-butylhydroperoxide) induced premature senescence that resulted in secretion. Furthermore, APP and major enzymes involved in formation were upregulated in these premature senescent RPE cells. It is believed that these results are consistent with deposition that occurs within drusen49. Therefore, a potential future study would be to analyze the effects of oxidative stress stimulation in vivo to determine whether A secretion and deposition occurs within drusen sites.
How does A enter the RPE cell?
is undoubtedly affects the normal functions of human RPE cells. However, it is currently not known how enters RPE cells to mediate its effect. Receptors for advanced glycation end products (RAGE) can be a receptor for and was shown to mediate its effects on microglia and neurons in AD59. Furthermore, RAGE was shown to control the transport of from the bloodstream into the brain60. In terms of AMD, RAGE is present in the RPE61. Moreover, its expression was shown to be upregulated in the maculas of human donor AMD eyes62. Recently,
Ma et al.63 observed that oligomers upregulated the secretion of VEGF by RAGE in a cell line of RPE (ARPE19). Thus, RAGE appeared to be an excellent candidate receptor for
oweverwe did not observe any expression changes for RAGE in our experiments. It is possible that constitutive levels of RAGE were sufficient to modify RPE behaviour in response to or alternatively, may interact with different receptors or none at all. has been termed a „promiscuous ligand‟ interacting with several receptor types83. Interestingly, we observed an increased expression of somatostatin receptor 2 (SSTR2) and several other
98 transporters. However, at this point it is not known whether is a ligand for SSTR2. Future experiments are needed to investigate this possibility.
3.5.5 What is the relationship between interleukin and 8 and AMD?
The role of IL- and IL-8 in the pathogenesis of AMD remains unknown. Previous studies have shown that RPE cells challenged with oxidized bovine photoreceptor outer segments (POS) in vitro express IL-8, which could explain the accumulation of immune cells in AMD lesions (e.g. drusen and CNV membranes)30. Along with immune cells such as macrophages, IL-8 alone, both in vitro and in vivo, has also been observed to trigger angiogenesis, which could potentially lead to neovascularisation and ultimately the „wet‟ form of AMD20, 28, 81. Furthermore, IL- stimulation of human RPE cells in vitro was observed to release of reactive oxygen species
(ROS)27 , which promotes oxidative damage and is highly associated with AMD pathology75-79.
Recently, genetic analyses found that carriers of the IL-8 +781 T allele80, and individuals homozygous for the IL-8 -251 AA genotype74 are at an increased risk for developing AMD.
Further genetic analysis is required to ascertain whether there are any polymorphisms in IL- that associated with an increased risk of developing AMD. Other future studies should look at the potential consequences of IL- and IL-8 in vivo to determine whether AMD pathology can be reproduced.
99 3.5.6 Are there potential ways to prevent A’s effect on RPE cells?
In addition to therapeutics against potential receptors for our results suggest that IL- may be a potential therapeutic target for AMD. Since IL- is one of several proinflammatory cytokines that is involved in inflammation, inhibition of its function could help prevent downstream activation of IL-8 and subsequent recruitment of immune cells. There are several strategies in the literature that have been shown to attenuate the expression of IL-. Successful blocking of IL- cell signalling in HL-60 cells has been demonstrated with an IL- specific monoclonal antibody64. Furthermore, Qin et al.65 observed that AMP-activated protein kinase
(AMPK) activator 5-aminoimidazole-4carboxamide riboside (AICAR) inhibits IL- induction of IL-8 in RPE cells. Our lab is currently looking at the idea of co-incubating human RPE cells with both oliogomers and either AICAR or an IL- antibody. We hypothesize that incubation of treated RPE cells with IL- antagonists will abolish the observed gene expression of not only Il-, but also its downstream signalling molecules, including IL-8.
Another possible strategy is to use siRNA to silence the IL-1 gene. It is hypothesized that A stimulation of RPE cells will then result in less toxicity as measured by the MTT assay.
3.6 CONCLUSION
The mechanism of the pathogenesis of AMD remains unsolved. However, recent research has led to the idea that inflammation plays a strong role in the pathogenesis of AMD. A step wise summary of the pathogenesis of AMD is depicted in Figure 3.1. Briefly, in step 1 several factors, including aging, ultraviolet light exposure, genetic polymorphisms, oxidative stress, and drusen
100 lead to the activation of RPE cells1-8. In Step 2, RPE activation results in altered expressions of many inflammatory related genes, including complement proteins (CFH) 10, 11, and other inflammatory molecules (TNF-and IL-6)12, 13. Furthermore, activating RPE cells may also release angiogenic factors (VEGF, PEGF), leading to the development of neovascularisation9.
The altered gene expression of many inflammatory related genes leads to local inflammation
(step 3), and consequently RPE cell death (Step 4)14, 15. Lastly, RPE cell death will ultimately result in one of three outcomes: i) CNV (wet AMD), ii) geographic atrophy (dry AMD), iii) additional drusen formation2, 3.
The results of this study add another factor to the pathogenesis of AMD (refer to grey color arrows in Figure 3.1). We discovered that in vitro stimulation with caused RPE cells to express the inflammatory cytokines, IL- and IL-8. IL- proceeds to induce RPE cells to produce ROS, which then leads to secretion of IL-8 from RPE cells23, 25, 27. Furthermore, we also observed the increased expression of the complement protein, CFI, which when bound to A becomes inactive and leads to unregulated complement activation31, 81. T his unregulated complement activation along with increased expression of inflammatory cytokines causes increased inflammation and eventually RPE cell death, and subsequently the development of
AMD. Our research provides a novel and original finding that is important to our understanding of the pathogenesis of AMD and offers a framework for which future experiments can be designed that will hopefully one day lead to our ability to treat and ultimately prevent the development of AMD.
101 3.7 FIGURES
Caption for Figure 3.1 on page 103.
102 Figure 3.1. Summary of the pathogenesis of AMD. In step 1 several factors, including aging, ultraviolet light exposure, genetic polymorphisms, oxidative stress, and drusen lead to the activation of RPE cells1-8. In Step 2, RPE activation results in altered expressions of many inflammatory related genes, including complement proteins (complement factor H (CFH) 10, 11, and other inflammatory molecules (Tumour necrosis factor alpha (TNF-, Interleukin (IL-6)12, 13. Furthermore, activating RPE cells may also release angiogenic factors (VEGF, PEGF), leading to the development of neovascularisation9. The altered gene expression of many inflammatory related genes leads to local inflammation (step 3), and consequently RPE cell death (Step 4)14, 15. Depicted in grey color arrows are the results of our study. Briefly, we discovered that in vitro stimulation with amyloid beta ( caused RPE cells to express the inflammatory cytokines, interleukin-1 beta (IL-) and Interleukin – 8 (IL-8). IL- proceeds to induce RPE cells to produce reactive oxygen species (ROS), which then leads to secretion of IL- 8 from RPE cells23, 25, 27. Furthermore, we also observed the increased expression of the complement protein, complement factor I (CFI), which when bound to A becomes inactive and leads to unregulated complement activation31, 81. This unregulated complement activation along with increased expression of inflammatory cytokines causes increased inflammation and eventually RPE cell death. Lastly, RPE cell death will ultimately result in one of three outcomes: i) CNV (wet AMD), ii) geographic atrophy (dry AMD), iii) additional drusen formation2, 3.
103 3.8 REFERENCES
1. Beatty S, Koh H, Phil M, Henson D, Boulton M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2000;45:115-134.
2. Zarbin MA. Current concepts in the pathogenesis of age-related macular degeneration. Arch.Ophthalmol. 2004;122:598-614.
3. Donoso LA, Kim D, Frost A, Callahan A, Hageman G. The role of inflammation in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2006;51:137-152.
4. de Jong PT. Age-related macular degeneration. N.Engl.J.Med. 2006;355:1474-1485.
5. Kanda A, Abecasis G, Swaroop A. Inflammation in the pathogenesis of age-related macular degeneration. Br.J.Ophthalmol. 2008;92:448-450.
6. Nowak JZ. Age-related macular degeneration (AMD): Pathogenesis and therapy. Pharmacol.Rep. 2006;58:353-363.
7. Kuehn BM. Gene discovery provides clues to cause of age-related macular degeneration. JAMA 2005;293:1841-1845.
8. Tezel TH, Bora NS, Kaplan HJ. Pathogenesis of age-related macular degeneration. Trends Mol.Med. 2004;10:417-420.
9. Yoshida T, Ohno-Matsui K, Ichinose S, et al. The potential role of amyloid beta in the pathogenesis of age-related macular degeneration. J.Clin.Invest. 2005;115:2793-2800.
10. Chen M, Forrester JV, Xu H. Synthesis of complement factor H by retinal pigment epithelial cells is down-regulated by oxidized photoreceptor outer segments. Exp.Eye Res. 2007;84:635-645.
11. Wu Z, Lauer TW, Sick A, Hackett SF, Campochiaro PA. Oxidative stress modulates complement factor H expression in retinal pigmented epithelial cells by acetylation of FOXO3. J.Biol.Chem. 2007;282:22414-22425.
12. de Kozak Y, Naud MC, Bellot J, Faure JP, Hicks D. Differential tumor necrosis factor expression by resident retinal cells from experimental uveitis-susceptible and -resistant rat strains. J.Neuroimmunol. 1994;55:1-9.
104 13. Holtkamp GM, Van Rossem M, de Vos AF, Willekens B, Peek R, Kijlstra A. Polarized secretion of IL-6 and IL-8 by human retinal pigment epithelial cells. Clin.Exp.Immunol. 1998;112:34-43.
14. Anderson DH, Mullins RF, Hageman GS, Johnson LV. A role for local inflammation in the formation of drusen in the aging eye. Am.J.Ophthalmol. 2002;134:411-431.
15. Kijlstra A, La Heij E, Hendrikse F. Immunological factors in the pathogenesis and treatment of age-related macular degeneration. Ocul.Immunol.Inflamm. 2005;13:3-11.
16. Mullins RF, Russell SR, Anderson DH, Hageman GS. Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. FASEB J. 2000;14:835-846.
17. Crabb JW, Miyagi M, Gu X, et al. Drusen proteome analysis: An approach to the etiology of age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:14682-14687.
18. Anderson DH, Talaga KC, Rivest AJ, Barron E, Hageman GS, Johnson LV. Characterization of beta amyloid assemblies in drusen: The deposits associated with aging and age-related macular degeneration. Exp.Eye Res. 2004;78:243-256.
19. Planck SR, Huang XN, Robertson JE, Rosenbaum JT. Retinal pigment epithelial cells produce interleukin-1 beta and granulocyte-macrophage colony-stimulating factor in response to interleukin-1 alpha. Curr.Eye Res. 1993;12:205-212.
20. Yoshida A, Yoshida S, Khalil AK, Ishibashi T, Inomata H. Role of NF-kappaB-mediated interleukin-8 expression in intraocular neovascularization. Invest.Ophthalmol.Vis.Sci. 1998;39:1097-1106.
21. Jaffe GJ, Roberts WL, Wong HL, Yurochko AD, Cianciolo GJ. Monocyte-induced cytokine expression in cultured human retinal pigment epithelial cells. Exp.Eye Res. 1995;60:533-543.
22. Elner VM, Elner SG, Standiford TJ, Lukacs NW, Strieter RM, Kunkel SL. Interleukin-7 (IL-7) induces retinal pigment epithelial cell MCP-1 and IL-8. Exp.Eye Res. 1996;63:297- 303.
105 23. Elner VM, Strieter RM, Elner SG, Baggiolini M, Lindley I, Kunkel SL. Neutrophil chemotactic factor (IL-8) gene expression by cytokine-treated retinal pigment epithelial cells. Am.J.Pathol. 1990;136:745-750.
24. Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines--CXC and CC chemokines. Adv.Immunol. 1994;55:97-179.
25. Bian ZM, Elner SG, Yoshida A, Elner VM. Differential involvement of phosphoinositide 3-kinase/Akt in human RPE MCP-1 and IL-8 expression. Invest.Ophthalmol.Vis.Sci. 2004;45:1887-1896.
26. Hwang YS, Jeong M, Park JS, et al. Interleukin-1beta stimulates IL-8 expression through MAP kinase and ROS signaling in human gastric carcinoma cells. Oncogene 2004;23:6603- 6611.
27. Yang D, Elner SG, Bian ZM, Till GO, Petty HR, Elner VM. Pro-inflammatory cytokines increase reactive oxygen species through mitochondria and NADPH oxidase in cultured RPE cells. Exp.Eye Res. 2007;85:462-472.
28. Killingsworth MC, Sarks JP, Sarks SH. Macrophages related to bruch's membrane in age- related macular degeneration. Eye 1990;4 ( Pt 4):613-621.
29. Heymans S, Luttun A, Nuyens D, et al. Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nat.Med. 1999;5:1135-1142.
30. Higgins GT, Wang JH, Dockery P, Cleary PE, Redmond HP. Induction of angiogenic cytokine expression in cultured RPE by ingestion of oxidized photoreceptor outer segments. Invest.Ophthalmol.Vis.Sci. 2003;44:1775-1782.
31. Wang J, Ohno-Matsui K, Yoshida T, et al. Altered function of factor I caused by amyloid beta: Implication for pathogenesis of age-related macular degeneration from drusen. J.Immunol. 2008;181:712-720.
32. Sahu A, Isaacs SN, Soulika AM, Lambris JD. Interaction of vaccinia virus complement control protein with human complement proteins: Factor I-mediated degradation of C3b to iC3b1 inactivates the alternative complement pathway. J.Immunol. 1998;160:5596-5604.
33. Tsiftsoglou SA, Willis AC, Li P, et al. The catalytically active serine protease domain of human complement factor I. Biochemistry 2005;44:6239-6249.
106 34. Hook JB, Tarloff JB, Lash LH, Goldstein RS. Toxicology of the Kidney. 2rd ed. New York, NY: Raven Press Ltd.; 1993;192-193.
35. Sultan KR, Haagsman HP. Species-specific primary cell cultures: a research tool in veterinary science. Veterinary Sciences Tomorrow. 2001;1:1-7.
36. Alge CS, Hauck SM, Priglinger SG, Kampik A, Ueffing M. Differential protein profiling of primary versus immortalized human RPE cells identifies expression patterns associated with cytoskeletal remodeling and cell survival. J.Proteome Res. 2006;5:862-878.
37. Dunn KC, Aotaki-Keen AE, Putkey FR, Hjelmeland LM. ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp.Eye Res. 1996;62:155-169.
38. Pfeffer BA, Clark VM, Flannery JG, Bok D. Membrane receptors for retinol-binding protein in cultured human retinal pigment epithelium. Invest.Ophthalmol.Vis.Sci. 1986;27:1031-1040.
39. Hall MO, Abrams T. Kinetic studies of rod outer segment binding and ingestion by cultured rat RPE cells. Exp.Eye Res. 1987;45:907-922.
40. Zhu M, Provis JM, Penfold PL. Isolation, culture and characteristics of human foetal and adult retinal pigment epithelium. Aust.N.Z.J.Ophthalmol. 1998;26 Suppl 1:S50-2.
41. Castillo BV,Jr, Little CW, del Cerro C, del Cerro M. An improved method of isolating fetal human retinal pigment epithelium. Curr.Eye Res. 1995;14:677-683.
42. McKay BS, Burke JM. Separation of phenotypically distinct subpopulations of cultured human retinal pigment epithelial cells. Exp.Cell Res. 1994;213:85-92.
43. Geisen P, McColm JR, King BM, Hartnett ME. Characterization of barrier properties and inducible VEGF expression of several types of retinal pigment epithelium in medium-term culture. Curr.Eye Res. 2006;31:739-748.
44. Kronick MN. Creation of the whole human genome microarray. Expert Rev.Proteomics 2004;1:19-28.
45. McGeer PL, McGeer EG. Inflammation and the degenerative diseases of aging. Ann.N.Y.Acad.Sci. 2004;1035:104-116.
46. Soto C. Unfolding the role of protein misfolding in neurodegenerative diseases. Nat.Rev.Neurosci. 2003;4:49-60.
107 47. Strohmeyer R, Shen Y, Rogers J. Detection of complement alternative pathway mRNA and proteins in the alzheimer's disease brain. Brain Res.Mol.Brain Res. 2000;81:7-18.
48. Akiyama H, Barger S, Barnum S, et al. Inflammation and alzheimer's disease. Neurobiol.Aging 2000;21:383-421.
49. Luibl V, Isas JM, Kayed R, Glabe CG, Langen R, Chen J. Drusen deposits associated with aging and age-related macular degeneration contain nonfibrillar amyloid oligomers. J.Clin.Invest. 2006;116:378-385.
50. Ning A, Cui JZ, To E, Hsiao Ashe K, Matsubara JA. Amyloid beta deposits lead to retinal degeneration in a mouse model of alzheimer disease. Invest.Ophthalmol.Vis.Sci. 2008.
51. Holcomb L, Gordon MN, McGowan E, et al. Accelerated alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes. Nat.Med. 1998;4:97-100.
52. Hsiao K, Chapman P, Nilsen S, et al. Correlative memory deficits, abeta elevation, and amyloid plaques in transgenic mice. Science 1996;274:99-102.
53. Duff K, Eckman C, Zehr C, et al. Increased amyloid-beta42(43) in brains of mice expressing mutant presenilin 1. Nature 1996;383:710-713.
54. Westerman MA, Cooper-Blacketer D, Mariash A, et al. The relationship between abeta and memory in the Tg2576 mouse model of alzheimer's disease. J.Neurosci. 2002;22:1858- 1867.
55. Ambati J, Anand A, Fernandez S, et al. An animal model of age-related macular degeneration in senescent ccl-2- or ccr-2-deficient mice. Nat.Med. 2003;9:1390-1397.
56. Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related macular degeneration. Science 2005;308:385-389.
57. Edwards AO, Ritter R,3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005;308:421-424.
58. Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308:419-421.
59. Yan SD, Chen X, Fu J, et al. RAGE and amyloid-beta peptide neurotoxicity in alzheimer's disease. Nature 1996;382:685-691.
108 60. Deane R, Du Yan S, Submamaryan RK, et al. RAGE mediates amyloid-beta peptide transport across the blood-brain barrier and accumulation in brain. Nat.Med. 2003;9:907- 913.
61. Zhou J, Cai B, Jang YP, Pachydaki S, Schmidt AM, Sparrow JR. Mechanisms for the induction of HNE- MDA- and AGE-adducts, RAGE and VEGF in retinal pigment epithelial cells. Exp.Eye Res. 2005;80:567-580.
62. Howes KA, Liu Y, Dunaief JL, et al. Receptor for advanced glycation end products and age-related macular degeneration. Invest.Ophthalmol.Vis.Sci. 2004;45:3713-3720.
63. Ma W, Lee SE, Guo J, et al. RAGE ligand upregulation of VEGF secretion in ARPE-19 cells. Invest.Ophthalmol.Vis.Sci. 2007;48:1355-1361.
64. Marshall JC, Jia SH, Parodo J, Watson RW. Interleukin-1beta mediates LPS-induced inhibition of apoptosis in retinoic acid-differentiated HL-60 cells. Biochem.Biophys.Res.Commun. 2008;369:532-538.
65. Qin S, Ni M, De Vries GW. Implication of S-adenosylhomocysteine hydrolase in inhibition of TNF-alpha- and IL-1beta-induced expression of inflammatory mediators by AICAR in RPE cells. Invest.Ophthalmol.Vis.Sci. 2008;49:1274-1281.
66. Johnson LV, Leitner WP, Rivest AJ, Staples MK, Radeke MJ, Anderson DH. The alzheimer's A beta -peptide is deposited at sites of complement activation in pathologic deposits associated with aging and age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:11830-11835.
67. Gewurz H, Ying SC, Jiang H, Lint TF. Nonimmune activation of the classical complement pathway. Behring Inst.Mitt. 1993;(93):138-147.
68. Bradt BM, Kolb WP, Cooper NR. Complement-dependent proinflammatory properties of the alzheimer's disease beta-peptide. J.Exp.Med. 1998;188:431-438.
69. McGeer PL, Akiyama H, Itagaki S, McGeer EG. Activation of the classical complement pathway in brain tissue of alzheimer patients. Neurosci.Lett. 1989;107:341-346.
70. Rogers J, Cooper NR, Webster S, et al. Complement activation by beta-amyloid in alzheimer disease. Proc.Natl.Acad.Sci.U.S.A. 1992;89:10016-10020.
109 71. Johnson LV, Leitner WP, Rivest AJ, Staples MK, Radeke MJ, Anderson DH. The alzheimer's A beta -peptide is deposited at sites of complement activation in pathologic deposits associated with aging and age-related macular degeneration. Proc.Natl.Acad.Sci.U.S.A. 2002;99:11830-11835.
72. Dentchev T, Milam AH, Lee VM, Trojanowski JQ, Dunaief JL. Amyloid-beta is found in drusen from some age-related macular degeneration retinas, but not in drusen from normal retinas. Mol.Vis. 2003;9:184-190.
73. Glotin AL, Debacq-Chainiaux F, Brossas JY, et al. Prematurely senescent ARPE-19 cells display features of age-related macular degeneration. Free Radic.Biol.Med. 2008;44:1348- 1361.
74. Goverdhan SV, Ennis S, Hannan SR, et al. Interleukin-8 promoter polymorphism -251A/T is a risk factor for age-related macular degeneration. Br.J.Ophthalmol. 2008;92:537-540.
75. Rao NA. Role of oxygen free radicals in retinal damage associated with experimental uveitis. Trans.Am.Ophthalmol.Soc. 1990;88:797-850.
76. Winkler BS, Boulton ME, Gottsch JD, Sternberg P. Oxidative damage and age-related macular degeneration. Mol.Vis. 1999;5:32.
77. Beatty S, Koh H, Phil M, Henson D, Boulton M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Surv.Ophthalmol. 2000;45:115-134.
78. Cai J, Nelson KC, Wu M, Sternberg P,Jr, Jones DP. Oxidative damage and protection of the RPE. Prog.Retin.Eye Res. 2000;19:205-221.
79. Truscott RJ. Age-related nuclear cataract: A lens transport problem. Ophthalmic Res. 2000;32:185-194.
80. Tsai YY, Lin JM, Wan L, et al. Interleukin gene polymorphisms in age-related macular degeneration. Invest.Ophthalmol.Vis.Sci. 2008;49:693-698.
81. Elner SG, Elner VM, Jaffe GJ, Stuart A, Kunkel SL, Strieter RM. Cytokines in proliferative diabetic retinopathy and proliferative vitreoretinopathy. Curr.Eye Res. 1995;14:1045-1053.
82. Capeans C, Pineiro A, Pardo M, et al. Amniotic membrane as support for human retinal pigment epithelium (RPE) cell growth. Acta Ophthalmol.Scand. 2003;81:271-277.
110
83. Tiffany HL, Lavigne MC, Cui YH, et al. Amyloid-beta induces chemotaxis and oxidant stress by acting at formylpeptide receptor 2, a G protein-coupled receptor expressed in phagocytes and brain. J.Biol.Chem. 2001;276:23645-23652.
111 APPENDICES
4.1Appendix I. Tables
Gene Name Description Genbank Fold p-value change Immune Response 1.98 IL19 Homo sapiens interleukin 19 (IL19) NM_153758 0.0412 Homo sapiens matrix metalloproteinase 8 (neutrophil 1.70 MMP8 collagenase) NM_002424 0.0415 1.56 CD180 Homo sapiens CD180 antigen NM_005582 0.0256 1.54 C6 Homo sapiens complement component 6 (C6) NM_000065 0.0439
Cell adhesion C21orf29 Homo sapiens chromosome 21 open reading frame 29 NM_144991 1.70 0.0463
LAMB2 laminin, beta 2 AW411241 1.70 0.00511
Intracellular signalling cascade
MCF2L MCF.2 cell line derived transforming sequence-like AK094289 1.65 0.0266
SHANK2 Homo sapiens SH3 and multiple ankyrin repeat domains 2 NM_133266 1.53 0.0115
Miscellaneous function KRT20 Apoptosis: keratin 20 CK820760 1.59 0.0158
112 Gene Name Description Genbank Fold p-value change Cell differentiation: sema domain, immunoglobulin domain SEMA3D (Ig), short basic domain, secreted, (semaphorin) 3D NM_152754 1.60 0.0136
Ion channel: transient receptor potential cation channel, TRPC2 subfamily C, member 2 (pseudogene) X89067 1.59 0.0472
Multicellular organismal development: ecotropic viral EVI1 integration site 1 NM_005241 1.67 0.0275
Protein binding: pleckstrin homology domain containing, PLEKHA5 family A member 5 AK126439 1.62 0.0244
TAAR2 Signal transduction: trace amine associated receptor 2 NM_014626 1.51 0.0372
Transcription regulation: basic helix-loop-helix domain BHLHB8 containing, class B, 8 NM_177455 1.57 0.0175
FBXO39 Ubiqitin cycle: F-box protein 39 NM_153230 1.99 0.0425
Unknown function MKS1 Meckel syndrome, type 1 AK090950 2.13 0.0373
C3ORF36 chromosome 3 open reading frame 36 NM_025041 1.79 0.0252
Homo sapiens TTL/TEL fusion protein TTL-T (TTL/TEL AY116214 fusion) mRNA, complete cds. AY116214 1.79 0.0188
LOC51152 Homo sapiens melanoma antigen mRNA, complete cds. AF172850 1.74 0.0129
113 Gene Name Description Genbank Fold p-value change KIAA0774 Homo sapiens KIAA0774 NM_015233 1.69 0.0321
FLJ26056 Homo sapiens cDNA FLJ26056 fis, clone PRS03239. AK129567 1.68 0.0174
AK094379 Homo sapiens cDNA FLJ37060 fis, clone BRACE2014780. AK094379 1.67 0.0378
ALU1_HUMAN (P39188) Alu subfamily J sequence THC2442419 contamination warning entry, partial (14%) THC2442419 1.66 0.0424
AK098562 Homo sapiens cDNA FLJ25696 fis, clone TST04563. AK098562 1.64 0.0156
Homo sapiens mRNA; cDNA DKFZp686G19280 (from HSD3B2 clone DKFZp686G19280). CR627415 1.64 0.0497
TMEM81 transmembrane protein 81 THC2340379 1.63 0.0349
CCDC70 coiled-coil domain containing 70 NM_031290 1.62 0.0429
X92778 H.sapiens mRNA for T cell receptor alpha (clone XPSZ31II) X92778 1.60 0.026
ALU5_HUMAN (P39192) Alu subfamily SC sequence THC2408432 contamination warning entry, partial (6%) THC2408432 1.60 0.0461
THC2411168 THC2411168 1.58 0.0278
C6ORF223 chromosome 6 open reading frame 223 NM_153246 1.57 0.0123
PREDICTED: Homo sapiens similar to olfactory receptor ENST000003 ENST00000358688 (LOC442185) 58688 1.57 0.0244
114 Gene Name Description Genbank Fold p-value change THC2404251 Q8N6M8 (Q8N6M8) IQ motif containing F1, partial (67%) THC2404251 1.53 0.0422
TSP-NY testis-specific protein TSP-NY NM_032573 1.51 0.0426
AW872828 hq69b03.x1 NCI_CGAP_HN13 cDNA clone IMAGE:3124589 3' similar to contains L1.t2 L1 repetitive AW872828 element AW872828 1.50 0.00267
Table 4.1.1. Complete list of differentially expressed genes upregulated in A treated RPE cells at 6 hours. The data is presented as fold changes and log-transformed fold changes. The expression levels of genes greater than 1.5 fold are considered upregulated (p- value <0.05).
115 Gene Name Description Genbank Fold p-value change Immune Response IL26 Homo sapiens interleukin 26 NM_018402 -1.52 0.0477
IL28B Homo sapiens interleukin 28B (interferon, lambda 3) NM_172139 -1.56 0.0123
CXCL10 Homo sapiens chemokine (C-X-C motif) ligand 10 NM_001565 -1.64 0.0445
TSLP Homo sapiens thymic stromal lymphopoietin NM_033035 -1.69 0.0327
Signal transduction
GLP1R Homo sapiens glucagon-like peptide 1 receptor NM_002062 -1.72 0.0298
Homo sapiens olfactory receptor, family 2, subfamily C, OR2C3 member 3 NM_198074 -1.75 0.0356
GPR82 Homo sapiens G protein-coupled receptor 82 NM_080817 -2.63 0.00699
Transporter NDUFS6 NADH dehydrogenase (ubiquinone) Fe-S protein 6 BC050337 -1.54 0.0405
CADPS Homo sapiens Ca2+-dependent secretion activator NM_183393 -1.61 0.0287
Homo sapiens solute carrier family 22 (organic anion SLC22A8 transporter), member 8 (SLC22A8) NM_004254 -1.75 0.0475
Transcription regulation HNF4A Homo sapiens hepatocyte nuclear factor 4, alpha NM_178850 -1.61 0.0226
116 Gene Name Description Genbank Fold p-value change HMG2L1 high-mobility group protein 2-like 1 THC2313103 -1.85 0.0421
HPX-2 H.sapiens HPX-2 X74861 -1.79 0.0155
Miscellaneous function Apoptosis: p53AIP1 mRNA, complete cds; alternatively P53AIP1 spliced. AY302135 -1.54 0.00694
ANXA10 Calcium-ion binding: annexin A10 NM_007193 -2.56 0.00711
NELL2 Cell adhesion: NEL-like 2 (chicken) NM_006159 -1.56 0.0243
Cell-cycle: SMC1 structural maintenance of SMC1L2 chromosomes 1-like 2 (yeast) NM_148674 -1.82 0.0343
Cytoskeleton protein binding: erythrocyte membrane EPB41L5 protein band 4.1 like 5 NM_020909 -1.54 0.0254
DNA repair: elastin (supravalvular aortic stenosis, Williams-Beuren syndrome), mRNA (cDNA clone ELN MGC:70763 IMAGE:6153564), complete cds. BC065566 -2.08 0.023
Endopeptidase inhibitor activity: similar to Complement LOC388503 C3 precursor NM_001013640 -1.69 0.0389
SST G-protein coupled receptor: Homo sapiens somatostatin NM_001048 -1.92 0.049
117 Gene Name Description Genbank Fold p-value change Intracellular signalling cascade: doublecortex; DCX lissencephaly, X-linked (doublecortin) NM_000555 -2.00 0.0411
Metabolism: kynurenine 3-monooxygenase (kynurenine KMO 3-hydroxylase) NM_003679 -1.54 0.0122
CA6 metal-ion binding: carbonic anhydrase VI NM_001215 -1.52 0.0114
Multicellular organismal development: neugrin, neurite NGRN outgrowth associated AL355699 -1.52 0.0422
Multicellular organismal development: mab-21-like 2 (C. MAB21L2 elegans) NM_006439 -1.85 0.0328
MXRA5 Protein binding: matrix-remodelling associated 5 NM_015419 -1.96 0.0169
Proteolysis: ADAM metallopeptidase with ADAMTS16 thrombospondin type 1 motif, 16 AB095949 -1.79 0.0453
FCRL4 Receptor activity: Fc receptor-like 4 NM_031282 -1.49 0.0285
Receptor activity: polycystic kidney and hepatic disease PKHD1L1 1 (autosomal recessive)-like 1 AB051438 -1.61 0.0106
Stress response: DnaJ (Hsp40) homolog, subfamily C, DNAJC5G member 5 gamma NM_173650 -1.56 0.0434
Ubiqitin cycle: ring finger and FYVE-like domain RFFL containing 1 BG260785 -1.59 0.00851
118 Gene Name Description Genbank Fold p-value change Unknown Function
THC2437024 THC2437024 -1.52 0.0176
AF289566 clone pp6455 unknown mRNA AF289566 -1.52 0.031
Homo sapiens family with sequence similarity 9, FAM9C member C (FAM9C) NM_174901 -1.54 0.0227
ANKRD21 ankyrin repeat domain 21 NM_174981 -1.54 0.0371
Homo sapiens cDNA FLJ45419 fis, clone AK127347 BRHIP3035222. AK127347 -1.54 0.0184
Homo sapiens olfactory receptor-like (PJCG9) ENST00000306 ENST00000306515 pseudogene mRNA, partial sequence. 515 -1.54 0.0425
chromosome 10 open reading frame 118, mRNA (cDNA C10orf118 clone IMAGE:5218944), complete cds. BC030557 -1.54 0.0221
ANKRD22 ankyrin repeat domain 22 NM_144590 -1.56 0.0225
Ca2+-dependent secretion activator, mRNA (cDNA ENST00000357 ENST00000357986 clone IMAGE:4308348), partial cds. 986 -1.59 0.0407
FLJ25439 Homo sapiens hypothetical protein FLJ25439 NM_144725 -1.59 0.0379
hypothetical gene supported by BC030596, mRNA LOC400794 (cDNA clone IMAGE:4816496), partial cds. BC020945 -1.61 0.0464
119 Gene Name Description Genbank Fold p-value change AI061292 an32e04.x1 Gessler Wilms tumor cDNA clone IMAGE:1700382 3' similar to contains Alu repetitive AI061292 element;contains element MER22 repetitive element AI061292 -1.64 0.00116
THC2408803 THC2408803 -1.64 0.0376
AF274944 Homo sapiens PNAS-19 mRNA, complete cds. AF274944 -1.67 0.0391
AY358732 retinol dehydrogenase 18 AY358732 -1.72 0.046
C11orf21 C11orf21 mRNA, complete cds. AB029488 -1.75 0.0111
AF030177 N-acetylglucosaminyl transferase component THC2379184 Gpi1 {Homo sapiens;} , partial (4%) THC2379184 -1.75 0.0258
ENST00000360 ENST00000360398 Homo sapiens mRNA; cDNA DKFZp586N0819 398 -1.85 0.00657
LDOC1L leucine zipper, down-regulated in cancer 1-like BC015836 -1.85 0.00859
Human mRNA for IgM kappa light-chain variable (IV) ENST00000283 ENST00000283657 region. 657 -1.85 0.0024
Homo sapiens cDNA FLJ11554 fis, clone AK021616 HEMBA1003037 AK021616 -1.92 0.00302
C20orf160 Homo sapiens chromosome 20 open reading frame 160 NM_080625 -2.00 0.0296
120 Gene Name Description Genbank Fold p-value change Homo sapiens cDNA FLJ32154 fis, clone FLJ32154 PLACE6000070. AK056716 -2.04 0.00988
Table 4.1.2. Complete list of differentially expressed genes downregulated in A treated RPE cells at 6 hours. The data is presented as fold changes and log-transformed fold changes. Decreased expression changes are expressed as – (treatment/control)-1. The expression levels of genes greater than 1.5 fold are considered upregulated (p-value <0.05).
121 4.2Appendix II. Figures
Figure 4.2.1. Photograph of passage 5 (P5) human RPE cells used for A stimulation study.
The RPE cells were grown and maintained in a humidified incubator of 5% CO2 and 95% air in DMEM supplemented with 100 g/ml penicillin, 100 g/ml streptomycin, 100 g/ml L- glutamate and 10% fetal calf serum.
122
Figure 4.2.2. Cell Viability Assay with A (1-42) Stimulation. Post-confluent RPE cells were stimulated with 0.3, 0.1, 0.05, 0.01, or 0.001M solutions of oligomeric A (1-42) at 24 hours. The 96-well plate was developed as described in the materials and methods described in chapter 2. The data depicts the means and standard error from three independent experiments. ANOVA assuming unequal variance followed by the Dunnett‟s post-hoc test were performed were performed on the data, comparing the control group (serum-free DMEM) to the different concentrations of A (1-42) (p-value <0.01). A (1-42) toxicity appears to level off after concentrations higher than 0.01 M.
123
Figure 4.2.3. RNA quality analysis (A) Example of RNA Integrity of P5 RPE cell RNA. rRNA Ratio [28s / 18s] was determined to be 1.9. The RNA Integrity Number (RIN) was found to be 10.0. (B) Gel Electrophoresis displaying both the 28s and 18s band. Experiment performed using Agilent Bioanalyzer 2100 and the Eukaryote Total RNA Nano Series II chip.
124 4.3 Appendix III. Potential manuscript information
Differential changes in gene expression of inflammatory genes in cultured human retinal pigment epithelial cells after beta-amyloid stimulation
Authors: Khaliq H. Kurji1, J. Cui1, T. Lin1, D. Harriman1, S. S. Prasad3, L. Kojic2,
J. Matsubara1*
Address: 1Department of Ophthalmology and Visual Sciences
University of British Columbia
2550 Willow Street
Vancouver, BC, V5Z 3N9, Canada
2Brain Research Centre
University of British Columbia
2211 Wesbrook Mall
Vancouver, BC, V6T 2B5, Canada
3Centre for Biologics Research
Biologics and Genetic Therapies Directorate, Health Canada
251 Sir Frederick Banting Driveway, A/L 2201E
Ottawa, ON, K1A 0L2, Canada
Corresponding Author: *Joanne Matsubara ([email protected])
Department of Ophthalmology and Visual Sciences
University of British Columbia, Vancouver, BC V5Z 3N9, Canada
125