Cell Costimulatory Receptor CD28 Protein That Interacts with The

GRID: A Novel Grb-2-Related Adapter Protein That Interacts with the Activated T Cell Costimulatory Receptor CD28

This information is current as Jonathan H. Ellis, Claire Ashman, M. Neil Burden, of September 25, 2021. Katherine E. Kilpatrick, Mary A. Morse and Paul A. Hamblin J Immunol 2000; 164:5805-5814; ; doi: 10.4049/jimmunol.164.11.5805

http://www.jimmunol.org/content/164/11/5805 Downloaded from

References This article cites 59 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/164/11/5805.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. GRID: A Novel Grb-2-Related Adapter Protein That Interacts with the Activated T Cell Costimulatory Receptor CD28

Jonathan H. Ellis,1* Claire Ashman,* M. Neil Burden,* Katherine E. Kilpatrick,‡ Mary A. Morse,† and Paul A. Hamblin*

Adapter proteins such as Grb2 play a central role in the formation of signaling complexes through their association with multiple protein binding partners. These interactions are mediated by specialized domains such as the well-characterized Src homology SH2 and SH3 motifs. Using yeast three-hybrid technology, we have identiﬁed a novel adapter protein, expressed predominantly in T lymphocytes, that associates with the activated form of the costimulatory receptor, CD28. The protein is a member of the Grb2 family of adapter proteins and contains an SH3-SH2-SH3 domain structure. A unique glutamine/proline-rich domain (insert domain) of unknown function is situated between the SH2 and N-terminal SH3 domains. We term this protein GRID for Grb2- related protein with insert domain. GRID coimmunoprecipitates with CD28 from Jurkat cell lysates following activation of CD28. Downloaded from Using mutants of CD28 and GRID, we demonstrate that interaction between the proteins is dependent on phosphorylation of CD28 at tyrosine 173 and integrity of the GRID SH2 domain, although there are also subsidiary stabilizing contacts between the PXXP motifs of CD28 and the GRID C-terminal SH3 domain. In addition to CD28, GRID interacts with a number of other T cell signaling proteins, including SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa), p62dok, and RACK-1 (receptor for activated protein kinase C-1). These ﬁndings suggest that GRID functions as an adapter protein in the CD28-mediated costimulatory pathway in T cells. The Journal of Immunology, 2000, 164: 5805–5814. http://www.jimmunol.org/

ne of the emerging paradigms for signal transduction in A large number of such motifs have been identified, including SH2 lymphocytes is that receptors and other signaling mole- and PTB domains, which bind phosphotyrosine residues; SH3 do- O cules operate not in isolation but through the recruitment mains, which bind PXXP motifs; leucine zippers; and many others of a complex of other proteins (1, 2). These serve to amplify and with less well-defined ligand specificities (7). A common feature is diversify the signal into a number of biochemical cascades. This that these individual sequence modules appear to behave as inde- model is exemplified by the TCR, where the formation of the Ag/ pendent functional units, facilitating the evolution of proteins bear- MHC/TCR trimolecular complex results in activation of an Src ing various combinations and numbers of domains. These may be by guest on September 25, 2021 family kinase and phosphorylation of various chains of CD3, prin- combined with a catalytic domain, such as a protein tyrosine ki- cipally CD3␨ (3). ZAP70 recognizes this activated receptor and is nase, as evidenced in the Src family of PTKs (2). Alternatively, in lck itself activated by p56 -mediated phosphorylation (4, 5). ZAP70 adapter proteins such as Grb2, the entire sequence is comprised of phosphorylates a number of downstream targets, such as SH2 do- such modules (7–9). The sole function of these molecules appears 2 main-containing leukocyte protein of 76 kDa (SLP-76) and LAT to be the formation of associations or bridges between other (linker for activation of T cells) (6). These proteins are essential for proteins. directing the assembly of multiprotein signaling complexes, which The stimulation of T lymphocytes by APC is known to require are known to include other adapter proteins, such as Grb2 and Sos. the activation of two intracellular signaling pathways. The primary Formation of these multiprotein complexes links proximal signal- 2ϩ signal is provided upon ligation of the TCR by MHC in conjunc- ing events to downstream pathways such as Ras activation, Ca tion with cognate peptide. Depending upon the presence or the mobilization, up-regulation of transcription factors such as NF-AT absence of a second costimulatory signal, T cells can enter an and AP-1, and ultimately the elevated expression of genes required activated or nonresponsive (anergic) state. The most potent and for proliferation and differentiation. best characterized costimulatory signal arises from the interaction Central to the formation of these complexes is a set of protein of TCR CD28 with its counter-receptors, CD80 and CD86, on the domains specialized for forming associations with other proteins. surface of APC (10, 11). Activation of CD28 is associated with the recruitment of nonreceptor PTKs, principally p56lck (12–14) and itk/emt *Immunopathology and †Immunology Units, GlaxoWellcome Medicines Research p72 (15, 16) and the subsequent phosphorylation of tyrosine Centre, Stevenage, United Kingdom; and ‡Department of Molecular Sciences, Glaxo- residues in the CD28 cytoplasmic domain, creating ligands for Wellcome, Inc., Research Triangle Park, NC 27709 proteins containing SH2 domains, formation of a multiprotein sig- Received for publication August 30, 1999. Accepted for publication March 21, 2000. naling complex, activation of the lipid kinase and Ras pathways, The costs of publication of this article were defrayed in part by the payment of page and eventually changes in gene transcription, including the up- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. regulation of survival factors such as IL-2 and Bcl-xL (17) A number of studies have examined the molecular composition 1 Address correspondence and reprint requests to Dr. Jonathan Ellis, Molecular Im- munology Unit, GlaxoWellcome, Medicines Research Centre, Gunnels Wood Road, of the proximal CD28 signaling complex. These suggest that the Stevenage, SG1 2NY, U.K. E-mail address: [email protected] major site for recruitment of downstream proteins appears to be a 2 Abbreviations used in this paper: SLP-76, SH2 domain-containing leukocyte protein motif around Tyr173, which is phosphorylated by p56lck, leading to of 76 kDa; PI-3-kinase, phosphoinositide 3Ј-kinase; GRID, Grb2-related protein with insert domain; EST, expressed sequence tag; PTK, protein tyrosine kinase; LAT, binding of the p85 subunit of PI-3-kinase (18) and Grb2 (19, 20). linker for activation of T cells; RACK-1, receptor for activated protein kinase C-1. To identify other proteins that may be recruited to the activated

Table I. Description of the CD28 and GRID mutations mutations described by Liu and McGlade (26). The GRID amino-terminal and carboxyl-terminal SH3 were inactivated by single-point mutations converting proline residues at positions 47 and 321, respectively, to leucine Mutants Description of mutation residues (N-SH3* and C-SH3* constructs). A double mutant (N-SH3*/C- CD28 SH3*) was also constructed in which both SH3 domains were inactivated. CD28-Y Wild-type CD28 The SH2 domain was inactivated by a single-point mutation converting CD28-F Y173F, mutation of p56lck phosphorylation site arginine 83 to lysine (SH2*). Finally, a mutant form of GRID lacking the CD28-P1 P178A/P181A, mutation of N-terminal PXXP unique proline/glutamine domain (or insert domain) was generated in ⌬ motif which aa 156–273 were deleted ( insert). The extent of the insert domain CD28-P2 P190A/P193A, mutation of C-terminal PXXP was determined by mapping the amino acid sequence of GRID onto the motif known three-dimensional crystal structure of Grb2 (A. Lewis, GlaxoWell- CD28-PP Mutation of both PXXP motifs come, Stevenage, U.K., unpublished observation). GRID Expression studies SH2* R83K, inactivated SH2 domain N-SH3* P47L, inactivated N-terminal SH3 domain Spleen and lymph node cDNA libraries were gifts from Dr. E. Zanders C-SH3* P321L, inactivated C-terminal SH3 domain (GlaxoWellcome); other cDNA libraries were obtained from Invitrogen N/C-SH3* P47L/P321L, inactivated both SH3 domains (Groningen, The Netherlands). Each PCR reaction contained ϳ2ngof ⌬insert Deletion of insert domain (aa 156–273) cDNA and 1 ␮M of each primer. GAPDH primers were: CE102, 5Ј-AC CACAGTCCATGCCATCAC; and CE103, 5Ј-TCCACCACCCTGTT GCTGTA. GRID ampliﬁcations used the following primers: CE 71, 5Ј- CD28 receptor, we have used a CD28 cytoplasmic domain phos- CATCGGATCCTTCCTTAGAGACAGAACCCGAGAA; and CE72, 5Ј- 173 CATCGAATTCTTACCACCGCACTCGCCCTGCCGCCTG. For RT- phorylated at Tyr as the “bait” in a yeast two-hybrid screen. 6 Downloaded from In this paper we describe the identiﬁcation of a novel T cell PCR, 10 actively growing cells were lysed, and total RNA was prepared using the SV Total RNA Isolation kit (Promega, Madison, WI). RT-PCR adapter protein and a detailed characterization of its interaction was performed using the Access kit (Promega). Each reaction contained with the costimulatory receptor CD28. This protein, termed GRID, RNA from the equivalent of 8 ϫ 104 cells and primers at 1 ␮M. Reactions possesses an SH3-SH2-SH3 domain structure and shares extensive were cycled using the supplied protocol for the indicated number of iter- homology with other adapter proteins, such as Grb2 and Grap (9, ations. The primers were those described above. Analysis of GRID expression in activated T cells was performed using a variant of the T cell co-

21). GRID also contains a unique proline/glutamine-rich domain stimulation assay described previously (27). Briefly, CD4-positive T cells http://www.jimmunol.org/ of unknown function. We demonstrate that GRID associates with were isolated from peripheral blood, plated out into wells coated with CD28 in vivo following activation of the receptor and, further- activating anti-CD3 and anti-CD28 Abs (clones OKT3 and 9.3; both from more, that it associates with a number of downstream signaling American Type Culture Collection, Manassas, VA), and incubated at 37°C molecules, including RACK-1, p62dok, and SLP-76. Based on for various times up to 48 h before being harvested for RNA isolation and RT-PCR as described above. Cell activation and subsequent proliferation these findings, we postulate an important role for GRID in the were assayed in parallel incubations by pulsing with [3H]thymidine after CD28 costimulatory pathway. 48 h, and the incorporated radioactivity was quantitated by scintillation counting. Materials and Methods GST fusion proteins and mAbs Cloning by guest on September 25, 2021 GRID wild-type and mutant constructs comprising the entire coding se- Standard molecular biology techniques were employed throughout. The quence, tagged with appropriate restriction enzyme sites, were PCR am- sequences of all constructs were verified by fluorescent dye terminator plified and cloned into pGEX-4T3 (Pharmacia, St. Albans, U.K.) to form sequencing. Database searches were performed using the BLAST tool (22). an in-frame fusion with the vector-encoded GST protein. Expression and Parental yeast trihybrid vectors, screening and selection methods, and the purification of GST-GRID and control GST proteins were performed as H9 cDNA library were essentially as described previously (23). For anal- previously described (24). One 8-wk-old female SJL mouse (The Jackson ysis of the CD28-GRID interaction, the cytoplasmic tail of CD28 was Laboratory, Bar Harbor, ME) was immunized on days 0, 2, 5, and 7 with cloned into the binding domain yeast vector pAS1. All GRID constructs 10 ␮g of recombinant GST-GRID using the RIMMS (repetitive immuni- were cloned into the yeast activation domain vector pACT2. Both plasmids zations, multiple sites) immunization and fusion strategy (28). On day 9 a were cotransformed into a yeast strain (Y4.1lck) stably expressing the pro- total of 7.3 ϫ 107 cells were isolated from pooled lymph nodes and used tein tyrosine kinase p56lck under an inducible promoter and selected on to prepare hybridomas. These were subjected to limiting dilution cloning, appropriate plates. Qualitative estimates of the association of CD28 and and clones were selected that secreted Ig immunoreactive for GST-GRID GRID were determined using methods described previously (24), while but not for control GST protein. semiquantitative data were obtained from a modified liquid assay using an average of three to five independent clones (25). For identification of pro- Protein complex precipitation teins that associated with GRID, GRID was cloned into the binding domain yeast vector pAS1 and stably transformed into the yeast strain Y190. This Actively growing Jurkat cells were washed in serum-free medium, acti- yeast strain was subsequently transformed with an H9 cDNA library in- vated by treatment with anti-CD28 and anti-CD3 Abs cross-linked with ϫ 7 serted into the yeast activation domain vector. goat anti-mouse Ig antiserum for 4 min, and lysed at 2 10 /ml in ice-cold RIPA buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS Mutagenesis of CD28 in PBS with added protease and phosphatase inhibitors). After centrifugation, the clarified lysate was precleared by tumbling with glutathione- Inserts encoding wild-type or various mutants of the CD28 cytoplasmic Sepharose (Pharmacia) at 4°C for 1 h. The supernatant was transferred to domain (summarized in Table I) were prepared by PCR amplification from tubes containing glutathione-Sepharose precharged with either GST-GRID overlapping oligonucleotide templates (24). In the CD28F mutant, tyrosine or GST and incubated overnight at 4°C. After extensive washing in RIPA 173, the principal target for p56lck phosphorylation and SH2 domain bind- buffer, protein complexes were eluted by boiling in SDS-PAGE sample ing, was mutated to phenylalanine. The CD28-P1 mutant contains a double buffer, separated by SDS-PAGE, and blotted to a polyvinylidene difluoride mutation at the first (most N-terminal) PXXP SH3 recognition motif, such membrane (Millipore, Bedford, MA). Precipitated proteins were visualized that the PRRP sequence (aa 178–181) was mutated to ARRA. Similarly, by enhanced chemiluminescent Western blot using antisera specific for the CD28-P2 mutant contains a double mutation at the second (most C- human Sam68 (SC333, Santa Cruz Biotechnology, Santa Cruz, CA), Sos2 terminal) PXXP SH3 recognition motif, such that the sequence PYAP (aa (SC258, Santa Cruz Biotechnology), and SLP-76 (SC1961, Santa Cruz 190–193) was mutated to AYAA. In the CD28-PP mutant, both PXXP Biotechnology). motifs were mutated as described above. Coimmunoprecipitation studies Mutagenesis of GRID Actively growing Jurkat (J6) cells were washed in PBS, resuspended in Various different mutants of GRID (summarized in Table I) were generated serum-free medium, and activated by treatment with anti-CD28 mAb (9.3) using an overlapping PCR strategy, based on domain-inactivating point and cross-linking goat anti-mouse IgG. Cells were then lysed on ice for 15 The Journal of Immunology 5807

Table II. Structure of the human GRID gene

Exon cDNA Residuesa Feature Exon Size (bp) Exon Startb Intron Size (bp)

1 Ϫ223 to Ϫ15 5Ј untranslated cϾ208 46,624 NA 2 Ϫ14 to 78 N-terminal SH3 92 92,595 45762 3 79 to 170 N terminal SH3 92 101,321 8634 4 171 to 290 SH2 120 105,557 4144 5 291 to 459 SH2 169 111,492 5815 6 460 to 690 Insert 231 113,544 1883 7 691 to 813 Insert 123 114,913 1138 8 814 to stop plus 3ЈUTR C-terminal SH3 3Ј untranslated Ͼ476d 116,407 1371

a Sequence numbering as per Fig. 1. b Sequence numbering as per GenBank entry Z82206. c Deﬁnitive transcription start site not established. d Consensus polyadenylation signal at position 116,859.

min in Nonidet P-40 lysis buffer containing protease inhibitors (29). After tion 388 of the J6 sequence, a second nonconservative mutation centrifugation the clarified lysate was tumbled overnight with Sepharose- was also present at position 954. The codon spanning this position Downloaded from conjugated protein A (Sigma, P3391) at 4°C. After extensive washing with is CCT (leucine) in the J6 sequence and CTT (phenylalanine) in Nonidet P-40 lysis buffer, protein complexes were eluted by boiling in SDS-PAGE sample buffer, separated by SDS-PAGE, and blotted to poly- the H9 sequence. vinylidene difluoride membrane. GRID or p85 association was visualized The J6 cDNA sequence encodes a polypeptide of 38 kDa pre- by enhanced chemiluminescent Western blotting reagents using the anti- dicted Mr with extensive homology to adapter proteins such as GRID mAb (1-13.4) or polyclonal anti-p85 (Upstate Biotechnology, Lake Grb2 (9) and Grap (21, 32). This novel adapter protein was termed Placid, NY; no. 06-195). GRID (Grb2-related protein with insert domain). Like Grb2 and http://www.jimmunol.org/ GRID-CD28 phosphopeptide ELISA Grap, GRID consists of an N-terminal SH3 domain, an SH2 domain, and a C-terminal SH3 domain. Uniquely, however, the se- Two peptides were selected corresponding to the CD28 sequence around tyrosine 173. The control peptide, [biotin]-KLLHSDYMNMTPR, and the quence also contains a proline and a glutamine region, lying be- phosphorylated peptide, [biotin]-KLLHSDpYMNMT, were chemically tween the SH2 and C-terminal SH3 domains. This domain, which synthesized ([biotin]-K indicates a lysyl residue bearing a biotin moiety, we term the insert domain, has no strong similarity with other and pY indicates a phosphotyrosine residue). Nunc Maxisorp microtiter proteins. plates (Naperville, IL) were coated with 2 ␮g/ml of streptavidin (STAR1B, Serotec, Kidlington, U.K.), washed with Tris-buffered saline/0.1% Tween- During preparation of this work, a number of other workers have 20, and blocked with a 3% (w/v) solution of BSA in PBS. After washing deposited sequences identical with GRID in the GenBank data- as described above, a 5-␮M solution of peptide was bound for1hatroom base: GrbX, accession number AF090456; GrbLG, AJ011736; by guest on September 25, 2021 temperature, washed, and then exposed to GST-GRID wild-type, GST- Grf40, AF042380; Gads, Y18051; and Grap-2, AF102694 (26, 33, GRID SH2 domain, GST-GRID insert domain, or GST for1hatroom 34). Comparison of these cDNA sequences identifies a number of temperature. Bound GST protein was quantified using a goat anti-GST primary Ab (Pharmacia) and an HRP-conjugated anti-goat secondary Ab conservative point mutations in the coding sequence. Although the (A5420, Sigma, Poole, U.K.). Bound peroxidase activity was visualized putative open reading frame from the J6 sequence is identical with using a chromogenic substrate (Fast OPD, Sigma) according to the man- those described above, the H9 sequence produces a protein se- ufacturer’s instructions. The color reaction was terminated by the addition quence with a single mutation (L320F). Although the GenBank of 3 M sulfuric acid and was measured at 490 nm. database does not contain any full-length cDNA clones that pos- Results sess the GRID phenylalanine variant, two EST clones (accession no. R02185 and R08413) do contain this mutation, suggesting that Cloning of GRID and sequence analysis the H9 sequence obtained in this study represents an authentic We have applied the yeast trihybrid system (23, 30) to screen for polymorphism in the GRID DNA sequence. proteins capable of binding to the cytoplasmic domain of CD28 in which the tyrosine residue Y173 has been phosphorylated by co- Identification of murine GRID expression of p56lck. The screen identified a number of clones We subsequently used the full-length GRID cDNA sequence to from a library derived from the H9 T cell line, one of which is rescreen GenBank for related murine nucleotide sequences. Two described in the present report. significant matches were obtained. The first was an EST (accession The initial sequence obtained from the yeast two-hybrid screen no. AA537513; IMAGE Consortium Clone ID 949818) from the was used to identify a number of ESTs from GenBank. These were Washington University/Howard Hughes Medical Institute Mouse used to build a composite sequence encoding an open reading EST/IMAGE Consortium Project (35). The appropriate clone was frame of 993 nucleotides, starting with an ATG codon in a context obtained from the IMAGE Consortium, and the entire 1.4-kb insert suitable for translation initiation (31). PCR primers spanning the was sequenced (accession no. AF236118). The results revealed an entire putative coding sequence were used to isolate full-length open reading frame of 966 bp encoding a protein 88% identical cDNA sequences from both a Jurkat J6 cell line and an H9 cDNA with GRID, possessing two SH3 domains, one SH2 domain, and, library. In both cases, a single band of ϳ1 kb was obtained, cloned, significantly, the insert domain. Based on the structure and degree and sequenced. The DNA for the Jurkat J6 cell line (J6 sequence) of homology, we believe that this sequence represents the murine and the H9 cDNA library (H9 sequence) have been submitted to orthologue of GRID. the GenBank database and assigned accession numbers AF236120 and AF236119. Human GRID gene structure Comparison of the J6 and H9 sequences revealed only two base We also identified a 144-kb human genomic sequence (accession changes. Although a conservative mutation was observed at posi- no. Z82206; submitted by the Sanger Centre Chromosome 22 5808 GRID: A NOVEL CD28 BINDING PROTEIN Downloaded from

FIGURE 2. Expression of GRID message. A, cDNA libraries from a variety of normal human tissues were subjected to PCR using primers for GRID (45 cycles) or as a positive control, GAPDH (35 cycles). Samples of http://www.jimmunol.org/ the reactions were analyzed by agarose gel electrophoresis. B, Total RNA was prepared from equal numbers of Jurkat, MAW, OZZ, and Thp1 cells and was subjected to 45 cycles of RT-PCR using primers for GRID and GAPDH.

after activation using an anti-CD28 Ab. Fig. 1B shows that the amount of GRID present in anti-CD28 immunoprecipitations sub-

stantially increased upon CD28 activation, suggesting that GRID by guest on September 25, 2021 was actively recruited to the signaling complex following CD28 activation. As a positive control, CD28 immunoprecipitations were FIGURE 1. In vivo association of GRID and CD28. A, mAb 1-13.4 was also probed with Abs to the p85 subunit of PI-3-kinase, a signaling raised against GST-GRID. This Ab detected a single band in Jurkat cell protein that is recruited to activated CD28 (18). A substantial in- lysates (39 kDa) and CHO cell lysates transiently transfected with Xpress- crease in CD28-associated p85 was also observed, although the tagged GRID (41 kDa). B, GRID was recruited to CD28 upon activation of kinetics of GRID and p85 association with CD28 were different the receptor with anti-CD28 antisera. At various time points following (Fig. 1C). GRID association with CD28 peaked at 1–4 min and activation of CD28, cell lysates were immunoprecipitated (IP) with anti- declined thereafter, while p85 association continued to increase CD28 antisera and blotted (IB) for GRID. C, As a positive control, the throughout the time course of activation. association of the p85 subunit of PI-3-kinase with CD28 following activation of the receptor was confirmed by immunoprecipitating (IP) with Expression of GRID message anti-CD28 antisera and blotting (IB) for p85 subunit. The most closely related genes, Grb2 and Grap, show markedly Mapping Project) containing the GRID 5Ј untranslated region, the different expression patterns. Grb2 is ubiquitously expressed, entire coding region, and the 3Ј untranslated region in a total of whereas Grap expression is predominantly confined to hemopoi- eight exons (Table II). This clone is annotated as mapping to chro- etic cells (9, 21, 32, 37). We therefore investigated the tissue dis- mosomal band 22q12-22qter, whereas the other members of the tribution of GRID expression. cDNAs isolated from a variety of family, Grb2 and Grap, lie on chromosome 17 (36) (J. H. Ellis, normal human tissues were used as templates in PCRs with prim- unpublished observations). These data in combination with a sim- ers spanning a portion of the GRID sequence encoded by several ilarity dendrogram (data not shown) suggest that GRID probably exons (Table II). The primers were positioned to detect any splice diverged from a common proto-Grb2 ancestor before the diver- variants of GRID in which the exons encoding the unique insert gence of Grb2 and Grap. domain were absent, which would produce a protein product very similar to Grb2 and Grap. GRID associates with CD28 in vivo Specific signals were obtained only from spleen and lymph node An mAb (mAb 1-13.4) was raised against a full-length GST-GRID cDNA, with extensive amplification failing to demonstrate expres- fusion protein as described in Materials and Methods. This Ab sion in other tissues, including skin, liver, colon, muscle, and lung detected a single 39-kDa band in a Western blot analysis of Jurkat (Fig. 2A). To refine these data further, we prepared RNA from four J6 total cell lysate (see Fig. 1A), confirming that the mAb does not cell lines representing major cell types of lymphoid tissue: Jurkat cross-react with the other family members, Grb2 and Grap. T cells; two EBV-transformed B cell lines, OZZ and MAW (38); To determine whether GRID interacts with CD28 in vivo, CD28 and the monocytic line Thp1. These were used in RT-PCR reac- was immunoprecipitated from Jurkat cell lysates both before and tions with primers specific for GRID (Fig. 2B). Of the cells tested, The Journal of Immunology 5809

FIGURE 3. Regulation of GRID expression. Samples of RNA were obtained from purified peripheral blood CD4-positive T lymphocytes after 0, 8, 18, 24, or 48 h of incubation with activating anti-CD3 and anti-CD28 Abs. These were used in RT-PCR reactions with primers specific for GRID (50 cycles) or GAPDH (35 cycles), and samples were separated by agarose gel electrophoresis. To verify successful cell activation, parallel triplicate cultures of cells were pulsed with [3H]thymidine after 48 h of incubation either with or without activating Abs, and the amount of label incorporated was determined by scintillation counting. Activated cells incorporated a mean of 23,481 cpm; unactivated cells incorporated 262 cpm. Downloaded from only the Jurkat T cell line showed expression of GRID message. These results were confirmed by Western blotting (data not shown), indicating that GRID is principally expressed in T lymphocytes. Only amplification products consistent with full-length

GRID messages were observed, offering no support for the exis- http://www.jimmunol.org/ tence of splice variants. To examine the modulation of GRID expression by external stimuli, purified human peripheral blood CD4-positive lymphocytes were activated in vitro by exposure to immobilized anti-CD3 and anti-CD28 Abs, and RNA samples obtained at a number of time points. These were analyzed for GRID mRNA content by FIGURE 4. Qualitative assessments of the association of CD28 and GRID. RT-PCR (Fig. 3) using conditions optimized to detect any increase The yeast strain Y4.1lck was transformed with the following constructs: A, in expression over the time-course of the experiment. The results CD28-Y; B, wild-type GRID; C, CD28-Y and wild-type GRID; D, CD28-Y show that GRID mRNA is present in resting CD4-positive lym- and wild-type GRID; E, CD28-F and wild-type GRID; F, CD28-F and wild- by guest on September 25, 2021 phocytes, supported by the fact that GRID protein is also readily type GRID; G, CD28-Y and GRID SH2*; H, CD28-Y and GRID SH2*; I, CD28-Y and p85SH2-C; J, CD28-Y and p85SH2-C. A–C, E,G,andI, De- detectable by Western blotting (data not shown). Levels of GRID veloped in the absence of p56lck activity; D, F, H, and J, developed in the mRNA are substantially up-regulated over 48 h following activa- presence of p56lck activity, which phosphorylates CD28 on Y173. tion compared with GAPDH levels, which show only a moderate increase over the same time course, consistent with cell proliferation. The results of RT-PCR and Western blotting indicate that were able to detect binding of GRID to isolated tyrosine phos- while GRID is present in resting CD4-positive cells, consistent phopeptides that span the tyrosine 173 phosphorylation site (Fig. with its role in early activation events, the level of GRID transcript 6). GRID was unable to bind to unphosphorylated peptides. Fi- is significantly up-regulated upon activation over a period of 48 h. nally, using the yeast three-hybrid system, we were unable to ob- serve binding of GRID to either the cytoplasmic tail of CTLA4 or Analysis of the GRID CD28 interaction CD3␨, suggesting that GRID is specific to the CD28 signaling Having established that GRID is indeed a physiological binding pathway. partner for activated CD28 receptors, we undertook a detailed Tyrosine 173 is contained within the sequence YMNM, a known analysis of the molecular basis of the GRID:CD28 interaction. A SH2 (Src homology 2) recognition motif for adapter proteins such series of CD28 and GRID mutants were generated and cloned into as Grb2 (19, 39, 40). The importance of the GRID SH2 domain for the yeast two-hybrid vectors (see Table I for details) association with CD28 was evaluated using complementary ap- We used a modification of the yeast two-hybrid system in which proaches to those described above. Inactivation of the GRID SH2 the active form of p56lck was coexpressed under an inducible pro- domain (SH2*) by a single-point mutation completely abolished moter to examine the importance of CD28 phosphorylation at CD28 binding even in the presence of phosphorylated CD28 (Figs. Y173 on the binding of GRID (23). In the absence of p56lck ac- 4, G and H, and Fig. 5). Because the isolated SH2 domain was also tivity no interaction between GRID and CD28 was observed (Fig. able to bind to CD28 phosphopeptides (Fig. 6), this suggests that 4C) while a strong interaction was detected when Lck activity was the SH2 domain was both necessary and sufficient for GRID-CD28 induced (Fig. 4D). Comparable levels of association were detected association. when the C-terminal SH2 domain of the p85 subunit of PI-3-kinase SH2 domains from the Grb2 family of proteins represent a dis- was used (p85SH2-C, see Fig. 4, I and J). The importance of the tinct structural class of SH2 domain, due to the presence of a phosphorylation of Y173 was underlined by the inability of the tryptophan residue (W121) in the EF loop which sterically hinders CD28F mutant to bind GRID under any conditions tested (Fig. 4, the binding of the pTyr ϩ 3 residue of the SH2 recognition motif E and F). A quantitative form of this assay (25) demonstrated that (41, 42). This feature imposes constraints on the conformation of the CD28-F mutation caused a 99% decrease in the association of phosphopeptide ligands for the SH2 domain which are quite dif- GRID with CD28 (Fig. 5A). Using purified GST fusion protein, we ferent from those associated with SH2 domains from Src family 5810 GRID: A NOVEL CD28 BINDING PROTEIN

FIGURE 5. Semiquantitative assessments of the association of CD28 and GRID. Values represent the average of three to ﬁve independent clones. A, Analysis of the interaction of the GRID SH2 domain with the SH2 binding motif (pYXNX) in the CD28 cytoplasmic tail. B, Analysis of the interaction of the GRID SH3 domains with the PXXP motifs in the CD28 cytoplasmic tail. Downloaded from

ϩ kinases (40). As a result of this structural feature, phosphopeptide tions and the finding that the asparagine at position Y 2 is essen- http://www.jimmunol.org/ ligands for the Grb2 SH2 fit the consensus sequence pYXNX, tial for the SH2-mediated association of Grb2 and CD28, as re- where pY indicates a phosphorylated tyrosine residue, and N is an ported by Kim and co-workers (19). invariant asparagine residue (19, 39). From a comparison of the sequences of the GRID, Grb2, and Grap SH2 domains, we predicted that the GRID SH2 domain would share this specificity. To Contribution of the GRID SH3 domains and PXXP recognition test this hypothesis, we examined the target specificity of the motifs to GRID-CD28 binding GRID SH2 domain (in the context of a full-length protein) by Although our data demonstrate that the SH2:phosphotyrosine 173 mutating the CD28 SH2 binding motif around the Y173 phosphor- interaction was both necessary and sufficient to mediate associa- by guest on September 25, 2021 ylation site, aa 172-DYMNM-176. Mutations D172V and M174V tion of GRID with the CD28 cytoplasmic domain, there are other had no effect on GRID binding, while the mutations N175K or possible interactions between these proteins. The association of the M174V/N175K abolished GRID binding (data not shown). These related adapter protein Grb2 and CD28 is stabilized by the inter- results indicate that the GRID binding motif conforms to the Grb2 action of the two SH3 domains with the PXXP motifs in the CD28 binding motif of pYXNX, consistent with our structural predic- cytoplasmic tail (19, 20). To assess the contributions of these motifs to the overall interaction of GRID and CD28, we used mutants of these proteins in a quantitative form of the yeast two-hybrid system. Parallel experiments were conducted with the isolated C- terminal SH2 domain of the p85 subunit of PI-3-kinase, confirming that the mutations in the PXXP motifs did not interfere with phosphorylation of Tyr173 by p56lck or binding of this site by an SH2 domain (data not shown). The contribution of the PXXP SH3 recognition motifs in the cytoplasmic tail of CD28 to GRID binding was evaluated using the CD28-P1, CD28-P2, and CD28-PP mutants. Fig. 5B shows that whilst both PXXP motifs may contribute to GRID binding, the first motif PRRP (aa 178–181) is the most significant. We also conducted complementary experiments using a wild-type CD28 cytoplasmic domain, and variants of GRID with one or both SH3 domains inactivated. Disabling the N-terminal SH3 domain of GRID (N-SH3*) had no effect on the binding to phosphorylated CD28, while inactivation of the C-terminal SH3 domain (C-SH3* and N-SH3*/C-SH3*) reduced CD28 binding by 70% compared with wild-type GRID (Fig. 5B). These data suggest that like Grb2, the overall association of GRID and CD28, was stabilized by interac- FIGURE 6. Binding of GRID to CD28 phosphopeptides. The binding of tions between C-terminal SH3 domain of GRID and the PXXP GRID to CD28 was evaluated using purified GST-GRID proteins and peptides corresponding to the sequence around the phosphorylation site motifs in the CD28 cytoplasmic tail (19, 20). For GRID, the prin- (Y173). The binding of purified fusion proteins, including GST, GST- cipal SH3 association site is the N-terminal PXXP motif (residues GRID, GST-GRID SH2 domain, and GST-GRID insert domain, to phos- 178–181), which is in contrast to Grb2 where the most C-terminal phorylated or unphosphorylated peptide was quantified by ELISA. PXXP motif (residues 190–193) is the most important. The Journal of Immunology 5811

Discussion Cloning of a novel CD28 binding protein The activation of T cells is known to require two stimulatory signals. The primary signal is generated by the interaction of the TCR with a MHC-peptide complex on the surface of APC. Dependent upon the presence or the absence of a second costimulatory signal, T cells are either activated or anergized. The most potent costimulatory signal arises from the interaction of CD80/CD86 on APC with the T cell receptor CD28. Although some components of the CD28 signaling pathway have already been identified, we are in- terested in identifying novel components that contribute to the costimulatory signal. Using a phosphorylated form of the CD28 cytoplasmic domain to mimic an activated receptor, we have employed yeast three-hybrid technology to clone a novel CD28 binding protein that we term GRID. FIGURE 7. Binding of GRID to signaling proteins. The binding of GRID shares extensive homology with a small family of adapter GRID to SLP-76, RACK-1, Sos2, and Sam68 was evaluated using purified proteins typified by Grb2 (50). Although it possesses an SH3-SH2- GST-GRID proteins. GST and GST-GRID were incubated with Jurkat cell SH3 domain structure similar to that of Grb2 and the other known lysates prepared from resting cells and cells activated with anti-CD28 and Downloaded from family member, Grap, GRID also has a proline/glutamine-rich do- anti-CD3 Abs. Coimmunoprecipitants were probed with the appropriate antiserum. main (the insert domain) that lacks strong similarity to any other sequence in GenBank, located between the SH2 and C-terminal SH3 domains. Our analysis of the human genome sequence cur- GRID associates with other signaling proteins rently available indicates that GRID is encoded by at least eight exons in the 22q12 chromosomal band, in contrast to the Grb2 and

To explore the spectrum of downstream proteins that GRID might http://www.jimmunol.org/ serve to recruit to CD28, we investigated its ability to form com- Grap genes, which lie on chromosome 17. Although the exon plexes with other proteins known to be involved in T cell signaling structure of GRID is such that it would be possible to splice out the pathways. Sos and Sam68 associate with the adapter protein Grb2 insert domain exons to leave a protein with the same architecture and are known to be involved in T-cell signaling events leading to as Grb2 and Grap, our studies of GRID gene expression have only Ras activation (43–46). In an attempt to detect GRID-Sos or identified mRNA transcripts consistent with the full-length protein. GRID-Sam68 interactions, we incubated Jurkat cell lysates with During the preparation of this study for publication, sequences purified GST-GRID fusion protein. Whereas Sos2 and Sam68 identical with GRID were independently reported by a number of were all detected when GRID was precipitated with glutathione other groups (26, 33, 34, 51, 52). These reports confirm our finding

Sepharose, none of these proteins was present when GST alone that GRID is primarily expressed in T lymphocytes. In contrast to by guest on September 25, 2021 was used (Fig. 7). The specific binding to Sos2 is supported by two reports (52, 53), using RT-PCR we find no evidence for the yeast two-hybrid data, which showed that GRID and GRID N- expression of GRID in monocytic/macrophage cell lines (Thp1) or SH3* were able to associate with Sos2, while a single-point mu- freshly isolated human macrophage cells, either at rest or in an tation in the C-terminal SH3 domain (GRID C-SH3*) completely activated state (data not shown). This distribution is even more abolished binding (data not shown). restricted than that of Grap (T and B cells) (32) and is very distinct Additionally, GRID was used as a bait in a yeast two-hybrid from the ubiquitous expression of Grb2 (9). screen in an attempt to identify novel GRID interacting proteins. Using this approach we isolated a number of clones that were able GRID is a physiological part of the CD28 signaling complex to associate with GRID. Some of these clones represent sequences Our discovery that GRID interacts with the phosphorylated cyto- not present in the GenBank database and are currently the subject plasmic tail of CD28 in vitro suggested that it may form a com- of further investigation. In addition to these novel sequences, three ponent of the CD28 signaling complex in vivo. Through RT-PCR previously characterized clones were obtained that encoded studies, we have established that the GRID gene is expressed in SLP-76 (47), the GTPase-activating protein p62dok (48, 49) and resting naive CD4-positive peripheral blood T lymphocytes, and RACK-1. GST and GST-GRID were incubated with lysates from that expression is further up-regulated following cell activation. either resting or activated Jurkat cells. Analysis of the coimmuno- This profile is consistent with a gene product involved in the ear- precipitant revealed that GRID was able to associate with both liest events of T cell signaling. Conclusive demonstration of SLP-76 and RACK-1 in either resting or activated cells (Fig. 7). GRID’s involvement in CD28 signaling is provided by our observation (Fig. 1B) that cross-linking of CD28 in intact T cells is Function of the GRID insert domain accompanied by rapid recruitment of GRID to the costimulatory To investigate the contribution of the GRID proline/glutamine-rich receptor signaling complex. insert domain to CD28 association, binding of the GRID insert To dissect the GRID-CD28 interaction further, we conducted an deletion mutant (⌬insert) to CD28 was quantitated and was com- extensive molecular analysis of the proteins using a variety of in parable to that of wild-type GRID (Fig. 5B). This observation was vitro systems. Tyrosine phosphorylation at residue 173 of CD28 is supported by the fact that the isolated GRID insert domain did not absolutely essential to allow GRID to bind. Phosphorylation of this bind CD28 phosphopeptide (Fig. 6), suggesting that the GRID in- residue by p56lck (and possibly also p72itk/emt) is one of the first sert domain did not contribute to CD28 binding. Furthermore, the sequelae of CD28 activation (12–16). We note that this same phos- absence of the insert domain had no effect on the ability of GST- photyrosyl residue forms a key part of the binding site for the p85 GRID to immunoprecipitate SLP-76 from Jurkat cell lysates, adapter subunit of PI-3-kinase, raising the intriguing possibility of whereas a single-point mutation in the C-terminal SH3 domain competition between the two adapter proteins for the activated completely abolished binding to SLP-76 (data not shown). receptor, and the scope for differential signals to arise. In support 5812 GRID: A NOVEL CD28 BINDING PROTEIN of this possibility, GRID and p85 recruitment to CD28 show dif- Analysis of the GRID SH2 domain amino acid sequence reveals ferent kinetics (Fig. 1, B and C); the GRID content in CD28 im- the presence of a tryptophan residue analogous to the tryptophan munoprecipitates peaks at 1 min after activation and declines to residue (W121) in Grb2 that defines the target specificity of the basal (or even subbasal) levels by 30 min, whereas the p85 content SH2 domain in this family of adapter proteins (19, 39). As a result increases gradually over 30 min. of this structural feature, phosphotyrosine motifs bound by the Targeted inactivation of the SH3 and SH2 domains of GRID by Grb2 SH2 domain fit the consensus pYXNX. site directed mutagenesis showed that the SH2 domain of GRID is Several of the reported GRID interacting proteins possess phos- also essential for CD28 association. The SH3 domains appear to photyrosine motifs that meet the Grb2 consensus, including CD28 provide some additional sites of interaction, binding to one or both (pYMNM) (the present study), Fms (pYKNI) (52), p66Shc of the PXXP motifs in the CD28 cytoplasmic domain, but their (pYYND and pYVNV) (26), and LAT (pYVNV) (34, 53), sug- role is subordinate to that of the SH2 domain, perhaps acting as gesting that the SH2 recognition motif of GRID and that of Grb2 stabilizing factors as has been reported for the Grb2-CD28 inter- have broadly similar binding specificities. In our initial experimen- action (19). Deletion of the insert domain does not modulate the tal analysis of GRID’s SH2 domain recognition properties, we ability of GRID to bind CD28. In vitro, the isolated SH2 domain found that mutation of the asparagine residue (N175) in the CD28 of GRID is sufficient to bind a phosphorylated CD28 peptide, al- cytoplasmic domain abolishes GRID binding, whereas alterations though an isolated GRID insert domain was not. Taken together, at the preceding residue, Met174, have no effect, as predicted by the these data indicate that GRID binds to phosphorylated CD28 pri- consensus. marily via a conventional SH2 domain-mediated mechanism. However, although there are clearly similarities between the

family members, there are also differences; for example, Grap does Downloaded from What does GRID bring to the CD28 signaling complex? not bind the phosphorylated CD28 cytoplasmic domain in systems where GRID binding is clear (K. Fuller, unpublished observation). To delineate the spectrum of signaling proteins that GRID may We also found signiﬁcant differences in the spectrum of proteins serve to recruit to a signaling complex, we and others have em- that associate with the SH3 domains of these adapters. For exam- ployed a number of biochemical techniques. GRID has been di- ple, p62dok and RACK-1 seem to interact speciﬁcally with GRID, rectly implicated in T cell signaling pathways due to its constitu-

showing no binding to Grb2 or Grap (C. Ashman, unpublished http://www.jimmunol.org/ tive association with SLP-76 and its ability to enhance SLP-76- observations). In contrast, Sos2 appears to have the ability to bind dependent signaling mediated by the TCR (34, 53). Using two to all family members. independent approaches, we have also confirmed SLP-76 as a These observations suggest that Grb2, Grap, and GRID are un- binding partner for GRID. SLP-76 was identified in a yeast two- likely to form a redundant pool of adapters, but instead have hybrid screen using GRID as the bait. Furthermore, SLP-76 was unique properties to contribute to a signaling complex. Each pro- coimmunoprecipitated with GST-GRID fusion protein from Jurkat vides a means to trigger common activation pathways such as cell lysates. Using GST fusion proteins encoding targeted mutants those downstream of Ras, but gives a different context to the signal of GRID, we also found that the interaction of GRID with SLP-76 through the recruitment of highly specific partners. Such a multi-

was dependent upon the integrity of the C-terminal SH3 domain. by guest on September 25, 2021 plex approach appears highly suited to the complex signaling en- In contrast, mutations in the SH2 or N-terminal SH3 domains or vironment of T cells, where a number of different positive and deletion of the insert domain had no effect on the binding of GRID negative signals (those arising from TCR, CD28, and CTLA4, for to SLP-76. example), must be amplified, integrated, and interpreted before a In addition to SLP-76, p62dok and RACK-1 were identified in a final outcome emerges. It may therefore not be a coincidence that yeast two-hybrid screen using GRID as the bait. RACK-1 may T cells uniquely express all three proteins, GRID, Grap, and Grb2, anchor PKC to the cytoskeleton and function in T cell signaling whereas most cells express only Grb2. pathways (54, 55). The role for PKC in CD28-mediated signaling remains controversial, with PKC inhibitors reported to have op- What is the role of GRID in T cells? posing effects on CD28-dependent activation of T cells (10). Because GRID expression is essentially restricted to T cells and is p62dok is a GTPase-activating protein and is phosphorylated upon recruited to the CD28 costimulatory receptor upon activation, what activation of CD28 (49). The association between p62dok and is the specific role of GRID in T cells? We draw out two comple- GRID is discussed further below. mentary hypotheses from the current information on this adapter Grb2 has been shown to act as a link between activated recep- protein. tors and downstream signaling pathways such as Ras activation by First, we note that most of the signals associated with CD28 recruiting proteins such as the guanine nucleotide exchange factor activation (activation of PI-3-kinase, Ras, and ceramide turnover) Sos (56, 57). Using affinity chromatography and a yeast two-hy- are common to other signaling pathways within the T cell. The best brid assay, we have also demonstrated that GRID can bind Sos2 characterized proximal signal that appears to be specifically asso- via its C-terminal SH3 domains and the T cell signaling/adapter ciated with CD28 triggering is the phosphorylation of p62dok; TCR protein Sam68. These data suggest that GRID does have the ca- activation does not result in this phosphorylation event (49). The pacity to bind Sos2, although the physiological relevance of this present findings that GRID, but not Grap or Grb2, associates with finding awaits further clarification. both p62dok and CD28, suggest that GRID may recruit p62dok to CD28, where it becomes phosphorylated by the active Src and/or Specificity within the Grb2 family Tec family PTKs in the complex. A GRID-mediated p62dok acti- Because GRID shows such strong similarity to the other identified vation may therefore provide a specific costimulatory context for members of this family of adapter proteins, Grb2 and Grap, the interpretation of the other activation signals that arise as a conse- question of specificity arises. Are the three proteins essentially quence of receptor activation. redundant adapters, simply serving to recruit a broad set of com- This model has intriguing parallels with observations from mon signaling molecules to activated receptors, or does each form chronic myeloid leukemia cells that express a constitutively active complexes with a different (though perhaps overlapping) set of PTK oncogene, p210bcr/abl. In one such cell line, p62dok is consti- molecules? tutively phosphorylated due to the activity of p210bcr/abl, even The Journal of Immunology 5813

though it does not interact directly with the PTK (58). GRID has 18. Pages, F., M. Ragueneau, R. Rottapel, A. Truneh, J. Nunes, J. Imbert, and been shown to bind autophosphorylated p210bcr/abl and also to be D. Olive. 1994. Binding of phosphatidylinositol-3-OH kinase to CD28 is required for T-cell signalling. Nature 369:327. expressed at high levels in another CML line (26), suggesting that 19. Kim, H. H., M. Tharayil, and C. E. Rudd. 1998. Growth factor receptor-bound in CML cells as well as T cells, GRID may serve as a bridge to protein 2 SH2/SH3 domain binding to CD28 and its role in co-signaling. J. Biol. recruit p62dok to an activating PTK environment. Chem. 273:296. 20. Okkenhaug, K., and R. Rottapel. 1998. Grb2 forms an inducible protein complex Secondly, GRID has recently been reported to associate with with CD28 through a Src homology 3 domain-proline interaction. J. Biol. Chem. LAT (linker for T cell activation, previously known as pp36) fol- 273:21194. 21. Feng, G. S., Y. B. Ouyang, D. P. Hu, Z. Q. Shi, R. Gentz, and J. Ni. 1996. Grap lowing activation of the T cells via cross-linking of the TCR (34, is a novel SH3-SH2-SH3 adaptor protein that couples tyrosine kinases to the Ras 53). Furthermore, activation of CD28 induces rapid tyrosine phos- pathway. J. Biol. Chem. 271:12129. phorylation of LAT in the absence of ZAP-70 and Syk (59), which 22. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403. may be consistent with GRID recruiting LAT to a zone of PTK 23. Fuller, K. J., M. A. Morse, J. H. White, S. J. Dowell, and M. J. Sims. 1998. activity associated with an active costimulatory receptor. It is in- Development of a yeast trihybrid screen using stable yeast strains and regulated teresting to note that following CD28 activation GRID association protein expression. BioTechniques 25:85. 24. Ellis, J. H., R. P. Sutmuller, M. J. Sims, and S. Cooksley. 1998. Functional with CD28 peaks at 1–4 min, while the peak in LAT phosphory- analysis of the T-cell-restricted protein tyrosine kinase Txk. Biochem J. 335:277. lation occurs shortly thereafter (5–10 min). We postulate, there- 25. Harshman, K. D., W. S. Moye-Rowley, and C. S. Parker. 1988. Transcriptional fore, that among other roles, GRID may provide the link between activation by the SV40 AP-1 recognition element in yeast is mediated by a factor similar to AP-1 that is distinct from GCN4. Cell 53:321. CD28 and LAT, acting as a crucial intermediary in the formation 26. Liu, S. K., and C. J. McGlade. 1998. Gads is a novel SH2 and SH3 domain- of a multiprotein signaling complex that serves as an integration containing adaptor protein that binds to tyrosine-phosphorylated Shc. Oncogene

point for signals from both the TCR and costimulatory receptors. 17:3073. Downloaded from 27. Ellis, J. H., M. N. Burden, D. V. Vinogradov, C. Linge, and J. S. Crowe. 1996. Recent cellular studies showing that antisense oligomer-mediated Interactions of CD80 and CD86 with CD28 and CTLA4. J. Immunol. 156:2700. down-regulation of GRID activity inhibits activation marker up- 28. Kilpatrick, K. E., S. A. Wring, D. H. Walker, M. D. Macklin, J. A. Payne, regulation following T cell stimulation (P. A. Hamblin et al., J. L. Su, B. R. Champion, B. Caterson, and G. D. McIntyre. 1997. Rapid development of affinity matured monoclonal antibodies using RIMMS. Hybridoma manuscript in preparation) are consistent with a role for GRID in 16:381. T cell costimulatory signaling. 29. Slavik, J. M., J. E. Hutchcroft, and B. E. Bierer. 1999. CD80 and CD86 are not equivalent in their ability to induce the tyrosine phosphorylation of CD28. J. Biol. http://www.jimmunol.org/ Acknowledgments Chem 274:3116. 30. Osborne, M. A., S. Dalton, and J. P. Kochan. 1995. The yeast tribrid system: We are grateful to Dr. Michelle Young for advice on the GST pulldown genetic detection of trans-phosphorylated ITAM-SH2-interactions. BioTechnol- ogy 13:1474. experiments, to Dr. Paul Life for the EBV-transformed B cell lines, and to 31. Kozak, M. 1984. Compilation and analysis of sequences upstream from the trans- Dr. Alan Lewis for molecular modeling. lational start site in eukaryotic mRNAs. Nucleic Acids Res. 12:857. 32. Trub, T., J. D. Frantz, M. Miyazaki, H. Band, and S. E. Shoelson. 1997. The role References of a lymphoid-restricted, Grb2-like SH3-SH2-SH3 protein in T cell receptor signaling. J. Biol. Chem. 272:894. 1. Pawson, T., and J. D. Scott. 1997. Signaling through scaffold, anchoring, and 33. Qiu, M., S. Hua, M. Agrawal, G. Li, J. Cai, E. Chan, H. Zhou, Y. Luo, and adaptor proteins. Science 278:2075. M. Liu. 1998. Molecular cloning and expression of human grap-2, a novel leu- 2. Rudd, C. E. 1999. Adaptors and molecular scaffolds in immune cell signaling. kocyte-specific SH2- and SH3-containing adaptor-like protein that binds to by guest on September 25, 2021 Cell 96:5. gab-1. Biochem. Biophys. Res. Commun. 253:443. 3. Cantrell, D. 1996. T cell antigen receptor signal transduction pathways. Annu. 34. Asada, H., N. Ishii, Y. Sasaki, K. Endo, H. Kasai, N. Tanaka, T. Takeshita, Rev. Immunol. 14:259. S. Tsuchiya, T. Konno, and K. Sugamura. 1999. Grf40, A novel Grb2 family 4. Chan, A. C., M. Iwashima, C. W. Turck, and A. Weiss. 1992. ZAP-70: a 70kD member, is involved in T cell signaling through interaction with SLP-76 and ␨ protein-tyrosine kinase that associates with the TCR chain. Cell 71:649. LAT. J. Exp. Med. 189:1383. 5. Chan, A. C., M. Dalton, R. Johnson, G. H. Kong, T. Wang, R. Thoma, and 35. Lennon, G., C. Auffray, M. Polymeropoulos, and M. B. Soares. 1996. The T. Kurosaki. 1995. Activation of ZAP-70 kinase activity by phosphorylation of I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their tyrosine 493 is required for lymphocyte antigen receptor function. EMBO J. expression. Genomics 33:151. 14:2499. 36. Yulug, I. G., S. E. Egan, C. G. See, and E. M. Fisher. 1994. Mapping GRB2, a 6. Zhang, W., J. Sloan-Lancaster, J. Kitchen, R. P. Trible, and L. E. Samelson. 1998. signal transduction gene in the human and the mouse. Genomics 22:313. LAT: the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular 37. Suen, K. L., X. R. Bustelo, T. Pawson, and M. Barbacid. 1993. Molecular cloning activation. Cell 92:83. of the mouse grb2 gene: differential interaction of the Grb2 adaptor protein with 7. Peterson, E. J., J. L. Clements, N. Fang, and G. A. Koretzky. 1998. Adaptor epidermal growth factor and nerve growth factor receptors. Mol. Cell. Biol. 13: proteins in lymphocyte antigen-receptor signaling. Curr. Opin. Immunol. 10:337. 5500. 8. Clark, S. G., M. J. Stern, and H. R. Horvitz. 1992. C. elegans cell-signalling gene sem-5 encodes a protein with SH2 and SH3 domains. Nature 356:340. 38. Life, P., J. F. Gauchat, V. Schnuriger, S. Estoppey, G. Mazzei, A. Durandy, 9. Lowenstein, E. J., R. J. Daly, A. G. Batzer, W. Li, B. Margolis, R. Lammers, A. Fischer, and J. Y. Bonnefoy. 1994. T cell clones from an X-linked hyper- A. Ullrich, E. Y. Skolnik, D. Bar-Sagi, and J. Schlessinger. 1992. The SH2 and immunoglobulin (IgM) patient induce IgE synthesis in vitro despite expression of SH3 domain-containing protein GRB2 links receptor tyrosine kinases to Ras nonfunctional CD40 ligand. J. Exp. Med. 180:1775. 39. Schneider, H., Y. C. Cai, K. V. Prasad, S. E. Shoelson, and C. E. Rudd. 1995. T signaling. Cell 70:431. ras 10. Ward, S. G. 1996. CD28: a signaling perspective. Biochem. J. 318:361. cell antigen CD28 binds to the GRB-2/SOS complex, regulators of p21 . Eur. 11. Sperling, A. I., and J. A. Bluestone. 1996. The complexities of T-cell co-stimu- J. Immumol. 25:1044. lation: CD28 and beyond. Immunol. Rev. 153:155. 40. Songyang, Z., S. E. Shoelson, J. McGlade, P. Olivier, T. Pawson, X. R. Bustelo, 12. Hutchcroft, J. E., B. Tsai, and B. E. Bierer. 1996. Differential phosphorylation of M. Barbacid, H. Sabe, H. Hanafusa, T. Yi, et al. 1994. Specific motifs recognized the T lymphocyte costimulatory receptor CD28: activation-dependent changes by the SH2 domains of Csk, 3BP2, fps/fes, GRB-2, HCP, SHC, Syk, and Vav. and regulation by protein kinase C. J. Biol. Chem. 271:13362. Mol. Cell. Biol. 14:2777. 13. King, P. D., A. Sadra, J. M. Teng, L. Xiao-Rong, A. Han, A. Selvakumar, 41. Ogura, K., S. Tsuchiya, H. Terasawa, S. Yuzawa, H. Hatanaka, V. Mandiyan, A. August, and B. Dupont. 1997. Analysis of CD28 cytoplasmic tail tyrosine J. Schlessinger, and F. Inagaki. 1999. Solution structure of the SH2 domain of residues as regulators and substrates for the protein tyrosine kinases, EMT and Grb2 complexed with the Shc-derived phosphotyrosine-containing peptide. LCK. J. Immunol. 158:580. J. Mol. Biol. 289:439. 14. Gibson, S., A. August, D. Branch, B. Dupont, and G. M. Mills. 1996. Functional 42. Ettmayer, P., D. France, J. Gounarides, M. Jarosinski, M. S. Martin, LCK is required for optimal CD28-mediated activation of the TEC family ty- J. M. Rondeau, M. Sabio, S. Topiol, B. Weidmann, M. Zurini, et al. 1999. Struc- rosine kinase EMT/ITK. J. Biol. Chem. 271:7079. tural and conformational requirements for high-affinity binding to the SH2 do- 15. Siliciano, J. D., T. A. Morrow, and S. V. Desiderio. 1992. itk, a T-cell-specific main of Grb2. J. Med. Chem. 42:971. tyrosine kinase gene inducible by interleukin 2. Proc. Natl. Acad. Sci. USA 89: 43. Reif, K., L. Buday, J. Downward, and D. A. Cantrell. 1994. SH3 domains of the 11194. adapter molecule Grb2 complex with two proteins in T cells: the guanine nucle- 16. Gibson, S., A. August, Y. Kawakami, T. Kawakami, B. Dupont, and G. B. Mills. otide exchange protein Sos and a 75-kDa protein that is a substrate for T cell 1996. The EMT/ITK/TSK (EMT) tyrosine kinase is activated during TCR sig- antigen receptor-activated tyrosine kinases. J. Biol. Chem. 269:14081. naling: LCK is required for optimal activation of EMT. J. Immunol. 156:2716. 44. Fath, I., F. Apiou, F. Schweighoffer, M. C. Chevallier-Multon, T. Ciora, 17. Boise, L. H., A. J. Minn, P. J. Noel, C. H. June, M. A. Accavitti, T. Lindsten, and B. Dutrillaux, and B. Tocque. 1993. Identification of two human homologues to C. B. Thompson. 1995. CD28 costimulation can promote T cell survival by Drosophila SOS (son of sevenless) localized on two different chromosomes. Nu- enhancing the expression of Bcl-XL. Immunity 3:87. cleic Acids Res. 21:4398. 5814 GRID: A NOVEL CD28 BINDING PROTEIN

45. Rozakis-Adcock, M., R. Fernley, J. Wade, T. Pawson, and D. Bowtell. 1993. The with the macrophage colony-stimulating factor receptor, is implicated in mono- SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras cyte/macrophage development. EMBO J. 17:7273. activator mSos1. Nature 363:83. 53. Liu, S. K., N. Fang, G. A. Koretzky, and C. J. McGlade. 1999. The hematopoi- 46. Fusaki, N., A. Iwamatsu, M. Iwashima, and J. Fujisawa. 1997. Interaction be- etic-specific adaptor protein gads functions in T-cell signaling via interactions tween Sam68 and Src family tyrosine kinases, Fyn and Lck, in T cell receptor with the SLP-76 and LAT adaptors. Curr. Biol. 9:67. signaling. J. Biol. Chem. 272:6214. 54. Liliental, J., and D. D. Chang. 1998. Rack1, a receptor for activated protein 47. Yablonski, D., M. R. Kuhne, T. Kadlecek, and A. Weiss. 1998. Uncoupling of kinase C, interacts with integrin ␤ subunit. J. Biol. Chem. 273:2379. nonreceptor tyrosine kinases from PLC-␥1 in an SLP-76-deficient T cell. Science 55. Ron, D., C. H. Chen, J. Caldwell, L. Jamieson, E. Orr, and D. Mochly-Rosen. 281:413. 1994. Cloning of an intracellular receptor for protein kinase C: a homolog of the 48. Wong, G., O. Muller, R. Clark, L. Conroy, M. F. Moran, P. Polakis, and ␤ subunit of G proteins. Proc. Natl. Acad. Sci. USA 91:839. F. McCormick. 1992. Molecular cloning and nucleic acid binding properties of 56. Byrne, J. L., H. F. Paterson, and C. J. Marshall. 1996. p21ras activation by the the GAP- associated tyrosine phosphoprotein p62. Cell 69:551. guanine nucleotide exchange factor Sos, requires the Sos/Grb2 interaction and a 49. Klasen, S., F. Pages, J. F. Peyron, D. A. Cantrell, and D. Olive. 1998. Two second ligand-dependent signal involving the Sos N-terminus. Oncogene distinct regions of the CD28 intracytoplasmic domain are involved in the tyrosine 13:2055. phosphorylation of Vav and GTPase activating protein-associated p62 protein. 57. Hu, Y., and D. D. Bowtell. 1996. Sos1 rapidly associates with Grb2 and is hy- Int. Immunol. 10:481. pophosphorylated when complexed with the EGF receptor after EGF stimulation. 50. Koretzky, G. A. 1997. The role of Grb2-associated proteins in T-cell activation. Oncogene 12:1865. Immunol. Today 18:401. 58. Carpino, N., D. Wisniewski, A. Strife, D. Marshak, R. Kobayashi, B. Stillman, and 51. Law, C. L., M. K. Ewings, P. M. Chaudhary, S. A. Solow, T. J. Yun, B. Clarkson. 1997. p62dok: a constitutively tyrosine-phosphorylated, GAP-associated A. J. Marshall, L. Hood, and E. A. Clark. 1999. GrpL, a Grb2-related adaptor protein in chronic myelogenous leukemia progenitor cells. Cell 88:197. protein, interacts with SLP-76 to regulate nuclear factor of activated T cell ac- 59. Tsuchida, M., E. R. Manthei, S. J. Knechtle, and M. M. Hamawy. 1999. CD28 tivation. J. Exp. Med. 189:1243. ligation induces rapid tyrosine phosphorylation of the linker molecule LAT in 52. Bourette, R. P., S. Arnaud, G. M. Myles, J. P. Blanchet, L. R. Rohrschneider, and the absence of Syk and ZAP-70 tyrosine phosphorylation. Eur. J. Immunol. G. Mouchiroud. 1998. Mona, a novel hematopoietic-specific adaptor interacting 29:2354. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021