Journal of Autoimmunity 78 (2017) 19e28
Contents lists available at ScienceDirect
Journal of Autoimmunity
journal homepage: www.elsevier.com/locate/jautimm
Chemokine receptor CXCR3 deficiency exacerbates murine þ autoimmune cholangitis by promoting pathogenic CD8 T cell activation
Hong-Di Ma a, Wen-Tao Ma a, Qing-Zhi Liu a, Zhi-Bin Zhao a, Mu-Zi-Ying Liu a, Koichi Tsuneyama b, Jin-Ming Gao c, William M. Ridgway d, Aftab A. Ansari e, ** * M. Eric Gershwin f, Yun-Yun Fei g, , Zhe-Xiong Lian a, h, a Liver Immunology Laboratory, Institute of Immunology and The CAS Key Laboratory of Innate Immunity and Chronic Disease, School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, China b Department of Molecular and Environmental Pathology, Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima, Japan c Department of Respiratory Disease, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences, Beijing, China d Division of Immunology, Allergy and Rheumatology, University of Cincinnati, Cincinnati, OH, USA e Department of Pathology, Emory University, Atlanta, GA, USA f Division of Rheumatology, Allergy and Clinical Immunology, University of California at Davis School of Medicine, Davis, CA, USA g Department of Rheumatology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences, Beijing, China h Innovation Center for Cell Signaling Network, Hefei National Laboratory for Physical Sciences at Microscale, Hefei, Anhui, China article info abstract
Article history: CXC Chemokine Receptor 3 (CXCR3) is functionally pleiotropic and not only plays an important role in Received 18 October 2016 chemotaxis, but also participates in T cell differentiation and may play a critical role in inducing and Received in revised form maintaining immune tolerance. These observations are particularly critical for autoimmune cholangitis 1 December 2016 in which CXCR3 positive T cells are found around the portal areas of both humans and mouse models of Accepted 1 December 2016 primary biliary cholangitis (PBC). Herein, we investigated the role of CXCR3 in the pathogenesis of Available online 24 January 2017 autoimmune cholangitis. We have taken advantage of a unique CXCR3 knockout dnTGFbRII mouse to focus on the role of CXCR3, both by direct observation of its influence on the natural course of disease, as Keywords: Interferon-gamma induced chemokines well as through adoptive transfer studies into Rag / mice. We report herein that not only do CXCR3 fi Primary biliary cholangitis de cient mice develop an exacerbation of autoimmune cholangitis associated with an expanded effector þ CD8þT cell gene expression profile memory T cell number, but also selective adoptive transfer of CXCR3 deficient CD8 T cells induces þ T-bet autoimmune cholangitis. In addition, gene microarray analysis of CXCR3 deficient CD8 T cells reveal an KLRG1 intense pro-inflammatory profile. Our data suggests that the altered gene profiles induced by CXCR3 þ deficiency promotes autoimmune cholangitis through pathogenic CD8 T cells. These data have signif- icance for human PBC and other autoimmune liver diseases in which therapeutic intervention might be directed to chemokines and/or their receptors. © 2017 Elsevier Ltd. All rights reserved.
Abbreviations: PBC, Primary biliary cholangitis; dnTGFbRII, TG, dominant negative transforming growth factor b receptor II; CXCR3, CXC Chemokine Receptor 3; WT, wide type; TGC3, dnTGFbRII CXCR3-/-; MNCs, mononuclear cells; CTL, cytotoxic lymphocyte; APCs, antigen-presenting cells; DCs, dendritic cells; IFN-g, interferon-g; TNF-a, tumor necrosis factor alpha; IL-6, interleukin-6; MIG, monokine induced by gamma-interferon; IP-10, interferon-induced protein of 10 kDa; I-TAC, interferon-inducible T cell alpha chemoattractant; CXCL9, chemokine (C-X-C motif) ligand 9; CXCL10, chemokine (C-X-C motif) ligand 10; ELISA, enzyme-Linked Immunosorbent Assay; AMAs, anti-mito- chondrial antibodies; Th1, T helper 1; Tem, effector memory T cells; KLRG1, killer cell lectin-like receptor G1; CAMs, cell adhesion molecules; KEGG, Kyoto Encyclopedia of Genes and Genomes; GPCRs, G proteinecoupled receptors. * Corresponding author. Liver Immunology Laboratory, Institute of Immunology and The CAS Key Laboratory of Innate Immunity and Chronic Disease, School of Life Sciences and Medical Center, University of Science and Technology of China, Hefei, 230027, China. ** Corresponding author. Department of Rheumatology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences, Beijing, 100032, China. E-mail addresses: [email protected] (Y.-Y. Fei), [email protected] (Z.-X. Lian). http://dx.doi.org/10.1016/j.jaut.2016.12.012 0896-8411/© 2017 Elsevier Ltd. All rights reserved. 20 H.-D. Ma et al. / Journal of Autoimmunity 78 (2017) 19e28
1. Introduction Kusatsu, Shiga, Japan). The expression levels of target genes (Cxcl9 and Cxcl10) were normalized to the housekeeping gene b2- CXCR3 is a chemokine receptor highly expressed on effector T microglobulin and the results calculated by DDCt [17]. Known cells and critically involved in both T cell trafficking and the dif- standards were included throughout. Primer sequences were based ferentiation of T cells into distinct functional subsets [1]. CXCR3 is on Primer-Bank (http://pga.mgh.harvard.edu/primerbank) and upregulated following CTL and Th1 cell differentiation [2]. CXCL9 blasted to confirm the target genes using Primer-Blast (http:// (MIG), CXCL10 (IP-10), and CXCL11 are the natural ligands of CXCR3 www.ncbi.nlm.nih.gov/tools/primer-blast). The primer sequences [3e5]. CXCR3 is functionally pleiotropic; it plays an important role used were as follows:b2-microglobulin, 50- CCGAACA- in the chemotaxis of Tregs to sites of inflammation following TACTGAACTGCTACGTAA -30 and 50- CCCGTTCTTCAGCATTTGGA -3’; binding [6,7], but also participates in T cell differentiation [5,8]. Cxcl9, 50- AATGCACGATGCTCCTGCA -30 and 50- AGGTCTTTGAGG- CXCR3 expression on T cells alters the balance between effector and GATTTGTAGTGG -3’; Cxcl10, 50-GCCGTCATTTTCTGCCTCA-30 and 50- þ memory CD8 T cell generation [9]. Finally, the CXCL11-CXCR3 CGTCCTTGCGAGAGGGATC-3’. The primers were synthesized by chemokine axis polarizes naive T cells and repolarizes effector Sangon Biotech (Shanghai, China). þ CD4 T cells into IL-10hi Tr1 cells to induce an immune-tolerizing state [10]. Our lab has been studying the pathogenesis of human 2.3. Enzyme-linked immunosorbent assays (ELISA) PBC and during the course of these studies reported significant increases in the levels of soluble IP-10 (CXCL10) and MIG (CXCL9) in TG and TGC3 mice livers were homogenized in PBS and centri- PBC and also a marked increase in the frequency of CXCR3 fuged for 5 min at 5000 g; supernatants were assayed using a expressing T cells in both blood and liver [11]. An epigenetic study CXCL9/MIG Quantikine ELISA Kit or Mouse CXCL10/IP-10/CRG-2 of DNA from PBC revealed aberrant demethylation of the CXCR3 Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, US). Serum þ promoter in CD4 T cells [12]. antiePDC-E2 (AMA) was measured by ELISA with purified recom- DnTGFbRII mice, transgenic for directed expression of a binant PDC-E2 as previously described [18] and including positive dominant-negative form of TGFb receptor type II (dnTGFbRII), un- and negative controls. der the direction of the CD4 promoter [13], develop autoimmune cholangitis [14]. DnTGFbRII mice mimic several key phenotypic 2.4. Serum cytokines features of human PBC, including spontaneous production of AMAs, lymphocytic liver infiltration with periportal inflammation and an Serum concentration of IFN-g, TNF-a and IL-6 from TG and TGC3 inflammatory cytokine profile. Furthermore, using adoptive trans- mice were quantitated using a mouse Th1/Th2/Th17 CBA kit (BD þ fer studies we have demonstrated that the CD8 T cell is pathogenic Biosciences, Franklin Lakes, NJ, US), using FACSVerse flow cytom- effector population [15]. In this study, we have advanced our work eter (BD Bioscience). Data were analyzed by FCAP Array™ v3.0.1 by developing CXCR3 gene deleted dnTGFbRII (TG) mice. We report (BD Bioscience) Software. herein that knocking-out CXCR3 significantly worsens autoimmune cholangitis and that the mechanism is secondary to generation of a 2.5. Liver tissue preparation and histological scoring þ hyper-activated CD8 T cells which promote biliary pathology. These data are significant for human autoimmune disease in which Liver from TG and TGC3 mice were fixed with 4% para- blockade of CXCR3 or its ligands is proposed. formaldehyde, embedded in paraffin and cut into 4 mm sections for hematoxylin-eosin (H&E) staining. Liver portal inflammation 2. Materials and methods scores were “blindly” performed on H&E-stained liver sections using a set of 4 indices by a “blinded” pathologist (K.T.), based on 2.1. Mice the levels of inflammation surrounding middle-large portal tract; the indices were scored as 0, none; 1, mild; 2, moderate; and 3, dnTGFbRII (TG) mice on a C57BL/6 back-ground (B6.Cg-Tg(Cd4- severe inflammation. TGFBR2)16Flv/J) [13] were initially derived from Jackson Labora- tory. The maintenance and genetic monitoring of this colony has 2.6. Preparation of hepatic mononuclear cells and flow cytometric been previously reported [14]. CXCR3 knockout mice on a C57BL/6 analysis background were previously established by gene targeting [16] and were kindly provided by Dr. Bao Lu (Harvard Medical School, Bos- Hepatic mononuclear cells were isolated as described [19].For ton, MA, USA). dnTGFbRII CXCR3-/- (TGC3) mice were obtained by flow cytometry analysis, hepatic mononuclear cells were blocked selectively backcrossing TG mice with CXCR3 knockout mice. 8e14 by incubation with anti-mouse CD16/32 (Biolegend, San Diego, CA, week old female TGC3 mice were used in all experiments. B6/ US) and stained with fluorochrome-conjugated antibodies (Abs) at Rag1-/- mice (Ly5.2) were obtained from Jackson Laboratory. 8e9 4 C in PBS with 0.2% bovine serum albumin for 20 min. All þ week old female Rag1-/- mice were used as recipients in our CD8 T fluorochrome-conjugated Abs, unless otherwise noted, were pur- þ adoptive transfer model. All mice were housed in a specific chased from Biolegend. To identify liver CD8 T cells and different T pathogen-free and controlled environment (22 C, 55% humidity, cell subsets, hepatic mononuclear cells from TG and TGC3 mice and 12-h day/night rhythm) and care provided according to the were stained with PacificBlue-CD3 (17A2), APC-Cy7-CD8a (19517), regulations of animal care at University of Science and Technology V500-CD4 (RM4-5, BD Bioscience), PE-Cy7-NK1.1 (PK136), PE- of China (Hefei, Anhui, China). CXCR3 (CXCR3-173), FITC-CD44 (IM7), PerCP/Cy5.5-CD62L (MEL- 14), APC-KLRG-1 (2F1/KLRG-1). Intracellular transcriptional factor 2.2. RNA preparation, reverse transcription and quantitative real- T-bet was stained by PerCP/Cy5.5-T-bet (4B10) and Alexa 647- time PCR Foxp3 (MF14). Normal IgG isotype controls (Biolegend) were used as controls. Total RNA was extracted from the liver of wide type B6 and TG For intracellular cytokine staining, hepatic mononuclear cells mice using Trizol (Invitrogen, Carlsbad, CA, US). M-MLV Tran- were stimulated in vitro with Cell Stimulation Cocktail (plus protein scriptase (Invitrogen) was used for reverse transcription. Quanti- transport inhibitors) (eBioscience, San Diego, CA, US) in RPMI-1640 tative real-time PCR was performed using Premix Ex Taq (Takara, (Life Technology, Carlsbad, CA, US) with 10% fetal bovine serum (GE H.-D. Ma et al. / Journal of Autoimmunity 78 (2017) 19e28 21