[CANCER RESEARCH 53. 2597-2«)2. June I. 1993] Human Interleukin 2 Analogues That Preferentially Bind the Intermediate-Affinity Interleukin 2 Receptor Lead to Reduced Secondary Cytokine Secretion: Implications for the Use of These Interleukin 2 Analogues in Cancer Immunotherapy '
Keith M. Heaton,2 Grace Ju, and Elizabeth A. Grimm neiHirnneiiis ctf Tumor rìitìlogydittiGeneral Surgen; the University of Te\as M. D. Anderson Ccincer Center. Hmtuon. Te\(ts 77030 fK. M. H.. E. A. G.J. anil the Department of Inflamtiiiition/Aittotinintine Diseii\e.\. HvffnHinn-lMRfciie. Inc.. M/f/cv. New Jersey 07110 ¡G.J.¡
ABSTRACT Many of the signs and symptoms of IL-2-induced toxicity are thought to be caused by the actions of cytokines such as IL-lß. Cancer patients undergoing interleukin (IL)-2-based immunotherapy TNF-a, TNF-ß.and IFN-y released by IL-2-activated PBMC (9-14). frequently experience dose-limiting side effects believed to be caused by the actions of such cytokines as II.-I/Î,tumor necrosis factor (TNF)-a and If secretion of these secondary cytokines could be reduced, patients -ß,and interferon-y (IFN-y). Human peripheral blood mononuclear cells receiving IL-2 immunotherapy might be able to tolerate higher and (PBMC) or monocyte-dcpleted peripheral blood lymphocytes »erestim more effective doses of IL-2. ulated for up to 7 days by either of 2 IL-2 analogues (R38A or F42K) that R38A and F42K. 2 human IL-2 analogues that have altered IL-2Ra bind to the intermediate-affinity II.-2/jy receptor but have reduced abil binding domains, differ from human rIL-2 by a single amino acid ities to bind the high-affinity II -2 receptor. We previously reported that substitution. In this report, we examined the capacity of R38A and these 11-2 analogues retain the ability to generate lymphokine-activated F42K to induce the secretion of IL-lß.TNF-a, TNF-ß,and IFN--y. killing by PBMC. In this study, we analyzed the cytokine content of Compared with cultures stimulated by rIL-2, cultures exposed to supernatants from stimulated PBMC and peripheral blood lymphocyte either of the IL-2 analogues showed significant reductions in the cultures by enzyme-linked immunosorbent assay. The secretions of IL-Iß, TNF-a, and -ß,and IFN-y induced by either R38A or F42K were mark amounts of these cytokines present. Previously, we showed that ana edly reduced compared with secretions produced in response to recombi logue-stimulated PBMC retain substantial LAK activity (15) (Table nant wild-type IL-2. In 4 experiments, secretion was reduced an average 1). Thus, the use of IL-2 analogues specific for the intermediate- of 39% for IL-lß, 57% for TNF-a, 83% for TNF-ß,and 86% for IFN-y. affinity IL-2R may prove to be an effective and less toxic means of Polymerase chain reaction analysis of recombinant wild-type 11-2 or an cancer immunotherapy. alogue-stimulated PBMC did not reveal the presence of IL-2 mRNA; thus, differential production of endogenous IL-2 could not account for these Findings. These data suggest the interaction of IL-2 and the high-affinity MATERIALS AND METHODS IL-2 receptor on human PBMC or peripheral blood lymphocyte is re quired for maximal secretion of IL-lß, TNF-a, TNF-ß,and IFN-y. Be PBMC Preparation. PBMC were obtained from normal, healthy volun cause such cytokines are believed to mediate the toxicity seen with 11-2- teers hy leukopheresis. The contents of the pheresis hags were diluted with based immunothérapies, IL-2 analogues with reduced binding to the high Hanks' balanced salt solution (Ha/relton Biologicals, Inc.. Lenexa. KS) and affinity IL-2 receptor may prove to be an effective and less toxic means of fractionated on Histopaque (Sigma Chemical Co.. St. Louis. MO) by centrif- cancer treatment. ugation at 450 x g for 30 min. PBMC were isolated at the interface, removed carefully, and washed 5 times in Hanks' balanced salt solution before being resuspended in serum-free AIM-V medium (Gibco Laboratories. Grand Island. INTRODUCTION NY) containing 2 ITISIi-glutamine. For experiments in which FBI, were used. The potent oncolytic properties of IL-21 as a single agent and in PBMC were either subjected to plastic adherence for 2 h or passed through a combination with IL-2-stimulated LAK cells have been used in many nylon wool column. PB1. were analy/ed for contaminating mnnncyte content cancer immunotherapy protocols. In a number of cancer centers, the by fluorescence-activated cell sorter using anti-LeuM3 antibodies. The per overall response rates for these IL-2-based regimens have been be centage of residual macrophages in each sample was less than 0.4%. tween 15 and 30% with complete responses in approximately 5-10% IL-2 and IL-2 Analogues. Clinical-grade human wild-type rIL-2 was ob of patients (\-4). The problem with these protocols, however, has tained from Dr. F. Khan of the Bioprocess Department at Hoffmann-LaRoche, Inc. (Nutley. NJ). IL-2 analogue proteins were prepared by site-directed mu- been the high incidence of multisystem toxicity that occurs in an IL-2 dose-dependent manner. Patients treated with IL-2-based therapies tagenesis. expressed in F.scherichia culi, and purified as described by gel filtration (16). This gel filtration technique also extracts any endotoxin that is may experience such difficulties as hypotension, cardiac arrhythmias, present in the purified protein preparations. The IL-2 analogue protein R38A pulmonary insufficiency, and renal failure with treatment-related mor contains an alanine substitution for Arg38. and the analogue F42K has a tality rates of about 2% (I. 5-8). substitution of lysine tor Phe42 (17). Binding of the analogues to the human IL-2R was evaluated as described hy Sauve et al. (17). As previously deter mined in murine cytotoxic T-lymphocyte line proliferation assays, the specific Received 1/18/93; accepted 3/22/93. The costs (if publication ol' this article were defrayed in part hy the payment of page activities of the analogue proteins were 2 x IO7 units/mg rIL-2. 7.ft x IO6 units/mg R38A. and 3.2 x IO5 units/mg F42K (17). Because of these differ charges. This article must therefore he herehy marked advertisement in accordance with 18 U.S.C. Section 1734 solely lo indicate this fact. ences in specific activity, equimolar concentrations of each protein were used 1Supported hy NIH Grant CA45445 (E. A. G.). National Cancer Institute General in all experiments. Dose titration curves for the analogues' induction of LAK Surgery Training Grant 5 T32 CA095(XM)4 (K. M. H.I. and Core Grant CAI6672. 2 To whom requests for reprints should he addressed, at the Department of Tumor activity were presented previously (15). In those studies, maximal activity was Biology. Box 79. The University of Texas M. D. Anderson Cancer Center. 1515 Holcomhe found at the concentration of I mi: therefore. I mi concentrations were used in Boulevard. Houston. TX 77030. all further experiments. Conversion factors for rIL-2 and the analogues are: I 'The abbreviations used are: IL. interleukin: LAK. lymphokine-activated killer; mi = 308 units/ml rIL-2 =117 units/ml R38A = 5 units/ml F42K. PBMC. peripheral blood mononuclear cells; TNF. tumor necrosis factor: IFN. interferon; Activation of LAK Cells. PBMC or PBL were cultured at IO6cells/ml in rlL-2. recombmani wild-type human interleukin 2: IL-2R. interleukin 2 receptor: PBL. peripheral blood lymphocytes; ELISA, enzyme-linked immunosorbent assay; PCR. poly- AIM-V medium and incubated at 37°Cin a humidified 5% CO? atmosphere merase chain reaction. with I nvi rIL-2 or IL-2 analogue. The AIM-V medium was selected because 2597
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research. IL-2 ANALOGUE-INDUCED CYTOK1NE CASCADE it is chemically defined and serum-free, enabling us to avoid serum-induced days, the cell-free culture supematants were tested for cytokine con secondary cytokine production from the stimulated cells. centration using ELISA methodology. In 2 of 4 experiments per Cytokine Assays. Supernatant cytokine concentrations were determined by formed using rIL-2 or analogue-activated PBMC from different do ELISA detecting TNF-a and TNF-ß(R & D Systems. Inc.. Minneapolis. MN). nors, no detectable IL-Ißwas found in the culture supematants. In the IL-lß(AMAC. Inc.. Westbrook. ME), and IFN--y(Endogen, Inc.. Boston. MA) 2 experiments in which IL-Ißwas present, however, the amount of following all manufacturer protocols. Briefly, supematants were obtained from IL-Ißsecretion induced by R38A averaged only 76%. and F42K- stimulated PBMC or PBL on the indicated day and cemrifuged at 90 x g for induced IL-Ißwas about 61% of that produced in response to rIL-2 5 min to remove any cells. These supematants were incubated in duplicate or in triplicale in antibody-coated wells of the supplied microtiter plates. A second (Fig. \A). Fig. Ißshows the kinetics of IL-Ißproduction for one distinct cytokine-specific antibody/en/yme conjugate was then added to each representative experiment. IL-Ißproduction peaked at 24 h and then well followed by addition of the appropriate chromogenic substance. Absor- subsequently decreased. Supematants from the monocyte-depleted bance was determined by spectrophotometry. and the concentration of cytokine PBL cultures were also tested for IL-Iß.No detectable IL-Ißwas was determined from a standard curve. Mean cytokine secretion was deter present up to 7 days after rIL-2 or analogue stimulation in the 2 mined by standardising the analogue-stimulated cytokine secretion as a per experiments performed. centage of the mean rIL-2-induced secretion for each day in each individual experiment. These percentages were then combined to give a mean 7-day secretion expressed as the percentage of rIL-2-induced cytokine secretion. Table I Competitive binding anil lytii- activity of IL-2 analogues" Unless otherwise specified. 4 experiments were performed for each cytokine bindingrIL-2 1 competitive using PBMC from different donors. The sensitivity of each ELISA was 5-7 activity pg/ml. (lyticunits)7.4 IL-2 PCR Analysis. PBMC were stimulated for 24 or 72 h with 10 ug/ml ±0.9 phytohemagglutinin or I nsi rIL-2. R38A. or F42K. Total RNA was isolated R38AF42K!L-2Rß-y10050-100 No ICW* 5.4 ±0.8 from 5 x 10* stimulated PBMC by RNA/.ol B (Biotecx Laboratories, Inc.. 50-100IL-2R«100No IC,oIL-2Raß-yUHI3-502Lytic 5.8 ±1.0 Kriendswood. TX) using the single-step phenol extraction technique described " Percent competitive binding was calculated from values of analogue concentration required to inhibit rIL-2 binding 50% as described (16, 17). Data are as presented by the manufacturer. The quantity of RNA used was 0.5 ug/reaction. Reverse previously (15, 17). Competitive binding to lL-2Ro. IL-2Rßy.and IL-2Raßy was as transcription was performed at 22°Cfor 10 min and then at 45°Cfor 45 min. sayed on immobilized purified human recomhinant p55. human YT cells, and human YT-1 PCR was performed using a Perkin Elmer/Cetus PCR kit (Norwalk. CT) in cells, respectively. Lytic activity was determined by 4-H 51Cr-release assays using PBMC 30-ul volumes with specific primers for IL-2 produced by The University of stimulated for 3-5 days with I n>i rIL-2, R38A, or F42K against Daudi target cells (mean ±SE calculated from 9 separate experiments). Texas M. D. Anderson Cancer Center macromolecular synthesis facility. The ICgoi concentration of analogue required to inhibit rIL-2 binding 5()c/t. IL-2 primer sequences span an intron and were purified with an oligonucle- otide purification cartridge (AB1. San Mateo. CA). The sequences are 5' primer 5'ATGTACAGGATGCAACTCCTGTCTT 3' and .V primer 5'GTTAGTGT- TGAGATGATGCTTTGAC 3'. The amplification procedure involved denaturation at 94°Cfor 1 min. an nealing at 60°Cfor 12 s. and extension at 72°Cfor 80 s during 38 cycles in a
Perkin-Elmer/Cetus GeneAmp PCR System 9600 thermal cycler. The PCR 0uSN products were resolved on a 29£agarose gel and visualized by ethidium bromide flourescence. //«clll-digesied XI74 RF DNA fragments (Gibco Lab 75 oratories. Inc.) served as the molecular weight markers in defining the size of 15-iTo the PCR products. Statistical Analysis. All dala are presented as mean ±SE. An analysis of 50- variance was performed with Dunnett's r test to compare the analogue-induced JWo cytokine secretion to that produced in response to rIL-2. Statistical significance m25-0.0-11* was reached with P < 0.05. Statistical analysis was performed using Slat View SE + graphics (copyright 1988-1991: Abacus Concepts. Inc.. Berkeley, CA) on an Apple Macintosh Usi personal computer.
rIL-2 R38A F42K RESULTS
To delineate the function of the IL-2R suhunits in the generation of 60ce LAK activity, we used IL-2 analogue proteins that differentially hind the low-, intermediate-, and high-affinity IL-2R complexes on human soo£_ lymphoid cells. The IL-2 analogue R38A was previously character 40-alSg)30-o"£•° ized as deficient in binding to the isolated low-affinity IL-2Ra sub- unit: however, this analogue is capable of fully binding to the IL- 2Rßy(intermediate-affinity) and of partially binding to IL-2Rc*ßy (high-affinity) receptors on YT cells (17) (Table I ). The related IL-2 20-- analogue F42K had no detectable binding to the low-affinity IL-2Ra. 10 but in contrast to R38A, F42K has only 2-3% binding to the high- affinity IL-2Rc*ßycomplex. Thus, both analogues maintain full ca 0t.1t•fiñÉI234CDrlL-2I^R38A»•|567 pacity to bind to the intermediate-affinity receptor but differ in ability to interact with the high-affinity receptor. Previously, we showed that Doy these analogues generate substantial LAK activity as measured against Fig. I. PBMC were stimulated for up to 7 days with I nst rIL-2. R38A. or F42K. and the natural killer-resistant Daudi cell line (15) (Table 1). cell-tree supematants analyzed for IL- IßbyELISA (*/•<0.05). A. mean 7-day secretion of IL-Ißhy R38A- or F42K-stimulated PBMC. Data were analyzed as described in Analogue-stimulated PBMC or PBL Secrete Less IL-Iß, "Materials and Methods." /?. cumulative IL-Ißproduction by PBMC. Data shown are TNF-a, TNF-ß,and IFN-y. Human PBMC or PBL were stimulated representative of the 2 experiments in which IL-lßwas detectable. PBMC from 2 donors for up to 7 days with I n.\t rIL-2 or IL-2 analogue. On the specified did not secrete IL-lßin response to rIL-2 or the analogues.
2598
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research. IL-2ANALOGUE-INDUCED CYTOK1NE CASCADE
TNF-a secretion was also attenuated during activation of PBMC by the IL-2 analogues. R38A-induced secretion of TNF-a from PBMC 100- cultures was only 61% ofthat produced in response to rIL-2, and only 43% of the TNF-a was secreted in response to F42K (Fig. 2A). Similarly, monocyte-depleted PBL cultures exposed to R38A secreted 75- 57%, and those exposed to F42K secreted 35% of the TNF-a pro duced in response to rIL-2 (Fig. 3/1). TNF-a secretion increased with 0 —¿ 1 o 50- time in both the PBMC and PBL cultures (Figs. 2B and 3B). The TNF-ßcontent was even more dramatically decreased when the IL-2 analogues were used. R38A-stimulated production of TNF-ß m 25 CL from PBMC was only 52% of that secreted in response to rIL-2, while F42K cultures produced just 17% (Fig. 4, A and fl). IFN-7 was the cytokine with the largest reduction in secretion in rIL-2 R38A F42K response to stimulation by the IL-2 analogues. PBL cultures stimu lated by R38A produced 49%, and those stimulated by F42K produced 33% as much IFN-7 as tnat produced in response to rIL-2 (Fig. 5, A B 100 T and B). PBMC cultures exposed to R38A produced 46%, and those 180-U exposed to F42K produced only 14% of the IFN-7 secreted in rIL-2- E2F42K, stimulated cultures (Fig. 6, A and B). Interestingly, while the secretion of IL-Iß,TNF-a, TNF-ß,and 6o'o* IFN-7 was reduced by as much as 86%, the lytic activity generated by 0 Q- PBMC stimulated by either R38A or F42K was only only marginally i40.o1z reduced when the lytic activities from all experiments were averaged t|**||1*Iil\ (Table 1). There was, however, one experiment (of the 4 performed) 20 in which the lytic activities were equal (11 lytic units), and the same decreases in cytokine production were observed. IL-2-stimulated PBMC Did Not Generate IL-2 mRNA. The n.CHrlL-21 1' production of endogenous IL-2 by IL-2-stimulated cells was also Day evaluated. Because no monoclonal antibodies specific for either the Fig. 3. Monocyte-depleted PBL were stimulated for up to 7 days with 1 DMrIL-2. R38A. or F42K. and cell-free supernatant; analyzed for TNF-a hy ELISA <*/>< 0.05). A. mean 7-day secretion of TNF-a by R38A- or F42K-stimulaied PBL. Data were analyzed as described in "Materials and Methods." R. cumulative TNF-a production by Ag PBL. Data shown arc representative of the 2 experiments performed. Monocyte contam 100-Vuv75 ination was less than 0.4% for both experiments.
-0 R38A or F42K protein exist, ELISA analysis of the culture superna-
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research. 11.-: ANALI«,I I•.-INDCITI) CYIOKIM. CASI \l>l well known to be secreted by IL-2-stimulated PBMC. IL-1. a proin- A100C nammutory cytokine, has been shown to cause fever, anorexia, and in some cases, hypotension (10. 18). Like IL-1, TNF-a and TNF-ßhave 01 many systemic effects, including cachexia. malaise, and nausea. In 75O) addition. IL-1 and TNF synergize with IFN-y in the production of C>4 (rt|O nitric oxide ( 19). a primary mediator of the vasodilatation and result =Ã1 ing hypotension frequently observed in patients undergoing IL-2- 'S 50 based immunotherapy (20, 21). Furthermore, each of these cytokines IM1fe (IL-1, TNF, and IFN-y) is capable of modulating the adherence of 25- IL-2-activated leukocytes to vascular endothelium by up-regulating the expression of cellular adhesion molecules (22. 23). Adherence of these leukocytes to the microvasculature and their subsequent local 0* release of secondary cytokines provide one possible mechanism for rlL-2 R38A F42K the pathogenesis of the vascular leak syndrome seen in IL-2-treated patients. B 600- Because of the tremendous side effects that patients experience CDrlL-2 when given IL-2. there have been many efforts to reduce the toxicity LCTR38A of IL-2 treatments. In mice, anti-TNF antibodies administered con i 450-- ^F42K currently with high-dose IL-2 partially abrogated IL-2 toxicity ( 12). In VuC _° a murine model, pentoxifyllinc. an inhibitor of macrophage TNF uC§F transcription, was able to diminish the side effects of i.p. injections of KE0 IL-2 without reducing that agent's antitumor efficacy (24). In addition, infusion of /V-methylarginine. a nitric oxide synthase inhibitor, has 0»¿ 150 been successful in eliminating hypotension in dogs given i.v. IL-2 u.n• (25). Another way to decrease the toxicity of IL-2 would be to reduce the ~*^ 1,*isi ,r**1i*i•¿ amount of IL-1. TNF, and IFN-y produced by a patient's IL-2-stim- ulated leukocytes. In this study, we evaluated the ability of 2 human Day IL-2 analogues to stimulate the secretion of IL-Iß.TNF-a. TNF-ß. Fig. 5. Monocyte-depleted PBL were stimulated for up to 7 days with I PM rIL-2. R38A. or F42K. and cell-tree supematants analyzed tor IFN-y by ELISA (*/> < 0.05). A. and IFN-y. The 2 analogues we selected (R38A and F42K) interact mean 7-day secretion of IFN-y by R3SA- or F42K-stimulated PBL. Data were analyzed as described in "Materials and Methods." H. cumulative IFN-y production by PBL. Data shown are representative of the 2 experiments performed. Momx'yte contamination was less than (}.V't tor both experiments. Ae 100uW with the intermediate-affinity IL-2R but have reduced binding to the -re«i 73•¿ ï high-affinity receptor. We observed that the concentrations of IL-Iß. TNF-a. TNF-ß.and IFN-y in the supematants of R38A- or F42K- _i.O TLÃŒ stimulated PBMC or PBL were dramatically decreased compared with 050-u those produced in response to rIL-2 (Figs. 1-6). In addition, we have previously show n that analogue-stimulated PBMC induce similar lev
i 25-n els of lytic activity despite large differences in the specific activity of the analogues as determined in murine cytotoxic T-lymphocyte line proliferation assays (15) (Table 1). These findings are not suprising -**i since the intermediate-affinity IL-2R to which rIL-2. R38A. and F42K rlL-2 R38A F42K bind with identical affinity has been shown to be responsible for the 350-300-250-200-150-1 induction of lytic activity, while stimulation of the high-affinity re ceptor complex is necessary for cellular proliferation ( 15. 26). If such E3R38AEZF42K•n,,, IL-2 analogues that retain LAK activity were used for cancer immu notherapy. the reductions in these cytokines could result in decreased toxicity to the patient. The decreased production of IFN-y by F42K-stimulated cells was particularly impressive and is important for several reasons. Lower IFN-y levels in patients given i.v. IL-2 have correlated with the tumor's response to treatment 114) and with decreased toxicity (9. 13). DO 4^ In addition, a theoretical benefit in reducing the production of IL-1. SO-(CZlrlL-2 TNF. and IFN-y exists because of their synergy in initiating the
n,) ,5 production of nitric oxide (19). If lower levels of these cytokines are 1 2 3 41*i^ 6*6*B7 present and nitric oxide synthesis is reduced (or not induced) by these Doy IL-2 analogues, patients treated with the analogues may not experi Fig. 4. PBMC were stimulated for up to 7 days wilh 1 HMrIL-2. R38A. or F42K. and ence the dose-limiting problems of hypotension and vascular leak cell-free supematants analyzed for TNF-ßby ELISA (*P < 0.05). A. mean 7-day secretion syndrome. of TNF-ßby R38A- or F42K-slimulated PBMC. Data were analyzed as described in "Materials and Methods." H. cumulative TNF-ßproduction by PBMC. Data are repre The regulatory pathways and mechanisms behind the secretion of sentative of the 2 experiments performed. these cytokines are unknown. One apparent explanation for the dif- 2600
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research. IL-2ANALOGUE.INDUCED CYTOKINE CASCADE
the high-affinity receptor complex markedly reduced both the tran Ai 100-Vuv75 scription of the IFN-y gene (27) and secretion of the IFN-y protein (27-29). The correlation between increased binding to the high affin ity receptor complex and increased cytokine secretion was also ap J0 CNE parent in our measurmcnts of IL-Iß.TNF-«, and TNF-ß.With the iE exception of the reports regarding IFN-y production (27-29), our dOfÃ’ 50-È*o2 report is the first to link reduced high-affinity IL-2R binding to re ductions in the secretion of these cytokines. Although our data clearly indicate that interaction of IL-2 with this receptor complex is impor 25-mo.n*T**T tant in cytokine regulation, some cytokine is clearly produced through stimulation of the intermediate-affinity ßyreceptor. In addition, a complex interactive network of cytokine regulatory controls exists. rlL-2 R38A F42K For example, while it is known that IL-2 and TNF-or enhance the production of IL-I from human PBMC (3()-32), TNF secretion is stimulated by IL-2 alone (33-35) and can be synergistically increased CDrlL-2 using a combination of IFN-y with IL-2 (36). Finally, the secretion of K3R38A both TNF-ß(37) and IFN-y (38, 39) requires the presence of both E3F42K •¿ £800- IL-I and IL-2. Thus, if the production of one cytokine is reduced, the v u secretion of other cytokines will probably also be affected. S^eoo One other explanation for decreased cytokine production by ana logue-stimulated leukocytes is the potential differential production of I 400 4- endogenous IL-2 in response to rIL-2, R38A. or F42K. IL-2 has been shown to be produced upon stimulation of PBMC by phorbol esters 200 •¿ • (40), lectins (41), or IL-1 in conjunction with antigen exposure (42, 43). To the best of our knowledge, IL-2 has not been shown to stimulate its own synthesis in an autocrine fashion. Our PCR data are consistent with this finding. Endogenous IL-2 mRNA was not de Day tected in response to stimulation of either the high-affinity IL-2R by Fig. 6. PBMC were stimulated for up to 7 days with 1 PMrlL-2, R38A. or F42K. and rIL-2 or the intermediate-affinity receptor complex by R38A or F42K cell-free supematants analyzed for IFN-y hy ELISA (*P < 0.05). A, mean 7-day seeretion of IFN-7 by R38A- or F42K-stimulated PBMC. Data were analyzed as described in (Fig. 7). Thus, it appears that differential regulation of endogenous "Materials and Methods." B. cumulative IFN-y production by PBMC. Data are represen IL-2 is not responsible for the differences in secondary cytokine tative of the 4 experiments performed. production that we observed. In summary, our data show that maximal production of IL-Iß. TNF-a. TNF-ß.and IFN-y by human PBMC is regulated by the IL-2 high-affinity IL-2 receptor and not by endogenous IL-2 production. Thus, we propose that analogues of human IL-2 that interact primarily DNA with the intermediate affinity IL-2R and not the high affinity receptor STO PHA complex may not only be useful as immunotherapeutic agents but may also evoke less systemic toxicity than that seen with native rIL-2.
REFERENCES
1. Rosenberg. S. A.. Lotze. M. T.. Yang. Ì.C,Aebersold, P. M., Linehan, W. M.. Seipp, C. A., and White. D. E. Experience with the use of high-dose interleukin-2 in the treatment of 652 cancer patients. Ann. Surg.. 210: 474-485. 1989. 2. West, W. H.. Tauer, K. W.. Yannelli, J. R., Marshall. G. D., Orr, D. W.. Thurman. G. B., and Oldham, R. K. Constant-infusion recomhinant interleukin-2 in adoptive ¡mmunotherapy of advanced cancer. N. Engl. J. Med.. )!(>: 898-905. 1987. 3. Dutcher, J. P. Crcekmore, S., Weiss. G. R.. Margolin, K.. Markowitz. A. B.. Roper. Fig. 7. PCR analysis for IL-2 mRNA. PBMC were stimulated for 0. 24, or 72 h with M.. Parkinson, D.. Ciobanu. N.. Fisher. R. !.. Bold!, D. H.. Doroshow. J. H.. Rayner. A. A.. Hawkins. M., and Atkins. M. A phase U study of interleukin-2 and lymphokine- no IL-2. 10 ug/ml phytohemagglutinin. or 1 nMrIL-2, R38A. or F42K. The extracted RNA was analyzed by PCR using lL-2-specific primers. IL-2 product is present only in PBMC activated killer cells in patients with melastatic malignant melanoma. J. Clin. Oncol.. 7:477-485, 1989. stimulated with phytohemagglutinin. The positive control for the PCR reaction, glycer- aldehyde-3-phosphate dehydrogenase. was present in each case (data not shown). The gel 4. Négrier.S., Philip. T.. Stoter. G.. Fossa, S. D., Janssen, S., lacene. A.. Ciclón, F. S., shown is representative of the 4 experiments performed. Eremin. O-, Israel. L.. Jasmin. C.. Rugarli. C.. Masse, H. V. D.. Thatcher. N.. Symann. M.. Bausch. H. H.. Bergmann. L.. Bijman. J. T. Palmer. P. A., and Franks. C. R. Interleukin-2 with or without LAK cells in metastatic renal cell carcinoma: a report of a European multicentre study. Eur. J. Cancer & Clin. Oncol., 25: s21-s28. 1989. ferential expression of cytokines is that stimulation of the high-affinity 5. Lee, R. E., Lotze. M. T.. Skibber, J. M.. Tucker. E.. Bonow. R. O.. Ognibene. F. P.. IL-2R is necessary for maximal secondary cytokine secretion. F42K. Carrasquillo, J. A.. Shelhamer. J. H.. Parrillo. J. E.. and Rosenberg. S. A. Cardiores- which interacts minimally with the high-affinity IL-2Raßy. produced piratory effects of ¡mmunotherapy with interleukin-2. J. Clin. Oncol.. 7: 7-20. 1989. 6. Goel. M.. Flaherty. L.. Lavine, S., and Redman. B. G. Reversible cardiomyopathy only 14% of the IFN-y made by rIL-2-stimulated cells (Fig. 6). R38A, after high-dose interleukin-2 therapy. J. Immunother.. //.- 225-229. 1992. on the other hand, with a more intermediate ability to bind to the 7. Denicoff. K. D.. Durkin. T. M.. Lotze, M. T. Quintan. P. E.. Davis. C. L.. Lislwak. high-affinity IL-2R. produced 46% as much IFN-y (Fig. 6). Several S. J., Rosenberg, S. A., and Rubinow. D. R. The neuroendocrine effects of intcrieu- kin-2 treatment. J. Clin. Endocrino!. Metab.. 69: 402-410. 1989. other studies have yielded similar results that further demonstrate the 8. Ettinghausen. S. E.. Moore. J. G.. White. D. E.. Platanias. L.. Young. N. S.. and importance of IL-2 interaction with the high-affinity receptor complex Rosenberg, S. A. Hématologieeffects of immunotherapy with lymphokine-activated in regulating secondary cytokine secretion. Blocking the low-affinity killer cells and recombinant ¡nterleukin-2 in cancer patients. Blood. f>V: 1654-1660. 1987. IL-2Ra with anti-7«cantibodies and thereby prohibiting binding to 9. Konrad. M. W.. DeWitt. S. K.. Bradley. E. C.. GixxJman. G., Groves, E. C.. Hersh. E. 2601
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research. IL-2ANALOGUE-INDUCED CYTOKINE CASCADE
M., Krigel. R. L.. and Rudolph, A. Interferon-.cumm« induced by administration of oxide (NO) formation. Proc. Am. Assoc. Cancer Res., 33: 328, 1992. recombinant interleukin-2 to patients with cancer: kinetics, dose dependence, and 26. Owen-Schaub. L. O.. Loudon. W. G.. Vagita, M., and Grimm, E. A. Funtional correlation with physiologic and therapeutic response. J. Immunother, 12: 55-63, differentiation of human lymphokine-activated killing (LAK) is distinct from expan 1992. sion and involves dissimilar interleukin 2 receptors. Cell. Immunol., ///: 235-246. 10. Okusawa. S , Gelfand. J. A.. Ikejima, T.. Connolly. R. J., and Dinarello, C. A. 1988. Interleukin I induces a shock-like state in rabbits. J. Clin. Invest., SI: 1162-1172, 27. Burdach. S.. Zessack, N.. Dilloo, D.. Shatsky, M., Thompson, D., and Levin, L. 1988. Differential regulation of lymphokine production by distinct subunits of the T cells 11. Martin, S.. Maruta, K.. Burkart, V., Gillis, S., and Kolb. H. IL-1 and IFN-fjammu interleukin 2 receptor. J. Clin. Invest., 87: 2114-2121. 1991. increase vascular permeability. Immunology. 64: 301-305. 1988. 28. Reem. G. H., and Yeh, N-H. Interleukin 2 regulates expression of its receptor and 12. Fraker, D. L., Langstein. H. N., and Norton. J. A. Passive immunization against tumor synthesis of .camma interferon by human T lymphocytes. Science (Washington DC). necrosis factor partially abrogates interleukin 2 toxicity. J. Exp. Med., 170: 1015- 225: 429-430. 1984. 1020, 1989. 29. Vilcek, J., Henriksen-Destefano, D., Siegel. D.. Klion. A.. Robb. R. J., and Junming. 13. Economou. J. S.. Hoban. M., Lee, J. D., Essner, R., Swisher. S., McBride. W., Hoon. L. Regulation of IFN-#amma induction in human peripheral blood cells by exogenous D. B.. and Morton. D. L. Production of tumor necrosis factor-a/p/>a and interferon- and endogenously produced interleukin 2. J. Immunol., 135: 1851-1856, 1985. tfamma in interleukin-2-treated melanoma patients: correlation with clinical toxicity. 30. Numerof. R. P.. Aronson. F. R.. and Mier. J. W. IL-2 stimulates the production of IL-1 Cancer Immunol. Immunother., 34: 49-52. 1991. alpha and 1L-1 beta by human peripheral blood mononuclear cells. J. Immunol., 141: 14. Schoof, D. D., Hunt, P., Ubando, J. A.. Cusack, J. C. Jr.. Andrews. V.. Terashima. Y. 4250-4257. 1992. and Eberlein. T. J. Secondary cytokine production by lymphoid cells used in cellular 31. Bachwich. P. R., Chensue. S. W.. Larrick, J. W.. and Kunkel, S. L. Tumor necrosis immunotherapy. Surg. Oncol., /. 163-172, 1992. factor stimulates interleukin I and prostaglandin E2 production from resting mac 15. Heaton, K. M., Ju, G.. Morris. D. K.. Delisio. K.. Bailón. P.. and Grimm. E. A. rophages. Biochem. Biophys. Res. Commun.. 136: 94-101, 1986. Characterization of lymphokine-activated killing by human peripheral blood mono- 32. Danis. V. A., Kulesz. D. S., Nelson, D. S., and Brooks, P. M. Cytokine regulation of nuclear cells stimulated with interleukin 2 (IL-21 analogs specific for the intermediate human monocyte interleukin-1 (IL-1) production in vitro. Enhancement of IL-1 affinity IL-2 receptor. Cell. Immunol.. in press, 1993. production by interferon (IFN) gamma, tumor necrosis factor-alpha. IL-2 and IL-1, 16. Ju, G., Collins. L.. Kaffka. K. L., Tsien. W-H.. Chizzonite. R.. Crowl. R.. Bhatt. R.. and inhibition by \FN-alpha. Clin. Exp. Immunol., 80: 435-443. 1990. and Kill.in. P. L. Structure-function analysis of human interleukin-2. J. Biol. Chem.. 33. Owen-Schaub. L. B., de Mars. M.. Murphy. E. C.. Jr., and Grimm, E. A. IL-2 dose 262; 5723-5731. 1987. regulates TNF-alpha mRNA transcription and protein secretion in human peripheral 17. Sauve. K.. Nachman. C.. Spence. C.. Bailón.P.. Campbell. E.. Tsien. W-H., Kondas, blood lymphocytes. Cell. Immunol., 132: 193-200, 1991. J. A., Hakimi. J., and Ju. G. Localization in human interleukin 2 of the binding site 34. Economou. J. S., McBride. W. H.. Essner. R.. Rhoades. K., Golub. S.. Holmes, E. C., to the a chain (p55) of the interleukin 2 receptor. Proc. Nail. Acad. Sci. USA. 88: and Morton. D. L. Tumor necrosis factor production by IL-2-activated macrophages 4636-1640, 1991. in vitro and in nwi. Immunology, 67: 514-519, 1989. 18. Siegel. J. P.. and Puri, R. K. Interleukin-2 loxicity. J. Clin. Oncol.. V: 694-704, 1991. 35. Remick, D. G.. Nguyen. D. T.. Eskandari, M. K., and Kunkel. S. L. Interleukin 2 19. Kilbourn. R. G.. and Belloni, P. Endothelial cell production of nitrogen oxides in induces tumor necrosis factor gene expression in vivo. Immunol. Invest.. 20: 395-405, response to interferon-flamma in combination with tumor necrosis factor, interleu- 1991. kin-l. orendotoxin. J. Nati. Cancer Inst.. 82: 772-776, 1990. 36. Nedwin, G. E., Svedersky, L. P., Bringman, T. S., Palladino, M. A., Jr., and Goeddel, 20. Ochoa. J. B., Curii. B.. Peitzman, A. B.. Simmons, R. L.. Billiar. T. R.. Hoffman. R.. D. V. Effect of interleukin 2, interferon-Kamma. and mitogens on the production of Rault. R.. Longo. D. L., Urba, W. J.. and Ochoa, A. C. Increased circulating nitrogen tumor necrosis factors alpha and beta. J. Immunol.. 135: 2492-2497. 1985. oxides after human tumor immunotherapy: correlation with toxic hemodynamic 37. Lazenby. A. W., Roth, J. A., Owen-Schaub, L. B.. and Grimm. E. A. 1L-1 synergy with changes. J. Nail. Cancer Inst.. 84: 864-867. 1992. IL-2 in the generation of lymphkine activated killer cells is mediated by TNF-alpha 21. Hibbs. J. B.. Jr.. Westenfelder. C.. Taintor. R.. Vavrin. Z.. Kablitz. C., Baranowski. R. and bela (lymphotoxin). Cytokine. in press, 1992. L.. Ward. J. H.. Menlove. R. L.. McMurray, M. P.. Kushner. J. P.. and Samlowski. W. 38. Croll. A. D.. and Morris. A. G. The regulation of gamma interferon production by E. Evidence for cytokine-inducible nitric oxide synthesis from i.-arginine in patients interleukins I and 2. Cell. Immunol.. 102: 33^»2,1986. receiving interleukin-2 therapy. J. Clin. Invest., 89: 867-877, 1992. 39. Wilson. A. B.. Harris, J. M.. and Coombs. R. R. A. lnterleukin-2-induced production 22. Pober. J. S.. Bevilacqua. M. P.. Mendrick, D. L., Lapierre. L. A.. Fiers, W., and of interferon-gamma by resting human T cells and large granular lymphocytes: Gimbrone. M. A., Jr. Two distinct monokines interleukin 1 and tumor necrosis factor requirement for accessory cell factors, including interleukin-1. Cell. Immunol., 113: each independently induce biosynthesis and transient expression of the same antigen 130-142, 1988. on the surface of cultured ñamanvascular endothelial cells. J. Immunol.. 136: 1680- 40. Mier, J. W., and Gallo, R. C. Purification and some characteristics of human T-cell 1687, 1986. growth factor from PHA-stimuIated lymphocyte conditioned media. Proc. Nati. Acad. 23. Pober. J. S.. Gimbrone. M. A.. Jr.. Cotran, R. S.. Reiss, C. S.. Burakoff, S. J., Fiers, Sci. USA, 77: 6134-6138. 1980. W., and Ault, K. A. la expression by vascular endothelium is inducible by activated 41. Larsson. E-L.. and Coutinho. A. The role of mitogenic lectins in T-cell triggering. T cells and by human gamma interferon. J. Exp. Med.. 157: 1339-1353. 1983. Nature (Lond.). 280: 239-241. 1979. 24. Edwards. M. J.. Abney. D. L.. and Miller. F. N. Pentoxifylline inhibits imerleukin-2- 42. Parrar. W. L.. Mizel, S. B., and Parrar. J. L. Participation of lymphocyte activating induced leukocyte-endothelial adherence and reduces systemic toxicity. Surgery. 110: factor (interleukin I) in the induction of cytotoxic T cell responses. J. Immunol., 124: 199-204. 1991. 1371-1377. 1980. 25. Kilbourn. R. G.. Owen-Schaub. L.. and Griffith, O. W. Interleukin-2 (IL-2) mediated 43. Smith, K. A.. Lachman. L. B.. Oppenheim. J. J.. and Favata. M. F. The functional hypotension in dogs is reversed by jV-methyl-L-arginine (NMA), an inhibitor of nitric relationship of the interleukins. J. Exp. Med.. 151: 1551-1556. 1980.
2602
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research. Human Interleukin 2 Analogues That Preferentially Bind the Intermediate-Affinity Interleukin 2 Receptor Lead to Reduced Secondary Cytokine Secretion: Implications for the Use of These Interleukin 2 Analogues in Cancer Immunotherapy
Keith M. Heaton, Grace Ju and Elizabeth A. Grimm
Cancer Res 1993;53:2597-2602.
Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/53/11/2597
E-mail alerts Sign up to receive free email-alerts related to this article or journal.
Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].
Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/53/11/2597. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.
Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1993 American Association for Cancer Research.