(12) Patent Application Publication (10) Pub. No.: US 2013/0189243 A1 Barr Et Al

US 2013 O1892.43A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0189243 A1 Barr et al. (43) Pub. Date: Jul. 25, 2013

(54) BOMARKERS FOR ACUTE SCHEMC Publication Classification STROKE (51) Int. Cl. CI2O I/68 (2006.01) (76) Inventors: Taura L. Barr, Waynesburg, PA (US); A6IB 6/00 (2006.01) Maria Del Mar Matarin, Kent (GB); A6IB5/055 (2006.01) Steven Jay Warach, West Lake Hills, GOIN33/68 (2006.01) TX (US); Andrew Barry Singleton, A6IB5/00 (2006.01) Poolesville, MD (US); Yvette P. Conley, (52) U.S. Cl. North Huntingdon, PA (US) CPC ...... CI2O I/6876 (2013.01); G0IN33/6893 (2013.01); A61B5/0042 (2013.01); A61B (21) Appl. No.: 131580,571 5/055 (2013.01); A61B 6/501 (2013.01) USPC ...... 424/94.64; 436/501; 435/7.92; 506/9: 435/6.12: 435/6.11:506/18: 506/16:435/7.1; (22) PCT Fled: Feb. 22, 2011 530/389.8:536/24.31; 530/300; 600/407; 600/410; 378/4 (86) PCT NO.: PCT/US1 1/25748 (57) ABSTRACT S371 (c)(1), The present invention provides methods and compositions for (2), (4) Date: Mar. 11, 2013 the diagnosis of acute ischemic stroke. The invention further provides methods and compositions for distinguishing acute ischemic stroke from other forms of stroke and TIAS and Related U.S. Application Data “stroke mimic' events. Moreover, methods and compositions (60) Provisional application No. 61/307,233, filed on Feb. are provided to facilitate the treatment of acute ischemic 23, 2010. stroke patients. Patent Application Publication Jul. 25, 2013 Sheet 1 of 30 US 2013/O189243 A1

cCR7 csPG: aGAP 8.

SS: s ------S stooAt2. CNRO SROKE

Gene p-value Fold Regulation Description change ARG1 2.84E-O7 3.175 Up Arginase-1 CA4 2.OE-04 2.122 Up Carbonic anhydrase-4 CCR7 4.37E-05 2.094 DOWn Chemokine CC Motif Receptor 7 CSPG2 3.45E-05 2.087 Up Chondroitin sulfate proteoglycan 2 IOGAP1 7.97 E-07 2.031 Up IQ motif-containing GTPase activating protein 1 LY96 0.001 2.159 Up Lymphocyte antigen 96; MD2 protein MMP9 1.11 E-05 2.644 Up Matrix metalloproteinase 9: gelatinase B ORM1 O.OO6 2.246 Up Orosomucoid 1; alpha 1 acid glycoprotein S100A12 3.87 E-04 2.354 Up S100 calcium binding protein A12; calgranulin C

Figure 1 Patent Application Publication Jul. 25, 2013 Sheet 2 of 30 US 2013/O189243 A1

input 355 genes 21.5 fold px0.05

Figure 2 Patent Application Publication Jul. 25, 2013 Sheet 3 of 30 US 2013/O189243 A1

Patent Application Publication Jul. 25, 2013 Sheet 5 of 30 US 2013/O189243 A1

Chemokine (C-C motif) receptor 7 precursor Homo sapiens ACCESSION NP 001829 (SEQID NO: 2)

MDLGKPMKSV TV VALTWTFO VCLCODEVTD DYTGDNT TVD YTLEESLCSK KDWRNFKAWF 61 LPIMYSIICF WGLLGNGLVW LTYYEKRLK TMITDTYLLNL AVADILELLT LPFWAYSAAK 121 SWWFGWHECK LIFAIYKMSE FSGMLLLLCI SIDRYWAIVO AVSAHRHRAR WILLISKLSCW 181 GTWILATVLS TPELLYSDLO RSSSECAMRC SLTTEHWEAF TTIOVAOMVI GFLVPLLAMS 241 FCYLVIIRTL LOARNFERNK AIKWIIAWWW VFIVFOLPYN GWWLAQTVAN ENITSSTCEL 301 SKOLNIAYDV TYSLACWRCC WNPFLAEIG WKERNDLFKL FKDLGCLSOE OLROWSSCRH 361 IRRSSMSWEA ETTTTFSP

Figure 4B Patent Application Publication Jul. 25, 2013 Sheet 6 of 30 US 2013/O189243 A1

Homo sapiens versican (VCAN), mRNA; CSPG2 NCBI Reference Sequence: NM 004385.2 (SEQID NO:3) l gctg.ccccga gcctttctggggaagaactic caggcgtgcggacgcaa.cag ccgagaacat 61 taggtgttgtggacaggage tgggaccaag atcteggcc agcccc.gcatcctcccgcat 121 CttCcagcac cgtCccgcac cctoCgcatc CttcCCCggg CCaCCacgct tcctatgtga 181 cccgcctggg caacgccgaa cocagtcgcg cagcgctgcagtgaattittc cccccaaact 241 gcaataagcc gcct tccaaggccaagatgttcataaatat aaagagcatc tatggatgt 301 gttcaacctt aatagtaacc catgcgctac ataaagtcaaagtgggaaaaag.cccaccgg 361 tgaggggctic cctetctgga aaagtcagcc taccttgtcatttittcaacg atgcctact 421 tgccacccagttacaacacc agtgaatttic tecgcatcaa atggtctaag attgaagtgg 481 acaaaaatgg aaaagatttgaaagagacta ctgtccttgtggcccaaaatggaaatatea 541 agattggtea ggactacaaagggagagtgtctgtgcccac acatcccgaggctgtgggcg 601 atgcctCcct cactgtggte aagctgctgg caagtgatgc gggtctttac cgctgtgacg 661 teatgtacgggattgaagac acacaagaca cggtgtcact gactgtggatggggttgtgt 721 ttcactacaggg.cggcaa.cc agcaggtaca cactgaattittgaggctgct cagaaggctt 781 gtttggacgttggggcagtc. atagcaactic cagagcagct ctittgctgcc tatgaagatg 841 gatttgagcagtgtgacgcaggctggctggctgatcagac tgtcagatat cocatccggg 901 ctCccagagtaggctgttat ggagataagatgggaaaggc aggagticagg actitatggat 961 tecgttctec ccaggaaact tacgatgtgt attgttatgtggatcatctggatggtgatg 1021 tgttccacct cactgtcCCC agtaaattica Cctitcgaggaggctgcaaaa gagtgtgaaa 1081 accaggatgc caggctggca acaggggggaactcCaggc ggcatggaggaacggctttg 1141 accagtgcgattacgggtgg ctgtcggatgccagcgtgcgccaccctgtg actgtggcca 1201 gggccCagtgtggaggtggt ctacttgggg tgagaaccct gtatcgttitt gagaaccaga 1261 caggcttccc tocccctgat agcagatttgatgcctactgctittaaacct aaagaggcta 1321 caaccatcgatttgagtatic cticgcagaaactgcatcacc cagtttatcc aaagaaccac 1381 aaatggttctgatagaact acaccaatcatccctittagttgatgaattacctgtcattc 1441 caacagagttccctcccgtgggaaatattgtcagttttga acagaaagcc acagtccaac 1501 cticaggctat cacagatagt ttagccacca aattacccac acctactggc agtaccaaga 1561 agccctggga tatggatgac tacticacct ctgcttcagg acctctgga aagctagaca 1621 tatcagaaattaaggaagaagtgctccagagtacaactgg cgtctcteat tatgctacgg 1681 attcatggga tggtgtcgtggaagataaac aaacacaaga atcggttaca Cagattgaac 1741 aaatagaagtgggtectttggtaacatctatggaaatctt aaagcacatt cottccaagg 1801 aatticcctgt aactgaaa.ca ccattggtaa ctgcaagaatgatcctggaatccaaaactg 1861 aaaagaaaatggtaagcact gttctgaattggtaaccac aggtoactatggattcacct 1921 tgggagaaga ggatgatgaagacagaacac tacagttgg atctgatgag agcaccttga 1981 totttgacca aatticctgaagtcattacgg tgtcaaagac ttcagaagac accatccaca 2041 ctcatttaga agacttggag toagtctoag catccacaac tgttcccct ttaattatgc 2101 ctgataataatggatcatcc atggatgact gggaagagag acaaactagt ggtaggataa 2161 cggaagagtt tottggcaaa tatctgtcta ctacaccttt tocatcacag catcgtacag 2221 aaatagaattgttcctitat tctggtgata aaatattagt agagggaatt tocacagtta 2281 tttatcCttc. tctacaaaca gaaatgacac atagaagaga aagaacagaa acactaatac 2341 cagagatgagaacagatact tatacagatgaaatacaaga agagatcact aaaagtccat 2401 tatgggaaaaacagaagaagaagticttct ctgggatgaa actictetaca totctictoag

Figure 5A Patent Application Publication Jul. 25, 2013 Sheet 7 of 30 US 2013/O189243 A1

2461 agccaatticatgttacagag tettctgtgg aaatgaccaagtcttittgat titcccaacat 2521 tgataacaaagttaagtgca gagccaacagaagtaagaga tatggaggaa gactttacag 2581 caactcCagg tactacaaaa tatgatgaaaatattacaac agtgcttittggcccatggta 2641 ctittaagtgttgaagcagcc actgtatcaaaatggtcatgggatgaagat aatacaacat 2701 ccaagccttt agagtctaca gaaccttcag cotcttcaaa attgccccct gccttactica 2761 caactgtggg gatgaatgga aaggataaag acatcccaagttcactgaagatggageag 2821 atgaatttac tottattoca gatagtactic aaaagcagtt agaggaggtt actgatgaag 2881 acatagcagc ccatggaaaattcacaatta gatttcagcc aactacatca actggtattg 2941 cagaaaagtic aactittgaga gattctacaactgaagaaaaagttccacct atcacaagca 300 ctgaaggcca agtttatgca accatggaag gaagtgctttgggtgaagtagaagatgtgg 3061 acctictotaa gccagtatict actgttccccaatttgcaca cacttcagaggtggaaggat 3121 tagcatttgttagttatagt agcacccaag agcctactac tatgtagac tottcccata 3181 ccattectct ttctgtaatt cocaagacag actggggagtgttagtacct tctgttccat 3241 cagaagatga agttctaggtgaacccticte aagacatact tgtcattgat cagacticgcc 3301 ttgaag.cgac tatttctoca gaaactatga gaacaacaaaaatcacagagggaacaactic 3361 aggaagaatt CCCttggaaagaacagactg cagagaaacc agttcctgct ctoagttcta 342 cagcttggac toccaaggag gcagtaacac cactggatga acaagagggc gatggatcag 3481 catatacagt ctetgaagatgaattgttga caggttctga gagggtccca gttttagaaa 3541 caacticcagttggaaaaattgatcacagtgtgtcttatcc accaggtgct gtaactgagc 360 l acaaagtgaaaacagatgaagtggtaacac taacaccacg cattgggcca aaagtatctt 3661 taagtCcagg gcctgaacaa aaatatgaaa cagaaggtag tagtacaacaggatttacat 372 catctttgag tecttttagt acccacatta cccagctitat ggaagaaacc actactgaga 3781 aaa.catccct agaggatattgatttaggct caggattatttgaaaag.ccc aaag.ccacag 3841 aacticataga attttcaacaatcaaagtica cagttccaag tigatattacc actgccttca 3901 gttcagtaga cagactitcac acaacticag cattcaagcc atctt.ccgcg atcactaaga 3961 aaccacctict catcgacagg gaacctggtgaagaaacaac cagtgacatggtaatcattg 4021 gagaatcaac atctoatgttcctccCacta cccttgaaga tattgtagcc aaggaaacag 4081 aaaccgatattgatagagag tatttcacga cttcaagtcc tectgctaca cagccaacaa 4141 gaccacccac tgtggaagac aaagaggcct ttggacctcaggcgctttct acgccacagc 4201 ccccagcaag cacaaaattt caccctgaca ttaatgttta tattattgaggteagagaaa 4261 ataagacagg tegaatgagt gatttgagtg taattggtoa tocaatagat teagaatcta 4321 aagaagatga accttgtagt gaagaaacag atccagtgcatgatctaatggctgaaattt 4381 tacctgaatt CCctgacata attgaaatag acctatacca cagtgaagaaaatgaagaag 4441 aagaagaaga gtgtgcaaatgctactgatgtgacaaccac cccatctgtgcagtacataa 4501 atgggaagcatctegttacc actgtgccca aggacccaga agctgcagaa.gctaggcgtg 4561 gccagtttgaaagtgttgca ccttctoaga atttctegga cagctctgaaagtgatactic 4621 atccatttgt aatagccaaaacggaattgtctactgctgtgcaacctaatgaatctacag 4681 aaacaactgagtcticttgaagttacatgga agcctgagac ttaccctgaa acatcagaac 4741 atttittcagg tggtgagcct gatgtttitcc ccacagtccc attccatgag gaatttgaaa 4801 gtggaacagc caaaaaaggggcagaatcag teacagagag agatactgaagttggtcatC 4861 aggcacatga acatactgaa cctgtatcte tgttcctga agagtcttcaggagagattg 4921 ccattgacca agaatctoag aaaatagcct ttgcaagggc tacagaagta acatttggtg 4981 aagaggtaga aaaaagtact tctgtcacat acacticccac tatagttcca agttctgcat 5041 cageatatgttcagaggaagaagcagtta ccctaatagg aaatccttgg ccagatgacc

Figure 5A (cont) Patent Application Publication Jul. 25, 2013 Sheet 8 of 30 US 2013/O189243 A1

5101 tattgtctac Caaagaaagc tgggtagaag caactCctag acaagttgta gagctctoag 5 161 ggagttctic gatt.ccaatt acagaaggct ctggagaage agaagaagatgaagatacaa 5221 tgttcaccatggtaactgat ttatcacaga gaaatactac tgatacactic attactittag 5281 acactagoaggataatcaca gaaagcttitt ttgaggttcc tgcaaccacc atttatccag 5341 tttctgaaca accttctgcaaaagtggtgc ctaccaagtttgtaagtgaa acagacact 5401 ctgagtggattitccagtacc actgttgagg aaaagaaaaggaaggaggag gagggaacta 5461 caggtacggc titctacatttgaggtatatt catctacaca gagatcggat caattaattit 5521 taccctttga attagaaagt coaaatgtag ctacatctag tgattcaggt accaggaaaa 5581 gttittatgtc cttgacaa.ca ccaacacagt ctgaaaggga aatgacagat tctact.cctg 5641 totttacaga aacaaataca ttagaaaatttgggggcaca gaccactgag cacagcagta 570l tccatcaacc tggggttcaggaagggctga ccactictocc acgtagtCct gcctctgtct 5761 tatggagcagggctctgga gaagctgctg.ccgacccaga aaccaccact gttcttcat 5821 tttcattaaacgtagagtatgcaattcaag ccgaaaagga agtagctggc actttgtcte 5881 cgcatgtgga aactacattc tccactgage Caacaggact ggttctgagt acagtaatgg 5941 acagagtagttgctgaaaatataaccCaaa catccaggga aatagtgatt teagagcgat 600l taggagaacc aaattatggggcagaaataaggggcttittC cacaggttitt cotttggagg 6061 aagattitcagtggtgactitt agagaatact caa.cagtgtc. tcatCccata gcaaaagaag 6121 aaacggtaatgatggaaggc tictggagatgcagcatttagggacacccag acttcaccat 6181 ctacagtacc tacticagttcacatcagtic acatatotgacticagaagga cccagtagca 6241 ccatggtoag cacttcagec titcccctggg aagagtttac atcctcagct gagggcticag 6301 glgagcaact ggtcacagtic ageagctctgttgttccagt gettcccagt gctgtgcaaa 6361 agttctgg tacagctitcc tocattatcg acgaaggattgggagaagtgggtactgtca 6421 atgaaattgatagaagatcc accattttac Caacagcaga agtggaaggtacgaaagctc 6481 cagtagagaaggaggaagta aaggtoagtggcacagttcaacaaactitt CCCcaaacta 6541 tagagccagc caaattatgg totaggcaagaagtcaaccCtgtaagacaagaaattgaaa 6601 glgaaacaac atcagaggaa caaattcaag aagaaaagtC atttgaatcc cctoaaaact 6661 ctcctgcaac agaacaaacaatctittgatt cacagacatt tactgaaactgaactcaaaa 6721 ccacagatta totgtacta acaacaaaga aaacttacag tgatgataaagaaatgaagg 6781 aggaagacac ttctttagtt alacatgtctacticcagatcc agatgcaaatggcttggaat 6841 cttacacaac totccctgaagctactgaaaagtcacattt tttcttagct actgcattag 6901 taactgaatc tataccagctgaacatgtag teacagattic accaatcaaaaaggaagaaa 6961 gtacaaaacatttitccgaaaggcatgagac caacaattica agagtcagat actgagctict 7021 tattetctgg actgggatcaggagaagaag tuttacctac tetaccaa.ca gagtcagtga 7081 attttactga agtggaacaa atcaataaca cattatatec ccacacttct caagtggaaa 7141 gtacctcaag tgacaaaattgaagactitta acagaatgga aaatgtggcaaaagaagttg 7201 gaccactcgt atctoaaacagacatctgaaggtagtgg gtcagtaacc agcacaacat 726l taatagaaattittaagtgac actggagcag aaggacccacggtggcacct ctocctttct 7321 ccacggacat cggacatcct caaaatcaga ctgtcaggtgggcagaagaa atccagacta 7381 gtagaccaca aaccataactgaacaagact ctaacaagaattcttcaaca gcagaaatta 7441 acgaaacaac aacctcatct actgattittctggctagagc titatggttctgaaatggcca 750 laagaatttgttacatcagca ccaaaaccatctgacttgta tatgaacct tctggagaag 756l gatctggaga agtggatatgttgattcatttcacacttctgcaactact caggcaacca 7621 gacaagaaag cagcaccacatttgttctgatgggtccct ggaaaaa.cat cotgaggtgc 768l caag.cgctaa agctgttact gctgatggat tccCaacagttcagtgatgctgcctettic

Figure 5A (cont) Patent Application Publication Jul. 25, 2013 Sheet 9 of 30 US 2013/O189243 A1

7741 attcagagca gaacaaaagc ticccctgatc caactagcac actgtcaaat acagtgtcat 7801 atgagaggte cacagacggt agttccaag accgttcagggaatticgaggatticcacct 7861 taaaacctaa cagaaaaaaa cccactgaaa atattatcat agacctggac aaagaggaca 7921 aggatttaat attgacaatt acagagagta ccatccttgaaattctacct gagctgacat 7981 cggataaaaa tactatoatagatattgatc atactaaacc tgtgtatgaa gacattctg 8041 gaatgcaaac agatatagat acagaggtac catcagaacc acatgacagtaatgatgaaa 8101 gtaatgatga cagcactcaagttcaagaga totatgaggc agctgtcaac ctittctittaa 8161 ctgaggaaac atttgagggc tictgctgatgttctggctagctacacticaggcaacacatg 8221 atgaatcaatgactitatgaagatagaagcc aactagatca catgggcttt cacttcacaa 8281 ctgggatccc tgctcctage acagaaacagaattagacgt tttactitccc acggcaacat 8341 ccctgccaat toctogtaag totgccacag tattocagagattgaagga ataaaagctg 8401 aagcaaaagc cctggatgac atgtttgaat caagcactittgtctgatggt caagctattg 8461 cagaccaaagtgaaataata ccaacattgg gccaatttgaaaggacticag gaggagtatg 8521 aagacaaaaa acatgctggt ccttctttitc agccagaatt ctettcaggagctgaggagg 8581 cattagtaga ccatacticcc tatctaagtattgctactac ccacct tatggatcagagtg 864l taacagaggt gcctgatgtgatggaaggat coaatccc.cc atattacact gatacaacat 870l tagcagttcaacatttgcg aagttgtctt ctoagacacc atcatctocc cticactatct 8761 acticaggcagtgaagcctctggacacacagagatccccca gcccagtgct ctgccaggaa 8821 tagacgtcggctCatctgta atgtccccac aggattcttt taaggaaatt catgtaaata 8881 ttgaagcaac tttcaaaccatcaagtgagg aatacct tca cataactgag cctocctictt 8941 tatctoctga cacaaaatta gaaccttcag aagatgatgg taaacctgag tattagaag 9001 aaatggaagc titctoccaca gaacttattgctgtggaaggaactgagatt ctocaagatt 9061 tocaaaacaa aaccgatggt caagttctggagaagcaat caagatgttt cocaccatta 912laaacacctgaggctggaact gttattacaactg.ccgatga aattgaatta gaaggtgcta 9181 cacagtggcc acactictact tctgcttctgccacctatggggtegaggcaggtgtggtgc 9241 cttggctaag tocacagact tctgagaggc ccacgctttc ttcttctoca gaaataaacc 9301 ctgaaactica agcagctitta atcagagggc aggattcCac gatagcagcatcagaacagc 936 laagtggcagc gagaattctgattccaatgatcaggcaac agtaaaccct gtggaattta 9421 atactgaggttgcaa.cacca ccatttitccc ttctggagac ttctaatgaa acagattitcc 948 tgattggcattaatgaagag teagtggaaggcacggcaat ctatttaccaggacctgatC 954l gctgcaaaatgaaccogtgc cttaacggaggcacctgtta tectactgaa actitcctacg 9601 tatgcacctgtgtgccagga tacagcggag accagtgtga acttgattittgatgaatgtc. 9661 actictaatcc ctgtcgtaatggagccacttgtgttgatgg ttittaacacattcaggtgcc 9721 totgcct tcc aagttatgttggtgcactttgtgagcaaga taccgagacatgtgactatg 9781 gctggcacaa attcCaaggg cagtgctaca aatactittgc ccatcgacgc acatgggatg 984l cagctgaacgggaatgccgt ctgcagggtgccCatctoac aagcatcctgtctoacgaag 9901 aacaaatgtt tgttaatcgtgtgggccatgattatcagtggataggcctic aatgacaaga 996l tgtttgagcatgactCcgttggactgatggcagcacact gcaatacgag aattggagac 10021 ccaaccagcc agacagcttic ttttctgctggagaagactgtgttgtaatc atttggcatg 10081 agaatggccagtggaatgat gttccctgca attaccatct cacctatacgtgcaagaaag 101.41 gaacagttgc ttgcggccag ccccctgttg tagaaaatgc caagacctittggaaagatga 10201 aacctcgtta tgaaatcaac tocctgatta gataccactgcaaagatggt ttcattcaac 10261 gtcaccttcc aactatocgg tgcttaggaa atggaagatgggctatacct aaaattacct

Figure 5A (cont) Patent Application Publication Jul. 25, 2013 Sheet 10 of 30 US 2013/O189243 A1

10321 gcatgaacco atctgcatac caaaggactt attctatgaa atactittaaaaatticcticat 10381 cagcaaagga caattcaata aatacatcca aacatgatcatcgttggagc cggaggtggc 1044 aggagtcgaggcgctgatcc ctaaaatggc gaacatgtgttcatcatt teagccaaag 10501 tectaacttic ctgtgccttt cotatcacct cgagaagtaattatcagttggtttggattt 10561 ttggaccacc gttcagtcat tttgggttgc cgtgctccca aaacatttta aatgaaagta 10621 ttggcattcaaaaagacagc agacaaaatgaaagaaaatgagagcagaaagtaageattt 10681 ccagcctate taatttcttt agttttctatttgccticcag tgcagticcatttcctaatgt 10741 ataccagcct actgtactatttaaaatgct caatttcagc accgatggcc atgtaaataa 10801 gatgatttaatgttgattittaatcctgtatataaaataaaaagtcacaatgagtttgggc 10861 atatttaatgatgattatgg agccttagaggtetttaatc attggttcgg ctgcttittat 10921 gtagtttagg ctggaaatgg tttcacttgc tictttgactgtcagcaagactgaagatggc 1098l ttttcctgga cagctagaaa acacaaaatc ttgtaggtoattgcacctat ctoagccata 11041 ggtgcagtttgcttctacat gatgctaaaggctg.cgaatgggatcCtgatggaactaagg 11101 acticcaatgtcgaactictitc tittgctgcattcctttittct tcacttacaagaaaggcctg 11161 aatggaggac ttttctgtaa ccagg

Figure 5A (cont)

Patent Application Publication Jul. 25, 2013 Sheet 12 of 30 US 2013/O189243 A1

3001 GODSTIAASE OOVAARILDS NDOATVNPVE FNTEVATPPF SLLETSNETD FLIGINEESV 3 O 61 EGTAIYLPGP DRCKMNPCLN GGTCYPTETS YWCTCVPGYS GDOCELDFDE CHSNPCRNGA 3121 TCVDGFNTFR CLCLPSYVGA LCEODTETCD YGWHKFOGOC YKYFAHRRTW DAAERECRLO 3181 GAHLTSILSH EEOMFVNRVG HDYOWIGLND KMFEHDFRWT DGSTLOYENW RPNOPDSFFS 3241 AGEDCVVIIW HENGOWNDVP CNYHLTYTCK KGTVACGOPP V VENAKTFGK MKPRYEINSL 3301 IRYHCKDGFI ORHLPTIRCL GNGRWAIPKI TCMNPSAYOR TYSMKYFKNS SSAKDNSINT 3361 SKHDHRWSRR WOESRR

Figure5B (cont)

Patent Application Publication Jul. 25, 2013 Sheet 14 of 30 US 2013/O189243 A1

2461 gaggatacaa gcagaagaaggcatateaag atcggttage ttacctgcgc ticccacaaag 2521 atgaagttgt aaagattcag tecctggcaaggatgcacca agctcgaaag.cgctatogag 2581 atcgcctgcagtacticcgg gaccatataa atgacattat caaaatcCaggcttittatto 2641 gggcaaacaa agctcgggatgactacaaga ctetcatcaatgctgaggat cetcetatgg 2701 ttgtggtccg aaaatttgtc. cacctgctgg accaaagtga ccaggattitt caggaggagc 2761 ttgacct tatgaagatgcgg gaagaggitta teaccCtcat tcgttctaac cagcagctgg 2821 agaatgacct caatcteatggatatcaaaattggactgct agtgaaaaataagattacgt 2881 tgcaggatgtggttcCCaC agtaaaaaac taccaaaaaaaataaggaa cagttgtctg 2941 atatgatgat gataaataaa cagaagggaggtetcaaggc tittgagcaag gagaagagag 3001 agaagttgga agcttaccag cacctgttitt atttattgca aaccaatccc acctatotgg 3061 ccaagctcat ttttcagatgcc.ccagaacaagtccaccaagttcatggac totgtaatct 3121 teacacticta caactacgcg tocaaccagc gagaggagtacctgctcctg.cggctcttta 3181 agacagcact ceaagaggaa atcaagtcga aggtagatca gattcaagag attgtgacag 3241 gaaatcctacggttattaaaatggttgtaagttcaa.ccgtggtgcccgtggccagaatg 3301 ccctgagaca gatctggcc ccagtcgtga aggaaattatggatgacaaatctetcaa.ca 3361 toaaaactga ccctgtggat atttacaaat cttgggittaatcagatggag tetcagacag 3421 gagaggcaag caaactgccc tatgatgtga cccctgagcagg.cgctagct catgaagaag 3481 tgaagacacggctagacagc ticcatcagga acatgcgggc tigtgacagac aagttctict 3541 cagccattgt cagctctgtggacaaaatcc ctatgggatgcgcttcattgccaaagtgc 3601 tgaaggactic gttgcatgag aagttccctgatgctggtgaggatgagctgctgaagatta 366 littggtaacttgctittattat cgatacatga atccagccattgttgcticct gatgcctttg 3721 acatcattga cctgtcagoaggaggccagc titaccacaga ccaacg.ccga aatctgggct 3781 ccattgcaaaaatgcttcag catgctgctt ccaataagatgttctgggagataatgccc 3841 acttaag.cat cattaatgaa tatct tccc agtcctacca gaaattcaga cggtttittcc 3901 aaactgcttgtgatgtc.cca gagcttcaggataaatttaatgtggatgag tactctgatt 3961 tagtaaccct caccaaaccagtaatctacatttccattggtgaaatcatC aacacccaca 4021 ctctectgttggatcaccag gatgccattgctccggagca caatgatcca atccacgaac 4081 tgctggacga ccteggcgaggtgcccaccatcgagtc.cct gataggggaa agctctggca 4141 atttaaatga cccaaataag gaggcactgg ctaagacgga agtgtctictc accctgacca 4201 acaagttcga cgtgcctgga gatgagaatgcagaaatggatgcticgaacc atcttactga 4261 atacaaaacg tttaattgtggatgtcatcc ggttccagcc aggagaga.cc ttgactgaaa 4321 tectagaaac accagccacc agtgaacagg aagcagaacatcagagagcc atgcagagac 438l gtgctatocgtgatgccaaa acacctgaca agatgaaaaagtcaaaatctgtaaaggaag 444l acagcaacct cacticttcaa gagaagaaag agaagatcca gacaggttta aagaagctaa 4501 cagagcttgg aaccgtggac ccaaagaacaaataccagga actgatcaac gacattgcca 4561 gggatatteggaatcagcgg aggtaccgacagaggagaaaggccgaacta gtgaaactgc 4621 aacagacata cgctgctctgaactictaagg ccaccttitta tggggagcaggtggattact 4681 ataaaagcta tatcaaaacc tgcttggata acttagccag caagggcaaagtctccaaaa 4741 agcctaggga aatgaaagga aagaaaag.ca aaaagatttic totgaaatat acagcagcaa. 4801 gactacatga aaaaggagttcttctggaaattgaggacct gcaagtgaat cagtttaaaa. 4861 atgttatatt tgaaatcagt ccaacagaagaagttggaga Cttcgaagtgaaag.cCaaat 4921 teatgggagttcaaatggag acttittatgttacattatcaggacctgctgcagctacagt 4981 atgaaggagttgcagticatgaaattatttgatagagctaa agtaaatgtc aacctcctga 5041 tottccttct caacaaaaagttctacggga agtaattgat cgtttgctgc cagcccagaa

Figure 6A (cont) Patent Application Publication Jul. 25, 2013 Sheet 15 of 30 US 2013/O189243 A1

5101 ggatgaagga aagaagcacc teacagctcc tttctaggte cttctttcct cattggaagc 5 161 aaagacctag ccaacaa.cag cacctcaatctgatacactic ccgatgccac atttittaact 5221 cctetcgctic tgatgggacatttgttaccc tttitttcata gtgaaattgtgttcaggct 5281 tagtctgacc tttctggttcttcatttitc. tccattact taggaaagag tggaaacticc 5341 actaaaattt ctetgtgttgttacagtictt agaggttgcagtactatatt gtaagetttg 5401 gtgtttgtttaattageaat agggatggtaggattcaaatgtgtgtcatt tagaagtgga 54.61 agctattagc accaatgaca taaatacata caagacacacaactaaaatgtcatgttatt 5521 aacagttatt aggttgtcatttaaaaataa agttccttta tatttctgtc. ccatcaggaa 5581 aactgaagga tatggggaat cattggttat ctitcCattgtgtttttcttt atggacagga 564l gctaatggaagtgacagtcatgttcaaagg aagcatttct agaaaaaagg agataatgtt 570l tttaaatttic attatcaaac ttgggcaatt ctgtttgtgt aactCcccga ctagtggatg 576l ggagagtccc attgctaaaatticagotact Cagataaatt cagaatgggt caaggcacct 582 gcctgtttttgttggtgcacagagattgac ttgatticaga gagacaattic acticcatccc 5881 tatggcagag gaatgggtta gccctaatgt agaatgtcattgtttittaaa actgtttitat 5941 atcttaagag tgccttatta aagtatagatgtatgtctta aaatgtgggtgataggaatt 6001 ttaaagattt atataatgcatcaaaagcct tagaataaga aaagcttttt ttaaattgct 6061 ttatctgtat atctgaactic ttgaaactta tagctaaaac actaggattt atctgcagtg 6121 ttcagggaga taattctgcc tittaattgtc taaaacaaaaacaaaaccag ccaacctatg 6181 ttacacgtgagattaaaaccaatttitttcc ccatttitttc. tcctttttitc tottgctgcc 6241 cacattgtgc ctttattitta tgagccccagttttctgggc titagtttaaaaaaaaaatca 6301 agtictaaacattgcatttagaaagcttttgttctggata aaaagticata cactittaaaa 6361 aaaaaaaaaactttittccaggaaaatatattgaaatcatgctgctgagec tetattittct 6421 ttctttgatgttttgatticagtattettitt atcataaattitttagcattt aaaaattcac 6481 tigatgtacat taagecaata aactgctitta atgaataacaaactatgtag tgtgtcccta 6541 ttataaatgc attggagaag tatttittatgagacticttta cticaggtgcatggttacagc 6601 ccacagggaggcatggagtgccatggaagg attcgccact accCagacct tgttttttgt 666l tgtattttgg aagacaggtt ttttaaagaa acattttcct cagattaaaagatgatgcta 6721 ttacaactag cattgcctica aaaactggga ccaaccaaagtgtgtcaacc ctgttcctt 678 aaaagaggct atgaatcCca aaggccacat CCaagacagg caataatgag cagagtttac 6841 agcticcttta ataaaatgtgtcagtaattt taaggtttat agttccctica acacaattgc 6901 taatgcagaa tagtgtaaaatgcgcttcaa gaatgttgat gatgatgata tagaattgtg 6961 gctttagtag cacagaggat gccccaacaa acticatggcgttgaaaccac acagttctca 7021 tactgttatttattagctg tagcattcto tgtctoctetctictectcct ttgaccttct 7081 cctegaccag ccatcatgac atttaccatgaatttacttic ctoccaagag tittggactgc 7141 ccgtcagattgttgctgcac atagttgcct ttgtatctotgtatgaaata aaaggtoatt 7201tgttcatgtt aaaaaaaaa

Figure 6A (cont)

Patent Application Publication Jul. 25, 2013 Sheet 17 of 30 US 2013/O189243 A1

NCBI Reference Sequence: NM 000607.2 Homo sapiens orosomucoid 1 (ORM), mRNA (SEQID NO: 7)

acagagtaaa cittittgctdg gcticcalagto accoccoata gtttattata aaggtoactd CaCCCtgcag cCaccagoaC tgcctggctic CacgtgCCtc CtggtCtcag tatgg.cgctg 121 tcCtgggttc ttacagtcct gag CCtcCta CCtctgctgg aag CCC agat CCCattgttgt 181 gCCaaCCtag taCCCC to CC CatCaCCaac CCCaCCCtgg aCCggat CaC tgg CaagtCG 2A1 ttittatatog catcdc.cctt. tCcaaacgacy gagtacaata agt cogttca cCagat CCaa 3 O gCaa CCtt Ct tt tact toac CCCC ala CalaC a CaCaCCaCa coat ctitt ct CagagagtaC 361 CagaCCCCaC aggaCCagtg CatCtataaC aCCaCCtaCC tgaatgtc.ca CCCCC aaaat 421 ggCaCCatCt CC agatacgt. CCCaCCCCala gag Cattt CC citcacttgct gatCCtCagg 481 gaCaccalaga cctacatgct tgcttittgac gtgaaCCatC agaagaactg gggg Ctgtct 5A Ot. CtatCCtC a Cala CCCaCa CaCCaCCaac CaCCala CtGC Gaga Citt Cta CCaag Ct. Ct. C 6O1 gaCtgCttgC gCatt CCCala gt Cagatgtc. gtgtaCaCCg attggaaaaa ggataagttgt 661 gaCCCaCtgC agalag Cag Ca CC agaaggag aggaala Cagg aCCaCCCCC a atCctagoag 721 gaCaCagCCt tggat Cagga. CagagaCttg gggg CC at CC tgcc.cct coa a CCCCaCatg 78 to taccticag Ctttitt.ccCt. Cact to catc aataaag citt ctdtott togg aacagctaaa. 8 A

Figure 7A Patent Application Publication Jul. 25, 2013 Sheet 18 of 30 US 2013/0189243 A1

NCBI Reference Sequence: NP 000598.2 orosomucoid 1 precursor Homo sapiens (SEQID NO: 8)

MALSWVLTVL SLLPLLEAOI PLCANLVPVP ITNAT)LDRIT GKWFYIASAF RNEEYNKSVO 61 EICATFFYFT PNKTEDTIFL REYOTRODOC IYNTTYLNVQ RENGTISRYV GGOEHFAHLL 121 ILRDTKTYML AFDVNDEKNW GLSWYADKPE TTKEQ LGEFY EALDCLRIPK SDV WYTDWKK 181 DKCEPLEKOH EKERKOEEGE S

Figure 7B Patent Application Publication Jul. 25, 2013 Sheet 19 of 30 US 2013/O189243 A1

Homo sapiens arginasc, liver (ARGl), mRNA NCBI Reference Sequence: NM 000045.2 (SEQ ID NO:9) ltgtcactgagggttgactgactggagagct caagtgcagc aaagagaagtgtcagagcat 61 gagcgc.caag tecagaacca tagggattattggagctcct ttctoaaagg gacagccacg 121 aggaggggtggaagaaggcc ctacagtatt gagaaaggctggtctgcttg agaaacttaa 181 agaacaagag tgtgatgtga aggattatggggacctgcCC tittgctgacatccctaatga 24l cagtCcctitt caaattgtga agaatcCaaggtotgtggga aaagcaag.cg agcagctggc 301 tggcaaggtggcagaagtica agaagaacgg aagaatcagc ctggtgctggg.cggagacca 361 cagtttggca attggaagcatctotggcca tgcCagggtc. caccctgatc ttggagticat 421 ctgggtggatgcticacactgatatoaacac tocactgaca accacaagtggaaacttgca 481 tggacaacct gtatictttcc tectgaagga actaaaagga aagatticccg atgtgcCagg 541 attctcctgggtgacticcct gtatatctgc caaggatattgtgtatattggcttgagaga 601 cgtggaccct ggggaacact acattttgaaaactictaggc attaaatact tttcaatgac 661 tgaagtggac agactaggaattggcaaggtgatggaagaa acacticagct atctactagg 721 aagaaagaaa aggccaattic atctaagttt tgatgttgacggactggacc Catctttcac 781 accagctact ggcacaccag tegtgggagg tetgacatacagagaaggte tetacatcac 841 agaagaaatc tacaaaacagggctacticte aggattagatataatggaagtgaacccatc 901 cctggggaag acaccagaagaagtaacticgaacagtgaac acagcagttgcaataacctt 961 ggcttgttcggacttgctic gggagggtaatcacaagcct attgactaccttaacccacc 1021 taagtaaatgtggaaacatc cgatataaat cteatagtta atggcataat tagaaagcta 1081 atcattttct taagcataga gttatccttic taaagacttgttctttcaga aaaatgtttt 1141 tocaattagtataaacticta caaattcCct cttggtgtaaaattcaagatgtggaaattic 1201 taacttittttgaaatttaaa agcttatatt ttctaacttggcaaaagact tatccttaga 1261 aagagaagtg tacattgatt tocaattaaaaatttgctgg cattaaaaataagcacactt 1321 acataagecc ccataca tag agtgggactic ttggaatcag gagacaaagc taccacatgt 1381 ggaaaggtac tatgtgtcca tgtcatteaa aaaatgtgat tttittataataaacticttta 1441 taacaag //

Figure 8A

Patent Application Publication Jul. 25, 2013 Sheet 21 of 30 US 2013/O189243 A1

Homo sapiens lymphocyte antigen 96 (LY96), mRNA NCBI Reference Scquence: NM 015364.3 (SEQ ID NO: 11) l agittaaatct tittctgctta Ctcaaaagga agagtctgat gattagttac to atcctcitt 61 tgCatttgta aag Ctttgga Catatt Calat CatgttaCCa titt Ctgttitt titt CCaCCCt 121 gttittctitcc a tatt tactg aag Citcagaa gCagtattgg gtctgcaact catc.cgatgc 181 alag tattt Ca taCaCCtaCt Ctgataaaat gCalata CCCa attt Caatta atgttala CCC 241 Ctgtatagaa ttgaaaagat Ccaaaggatt attgcacatt titCta Cattic Cala CCaC aga 3O1 tittaaa.gcaa. ttatatttcal atct citat at aactgtcaiac aCCatgaat C tt CCaaag.cg 361 Calaagaagtt atttgCC gag CatCtgatga cgattactict titttgCagag Ct Citgaaggg 421 agaga Citctg aata Caacaa tat cattct c Ctt Calaggda ataaaattitt Ctalaggdalala 481 alta Calaat Ct gttgttgaag Ctatttctgg CaCCCCaCaa galaatgCtCt tittgcttgga 54 gtttgtcatc Cta CaCCalaC Ctaattcaaa. ttagaataaa ttgagtattt aaaaaaaaaa. 6O1 dadadcaa.ca cadcadalcal //

Figure 9A

Patent Application Publication Jul. 25, 2013 Sheet 24 of 30 US 2013/O189243 A1

NCBI Reference Sequence: NP 056179.2 LY96 protein precursor Homo sapiens (SEQID NO: 14)

1 MLPFLFFSTL FSSIFTEAOK OYWVCNSSDA SISYTYCDKM OYPISINVNP CIELKRSKGL 61 LHIFYIPRRD LKOLYFNLYI TVNTMNLPKR KEWICRGSDD DYSFCRALKG ETVNTTISFS 121 FKGIKFSKGK YKCVVEAISG SPEEMLFCLE FWILHOPNSN A/

Figure 10B

Patent Application Publication Jul. 25, 2013 Sheet 26 of 30 US 2013/O189243 A1

NCBI Reference Sequence: NP 000708.1 carbonic anhydrase IV precursor Homo sapiens (SEQID NO: 16) 1 MRMLLALLAL SAARPSASAE SHWCYEVOAE SSNYPCLVPV KWGGNCOKDR OSPINIVTTK 61 AKVDKKLGRF. FFSGYDKKOT WTVONNGHSV MMLLENKAST SGGGLPAPYO AKOLHLHWSD 121 LPYKGSEHSL DGEHFAMEMH IVHE KEKGTS RNVKEAODPE DEIAVLAFLV EAGTOVNEGF 181 QPLVEALSNI PKPEMSTTMA ESSLLDLLPK EEKLRHY FRY LGSLTTPTCD EKVVWTVFRE 241 PIOLHREOIL AFSOKLYYDK EOTVSMKDNV RPLOOLGORT VIKSGAPGRP LPWALPALLG 3 Ol PMLACLLAGE LR A /

Figure l l B Patent Application Publication Jul. 25, 2013 Sheet 27 of 30 US 2013/O189243 A1

NCBI Reference Sequence: NM 005621.1 Homo sapiens S100 calcium binding protein A12 (S100A12), mRNA (SEQ ID NO: 17) 1. accactocto Octittittgct gtag citccac atticcitotgc attgaggggit taacattagg 61 Ctgggalagat gacaaaactt Caagag CatC tggagggaat tgttcaatato titcCaCCaat 121 aCtCagtt CC Caagggg Cat tittgaCaCCC tCtCta aggg tgag Citgaac CagCtgCtta 181 Calaaggag Ct tgCadaCaCC at Caagaata tCadagatala agCtgt Catt gatgaaat at 241 to CaaggcCt gigatgctaat CaagatgaaC aggtogactit tdaagaattic at at CCCtgg 3O1 tagccattgc CCtgaaggct gcc.cattacc aCaCCCaCala agagtaggta gctictotgaa 361 ggcttitttac ccagoaatgt. CCtcaatgag ggtottttct titCCC to a CC aaaaccCagc 421 CttgcCCgtg CCGagtalaga gttaataaac acacticacga aaagtt //

Figure 12A Patent Application Publication Jul. 25, 2013 Sheet 28 of 30 US 2013/O189243 A1

NCBI Reference Sequence: NP 005612.1 S100 calcium-binding protein A12 Homo sapiens (SEQID NO: 18)

1 MTKLEEHLEG IVNIFHOYSV RKGHFDTLSK GELKOLLTKE LANTIKNIKD KAVIDEIFOG 61 LDANODEOVD FOEFISLVAI ALKAAHYHTH KE A /

Figure 12B Patent Application Publication Jul. 25, 2013 Sheet 29 of 30 US 2013/O189243 A1

Injection Magnetic Syringe particles Ring magnet

Tygon Tubing Purification Air Separation 2 buffers S

Figure 13 Patent Application Publication Jul. 25, 2013 Sheet 30 of 30 US 2013/O189243 A1

DNA/RNA Recognition Sequence

Hairpin Formation Sequence O - Cyanine Fluorescent Dye

10 Thymine Spacer

C6 Thiol Linker

Figure 14 US 2013/O 189243 A1 Jul. 25, 2013

BOMARKERS FOR ACUTE SCHEMC for most instances of stroke in patients, and consequently, the STROKE category of stroke having the greatest financial burden. 0010 Ischemic stroke encompasses thrombotic, embolic, INCORPORATION BY REFERENCE lacunar and hypoperfusion types of strokes. Thrombi are 0001. This application claims priority to U.S. Provisional occlusions of arteries created in situ within the brain, while Application Ser. No. 61/307,233, filed Feb. 23, 2010, the emboli are occlusions caused by material from a distant entire contents of which are incorporated herein by reference. Source. Such as the heart and major vessels, often dislodged 0002 All documents cited or referenced herein and all due to myocardial infarct or atrial fibrillation. Less fre documents cited or referenced in the herein cited documents, quently, thrombi may also result from vascular inflammation together with any manufacturers instructions, descriptions, due to disorders such as meningitis. Thrombi or emboli can product specifications, and product sheets for any products result from atherosclerosis or other disorders, for example, arteritis, and lead to physical obstruction of arterial blood mentioned herein or in any document incorporated by refer Supply to the brain. Lacunar stroke refers to an infarct within ence herein, are hereby incorporated by reference, and may be non-cortical regions of the brain. Hypoperfusion embodies employed in the practice of the invention. diffuse injury caused by non-localized cerebral ischemia, GOVERNMENT SUPPORT typically caused by myocardial infarction and arrhythmia. 0011. Of the 88% of ischemic strokes that occur each year, 0003. This application was supported by a pre-doctoral 8-12% results in death within 30 days. The risk of ischemic Intramural Research Training Award via the Graduate Part stroke is associated with various familial and environmental nerships Program through the National Institute of Nursing factors, such as the presence of hypertension, obesity, tobacco Research, National Institutes of Health. This research pre use, and a positive family history. Determinants of outcome sented in this application was also supported by the Division include non-modifiable risk factors such as age, race, gender of Intramural Research of the National Institute of Neurologi and genetic variation along with clinical phenotypes of sever cal Disorders and Stroke (Grant No. Z01 AG000957-05), and ity, such as stroke scale score, the presence of fever and the Laboratory of Neurogenetics, National Institute of Aging serologic blood markers. Advances in neuroimaging and National Institutes of Health. Accordingly, the Government acute clinical management have resulted in greater numbers may have certain rights in this invention. of patients surviving the initial insult. However, morbidity remains high secondary to complications following the pri BACKGROUND OF THE INVENTION mary event and initial misdiagnosis. 0004. 1. Field of the Invention 0012. The onset of ischemic stroke is often abrupt, and can 0005. The present invention relates to the identification begin with a manifestation of neurologic deficits that worsen and use of diagnostic markers for acute ischemic stroke. In a over a 24-48 hour period. Stroke-associated symptoms com various aspects, the invention relates to methods for rapid and monly include unilateral neurologic dysfunction that extends early detection of acute ischemic stroke, as well as the iden progressively, without producing headache or fever. Early tification of individuals at risk for acute ischemic stroke. manifestations may rapidly progress to more severe symp 0006 2. Background toms within a few minutes. 0007 Stroke is clinically defined as a rapidly developing 0013 Hemorrhagic stroke is caused by intracerebral or syndrome of vascular origin that manifests itself in focal loss Subarachnoid hemorrhage, i.e., bleeding into brain tissue, of cerebral function. In more severe situations, the loss of following blood vessel rupture within the brain. Intracerebral cerebral function is global. Stroke can be categorized into two and Subarachnoid hemorrhage are Subsets of a broader cat broad types, “ischemic stroke' (about 87%) and “hemor egory of hemorrhage referred to as intracranial hemorrhage. rhagic stroke' (about 10%). Ischemic stroke occurs when the Intracerebral hemorrhage is typically due to chronic hyper blood supply to the brain is suddenly interrupted. Hemor tension, and a resulting rupture of an arteriosclerotic vessel. rhagic stroke happens when a blood vessel located in our Stroke-associated symptom(s) of intracerebral hemorrhage around the brain bursts leading to the leakage and accumula are abrupt, with the onset of headache and steadily increasing tion of blood directly in the brain tissue. Additionally, a neurological deficits. Nausea, vomiting, delirium, seizures patient may experience transient ischemic attacks, which and loss of consciousness are additional common stroke indicates a high risk for the future development of a more associated symptoms. severe episode. Stroke also includes Subarachnoid hemor 0014. In contrast, most subarachnoid hemorrhage is rhage (about 3%). caused by head trauma or aneurysm rupture which is accom 0008. The symptoms of stroke often include numbness or panied by high blood pressure release which also causes weakness, especially on one side of the body; Sudden confu direct cellular trauma. Prior to rupture, aneurysms may be sion or trouble speaking or understanding speech; sudden asymptomatic, or occasionally associated with tension or trouble seeing in one or both eyes; Sudden trouble walking; migraine headaches. However, headache typically becomes dizziness; or loss of balance or coordination. Stroke is the acute and severe upon rupture, and may be accompanied by most common devastating neurologic disease in the world varying degrees of neurological deficit, vomiting, dizziness, and despite recent progress understanding stroke mecha and altered pulse and respiratory rates. nisms, stroke management is still not optimal. 0015 Transient ischemic attacks (TIAS) have a sudden 0009 Stroke is the third leading cause of death in the onset and brief duration, typically 2-30 minutes. Most TIAS world, after only heart disease and cancer. In the United States are due to emboli from atherosclerotic plaques, often origi alone, approximately 780,000 people experience a stroke nating in the arteries of the neck, and can result from brief each year, which contributes to an overall financial burden of interruptions of blood flow. The symptoms of TIAS are iden over S65 billion per year. As noted, ischemic stroke accounts tical to those of stroke, but are only transient. Concomitant US 2013/O 189243 A1 Jul. 25, 2013

with underlying risk factors, patients experiencing TIAS are mation of stroke diagnosis and the identification of stroke at a markedly increased risk for stroke. type limit the number of patients that may benefit from early intervention therapy. 0016. There are few pharmaceutical therapies for treating 0021. Another limitation in the diagnosis of ischemic stroke. In point of fact, the only Food and Drug Administra stroke relates to the fact that, due to the rapidity of onset and tion (FDA) approved treatment for ischemic stroke is recom progression of acute ischemic stroke, circumstances are Such binant issue plasminogen activator (rtPA), alteplase. Multiple that ischemic stroke patients are often not seen by clinicians attempts to identify other pharmacologic agents have resulted having the appropriate knowledge and training to be able to in negative findings; therefore a redirection of the Science is provide a correct, life-saving diagnosis. For instance, brain necessary to understand the human variable response to imaging technology is an integral and key aspect of the clini stroke, in particular, to ischemic stroke, to provide alternative cal stroke evaluations. However, such technology is often not avenues for therapeutic treatment. available. Even if the technology is available, proper inter 0017. Since its commencement into the clinical arena in pretation of brain imaging results concerning stroke diag 1996, recombinant tissue plasminogen activator (rtPA) has noses is best Suited for those clinicians who are highly and proven to be a promising therapeutic treatment for ischemic specifically trained in the treatment and care of stroke stroke and is safe and effective for use in routine clinical patients. Indeed, due to the rapid onset of an acute ischemic practice. However, its powerful effects are not seen without stroke and other factors. Such as the scarcity of trained stroke significant clinical complications. In addition, rtPA is only clinicians and neurologists, clinical assessment of a potential approved for use when patients present to the hospital within victim is often carried out by a non-stroke specialist, e.g., a three hours from onset of symptoms. The downside is that the family practitioner, paramedic or triage nurse. Thus, achiev median time from stroke symptom onset to presentation to the ing and accurate and rapid early diagnosis is often not pos emergency department is 3-6 hours. A recent study addressed sible under present clinical circumstances. the possibility of extending this limited therapeutic time win 0022. Patients, even those with mild symptoms, may be dow and it was shown that intravenous rtPA given between 3 eligible for various ischemic stroke therapies if they can be and 4.5 hours after onset of symptoms significantly improved started within a few hours of symptom onset. Patients who do clinical outcomes following ischemic stroke compared to not receive such early therapies are at an increased risk of placebo. This is promising given that the time window limit of recurrent stroke, often occurring even within a matter of days. 3 hours and a large list of contraindicating factors for throm Thus, prompt administration of a suitable therapy in a timely bolytic therapy currently results in only 3-8% of stroke manner can Substantially increase the efficacy of treatment patients receiving rtPA. while reducing the risk of recurrent stroke. 0023. However, presently there are no rapid diagnostic 0018. The advancements of rtPA therapy aside, there is procedures or methods that can be used to reliably determine still a demand for alternative acute ischemic stroke therapies whether a patient has suffered a stroke, in particular, an acute in clinical practice. Unfortunately, the results of recent clini ischemic stroke, or whether a Subject is at risk for ischemic cal trials have demonstrated that there is still a gap in the stroke. understanding of the variable human response to ischemic 0024. Accordingly, a rapid diagnostic test capable of mak stroke. Numerous promising pre-clinical therapeutics display ing an accurate clinical diagnosis of ischemic stroke irrespec insignificant clinical utility in human patients, which speaks tive of the clinicians level of stroke expertise or lack thereof to the difficulty of translating what is learned at the bench to would be extremely useful. To date, the identification of the patient at the bedside. appropriate biomarkers for ischemic stroke have proven to be 0019. These negative findings may be due in part to the extremely difficult. This may be tied, in part, to the observa complexity of the human physiologic response to ischemic tion that the proteins associated with stroke-affected brain stroke, limited knowledge about the multiple pathways inter and neurological tissues are slow to be released into the blood acting in response to ischemic stroke and the implications of due to the blood-brain barrier. In addition, many potential genomic variability on individual recovery from ischemic stroke markers, including markers of cerebral ischemia and stroke. The difficulty may also be attributable to insufficient inflammation, located in the blood are associated with other classification of ischemic stroke subtype. It is possible that conditions that may mimic stroke, e.g., severe myocardial gene expression profiling can help to identify Subtypes of infarction and brain infection. ischemic stroke, which has tremendous utility in designing 0025. This invention solves these deficiencies in the art. therapeutic strategies for treatment. A better understanding of stroke pathophysiology in humans and more appropriate SUMMARY OF THE INVENTION stroke Subtyping may provide the foundation needed to 0026. The present invention relates to the identification design appropriate therapeutics for battling ischemic stroke and use of diagnostic markers for acute ischemic stroke. The and other stroke types. methods and compositions described herein can meet the 0020 Immediate diagnosis and care of a patient experi need in the art for rapid, sensitive and specific diagnostic encing stroke can be critical. As noted, tissue plasminogen assay to be used in the diagnosis of acute ischemic stroke in activator (rtPA) given within three hours of symptom onset in patients or in the assessment of the risk of developing acute ischemic stroke is beneficial for selected acute ischemic ischemic stroke. The methods and compositions can also be stroke patients. Patients may also benefit from anticoagulants used to distinguish acute ischemic stroke from other various (e.g., heparin) if they are not candidates for rtPA therapy. In forms of stroke and TIAS and “stroke mimic' events. More contrast, thrombolytics and anticoagulants are strongly con over, the methods and compositions of the present invention traindicated in hemorrhagic strokes. Thus, early and rapid can also be used to facilitate the treatment of stroke patients differentiation of ischemic stroke from hemorrhagic-type and the development of additional diagnostic and/or prognos stroke is imperative and often critical. Delays in the confir tic indicators. US 2013/O 189243 A1 Jul. 25, 2013

0027 Prior to this invention, the diagnosis of ischemic positions (e.g., arrays, probes, biomarker panels) that com stroke has been difficult and inaccurate. These problems are prise the nine identified genes which can be used in the due in part to limitations in the technology currently used to diagnosis of acute ischemic stroke and/or to distinguish acute evaluate a patient for a stroke and limitations in the level of ischemic stroke from TIAS and "stroke mimic' events. Fur experience and/or proper training possessed by medical cli ther, since the biomarkers of the invention represent potential nicians who engage the patients. These circumstances are targets of intervention for the treatment of stroke, the biom detrimental to stroke victims because an accurate and quick arkers of the invention can be used in methods for Screening diagnosis of acute ischemic stroke is extremely important to compounds or agents that can treat acute ischemic stroke or a the health and outcome of the patients. symptom thereof and which are detectable by the evaluation 0028 Brain imaging technology is an integral and key of the biomarkers of the invention. aspect of the clinical stroke evaluations but may suffer from a 0034. In addition, the invention is directed to composi number of limitations, including lack of sensitivity and lack tions that are useful in the detection of the biomarkers, includ of availability. Moreover, proper interpretation of brain imag ing nucleic acid probes and antibodies that are specific for the ing results concerning stroke diagnoses is best Suited for those biomarkers of the invention, as well as to compositions com clinicians who are highly and specifically trained in the treat prising purified biomarkers and their corresponding encoding ment and care of stroke patients. Indeed, due to the rapid onset nucleic acid molecules. of an acute ischemic stroke and other factors, such as the 0035. In a particular aspect, the present invention provides scarcity of trained stroke-clinicians and neurologists, clinical a method for the diagnosis of acute ischemic stroke in a assessment of a potential victim is often carried out by a Subject, comprising detecting in a sample of whole peripheral non-stroke specialist, e.g., a family practitioner, paramedic or blood obtained from the subject the presence of two or more triage nurse. Thus, achieving an accurate and rapid early biomarkers selected from the group consisting of: (a) diagnosis is often not possible. chemokine receptor 7 (CCR7); (b) chondroitin sulfate pro 0029 Patients, even those with mild symptoms, may be teoglycan 2 (CSPG2); (c) IQ motif-containing GTPase acti eligible for various ischemic stroke therapies if they can be vation protein 1 (IQGAP1); (d) orosomucoid 1 (ORM1); (e) started within a few hours of symptom onset. Patients who do arginase 1 (ARG1); (f) lymphocyte antigen 96 (LY96); (g) not receive such early therapies are at an increased risk of matrix metalloproteinase 9 (MMP9): (h) carbonic anhydrase recurrent stroke, often occurring even within a matter of days. 4 (CA4): (i) s100 calcium binding protein A12 (S100A12); Thus, prompt administration of a Suitable therapy in a timely and wherein at least one of the biomarkers is (a), (b), (c) or (d), manner can substantially increase the risk of treatment while and wherein detection of the presence of the two or more reduce the risk of recurrent stroke. biomarkers is indicative of acute ischemic stroke in the sub 0030. Accordingly, a rapid diagnostic test capable of mak ject. ing an accurate clinical diagnosis of ischemic stroke irrespec 0036. In one embodiment, the above method further com tive of the clinicians level of stroke expertise or lack thereof prises obtaining brain imaging data of the Subject and evalu would be extremely useful. However, to date, the identifica tion of appropriate blood biomarkers for ischemic stroke have ating the data to detect an acute ischemic stroke. The brain proven to be extremely difficult. This may be tied, in part, to imaging data can be obtained through MRI or CT scan. the observation that the proteins associated with stroke-af 0037. In another embodiment, the invention provides a fected brain and neurological tissues are slow to be released method for identifying a candidate for acute ischemic stroke into the blood due to the blood-brain barrier. In addition, therapy using the biomarkers of the invention to diagnose many potential stroke markers (including markers of cerebral acute ischemic stroke in a patient. The therapy can be the ischemia and inflammation) located in the blood are associ administration of a therapeutically effective amount of ated with other conditions that may mimic stroke (e.g., severe recombinant plasminogen activator (rtPA). myocardial infarction and brain infection). A recent compre 0038. In yet another aspect, the invention provides a hensive review of published blood-based stroke biomarkers method for the diagnosis of acute ischemic stroke in a Subject, revealed significant problems and weaknesses associated comprising detecting in a biological sample obtained from with currently published biomarkers, indicating that no single the Subject one or more biomarkers selected from the group marker or panel of markers could be recommended for rou consisting of: (a) chemokine receptor 7 (CCR7); (b) chon tine clinical practice. droitin sulfate proteoglycan 2 (CSPG2); (c) IQ motif-contain 0031. Thus, at the time of the present invention, there ing GTPase activation protein 1 (IQGAP1); and (d) orosomu remained a substantial need for a single biomarker or panel of coid 1 (ORM1). biomarkers which were clinically effective in the diagnosis of 0039. In a further aspect, the invention provides a method acute ischemic stroke. for the diagnosis of acute ischemic stroke in a Subject, com 0032. In one particular embodiment, using a gene expres prising detecting in a biological sample obtained from the sion profiling approach, this application describes obtaining Subject two or more biomarkers selected from the group peripheral blood samples from 39 stroke patients and 25 consisting of chemokine receptor 7 (CCR7); chondroitin healthy controls at various times relative to the onset of acute sulfate proteoglycan 2 (CSPG2); IQ motif-containing ischemic stroke symptoms and then evaluated changes in GTPase activation protein 1 (IQGAP1); orosomucoid 1 gene expression profiles in both stroke and control groups (ORM1); arginase 1 (ARG1); lymphocyte antigen 96 (LY96); over time. The gene expression profiles were analyzed to matrix metalloproteinase 9 (MMP9); carbonic anhydrase 4 identify nine gene candidates having a likely role in acute (CA4); and s100 calcium binding protein A12 (S100A12), ischemic stroke, thereby serving as biomarkers therefore. wherein at least one of the biomarkers is chemokine receptor 0033. Thus, in one aspect, the invention provides a set of 7 (CCR7); chondroitin sulfate proteoglycan 2 (CSPG2); IQ biomarkers for use in methods for diagnosing acute ischemic motif-containing GTPase activation protein 1 (IQGAP1); or stroke. In addition, the present invention is directed to com orosomucoid 1 (ORM1). US 2013/O 189243 A1 Jul. 25, 2013

0040. In a still further aspect, the invention provides a with a detection means capable of detecting the biomarker. method for differentiating an acute ischemic stroke from a The biomarker can be a nucleic acid molecule (e.g., mRNA) transient ischemic attack (TIA), a hemorragic stroke and a corresponding to or encoding one of (a) chemokine receptor stroke mimic in a subject presenting symptoms characteristic 7 (CCR7); (b) chondroitin sulfate proteoglycan 2 (CSPG2); of a stroke or at risk of having a stroke, comprising: (c) IQ motif-containing GTPase activation protein 1 (IQ (a) obtaining a biological sample from the patient; GAP1); (d) orosomucoid 1 (ORM1); (e) arginase 1 (ARG1); (b) contacting the biological sample with a detection means (f) lymphocyte antigen 96 (LY96); (g) matrix metalloprotein capable of detecting the presence of at least one biomarker ase 9 (MMP9): (h) carbonic anhydrase 4 (CA4); or (i) s100 selected from the group consisting of chemokine receptor 7 calcium binding protein A12 (S100A12). (CCR7); chondroitin sulfate proteoglycan 2 (CSPG2); IQ 0048. In still other embodiments, the biomarker can be a motif-containing GTPase activation protein 1 (IQGAP1); and polypeptide or active fragment thereof of (a) chemokine orosomucoid 1 (ORM1), wherein the presence of at least one receptor 7 (CCR7); (b) chondroitin sulfate proteoglycan 2 of the biomarkers in the biological sample is indicative of an (CSPG2); (c) IQ motif-containing GTPase activation protein acute ischemic stroke but not indicative of a transient 1 (IQGAP1); (d) orosomucoid 1 (ORM1); (e) arginase 1 ischemic attack (TIAS), hemorragic stroke or stroke mimic. (ARG1); (f) lymphocyte antigen 96 (LY96); (g) matrix met 0041. In other aspects, the invention provides a kit com alloproteinase 9 (MMP9): (h) carbonic anhydrase 4 (CA4); or prising a means for detecting one or more biomarkers diag (i) s100 calcium binding protein A12 (S100A12). nostic of acute ischemic stroke, said biomarkers being 0049. Depending on the form of the biomarker of the selected from the group consisting of: invention (e.g., the mRNA or polypeptide of (a) chemokine (a) chemokine receptor 7 (CCR7); receptor 7 (CCR7); (b) chondroitin sulfate proteoglycan 2 (b) chondroitin sulfate proteoglycan 2 (CSPG2); (CSPG2); (c) IQ motif-containing GTPase activation protein (c) IQ motif-containing GTPase activation protein 1 (IQ 1 (IQGAP1); (d) orosomucoid 1 (ORM1); (e) arginase 1 GAP1); and (ARG1); (f) lymphocyte antigen 96 (LY96); (g) matrix met (d) orosomucoid 1 (ORM1). alloproteinase 9 (MMP9): (h) carbonic anhydrase 4 (CA4); or 0042. In certain other aspects, the invention provides a (i) S100 calcium binding protein A12 (S100A12)), the detec filament-based diagnostic system comprising a panel of tion means can be, but is not limited to, an antibody or oligo detectable polypeptides or functional polypeptide fragments nucleotide probe. The detection means can also be in the form thereof each corresponding to an acute ischemic stroke biom of a kit or assay, such as a filament-based diagnostic system arker selected from the group consisting of capable of detecting a polypeptide biomarker or a nucleic acid (a) chemokine receptor 7 (CCR7); molecule biomarker of the invention. (b) chondroitin sulfate proteoglycan 2 (CSPG2); 0050. In certain other embodiments, the inventive meth (c) IQ motif-containing GTPase activation protein 1 (IQ ods include treating the subject with a stroke therapy if the GAP1); and Subject is diagnosed as having had an acute ischemic stroke or (d) orosomucoid 1 (ORM1). is at risk of therefore. The stroke therapy can include the 0043. In still other aspects, the invention provides a fila administration of a therapeutically effective amount of ment-based diagnostic system comprising a panel of detect recombinant plasminogen activator (rtPA). able oligonucleotides each corresponding to an acute 0051. In still other embodiments, the one or more detected ischemic stroke biomarker selected from the group consisting biomarkers of the invention using the methods of the inven of: tion has at least a 1.5 fold increase or decrease in expression (a) chemokine receptor 7 (CCR7); level as compared to the levels of the one or more biomarkers (b) chondroitin sulfate proteoglycan 2 (CSPG2); in a non-stroke Subject. (c) IQ motif-containing GTPase activation protein 1 (IQ 0052. In other embodiments, the one or more detectable GAP1); and biomarkers of the invention using the methods of the inven (d) orosomucoid 1 (ORM1). tion has at least a 2.0 fold increase or decrease in expression 0044. In still further aspects, the invention provides a fila level as compared to the levels of the one or more biomarkers ment-based diagnostic system comprising a panel of detect in a non-stroke Subject. able antibodies each capable of specifically binding an acute 0053. In certain other embodiments of the invention, kits ischemic stroke biomarker selected from the group consisting comprising a filament-based diagnostic system includes a of: Surface on which is attached at known locations one or more (a) chemokine receptor 7 (CCR7); oligonucleotides capable of hybridizing to the biomarkers. (b) chondroitin sulfate proteoglycan 2 (CSPG2); 0054. In other embodiments of the invention, kits com (c) IQ motif-containing GTPase activation protein 1 (IQ prising a filament-based diagnostic system includes a Surface GAP1); and on which is attached at known locations one or more antibod (d) orosomucoid 1 (ORM1). ies capable of binding to the biomarkers. The surface can be 0045. In certain embodiments, the sample is or is obtained a microarray, microtiter plate, membrane or the like. The kits from whole peripheral blood from the subject. may also include instructions for use. 0046. In other embodiments, the method of the invention 0055. These and other embodiments are disclosed or are is executed on the subject no more than 3 hours after onset of obvious from and encompassed by, the following Detailed presenting acute ischemic stroke symptoms. In still further Description. embodiments, the method is executed on the Subject no more than 4.5 hours after onset of presenting acute ischemic stroke BRIEF DESCRIPTION OF THE DRAWINGS symptoms. 0047. Other embodiments of the invention provide that the 0056. The following detailed description, given by way of detecting step comprises contacting the biological sample example, but not intended to limit the invention solely to the US 2013/O 189243 A1 Jul. 25, 2013

specific embodiments described, may best be understood in 0066 FIGS. 10A and 10B provides the nucleotide and conjunction with the accompanying drawings. amino acid sequences, respectively, for human MMP9. 0057 FIG.1. Depicts the results of a nine-gene panel for 0067 FIGS. 11A and 11B provides the nucleotide and ischemic stroke diagnosis. After comparison between both amino acid sequences, respectively, for human CA4. statistical packages there were 9 genes differentially 0068 FIGS. 12A and 12B provides the nucleotide and expressed with at least a 2 fold difference in expression and amino acid sequences, respectively, for human S100A12. Bonferroni corrected p-0.05 between stroke patients and 0069 FIG. 13 depicts a simple pull-through DNA/RNA control subjects. (ARG1, CA4, CCR7, CSPG2, IQGAP1, extraction design, i.e., a filament based Point of Care (POC) LY96, MMP9, ORM1, S100A12) test of the invention. In this system, 100 ul of each consecutive 0058 FIG. 2 provides a graph depicting the top pathways treatment buffer is pre-loaded by injecting through the wall of affected by acute ischemic stroke. A total of 355 genes with at the Tygon tubing. High Surface tension forces between the least a 1.5 fold difference in expression between stroke liquid/air interface in this Small diameter tubing maintain patients and control subjects and a Bonferroni corrected p-0. Solution separation. A ring magnet is moved longitudinally 05 were eligible for pathway analysis. A score, which was along the length of the Tygon tubing thereby pulling magnetic derived from a p value, was generated for each pathway; scores of 2 or higher are considered to have at least a 99% particles containing nucleic acid molecule of interest bound confidence of not being generated by chance alone. IPA thereto across air separations from one purification buffer to analysis showed that the top 5 most significant canonical the next. pathways in the peripheral blood of AICS patients were asso 0070 FIG. 14 is a schematic of a molecular beacon for use ciated with CD28 signaling in T-helper cells (p=4.03E00), in the present invention. Near the 3' end, binding of DNA or nuclear factor of activated T cells (NFAT) in regulation of the RNA complementary to the loop region opens the stem region immune response (p=4.03E00) dendritic cell maturation and the cyanine fluorescent dye moves away from the gold (p=3.4E00), toll-like receptor signaling (p=3.33E00), and surface attached via a T spacer & C6 thiol linker at the 5' end. calcium-induced T-lymphocyte apoptosis (p=2.92E00). 0059 FIG. 3 provides a schematic depicting Toll-like DETAILED DESCRIPTION OF THE INVENTION Receptor Signaling. There were more genes involved in the Toll-like receptor signaling pathway in our dataset compared 0071. The present invention is based, at least in part, on the to the total number of genes in the Toll-like receptor pathway unexpected discovery of certain biomarkers for acute with a ratio >2 and p=3.33E00 (TLR2, TLR1, FOS, LY96, ischemic stroke in peripheral blood. Accordingly, the present TLR8 (includes EG: 51311), IF2AK2, IRAK3). The activa invention provides methods and compositions for the identi tion of the TLR4/LY96(MD2) complex and TLR2 from fication and use of biomarkers that are associated with the endogenous alarmins such as S100A12 results inactivation of diagnosis and prognosis of acute ischemic stroke in a Subject. IRAK1 through interaction with MyD88. This leads to Such biomarkers can be used in diagnosing and treating a engagement of TRAF6, which is a member of the TNF recep Subject for acute ischemic stroke and/or to monitor the course tor family. Then through the IkappB kinase pathway, NF of an ischemic stroke treatment regimen; for screening Sub kappaB translocates from the cytoplasm to the nucleus where jects for the occurrence or risk of acute ischemic stroke; and it stimulates transcription of both proinflammatory and anti for screening compounds and pharmaceutical compositions inflammatory cytokines and chemokines (e.g. pro inflamma that might provide a benefit in treating or preventing Such tory IL6 and IL8 (resulting in neutrophil release of MMP9); conditions. anti-inflammatory IL10 and TNFC.). Simultaneous with NfkappaB activation, engagement of TRAF6 also results in: Acute Ischemic Stroke 1) the stimulation of the JNK pathway and activation of immediate early response genes clun and cFos which come 0072 Acute ischemic stroke occurs when there is a together to form the API early response transcription factor decrease or loss of blood flow to an area of the brain resulting which increases the activation of the MAPK signaling cas in tissue damage or destruction. It is the largest Subtype of cade with subsequent ELK1 activation with binding to the stroke pathologies and therefore accounts for the majority of serum response factor (SRF) in the promoter of the cFos the death and disability associated with stroke. proto-oncogene. Therefore, within the TLR pathway there are 0073. There are numerous scenarios that contribute to both pro-inflammatory mechanisms of engagement (NF-kap compromised cerebral perfusion; combine this with the mul paB) and anti-inflammatory and neurotrophic pathways of tifactorial effects of the environment and individual genomic regeneration (BDNF and SRF). responses secondary to DNA variation and epigenetic DNA 0060 FIGS. 4A and 4B provide the nucleotide and amino modification and the result is variability of patient presenta acid sequences, respectively, for human CCR7. tion and recovery. This complexity makes ischemic stroke very difficult to treat, both medically and pharmacologically. 0061 FIGS.5A and 5B provides the nucleotide and amino Most cerebral ischemic pathologic conditions involve alter acid sequences, respectively, for human CSPG2. ations in cerebrovascular reactivity and clot formation. 0062 FIGS. 6A and 6B provides the nucleotide and amino acid sequences, respectively, for human IQGAP1. 0074 Ischemia is the consequence of one or more of the following causes: thrombosis, embolism or decreased sys 0063 FIGS. 7A and 7B provides the nucleotide and amino temic circulation. Thrombosis is a localized obstruction of acid sequences, respectively, for human ORM1. blood flow in one or more blood vessels, most commonly 0064 FIGS. 8A and 8B provides the nucleotide and amino caused by atherosclerosis. Stroke refers to a blockage of the acid sequences, respectively, for human ARG1. blood vessel not caused by a localized process, but rather 0065 FIGS. 9A and 9B provides the nucleotide and amino material originating from outside of the cerebral circulation, acid sequences, respectively, for human LY96. most commonly the heart. Decreased systemic perfusion US 2013/O 189243 A1 Jul. 25, 2013 results in a decrease in cerebral perfusion pressure, and ulti resulting in cytotoxic edema. Capillary endothelial cells mately cerebral blood flow secondary to cardiac pump failure begin to function abnormally and the tight junctions between or systemic hypotension. them loose their integrity, leading to blood brain barrier 0075 Although each scenario has a different origin, the (BBB) disruption. Intravascular fluid leaks into the extravas result is either a temporary or permanent decrease or loss of cular space and spreads easily throughout the white matter, cerebral blood flow. Permanent loss of cerebral blood flow to resulting in vasogenic edema. Additionally, excess intracel an area of the brain resulting in cell death is termed infarction. lular Ca2 triggers free radical production along with free The penumbra is the area of the brain receiving less than radicals produced during anaerobic metabolism contributing optimal blood flow and is damaged but "salvageable', not yet to protease and lipase activation. Superoxide and peroxyni infarcted. In all cases of ischemic stroke, the intent of therapy trite (free radicals) production increases beyond the cells is to rescue this penumbral tissue and if therapy or reperfusion capacity to quench them, which in turn activates the produc occurs quickly, this tissue can be rescued. The extent of tissue tion of other detrimental ROS. Eventually the swollen cells damage depends on the location and duration of the infarction enter cell death pathways through necrotic or apoptotic pro or lack of blood flow and the extent to which collateral vessels cesses dependent upon the cell type, severity of injury and the can Supply oxygen and nutrients to compromised areas. The level of available ATP. Unfortunately, reoxygenation through cerebral ischemic response is complex and involves a reperfusion also acts as a Substrate for enzymatic reactions decrease in oxygen and glucose delivery but also an accumu that produce ROS. Cells attempt to minimize damage caused lation of detrimental metabolic waste products. Therefore by ischemia by rebalancing energy Supply and demand. This reactive oxygen species (ROS) and inflammatory mediators early neuroprotective response results in an overall Suppres play a critical role in the events following ischemia. sion of non-essential energy consumption. 0076. Immediately following ischemic brain injury a cas 0080 All of these events together result in blood-brain cade of events occurs in response to loss of blood flow. Alter barrier (BBB) permeability, loss of cell ion homeostasis, and ations at the cell membrane result in release of glutamate, excitotoxicity, resulting in a modulation of gene and protein activation of N-methyl-D-aspartic acid (NMDA) receptors expression. The molecular imprint of these processes is vis and release of calcium (Ca+2) into the extracellular space. ible within all cells that migrate and circulate throughout the This process ultimately leads to the activation of Immediate area of cerebral injury. These cells then circulate out of the Early Genes (IGE's), such as c-fos and c-jun. IGE's propa central nervous system into the peripheral blood. gate the physiologic response by participating intranscription I0081 Clinical diagnosis of ischemic stroke is often diffi of neurotrophic factors (endogenous neuroprotection), heat cult, complicated by its multiple etiologies and variable clini shock proteins (general stress response), cytokines and cal presentation. In most hospitals, diagnosis is made when immune mediated complexes (inflammatory and immune the patient presents with symptoms suggestive of acute cere activation), and nitric oxide synthase (NOS) activation (neu bral ischemia in conjunction with pathologic findings on ronal stimulation). Pathway specific responses are mediated cerebral imaging that are most likely associated with the by non-modifiable factors (DNA variation, age, gender, and presenting symptoms. When possible, medical history is severity of injury), modifiable factors (diet, physical activity, obtained via inquisition of the following: personal and family temperature, and environmental stress) and the interaction of medical history; discussion of history of stroke or symptoms signaling molecules within the pathways themselves. Suggestive of stroke; time and activity at the onset of Symp 0077. The collective response, secondary to human toms; temporal progression of symptoms; and whether or not genetic variation, results in either propagation of injurious they are accompanied by other factors, such as headache or mechanisms and cell death or initiation of repair mechanisms nausea. Unfortunately more often than not, this information is and neuronal Sustainment. unobtainable secondary to severity of the stroke and whether 0078 Since the brain does not store oxygen or glucose, or not the patient has family available that can provide the cellular energy production fails to maintain normal metabo history. At this point the physical examination and brain lism within minutes following compromised cerebral blood imaging findings are used to make the definitive diagnosis. flow. Within the mitochondria, the electron transport chain Identifying the physical location of the stroke is made by removes electrons from an electron donor and passes them assessment of neurologic status via the neurologic examina onto oxygen to form water through a series of redox reactions. tion, which may include National Institutes of Health Stroke These reactions create a proton gradient across the mitochon scale (NIHSS) score and the presence of pathologic findings drial membrane that drives production of adenosine triphos on computed tomography (CT) or magnetic resonance imag phate (ATP). ATP then enters the Krebs cycle (citric acid ing (MRI). cycle) to become part of a metabolic pathway that converts I0082. The majority of hospitals in the United States use carbohydrates, fats, and proteins into usable forms of energy CT to rule outstroke; however it has been found that CT is less (e.g. carbon dioxide and water). When oxygen is unavailable than optimal for identifying acute ischemia. A recent study of the electron transport chain can no longer accept electrons; a emergency room (ER) neurology consults found that the ini proton gradient is not produced, ATP production ceases, and tial diagnosis of the ER physician agrees with the final diag pyruvate becomes the final acceptor of electrons in the chain. nosis ~60% of the time. There was a significant pattern of This switch from oxygen dependent aerobic metabolism to mis-diagnosis for stroke and seizure; other benign medical anaerobic energy production results in an accumulation of conditions (e.g. migraine) and psychiatric disorders were lactic acid and ionic pump failures. originally diagnosed and medically treated as stroke. 0079 Sodium potassium (Na+/K+) pumps are highly Although over-diagnosis of stroke early may appear to erron dependent upon ATP energy production and begin to fail the side of patient safety, it puts a percentage of patients into within minutes of anaerobic metabolism. Na+, water and a category where they are being treated for an acute stroke that calcium (Ca+2) begin to pass from the extracellular space to they do not have. Given the complications associated with the intracellular space and cerebral cells begin to swell, bleeding following rtPA administration, this practice is quite US 2013/O 189243 A1 Jul. 25, 2013

risky. For this reason, Some ER physicians are reluctant to detection of the biomarkers of the invention through the use of treat a patient with rtPA unless they are completely sure of a any Suitable detection assay, e.g., ELISA. stroke diagnosis. I0088 As used herein, the terms “biological sample' or 0083. Where possible, hospitals are moving toward using “patient sample or “test sample' or “sample' as used herein, MRI for acute diagnosis of stroke; however this is facilitated refer to a sample obtained from an organism or from compo best by the presence of a dedicated stroke clinical team and nents (e.g., cells) of a Subject or patient for the purpose of only possible in facilities with 24 hour MRI availability. diagnosis, prognosis, or evaluation of a Subject of interest, Additionally, even though rtPA is FDA approved, only a small Such as a patient. In certain embodiments, such a sample may number of stroke patients actually receive the drug. The Brain be obtained for the purpose of determining the outcome of an Attack Coalition has recommended a movement toward the ongoing condition or the effect of a treatment regimen on a creation of widespread primary stroke centers to increase the condition. The sample may be of any biological tissue or utilization of rtPA and creation of standards of care for fluid. The sample may be a clinical sample which is a sample ischemic stroke patients. In a small community hospital derived from a patient. Such samples include, but are not located in Bethesda, Md. the establishment of a primary limited to, brain cells or tissues, cerebrospinal fluid, nerve stroke team resulted in a 7-fold increase in the proportion of tissue, sputum, blood, serum, plasma, blood cells (e.g., white stroke patients treated with rtPA within 24 months after the cells), tissue samples, biopsy samples, urine, peritoneal fluid, onset of the program. This paradigm can be applied to other and pleural fluid, saliva, semen, breast exudate, tears, Small community hospitals and has the potential to increase mucous, lymph, cytosols, ascites, amniotic fluid, bladder the numbers of stroke patients treated with rtPA by an addi washes, and bronchioalveolar lavages or cells therefrom, tional 30,000 patients per year. More and more hospitals are among other body fluid samples. Preferably, the sample is moving towards the establishment of primary stroke teams; peripheral blood. Preferable, the sample contains one or more however there are still quite a few hospitals that rely solely on of the biomarkers of the invention, or a nucleic acid encoding the ER physician’s expertise in diagnosing ischemic stroke. a biomarker of the invention (e.g., mRNA). The patient 0084 Quick and definitive diagnosis in the acute care set samples may be fresh or frozen, and may be treated, e.g. with ting is essential to separate stroke from non-stroke, distin heparin, citrate, or EDTA. Biological samples may also guish hemorrhage from ischemia, and identify the potential include sections of tissues such as frozen sections taken for cause of the infarction, but most importantly to determine histological purposes. eligibility for thrombolytic therapy (e.g., rtPA-alteplase) to I0089. As used in this invention, the term “epitope' means begin treatment within the three hour window of opportunity. any antigenic determinant on an antigen, e.g., a biomarker of An additional diagnostic measure, such as a serologic blood the invention, to which an antibody binds through an anti test or a screen of a panel of markers, would be extremely genic binding site. Determinants orantigenic determinants on beneficial in obtaining a definitive diagnosis of acute stroke an antigen usually consist of chemically active Surface group and increasing the utilization of rtPA, especially in hospitals ings of molecules Such as amino acids or Sugar side chains where primary stroke centers are non-existent. and usually have specific three dimensional structural char acteristics, as well as specific charge characteristics. DEFINITIONS AND USE OF TERMS 0090. As used herein, the term antibody that “specifically 0085. The present invention may be understood more binds to or is “specific for a particular polypeptide or an readily by reference to the following detailed description of epitope on a particular polypeptide is one that binds to that preferred embodiments of the invention and the Examples particular polypeptide or epitope on a particular polypeptide included therein. Before the present methods and techniques without Substantially binding to any other polypeptide or are disclosed and described, it is to be understood that this polypeptide epitope. Alternatively, an antibody that specifi invention is not limited to specific analytical or synthetic cally binds to an antigen, in accordance with this invention, methods as such may, of course, vary. It is also to be under refers to the binding of an antigen by an antibody or fragment stood that the terminology used herein is for the purpose of thereof with a dissociation constant (IQ) of 104 or lower, as describing particular embodiments only and is not intended to measured by a suitable detection instrument, e.g., Surface be limiting. Unless defined otherwise, all technical and sci plasmon resonance analysis using, for example, a BIA entific terms used herein have the meaning commonly under CORER surface plasmon resonance system and BIACORER) stood by one of ordinary skill in the art to which this invention kinetic evaluation software (eg. version 2.1). The affinity or belongs. dissociation constant(K) for a specific binding interaction is I0086. As used herein and in the appended claims, the preferably about 500 nM or lower, more preferably about 300 singular forms “a,” “and” and “the include plural reference nMorlower and preferably at least 300 nM to 50pM,200 nM unless the context clearly dictates otherwise. Thus, for to 50 pM, and more preferably at least 100 nM to 50 pM, 75 example, reference to “a gene' is a reference to one or more nM to 50 pM, 10 nM to 50 pM. genes and includes equivalents thereof known to those skilled 0091. The term “treatment' includes any process, action, in the art, and so forth. application, therapy, or the like, whereina Subject (or patient), 0087 As used herein, the term “antibody' refers to immu including a human being, is provided medical aid with the noglobulin molecules (e.g., any type, including IgG, IgE, object of improving the Subject’s condition, directly or indi IgM, Ig|D, IgA and IgY, and/or any class, including, IgG1. rectly, or slowing the progression of a condition or disorder in IgG2, IgG3, IgG4, IgA1 and IgA2) isolated from nature or the Subject, or ameliorating at least one symptom of the prepared by recombinant means or chemically synthesized. disease or disorder under treatment. The terms “antibody” and “immunoglobubin' can be used 0092. The term “combination therapy” or “co-therapy” synonymously throughout the specification, unless indicated means the administration of two or more therapeutic agents to otherwise. Antibodies or immunoglobulins of the invention treat a disease, condition, and/or disorder, e.g., acute ischemic can be used for various purposes, including, for example, the stroke. Such administration encompasses “co-administra US 2013/O 189243 A1 Jul. 25, 2013

tion of two or more therapeutic agents in a Substantially 0097 “Proteins or polypeptides' used as biomarkers in the simultaneous manner. One therapy can be based on the biom present invention are contemplated to include any fragments arkers of the invention. A second therapy can be based on a thereof, in particular, immunologically detectable fragments. known therapy for a disorder, e.g., acute ischemic stroke, One of skill in the art would recognize that proteins which are Such as tissue plasminogen activator (rtPA). The order of released by cells of the central nervous system which become administration of two or more sequentially co-administered damaged during a cerebral attack (e.g., acute ischemic stroke) therapeutic agents is not limited. could become degraded or cleaved into Such fragments. Addi 0093. The phrase “therapeutically effective amount” tionally, certain markers are synthesized in an inactive form, means the amount of each agent (e.g., an agent that benefi which may be Subsequently activated, e.g., by proteolysis. cially interacts with a biomarker of the invention to treat acute Examples of such markers are described hereinafter. The term ischemic stroke) administered that will achieve the goal of “related marker as used herein refers to one or more frag improvement in a disease, condition, and/or disorder severity, ments of a particular marker that may be detected as a Surro gate for the marker itself. These related markers may be, for and/or symptom thereof, while avoiding or minimizing example, “pre.” “pro” or “prepro’ forms of biomarkers, or adverse side effects associated with the given therapeutic the “pre.” “pro” or “prepro’ fragment removed to form the treatment. mature marker. In preferred embodiments, these “pre.” “pro” 0094. The term “pharmaceutically acceptable” means that or “prepro’ forms or the removed “pre” “pro” or “prepro” the Subject item is appropriate for use in a pharmaceutical fragments are used in an equivalent fashion to the mature product. markers in the methods described herein. 0095. The term “biomarker' or “marker as used herein 0098. The phrase “diagnosis' as used herein refers to refers to proteins or polypeptides (or active fragment thereof) methods by which the skilled artisan can estimate and/or that are associated with brain tissue or neural cells, and which determine whether or not a patient is suffering from, or is at can be correlated with acute ischemic stroke, but are not Some level of risk of developing, a given disease or condition. correlated with other types of injury. Such specific biomark The skilled artisan (e.g., stroke clinician or emergency room ers of acute ischemic stroke identified by the methods of the physician) often makes a diagnosis on the basis of one or invention include (1) chemokine receptor 7 (CCR7); (2) more diagnostic indicators, i.e., a biomarker, the risk, pres chondroitin sulfate proteoglycan 2 (CSPG2); (3) IQ motif ence, absence, or amount of which is indicative of the pres containing GTPase activation protein 1 (IQGAP1); (4) oroso ence, severity, or absence of the condition, e.g., acute mucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lymphocyte ischemic stroke. antigen 96 (LY96); (7) matrix metalloproteinase 9 (MMP9); 0099. The term “interaction refers to direct or indirect (8) carbonic anhydrase 4 (CA4); and (9) S100 calcium bind binding or alteration of a biological activity of a biomolecule, ing protein A12 (S100A12), and the like. These specific biom e.g., a biomarker. arkers are described in detail hereinafter. Biomarkers can be 0100. The term “sensitivity”, as used herein in the context detected or identified or measured and the like using any of its application to diagnostic assays, refers to the proportion Suitable methods or instrumentation for measuring, identify of all subjects with acute ischemic stroke or at risk for devel ing or detecting polypeptides or proteins. In certain embodi oping acute ischemic stroke that are correctly identified as ments, nucleic acids encoding the biomarkers can be mea such (that is, the number of true positives divided by the sum Sured, identified or detected using any suitable means by of the number of true positives and false negatives). which to analyze nucleic acid molecules (e.g., mRNA mol 0101 The term “specificity' of a diagnostic assay, as used ecules in peripheral blood encoding a biomarker of the inven herein in the context of its application to diagnostic assays, tion). Where the detection or diagnosis is made through mea refers to the proportion of all subjects not having acute Suring, detecting, or the like of the nucleic acid molecules ischemic stroke or who are not at risk for developing acute (e.g., mRNA) corresponding to or encoding a biomarker ischemic stroke that are correctly identified as Such (that is, polypeptide of the invention, the term “biomarker can also the number of true negatives divided by the sum of the number be in reference to the nucleic acid molecule itself. For of true negatives and false positives). example, a “biomarker' of the invention can include mRNA 0102. Within the context of the invention, the terms (or DNA) encoding (1) chemokine receptor 7 (CCR7); (2) “detect”, “detection' or “detecting refer to the identification chondroitin sulfate proteoglycan 2 (CSPG2); (3) IQ motif of the presence, absence, or quantity of a given biomarker. containing GTPase activation protein 1 (IQGAP1); (4) oroso (0103 As used herein, the term “acute ischemic stroke' mucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lymphocyte refers to those patients having or at risk for “definite acute antigen 96 (LY96); (7) matrix metalloproteinase 9 (MMP9); ischemic cerebrovascular syndrome (AICS)’ as defined by (8) carbonic anhydrase 4 (CA4); and (9) S100 calcium bind the diagnostic criteria of Kidwell et al. Acute Ischemic Cere ing protein A12 (S100A12). Other biomarkers can be identi brovascular Syndrome: Diagnostic Criteria. Stroke, 2003, fied using the screening methods of the invention. 34, pp. 2995-2998 (incorporated herein by reference). AICS 0096. The term “active fragment of a biomarker” refers to diagnostic criteria are as follow: a fragment of a biomarker having Sufficient sequence Such Definite AICS: Acute onset of neurologic dysfunction of any that it still possesses the same or Substantially the same func severity consistent with focal brain ischemia AND imaging/ tion as the full-size biomarker. Preferably, an active fragment laboratory CONFIRMATION of an acute vascular ischemic of a biomarker retains at least 100% of the activity of the pathology. full-size biomarker, or at least 99%, 95%, 90%, 85%, 80% Probable AICS: Acute onset of neurologic dysfunction of any 75%, 70%. 65% or 60% of its activity. In certain embodi severity Suggestive of focal brain ischemic syndrome but ments, an active fragment of a biomarker is one which is WITHOUT imaging/laboratory CONFIRMATION of acute immunologically detectable (i.e., detectable using an anti ischemic pathology (diagnostic studies were negative but body). INSENSITIVE for ischemic pathology of the given duration, US 2013/O 189243 A1 Jul. 25, 2013

severity and location). Imaging, laboratory, and clinical data across the U.S. are not large academic centers where stroke studies do not suggest nonischemic etiology: possible alter neurologists are available at all times and where an MRI can native etiologies ARE ruled out. be used for acute assessment of cerebral ischemic changes Possible AICS: Acute neurologic dysfunction of any duration prior to the administration of rtPA. The standard, however, is or severity possibly consistent with focal brain ischemia Something quite different. More often than not, an emergency WITHOUT imaging/laboratory CONFIRMATION of acute room (ER) physician would be given the task of assessing, ischemic pathology (diagnostic Studies were not performed diagnosing and treating acute ischemic stroke through clini or were negative and SENSITIVE for ischemic pathology of cal history assessment and CT without the assistance of a the given duration, severity and location). Possible alternative stroke-trained neurologist. etiologies are NOT ruled out. Symptoms may be nonfocal or 0110 Recent studies have reinforced that although ER difficult to localize. physicians are more than capable of treating stroke patients, Not AICS: Acute onset of neurologic dysfunction with imag they are often reluctant to administer stroke therapies (e.g., ing/laboratory CONFIRMATION of NONISCHEMIC rtPA) unless the diagnosis is definitive. In addition, there is a pathology/(including normal imaging/laboratory studies that shortage of trained emergency personnel and ER nursing staff are highly sensitive for ischemic pathology of the given dura capable of identifying stroke symptoms or conducting an tion, severity, and location) as the cause of the neurologic appropriate stroke assessment. The Small percentage of syndrome. patients who actually receivertPA (3-5%) and the large num 0104. As used herein, reference to “stroke symptoms” or bers of patients who leave the hospital (without treatment) “symptoms characteristic of a stroke' can refer to those with either a diagnosis of transient ischemic attack (TIA) or symptoms that may present at the onset of any type of stroke stroke of undetermined cause pays testament to the need to (including acute ischemic and hemorrhagic stroke and oth identify additional means of stroke diagnosis. ers), including those symptoms recognized by the National 0111. The skilled artisan will appreciate that peripheral Stroke Association (www.stroke.org), which are as follows: blood markers specific for brain injury have proven virtually (a) Sudden numbness or weakness of the face, arm or leg impossible to identify. Some groups have even begun to ques especially on one side of the body; (b) Sudden confusion, tion the use of blood biomarkers in the study of acute brain trouble speaking or understanding; (c) Sudden trouble seeing injury. Numerous studies over the years have resulted in in one or both eyes; (d) Sudden trouble walking, dizziness, either insignificant findings or findings that could not be loss of balance or coordination, and (e) Sudden severe head replicated. Traditional methods for the identification of these ache with no known cause. biomarkers have fallen short of the rigor and sensitivity nec essary to identify such markers for brain injury, including Biomarkers ischemic stroke. 0105. In one aspect, the present invention provides biom 0112. In one aspect, the present invention provides a arkers for diagnosing and detecting acute ischemic stroke in a panel of genes (or biomarkers) and their cognate encoded patient at risk for ischemic stroke or who has already had a polypeptide products that can be used to detect or diagnose stroke event. acute ischemic stroke. As shown in the Examples, the inven 0106. In one embodiment, the biomarkers include a tion provides at least 9 genes identified by the methods of the 9-biomarker panel comprising: (1) chemokine receptor 7 invention that can predict acute ischemic stroke in a patient (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) with a Substantially high degree of accuracy as compared to IQ motif-containing GTPase activation protein 1 (IQGAP1); MRI or CT based methods. Preferably, the predictive value of (4) orosomucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lym the 9 biomarker panel is at least 95%; or preferably at least phocyte antigen 96 (LY96); (7) matrix metalloproteinase 9 90%, 85%, 80%, 75%, 70%, 65%, or 60% accurate, as com (MMP9); (8) carbonic anhydrase 4 (CA4); and (9) S100 cal pared to the diagnostic capability of both MRI (85% accurate) cium binding protein A12 (S100A12). The biomarkers and CT (54% accurate). include both the polypeptides or nucleic acid molecules cor 0113. The 9-biomarker panel identified in this study com responding to the polypeptides, e.g., mRNA encoding the prises: (1) chemokine receptor 7 (CCR7); (2) chondroitin polypeptide biomarkers. sulfate proteoglycan 2 (CSPG2); (3) IQ motif-containing 0107. In other embodiments, the invention provides addi GTPase activation protein 1 (IQGAP1); (4) orosomucoid 1 tional Suitable biomarkers for detecting and diagnosing (ORM1); (5) arginase 1 (ARG1); (6) lymphocyte antigen 96 stroke events utilizing the biomarker Screening methods of (LY96); (7) matrix metalloproteinase 9 (MMP9); (8) carbonic the invention as exemplified in the Examples. These screen anhydrase 4 (CA4); and (9) S100 calcium binding protein A12 ing methods relate to the Surprising finding that biomarkers (S100A12). Each of these biomarkers is described further as for stroke may be found by analyzing gene expression profil follows. ing of whole peripheral blood. Such methods can be utilized 0114 (1) Chemokine Receptor 7. to identify other biomarkers for acute ischemic stroke, or 0115 Chemokines are a family of small proteins that regu other types of stroke or brain trauma. late leukocyte trafficking Aside from their role in inflamma 0108. The biomarkers of the invention, including the tory and immune responses there is increasing evidence that 9-biomarker panel identified herein, have various utilities, they play a significant role in glial cell proliferation and including, for example, their use in rapid blood tests to evalu migration as part of the neuro-immune response. Several ate risk of acute ischemic stroke or to provide a diagnosis of chemokines have been identified in both the serum and CSF acute ischemic stroke in a patient or to diagnose other forms (cerebralspinal fluid) of stroke patients. CXCL5, CCL2. of stroke or brain trauma. CCL3, and CXCL8 are significantly increased following 0109 As noted, a rapid blood test for the diagnosis of stroke and play a modulatory role of inflammation during the acute ischemic stroke would transform stroke care in the acute phase of ischemia. In addition CCR8 is expressed in United States and throughout the world. Most hospitals activated microglia on brain sections of ischemic stroke US 2013/O 189243 A1 Jul. 25, 2013 patients. The down regulation of CCR7 in peripheral blood as during an acute phase response. It has been shown to suppress shown by the methods of this invention (see Examples) Sug lymphocyte response to LPS (thereby preventing ongoing gests there is decreased glial cell proliferation and migration tissue damage by neutrophil proteases), decrease platelet very early in the acute phase of ischemic stroke; which coin aggregation (and thus further platelet recruitment), and cides with the literature that these cytokines become increas enhance cytokine Secretion (as possibly part of a feedback ingly more active during recovery and repair. The human mechanism). It exhibits both pro and anti-inflammatory CCR7 mRNA sequence is publicly available as GenBank effects and is therefore Suggested to play a significant role in Accession No. NM 001838, the complete sequence of immunomodulation. An up-regulation of ORM1 as shown by which is shown in FIG. 4A. The human CCR7 amino acid the methods of this invention (see Examples) suggests a neu sequence is publicly available as GenPept Accession No. roimmune response in acute ischemic stroke mediated by a NP 001829, the complete sequence of which is shown in balance between pro and anti-inflammatory signaling mol FIG. 4B. ecules. The human ORM1 mRNA sequence is publicly avail 0116 (2) Chondroitin Sulfate Proteoglycan 2. able as GenBank Accession No. NM 000607, the complete 0117 Chondroitin sulfate proteoglycan 2 (CSPG2) also sequence of which is shown in FIG. 7A. The human ORM1 known as versican, was first identified in hyaline cartilage amino acid sequence is publicly available as GenPept Acces where it provides mechanical Support. Recent studies have sion No. NP 000598, the complete sequence of which is identified CSPG2 as a primary component of the extracellular shown in FIG. 7B. matrix in the CNS. A disaccharide degradation product of 0.122 (5) Arginase 1 (ARG1). CSPG2 has been shown to stimulate microglia to possess I0123 Arginase-1 (ARG1) is an enzyme induced by increase phagocytic activity without cytotoxic effects. This T-helper 2 cytokines that metabolizes L-arginine to ornithine suggests a role for CSPG2 in immune-related neuroden and urea and is a critical regulator of nitric oxide (NO) syn generative disorders. In addition, increased CSPGs exhibit thesis. Inflammatory stimuli (T-helper 1 cytokines) result in growth inhibiting properties and inhibit axonal sprouting an increased expression of inducible NO synthetase (iNOS) within the glial scar. Within the infarct core CSPG2 expres through L-arginine metabolism. It is possible to determine the sion is dramatically increased, resulting in increased cell type of inflammatory response to injury depending on the death and reactive astrocytosis. Several enzymatic processes relative amount of ARG1 and iNOS since both compete for cleave CSPG2, including the matrix metalloproteinases. The L-arginine. Trauma is associated with an increase activity of up-regulation of CSPG2 as shown by the methods of this ARG1 and a decrease in the level of arginine. In addition invention (see Examples) suggests there is inhibited axonal recent studies suggest activation of the JAK and STAT path growth in the acute phase of ischemic stroke. The human ways induces ARG1 in Smooth muscle. Since humoral anti CSPG2 mRNA sequence is publicly available as GenBank inflammatory cytokines induce ARG1, the up-regulation of Accession No. NM 004385, the complete sequence of ARG1 as shown by the methods of this invention (see which is shown in FIG. 5A. The human CSPG2 amino acid Examples) suggests that the response to acute ischemic stroke sequence is publicly available as GenPept Accession No. favors an innate humoral immune response. The human NP 004376, the complete sequence of which is shown in ARG1 mRNA sequence is publicly available as GenBank FIG.SB. Accession No. NM 000045, the complete sequence of 0118 (3) IQ Motif-Containing GTPase Activation Protein which is shown in FIG. 8A. The human ARG1 amino acid 1 (IQGAP1). sequence is publicly available as GenPept Accession No. 0119) IQ Motif-containing GTPase activating protein 1 NP 000036, the complete sequence of which is shown in (IQGAP1) is an evolutionarily conserved molecule that FIG. 8B. serves as a scaffold protein and plays a fundamental role in 0.124 (6) Lymphocyte Antigen 96 (LY96). cell polarity. It modulates several cellular activities including 0.125 Lymphocyte antigen 96 (LY96) also known as MD2 cytoskeletal architecture, cell-cell adhesion, transcription and protein, is critical for toll-like receptor 4 (TLR4) activation as signaling (ERK signaling). Rho-family GTPases, including an innate response to lipopolysaccharide (LPS) which is the Cdc42 require IQGAP1 to regulate actin cytoskeleton and main constituent of gram-negative bacteria. TLR4 activation produce a gradient of signaling molecules. Cdc42 and induces transduction pathways resulting in NF-kappaB IQGAP1 it co-localizes with actin filaments throughout the expression and Subsequent release of pro-inflammatory brain. In addition, increased Cdc42 activity has been impli cytokines (e.g. IL6 and IL8). Interestingly, natural selection cated in the breakdown of the blood brain barrier (BBB). An has shaped the sequence patterns of TLR genes in primate up-regulation of IQGAP1 expression as shown by the meth evolution. However, pathogens and LPS are not the only ods of this invention (see Examples) suggests there is an cause of tissue damage; ischemia is another mechanism. increase in cellular signaling and transcription in the acute There is accumulating evidence that ischemic tissue damage phase of ischemic stroke and IQGAP1 may mediate the dis is recognized at the cell level via receptor-mediated detection ruption of the BBB as a means by which signals from the of proteins (alarmins) released by dead cells. Therefore there brain enter the periphery to augment cellular recruitment. The are exogenous pathogen-associated molecular patterns human IQGAP1 mRNA sequence is publicly available as (PAMPs; such as LPS) and endogenous alarmins that elicit GenBank Accession No. NM 003870, the complete similar responses of the innate immune system known as sequence of which is shown in FIG. 6A. The human IQGAP1 damage associated molecular patterns (DAMPs). The amino acid sequence is publicly available as GenPept Acces upregulation of LY96 as shown by the methods of this inven sion No. NP 003861, the complete sequence of which is tion (see Examples) suggests that the response to acute shown in FIG. 6B. ischemic stroke is mediated by the innate immune system and 0120 (4) Orosomucoid 1 (ORM1). TLR signaling. The human LY96 mRNA sequence is publicly 0121 Oromucosid 1 (ORM1) also known as alpha-1 acid available as GenBank Accession No. NM 015364, the com glycoprotein is an acute phase protein and increases 2-5 times plete sequence of which is shown in FIG. 9A. The human US 2013/O 189243 A1 Jul. 25, 2013

LY96 amino acid sequence is publicly available as GenPept GenPept Accession No. NP 005612, the complete sequence Accession No. NP 056179, the complete sequence of which of which is shown in FIG. 12B. is shown in FIG. 9B. 0.132. The biomarkers described herein, including the 0126 (7) Matrix Metalloproteinase 9 (MMP9). 9-biomarkers above, may be used individually, or as part of 0127. Matrix Metalloproteinase 9 (MMP9) is a zinc and one or more panels as described hereinafter, and Such panels calcium dependent endopeptidase responsible for regulation may comprise 2, 3, 4, 5, 6, 7, 8, or 9 or more of individual of the extracellular matrix (ECM). Ischemia and reperfusion biomarkers or related markers. injury results in oxidative stress that mediates BBB disruption through metalloproteinase activation. MMP9 expression is 0.133 Particularly preferred markers for the diagnosis and/ the result of activated leukocytes (particularly neutrophils), or prognosis of acute ischemic stroke include (1) chemokine and results in IL1beta activation and initiation of the inflam receptor 7 (CCR7); (2) chondroitin sulfate proteoglycan 2 matory cascade, further contributing to BBB impairment. (CSPG2); (3) IQ motif-containing GTPase activation protein Up-regulation of MMP9 following acute ischemic stroke as 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) arginase 1 shown by the methods of this invention (see Examples) Sug (ARG1); (6) lymphocyte antigen 96 (LY96); (7) matrix met gests an increase in proteolytic activity early that may con alloproteinase 9 (MMP9); (8) carbonic anhydrase 4 (CA4); tribute to BBB disruption, which would allow cellular migra and (9) S100 calcium binding protein A12 (S100A12) or tion and signaling to and throughout the CNS. The human markers related (i.e., related markers of these biomarkers as MMP9 mRNA sequence is publicly available as GenBank defined herein) thereto. Accession No. NM 004994, the complete sequence of 0.134 Certain preferred marker panels include at least one which is shown in FIG. 10A. The human MMP9 amino acid biomarker, and preferably 2, 3, or 4 biomarkers selected from sequence is publicly available as GenPept Accession No. the group consisting of (1) chemokine receptor 7 (CCR7); (2) NP 004985, the complete sequence of which is shown in chondroitin sulfate proteoglycan 2 (CSPG2); (3) IQ motif FIG 10B. containing GTPase activation protein 1 (IQGAP1); (4) oroso 0128 (8) Carbonic Anhydrase 4 (CA4). mucoid 1 (ORM1). In particularly preferred embodiments, 0129 Carbonic anhydrase IV (CA4) is a zinc enzyme that one or more of these markers, and preferably 2, 3, or 4 of these catalyzes the conversion between carbon dioxide and the biomarkers, may be combined with one or more different bicarbonate ion, thus making it crucial for all physiologic markers and preferably 2, 3,4,5,6,7,8, or 9 or more different processes involved in cellular respiration and transport. CA4 markers or related markers. In preferred embodiments, the is a membrane-bound protein found in tissues throughout the invention provide biomarker panels that includes at least one body and is found in the brain within the luminal surface of biomarker selected from the group consisting of (1) chemok capillary endothelial cells suggesting a role for CA4 in the ine receptor 7 (CCR7); (2) chondroitin sulfate proteoglycan 2 blood brain barrier as a regulator of CO2 and bicarbonate (CSPG2); (3) IQ motif-containing GTPase activation protein homeostasis in the brain. The up-regulation of CA4 as shown 1 (IQGAP1); (4) orosomucoid 1 (ORM1) and any number of by the methods of this invention (see Examples) suggests other biomarkers identified herein or which could be identi there is an increase in cellular respiration following acute fied using the methods of the invention or other previously ischemic stroke that requires an increase in CA4 to convert known biomarkers for acute ischemic stroke or other type of CO to HCO to maintain pH. The human CA4 mRNA stroke. sequence is publicly available as GenBank Accession No. 0.135 The biomarker panels of the invention can include NM 000717, the complete sequence of which is shown in any suitable biomarker for acute ischemic stroke, or if useful, FIG. 11A. The human CA4 amino acid sequence is publicly any other type of stroke or brain injury if Such inclusion is available as GenPept Accession No. NP 000708, the com deemed suitable by the user of the panel. Biomarkers for plete sequence of which is shown in FIG. 11B. ischemic stroke previously disclosed in the art can include 0130 (9) S100 Calcium Binding Protein A12 (s100A12). those described in Tang et al., “Gene expression in blood 0131 s 100 calcium binding protein A12 (S100A12) also changes rapidly in neutrophils and monocytes after ischemic known as calgranulin C and EN-RAGE (extracellular newly stroke in humans: a microarray study.” Journal of Cerebral identified RAGE binding protein) is specifically related to Blood Flow & Metabolism (2006)26, pp. 1089-1102: White innate immune function. S100A12 is expressed by phago ley et al., “Blood Biomarkers in the Diagnosis of Ischemic cytes and released at the site of tissue inflammation. It is an Stroke: A Systematic Review.” Stroke (2008) 39, pp. 2902 endogenous DAMP that turns pro-inflammatory after a 2909; Flex et al. “Proinflammatory Genetic Profiles in Sub release into the extracellular space following brain injury. The jects With History of Ischemic Stroke.” Stroke (2004)35, pp. Receptor for Advanced Glycation End Products (RAGE) is a 2270-2275; and Moore et al., “Using Peripheral Blood Mono member of the immunoglobulin Superfamily and is a specific nuclear Cells to Determine a Gene Expression Profile of cell Surface reaction site for advanced glycation endproducts Acute Ischemic Stroke: A Pilot Investigation.” Circulation (AGES) which increase with advancing age. Interaction (2005) 111, pp. 212-221, each of which are incorporated between AGEs and RAGE has been linked to chronic inflam herein in their entireties by reference. mation. Once engaged RAGE interaction in inflammatory 0.136. In other embodiments, the biomarker panels of the and vascular cells results in the increased expression of invention can comprise biomarkers that are diagnostic to MMPs. The up-regulation of s 100A12 as shown by the meth different types of stroke, including acute ischemic stroke, ods of this invention (see Examples) Supports the claim that hemorrhagic stroke, transientischemic attacks, and Subarach the response to acute ischemic stroke is largely driven by noid hemorrhage and other forms of cerebral injury. innate immunity. The human S100A12 mRNA sequence is Examples of other such markers can be found in the art, publicly available as GenBank Accession No. NM 005621, including, for example, in U.S. Pat. Nos. 7,608.406, 7,622, the complete sequence of which is shown in FIG. 12A. The 114, 6,896,872, 7,361,473, 7,358,055, and 6,897,030, each of human S100A12 amino acid sequence is publicly available as which is incorporated herein by reference in their entireties. US 2013/O 189243 A1 Jul. 25, 2013

0.137 In one embodiment, the present invention provides a array or a multi-well plate or a filament-based diagnostic biomarker panel for detecting or diagnosis from a test sample system (described in further detail herein), at the time they are (e.g., peripheral blood) evidence of risk for or an occurrence analyzed, tested, assayed, probed, measured, quantified, of acute ischemic stroke in a patient comprising at least one, evaluated, an the like. This also includes where the biomark or preferably 2, 3 or 4 biomarker(s) selected from the group ers are separately analyzed, tested, assayed, probed, mea consisting of chemokine receptor 7 (CCR7) or chondroitin Sured, quantified, evaluated, and the like, i.e., in separate sulfate proteoglycan 2 (CSPG2) or IQ motif-containing reaction vessels or reaction environments, such that their GTPase activation protein 1 (IQGAP1) or orosomucoid 1 assay results are obtained at Substantially the same time. The (ORM1). biomarker panel can refer to the constitution of polypeptides 0.138. As noted above, the amino acid and corresponding or nucleic acid molecules in a biological sample against nucleic acid sequences of the biomarkers of the invention are which are analyzed, tested, assayed, probed, measured, quan known in the art and can be found in publicly available pub tified, evaluated, and the like. Alternatively, the biomarker lications and databases. Exemplary sequences are set forth panel can refer a testing device on which isolated or purified below in the form of GenBank accession numbers. The biomarkers of the invention (or nucleic acid molecules encod nucleic acid and polypeptide accession numbers, respec ing the biomarkers of the invention or parts thereof or anti tively, are set forth in parenthesis after each biomarker; (1) bodies specific for the biomarkers) are placed to enable the chemokine receptor 7 (CCR7); (2) chondroitin sulfate pro interaction of the biomarker panel with a test biological teoglycan 2 (CSPG2); (3) IQ motif-containing GTPase acti sample. vation protein 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) 0141 For example, a biomarker panel can include anarray arginase 1 (ARG1); (6) lymphocyte antigen 96 (LY96); (7) of antibodies specific for the biomarkers of the invention, matrix metalloproteinase 9 (MMP9); (8) carbonic anhydrase which can be used to detect the presence of the biomarkers in 4 (CA4); and (9) S100 calcium binding protein A12 a test biological sample (e.g., peripheral blood). In another (S100A12). One of skill in the art will understand that embodiment, the biomarker panel can include an array of although accession numbers are provided, each biomarker nucleic acid molecules (e.g., oligonucleotide probes) which may exist in multiple forms, each of which are encompassed are complimentary to mRNA encoding the biomarkers of the by the invention. For example, variants may exist in which a invention which may be present in a test sample (e.g., periph Small number, e.g., 1, 2, 3, 4, 5, 10 or more, nucleotides or eral blood). In yet another embodiment, the biomarker panel amino acid residues are different in relation to the exemplary can include purified biomarker polypeptides of the invention accession numbers set forth above. However, these variants for the screening of compounds or agents in a test sample or are intended to be used in the methods of the invention. In agent library that may interact or bind to the biomarker addition, “derivatives” of the biomarkers are contemplated. polypeptides of the invention. 0.139. As used herein, a "derivative' of a biomarker (or of 0142. It will be appreciated that the biomarker panels pref if encoding nucleic acid molecule) to a modified form of a erably include at least one biomarker for diagnosis or predict biomarker of the invention. A modified form of a given biom ing acute ischemic stroke, including (1) chemokine receptor 7 arker may include at least one amino acid substitution, dele (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) tion, or insertion, wherein said modified form retains a bio IQ motif-containing GTPase activation protein 1 (IQGAP1); logical activity of an unmodified form. An amino acid (4) orosomucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lym substitution may be considered “conservative' when the sub phocyte antigen 96 (LY96); (7) matrix metalloproteinase 9 stitution results in similar structural or chemical properties (MMP9); (8) carbonic anhydrase 4 (CA4); and (9) S100 cal (e.g., replacement of leucine with isoleucine). An amino acid cium binding protein A12 (S100A12) or markers related (i.e., substitution may be “non-conservative' in nature wherein the related markers of these biomarkers as defined herein) structure and chemical properties vary (e.g., replacement of thereto. Preferably, the biomarker panels include at least one arginine with alanine). A modified form of a given biomarker of (1) chemokine receptor 7 (CCR7); (2) chondroitin sulfate may include chemical modifications, wherein a modified proteoglycan 2 (CSPG2); (3) IQ motif-containing GTPase form retains a biological activity of a given biomarker. Such activation protein 1 (IQGAP1); (4) orosomucoid 1 (ORM1). modifications include, but are not limited to, glycosylation, As noted, the biomarker panels of the invention can be com phosphorylation, acetylation, alkylation, methylation, bioti prised of the biomarker polypeptides themselves, antibodies nylation, glutamylation glycylation, isoprenylation, lipoyla that are specific to the biomarker polypeptides or even nucleic tion, pegylation, phosphopantetheinylation, Sulfation, selena acid molecules that are complimentary or that recognize cor tion, and C-terminal amidation. Other modifications include responding nucleic acid molecules in a sample which encode those involving other proteins such as ISGylation, SUMOy a biomarker of the invention. lation, and ubiquitination. In addition, modifications may 0143. In addition, the biomarker panels of the invention also include those involved in changing the chemical nature can include other biomarkers that pertain to other diseases or of an amino acid Such as deimination and deamidation. conditions other than acute ischemic stroke, including any 0140. The term “biomarker panel” refers to a collection, other type of stroke, or other non-stroke condition, in the e.g., 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 event a user wishes to test or detect not only acute ischemic or more, 8 or more, 9 or more, preferably 2, 3, 4, 5, 6, 7, 8 or strokes, but also other conditions at the same time or using the 9 or more biomarkers (e.g., in the form of polypeptides or same panel or set of biomarkers. Examples of other Such nucleic acid molecules or the like), that may be analyzed, biomarkers include those related to blood pressure (e.g., tested, assayed, probed, measured, quantified, evaluated, an A-type natriuretic peptide, C-type antriuretic peptide, uro the like, in a generally simultaneous manner. This includes tensin II, vasopressen, calcitonin, angiotensin II, adrenom where the individual biomarkers or means for detecting the edulin, and endothenlins), coagulation and hemostasis biomarkers (e.g., oligonucleotide probe orantibody) are situ (D-dimer, plasmin, b-thromboglobulin, platelet factor 4. ated on a single Surface or Support medium, e.g., fixed to an fibrinopeptide A, platelet-derived growth factor, prothrom US 2013/O 189243 A1 Jul. 25, 2013

bin, P-selectin and thrombin), acute phase response (C-reac phase, such as a bead, a plate, a membrane or an array. After tive protein, mannose-binding protein, human neutrophil unbound materials are washed away, the captured analytes elastase, inducible nitric oxide synthase, lysophosphatidic are detected and/or measured by mass spectrometry. (This acid, malondialdehyde LDL, lipopolysaccharide binding method also will also result in the capture of protein intere protein) and markers related to inflammation (interleukins, actors that are bound to the proteins or that are otherwise tumor necrosis factor, myeloperoxidase, Soluble intercellular recognized by antibodies and that, themselves, can be biom adhesion molecule, Vascular cell adhesion molecule, mono arkers.) Various forms of mass spectrometry are useful for cyte chemotactic protein-1). Such other biomarkers may detecting the protein forms, including laser desorption assist in gaining a better overall clinical picture of the health approaches, such as traditional MALDI or SELDI, and elec of the patient and the potential causes of stroke. Such markers trospray ionization. can be selected on the basis of the knowledge of one or ordinary skill in the art. Additional examples of such markers Detection Methods can be found in the art, for example, in U.S. Pat. No. 7,608, 406, which is incorporated herein by reference. 0.149 Numerous methods and devices are well known to the skilled artisan for the detection and analysis of the biom Biomarker Forms arkers of the instant invention. 0144 One of ordinary skill in the art will appreciate that 0150. With regard to polypeptides or proteins in patient proteins frequently exist in a biological sample in a plurality test samples, immunoassay devices and methods can be used. of different forms. These forms can result from either or both See, e.g., U.S. Pat. Nos. 6,143,576; 6,113,855; 6,019,944; of pre- and post-translational modification. Pre-translational 5,985,579; 5,947,124; 5,939,272; 5,922,615; 5,885,527; modified forms include allelic variants, splice variants and 5,851,776; 5,824,799; 5,679,526; 5,525,524; and 5,480,792, RNA editing forms. Post-translationally modified forms each of which is hereby incorporated by reference in its include forms resulting from proteolytic cleavage (e.g., cleav entirety, including all tables, figures and claims. These age of a signal sequence or fragments of a parent protein), devices and methods can utilize labeled molecules in various glycosylation, phosphorylation, lipidation, oxidation, methy sandwich, competitive, or non-competitive assay formats, to lation, cysteinylation, Sulphonation and acetylation. generate a signal that is related to the presence or amount of 0145 When detecting or measuring a biomarker of the an analyte of interest. invention in a sample, the ability to differentiate between 0151. Additionally, certain methods and devices, such as different forms of a protein biomarker depends upon the biosensors and optical immunoassays, may be employed to nature of the difference and the method used to detect or determine the presence or amount of analytes without the measure. For example, an immunoassay using a monoclonal need for a labeled molecule. See, e.g., U.S. Pat. Nos. 5,631, antibody will detect all forms of a protein containing the 171; and 5,955,377, each of which is hereby incorporated by epitope and will not distinguish between them. However, a reference in its entirety, including all tables, figures and sandwich immunoassay that uses two antibodies directed claims. One skilled in the art also recognizes that robotic against different epitopes on a protein will detect all forms of instrumentation including but not limited to Beckman the protein that contain both epitopes and will not detect those ACCESSR), Abbott AXSYMCR, Roche ELECSYS(R), Dade forms that contain only one of the epitopes. Behring STRATUS(R) systems are among the immunoassay 0146 Indiagnostic assays, the inability to distinguish dif analyzers that are capable of performing the immunoassays ferent forms of a biomarker protein has little impact when the taught herein. forms detected by the particular method used are equally good biomarkers as any other particular form. However, 0152 Preferably the biomarkers are analyzed using an when a particular form (or a subset of particular forms) of a immunoassay, although other methods are well known to protein is a better biomarker than the collection of different those skilled in the art (for example, the measurement of forms detected together by a particular method, the power of marker RNA levels). The presence or amount of a marker is the assay may suffer. In this case, it may be useful to employ generally determined using antibodies specific for each anassay method that distinguishes between forms of a protein marker and detecting specific binding. Any Suitable immu and that specifically detects and measures a desired form or noassay may be utilized, for example, enzyme-linked immu forms of the protein. Distinguishing different forms of an noassays (ELISA), radioimmunoassays (RIAS), competitive analyte (e.g., a biomarker) or specifically detecting a particu binding assays, and the like. Specific immunological binding lar form of an analyte is referred to as “resolving the analyte. of the antibody to the marker can be detected directly or 0147 Mass spectrometry is a particularly powerful meth indirectly. Direct labels include fluorescent or luminescent odology to resolve different forms of a protein because the tags, metals, dyes, radionuclides, and the like, attached to the different forms typically have different masses that can be antibody. Indirect labels include various enzymes well known resolved by mass spectrometry. Accordingly, if one form of a in the art, Such as alkaline phosphatase, horseradish peroxi protein is a Superior biomarker for a disease than anotherform dase and the like. of the biomarker, mass spectrometry may be able to specifi 0153. The use of immobilized antibodies specific for the cally detect and measure the useful form where traditional markers is also contemplated by the present invention. The immunoassay fails to distinguish the forms and fails to spe antibodies could be immobilized onto a variety of solid Sup cifically detect to useful biomarker. ports, such as magnetic or chromatographic matrix particles, 0148 One useful methodology combines mass spectrom the Surface of an assay place (such as microtiter wells), pieces etry with immunoassay. First, a biospecific capture reagent of a solid Substrate material or membrane (such as plastic, (e.g., an antibody that recognizes the biomarker and other nylon, paper), and the like. An assay strip could be prepared forms of it) is used to capture the biomarker of interest. by coating the antibody or a plurality of antibodies in an array Preferably, the biospecific capture reagent is bound to a solid on solid support. This strip could then be dipped into the test US 2013/O 189243 A1 Jul. 25, 2013

sample and then processed quickly through washes and cium binding protein A12 (S100A12) or related markers, and detection steps to generate a measurable signal. Such as a more preferably at least one of (1) chemokine receptor 7 colored spot. (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) 0154 The analysis of a plurality of biomarkers may be IQ motif-containing GTPase activation protein 1 (IQGAP1); carried out separately or simultaneously with one test sample. or (4) orosomucoid 1 (ORM1) or related markers. For separate or sequential assay of markers, Suitable appara 0157. The analysis of a single marker or subsets of mark tuses include clinical laboratory analyzers such as the ELEC ers comprising a larger panel of markers could be carried out SYS(R) (Roche), the AXSYMR (Abbott), the ACCESS(R) by one skilled in the art to optimize clinical sensitivity or (Beckman), the ADVIAR CENTAURR) (Bayer) immunoas specificity in various clinical settings. These include, but are say systems, the NICHOLS ADVANTAGE(R) (Nichols Insti not limited to ambulatory, urgent care, emergency care, criti tute) immunoassay system, etc. Preferred apparatuses or pro cal care, intensive care, monitoring unit, inpatient, outpatient, tein chips perform simultaneous assays of a plurality of physician office, medical clinic, and health screening set markers on a single Surface. Particularly useful physical for tings. Furthermore, one skilled in the art can use a single mats comprise Surfaces having a plurality of discrete, addres marker or a Subset of markers comprising a larger panel of sable locations for the detection of a plurality of different markers in combination with an adjustment of the diagnostic analytes. Such formats include protein microarrays, or “pro threshold in each of the aforementioned settings to optimize tein chips” (see, e.g., Ng and Ilag, J. Cell Mol. Med. 6: clinical sensitivity and specificity. 329-340 (2002)) and certain capillary devices (see e.g., U.S. 0158. In addition, the analysis of the biomarkers of the Pat. No. 6,019,944). In these embodiments each discrete sur invention can be carried out by a person of skill who may not face location may comprise antibodies to immobilize one or necessarily have an expertise with stroke-specific medicine more analyte(s) (e.g., a marker) for detection at each location. and care, e.g., emergency room or urgent care clinicians, Surfaces may alternatively comprise one or more discrete ambulatory clinicians, or any physician not having an exper particles (e.g., microparticles or nanoparticles) immobilized tise in stroke-specific medicine. at discrete locations of a surface, where the microparticles comprise antibodies to immobilize one analyte (e.g., a 0159. The analysis of markers could be carried out in a marker) for detection. As noted, many protein biochips are variety of physical formats as well. For example, the use of described in the art. These further include, for example, pro microtiter plates or automation could be used to facilitate the tein biochips produced by Ciphergen Biosystems, Inc. (Fre processing of large numbers of test samples. Alternatively, mont, Calif.), Packard BioScience Company (Meriden single sample formats could be developed to facilitate imme Conn.), Zyomyx (Hayward, Calif.), Phylos (Lexington, diate treatment and diagnosis in a timely fashion, for Mass.) and Biacore (Uppsala, Sweden). Examples of such example, in ambulatory transport or emergency room set protein bio chips are described in the following patents or tings. published patent applications: U.S. Pat. No. 6,225,047: PCT 0160 The present invention also contemplates the use of International Publication No. WO99/51773: U.S. Pat. No. filament-based detection systems for rapidly detecting the 6,329,209, PCT International Publication No. WO 00/56934 biomarkers of the invention. Filament-based detection sys and U.S. Pat. No. 5.242,828, each of which are incorporated tems are known in the art and can be found, for example, in by reference. US Published Application No. 2006/012148 A1, and which 0155 Several markers may be combined into one test for are described in further detail below. efficient processing of a multiple of samples. In addition, one skilled in the art would recognize the value oftesting multiple Diagnosis Methods samples (for example, at Successive time points) from the same individual. Such testing of serial samples will allow the 0.161 The invention provides methods and systems for the identification of changes in marker levels overtime. Increases identification of one or more biomarkers for the diagnosis of or decreases in marker levels, as well as the absence of change disease, including preferably acute ischemic stroke. One in marker levels, would provide useful information about the skilled in the art will also recognize that analysis of markers disease status that includes, but is not limited to identifying can be performed and the data from the analyses of multiple the approximate time from onset of the event, the presence markers can be combined to form panels of markers to and amount of salvageable tissue, the appropriateness of drug increase the sensitivity and reliability of a diagnosis. therapies, the effectiveness of various therapies as indicated 0162. In developing a panel of markers useful in diagnosis by reperfusion or resolution of symptoms, differentiation of of a particular disease or condition, e.g., acute ischemic the various types of stroke, identification of the severity of the stroke, data for a number of potential markers may be event, identification of the disease severity, and identification obtained from a group of subjects by testing for the presence of the patient's outcome, including risk of future events. or level of certain markers. The group of subjects can be 0156. As noted, a biomarker panel consisting of the biom divided into two sets, and preferably the first set and the arkers referenced above may be constructed to provide rel second set each have an approximately equal number of Sub evant information related to diagnosis of acute ischemic jects. The first set includes subjects who have been confirmed stroke. Such a panel may be constructed using 1, 2, 3, 4, 5, 6, as having a disease or, more generally, being in a first condi 7, 8, 9, 10, 15, 20, or more or individual markers, but prefer tion state (e.g., acute ischemic stroke). For example, this first ably includes at least one of (1) chemokine receptor 7 set of patients may be those that have recently had an acute (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) ischemic stroke, or may be those having a specific type of IQ motif-containing GTPase activation protein 1 (IQGAP1); stroke (e.g., thrombotic, embolic, lacunar, hypoperfusion, (4) orosomucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lym intracerebral hemorrhage, and Subarachnoid hemorrhage phocyte antigen 96 (LY96); (7) matrix metalloproteinase 9 types of strokes). The confirmation of this condition state may (MMP9); (8) carbonic anhydrase 4 (CA4); and (9) S100 cal be made through a more rigorous and/or expensive testing US 2013/O 189243 A1 Jul. 25, 2013

such as MRI or CT or other instrumentation-based confirma expressed using a ROC (Receiver Operating Characteristic) tory test. Hereinafter, subjects in this first set will be referred curve. ROC curves are well known to those skilled in the art. to as “diseased'. 0167. The horizontal axis of the ROC curve represents 0163 The second set of subjects are simply those who do (1-specificity), which increases with the rate of false posi not fall within the first set. Subjects in this second set may be tives. The vertical axis of the curve represents sensitivity, “non-diseased: that is, normal subjects. Alternatively, sub which increases with the rate of true positives. Thus, for a jects in this second set may be selected to exhibit one symp particular cutoff selected, the value of (1-specificity) may be tom or a constellation of symptoms that mimic those symp determined, and a corresponding sensitivity may be obtained. toms exhibited by the “diseased subjects. In the case of The area under the ROC curve is a measure of the probability neurological disorders, for example, the skilled artisan will that the measured marker level will allow correct identifica understand that neurologic dysfunction is a common Symp tion of a disease or condition. Thus, the area under the ROC tom in various systemic disorders (e.g., alcoholism, Vascular curve can be used to determine the effectiveness of the test. disease, stroke, a specific type of stroke (e.g., thrombotic, (0168 As discussed above, the measurement of the level of embolic, lacunar, hypoperfusion, intracerebral hemorrhage, a single marker may have limited usefulness. The measure and Subarachnoid hemorrhage types of strokes) autoimmu ment of additional markers provides additional information, nity, metabolic disorders, aging, etc.). but the difficulty lies in properly combining the levels of two potentially unrelated measurements. In the methods and sys 0164. Specific neurologic dysfunctions or “stroke-associ tems according to embodiments of the present invention, data ated symptoms' or “stroke-mimicking symptoms” may relating to levels of various markers for the sets of diseased include, but are not limited to, pain, headache, aphasia, and non-diseased patients may be used to develop a panel of apraxia, agnosia, amnesia, stupor, confusion, Vertigo, coma, markers to provide a useful panel response. The data may be delirium, dementia, seizure, migraine insomnia, hyperSom provided in a database Such as Microsoft Access, Oracle, nia, sleep apnea, tremor, dyskinesia, paralysis, visual distur other SQL databases or simply in a data file. The database or bances, diplopia, paresthesias, dysarthria, hemiplegia, hemi data file may contain, for example, a patient identifier Such as anesthesia, hemianopia, etc. Patients exhibiting one or more a name or number, the levels of the various markers present, of these symptoms but that have not suffered from a stroke are and whether the patient is diseased or non-diseased. referred to herein as “stroke mimics' Conditions within the 0169. Next, an artificial cutoff region may be initially differential diagnosis of stroke include brain tumor (includ selected for each marker. The location of the cutoff region ing primary and metastatic disease), aneurysm, electrocution, may initially be selected at any point, but the selection may burns, infections (e.g., meningitis), cerebral hypoxia, head affect the optimization process described below. In this injury (including concussion), stress, dehydration, nerve regard, selection near a suspected optimal location may facili palsy (cranial or peripheral), hypoglycemia, migraine, mul tate faster convergence of the optimizer. In a preferred tiple Sclerosis, peripheral vascular disease, peripheral neur method, the cutoff region is initially centered about the center opathy, seizure (including grand mal seizure), Subdural of the overlap region of the two sets of patients. In one hematoma, Syncope, and transient unilateral weakness. Pre embodiment, the cutoff region may simply be a cutoff point. ferred markers and marker panels are those that can distin In other embodiments, the cutoff region may have a length of guish acute ischemic stroke from these stroke mimicking greater than Zero. In this regard, the cutoff region may be conditions. defined by a center value and a magnitude of length. In prac 0.165. The data obtained from subjects in these sets tice, the initial selection of the limits of the cutoff region may includes levels of a plurality of markers. Preferably, data for be determined according to a pre-selected percentile of each the same set of markers is available for each patient. This set set of Subjects. For example, a point above which a pre of markers may include all candidate markers which may be selected percentile of diseased patients are measured may be Suspected as being relevant to the detection of a particular used as the right (upper) end of the cutoff range. disease or condition, e.g., those identified 9-biomarkers of the 0170 Each marker value for each patient may then be invention. Embodiments of the methods and systems mapped to an indicator. The indicator is assigned one value described herein may be used to determine which of the below the cutoff region and another value above the cutoff candidate markers are most relevant to the diagnosis of the region. For example, if a marker generally has a lower value disease or condition. The levels of each marker in the two sets for non-diseased patients and a higher value for diseased of subjects may be distributed across abroad range, e.g., as a patients, a Zero indicator will be assigned to a low value for a Gaussian distribution. However, no distribution fit is particular marker, indicating a potentially low likelihood of a required. positive diagnosis. In other embodiments, the indicator may 0166 As noted above, a marker often is incapable of be calculated based on a polynomial. The coefficients of the definitively identifying a patient as either diseased or non polynomial may be determined based on the distributions of diseased. For example, if a patient is measured as having a the marker values among the diseased and non-diseased Sub marker level that falls within the overlapping region, the jects. results of the test may not be helpful in diagnosing the patient. 0171 The relative importance of the various markers may An artificial cutoff may be used to distinguish between a be indicated by a weighting factor. The weighting factor may positive and a negative test result for the detection of the initially be assigned as a coefficient for each marker. As with disease or condition. Regardless of where the cutoff is the cutoff region, the initial selection of the weighting factor selected, the effectiveness of the single marker as a diagnosis may be selected at any acceptable value, but the selection may tool is unaffected. Changing the cutoff merely trades off affect the optimization process. In this regard, selection near between the number of false positives and the number of false a Suspected optimal location may facilitate faster conver negatives resulting from the use of the single marker. The gence of the optimizer. In a preferred method, acceptable effectiveness of a test having such an overlap is often weighting coefficients may range between Zero and one, and US 2013/O 189243 A1 Jul. 25, 2013

an initial weighting coefficient for each marker may be 0176 It is possible that one of the markers in the panel is assigned as 0.5. In a preferred embodiment, the initial weight specific to the disease or condition being diagnosed. When ing coefficient for each marker may be associated with the Such markers are present at above or below a certain thresh effectiveness of that marker by itself. For example, a ROC old, the panel response may be set to return a “positive' test curve may be generated for the single marker, and the area result. When the threshold is not satisfied, however, the levels under the ROC curve may be used as the initial weighting of the marker may nevertheless be used as possible contribu coefficient for that marker. tors to the objective function. 0172 Next, a panel response may be calculated for each 0177. An optimization algorithm may be used to maxi Subject in each of the two sets. The panel response is a func mize or minimize the objective function. Optimization algo tion of the indicators to which each marker level is mapped rithms are well-known to those skilled in the art and include and the weighting coefficients for each marker. One advan several commonly available minimizing or maximizing func tage of using an indicator value rather than the marker value tions including the Simplex method and other constrained is that an extraordinarily high or low marker levels do not optimization techniques. It is understood by those skilled in change the probability of a diagnosis of diseased or non theart that some minimization functions are better than others diseased for that particular marker. Typically, a marker value at searching for global minimums, rather than local mini above a certain level generally indicates a certain condition mums. In the optimization process, the location and size of state. Marker values above that level indicate the condition the cutoff region for each marker may be allowed to vary to state with the same certainty. Thus, an extraordinarily high provide at least two degrees of freedom per marker. Such marker value may not indicate an extraordinarily high prob variable parameters are referred to herein as independent ability of that condition state. The use of an indicator which is variables. In a preferred embodiment, the weighting coeffi constant on one side of the cutoff region eliminates this con cient for each marker is also allowed to vary across iterations C. of the optimization algorithm. In various embodiments, any 0173 The panel response may also be a general function permutation of these parameters may be used as independent of several parameters including the marker levels and other variables. factors including, for example, race and gender of the patient. 0178. In addition to the above-described parameters, the Other factors contributing to the panel response may include sense of each marker may also be used as an independent the slope of the value of a particular marker over time. For variable. For example, in many cases, it may not be known example, a patient may be measured when first arriving at the whether a higher level for a certain marker is generally indica hospital for a particular marker. The same marker may be tive of a diseased state or a non-diseased State. In such a case, measured again an hour later or some other time increment it may be useful to allow the optimization process to search on later, and the level of change may be reflected in the panel both sides. In practice, this may be implemented in several response. Further, additional markers may be derived from ways. For example, in one embodiment, the sense may be a other markers and may contribute to the value of the panel truly separate independent variable which may be flipped response. For example, the ratio of values of two markers may between positive and negative by the optimization process. be a factor in calculating the panel response. Alternatively, the sense may be implemented by allowing the 0.174 Having obtained panel responses for each subject in weighting coefficient to be negative. each set of subjects, the distribution of the panel responses for 0179 The optimization algorithm may be provided with each set may now be analyzed. An objective function may be certain constraints as well. For example, the resulting ROC defined to facilitate the selection of an effective panel. The curve may be constrained to provide an area-under-curve of objective function should generally be indicative of the effec greater than a particular value. ROC curves having an area tiveness of the panel, as may be expressed by, for example, under the curve of 0.5 indicate complete randomness, while overlap of the panel responses of the diseased set of Subjects an area under the curve of 1.0 reflects perfect separation of the and the panel responses of the non-diseased set of subjects. In two sets. Thus, a minimum acceptable value, such as 0.75, this manner, the objective function may be optimized to maxi may be used as a constraint, particularly if the objective mize the effectiveness of the panel by, for example, minimiz function does not incorporate the area under the curve. Other ing the overlap. constraints may include limitations on the weighting coeffi (0175. In a preferred embodiment, the ROC curve repre cients of particular markers. Additional constraints may limit senting the panel responses of the two sets of Subjects may be the sum of all the weighting coefficients to a particular value, used to define the objective function. For example, the objec such as 1.0. tive function may reflect the area under the ROC curve. By 0180. The iterations of the optimization algorithm gener maximizing the area under the curve, one may maximize the ally vary the independent parameters to satisfy the constraints effectiveness of the panel of markers. In other embodiments, while minimizing or maximizing the objective function. The other features of the ROC curve may be used to define the number of iterations may be limited in the optimization pro objective function. For example, the point at which the slope cess. Further, the optimization process may be terminated of the ROC curve is equal to one may be a useful feature. In when the difference in the objective function between two other embodiments, the point at which the product of sensi consecutive iterations is below a predetermined threshold, tivity and specificity is a maximum, sometimes referred to as thereby indicating that the optimization algorithm has the “knee may be used. In an embodiment, the sensitivity at reached a region of a local minimum or a maximum. the knee may be maximized. In further embodiments, the 0181. Thus, the optimization process may provide a panel sensitivity at a predetermined specificity level may be used to of markers including weighting coefficients for each marker define the objective function. Other embodiments may use and cutoff regions for the mapping of marker values to indi the specificity at a predetermined sensitivity level may be cators. In order to develop lower-cost panels which require used. In still other embodiments, combinations of two or the measurement offewer marker levels, certain markers may more of these ROC-curve features may be used. be eliminated from the panel. In this regard, the effective US 2013/O 189243 A1 Jul. 25, 2013

contribution of each marker in the panel may be determined to 0186. As noted, a number of immunoassays or nucleic identify the relative importance of the markers. In one acid based tests can be used to rapidly detect the presence of embodiment, the weighting coefficients resulting from the the biomarkers of the invention in a biological sample, in optimization process may be used to determine the relative particular, when done in the context of the urgent clinical importance of each marker. The markers with the lowest setting. Examples include radioimmunoassays, enzyme coefficients may be eliminated. immunoassays (e.g. ELISA), immunofluorescence, immuno 0182. In certain cases, the lower weighting coefficients precipitation, latex agglutination, hemagglutination, and his may not be indicative of a low importance. Similarly, a higher tochemical tests. A particularly preferred method, however, weighting coefficient may not be indicative of a high impor because of its speed and ease of use, is latex agglutination. tance. For example, the optimization process may result in a 0187 Latex agglutination assays have been described in high coefficient if the associated marker is irrelevant to the Beltz, G. A. et al., in Molecular Probes: Techniques and diagnosis. In this instance, there may not be any advantage Medical Applications, A. Albertini et al., eds., Raven Press, that will drive the coefficient lower. Varying this coefficient New York, 1989, incorporated herein by reference. In the may not affect the value of the objective function. latex agglutination assay, antibody raised against a particular 0183 Individual panel response values may also be used biomarker is immobilized on latex particles. A drop of the as markers in the methods described herein. For example, a latex particles is added to an appropriate dilution of the serum panel may be constructed from a plurality of markers, and to be tested and mixed by gentle rocking of the card. With each marker of the panel may be described by a function and samples lacking sufficient levels of the biomarkers, the latex a weighting factor to be applied to that marker (as determined particles remain in Suspension and retain a Smooth, milky by the methods described above). Each individual marker appearance. However, if biomarkers reactive with the anti level is determined for a sample to be tested, and that level is body are present, the latex particles clump into visibly detect applied to the predetermined function and weighting factor able aggregates. for that particular marker to arrive at a sample value for that 0188 An agglutination assay can also be used to detect marker. The sample values for each marker are added together biomarkers wherein the corresponding antibody is immobi to arrive at the panel response for that particular sample to be lized on a suitable particle other than latex beads, for tested. For a “diseased' and “non-diseased’ group of patients, example, on gelatin, red blood cells, nylon, liposomes, gold the resulting panel responses may be treated as if they were particles, etc. The presence of antibodies in the assay causes just levels of another disease marker. agglutination, similar to that of a precipitation reaction, 0184 One could use such a method to define new biom which can then be detected by Such techniques as nephelom arkers. For example, one may divide stroke Subjects and etry, turbidity, infrared spectrometry, visual inspection, colo non-stroke Subjects as follows: (1) ischemic stroke; (2) hem rimetry, and the like. orrhagic stroke; (3) normals; (4) TIAS; (5) other stroke mim 0189 The term latex agglutination is employed generi ics. One would define a first panel constructed from a plural cally herein to refer to any method based upon the formation ity of markers as described above, and obtain the panel of detectable agglutination, and is not limited to the use of responses from this first panel for all the subjects. Then, the latex as the immunosorbent substrate. While preferred sub members of any one of these 5 groups may be compared to the strates for the agglutination are latex based, such as polysty panel responses of the members of any other of these groups rene and polypropylene, particularly polystyrene, other well to define a function and weighting factor that best differenti known Substrates include beads formed from glass, paper, ates these two groups based on the panel responses. This can dextran, and nylon. The immobilized antibodies may be be repeated as all 5 groups are compared pairwise. The covalently, ionically, or physically bound to the Solid-phase “markers' used to define a second panel might include any or immunoadsorbent, by techniques such as covalent bonding all of the following as a new “marker: ischemic stroke versus via an amide or ester linkage, ionic attraction, or by adsorp normals as marker 1, hemorrhagic stroke versus normals as tion. Those skilled in the art will know many other suitable marker 2; ischemic stroke versus TIAS as marker 3; hemor carriers for binding antibodies, or will be able to ascertain rhagic stroke versus TIAS as marker 4, ischemic stroke versus Such, using routine experimentation. other mimics as marker 5; and hemorrhagic stroke Versus 0.190 Conventional methods can be used to prepare the other mimics as marker 6. antibodies. For example, by using a peptide of a biomarker of 0185. Measures of test accuracy may be obtained as the invention, polyclonal antisera or monoclonal antibodies described in Fischer et al., Intensive Care Med. 29: 1043-51, can be made using standard methods. A mammal, (e.g., a 2003, and used to determine the effectiveness of a given mouse, hamster, or rabbit) can be immunized with an immu marker or panel of markers. These measures include sensi nogenic form of the peptide which elicits an antibody tivity and specificity, predictive values, likelihood ratios, response in the mammal. Techniques for conferring immu diagnostic odds ratios, and ROC curve areas. As discussed nogenicity on a peptide include conjugation to carriers or above, suitable tests may exhibit one or more of the following other techniques well known in the art. For example, the results on these various measures: at least 75% sensitivity, peptide can be administered in the presence of adjuvant. The combined with at least 75% specificity; ROC curve area of at progress of immunization can be monitored by detection of least 0.7. more preferably at least 0.8, even more preferably at antibody titers in plasma or serum. Standard ELISA or other least 0.9, and most preferably at least 0.95; and/or a positive immunoassay procedures can be used with the immunogenas likelihood ratio (calculated as sensitivity/(1-specificity)) of at antigen to assess the levels of antibodies. Following immu least 5, more preferably at least 10, and most preferably at nization, antisera can be administered and, if desired, poly least 20, and a negative likelihood ratio (calculated as (1-sen clonal antibodies isolated from the sera. sitivity)/specificity) of less than or equal to 0.3, more prefer 0191 To produce monoclonal antibodies, antibody pro ably less than or equal to 0.2, and most preferably less than or ducing cells (lymphocytes) can be harvested from an immu equal to 0.1. nized animal and fused with myeloma cells by standard US 2013/O 189243 A1 Jul. 25, 2013

Somatic cell fusion procedures thus immortalizing these cells chemokine receptor 7 (CCR7); (2) chondroitin sulfate pro and yielding hybridoma cells. Such techniques are well teoglycan 2 (CSPG2); (3) IQ motif-containing GTPase acti known in the art, (e.g., the hybridoma technique originally vation protein 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) developed by Kohler and Milstein (Nature 256, 495-497 arginase 1 (ARG1); (6) lymphocyte antigen 96 (LY96); (7) (1975)) as well as other techniques such as the human B-cell matrix metalloproteinase 9 (MMP9); (8) carbonic anhydrase hybridoma technique (Kozbor et al., Immunol. Today 4, 72 4 (CA4); or (9) S100 calcium binding protein A12 (S100A12). (1983)), the EBV-hybridoma technique to produce human 0.197 In another embodiment, this invention provides a monoclonal antibodies (Cole et al. Monoclonal Antibodies in complex between a biomarker of this invention and biospe Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96), and cific capture reagent that specifically binds the biomarker. In screening of combinatorial antibody libraries (Huse et al., other embodiments, the biospecific capture reagent is bound Science 246, 1275 (1989). Hybridoma cells can be screened to a solid phase. For example, this invention contemplates a immunochemically for production of antibodies specifically device comprising bead or chip derivatized with a biospecific reactive with the peptide and the monoclonal antibodies can capture reagent that binds to a biomarker of this invention be isolated. Therefore, the invention also contemplates hybri and, also, the device in which a biomarker of this invention is doma cells secreting monoclonal antibodies with specificity bound to the biospecific capture reagent. for the biomarkers of the invention as described herein. 0.198. In another embodiment, this invention provides a 0.192 In addition, the biomarkers of the invention may be device comprising a solid Substrate to which is attached an measured by detection and quantification of nucleic acids adsorbent, e.g., a chromatographic adsorbent, to which is encoding the biomarkers, e.g., cDNAS corresponding to further bound a biomarker of this invention. mRNAs present in the peripheral blood. Such detection meth ods may be carried out by any suitable means for analyzing Kits and Detection Systems (e.g., Filament-Based Detection nucleic acids, including traditional PCR assays such as cDNA Systems) hybridization, Northern blots, or Southern blots. These meth 0199. In another embodiment the invention provides kits ods can be carried out using oligonucleotides that hybridize to for diagnosing acute ischemic stroke in a patient. Depending nucleic acid molecules encoding the polypeptide biomarkers on how the kit is to be operated, the kit may include one or of the invention. One of ordinary skill in the art is fully more biomarker polypeptides of the invention, including capable of designing and selecting appropriate oligonucle preferably (1) chemokine receptor 7 (CCR7); (2) chondroitin otide molecules based on the known sequences of the biom sulfate proteoglycan 2 (CSPG2); (3) IQ motif-containing arkers as noted above. GTPase activation protein 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lymphocyte antigen 96 Compositions of Matter (LY96); (7) matrix metalloproteinase 9 (MMP9); (8) carbonic 0193 In another aspect, this invention provides composi anhydrase 4 (CA4); or (9) S100 calcium binding protein A12 tions of matter based on the biomarkers of the present inven (S100A12). In addition, the kit may include antibodies that tion. specifically bind to any of the biomarker polypeptides of the 0194 In one embodiment, this invention provides biom invention. If the kit is to be used to detect nucleic acid mol arkers of this invention in purified form. Purified biomarkers ecules that correspond to the biomarkers of the invention, the have utility as antigens to raise antibodies. Purified biomar kit may include oligonucleotide molecules or other nucleic kers also have utility as standards in assay procedures. As acid molecules for use in the detection of the biomarker DNA used herein, a “purified biomarker' is a biomarker that has or RNA in a sample. Both antibody and antigen preparations been isolated from other proteins and peptides, and/or other should preferably be provided in a suitable titrated form, with material from the biological sample in which the biomarker is antigen concentrations and/or antibody titers given for easy found. Biomarkers may be purified using any method known reference in quantitative applications. in the art, including, but not limited to, mechanical separation 0200. In certain embodiments, the kits may also includean (e.g., centrifugation), ammonium Sulphate precipitation, immunodetection reagent or label for the detection of specific dialysis (including size-exclusion dialysis), size-exclusion immunoreaction between the provided biomarkers and/or chromatography, affinity chromatography, anion-exchange antibody, as the case may be, and the diagnostic sample. chromatography, cation-exchange chromatography, and Suitable detection reagents are well known in the art as exem metal-chelate chromatography. Such methods may be per plified by radioactive, enzymatic or otherwise chromogenic formed at any appropriate scale, for example, in a chroma ligands, which are typically employed in association with the tography column, or on a biochip. antigen and/or antibody, or in association with a second anti 0.195 Thus, in one embodiment, the present invention pro body having specificity for first antibody. Thus, the reaction is vides purified biomarkers of the invention, including (1) detected or quantified by means of detecting or quantifying chemokine receptor 7 (CCR7); (2) chondroitin sulfate pro the label. Immunodetection reagents and processes Suitable teoglycan 2 (CSPG2); (3) IQ motif-containing GTPase acti for application in connection with the novel methods of the vation protein 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) present invention are generally well known in the art. arginase 1 (ARG1); (6) lymphocyte antigen 96 (LY96); (7) 0201 The reagents may also include ancillary agents such matrix metalloproteinase 9 (MMP9); (8) carbonic anhydrase as buffering agents and protein stabilizing agents, e.g., 4 (CA4); and (9) S100 calcium binding protein A12 polysaccharides and the like. The diagnostic kit may further (s100A12). include where necessary agents for reducing background 0196. In another embodiment, this invention provides bio interference in a test, agents for increasing signal, apparatus specific capture reagents that specifically bind a biomarker of for conducting a test, calibration curves and charts, standard this invention, optionally in purified form. Preferably, a bio ization curves and charts, and the like. specific capture reagent is an antibody. In one embodiment, a 0202 The kit can also comprise a washing solution or biospecific capture reagent is an antibody that binds (1) instructions for making a washing solution, in which the US 2013/O 189243 A1 Jul. 25, 2013 combination of the capture reagent and the washing Solution system for rapid diagnosis of acute ischemic stroke or risk allows capture of the biomarker or biomarkers on the solid thereof utilizing the biomarkers of the invention, including, Support for Subsequent detection by, e.g., mass spectrometry. the nine gene panel of the invention (or some Subgroup The kit may include more than type of adsorbent, each present thereof, e.g., at least 2 biomarkers, or 3, or 4, or 5, or 6, or 7. on a different solid support. or 8 of the biomarkers of the group including (1) chemokine 0203. In a further embodiment, such a kit can comprise receptor 7 (CCR7); (2) chondroitin sulfate proteoglycan 2 instructions for Suitable operational parameters in the form of (CSPG2); (3) IQ motif-containing GTPase activation protein a label or separate insert. For example, the instructions may 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) arginase 1 inform a consumer about how to collect the sample, how to (ARG1); (6) lymphocyte antigen 96 (LY96); (7) matrix met wash the probe or the particular biomarkers to be detected. alloproteinase 9 (MMP9); (8) carbonic anhydrase 4 (CA4); 0204 Inyet another embodiment, the kit can comprise one and (9) S100 calcium binding protein A12 (S100A12)), to or more containers with biomarker samples, to be used as rapidly and easily detect or diagnose acute ischemic stroke standard(s) for calibration. and/or to distinguish from diagnoses other forms of stroke, 0205. In a more particular aspect, the kit of the invention TIAS and stroke mimic events. Such a POC test advanta relates to a rapid biomarker panel for detecting acute ischemic geously be operated by anyone irrespective of a person’s level stroke in a patient comprising antibodies to one or more of expertise in clinical stroke care and/or testing. biomarkers of the invention, including preferably (1) 0209. As used herein, a “filament-based test or diagnostic chemokine receptor 7 (CCR7); (2) chondroitin sulfate pro system' takes the meaning as contemplated in the art, and in teoglycan 2 (CSPG2); (3) IQ motif-containing GTPase acti particular, in U.S. Published Application No. US 2006/ vation protein 1 (IQGAP1); (4) orosomucoid 1 (ORM1); (5) 012148 A1, which is incorporated herein by reference in its arginase 1 (ARG1); (6) lymphocyte antigen 96 (LY96); (7) entirety. In general, filament-based tests utilize either capture matrix metalloproteinase 9 (MMP9); (8) carbonic anhydrase antibodies on a polyester filament, or DNA (or other nucleic 4 (CA4); or (9) S100 calcium binding protein A12 (S100A12), acid) probe on a gold wire, each of which function as molecu and including more preferably (1) chemokine receptor 7 lar hooks to troll for polypeptides or nucleic acid molecules of (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) interest (e.g., the biomarker polypeptides of the invention, or IQ motif-containing GTPase activation protein 1 (IQGAP1); their corresponding mRNA molecules) in a biological or (4) orosomucoid 1 (ORM1). Such kits may include other sample, e.g., peripheral blood. For antibody detection of “tar components, as needed and as described above. get polypeptides (e.g., the biomarker polypeptides of the 0206. In another particular aspect, the kit of the invention invention), a filament material immobilized with antibodies relates to a rapid biomarker panel for detecting acute ischemic specific for the target polypeptides that has been exposed to a stroke in a patient comprising one or more biomarkers of the test sample (e.g., peripheral blood) is threaded through an invention, including preferably (1) chemokine receptor 7 array of chambers that carry out the washing and ultimate (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) reporting of the result. For nucleic acid detection (e.g., IQ motif-containing GTPase activation protein 1 (IQGAP1); mRNA encoding the biomarkers of the invention), a filament (4) orosomucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lym containing DNA or nucleotide probes bound to the filament phocyte antigen 96 (LY96); (7) matrix metalloproteinase 9 (e.g., gold filament) that are specific or hybridize to target (MMP9); (8) carbonic anhydrase 4 (CA4); or (9) S100 cal nucleic acid molecules in the a biological sample (e.g., cium binding protein A12 (S100A12), and including more mRNA of each biomarker in a sample of peripheral blood), preferably (1) chemokine receptor 7 (CCR7); (2) chondroitin that is passed through various chambers that carry out the sulfate proteoglycan 2 (CSPG2); (3) IQ motif-containing washing and reporting of any probe/target interactions that GTPase activation protein 1 (IQGAP1); or (4) orosomucoid 1 have occurred on the filament surface. (ORM1). Such kits may include other components, as needed 0210. In one aspect, the filament-based system includes a and as described above. filament Support which provides the opportunity to rapidly 0207. In yet another particular aspect the invention relates and efficiently move probes between different Zones (e.g., to a rapid biomarker panel for detecting acute ischemic stroke chambers, such as the washing chamber or a reporting cham in a patient comprising a nucleic acid molecule (e.g., an ber) of an apparatus and still retain information about their oligonucleotide) that hybridizes with a nucleic acid molecule location. It also permits the use of very small volumes of encoding one or more biomarkers of the invention (e.g., the various samples—as little as nanoliter Volume reactions. The mRNA corresponding to or encoding the biomarkers of the filament may be constructed so that the probes are arranged in invention), including preferably (1) chemokine receptor 7 an annular fashion, forming a probe band around the circum (CCR7); (2) chondroitin sulfate proteoglycan 2 (CSPG2); (3) ference of the filament. This also permits bands to be depos IQ motif-containing GTPase activation protein 1 (IQGAP1); ited so as to achieve high linear density of probes on the (4) orosomucoid 1 (ORM1); (5) arginase 1 (ARG1); (6) lym filament. phocyte antigen 96 (LY96); (7) matrix metalloproteinase 9 0211. The filament may be made of any of a number of (MMP9); (8) carbonic anhydrase 4 (CA4); or (9) S100 cal different materials. Suitable materials include polystyerene, cium binding protein A12 (S100A12), and including more glass (e.g., fiber optic cores), nylon or other Substrate deriva preferably (1) chemokine receptor 7 (CCR7); (2) chondroitin tized with chemical moieties to impart desired surface struc sulfate proteoglycan 2 (CSPG2); (3) IQ motif-containing ture (3-dimensional) and chemical activity. The filament may GTPase activation protein 1 (IQGAP1); or (4) orosomucoid 1 also be constructed to contain Surface features such as pores, (ORM1). Such kits may include other components, as needed abrasians, invaginations, protrusions, or any other physical or and as described above. chemical structures that increase effective surface area. These 0208. In a particular embodiment, the present invention Surface features may, in one aspect, provide for enhanced contemplates a filament-based rapid diagnostic kit or test mixing of Solutions as the filament passes through a solution system that can be used as a “point-of-care” (POC) diagnostic containing chamber, or increase the number and availability US 2013/O 189243 A1 Jul. 25, 2013 20 of probe molecules. The filament may also contain a probe TAMRA, TET. Tetramethylrhodamine, and/or Texas Red. identifier which allows the user to track large numbers of Enzymes (an enzyme tag) that will generate a colored product different probes on a single filament. The probe identifiers upon contact with a chromogenic Substrate may also be used. may be dyes, magnetic, radioactive, fluorescent, or chemillu Examples of Suitable enzymes include urease, alkaline phos minescent molecules. Alternatively, they may comprise Vari phatase, (horseradish) hydrogen peroxidase or glucose oxi ous digital or analog tags. dase. Preferred secondary binding ligands are biotin and/or 0212. The probes that are attached to the filaments can be avidin and streptavidin compounds. The use of Such labels is any of a variety of biomolecules, including, in particular with well known to those of skill in the art and are described, for respect to this invention, nucleic acid molecules (e.g., oligo example, in U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; nucleotides) and antibodies or antibodies fragments. The 3.996,345; 4,277,437; 4,275,149 and 4,366,241; each incor probes should be capable of binding to or interacting with a porated herein by reference. target Substance of interest (e.g., the polypeptide biomarkers 0219. The chambers of the filament-based system can be of the invention or their encoding mRNA molecules) in a of any Suitable design or function, including processing sample to be tested (e.g., peripheral blood). Such that the chambers, pretreatment chambers, wash chambers and binding to or interaction is capable of being detected. amplification chambers. 0213. The term “nucleic acid' is well known in the art. A 0220 A variety of different types of chambers may be “nucleic acid as used herein will generally refer to a mol used in accordance with the present invention. The invention ecule of DNA, RNA or a derivative or analog thereof, includ contemplates a processing chamber containing putative target ing synthetic molecules. Nucleic acids are also defined as molecules for binding. It also is possible, where convenient, molecules containing a series of naturally-occurring purine or to have a series of processing chambers that are connected by pyrimidine bases. The term “nucleic acid encompasses the means other than the filament. For example, one may wish to terms "oligonucleotide' and “polynucleotide, each as a sub “recycle” target solution by moving it from one chamber to genus of the term “nucleic acid.” The term "oligonucleotide' another for reuse. A processing chamber may also be reused refers to a molecule of between about 3 and about 100 nucleo in the sense that the filament may be passed through a given bases in length. The term “polynucleotide' refers to at least the chamber more than once. one molecule of greater than about 100 nucleobases in length. 0221) The present invention may utilize multiple process 0214. These definitions generally refer to both single ing in Such chambers where different target Solutions stranded and double-stranded molecules, the latter being sub included therein. Thus, a single filament can be utilized for stantially or fully complementary to each other. A nucleic multiple reactions in a single “run” If a large number of acid may even encompass a triple-stranded molecule. As used reactions are to be run, a series of processing chambers may herein, a single Stranded nucleic acid may be denoted by the be utilized that can quickly be emptied, rinsed, and filled with prefix “ss,” a double stranded nucleic acid by the prefix “ds.” new target Solutions. Thus, one can image an apparatus with and a triple stranded nucleic acid by the prefix “ts.” three processing chambers A, B and C, where after a filament 0215. The probes can also be proteinaceous materials, passes through each chamber, the chambers can be emptied e.g., polypeptides or polypeptide fragments of the biomarkers and refilled with new target solutions, and the movement of of the invention. In another embodiment, the probe may be a the filament is reversed. By repeating this process two more proteinaceous compound. There are wide variety of protein times, a series of four filament passes permit exposure to protein interactions; however, proteins also bind nucleic twelve different target solutions. acids, metals and other non-proteinaceous compounds (e.g., 0222. The probes or filaments can also be “pretreated in lipids, hormones, transmitters). Some other examples of pro Such a way as to ensure that the ensuing reaction with the tein that may be used as either targets or probes include, but target has a high degree offidelity, i.e., minimize non-specific are not limited to, antibodies, enzymes, receptors, and DNA attachment. A classic example is of a pretreatment is a “block or RNA-binding proteins. ing reaction. Non-specific protein-protein interactions by 0216. In various embodiments, it may desirable to label inhibited by pretreating a Substrate with a non-specific pro probe or target molecules. Examples of labels include para tein such as BSA. Similarly, non-specific DNA reactions can magnetic ions, radioactive isotopes; fluorochromes, NMR be reduced by incubating the probe with a “random' DNA detectable Substances, and X-ray imaging compounds. known to lack homology with the probe. 0217 Paramagnetic ions include chromium (III), manga 0223) The filament-based system also contemplates wash nese (II), iron (III), iron (II), cobalt(II), nickel (II), copper ing chambers to remove non-specifically bound molecules (II), neodymium (II), Samarium (III), ytterbium (III), gado from the probe. Though achieving the same goal as pretreat linium (III), vanadium (II), terbium (III), dysprosium (III), ment, washing takes place after the exposure of probe to holmium (III) and/or erbium (III), with gadolinium being target. Typically, wash solutions comprise a buffer similar to particularly preferred. Ions useful in other contexts, such as that used in the target Solution, but lacking the target itself X-ray imaging, include but are not limited to lanthanum (III), Occasionally, it will be desirable to alter the chemical prop gold (III), lead (II), and especially bismuth(III). erties of the wash solution by, for example, changing the salt 0218 Radioactive isotopes include ''-carbon, chro concentration or pH. mium, '-chlorine, 'cobalt, and the like may be utilized. 0224. The system can also include a signal-amplification Among the fluorescent labels contemplated for use include chamber capable of recursively amplifying signals relating to Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY binding of targets to probe. There are a variety of mechanisms 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, for accomplishing this. However, a common feature will be BODIPY-TRX, Cascade Blue, Cy3, Cy5,6-FAM, Fluores the need for one or more chambers which effect the necessary cein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, steps to achieve the amplification. Oregon Green 500, Oregon Green 514, Pacific Blue, REG, 0225. The above disclosure generally describes the Rhodamine Green, Rhodamine Red, Renographin, ROX, present invention. A more complete understanding can be US 2013/O 189243 A1 Jul. 25, 2013 obtained by reference to the following specific examples, ruption or aid in the development of novel stroke therapeutics. which are provided for purposes of illustration only and are A secondary advantage of gene expression profiling is its not intended to limit the scope of the invention. ability to unveil the molecular pathways involved in brain recovery and health and elucidate complex genomic interac EXAMPLES tions that may play a role in outcome. 0226. The structures, materials, compositions, and meth 0232 Gene expression profiling has been utilized for the ods described herein are intended to be representative characterization of several neurological and immune disor examples of the invention, and it will be understood that the ders (5-7). In the case of cancertissue samples the method has scope of the invention is not limited by the scope of the facilitated the identification and refinement of tumor subtypes examples. Those skilled in the art will recognize that the (8), distinction between good-prognosis and poor-prognosis invention may be practiced with variations on the disclosed tumors (9) and the prediction of response to treatment (10). To structures, materials, compositions and methods, and Such date there are two reports of peripheral blood mononuclear variations are regarded as within the ambit of the invention. cells (PBMCs) (11, 12) and one of peripheral whole blood (13) examining the changes of gene expression in patients Example 1 following ischemic stroke. These studies provide a novel and Sophisticated approach to identifying candidates for stroke Identification of Blood Biomarkers for Acute diagnosis (14). However, the study designs are not compli Ischemic Stroke mentary; nor are the findings. Gene expression profiling of PBMCs captures a significantly smaller proportion of the 0227. Overview. differential gene expression following stroke compared to 0228. The objective of this study was to identify peripheral that which can be found in whole blood RNA (13). Thus, the blood biomarkers for the differential diagnosis of acute purpose of our study was to determine the gene expression ischemic cerebrovascular syndrome (AICS) through gene profile of peripheral whole blood following acute ischemic expression profiling. Peripheral whole blood samples were stroke in a larger cohort of stroke patients and control Sub collected from n=39 patients who were 18 years of age with jects, adjusting for common stroke risk factors in an attempt MRI diagnosed AICS and n=25 control subjects who were to replicate the findings of previous studies. This data can be Non-stroke neurologically healthy. Total RNA was extracted used to examine the diagnostic capability of the candidate from whole blood stabilized in Paxgene RNA tubes, ampli genes for ischemic stroke and to explore innate immune fied, and hybridized to Illumina human Ref-8V2 bead chips. responses to ischemic stroke. Gene expression was compared in a univariate manner between stroke patients and control Subjects using t-test in 0233 Methods. GeneSpring. The significant genes were tested in a logistic 0234. This was a prospective case-control gene expression regression model controlling for age, hypertension and dys profiling study of peripheral whole blood in ischemic stroke lipidemia. Inflation of type one error was corrected by Bon patients. Recruitment was conducted from June 2007 through ferroni and False Discovery Rate. Validation was performed September 2008. Stroke patients were recruited from an IRB by QRT-PCR using Taqman gene expression assays. A nine approved NINDS/NIH study at Suburban Hospital, Bethesda gene profile has been identified in the whole blood of AICS Md. after written informed consent was obtained when the patients using gene expression profiling. Five of these nine following inclusion criteria were met: age 18 years: MRI genes were identified in a previously published expression diagnosed definite Acute Ischemic Cerebrovascular Syn profiling study of stroke and are therefore likely candidates drome (AICS15); and research blood draw within 24 hours for AICS diagnosis. Pathway analysis revealed toll like recep from onset of symptoms. Patients with probable/possible tor (TLR) signaling as a highly significant canonical pathway AICS and hemorrhage (ruled out by MRI) were excluded present in the peripheral whole blood of AICS patients. This from this study. The time of stroke symptom onset was deter study replicates the findings of a previous expression profil mined as the time the patient was last known to be free of the ing study of ischemic stroke and therefore Supports the claim acute stroke symptoms. Patient evaluations and management that gene expression profiling of peripheral whole blood can were standardized. Thrombolytic therapy with tissue plasmi be used to identify biomarkers of AICS. nogen activator (rtPA) was given to patients with disabling 0229 Introduction. symptoms within 3 hours from presentation to the clinical 0230 Stroke is the third leading cause of death in the stroke team. Pre-morbid deficits were determined by the United States (1) and one of the most common causes of death Modified Rankin Scale (MRS) during the acute clinical and disability in industrialized countries (2). Despite signifi assessment for status prior to stroke and 30 days post-stroke cant advances in neuroimaging and acute clinical manage and severity of injury was determined by the National Insti ment that have resulted in greater numbers of patients Surviv tutes of Health Stroke Scale (NIHSS) at the time of blood ing the initial insult (3), the rate of false-positive diagnoses of draw after stroke. Peripheral whole blood samples were col ischemic stroke can be as high as 25% (4). The Small percent lected from stroke patients into Paxgene blood RNA tubes age of patients who actually receivertPA (3-5%) and the large (PreAnalytiX, Qiagen) within 24 hours from onset of stroke numbers of patients who leave the hospital with either a symptoms. Adult control Subjects were recruited under a diagnosis of transient ischemic attack (TIA) or stroke of separate NIA/NIH protocol during Support group sessions for undetermined cause reflects the need to identify additional patients with movement disorders if they were significant definitive means of stroke diagnosis. others of patients affected by movement disorders and they 0231. A novel approach to the study of ischemic stroke is were neurologically normal per neurologist assessment at the the use of gene expression profiling to discover biomarkers time of enrollment. Clinical demographic data was collected that improve acute stroke diagnosis and classification, iden from the stroke patient or significant other and all control tify secondary complications such as blood brain barrier dis Subjects by trained neurologists. US 2013/O 189243 A1 Jul. 25, 2013 22

0235 RNA Extraction and Amplification. 0243 Gene Expression Level Analysis. 0236 Peripheral whole blood samples were collected 0244 Data analysis for gene expression was conducted in from control Subjects and stroke patients into Paxgene blood Illumina BeadStudio Gene Expression Module and verified RNA tubes following consent. Paxgene RNA tubes were in GeneSpring. Genes with at least a 2 fold difference in inverted 8-10 times to ensure RBC lysis, and immediately expression were compared in a univariate manner between placed in a -80° C. freezer until RNA extraction. All frozen stroke patients and control Subjects through the use of Illu whole blood specimens were allowed to thaw at room tem mina’s custom model (modified t-test) in BeadStudio and perature for 24 hours on a rotating bed prior to RNA isolation t-test comparisons in GeneSpring. The influence of multiple procedures to ensure complete red blood cell lysis. RNA was testing was evaluated using the false discovery rate (FDR) extracted from whole blood stabilized in Paxgene tubes in one and the Bonferroni Family wise error (FWER). batch per manufacturer's protocol using the Paxgene Blood 0245 Logistic Regression for Identification of Off-Target RNA extraction Kit (PreAnalytiX. Qiagen). A recent study Effects. demonstrated that globin reduction does not increase the number of differentially expressed transcripts when hybrid 0246 To assess the specificity of the 9 gene profile for izing to HumanRef-8 V2 beadchips and therefore has little ischemic stroke diagnosis, all 9 genes were tested indepen impact on probe detection when using the Illumina platform dently in a logistic regression model controlling for age, (16). Therefore, globin reduction was not conducted on any hypertension and dyslipidemia. The normalized signal inten sample in this study. Biotinylated, amplified RNA was gen sities for each gene were entered into separate models with erated from the Illumina TotalPrep RNA amplification kit age and then hypertension and dyslipidemia as the covariates (Applied Biosystems). RNA quantity was determined by the of interest. A bonferroni corrected p of <0.005 (0.05/9) was Nanodrop and RNA quality was determined by A260/A280 considered to be statistically significant. ratio and the presence of two distinct ribosomal bands on gel 0247 Pathway Analysis. electrophoresis. 0248 Data were interpreted through the use of INGENU 0237 Array Hybridization. ITY(R) Systems Pathway analysis (IPA(R) 0238 RNA was hybridized to Illumina Human Ref-8 v2 (INGENUITY(RSystems, www.ingenuity.com). To increase expression bead chips. The Human Ref-8 V2 bead chips have the number of genes included in the analysis, genes with a 1.5 the capability to analyze >22,000 probes targeting genes and fold difference in expression between stroke patients and known alternative splice variants. Stroke patients and control control Subjects were chosen. The data set that contained gene subjects were randomly hybridized to each array for a total of identifiers and their corresponding expression signal intensi 8 arrays (8 samples per array). Beadarrays were scanned by ties was uploaded into the INGENUITY(R) systems program. the Illumina BeadStation 500x and raw intensity values were The gene list was compared one-by-one to the Canonical saved in Illumina’s Bead Studio program manager. Sample Pathways stored in the INGENUITYR) systems knowledge labeling, hybridization, and Scanning were conducted using base; pathways with significant p-values (p<0.05) were iden standard Illumina protocols. tified. The p-value measures how likely genes from the gene 0239 Statistical Analysis. list participate in the function described in the specific path 0240 Baseline descriptive statistics for the sample were way. The INGENUITYR) systems software queried the computed using SPSS (version 15, SPSS, Inc., Chicago, Ill.). INGENUITY(R) knowledge base and generated a set of net Descriptive and frequency analysis was conducted for all works with a network size of 35 genes/gene products. A score, demographic and clinical data. Baseline demographic and which was derived from a p-value, was generated for each clinical characteristics were compared between stroke network according to the fit of the set of significant genes. patients and control Subjects using chi-square analysis for the Scores of 2 or higher were considered to have at least a 99% following categorical variables: gender, race, presence of confidence of not being generated by chance alone. Biologi comorbidities (hypertension, diabetes and hyperlipidemia), cal functions were then calculated and assigned to each net and medication history. Student's t-test was used to analyze work. The significance of the association between the data set the difference between stroke patients and control subjects by and the canonical pathway was measured in two ways: 1) a age. The level of significance for these descriptive compari ratio of the number of significant genes that mapped to the sons was established at 0.05 for two-sided hypothesis testing. canonical pathway (the number of molecules in a given path 0241 Probe Level Analysis. way that meet the 1.5 fold cut off, divided by the total number 0242. After scanning the beadchip the raw probe expres of molecules that make up that pathway); and 2) A right tailed sion values were saved into Illumina BeadStudio Gene Fisher's exact test to calculate a p-value determining the Expression (GX) Module (version 1, IlluminaR, San Diego probability that the association between the genes in the Calif.) and GeneSpring GX v10 (Agilent technologies). dataset and the canonical pathway is not explained by chance Probes were filtered in GeneSpring based on signal intensity alone. resulting in a final probe set of 24,424 to be used in analysis. 0249 Polymerase Chain Reaction Validation. The probe level data were collated using robust multi-array 0250 cDNA was generated from total RNA per manufac analysis (RMA) normalization with data processing occur turer's protocol. (Invitrogen, SuperScript III first strand syn ring in the following order: 1) Background correction using thesis kit). Quantitative real-time polymerase chain reaction perfect match probe information only; 2) Quantile normal (QRT-PCR) using Taqman gene expression probes was used ization-probe level normalization; and 3) Summarization to validate the significant transcripts identified in this study expression measure Summary done in log base 2 scale and that overlapped with previous findings and one novel gene median was used to fit a linear model. Unsupervised cluster identified in this study. An endogenous control gene with a ing was performed without knowledge of class to determine constant expression level between stroke patients and control phylogenetic distances between samples to detect potential Subjects (Beta-actin) based on the microarray data was used outliers. to normalize the relative expression of chosen genes. When US 2013/O 189243 A1 Jul. 25, 2013 using Taqman gene expression assays the comparative CT bid neurological deficits. Severity of stroke was mild with a method for determining relative fold change correlates well median baseline National Institutes of Health Stroke Scale with expected fold change values (17). Therefore relative fold score (NIHSS) of 3 with a range from 0-23 and a hospital change differences between stroke patients and control Sub discharge NIHSS median of 0 with a range from 0-10. There jects were calculated using the delta CT method (18). Valida was no difference by race or gender between the stroke patient tion was determined positive if the relative fold change in and control Subject groups. However, stroke patients were expression was in the same direction as what was identified significantly older than control subjects (t=-4.03, p=0.000) with the microarray results, t-test analysis revealed signifi and stroke patients were more likely to have the presence of cance and there was a positive correlation between QRT-PCR comorbidities for which they were receiving medication. See and microarray results. Table 1, below. TABLE 1. Univariate associations between stroke patients and control Subiects Total Stroke Control Sample n = 39 (61.9%) n = 24 (38.1%) Statistic/df p value Gender 36 (57.1%) 22 (56.4%) 14 (58.3%) x 0.02/1 0.883 (% female) Mean age, 68.1 14.02 73.1 : 14 59.99.73 T 4.461 O.OOO years Hypertension 32 (50.8%) 25 (64.1%) 7 (29.2%) x 6.6/1 O.O10 Diabetes 13 (20.6%) 11 (28.2%) 2 (8.3%) x 3.3/1 O.O68 Dyslipiderma 18 (28.6%) 18 (46.2%) O x 14.9/1 0.000 Atrial 6 (9.5%) 6 (15.4%) O X3.9/1 O.048 Fibrillation Myocardial 6 (9.5%) 6 (15.4%) O x 3.9/1 O.048 Infarction Previous 8 (12.7%) 6 (15.4%) 2 (8.3%) x 0.7/1 0.414 Ischemic Stroke Previous or 30 (47.6%) 15 (38.5%) 15 (62.5%) x 7.8/2 O.O2O Current smoker Hypertension 37 (47.6%) 29 (74.4%) 8 (33.3%) x 10.3/1 0.001 Medication Diabetes 8 (12.7%) 7 (17.9%) 1 (4.2%) x 2.66/1 0.103 Medication Cholesterol 22 (34.9%) 17 (43.6%) 5 (20.8%) x 3.4/1 O.066 Medication Anticongulant 21 (33.3%) 20 (51.3%) 1 (4.2%) x 14.8/1 0.000 or antiplatelet Family history 19 (30.2%) 15 (38.5%) 4 (16.7%) x 3.6/1 O.169 of Stroke

0251 Results. (0255 Array Quality Control. 0256 Total RNA purified using the Paxgene system was 0252 Clinical Characteristics. highly pure, with A260/A280 values between 1.9 and 2.2 and 0253) A total of 92 subjects (67 stroke patients and 25 RNA yields >1-2 ug from 2.5 ml of peripheral whole blood. Hybridization controls were appropriate for low, medium and control subjects) were recruited to address the aims of the high. Negative control, background, and noise signals were study. Of the 67 stroke patients enrolled, 39 stroke patients low (<200) across all bead arrays and housekeeping and received a diagnosis of definite AICS 15 with an acute blood biotin signals were consistently high (>20,000). The average draw within 24 hours from onset of symptoms. Using the signal for internal controls across the arrays was similar. The TOAST (Trial of ORG 10172 in Acute Stroke Treatment) control plots were consistent with high quality data. subtype criterion 43.6% (n=17) of the causes were classified 0257 Nine Gene Profile for Stroke. as cardioembolic stroke; 28.2% (n=11) were of undetermined 0258 All analyses were conducted first in Illumina Bead cause; 12.8% (n=5) were large artery embolus/thrombosis Studio Gene Expression (GX) Module (version 1, IlluminaR), and the remaining 15.4% (n-6) were small vessel or other San Diego Calif.) and then in GeneSpring GX v10 (Agilent CalSC. technologies) to verify the findings. Unsupervised clustering of samples revealed two outliers in the dataset (one stroke 0254 The presence of comorbidity was prevalent in the patient and one control Subject). The outlying control Subject stroke patient group, with 64% having a history of hyperten was removed. It could not be determined if the patient sample sion, 28% with a history of diabetes, 15.4% with a history of was an outlier because of technical or biological variability prior stroke, and 38% with a smoking history (previous or and to keep credibility of the dataset, the patient outlier was current). The mean time from Symptom onset to acute blood kept in the analysis resulting in a final total of 39 stroke patients and 24 control subjects. BeadStudio identified 344 draw (baseline RNA profile) was 10:06 hours-E6:31. Nine genes with a 1.5 fold difference in expression with a Diff (23.1%) of the patients received rtPA, of which only one score >13 (corrected p-0.05) between stroke patients and patient had their blood drawn before rtfA administration. control subjects. There were 19 genes with a 2 fold difference Stroke patients had a median pre stroke Modified Rankin in expression with a Diff score >13 (corrected p-0.05). See Scale (MRS) score of Zero, implying the absence of premor Supplemental Table 1, below. US 2013/O 189243 A1 Jul. 25, 2013 24

SUPPLEMENTAL TABLE 1. 0260. After comparison between the findings of the two statistical programs, there were 9 genes significantly different Beadstudio 2 fold, p is 0.05 Gene List. 19 Genes between stroke patients and control subjects with at least a 2 fold difference in expression and corrected p-0.05 the same Gene DiffScore Regulation across the two statistical packages. See FIG. 1. ARG1 44.13 l 0261. It is important to note that five of these 9 genes were BNIP3L 25.68 l CA4 40.43 l also found to be significant in the first whole blood gene CCRT -71.37 down expression profiling study of stroke (ARG1; CA4; LY96; CEACAM6 16.8 l MMP9; S100A12) (13). See Table 2, below. CEACAM8 15.99 l CSPG2 53.25 l ECHDC3 17.85 l TABLE 2 FKBP5 15.1 l IQGAP1 70.95 l Comparison of Gene List to Previous Study KCTD12 14.99 l LY96 49.69 l Fold Fold MMP9 30.01 l Gene p value Change p value Change OLFM4 18.97 l ARG1 2.84E-07 3.2 S.O3E-04 3.8 ORM1 17.00 l CA4 2.OE-04 2.1 3.54E-OS 2.2 PDK4 102.71 l LY96 O.OO1 2.2 3.67E-03 2.1 S100A12 39.53 l MMP9 111E-05 2.6 3.54E-OS 3.2 SDPR. 41.33 l S100A12 3.87E-04 2.4 2.59E-04 2.2 TPST1 26.83 l *Diffscore: Using the Illumina CustomAlgorithma Diffscore is calculated from the p-value This Study of significance. DiffScore = (10sgn(Icond -Iref)log10(p)). For each gene, Diff scores of Tang et al 2006 corresponding probes are averaged and concordance between the probes is reported. For a p-value of 0.05, Diff score = +13 0262 Regression for Identification of Off-Target Effects. 0263. Given the significant difference between stroke 0259 Results were comparable in GeneSpring with 355 patients and control Subjects by age, a logistic regression was genes having a 1.5 fold difference in expression (corrected performed to determine if the 9 genes in the identified profile p-0.05) and 16 genes with 2 fold difference in expression were preferentially regulated by age. After controlling for the between stroke patients and control subjects (corrected p-0. effects of age and correcting for multiple testing (p=9/0.05), 05). See Supplemental Table 2, below. s100A12 fell out of the model (p=0.014). SeeTable 3, below. SUPPLEMENTAL TABLE 2 TABLE 3 GeneSpring 2 fold, p is 0.05 Gene List, 16 Genes Logistic Regression Controlling for Age Gene p-value Regulation Predictor Odds Ratio 95% CI for OR p value ACSL1 4.03e-04 l AKAP7 O.OO l ARG1 O.061 (0.012-0.312) O.OO1 APOBEC3A O.O3 l CA4 O.167 (0.058-0.482) O.OO1 ARG1 2.84E-O7 l CCRT 7.986 (2.229-28.61) O.OO1 CA4 2.OOE-04 l CSPG2 O.223 (0.086-0.628) O.OO)4 CCRT 4.37E-OS down IQGAP1 O.061 (0.011-0.339) O.OO1 CRISPLD2 4.74E-06 l LY96 O.361 (0.186-0.701) O.OO3 CSPG2 3.45E-OS l MMP9 O.131 (0.041-0.422) O.OO1 FCGR3B O.O24 l ORM1 O.O33 (0.156-0.704) O.OO)4 FOLR3 9.23E-04 l S100A12 0.444 (0.233-0.846) O.O14 IQGAP1 7.97E-07 l Note: LY96 O.OO l MMP9 111E-OS l p<0.005 statistically significant after Boniferonni correction ORM1 O.OO6 l PADI4 4.7OE-06 l 0264. An additional logistic regression analysis revealed S100A12 3.87E-04 l that ARG1 (p=0.002), CA4 (p=0.002), CCR7 (p=0.005), CSPG2 (p=0.003), IQGAP1 (p=0.003), and MMP9 (p=0. *Bonferroni Family wise error (FWER) corrected p-value Legend: 002) remained significantly associated with stroke diagnosis ACSL1 = acyl-CoA synthetase long-chain family member 1; after controlling for history of hypertension and dyslipi AKAP7 = A-kinase anchor protein 7: demia. APOBEC3A = apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A; ARG1 = Arginase 1: 0265 Pathway Analysis. CA4 = Carbonic anhydrase 4; 0266 There were 355 genes eligible for pathway analysis CCR7 = Chemokine receptor 7: (at least a 1.5 fold difference in expression between stroke CRISPLD2 = cysteine-rich secretory protein LCCL domain containing 2; patients and control subjects and corrected p-0.05). IPA CSPG2 = Chondroitin sulfate proteoglycan 2; FCGR3B = Fc fragment of IgG, low affinity IIIb, receptor (CD16b); revealed the five most significant canonical pathways present FOLR3 = folate receptor 3; in the peripheral whole blood RNA of stroke patients were IQGAP1 = IQ motif containing GTPase activating protein 1: CD28 signaling in T-helper cells (p=4.03E00), nuclear factor LY96 = Lymphocyte antigen 96; MMP9 = Matrix metalloproteinase 9; of activated T cells (NFAT) in regulation of the immune ORM1 = orosomucoid 1; response (p=4.03E00), dendritic cell maturation (p=3.4E00), PADI4 = peptidyl arginine deiminase, type IV: toll-like receptor (TLR) signaling (p=3.33E00), and calcium S100A12 = S100 calcium binding protein A12 induced T-lymphocyte apoptosis (p=2.92E00). Supplemental Data. However, there were more genes from our dataset dif US 2013/O 189243 A1 Jul. 25, 2013 ferentially expressed in the TLR signaling pathway between hours were also regulated at 5 and 24 hours with greater stroke patients and control Subjects than in any other identi numbers of genes expressed as time passed. These findings of fied pathway, (with a ratio >2 and p=3.33E00) implying the this study suggested the use of peripheral whole blood gene TLR pathway is the most significant for this dataset. See FIG. expression is the most useful for making early diagnosis of 2. ischemic stroke in humans. The third study examined the 0267 Taqman Gene Expression Assay Validation. changes of peripheral PBMC's in patients 24 hours following 0268 Taqman gene expression assays were used to con stroke, and identified one gene with measurable differences firm the beadarray results. QRT-PCR reactions were per between stroke patients and control Subjects, phosphodi formed using Taqman(R) gene expression probes (Applied esterase 4D (PDE4D), but no genes in common with the first Biosystems) for the genes ARG1, CCR7, LY96, and MMP9 two studies. (11) by the 7900HT QRT-PCR system based on availability of (0273. There were 156 genes (11%) with at least a 1.5 fold RNA. ARG1, LY96, and MMP9 was chosen because they change in expression coincident between the first two studies were also significant in the first gene expression profiling (14). However, when comparing the significant gene lists, study of stroke. CCR7 was the only down-regulated gene for only 2 genes were identified in both studies: N-acetylneu stroke found in our study. QRT-PCR validated significant raminate pyruvate lyase (NPL) and v-ets Erythroblastosis changes in mRNA levels in all 4 genes. It is important to note virus E26 oncogene homolog 2 (avian). Tang and colleagues that the first gene expression profiling study conducted by interpreted this lack of replication secondary to the fact that Tang et all was not able to validate microarray results by the majority of patients in the Moore etal study were treated limitations in the availability of RNA; for this same reason we with rtPA, the symptom onset time from blood draw (RNA could not validate the entire gene profile. profile assessment) was variable, and different cell popula 0269 Discussion tions were examined. Considering this, the group Suggested 0270. A rapid blood test to confirm the diagnosis of that the changes of peripheral blood gene expression identi ischemic stroke would transform stroke care in the US and fied in the first 3 hours after ischemic stroke symptom onset across the world. We found that 9 genes were differentially prior to rtPA administration would be the most useful for expressed with at least a 2 fold difference between stroke discovering biomarkers for early stroke diagnosis. Thus they patients and control Subjects. Although the major limitation reported 18 significant genes with differential expression of our study was a younger control group, post-hoc analyses controlling forage and other stroke risk factors Supported the between stroke patients and control subjects at 3 hours after primary analysis findings. In addition, the fact that 5 of the 9 ischemic stroke symptom onset. genes identified in this study were also found to be significant 0274. In this study, with regard to significant genes with at in the first whole blood gene expression profiling study of least a 2 fold difference in expression there was one gene ischemic stroke suggests that confounding factors as age, coincident with the Moore etal study (CSPG2) and 5 genes time after stroke and other factors probably did not radically overlapping with the Tang et al study (ARG1; CA4; LY96; affect our results and confirms the validity of this method for MMP9; S100A12). Nine patients (23%) in our study received the identification of diagnostic biomarkers in this population. rtPA, a similar proportion to that of Moore's study, and the 0271 Peripheral whole blood gene expression analysis in mean time from symptom onset to blood draw was 10:06 AICS patients identified 9 genes; 8 of which are up-regulated. hours; more than the 3 hours Suggested by Tang et al (13). It These are Arginase 1 (ARG1); carbonic anhydrase 4 (CA4); is remarkable that besides these differences 50% of the genes chondroitin sulfate proteoglycan 2 (CSPG2); IG motif-con identified by Tang etal have been replicated in our study. This taining GTPase activation protein 1 (IQGAP1); lymphocyte indicates first that the differences between the two first antigen 96 (LY96); matrix metalloproteinase 9 (MMP9); expression studies were due primarily to differences in cell orosomucoid 1 (ORM1) and s100 calcium binding protein populations under study; and second that expression in the A12 (S100A12) and one down-regulated, the chemokine genes found to be coincident with the Tang etal study are not receptor 7 (CCR7) gene (see FIGS. 4-12 and the Detailed reflecting changes secondary to administration of rtPA as Description for Accession numbers, nucleotide sequences previously considered, but rather are changes associated with and amino acid sequences for each marker). ischemic stroke. These findings suggesting a larger time win dow beyond 3 hours for the identification of biomarkers of Comparison to Previous Studies stroke diagnosis has tremendous clinical applications as the majority of stroke patients do not come to the hospital within 0272. The inconsistency between the first three peripheral 3 hours from onset of stroke symptoms. Previous proteomic blood gene expression profiling studies of AICS is most blood biomarker studies of stroke performing poorly beyond attributable to the different sources of RNA under study. The 3 hours from stroke symptom onset (19), reinforces gene first human study compared the gene expression levels in expression profiling as an alternative method of biomarker peripheral blood mononuclear cells (PBMC) between 20 identification for stroke diagnosis. ischemic stroke patients and 20 control Subjects. Using pre diction analysis for microarrays (PAM), the group identified 0275. The control subjects in this present study were a 22 gene panel that classified stroke in a validation cohort matched for race and there was no significant difference in with a sensitivity of 78% and a specificity of 80% (12) The gender between stroke patients and control Subjects. Subsequent study performed by Tang and colleagues exam Although the stroke patients in our study were older than the ined the gene expression profiles of whole blood in 15 stroke control Subjects, post-hoc analyses controlling for age and patients at 3 hours, 5 hours, and at 24 hours after ischemic other stroke risk factors (e.g. hypertension and dyslipidemia) stroke in comparison to 8 control subjects (13). The study Supported the primary analysis findings with the exception of revealed that the majority of the genes induced between 2 and S100A12. 24 hours following stroke symptoms were induced in neutro 0276. The results of this study and the previous studies, phils and monocytes. Nearly all of the genes regulated at 3 suggest that the relative expression of ARG1, CA4, LY96, US 2013/O 189243 A1 Jul. 25, 2013 26

MMP9, and S100A12 taken together have strongevidence for Chondroitin Sulfate Proteoglycan 2 (CSPG2) diagnostic capability in acute ischemic stroke. 0281 CSPG2, also known as versican, is a primary com 0277 Aside from the comparability of these findings to ponent of the extracellular matrix in the central nervous sys the previous gene expression profiling study, MMP9 and tem (CNS). CSPG2 is involved in cell adhesion, proliferation, various isoforms of S100 at the protein level have been impli migration and angiogenesis (31). Several experimental stud cated as biomarkers of ischemic stroke. One of our recent ies have demonstrated elevated expression of CSPGs in publications suggests baseline serum MMP9 may help to response to brain injury (32.33). Diminished versican expres predict the occurrence of blood brain barrier disruption fol sion in brain has been associated with deep cerebral white lowing ischemic stroke (20) and high levels of S100 serum matter injury in neonatal hypoxic-ischemic rat injury (34). protein have been associated with poor outcome following Furthermore, it has been reported that CSPG2 expression is stroke (21), implying they may be useful as prognostic mark dramatically increased within the infarct core following CS. ischemic stroke, resulting in increased cell death and reactive astrocytosis (35). In a rat model of myocardial infarction, Novel Candidates for Biomarkers of Stroke versican expression is upregulated in monocytes and mac 0278. In addition to the 5 genes identified by this study and rophages within the infarcted myocardium (36) To our the previous study by Tang et al., we have identified other knowledge, studies of CSPG2 expression in humans are novel candidates for stroke diagnosis: CCR7, CSPG2. absent with the exception of the first blood gene expression IQGAP1, and ORM1. profiling study of stroke (12), which identified CSPG2 as one of the significant genes that classified stroke with a specificity Chemokine Receptor 7 (CCR7) of 80%. Up-regulation of CSPG2 in our dataset is consistent with these findings. (0279 CCR7 is a member of the G-coupled chemokine receptor family. Inflammatory chemokines function mainly IQ Motif-Containing GTPase Activating Protein 1 (IQGAP1) as chemoattractants for leukocytes, recruiting monocytes, neutrophils and other effector cells from the blood to sites of 0282 IQGAP1 is an evolutionarily conserved molecule infection or tissue damage (22). That cytokines could be the that serves as a scaffold protein and plays a fundamental role driving force in the neuroinflammatory immune response in cell polarity. It modulates several cellular activities includ following stroke, is suggested as specific cytokines have ing cytoskeletal architecture, cell-cell adhesion, transcription shown to exacerbate brain damage (23) and pharmacological and signaling (ERK signaling) (37). Rho-family GTPases, chemokine receptor antagonists have been reported to reduce are a family of Small signaling G proteins that require infarct volume in mice (24, 25). In addition chemokines IQGAP1 to regulate actin cytoskeleton to produce a gradient directly affect blood brain barrier (BBB) permeability via of signaling molecules (38). Experimental evidence Suggests alterations in tight junction (TJ) proteins in an in vitro BBB that the expression of RhoA increases in aortic and basilar model (co-cultures of endothelial cells and astrocytes) (26). arteries with age (39), therefore RhoA, and indirectly Interestingly chemokines also play an important role in vas IQGAP1, may play a role in taltered vascular responses asso ciated with aging (39). Furthermore, studies in vitro have culogenesis by augmenting endothelial progenitor cell (EPC) Suggested that leukocyte transmigration and changes in recruitment in ischemic tissues (27, 28). endothelial permeability can be facilitated by RhoA (40). It 0280 Most of the knowledge on the involvement of CCR7 has been shown that down-regulation of Rho improves endot in the development of immunity and tolerance in stroke is helial barrier function (41), however long-term inactivation derived from mouse models, whereas the data on CCR7 func of Rho can lead to loss of intercellular junctions and an tion in humans is rather sparse. Increased levels of CCR7 have increase in endothelial permeability through disrupting VE been found in experimental stroke rat brain at 22 hours fol cadherin and cell-cell adhesion (42). The up-regulation of lowing injury, in contrast with a significant reduction of IQGAP1 expression in the context of ischemic stroke could CCRT mRNA in spinal cord, Suggesting a compensatory Suggest an increase in cellular signaling and transcription in response to intracranial events (29). In humans, an increase of CCR7+ T cells has been reported in peripheral blood leuko the acute phase of ischemic stroke leading to increased per cytes (PBL) of ischemic stroke patients with mild to moderate meability of the BBB. IOGAP1 may mediate the disruption of severity 1 week following stroke (30). In this study, down the BBB as a means by which signals from the brain enter the regulation of CCR7 was found in the peripheral blood in the periphery to augment cellular recruitment. acute phase of ischemic stroke. Differences in the direction of the regulation could be explained as differences in tissue/cell Oromucosid 1 (ORM1) specific immune response or different immune responses fol 0283 Finally, ORM1 also known as alpha-1 acid glyco lowing stroke progression. Another possibility is that our protein is an acute phase protein and increases 2-5 times findings are reflecting immune responses after stroke of mild during an acute phase response. ORM1 has been shown to severity, as most of our patients had mild stroke symptoms. Suppress lymphocyte response to lipopolysacchardies (LPS) One third possibility is the down regulation of CCR7 is a (thereby preventing ongoing tissue damage by neutrophil consequence of the increased age of our stroke patients, as proteases), decrease platelet aggregation (and thus further age-associated reductions in CCR7 expression has been platelet recruitment), and enhance cytokine secretion as pos reported in animal models (30). However, the logistic regres sibly part of a feedback mechanism (43). It exhibits anti sion performed correcting for age, suggests that CCR7 is inflammatory effects by inhibiting polymorphonuclear neu associated with Stroke independent of age. If the response of trophil activation and increasing the Secretion of IL-1 and is CCR7 is related to age, tissue, cell population, severity of therefore Suggested to play a significant role in immuno AICS or stage of AICS progression, further studies of CCR7 modulation of the acute phase response (44). The up-regula and stroke should address this issue. tion of ORM1 in the context of ischemic stroke suggests an US 2013/O 189243 A1 Jul. 25, 2013 27 acute phase response in ischemic stroke that is similar to present, although progress has been made, a better under trauma, infection and systemic tissue injury. standing of how these pathways react and respond to ischemic stroke may lead to the emergence of new avenues for thera Toll-Like Receptor Signaling peutic intervention. The TLR pathway is a promising and 0284 IPA analysis identified TLR signaling as the most worthy target to be considered and studied with more detail. significant canonical pathway present in the peripheral blood 0288 The results of this study provide insight into the of ischemic stroke patients in this dataset. The genes differ molecular mechanisms involved in cerebral ischemia. Nine entially expressed between stroke patients and control Sub genes were differently expressed with at least a 2 fold differ jects identified in the TLR pathway are TLR2, TLR1, FOS, ence between stroke patients and control Subjects. The study LY96, TLR8 (includes EG:51311), IF2AK2, and IRAK3. See replicates the findings of a previous gene expression study of FIG. 3. ischemic stroke (13). and therefore Supports the use of gene 0285. The TLR pathway is a necessary component of the expression profiling of peripheral whole blood to identify innate immune system. Recent evidence Suggests the TLR biomarkers of AICS. system as a key player in ischemic preconditioning and there fore may be a novel target for stroke therapeutics (45). Acti Example 2 Vation of the innate immune response, through TLRs, is a primary component of pro-inflammatory cytokine generation Gene Expression Profile for the Diagnosis of following ischemic brain injury (46). TLRS recognize patho Ischemic Stroke gen associated molecular patterns (PAMPs), a diverse set of stress and injury-induced molecules with highly conserved Specific Aims Introduction. structures, to initiate the innate immune response to infection. 0289 Stroke is the third leading cause of death in the Traditionally the PAMP/TLR activation pathway was prima United States (60) and accounts for 10% of deaths worldwide rily implicated in tolerance to endotoxins that alert an organ (61). Clinical diagnosis of ischemic stroke is often difficult, ism to intruding pathogens. However, it is becoming increas complicated by its multiple etiologies and variable clinical ingly clear that microbial invasion is not the only mechanism presentation. Most hospitals in the United States use CT to by which the TLR pathway becomes activated (47, 48). Prod initially evaluate patients suspected of having an acute stroke; ucts of protein degradation, damaged DNA, fibrinogen and however CT is less than optimal for identifying acute heat shock proteins have emerged as activators of the TLR ischemia (62). The only Food and Drug Administration pathway through a mechanism known as damage associated (FDA) approved treatment for ischemic stroke is recombinant molecular pattern (DAMPs) recognition (48). tissue plasminogen activator (rtPA), and rtPA is only 0286 Several studies have shown that the responsiveness approved for use when patients present to the hospital within of the adaptive immune system dramatically decreases with three hours after onset of symptoms. The downside is that the age (49) and a pro-inflammatory shift in gene expression median time from stroke symptom onset to presentation to the occurs with increasing age (50, 49). TLRs are upregulated in emergency department is 3-6 hours (63). (It is noted that this the aged mouse brain (51) and specifically, TLR4 is upregu Example 2 includes a separate listing of references to which lated in the cardiovascular system of aged rodents (50). How ever, the expression of TLR2 and TLR4 on neutrophils is not the text makes reference to). affected by age. (52) which has implications for this present 0290 Currently only 3-8% of stroke patients receivertPA study given the RNA profile under study was extracted from (64). The recent extension of the time window to up to about peripheral whole blood. On the other hand, TLR2 and TLR4 4.5 hours is likely to change this proportion only modestly. have been shown to play a significant role in ischemic brain Where possible, hospitals are moving toward using MRI for damage, regardless of age (53). Activation of the innate acute diagnosis of stroke; however this often requires a dedi immune response, through TLRs, is a primary component of cated stroke clinical team and is only possible in facilities inflammatory activation following ischemic brain injury, (46) with 24 hour MRI availability. Quick and definitive diagnosis and TLR4 activation has recently been implicated as a nega in the acute care setting is essential to separate stroke from tive effector of the innate immune response (54). Down regu non-stroke, distinguish hemorrhage fromischemia, and iden lation of TLR4 results in a decrease in final infarct volume and tify the potential cause of the infarction, but most importantly better outcome in a mouse middle cerebral artery occlusion to determine eligibility for thrombolytic therapy to begin (MCAO) model. TLR4 deficient mice are protected by treatment within the about 3 to 4.5 hour window of opportu ischemic injury through a down-regulation of inducible nitric nity. oxide synthase (iNOS) production (55,56). In addition, mice 0291 An additional diagnostic measure. Such as a sero who are TLR4 deficient also have better behavior following logic blood test or a screen of a panel of markers, would be MCAO that is preceded by significant psychological stress extremely beneficial in obtaining a definitive diagnosis of (57). Human studies have added to this theory of TLR medi acute stroke to help increase the utilization ofrtPA, especially ated negative outcome and have identified that increased acti in hospitals that are not stroke centers. vation of TLR4 following ischemic stroke corresponds to 0292. In Example 1, a nine gene panel of biomarkers was worse clinical outcome (58, 59). identified in the peripheral whole blood of ischemic stroke 0287 Strong evidence Suggests that stroke and aging are patients which can be used for acute diagnosis of ischemic associated with an increase in inflammatory mediators; how stroke (65). The nine genes identified in Example 1 and dis ever, the relationship between stroke and aging on innate cussed elsewhere in this application predicted stroke with an immunity, toll like receptor signaling and inflammatory gene accuracy of 95%; which is higher than the diagnostic capa expression warrants further investigation. The predominance bility of either MRI (85%) or CT (54%) (62). of these innate and inflammatory immune pathways in our 0293. An additional experimental goal is to validate these study reinforces their importance in ischemic stroke. At findings in a larger age matched cohort of stroke patients, US 2013/O 189243 A1 Jul. 25, 2013 28 disease control Subjects and stroke-free control Subjects to and hemorrhage, be available in small centers without the further ensure the differential diagnostic capability of the need for interpretation outside of the facility, and easily panel. accessible. 0294. This Example outlines a project to validate gene 0305 Study: expression profiles for the acute diagnosis of ischemic stroke, 0306 This Example outlines a validation study to deter which will lead to improved assessment and treatment of mine a gene expression profile that can be used in the acute patients who experience astroke. Gene expression profiling is care setting for ischemic stroke diagnosis. Example 1 identi an effective approach to identify genes and pathways that fied nine genes that were differentially expressed with at least predict a phenotype and clinical outcome. a 2 fold difference between stroke patients and control sub 0295 The inventors have determined that expression pro jects. To further validate the results of Example 1, this filing of peripheral whole blood could be used to differentiate Example proposes to recruit age-matched stroke-free con stroke from stroke mimic, as well as to predict the clinical trols and a separate group of neurologic disease and inflam trajectory following a neurologic insult. matory stress disease controls to determine the differential 0296. The Specific Aims of this Example: diagnostic capability of the nine gene panel of the invention 0297 Specific Aim 1 To validate and replicate a gene (markers identified as Arginase 1 (ARG1); carbonic anhy expression profile for the diagnosis of ischemic stroke in a drase 4 (CA4); chondroitin sulfate proteoglycan 2 (CSPG2); larger cohort of ischemic stroke patients, using neurologic IG motif-containing GTPase activation protein 1 (IQGAP1); disease control patients. The neurologic disease groups lymphocyte antigen 96 (LY96); matrix metalloproteinase 9 include: 1) patients with CT or MRI confirmed acute (MMP9); orosomucoid 1 (ORM1) and s100 calcium binding ischemic stroke (IS) of all severities (n=75); 2) acute (<24 protein A12 (S100A12) and one down-regulated, the chemok hrs) transient ischemic attack (TIA) patients (n=75); and 3) ine receptor 7 (CCR7) gene). intracerebral hemorrhage (ICH) patients (n=50). 0298 Specific Aim 2 To determine if the gene profile is (0307 Filament Based Point of Care (POC) Test: specific for ischemic stroke by comparing the gene profile in 0308 Dr. Haselton and his group at Vanderbilt University neurologic disease patients (IA, TIA and ICH) with patients have developed a filament-based point of care (POC) test for following acute inflammatory/ischemic stress (myocardial bedside diagnosis of infectious diseases (See U.S. Patent infarction (MI) or age matched normal controls. Application No. 20060121481, which is incorporated herein 0299 Specific Aim 3 To develop a filament based point by reference; also see Stone et al., Ann Biomed Eng., 2006 of care (POC) test that can be used at the bedside for differ November; 34(70): 1778-85; Stone et al., J Biomed Opt., ential diagnosis of ischemic stroke, which will be based on 2006, May-June; 11 (62):34012; and Stone et al., Biotechnol. gene expression profiles validated in Specific Aims 1 and Bioeng..., 2005, Sept. 20; 91 (65):699-706, each of which are 2. incorporated herein by reference). 0300. A secondary aim of this study is to identify the 0309 The technology uses DNA beacons on a gold wire to peripheral blood gene expression profile associated with detect RNA in a small biological solution (73). In the proto clinical outcomes at 30 and 90 days in order to determine type design, extraction is performed as illustrated in FIG. 13. whether the identified gene activity can be used to predict Silica-coated magnetic particles are mixed with a patient recovery from ischemic stroke. sample and pulled through processing solutions in the device by an external magnet. Nucleic acid, in this case RNA, is Background and Significance. freed from the particle surface in elution buffer. At this point, capture beacons on a gold wire are exposed to the isolated 0301 Gene Expression Profiling in Neurological Disease: RNA. As the wire is pulled upwards through the device by a 0302) A novel approach to the study of ischemic stroke is Small machine, the gold wire passes through further process the use of gene expression profiling to discover biomarkers ing chambers. The molecular beacons are then positioned that improve acute stroke diagnosis, identify secondary com within the top reporting chamber. It is contemplated that this plications or aid in the development of novel stroke therapeu platform could be used in an over-the-counter capacity. As tics. Gene expression profiling has the potential to identify part of this study, a prototype of the POC will be developed biomarkers for many acute neurological diseases, as well as and evaluated for the gene profile of the nine biomarkers (or stratifying risk for patients with common asymptomatic neu a subset of same) identified and validated in this study. This rological diseases, such as asymptomatic aneurysm and prototype will then be tested in the field for acute stroke carotid Stenosis. A stratification of risk based on a blood gene definitive diagnosis in a multi-site clinical trial. profile would aid in the decision to treat or not to treat, dramatically improving current treatments. Research Design and Methods. 0303 Blood Biomarkers for Stroke Diagnosis: 0304. There has been a substantial attempt to identify 0310 Research Design: blood biomarkers for ischemic stroke in the past; however the 0311. A matched case-control, repeated measures design task has proven difficult and has not provided Successful is proposed to validate the nine gene profile of the invention in results. Many potential blood markers of ischemia and its capacity to detect ischemic stroke in patients as compared inflammation are also found in other conditions that may to neurologic disease control patients, acute inflammatory/ mimic stroke, which complicates the ability to identify a ischemic stress control patients and stroke-free age-matched specific biomarker of stroke. A recent meta-analysis of pub control subjects. The diagnostic capability of the panel will be lished blood biomarker studies for stroke revealed significant tested to ensure that the profile withstands differential diag methodological and design weaknesses in the studies includ nosis of TIA and other neurologic diseases that can mimic ing Small sample size, poor references, and poor choice of stroke in the acute care setting. This study will be crucial in control subjects and lack of validation. An ideal biomarker identifying the utility of an RNA based POC test for differ panel should distinguish ischemic stroke from stroke mimic ential diagnostics of neurological disease. US 2013/O 189243 A1 Jul. 25, 2013 29

0312 Subjects: tative measure of neurologic deficit. It assesses level of con 0313 Male and female subjects will be recruited from sciousness, gaze, visual fields, facial weakness, motor perfor Mayo Clinic, Jacksonville Fla.. if they are over age 18 years, mance of the extremities, sensory deficit, coordination present to the emergency room within 24 hours from onset of (ataxia), language (aphasia), speech (dysarthria), and hemi symptoms and: inattention (neglect). For all parameters, a value of 0 is nor 0314 Ischemic Stroke (IS): Symptoms of acute onset of mal; so, the higher the score, the worse the neurological neurologic dysfunction of any severity consistent with deficit (the highest possible score is 42). The NIHSS will be focal brain ischemia and imaging (MRI or CT) or labo performed during the baseline assessment and at Subsequent ratory confirmation of an acute vascular ischemic evaluations (24 hours and day 30). pathology (74). 0330 Functional outcome will be determined using the 0315 Transient Ischemic Attack (TIA): Symptoms of Modified Rankin Scale (MRS) at 30 days post onset of symp acute onset of neurologic dysfunction of any severity, toms in all patients. The MRS (78) measures degree of dis that is transient and caused by focal brain, spinal cord, or ability following stroke on a 0-6 scale, from no symptoms to retinal ischemia, without acute infarction (75). death. 0316 Acute myocardial infarction (AMI): Symptoms 0331. The Barthel Index (BI) (79) is a test of independence associated with ST segment elevation MI (STEMI). and scores the ability of a patient to care for himself and will ECG elevation of ST-segments by >0.1 mV in contigu be determined at 30 days. The values assigned to each item ous leads in patients with ischemic symptoms. Increased are based on time and amount of physical assistance required. cardiac biomarkers (>99th percentile of the upper refer A patient scoring 100 BI is continent, feeds himself, dresses ence limit for cardiac troponin 1 (TnI), cutoff 0.04 ug/L). himself, gets up out of bed and chairs, bathes himself, walks 0317 Intracerebral hemorrhage (ICH): Have symptoms at least one block, and can ascend and descend stairs. The suggestive of intracerebral hemorrhage (ICH) with a total score however, is not as significant or meaningful as the diagnostic CT scan breakdown into individual items, since these indicate where 0318 Stroke-free age-matched control subjects: No deficiencies are. major CNS disease or history of acute ischemic stroke or 0332 The Extended Glasgow Outcome Scale Score TIA. They answer positively to any item on the Ques (EGOS) is an 8 level scale ranging from Death to Upper Good tionnaire for Verifying Stroke-Free Status (QVSS) (17). Recovery and will be used to determine functional outcome at The sedimentation rate is >19 mm for men or >22 mm 30 days (80). for women (77). 0333. The Seattle Angina Questionnaire (SAQ) is a reli 0319 Exclusion Criteria: able instrument that measure five clinically important dimen 0320 Diagnosis of pre-existing condition, including a sions of health and will be used to address health-related chronic inflammatory disorder, such as celiac disease, vascu quality of life outcomes in AMI patients at 30 days post onset litis, lupus, chronic obstructive pulmonary disease, irritable of symptoms (81). bowel disease, arthritis, and psoriasis or pregnancy. 0334 Covariates: 0321) Study Material and Methods: 0335 Potential covariates include severity of injury (de 0322 IS, TIA, ICH and AMI patients will be assessed as termined by the NIHSS and clinical assessment), history of soon as possible following presentation to the ED (day 0), and comorbidities (e.g. presence of hypertension), and medica at 24 hours after admission. Long term follow-up evaluations tion history. A detailed history will be obtained from the will be performed at 30 days following onset of symptoms for patient and/or patient representative during the acute clinical the 4 patient groups. work up. A modified k-prototypes algorithm for clustering 0323 Stroke-free age-matched control subjects will biological samples based on simultaneously considering undergo an evaluation at baseline and will not be followed gene expression data and classes of known phenotypic vari over time. ables will be used during statistical analysis to attempt to 0324 Collection of Venous Blood Samples: control for these covariates (82). 0325 Peripheral blood samples will be collected on all 0336 Power Analysis: patients and controls at each evaluation. Samples to be col 0337 Sample size calculations have been conducted using lected include: 5 ml blood in Paxgene blood tubes (for RNA), PASS: Power Analysis and Sample Size System and JMP 8 ml blood in ACD tubes (DNA); and 8 ml blood in EDTA Software. A 2.0 fold change is generally expected in genes of tubes (WBC). All samples will be processed appropriately significance; however a smaller fold change of 1.5 may be and frozen at -80 until analysis. used to identify genes not that differentially expressed 0326 Human Ref-8 v2 Expression Bead Chips: between similar groups. 0327 RNA will be extracted from venous whole blood 0338 For Specific Aim 1 and Aim 2 group sample sizes of samples according to Paxgene blood RNA protocol. Illumina 50 achieve 95% power for each gene to detect a true differ human Ref-8 V2 expression bead chips will be used for the ence in expression of at least 1.5 with estimated group stan study and have the capability to analyze 18,631 unique dard deviations of 1.5 and 1.5 and with a false discovery rate curated genes at once. The multi-sample format allows for up (FDR) of 0.0500 using a two-sided two-sample T-Test. For a to eight samples to be arrayed in parallel, increasing through single test, the individual test alpha is 0.0002092. The prob put and decreasing experimental variability. Sample labeling, ability of detecting 100 genes with true mean difference in hybridization, and Scanning will be conducted using standard expression >1.5, is 0.00668. Since patients will be matched to Illumina protocols. QRT-PCR will be used to validate controls by age over-recruitment of patients will be con microarray data. ducted to ensure appropriate power to address Specific Aims 0328 Clinical Severity and Outcome Measures: 1, 2 and 3. 0329. The National Institutes of Health Stroke Scale Score 0339. Therefore a total N of 325 will be recruited. N=75 (NIHSS) is a 15-item assessment tool that provides a quanti Acute Ischemic Stroke; N=75 Transient Ischemic Attack; US 2013/O 189243 A1 Jul. 25, 2013 30

N=50 Myocardial Infarction; N=75 Stroke-free Volunteers: (0349 Thermal Specificity Studies of MB on Gold. and N=50 Intracerebral hemorrhage. 0350 A patient extract sample may result in high non (0340 Development of POC Device: specific MB opening and therefore loss of specificity which 0341 The POC design includes nucleic acid isolation, could negatively impact the limit of detection. The tempera target binding, and result reporting. Silica-coated magnetic ture control features of a real time PCR machine will be used particles are mixed with a patient sample and injected through to study molecular beacon fluorescence response to patient the wall of Tygon tubing. In the prototype design the Tygon sample extracts as a function of temperature to establish the tubing has been pre-loaded with 100 ul of each of the pro importance of controlling the temperature for maximum sig cessing buffers arranged along the length of tubing held in nal for obtaining reproducible results; and secondly, identify place by Surface tension forces. Magnetic beads are entrained the optimum temperature for differentiating between targets by an external magnet and pulled through each of the pro which exactly match the beacon loop sequence and all other cessing solutions. When the beads reach the liquid-air inter bound species. face they pass through without entraining the Solution. Entry 0351) Data Analysis. into the next solution proceeds similarly until the entire cloud 0352. Descriptive Statistics: of particles has passed through all of the process steps (about 0353 Baseline descriptive statistics for the sample will be 2 minutes). The final elution buffer removes the RNA from computed using SPSS (version 15, SPSS, Inc., Chicago, Ill.). the bead Surface and will be used in downstream processing to Baseline demographic and clinical characteristics will be detect markers of interest. compared between IS patients of differing severity and IS and 0342 Candidate MB structures will be evaluated using synthetic targets using methods reported in our recent Analyst control Subjects using chi-square analysis for the following publication (83). The experimental studies of Aim 3 will be categorical variables: gender, race, presence of comorbidities performed using real-time PCR and modifications of a single (HTN, DM, etc.), and medication history. The level of sig MB design coupled to the surface of gold nanoparticles. Per nificance for these descriptive comparisons will be estab formance as measured by fluorescence of candidate lished at 0.05 for two-sided hypothesis testing. Hierarchical MB/nanoparticle construct will be compared to a matched linear modeling will be used to compare the trajectory of the control beacon using increasing concentrations of synthetic gene expression response across time after injury by severity target alone and in the presence of a non-specific control of IS. target and by adding known concentrations of the synthetic 0354) Differential Expression Analysis: target to patient samples before and after the performance of 0355. After scanning the beadchip the raw probe expres a RNA extraction. Our goal is to identify those features of the sion values will be saved into Illumina BeadStudio Gene molecular beacon structure and its interaction with the gold Expression (GX) Module (version 1, IlluminaR), San Diego Surface that are the most robustin the presence of any residual Calif.). Specific Aim One: Data analysis for gene expression patient sample constituents contained in solution with will be conducted in GeneSpring GX v10 (Agilent technolo extracted RNA. gies) and RC) (GNU). Genes with at least a 2 fold difference 0343 Optimization of the Stem and Loop Structures of the in expression will be compared in a univariate manner Molecular Beacon (“MB’): between stroke patients and neurologic disease control 0344 One molecular beacon contemplated by the inven patients through the use of ANOVA in GeneSpring. Specific tion is presented in FIG. 14. One additional aim of this Aim Two: Genes with at leasta 2 fold difference in expression Example is focus on improving both the capture and reporting will be compared in a univariate manner between stroke functions of MB in the likely patient sample matrix by modi patients, acute inflammatory/ischemic stress control patients fying stem and loop region lengths (84). and stroke-free age-matched control Subjects through the use (0345 Hydrolytic Amplification: of the ANOVA in GeneSpring. For Aims 1 and 2, the uncor 0346. To increase the limit of detection, a mixture of MB rected probability values will be assigned a cutoff threshold will be coupled to the gold surface with loop structures value of significance of <0.05. Inflation of type one error from complementary to sequences unique to the DNA. To quantify multiple hypothesis testing will be corrected by the Bonfer hydrolysis, the extracted samples will be run on an Agilent roni Family wise error (FWER) and a false detection rate of 2100 Bioanalyzer and the resulting electropherograms will be <0.05 after correction will be considered statistically signifi examined. The signal produced by homogenous MB on a Cant gold Surface will be compared to the signal produced by 0356 Logistic Regression for Identification of Off-Target heterogeneous MB coupling on a gold Surface, with and with Effects: out hydrolysis. 0357 To assess the specificity of the identified gene profile 0347 Amplification of Fluorescence Signal Using Multi for ischemic stroke diagnosis, the profile will be tested inde valent QDs: pendently in a logistic regression model controlling for 0348. To achieve the necessary level of detection, the hypertension and dyslipidemia. The normalized signal inten incorporation of amplification features into the device design sities for each gene will be entered into separate models with will be examined. The fluorescence signal associated with age and then hypertension and dyslipidemia as the covariates MB opening is increased by assembling large fluorescent of interest. A bonferroni corrected p of <0.005 will be con structures through alternating exposure of the capture region sidered to be statistically significant. of the gold containing these MB to multivalent streptavidin 0358 Pathway Analysis: quantum dots and then multivalent biotin quantum dots. The 0359 Data will be interpreted through the use of INGE upper limit of fluorescence signal will be determined by an NUITY(R) Systems Pathway analysis (IPA) (INGENUITYR alternating quantum dot coupling method by plotting the Systems, www.ingenuity.com). Genes with a 1.5 fold differ average fluorescence as a function of the number of amplifi ence in expression between stroke patients and control Sub cation steps. jects will be identified. The data set that contains gene iden US 2013/O 189243 A1 Jul. 25, 2013

tifiers and their corresponding expression signal intensities Result B. Analysis of stroke overtime data verified the change will be uploaded into the INGENUITY(R) systems program. in the TLR pathway and the identification of the CTLA path 0360 Secondary Aim: way. INGENUITYR pathway analysis validated the follow 0361. The change in the gene expression profile over time ing cononical pathways as likely to involve the 9-gene biom (baseline to 24 hours) will be analyzed in comparison to arker panel of the invention: MRS. The profile obtained in stroke patients from the base 0370 Gene expression over time: genes 2 fold and p-0. line time point in aim one will be assessed at 24 hours and the 05 different between baseline and follow up: IL8, LY96, change in the profile will be explained as change in the regu SDPR lation of the gene set from baseline to 24 hours. MRS at 30 0371 Ingenuity pathway analysis data: days will be divided into a binary variable as good outcome 0372 Ephrin receptor signaling 8.5E-04: 14/198 (MRS 0-1) and bad outcome (MRS3-6). Genes with at least (0.071) a 2 fold change in expression over time will be compared in a 0373 Dopamine receptor signaling 1.95E-03; 8/93 univariate manner between stroke patients with good or bad (0.086) outcomes through the use oft-tests in GeneSpring. 0374 CTLA4 signaling in cytotoxic T lymphocytes 0362 Relevance and Innovation: 2.44E-03: 9/100 (0.09) 0363 This project has the capability to identify biomark 0375 P70S6K signaling 1.39E-02; 9/133 (0.068) ers associated with response to ischemic stroke (IS) and elu 0376 Regulation of actin-based motility by Rho cidate complex genomic interactions that may play a role in 1.59E-02; 7/92 (0.076) outcome following IS. This study is innovative in that we are The pathways identified above, including in particular, the proposing one of the first bedside RNA diagnostic tools for CTLA4 pathway, Suggest that the cell-mediated immune neurologic disease. Interdisciplinary collaborations across response is involved in responding to acute ischemic stroke at multiple sectors, such as that proposed in this project, are a later stage. required to push bench concepts of RNA based diagnostics to 0377 The use of INGENUITYR's IPA software is well patients at the bedside. known in the art. Reference can be made, for example, to the following publications which cite to the use of IPA software: Example 3 0378 “Mining knowledge and data to discover intelligent Validation of 9-Gene Biomarker Panel by Further molecular biomarkers: Prostate canceri-Biomarkers.’ Soft Bioinformatic and Biostatistical Analysis Using Computing Applications (SOFA), 2010 4th International INGENUITY(R) Systems, Inc.’s IPAR Software Workshop on. Pages: 113-118. 15-17 Jul. 2010. Floares, Package A.; Balacescu, O.; Floares, C.; Balacescu, L.; Popa, T.; Vermesan, O.; Dept. of Artificial Intell. SAIA & OncoPre 0364 The data of Example 1 was further analyzed using dict, Cluj-Napoca, Romania.; INGENUITY(R) Systems, Inc.’s IPAR) software package to 0379) “Exploration of a genomic expression and pathway determine the most relevant biological pathways likely to analysis approach to neurocognitive performance: prelimi involve the group of biomarkers of the invention, namely, nary findings.” Neurobehavioral HIV Medicine. July 2010, chemokine receptor 7 (CCR7); chondroitin sulfate proteogly Volume 2010:2 Pages 23-32. Chad A Bousman, Gursharan can 2 (CSPG2); IQ motif-containing GTPase activation pro Chana, Stephen J Glatt, Sharon D Chandler, Todd May, tein 1 (IQGAP1); orosomucoid 1 (ORM1); arginase 1 James Lohr, Ian P Everall, William S. Kremen, Ming T (ARG1); lymphocyte antigen 96 (LY96); matrix metallopro TSuang; teinase 9 (MMP9); carbonic anhydrase 4 (CA4); and s100 0380 "Comparison of the performance of two affinity calcium binding protein A12 (S100A12), wherein at least one depletion spin filters for quantitative proteomics of CSF: of the biomarkers is chemokine receptor 7 (CCR7); chon Evaluation of sensitivity and reproducibility of CSF analy droitin sulfate proteoglycan 2 (CSPG2); IQ motif-containing sis using GeLC-MS/MS and spectral counting.” PRO GTPase activation protein 1 (IQGAP1); or orosomucoid 1 TEOMICS Clinical Applications. Volume 4, Issue 6-7, (ORM1). pages 613-617. July 2010. Silvina A. Fratantoni, Sander R. Result A. Analysis of stroke versus control data validated the Piersma, Connie R. Jimenez: 9 gene panel of the invention. INGENUITY(R) pathway analy 0381 “Transcriptome profiling and network analysis of sis identified the following cononical pathways as most likely genetically hypertensive mice identifies potential pharma to involve the 9-gene biomarker panel of the invention: cological targets of hypertension.” Physiol Genomics. 0365 PI3K signaling in B lymphocytes; p=4.72E-05; 2010 Jun. 29. Epub ahead of print Puig O. Wang I M. 11/147 (0.075) Cheng P. Zhou P. Roy S. Cully D, Peters MA, Benita Y. 0366 Role of macrophages, fibroblasts and endothelial Thompson J. Cai T Q; cells in rheumatoid arthritis; p=1.57E-04: 17/359 0382 “Osteosarcoma is characterised by reduced expres (0.047) sion of markers of osteoclastogenesis and antigen presen 0367 Altered T cell and B cell signaling in rheumatoid tation compared with normal bone.” Br J. Cancer. 2010 arthritis; p=1.9E-4; 8/91 (0.088) Jun. 29; 103(1):73-81. Epub 2010 Jun. 15. Endo-Munoz L, 0368 Toll-like receptor signaling; p=2.6E-04; 6/54 Cumming A. Sommerville S. Dickinson I, Saunders NA; (0.111) and 0369 Primary immunodeficiency signaling; p=4.5-04; 0383 “P-225 Specific gene expression in human cumulus 6/63 (0.095) cells according to oocyte nuclear maturation stages under The pathways identified above, including in particular, the in vivo maturation: clinical applications. Human Repro TLR pathway, Suggest that the innate immunity response are duction. 2010 25(Supplement 1): 1170-i210. G. Ouanda involved in responding to acute ischemic stroke at an early ogo, S. Assou, D. Haouzi, A. Ferrieres, T. Anahory, J. De Stage. Vos and S. Hamamah; and US 2013/O 189243 A1 Jul. 25, 2013 32

0384 “Transcript abundance patterns in Kawasakidisease 0396 11. Grond-Ginsbach C, Hummel M, Wiest T. Horst patients with intravenous immunoglobulin resistance.” mann S. Pfleger K, Hergenhahn M. Holstein M, Mans Hum Immunol. 2010 Jun. 20. Fury W. Tremoulet A H, mann U. Grau A. J. Wagner S. Gene expression in human Watson V. E. Best BA, Shimizu C, Hamilton J, Kanegaye peripheral blood mononuclear cells upon acute ischemic JT, WeiY, Kao C, Mellis S, Lin C, Burns JC; each of which stroke. J. Neurol. 2008: 255:723-731 are incorporated herein by reference. 0397 12. Moore DF, Li H, Jeffries N. Wright V, Cooper R A, Jr., Elkahloun A, Gelderman MP, Zudaire E. Blevins G, REFERENCES Yu H. Goldin E, Baird A. E. Using peripheral blood mono 0385. The following references are incorporated herein by nuclear cells to determine a gene expression profile of reference and may be cited to as further background Support acute ischemic stroke: A pilot investigation. Circulation. of this specification. 2005; 111:212-221 0386 1. Thom T. Haase N, Rosamond W. Howard VJ, 0398 13.TangY,Xu H, Du X, Lit L. Walker W. LuA, Ran Rumsfeld J. Manolio T. Zheng ZJ. Flegal K. O'Donnell C, R. Gregg JP, Reilly M. Pancioli A, Khoury J C, Sauerbeck Kittner S. Lloyd-Jones D, Goff DC, Jr., Hong Y. Adams R. L. R. Carrozzella JA, Spilker J. Clark J. Wagner KR, Jauch Friday G, Furie K. Gorelick P. Kissela B. Marler J. Meigs EC, Chang DJ, Verro P. Broderick J P Sharp F R. Gene J. Roger V. Sidney S, Sorlie P. Steinberger J. Wasserthiel expression in blood changes rapidly in neutrophils and Smoller S, Wilson M, Wolf P. Heart disease and stroke monocytes after ischemic stroke in humans: A microarray statistics 2006 update: A report from the american heart study. J Cereb Blood Flow Metab. 2006:26:1089-1102 association statistics committee and stroke statistics Sub 0399. 14. Sharp F R, Xu H, Lit L. Walker W, Pinter J, committee. Circulation. 2006: 113:e85-151 Apperson M, Verro P. Genomic profiles of stroke in blood. (0387 2. McKay J, Mensah GA, ebrary Inc. The atlas of Stroke. 2007:38:691-693 heart disease and stroke. Geneva: World Health Organiza 0400 15. Kidwell CS, Warach S. Acute ischemic cere tion; 2005. brovascular syndrome: Diagnostic criteria. Stroke. 2003; 0388. 3. Kim D. Liebeskind D S. Neuroimaging advances 34:2995-2998 and the transformation of acute stroke care. Semin Neurol. 0401 16. D., NC. Expression profiling of whole blood 2005; 25:345-361 specimens on illumina beadchips. Expression analysis tech 0389 4. HemmenTM, Meyer B C, McClean T L. Lyden note: www.Expressionanalysis.Com. October 2007 PD. Identification of nonischemic stroke mimics among 04.02 17. Amplification efficiency of taqman gene expres 411 code strokes at the University of California, San Diego, Sion assays, www3. Appliedbiosystems.Com, stroke center. J Stroke Cerebrovasc Dis. 2008; 17:23-25 stockii 127ap05-03 0390 5. Tajouri L, Fernandez F, Griffiths L. R. Gene 0403. 18. Livak K.J. Schmittgen TD. Analysis of relative expression studies in multiple Sclerosis. Curr Genomics. gene expression data using real-time quantitative per and 2007; 8:181-189 the 20-delta deltac(t)) method. Methods. 2001:25:402-408 0391 6. Scherzer C R. Eklund A. C. Morse L J, Liao Z, 0404 19. Laskowitz, DT, Kasner SE, Saver J, Remmel K Locascio J.J. Fefer D, Schwarzschild MA, Schlossmacher S, Jauch E. C. Clinical usefulness of a biomarkerbased MG, Hauser MA, Vance JM, Sudarsky L. R. Standaert D diagnostic test for acute stroke: The biomarker rapid G, Growdon J H, Jensen R. V. Gullans S R. Molecular assessment in ischemic injury (brain) study. Stroke. 2009: markers of early parkinson's disease based on gene expres 40:77-85 sion in blood. Proc Natl AcadSci USA. 2007: 104:955-960 0405. 20. Barr T L. Latour L. L. Lee KY. Schaewe T J, 0392 7. Maes O C, Xu S, Yu B, Chertkow HM, Wang E, Luby M. Chang G. S. El-Zammar Z, Alam S. Hallenbeck J Schipper H M. Transcriptional profiling of alzheimer M. Kidwell CS, Warach S. Blood-brain barrier disruption blood mononuclear cells by microarray. Neurobiol Aging. in humans is independently associated with increased 2007; 28:1795-1809 matrix metalloproteinase-9. Stroke. 2009 0393 8. Bittner M, Meltzer P. Chen Y, Jiang Y, Seftor E, 0406. 21. Brea D. Sobrino T. Blanco M. Cristobo I, Rod Hendrix M, Radmacher M, Simon R, Yakhini Z, Ben-Dor riguez-Gonzalez R. Rodriguez-Yanez M, Moldes O, A, Sampas N. Dougherty E. Wang E. Marincola F. Gooden Agulla J, Leira R, Castillo J. Temporal profile and clinical C. Lueders J. Glatfelter A. Pollock P. Carpten J. Gillanders significance of serum neuronspecific enolase and S100 in E. Leja D. Dietrich K, Beaudry C, Berens M, Alberts D, ischemic and hemorrhagic stroke. Clin Chem Lab Med. Sondak V. Molecular classification of cutaneous malignant 2009; 47: 1513-1518 melanoma by gene expression profiling. Nature. 2000; 04.07 22. Fernandez EJ, Lolis E. Structure, function, and 406:536-540 inhibition of chemokines Annu Rev Pharmacol Toxicol. 0394. 9. Jones M H, Virtanen C, Honjoh D, Miyoshi T. 2002:42:469-499 Satoh Y. Okumura S. Nakagawa K, Nomura H, Ishikawa Y. (0408. 23. Mines M, Ding Y. Fan G. H. The many roles of Two prognostically significant Subtypes of high-grade lung chemokine receptors in neurodegenerative disorders: neuroendocrine tumours independent of Small-cell and Emerging new therapeutical strategies. Curr Med. Chem. large-cell neuroendocrine carcinomas identified by gene 2007; 14:24.56-2470 expression profiles. Lancet. 2004; 363:775-781 04.09 24. Takami S, Minami M. Katayama T. Nagata I, 0395. 10. Chang J C, Wooten E C, Tsimelzon A, Hilsen Namura S. Satoh M. Tak-779, a nonpeptide cc chemokine beck SG, Gutierrez MC, Elledge R. Mohsin S, Osborne C receptor antagonist, protects the brain against focal cere K. Chamness G C. Allred DC, O’Connell P. Gene expres bral ischemia in mice. J Cereb Blood Flow Metab. 2002: sion profiling for the prediction of therapeutic response to 22:78O-784 docetaxel in patients with breast cancer. Lancet. 2003; 0410. 25. Takami S, Minami M. Nagata I, Namura S. 362:362-369 Satoh M. Chemokine receptor antagonist peptide, viral US 2013/O 189243 A1 Jul. 25, 2013

mip-ii, protects the brain against focal cerebral ischemia in 0425 40. Wojciak-Stothard B. Ridley A. J. Rho gtpases mice. J Cereb Blood Flow Metab. 2001; 21:1430-1435 and the regulation of endothelial permeability. Vascul 0411. 26. Stamatovic SM, Shakui P. Keep RF, Moore BB, Pharmacol. 2002:39:187-199 Kunkel S. L. Van Rooijen N. Andjelkovic AV. Monocyte 0426 41. Carbajal J M. Schaeffer RC, Jr. Rhoa inactiva chemoattractant protein-1 regulation of blood-brain barrier tion enhances endothelial barrier function. Am J. Physiol. permeability. J Cereb Blood Flow Metab. 2005; 25:593 1999; 277:C955-964 606 0427 42. Hordijk PL, Anthony E, Mul F. P. Rientsma R, 0412. 27. Ceradini DJ, Kulkarni A R. Callaghan M. J. Oomen L. C. Roos D.Vascular-endothelialcadherin modu Tepper O M. Bastidas N. Kleinman M. E. Capla J M. lates endothelial monolayer permeability. JCell Sci. 1999; Galiano R. D. Levine J. P. Gurtner G. C. Progenitor cell 112 (Pt. 12):1915-1923 trafficking is regulated by hypoxic gradients through hif-1 0428 43. Hochepied T. Berger FG, Baumann H, Libert C. induction of Sdf-1. Nat. Med. 2004; 10:858-864 Alpha(1)-acid glycoprotein: An acute phase protein with 0413. 28. Yamaguchi J. Kusano KF, Masuo O. Kawamoto inflammatory and immunomodulating properties. Cytok A, Silver M, Murasawa S, Bosch-Marce M, Masuda H, ine Growth Factor Rev. 2003; 14:25-34 Losordo DW. Isner J. M., Asahara T. Stromal cell-derived 0429 44. Fournier T, Medjoubi NN, Porquet D. Alpha-1- factor-1 effects on ex vivo expanded endothelial progenitor acid glycoprotein. Biochim Biophys Acta. 2000: 1482: cell recruitment for ischemic neovascularization. Circula 157-171 tion. 2003: 107:1322-1328 0430 45. Marsh BJ, Stevens SL, Hunter B, Stenzel-Poore 0414, 29. Offner H. Subramanian S, Parker SM, Afentou MP. Inflammation and the emerging role of the toll-like lis ME, Vandenbark AA, Hurn PD. Experimental stroke receptor system in acute brain ischemia. Stroke. 2009; induces massive, rapid activation of the peripheral immune 40:S34-37 system. J Cereb Blood Flow Metab. 2006; 26:654-665 0431 46. Medzhitov R. Toll-like receptors and innate 0415. 30. Yan J. Greer J M, Etherington K, Cadigan G. P. immunity. Nat Rev Immunol. 2001; 1:135-145 Cavanagh H, Henderson RD, O'Sullivan JD, Pandian J D. 0432 47. Rubartelli A, Lotze MT. Inside, outside, upside Read SJ, McCombe PA. Immune activation in the periph down: Damage-associated molecular-pattern molecules eral blood of patients with acute ischemic stroke. J. Neu (damps) and redox. Trends Immunol. 2007; 28:429-436 roimmunol. 2009; 206:112-117 0433 48. Bianchi ME. Damps, pamps and alarmins: All 0416) 31. Zheng PS, Wen J. Ang L. C. Sheng W, Viloria we need to know about danger.J Leukoc Biol. 2007; 81:1-5 Petit A, Wang Y. Wu Y. Kerbel R. S. Yang B B. Versican/ 0434 49. Salminen A, Huuskonen J. Ojala J, Kauppinen pg-m g3 domain promotes tumor growth and angiogenesis. A, Kaarniranta K, SuuronenT. Activation of innate immu FASEB J. 2004; 18:754-756 nity system during aging: Nf-kb signaling is the molecular 0417. 32. Vorisek I, Hajek M. Tintera.J., Nicolay K, Sykova culprit of inflamm-aging. Ageing Res Rev. 2008; 7:83-105 E. Water ade, extracellular space volume, and tortuosity in 0435 50. Csiszar A. Wang M, Lakatta E G, Ungvari Z. the rat cortex after traumatic injury. Magn Reson Med. Inflammation and endothelial dysfunction during aging: 2002:48:994-1003 Role of nif-kappab. J Appl Physiol. 2008: 105:1333-1341 0418 33. Beggah A.T. Dours-Zimmermann MT. Barras F 0436 51. Letiembre M, Hao W. Liu Y. Walter S. Mihal M, Brosius A, Zimmermann D R, Zurn A D. Lesion-in jevic I, Rivest S. Hartmann T. Fassbender K. Innate duced differential expression and cell association of neu immune receptor expression in normal brain aging. Neu rocan, brevican, versican V1 and V2 in the mouse dorsal roscience. 2007: 146:248-254 root entry Zone. Neuroscience. 2005; 133:749-762 0437 52. FulopT, Larbi A, DouziechN, Fortin C, Guerard 0419. 34. Leonardo C C, Eakin A K. Ajmo J. M. Gottschall KP, Lesur O. Khalil A, Dupuis G. Signal transduction and P E. Versican and brevican are expressed with distinct functional changes in neutrophils with aging. Aging Cell. pathology in neonatal hypoxic-ischemic injury. J Neurosci 2004; 3:217-226 Res. 2008: 86: 1106-1114 0438 53. Marsh BJ, Williams-Karnesky R L. Stenzel 0420 35. Carmichael ST. Archibeque I, Luke L, Nolan T. Poore MP. Toll-like receptor signaling in endogenous neu Momiy J. Li S. Growth-associated gene expression after roprotection and stroke. Neuroscience. 2009; 158:1007 stroke: Evidence for a growth-promoting region in peri 102O infarct cortex. Exp Neurol. 2005; 193:291-311 0439 54. Kilic U, Kilic E. Matter C M. Bassetti C L, 0421 36. Toeda K. Nakamura K, Hirohata S. Hatipoglu O Hermann DM. Tlr-4 deficiency protects against focal cere F. Demircan K. Yamawaki H, Ogawa H. Kusachi S, Shira bral ischemia and axotomy-induced neurodegeneration. tori Y. Ninomiya Y. Versican is induced in infiltrating Neurobiol Dis. 2008; 31:33-40 monocytes in myocardial infarction. Mol Cell Biochem. 0440 55. Ziegler G, Harhausen D. Schepers C, Hoffmann 2005; 280:47-56 O, Rohr C, PrinzV. Konig J, Lehrach H, Nietfeld W. Tren 0422 37. Brown M. D. Sacks D B. Idgap 1 in cellular delenburg G. Tr2 has a detrimental role in mouse transient signaling: Bridging the gap. Trends Cell Biol. 2006; focal cerebral ischemia. Biochem Biophys Res Commun. 16:242-249 2007; 359:574-579 0423 38. Fukata M, Nakagawa M. Kaibuchi K. Roles of 0441 56. Caso J. R. Pradillo J. M. Hurtado O. Lorenzo P. rho-family gtpases in cell polarisation and directional Moro MA, Lizasoain I. Toll-like receptor 4 is involved in migration. Curr Opin Cell Biol. 2003; 15:590-597 brain damage and inflammation after experimental stroke. 0424 39. Miao L, Calvert J. W. Tang J. Parent A. D. Zhang Circulation. 2007: 115:1599-1608 J. H. Age-related rhoa expression in blood vessels of rats. 0442. 57. Caso J R, Pradillo J. M. Hurtado O, Leza J C, Mech Ageing Dev. 2001: 122:1757-1770 Moro MA, Lizasoain I. Toll-like receptor 4 is involved in US 2013/O 189243 A1 Jul. 25, 2013 34

Subacute stress-induced neuroinflammation and in the leukeminc and genetic Subtype as well as of minimal worsening of experimental stroke. Stroke. 2008; 39:1314 residual disease status. Leukemia 2007: 21:1198-1203 132O 0454) 69. Cardoso F.Vant-Verr L, Rutgers E, Loi S, Mook 0443) 58. Yang Q W. Li J C, Lu FL, Wen A Q, Xiang J, Zhang L. L. Huang ZY. Wang J. Z. Upregulated expression S. Piccart-Gebhart M. Clinical application of the 70-gene of toll-like receptor 4 in monocytes correlates with severity profile: The mindact trial. Journal of Clinical Oncology. of acute cerebral infarction. J Cereb Blood Flow Metab. 2008; 26:729-735 2008; 28:1588-1596 0455 70. Sharp F R, Xu H, Lit L. Walker W. Apperson M, 0444 59. Urra X, Cervera A, Obach V. Climent N. Planas Gilbert D. L., Glauser TA, Wong B, Hershey A. Liu DZ, A M, Chamorro A. Monocytes are major players in the Pinter J, Zhan X, Liu X, Ran R. The future of genomic prognosis and risk of infection after acute stroke. Stroke. profiling of neurological diseases using blood. Arch Neu 2009; 40:1262–1268 rol. 2006; 63:1529-1536 0445 60. Thom T. Haase N, Rosamond W. Howard VJ, 0456 71. Whiteley W. Tseng MC, Sandercock P. Blood Rumsfeld J. Manolio T. Zheng ZJ. Flegal K. O'Donnell C, biomarkers in the diagnosis of ischemic stroke. A system Kittner S. Lloyd-Jones D, Goff DC, Jr., Hong Y. Adams R. atic review. Stroke. 2008 Friday G, Furie K. Gorelick P. Kissela B. Marler J. Meigs 0457 72. Montaner J. Perea-Gainza M, Delgado P, Ribo J. Roger V. Sidney S, Sorlie P. Steinberger J. Wasserthiel M. Chacon P. Rosell A, Quintana M. Palacios ME, Molina Smoller S, Wilson M, Wolf P. Heart disease and stroke C A, Alvarez-Sabin J. Etiologic diagnosis of ischemic statistics 2006 update: A report from the american heart stroke subtypes with plasma biomarkers. Stroke. 2008; association statistics committee and stroke statistics Sub 39:228O-2287 committee. Circulation. 2006: 113:e85-151 0446 61. McKay J, Mensah GA, ebrary Inc. The atlas of 0458 73. Stone G. P. Mernaugh R, Haselton F R. Virus heart disease and stroke. Geneva: World Health Organiza detection using filament-coupled antibodies. Biotechnol tion; 2005. Bioeng 2005: 91:699-706 0447 62. Chalela JA, Kidwell CS, Nentwich LM, Luby 0459 74. Kidwell CS, Warach S. Acute ischemic cere M, Butman JA, Demchuk A M, Hill M D, Patronas N, brovascular syndrome: Diagnostic criteria. Stroke. 2003; Latour L. Warach S. Magnetic resonance imaging and 34:2995-2998 computed tomography in emergency assessment of patients with Suspected acute stroke: A prospective com 0460) 75. Easton JD, Saver J. L., Albers G. W. Alberts MJ, parison. Lancet. 2007:369:293-298 Chaturvedi S, Feldmann E. Hatsukami TS, Higashida RT, 0448 63. Rosamond W. Flegal K. Furie K. Go A, Green Johnston SC, Kidwell CS, Lutsep HL, Miller E. Sacco R lund K, Haase N. Hailpern SM, Ho M. Howard V. Kissela L. Definition and evaluation of transientischemic attack: A B. Kittner S. Lloyd-Jones D. McDermott M, Meigs J. Moy scientific statement for healthcare professionals from the C, Nichol G. O'Donnell C, Roger V. Sorlie P. Steinberger J, american heart association/american stroke association Thom T. Wilson M, Hong Y. Heart disease and stroke stroke council; council on cardiovascular Surgery and anes statistics 2008 update: A report from the american heart thesia; council on cardiovascular radiology and interven association statistics committee and stroke statistics Sub tion; council on cardiovascular nursing; and the interdisci committee. Circulation. 2008: 117:e25-146 plinary council on peripheral vascular disease. The 0449 64. Reeves MJ, Arora S. Broderick J P Frankel M, american academy of neurology affirms the value of this Heinrich J P Hickenbottom S. Karp H, LaBresh K A, statement as an educational tool for neurologists. Stroke. Malarcher A, Mensah G, Moomaw C J, Schwamm L., 2009; 40:2276-2293 Weiss P. Acute stroke care in the us: Results from 4 pilot 0461) 76. Meschia J. F. Lojacono MA, Miller MJ, Brott T prototypes of the paul coverdell national acute stroke reg G, Atkinson E. J. O’Brien PC. Reliability of the question istry. Stroke. 2005:36:1232-1240 naire for verifying stroke-free status. Cerebrovasc Dis. 0450 65. BarrTL, ConleyY P. Dillman A, Ding J, Warach 2004; 17:218-223 S, Singleton A, Matarin M. Gene expression profiling in 0462 77. Griffiths R A, Good W R, Watson N P. human acute ischemic stroke. University of Pittsburgh O'Donnell HF, Fell PJ, Shakespeare J. M. Normal eryth School of Nursing. 2009; PhD:270 rocyte sedimentation rate in the elderly. Br Med.J (Clin Res 0451 66. TangY,Xu H, Du X, Lit L. Walker W. LuA, Ran R. Gregg JP, Reilly M, Pancioli A, Khoury J C, Sauerbeck Ed). 1984; 289:724-725 L. R. Carrozzella JA, Spilker J. Clark J. Wagner KR, Jauch 0463 78. Bonita R, Beaglehole R. Recovery of motor EC, Chang DJ, Verro P. Broderick J. P. Sharp F R. Gene function after stroke. Stroke. 1988; 19:1497-1500 expression in blood changes rapidly in neutrophils and 0464) 79. Mahoney F I, Barthel D. W. Functional evalua monocytes after ischemic stroke in humans: A microarray tion: The barthel index. Md State Med J. 1965; 14:61-65 study. J Cereb Blood Flow Metab. 2006; 26:1089-1102 0452 67. Basso G, Case C, Dell’Orto M. Diagnosis and 0465) 80. Wilson JT, Pettigrew LE, Teasdale GM. Struc genetic Subtypes of leukemia combining gene expression tured interviews for the glasgow outcome scale and the and flow cytometry. Blood Cells, Molecules, and Diseases. extended glasgow outcome scale: Guidelines for their use. 2007:39:164-168 J. Neurotrauma. 1998; 15:573-585 0453 68. Andersson A. Ritz C. Lindgren D. Eden P. Las 0466 81. Spertus JA, Winder JA, Dewhurst TA, Deyo R sen C, Heldrup J, Olofsson T. Rade J, Fontes M. Porwit A, Prodzinski J. McDonell M. Fihn SD. Development and MacDonald A. Behrendtz M, Hoglund M. Johansson B, evaluation of the Seattle angina questionnaire: A new func Fioretos T. Microarray-based classification of a consecu tional status measure for coronary artery disease. JAm Coll tive series of 121 childhood acute leukemias: Prediction of Cardiol. 1995; 25:333-341 US 2013/O 189243 A1 Jul. 25, 2013 35

0467 82. Bushel PR, Wolfinger R D, Gibson G. Simulta 0470 85. Bonnet G, Tyagi S. Libchaber A. Kramer F R. neous clustering of gene expression data with clinical Thermodynamic basis of the enhanced specificity of struc chemistry and pathological evaluations reveals phenotypic tured DNA probes. Proc Natl Acad Sci USA. 1999; prototypes. BMC Syst Biol. 2007: 1:15 96:6171-6176 0468) 83. Perez J. M. Hasleton, F. R., Wright, Dr. W. Viral 0471) Having thus described in detail preferred embodi detection using DNA functionalized gold filaments. The ments of the present invention, it is to be understood that the Analyst. 2009; 134, 1548-1553. invention defined by the above paragraphs is not to be limited 0469 84. Tsourkas A, Behlke MA, Rose S D, Bao G. to particular details set forth in the above description as many Hybridization kinetics and thermodynamics of molecular apparent variations thereof are possible without departing beacons. Nucleic Acids Res. 2003:31:1319-1330 from the spirit or Scope of the present invention.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 19

<21 Os SEQ ID NO 1 &211s LENGTH: 2.188 212s. TYPE : DNA <213> ORGANISM: Homo sapiens <4 OOs SEQUENCE: 1

aga Caggggt agtgcgaggc cgggcacagc ct tcctgtgt ggittitt accg cc cagaga.gc 60

gtcatggacc tggggaalacc aatgaaaagc gtgctggtgg tggct citcct tgtcatttitc 12O

Cagg tatgcc tgtgtcaaga tgagg to acg gacgattaca toggagacaa Caccacagtg 18O

gactacactt tgttcgagtic tttgtgcticc aagaaggacg tgcggaactt taaa.gc.ctgg 24 O

ttic ct coct a to atgtactic catcatttgt ttctgggcc tactggggaa tgggctggtc 3 OO

gtgttgacct at atctattt Caagaggctic aagaccatga cc.gataccta cc togct caac 360

cagacat cot ct tcc toctg accottic cott totgggcct a cagcgcggcc aagtic ctggg tott.cggtgt cc acttittgc aagct catct ttgc catcta Caagatgagc

ttctt cagtg gcatgct cot acttctittgc at cago attg accoctacgt. ggc.cat citc 54 O

Caggctgtct cagotcaccg ccaccgtgcc cgcgtcc titc to at cagdaa gctgtc.ctgt 6 OO

gtgggcatct ggatact agc cacagtgctic to catcc cag agct cotgta cagtgacctic 660 cagaggagca gcagtgagca agcgatgcga tgct citctica to acagagca tgttggaggcc

titt at Cacca to Caggtggc ccagatggtg atcqgctitt c tggit coccct gctggc catg

agcttctgtt accttgtcat catcc.gcacc Ctgctcc agg cacgcaactt tgagcgcaac 84 O

aaggc catca aggtgat cat cgctgtggtc gtggtct tca tagt ct tcca gctgcc ctac 9 OO

aatggggtgg to ctggcc.ca gacggtggCC aact tcaa.ca to accagtag Cacctgtgag 96.O

cticagtaagc aacticaa.cat cgc.ctacgac gt cacct aca gcctggcctg cgt.ccgctgc tgcgt calacc ctittcttgta cgcct tcatc ggcgtcaagt to cqcaacga totcttcaag

citcttcaagg acctgggctg cct cago cag gaggagct cc ggcagtggtC tt CCtgtcgg 14 O

cacat coggc gcticctic cat gagtgttggag gcc.gagacca CCaCCaCCtt ct coccatag 2 OO

gcc actic titc tgcctggact agagggacct Ctcc cagggit CCCtggggtg gggataggga 26 O

gcagatgcaa. tgact cagga catcc cc cc.g ccaaaagctg ct Cagggaaa agcagotctic 32O

cc ct cagagt gcaa.gc.ccct gcticcagaag at agctt cac CC caat CCCa gctacct caa

ccalatgccala aaaaaga cag ggctgataag ctaacaccag acagacaa.ca Ctgggaaa.ca 4 4 O

gaggctattg to CCCtaaac caaaaactga aagtgaaagt cc agaaactg tt cocacctg 5 OO

Ctggagtgaa ggggcCaagg agggtgagtg Caagggg.cgt. gggagtggcc tgaagagt cc 560 US 2013/O 189243 A1 Jul. 25, 2013 36

- Continued tctgaatgaa cct tctggcc ticc cacagac toaaatgctic agaccagctic titc.cgaaaac 162O

Caggcctt at Ctccalagacic agagatagtggggagacttic ttggcttggit gaggaaaagc 168O ggacat cago tdgtoaaa.ca aactic totga acc cct c cot coat cqttitt citt cactgtc 1740 Ctccaa.gc.ca gcgggaatgg cagctgccac gcc.gc.cctaa aag cacactic at CCC ct cac 18OO ttgcc.gcgt.c gcc ct cccag gct ct caa.ca ggggaga.gtg tdgtgtttcc tec aggc.ca.g 1860 gccagotgcc ticcgcgtgat Caaagccaca Ctctgggctic cagagtgggg atgacatgca 1920 Ctcagct Ctt ggctcc actg ggatgggagg agaggacaag ggaaatgtca ggggcgggga 198O gggtgacagt ggcc.gc.ccala ggcc.cacgag Cttgttctitt gttctttgtc. acagggactg 2O4. O aaaacct citc ct catgttct gctitt cqatt cqttaa.gaga gcaac attitt acccacacac 21OO agataaagtt titc ccttgag gaaacaacag ctittaaaaga aaaagaaaaa aaaagtic titt 216 O ggtaaatggc aaaaaaaaaa aaaaaaaa 21.88

<210s, SEQ ID NO 2 &211s LENGTH: 378 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 2 Met Asp Lieu. Gly Llys Pro Met Lys Ser Val Lieu Val Val Ala Lieu. Lieu. 1. 5 1O 15 Val Ile Phe Glin Val Cys Lieu. Cys Glin Asp Glu Val Thr Asp Asp Tyr 2O 25 3O Ile Gly Asp Asn Thr Thr Val Asp Tyr Thr Lieu Phe Glu Ser Lieu. Cys 35 4 O 45 Ser Lys Lys Asp Val Arg Asn. Phe Lys Ala Trp Phe Lieu Pro Ile Met SO 55 6 O Tyr Ser Ile Ile Cys Phe Val Gly Lieu. Lieu. Gly Asn Gly Lieu Val Val 65 70 7s 8O Lieu. Thir Tyr Ile Tyr Phe Lys Arg Lieu Lys Thr Met Thr Asp Thr Tyr 85 90 95 Lieu. Lieu. Asn Lieu Ala Val Ala Asp Ile Lieu. Phe Lieu. Lieu. Thir Lieu Pro 1OO 105 11 O Phe Trp Ala Tyr Ser Ala Ala Lys Ser Trp Val Phe Gly Val His Phe 115 12 O 125 Cys Llys Lieu. Ile Phe Ala Ile Tyr Lys Met Ser Phe Phe Ser Gly Met 13 O 135 14 O Lieu. Lieu. Lieu. Lieu. Cys Ile Ser Ile Asp Arg Tyr Val Ala Ile Val Glin 145 150 155 160 Ala Val Ser Ala His Arg His Arg Ala Arg Val Lieu. Lieu. Ile Ser Lys 1.65 17O 17s Lieu. Ser Cys Val Gly Ile Trp Ile Leu Ala Thr Val Lieu Ser Ile Pro 18O 185 19 O Glu Lieu. Lieu. Tyr Ser Asp Lieu. Glin Arg Ser Ser Ser Glu Glin Ala Met 195 2OO 2O5 Arg Cys Ser Lieu. Ile Thr Glu. His Val Glu Ala Phe Ile Thr Ile Glin 21 O 215 22O Val Ala Gln Met Val Ile Gly Phe Leu Val Pro Leu Lleu Ala Met Ser 225 23 O 235 24 O

Phe Cys Tyr Lieu Val Ile Ile Arg Thr Lieu. Lieu. Glin Ala Arg Asn. Phe 245 250 255

US 2013/O 189243 A1 Jul. 25, 2013 38

- Continued caac catcga tittgagtatic ct cqcagaaa citgcatcacc cagtttatcc aaagaac cac 38O aaatggitttctgatagaact acaccaat catcc ctittagt tdatgaatta cctdt catt c 44 O caacagagtt cocticcc.gtg ggaaatattgtcagttittga acagaaagcc acagt ccaac SOO cticaggctat cacagatagt ttagocacca aattacccac acc tactggc agtaccalaga 560 agcc ctggga tatggatgac tact caccitt Ctgct tcagg acct Cttgga aagct agaca 62O tatic agaaat taaggaagaa gtgct coaga gtacaactgg ct ct ct cat tatgctacgg 68O att catggga tiggtgtcgtg galagataaac aaacacalaga atcggittaca Cagattgaac 74 O aaatagaagt giggit cotttg gtaacatcta tdgaaatctt aaag.cacatt cottccaagg 8OO aatticcictgt aactgaaaca ccattggtaa citgcaagaat gatcc tiggaa tocaaaactg 86 O aaaagaaaat gigtaag cact gtttctgaat tdgtaac cac agg to actat ggatt cacct 92 O tgggagaaga ggatgatgaa gacagaacac ttacagttgg atctgatgag agcaccittga 98 O t ctittgacca aatticctgaa gttcattacgg tdtcaaagac titcagaagac accatccaca 2O4. O ct catttaga agacittggag toagt ct cag catccacaac tdttt cocct ttaattatgc 21OO Ctgataataa tigatcatcc atggatgact gggaagagag acaaact agt gg taggataa 216 O cggaagagtt tottggcaaa tatctgtcta ctacaccittt to cat cacag catcgtacag 222 O aaatagaatt gtttcc titat tctggtgata aaat attagt agagggaatt to cacagtta 228O tittatc ctitc tictacaaaca gaaatgacac atagaagaga aagaacagaa acactaatac 234 O cagagatgag alacagatact tatacagatgaaatacaaga agagat cact aaaagtic cat 24 OO titatgggaaa alacagaagaa gaagt cittct ctdggatgaa act ct ctaca tot ct ct cag 246 O agccaattica tottacagag tottctgtgg aaatgaccaa gtc.ttittgat titcc.caacat 252O tgataacaaa gttalagtgca gagccaacag aagta agaga tatggaggala gaCtttacag 2580 caactic cagg tact acaaaa tatgatgaaa at attacaac agtgcttittg gcc catggta 264 O

Ctttalagtgt talagcagcc actgt atcaa aatggtcatg ggatgaagat aatacaiacat 27 OO c caa.gc.ctitt agagtic taca gaacct tcag cct cittcaaa attgcc.ccct gcct tactica 276 O Caactgtggg gatgaatgga aaggataaag acatccCaag titt cactgaa gatggagcag 282O atgaatttac tottatt coa gatag tactic aaaag cagtt agaggaggitt actgatgaag 288O acatagcago ccatggaaaa titcacaatta gattt cagoc alacta catca actgg tattg 294 O cagaaaagtic aactittgaga gattctacaa citgaagaaaa agttccacct at cacaa.gca 3 OOO

Ctgaaggc.ca agtttatgca accatggaag gaagtgctitt gggtgaagta gaagatgtgg 3 O 6 O acct ct citaa gcc agitat ct actgttcc cc aatttgcaca cactt cagag gtggaaggat 312 O tagcatttgt tagttatagt agcacccaag agcct actac titatgtagac tott.cccata 318O c cattcct ct ttctgtaatt cocaagacag actggggagt gttagtacct tctgttc cat 324 O cagaagatga agttctaggit gaaccct citc aagacatact togt cattgat cagacitcgc.c 33 OO ttgaag.cgac tatttcticca gaalactatga gaacaacaaa aat cacagag ggaacaactic 3360 aggaagaatt CCCttggaaa galacagactg cagagaalacc agttcCtgct ct cagttcta 342O Cagcttggac toccaaggag gcagtaacac cactggatga acaagagggc gatggat cag 3480 catata cagt citctgaagat gaattgttga Caggttctga gagggtc.cca gttittagaaa 354 O caactic cagt toggaaaaatt gat cacagtg tdt cittatcc accaggtgct gtaactgagc 36OO acaaagtgaa alacagatgaa gtggtaacac taacaccacg cattgggcca aaagt at Ctt 366 O US 2013/O 189243 A1 Jul. 25, 2013 39

- Continued taagttcCagg gcctgaacaa aaatatgaaa Cagaaggtag tag tacaiaca ggatttacat 372 O catctittgag toctitt tagt acccacatta cccagottat gigaagaaacc act actgaga 378 O aaac atcc ct agaggatatt gatttaggct caggattatt togaaaag.ccc aaa.gc.cacag 384 O aact cataga attittcaa.ca atcaaagt ca cagttccaag togatatt acc actgc ctitca 3900 gttcagtaga cagactitcac acaactitcag cattcaa.gcc atctitcc.gcg at cactalaga 396 O alaccacct ct catcgacagg galacctggtg aagaaacaac Cagtgacatg gtaat cattg 4 O2O gagaat caac atctoratgtt cct cocacta ccc.ttgaaga tattgtagcc aaggaaa.ca.g 4 O8O aaac cqatat tdatagagag tattt cacga cittcaagtcc ticcitgctaca cagccaacaa 414 O gaccacccac ttggalagac aaagaggcct ttggacctica ggcgctttct acgc.cacagc 42OO c cccagcaag cacaaaattt caccctgaca ttaatgttta tattattgag gtcagagaaa 426 O ataaga Cagg togaatgagt gatttgagtg taattggit catccaatagat t cagaat ct a 432O aagaagatga accttgtagt gaagaaacag atc.ca.gtgca tdatctaatg gctgaaattit 438 O tacctgaatt coctdacata attgaaatag acctatacca cagtgaagaa aatgaagaag 4 44 O aagaagaaga gtgtgcaaat gct actgatg tacaiaccac ccCatctgtg cagtacatala 4500 atgggaag catct cqttacc actgtgcc.ca aggacccaga agctgcagala gct aggcgtg 456 O gccagtttga aagtgttgca cct tct caga atttct cqga cagotctgaaagtgatactic 462O atccatttgt aatagocaaa acggaattgt Ctactgctgt gcaacctaat gaatctacag 468O aaacaactgagt ct cittgaa gttacatgga agcct gagac ttaccctgaa a catcagaac 474. O atttitt cagg toggtgagcct gatgttitt co coacagt ccc attic catgag gaatttgaaa 48OO gtggalacagc caaaaaaggg gCagaatcag to acagagag agatactgaa gttggit catc 486 O aggcacatga acatactgaa cct gtatic to ttitt Cotga agagt ct tca ggagagattg 492 O c cattgacca agaatctgag aaaatagcct ttgcaagggc tacagaagta acatttggtg 498O aagagg taga aaaaagtact tctgtcacat acact cocac tatagttcca agttctgcat 5040 Cagcatatgt ttcagaggaa galagcagtta C cctaatagg aaatcCttgg C cagatgacc 51OO tgttgtctac Caaagaaagc tigggtagaag caact cotag acaagttgta gagct ct cag 516 O ggagttct tc gattic caatt acaga aggct Ctggaga agc agaagaagat galagatacaa 522 O tgttcaccat gigtaactgat titat cacaga gaaatactac tdata cactic attactittag 528 O acac taggag gataat caca gaaagcttitt ttgaggttcc togcaaccacc atttatc.ca.g 534 O tittctgaaca accttctgca aaagtggtgc ctaccaagtt totaagtgaa acaga cactt 54 OO

Ctgagtggat titcCagtacc actgttgagg aaaagaaaag gaaggaggag gagggaact a 546 O cagg tacggc titctacattt gaggtatatt catctacaca gagat.cggat caattaattit 552O tacic ctittga attagaaagt ccaaatgtag cta catc tag togatt caggit accaggaaaa 558 O gttt tatgtc. cittgacaa.ca cca acacagt ctogaaaggga aatgacagat t c tactic ct g 564 O tctttacaga aacaaataca ttagaaaatt togggcaca gaccactgag cacagcagta st OO tccatcaa.cc toggggttcag gaagggctga ccact ct coc acg tagt cct gcct ctdtct 576. O titatggagca gggctctgga gaagctgctg. cc.gacccaga aaccaccact gtttctt cat 582O titt cattaaa cqtagagtat gcaattcaag ccgaaaagga agtagctggc actttgtctic 588 O cgcatgtgga aactacatt C to cactgagc caa.caggact ggttittgagt acagtaatgg 594 O US 2013/O 189243 A1 Jul. 25, 2013 40

- Continued acagagtagt totgaaaat at aacccalaa catcCaggga aatagtgatt tdagagcgat 6 OOO taggagaacc aaattatggg gcagaaataa ggggottttic cacaggttitt CCtttggagg 6 O6 O aagattitcag toggtgactitt agagaatact caa.ca.gtgtc. tcatcc cata gcaaaagaag 612 O aaacggtaat gatggaaggc tictggagatg cagcatttag gga cacc cag actitcac cat 618O ctacagtacc tactitcagtt cacat cagtic acatatctga citcagaagga cccagtagca 624 O c catggtcag cactticagoc titc.ccctggg aagagtttac atcct cagct gagggct cag 63 OO gtgagcaact ggt cacagtic agcagctctg. ittgttcCagt gct tcc.cagt gctgtgcaaa 636 O agttittctgg tacagct tcc ticcattatcg acgaaggatt gggagaagtg ggtactgtca 642O atgaaattga tagaagat Co accattttac Caacagoaga agtggaaggit acgaaagctic 648 O

Cagtagagaa ggaggaagta aaggt cagtg gCacagtttic aacaaactitt CCC caaact a 654 O tagagc.ca.gc caaattatgg totaggcaag aagttcaa.ccc titaaga caa gaaattgaaa 66OO gtgaaacaac at cagaggaa caaattcaag aagaaaagtic atttgaatcc cct caaaact 666 O citcc togcaac agaacaaaca atctittgatt cacagacatt tactgaaact gaact caaaa 672 O ccacagatta ttctgtacta acaacaaaga aaact tacag tdatgataaa gaaatgaagg 678 O. aggaagacac ttctittagtt aacatgtcta citccagatcc agatgcaaat ggcttggaat 6840 cittacacaac tot coctdaa got actgaaa agt cacattt titt cittagct actgcattag 69 OO taactgaatc tataccagct gaa catgtag to acagattic accaatcaaa aaggaagaaa 696 O gtacaaaa.ca tttitcc.gaaa gocatgagac caacaattica agagt cagat actgagctict 7 O2O tatt Ctctgg actgggat.ca ggagaagaag titt tacctac totaccalaca gag to agtga 708 O attt tact ga agtggaacaa at caataa.ca cattatat co ccacactitct caagtggaaa 714. O gtacct Caag tacaaaatt galagactitta acagaatgga aaatgtggca aaagaagttg f2OO gaccactic gt atctoaaa.ca gacat ctittgaaggtag togg gtcagta acc agcacaacat 726 O taatagaaat tittaagtgac actggagcag aaggacccac gigtggcacct citc cctittct 732O ccacggacat cqgacatcct caaaatcaga Ctgtcaggtg ggcagaagaa atc.ca.gact a 7380 gtag accaca aaccataact gaacaagact ctaacaagaa ttcttcaa.ca gcagaaatta 744. O acgaaacaac aacct catct actgattittctggctagagc titatggittitt gaaatggc.ca 75OO aagaatttgt tacat cagca ccaaaaccat citgacttgta t tatgaacct tctggagaag 756 O gatctggaga agtggatatt gttgatt cat titcacacttic togcaact act caggcaacca 762O gacaagaaag cagcaccaca tttgtttctg atgggtc. cct ggaaaaa.cat cct gaggtgc 768 O caag.cgctaa agctgttact gctgatggat tcc caac agt titcagtgat g c togcct citt c 774. O attcagagca gaacaaaagc ticc cctdatc caactagoac actgtcaaat acagtgt cat 78OO atgagagg to Cacagacggit agttt coaag accgttt cag ggaattic gag gattic cacct 786 O taaaac ctaa cagaaaaaaa cccactgaaa at attat cat agacctggac aaagaggaca 7920 aggatttaat attgacaatt acagagagta ccatccttga aattic tacct gagctgacat 798 O cggataaaaa tactat cata gat attgatc atactaalacc tdtgitatgaa gacattcttg 804 O gaatgcaaac agatatagat acagaggtac Cat Caga acc acatgacagt aatgatgaaa 81OO gtaatgatga cagcacticaa gttcaagaga tictatgaggc agctgtcaac ctittctittaa 816 O

Ctgaggaaac atttgagggc tictgctgatgttctggctag ctacact cag gcaacacatg 822 O atgaat caat gactitatgaa gatagaagcc aactagat.ca catgggctitt cactt cacaa 828O

US 2013/O 189243 A1 Jul. 25, 2013 42

- Continued ttggaccacc gttcagt cat tittgggttgc cqtgctic cca aaa catttta aatgaaagta O62O ttggcattca aaaaga cagc agacaaaatgaaagaaaatg agagcagaala gtaagcattt O68O c cagccitat c taatttctitt agttittct at ttgcc to cag togcagtic cat titcctaatgt Of 4 O ataccago: ct actgtact at ttaaaatgct caattitcago accogatggcc atgtaaataa O8OO gatgatttaa tdttgattitt aatcc tigt at ataaaataaa aagt cacaat gagtttgggc O 860 at atttaatg atgattatgg agc cittagag gtc.tttaatc attggttcgg ctgctttitat O92O gtag tittagg Ctggaaatgg titt cacttgc tictittgactg. t cagcaagac talagatggc O98O ttitt cotgga cagctagaaa acacaaaatc ttgtaggtoa ttgcaccitat citcagccata 104 O ggtgcagttt gct tct acat gatgctaaag gctg.cgaatg ggatcCtgat ggalactalagg 11OO actic caatgt cqaact ctitc tittgctgcat tcc tttittct t cact tacaa gaaaggcctg 116 O aatggaggac ttittctgtaa C cagg 1185

<210s, SEQ ID NO 4 &211s LENGTH: 3376 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 4 Lieu. His Llys Val Llys Val Gly Lys Ser Pro Pro Val Arg Gly Ser Lieu. 1. 5 1O 15 Ser Gly Llys Val Ser Lieu Pro Cys His Phe Ser Thr Met Pro Thr Lieu 2O 25 3O Pro Pro Ser Tyr Asn. Thir Ser Glu Phe Leu Arg Ile Llys Trp Ser Lys 35 4 O 45 Ile Glu Val Asp Lys Asn Gly Lys Asp Lieu Lys Glu Thir Thr Val Lieu. SO 55 6 O Val Ala Glin Asn Gly Asn. Ile Lys Ile Gly Glin Asp Tyr Lys Gly Arg 65 70 7s 8O Val Ser Val Pro Thr His Pro Glu Ala Val Gly Asp Ala Ser Lieu. Thr 85 90 95 Val Val Lys Lieu. Lieu Ala Ser Asp Ala Gly Lieu. Tyr Arg Cys Asp Wall 1OO 105 11 O Met Tyr Gly Ile Glu Asp Thr Glin Asp Thr Val Ser Lieu. Thr Val Asp 115 12 O 125 Gly Val Val Phe His Tyr Arg Ala Ala Thr Ser Arg Tyr Thr Lieu. Asn 13 O 135 14 O Phe Glu Ala Ala Glin Lys Ala Cys Lieu. Asp Val Gly Ala Val Ile Ala 145 150 155 160 Thr Pro Glu Gln Leu Phe Ala Ala Tyr Glu Asp Gly Phe Glu Gln Cys 1.65 17O 17s Asp Ala Gly Trp Lieu Ala Asp Glin Thr Val Arg Tyr Pro Ile Arg Ala 18O 185 19 O Pro Arg Val Gly Cys Tyr Gly Asp Llys Met Gly Lys Ala Gly Val Arg 195 2OO 2O5 Thr Tyr Gly Phe Arg Ser Pro Glin Glu Thr Tyr Asp Val Tyr Cys Tyr 21 O 215 22O Val Asp His Lieu. Asp Gly Asp Val Phe His Lieu. Thr Val Pro Ser Lys 225 23 O 235 24 O

Phe Thr Phe Glu Glu Ala Ala Lys Glu. Cys Glu Asn Glin Asp Ala Arg 245 250 255 US 2013/O 189243 A1 Jul. 25, 2013 43

- Continued

Lieu Ala Thr Val Gly Glu Lieu. Glin Ala Ala Trp Arg Asn Gly Phe Asp 26 O 265 27 O Glin Cys Asp Tyr Gly Trp Lieu. Ser Asp Ala Ser Val Arg His Pro Val 27s 28O 285 Thr Val Ala Arg Ala Glin Cys Gly Gly Gly Lieu. Lieu. Gly Val Arg Thr 29 O 295 3 OO Lieu. Tyr Arg Phe Glu Asn Gln Thr Gly Phe Pro Pro Pro Asp Ser Arg 3. OS 310 315 32O Phe Asp Ala Tyr Cys Phe Llys Pro Lys Glu Ala Thir Thir Ile Asp Lieu. 3.25 330 335 Ser Ile Leu Ala Glu Thir Ala Ser Pro Ser Leu Ser Lys Glu Pro Glin 34 O 345 35. O Met Val Ser Asp Arg Thr Thr Pro Ile Ile Pro Leu Val Asp Glu Lieu. 355 360 365 Pro Val Ile Pro Thr Glu Phe Pro Pro Val Gly Asn Ile Val Ser Phe 37 O 375 38O Glu Gln Lys Ala Thr Val Glin Pro Glin Ala Ile Thr Asp Ser Lieu Ala 385 390 395 4 OO Thr Lys Lieu Pro Thr Pro Thr Gly Ser Thr Lys Llys Pro Trp Asp Met 4 OS 41O 415 Asp Asp Tyr Ser Pro Ser Ala Ser Gly Pro Lieu. Gly Llys Lieu. Asp Ile 42O 425 43 O Ser Glu Ile Lys Glu Glu Val Lieu. Glin Ser Thr Thr Gly Val Ser His 435 44 O 445 Tyr Ala Thr Asp Ser Trp Asp Gly Val Val Glu Asp Llys Glin Thr Glin 450 45.5 460 Glu Ser Val Thr Glin Ile Glu Glin Ile Glu Val Gly Pro Leu Val Thr 465 470 47s 48O Ser Met Glu Ile Leu Lys His Ile Pro Ser Lys Glu Phe Pro Val Thr 485 490 495 Glu Thr Pro Leu Val Thr Ala Arg Met Ile Leu Glu Ser Lys Thr Glu SOO 505 51O Lys Llys Met Val Ser Thr Val Ser Glu Lieu Val Thr Thr Gly His Tyr 515 52O 525 Gly Phe Thir Lieu. Gly Glu Glu Asp Asp Glu Asp Arg Thr Lieu. Thr Val 53 O 535 54 O Gly Ser Asp Glu Ser Thr Lieu. Ile Phe Asp Glin Ile Pro Glu Val Ile 5.45 550 555 560 Thr Val Ser Lys Thr Ser Glu Asp Thir Ile His Thr His Lieu. Glu Asp 565 st O sts

Lieu. Glu Ser Wal Ser Ala Ser Thir Thir Wal Ser Pro Leu. Ile Met Pro 58O 585 59 O Asp Asn. Asn Gly Ser Ser Met Asp Asp Trp Glu Glu Arg Glin Thir Ser 595 6OO 605 Gly Arg Ile Thr Glu Glu Phe Leu Gly Lys Tyr Lieu Ser Thr Thr Pro 610 615 62O Phe Pro Ser Gln His Arg Thr Glu Ile Glu Lieu Phe Pro Tyr Ser Gly 625 630 635 64 O Asp Lys Ile Leu Val Glu Gly Ile Ser Thr Val Ile Tyr Pro Ser Leu 645 650 655

Gln Thr Glu Met Thr His Arg Arg Glu Arg Thr Glu Thir Lieu. Ile Pro US 2013/O 189243 A1 Jul. 25, 2013 44

- Continued

660 665 67 O Glu Met Arg Thr Asp Thr Tyr Thr Asp Glu Ile Glin Glu Glu Ile Thr 675 68O 685 Lys Ser Pro Phe Met Gly Lys Thr Glu Glu Glu Val Phe Ser Gly Met 69 O. 695 7 OO Lys Lieu Ser Thr Ser Leu Ser Glu Pro Ile His Val Thr Glu Ser Ser 7 Os 71O 71s 72O Val Glu Met Thr Lys Ser Phe Asp Phe Pro Thr Lieu. Ile Thr Lys Lieu. 72 73 O 73 Ser Ala Glu Pro Thr Glu Val Arg Asp Met Glu Glu Asp Phe Thr Ala 740 74. 7 O Thr Pro Gly Thr Thr Lys Tyr Asp Glu Asin Ile Thr Thr Val Lieu. Leu 7ss 760 765 Ala His Gly. Thir Lieu Ser Val Glu Ala Ala Thr Val Ser Lys Trp Ser 770 775 78O Trp Asp Glu Asp Asn. Thir Thr Ser Llys Pro Leu Glu Ser Thr Glu Pro 78s 79 O 79. 8OO Ser Ala Ser Ser Lys Lieu Pro Pro Ala Leu Lieu. Thir Thr Val Gly Met 805 810 815 Asn Gly Lys Asp Lys Asp Ile Pro Ser Phe Thr Glu Asp Gly Ala Asp 82O 825 83 O Glu Phe Thr Lieu. Ile Pro Asp Ser Thr Glin Lys Gln Lieu. Glu Glu Val 835 84 O 845 Thir Asp Glu Asp Ile Ala Ala His Gly Llys Phe Thir Ile Arg Phe Glin 850 855 860 Pro Thir Thr Ser Thr Gly Ile Ala Glu Lys Ser Thr Lieu. Arg Asp Ser 865 87O 87s 88O Thir Thr Glu Glu Lys Val Pro Pro Ile Thr Ser Thr Glu Gly Glin Val 885 890 895 Tyr Ala Thr Met Glu Gly Ser Ala Lieu. Gly Glu Val Glu Asp Val Asp 9 OO 905 91 O Lieu. Ser Llys Pro Val Ser Thr Val Pro Glin Phe Ala His Thr Ser Glu 915 92 O 925 Val Glu Gly Lieu Ala Phe Val Ser Tyr Ser Ser Thr Glin Glu Pro Thr 93 O 935 94 O Thr Tyr Val Asp Ser Ser His Thr Ile Pro Leu Ser Val Ile Pro Llys 945 950 955 96.O Thr Asp Trp Gly Val Lieu Val Pro Ser Val Pro Ser Glu Asp Glu Val 965 97O 97. Lieu. Gly Glu Pro Ser Glin Asp Ile Lieu Val Ile Asp Glin Thir Arg Lieu. 98O 985 99 O Glu Ala Thir Ile Ser Pro Glu Thr Met Arg Thr Thr Lys Ile Thr Glu 995 1OOO 1005 Gly. Thir Thr Glin Glu Glu Phe Pro Trp Llys Glu Gln Thr Ala Glu 1010 1015 1 O2O Llys Pro Val Pro Ala Leu Ser Ser Thr Ala Trp Thr Pro Lys Glu 1025 1O3 O 1035 Ala Val Thr Pro Lieu. Asp Glu Glin Glu Gly Asp Gly Ser Ala Tyr 104 O 1045 1 OSO Thr Val Ser Glu Asp Glu Lieu. Lieu. Thr Gly Ser Glu Arg Val Pro 105.5 106 O 1065 US 2013/O 189243 A1 Jul. 25, 2013 45

- Continued Val Lieu. Glu Thir Thr Pro Val Gly Lys Ile Asp His Ser Val Ser Of O O7 O8O Tyr Pro Pro Gly Ala Val Thr Glu. His Llys Val Lys Thr Asp Glu O85 O9 O O95 Val Val Thr Lieu. Thr Pro Arg Ile Gly Pro Llys Val Ser Lieu. Ser OO O5 10 Pro Gly Pro Glu Glin Llys Tyr Glu Thr Glu Gly Ser Ser Thr Thr 15 2O 25 Gly Phe Thr Ser Ser Leu Ser Pro Phe Ser Thr His Ile Thr Glin 3O 35 4 O Lieu Met Glu Glu Thir Thir Thr Glu Lys Thir Ser Lieu. Glu Asp Ile 45 SO 55 Asp Lieu. Gly Ser Gly Lieu. Phe Glu Lys Pro Lys Ala Thr Glu Lieu.

Ile Glu Phe Ser Thr Ile Llys Val Thr Val Pro Ser Asp Ile Thr

Thr Ala Phe Ser Ser Val Asp Arg Lieu. His Thr Thr Ser Ala Phe 90 95 2OO Llys Pro Ser Ser Ala Ile Thir Lys Llys Pro Pro Lieu. Ile Asp Arg 2O5 21 O 215 Glu Pro Gly Glu Glu Thir Thr Ser Asp Met Val Ile Ile Gly Glu 22O 225 23 O Ser Thr Ser His Val Pro Pro Thr Thr Lieu. Glu Asp Ile Val Ala 235 24 O 245 Lys Glu Thr Glu Thir Asp Ile Asp Arg Glu Tyr Phe Thr Thr Ser 250 255 26 O Ser Pro Pro Ala Thr Glin Pro Thr Arg Pro Pro Thr Val Glu Asp 265 27 O 27s Lys Glu Ala Phe Gly Pro Glin Ala Leu Ser Thr Pro Glin Pro Pro 28O 285 29 O Ala Ser Thr Lys Phe His Pro Asp Ile Asn Val Tyr Ile Ile Glu 295 3OO 305 Val Arg Glu Asn Llys Thr Gly Arg Met Ser Asp Lieu. Ser Val Ile 310 315 32O Gly His Pro Ile Asp Ser Glu Ser Lys Glu Asp Glu Pro Cys Ser 3.25 33 O 335 Glu Glu Thir Asp Pro Val His Asp Lieu Met Ala Glu Ile Lieu Pro 34 O 345 350 Glu Phe Pro Asp Ile Ile Glu Ile Asp Lieu. Tyr His Ser Glu Glu 355 360 365 Asn Glu Glu Glu Glu Glu Glu. Cys Ala Asn Ala Thr Asp Val Thr 37O 375 38O Thir Thr Pro Ser Val Glin Tyr Ile Asin Gly Lys His Leu Val Thr 385 390 395 Thr Val Pro Lys Asp Pro Glu Ala Ala Glu Ala Arg Arg Gly Glin 4 OO 405 41 O Phe Glu Ser Val Ala Pro Ser Glin Asn Phe Ser Asp Ser Ser Glu 415 42O 425 Ser Asp Thr His Pro Phe Val Ile Ala Lys Thr Glu Lieu Ser Thr 43 O 435 44 O

Ala Wall Glin Pro Asn. Glu Ser Thr Glu Thir Thr Glu Ser Lieu. Glu 445 450 45.5 US 2013/O 189243 A1 Jul. 25, 2013 46

- Continued

Val Thir Trp Llys Pro Glu Thir Tyr Pro Glu Thir Ser Glu. His Phe 460 465 47 O Ser Gly Gly Glu Pro Asp Val Phe Pro Thr Val Pro Phe His Glu 47s 48O 485 Glu Phe Glu Ser Gly Thr Ala Lys Lys Gly Ala Glu Ser Val Thr 490 495 SOO Glu Arg Asp Thr Glu Val Gly His Glin Ala His Glu. His Thr Glu 5 OS 510 515 Pro Val Ser Leu Phe Pro Glu Glu Ser Ser Gly Glu Ile Ala Ile 52O 525 53 O Asp Glin Glu Ser Glin Lys Ile Ala Phe Ala Arg Ala Thr Glu Val 535 54 O 545 Thr Phe Gly Glu Glu Val Glu Lys Ser Thr Ser Val Thr Tyr Thr 550 555 560 Pro Thir Ile Val Pro Ser Ser Ala Ser Ala Tyr Val Ser Glu Glu 565 st O sts Glu Ala Val Thir Lieu. Ile Gly Asn. Pro Trp Pro Asp Asp Lieu. Lieu. 58O 585 590 Ser Thr Lys Glu Ser Trp Val Glu Ala Thr Pro Arg Glin Val Val 595 6OO 605 Glu Lieu Ser Gly Ser Ser Ser Ile Pro Ile Thr Glu Gly Ser Gly 610 615 62O Glu Ala Glu Glu Asp Glu Asp Thr Met Phe Thr Met Val Thr Asp 625 63 O 635 Lieu. Ser Glin Arg Asn. Thir Thr Asp Thr Lieu. Ile Thr Lieu. Asp Thr 64 O 645 650 Ser Arg Ile Ile Thr Glu Ser Phe Phe Glu Val Pro Ala Thir Thr 655 660 665 Ile Tyr Pro Val Ser Glu Gln Pro Ser Ala Lys Val Val Pro Thr 670 675 68O Llys Phe Val Ser Glu Thir Asp Thr Ser Glu Trp Ile Ser Ser Thr 685 69 O. 695 Thr Val Glu Glu Lys Lys Arg Lys Glu Glu Glu Gly. Thir Thr Gly 7 OO 7Os 71O Thr Ala Ser Thr Phe Glu Val Tyr Ser Ser Thr Glin Arg Ser Asp 71s 72 O 72

Glin Lieu. Ile Leu Pro Phe Glu Lieu. Glu Ser Pro Asn. Wall Ala Thr 73 O 73 74 O Ser Ser Asp Ser Gly Thr Arg Llys Ser Phe Met Ser Lieu. Thir Thr 74. 7 O 7ss Pro Thr Glin Ser Glu Arg Glu Met Thr Asp Ser Thr Pro Val Phe 760 765 770 Thr Glu Thr Asn Thr Lieu. Glu Asn Lieu. Gly Ala Glin Thr Thr Glu 775 78O 78s His Ser Ser Ile His Glin Pro Gly Val Glin Glu Gly Lieu. Thir Thr 79 O 79. 8OO Lieu Pro Arg Ser Pro Ala Ser Val Phe Met Glu Gln Gly Ser Gly 805 810 815 Glu Ala Ala Ala Asp Pro Glu Thir Thr Thr Val Ser Ser Phe Ser 82O 825 83 O

Lieu. Asn Val Glu Tyr Ala Ile Glin Ala Glu Lys Glu Val Ala Gly US 2013/O 189243 A1 Jul. 25, 2013 47

- Continued

835 84 O 845

Thir Lieu. Ser Pro His Wall Glu. Thir Thr Phe Ser Thr Glu Pro Thr 850 855 86 O Gly Lieu Val Lieu. Ser Thr Val Met Asp Arg Val Val Ala Glu Asn 865 87 O 87s Ile Thr Glin Thr Ser Arg Glu Ile Val Ile Ser Glu Arg Lieu. Gly 88O 885 890 Glu Pro Asn Tyr Gly Ala Glu Ile Arg Gly Phe Ser Thr Gly Phe 895 9 OO 905 Pro Leu Glu Glu Asp Phe Ser Gly Asp Phe Arg Glu Tyr Ser Thr 910 915 92 O Val Ser His Pro Ile Ala Lys Glu Glu Thr Val Met Met Glu Gly 925 93 O 935 Ser Gly Asp Ala Ala Phe Arg Asp Thr Glin Thr Ser Pro Ser Thr 94 O 945 950 Val Pro Thir Ser Val His Ile Ser His Ile Ser Asp Ser Glu Gly 955 96.O 965 Pro Ser Ser Thr Met Val Ser Thr Ser Ala Phe Pro Trp Glu Glu 97O 97. 98 O Phe Thir Ser Ser Ala Glu Gly Ser Gly Glu Gln Leu Val Thr Val 985 990 995 Ser Ser Ser Val Val Pro Val Lieu Pro Ser Ala Val Glin Llys Phe 2OOO 2005 2010 Ser Gly Thr Ala Ser Ser Ile Ile Asp Glu Gly Lieu. Gly Glu Val 2015 2O2O 2O25 Gly Thr Val Asn Glu Ile Asp Arg Arg Ser Thr Ile Leu Pro Thr 2O3O 2O35 2O4. O Ala Glu Val Glu Gly. Thir Lys Ala Pro Val Glu Lys Glu Glu Val 2O45 2OSO 2O55 Llys Val Ser Gly Thr Val Ser Thr Asn Phe Pro Gln Thr Ile Glu 2O60 2O65 2. Of O Pro Ala Lys Lieu. Trp Ser Arg Glin Glu Val Asn Pro Val Arg Glin 2O75 2O8 O 2O85

Glu Ile Glu Ser Glu. Thir Thir Ser Glu Glu Glin Ile Glin Glu Glu 2O90 2095 21OO Lys Ser Phe Glu Ser Pro Glin Asn Ser Pro Ala Thr Glu Gln Thr

Ile Phe Asp Ser Glin Thr Phe Thr Glu Thr Glu Lieu Lys Thir Thr

Asp Tyr Ser Val Lieu. Thir Thr Lys Llys Thr Tyr Ser Asp Asp Llys

Glu Met Lys Glu Glu Asp Thir Ser Leu Val Asn Met Ser Thr Pro

Asp Pro Asp Ala Asn Gly Lieu. Glu Ser Tyr Thir Thr Lieu Pro Glu

Ala Thr Glu Lys Ser His Phe Phe Leu Ala Thr Ala Leu Val Thr

Glu Ser Ile Pro Ala Glu. His Val Val Thr Asp Ser Pro Ile Lys 21.95 22 OO 22O5 Lys Glu Glu Ser Thr Lys His Phe Pro Lys Gly Met Arg Pro Thr 221 O 2215 222 O US 2013/O 189243 A1 Jul. 25, 2013 48

- Continued Ile Glin Glu Ser Asp Thr Glu Lieu. Lieu. Phe Ser Gly Lieu. Gly Ser 2225 223 O 2235 Gly Glu Glu Val Lieu Pro Thr Lieu Pro Thr Glu Ser Val Asn Phe 224 O 2.245 225 O Thr Glu Val Glu Glin Ile Asn Asn Thr Lieu. Tyr Pro His Thir Ser 2255 226 O 2265 Glin Val Glu Ser Thir Ser Ser Asp Llys Ile Glu Asp Phe Asn Arg 2270 2275 228O Met Glu Asn Val Ala Lys Glu Val Gly Pro Leu Val Ser Glin Thr 2285 229 O 2295 Asp Ile Phe Glu Gly Ser Gly Ser Val Thr Ser Thr Thr Lieu. Ile 23 OO 23 OS 2310 Glu Ile Leu Ser Asp Thr Gly Ala Glu Gly Pro Thr Val Ala Pro 2315 232O 2325 Lieu Pro Phe Ser Thr Asp Ile Gly His Pro Glin Asn Glin Thr Val 233 O 2335 234 O Arg Trp Ala Glu Glu Ile Glin Thr Ser Arg Pro Gln Thr Ile Thr 2345 2350 2355 Glu Glin Asp Ser Asn Lys Asn. Ser Ser Thr Ala Glu Ile Asn. Glu 2360 23.65 2370 Thir Thir Thr Ser Ser Thr Asp Phe Leu Ala Arg Ala Tyr Gly Phe 2375 238O 23.85 Glu Met Ala Lys Glu Phe Val Thr Ser Ala Pro Llys Pro Ser Asp 23.90 23.95 24 OO Lieu. Tyr Tyr Glu Pro Ser Gly Glu Gly Ser Gly Glu Val Asp Ile 24 O5 241. O 24.15 Val Asp Ser Phe His Thr Ser Ala Thr Thr Glin Ala Thr Arg Glin 242O 24.25 243 O Glu Ser Ser Thr Thr Phe Val Ser Asp Gly Ser Lieu. Glu Lys His 2435 244 O 2445 Pro Glu Val Pro Ser Ala Lys Ala Val Thr Ala Asp Gly Phe Pro 2450 2455 246 O Thr Val Ser Val Met Leu Pro Leu. His Ser Glu Gln Asn Lys Ser 24 65 2470 2475 Ser Pro Asp Pro Thr Ser Thr Lieu Ser Asn Thr Val Ser Tyr Glu 248O 2485 249 O Arg Ser Thr Asp Gly Ser Phe Glin Asp Arg Phe Arg Glu Phe Glu 2495 25 OO 2505 Asp Ser Thr Lieu Lys Pro Asn Arg Llys Llys Pro Thr Glu Asn. Ile 251O 25.15 252O Ile Ile Asp Lieu. Asp Llys Glu Asp Lys Asp Lieu. Ile Lieu. Thir Ile 2525 253 O 25.35 Thr Glu Ser Thr Ile Leu Glu Ile Leu Pro Glu Lieu. Thir Ser Asp 254 O 25.45 2550 Lys Asn. Thir Ile Ile Asp Ile Asp His Thr Llys Pro Val Tyr Glu 2555 2560 25.65 Asp Ile Leu Gly Met Glin Thr Asp Ile Asp Thr Glu Val Pro Ser 2570 27s 2580 Glu Pro His Asp Ser Asn Asp Glu Ser Asn Asp Asp Ser Thr Glin 2585 2590 2595

Val Glin Glu Ile Tyr Glu Ala Ala Val Asn Lieu. Ser Lieu. Thr Glu 26 OO 2605 261 O US 2013/O 189243 A1 Jul. 25, 2013 49

- Continued

Glu Thr Phe Glu Gly Ser Ala Asp Val Leu Ala Ser Tyr Thr Glin 2615 262O 262s Ala Thr His Asp Glu Ser Met Thr Tyr Glu Asp Arg Ser Glin Lieu. 263 O 2635 264 O Asp His Met Gly Phe His Phe Thr Thr Gly Ile Pro Ala Pro Ser 2645 2650 2655 Thr Glu Thr Glu Lieu. Asp Val Lieu. Leu Pro Thr Ala Thr Ser Lieu. 266 O 2665 2670 Pro Ile Pro Arg Llys Ser Ala Thr Val Ile Pro Glu Ile Glu Gly 2675 268O 2685 Ile Lys Ala Glu Ala Lys Ala Lieu. Asp Asp Met Phe Glu Ser Ser 2690 2695 27 OO Thir Lieu. Ser Asp Gly Glin Ala Ile Ala Asp Glin Ser Glu Ile Ile 27 OS 271 O 2715 Pro Thr Lieu. Gly Glin Phe Glu Arg Thr Glin Glu Glu Tyr Glu Asp 272O 2725 273 O Lys Llys His Ala Gly Pro Ser Phe Glin Pro Glu Phe Ser Ser Gly 2735 274 O 2745 Ala Glu Glu Ala Lieu Val Asp His Thr Pro Tyr Lieu. Ser Ile Ala 2750 27s 276 O Thir Thr His Leu Met Asp Glin Ser Val Thr Glu Val Pro Asp Val 2765 2770 2775 Met Glu Gly Ser Asn Pro Pro Tyr Tyr Thr Asp Thr Thr Lieu Ala 2780 2785 279 O Val Ser Thr Phe Ala Lys Lieu Ser Ser Glin Thr Pro Ser Ser Pro 2.79s 28OO 2805 Lieu. Thir Ile Tyr Ser Gly Ser Glu Ala Ser Gly His Thr Glu Ile 2810 2815 282O Pro Gln Pro Ser Ala Leu Pro Gly Ile Asp Val Gly Ser Ser Val 2825 283 O 2835 Met Ser Pro Glin Asp Ser Phe Lys Glu Ile His Val Asn Ile Glu 284 O 284.5 285 O Ala Thr Phe Llys Pro Ser Ser Glu Glu Tyr Lieu. His Ile Thr Glu 2855 286 O 2865 Pro Pro Ser Leu Ser Pro Asp Thr Lys Lieu. Glu Pro Ser Glu Asp 2870 2875 288O Asp Gly Llys Pro Glu Lieu. Lieu. Glu Glu Met Glu Ala Ser Pro Thr 2.885 289 O 2.895 Glu Lieu. Ile Ala Val Glu Gly Thr Glu Ile Lieu. Glin Asp Phe Glin 29 OO 29 OS 291. O Asn Llys Thr Asp Gly Glin Val Ser Gly Glu Ala Ile Llys Met Phe 291.5 292 O 2925 Pro Thir Ile Llys Thr Pro Glu Ala Gly Thr Val Ile Thr Thr Ala 293 O 2935 294 O Asp Glu Ile Glu Lieu. Glu Gly Ala Thr Glin Trp Pro His Ser Thr 29.45 295 O 2955 Ser Ala Ser Ala Thr Tyr Gly Val Glu Ala Gly Val Val Pro Trp 2960 296.5 297 O Lieu. Ser Pro Gln Thr Ser Glu Arg Pro Thr Lieu Ser Ser Ser Pro 297 298O 2985

Glu Ile Asn Pro Glu Thr Glin Ala Ala Lieu. Ile Arg Gly Glin Asp US 2013/O 189243 A1 Jul. 25, 2013 50

- Continued

2990 2995 3 OOO Ser Thir Ile Ala Ala Ser Glu Glin Glin Val Ala Ala Arg Ile Lieu. 3 O OS 3O1 O 3 O15 Asp Ser Asn Asp Glin Ala Thr Val Asn Pro Val Glu Phe Asn Thr 3O2O 3O25 3O3O

Glu Wall Ala Thr Pro Pro Phe Ser Lieu Lleu. Glu Thir Ser Asn. Glu 3035 3O4 O 3O45 Thr Asp Phe Lieu. Ile Gly Ile Asin Glu Glu Ser Val Glu Gly Thr 3 OSO 3 O55 3 O 6 O Ala Ile Tyr Lieu Pro Gly Pro Asp Arg Cys Llys Met Asn. Pro Cys 3 O 65 3. Of O 3 Ofs Lieu. Asn Gly Gly Thr Cys Tyr Pro Thr Glu Thir Ser Tyr Val Cys 3O8O 3O85 3 O9 O Thr Cys Val Pro Gly Tyr Ser Gly Asp Gln Cys Glu Lieu. Asp Phe 3095 31OO 3105 Asp Glu. Cys His Ser Asn Pro Cys Arg Asn Gly Ala Thr Cys Wall

Asp Gly Phe Asn Thr Phe Arg Cys Lieu. Cys Lieu Pro Ser Tyr Val

Gly Ala Lieu. Cys Glu Glin Asp Thr Glu Thir Cys Asp Tyr Gly Trp

His Llys Phe Glin Gly Glin Cys Tyr Lys Tyr Phe Ala His Arg Arg

Thir Trp Asp Ala Ala Glu Arg Glu. Cys Arg Lieu. Glin Gly Ala His

Lieu. Thir Ser Ile Leu Ser His Glu Glu Gln Met Phe Val Asn Arg

Val Gly His Asp Tyr Glin Trp Ile Gly Lieu. Asn Asp Llys Met Phe 32OO 32O5 321 O Glu. His Asp Phe Arg Trp Thr Asp Gly Ser Thr Lieu. Glin Tyr Glu 3215 322 O 3225 Asn Trp Arg Pro Asn Glin Pro Asp Ser Phe Phe Ser Ala Gly Glu 323 O 3235 324 O Asp Cys Val Val Ile Ile Trp His Glu Asn Gly Glin Trp Asn Asp 3.245 325 O 3255 Val Pro Cys Asn Tyr His Lieu. Thr Tyr Thr Cys Llys Lys Gly Thr 326 O 3265 3270 Val Ala Cys Gly Glin Pro Pro Val Val Glu Asn Ala Lys Thr Phe 3275 328O 3285 Gly Lys Met Llys Pro Arg Tyr Glu Ile Asn. Ser Lieu. Ile Arg Tyr 3290 3.295 33 OO His Cys Lys Asp Gly Phe Ile Glin Arg His Lieu Pro Thir Ile Arg 3305 3310 3.31.5 Cys Lieu. Gly Asn Gly Arg Trp Ala Ile Pro Llys Ile Thr Cys Met 332O 3.325 333 O Asn Pro Ser Ala Tyr Glin Arg Thr Tyr Ser Met Lys Tyr Phe Lys 33.35 334 O 3.345 Asn Ser Ser Ser Ala Lys Asp Asn. Ser Ile Asn. Thir Ser Llys His 3350 3355 3360 Asp His Arg Trp Ser Arg Arg Trp Glin Glu Ser Arg Arg 33 65 337 O 337s

US 2013/O 189243 A1 Jul. 25, 2013 53

- Continued gtgctato.cg tatgc.calaa acacctgaca agatgaaaaa gtcaaaatct gtaaaggaag 4 44 O acagcaac ct cacticttcaa gagaagaaag agaagat coa gacaggttta aagaa.gctaa 4500 cagagcttgg aaccgtggac C caaagaa.ca aataccagga actgat Caac gaCattgc.ca 456 O gggatatt.cg gaatcagogg agg taccgac agaggagaaa ggc.cgaact a gtgaaactgc 462O alacaga cata cqctgctctgaactictaagg ccaccttitta tigggagcag gtggattact 468O ataaaagcta tat caaaacc togcttggata acttagc.cag caagggcaaa gtc. tccaaaa 474. O agcc taggga aatgaaagga aagaaaag.ca aaaagattitc. tctgaaatat acagcagcaa. 48OO gact acatga aaaaggagtt Cttctggalaa ttgaggacct gcaagtgaat cagtttaaaa 486 O atgttatatt taaat cagt cca acagaag aagttggaga Cttcaagtgaaagccalaat 492 O t catgggagt tdaaatggag actitt tatgt tacattatca ggacctgctg. Cagct acagt 498O atgaaggagt to agt catgaaattatttgatagagctaa agtaaatgtc. aacct Cotga 5040 tott cottct caacaaaaag ttctacggga agtaattgat cqtttgctgc cagcc cagaa 51OO ggatgaagga aagaagicacic ticacagotcc tittctagg to cittctitt colt cattggaagic 516 O aaag acctag ccaacaacag cacct caatc tdata cactic ccgatgccac atttittaact 522 O cct citcgctic tdatgggaca tttgttaccc titttitt cata gtgaaattgt gttt caggct 528 O tagt ctdacc tittctggttt citt catttitc titc cattact taggaaagag toggaaacticc 534 O actaaaattt citctgtgttg ttacagt citt agaggttgca gtactatatt gtaagctittg 54 OO gtgtttgttt aattagcaat agggatggta ggattcaaat gtgtgtcatt tagaagtgga 546 O agct attagc accaatgaca taaatacata caaga cacac aactaaaatgtcatgttatt 552O aacagttatt aggttgtcat ttaaaaataa agttc ctitta tatttctgtc. c catcaggaa 558 O aactgaagga tatggggaat cattggitt at Ctt coattgt gtttittctitt atggacagga 564 O gctaatggaa gtgacagt catttcaaagg aag catttct agaaaaaagg agataatgtt st OO tittaaattitc attatcaaac ttgggcaatt ctdtttgtgt aactic ccc.ga citagtggatg 576. O ggagagtic cc attgctaaaa ttcagctact Cagataaatt Cagaatgggt Caaggcacct 582O gcctgtttitt gttggtgcac agagattgac ttgattcaga gagacaattic act coat coc 588 O tatggcagag gaatgggitta gcc ctaatgt agaatgtcat tdtttittaaa actgtttitat 594 O atcttalagag tec Ctt atta aagtatagat gtatgtc.tta aaatgtgggit gatagga att 6 OOO ttaaagattt atataatgca totaaaag.cct tagaataaga aaa.gctttitt ttaaattgct 6 O6 O ttatctgt at atctgaactic titgaaactta tagctaaaac act aggattt atctgcagtg 612 O ttcagggaga taattctgcc tittaattgtc taaaacaaaa acaaaac cag cca acctatg 618O ttacacgtga gattaaaacc aattittitt co coatttitttc. tcc titttitt c ticttgctgcc 624 O cacattgtgc ctittattitta tdagc.cccag ttitt ctoggc titagtttaaa aaaaaaatca 63 OO agtictaaa.ca ttgcatttag aaa.gcttttgttcttggata aaaagt cata cactittaaaa 636 O aaaaaaaaaa citttitt coag gaaaatatat tdaaatcatg citgctgagcc tictattittct 642O ttctittgatgttittgattica gtatt cittitt at cataaatt tittagcattt aaaaatt cac 648 O tgatgtacat taa.gc.caata aactgctitta atgaataa.ca aactatogtag tdtgtcc cta 654 O ttataaatgc attggagaag tatttittatg agact ctitta citcaggtgca tdgttacagc 66OO ccacagggag gcatggagtg C catggalagg attcgcc act acccagacct tdtttitttgt 666 O tg tattittgg aagacaggitt ttittaaagaa acatttitcct cagattaaaa gatgatgcta 672 O US 2013/O 189243 A1 Jul. 25, 2013 54

- Continued ttacaactag cattgcctica aaaactggga ccaac caaag togtgtcaacc ctdtttccitt 678 O. aaaagaggct atgaatcc.ca aaggccacat C caagacagg caataatgag cagagtttac 6840 agct cottta ataaaatgtg toagtaattt taaggtttat agttc cct ca acacaattgc 69 OO taatgcagaa tagtgtaaaa togcttcaa gaatgttgat gatgatgata tagaattgtg 696 O gctittagtag cacagaggat gcc ccaacaa act catgg.cg ttgaaac cac acagttctica 7 O2O ttactgtt at ttattagctg. tag cattct c tdt ct cotct ct citcct cot ttgacct tct 708 O cct cqaccag ccatcatgac atttaccatgaatttactitc ctic ccaagag tittgg actgc 714. O ccgt.ca.gatt gttgctgcac at agttgcct ttgtatic tot gitatgaaata aaagg to att f2OO tgttcatgtt aaaaaaaaa 7219

<210s, SEQ ID NO 6 &211s LENGTH: 1657 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 6 Met Ser Ala Ala Asp Glu Val Asp Gly Lieu. Gly Val Ala Arg Pro His 1. 5 1O 15 Tyr Gly Ser Val Lieu. Asp Asn. Glu Arg Lieu. Thir Ala Glu Glu Met Asp 2O 25 3O Glu Arg Arg Arg Glin Asn Val Ala Tyr Glu Tyr Lieu. Cys His Lieu. Glu. 35 4 O 45 Glu Ala Lys Arg Trp Met Glu Ala Cys Lieu. Gly Glu Asp Lieu Pro Pro SO 55 6 O Thir Thr Glu Lieu. Glu Glu Gly Lieu. Arg Asn Gly Val Tyr Lieu Ala Lys 65 70 7s 8O Lieu. Gly Asn Phe Phe Ser Pro Llys Val Val Ser Lieu Lys Lys Ile Tyr 85 90 95 Asp Arg Glu Glin Thr Arg Tyr Lys Ala Thr Gly Lieu. His Phe Arg His 1OO 105 11 O Thir Asp Asn Val Ile Glin Trp Lieu. Asn Ala Met Asp Glu Ile Gly Lieu. 115 12 O 125 Pro Lys Ile Phe Tyr Pro Glu Thir Thr Asp Ile Tyr Asp Arg Lys Asn 13 O 135 14 O Met Pro Arg Cys Ile Tyr Cys Ile His Ala Leu Ser Lieu. Tyr Lieu Phe 145 150 155 160 Llys Lieu. Gly Lieu Ala Pro Glin Ile Glin Asp Lieu. Tyr Gly Llys Val Asp 1.65 17O 17s Phe Thr Glu Glu Glu Ile Asn Asn Met Lys Thr Glu Lieu. Glu Lys Tyr 18O 185 19 O Gly Ile Gln Met Pro Ala Phe Ser Lys Ile Gly Gly Ile Lieu Ala Asn 195 2OO 2O5 Glu Lieu. Ser Val Asp Glu Ala Ala Lieu. His Ala Ala Val Ile Ala Ile 21 O 215 22O Asn Glu Ala Ile Asp Arg Arg Ile Pro Ala Asp Thr Phe Ala Ala Lieu 225 23 O 235 24 O Lys Asn Pro Asn Ala Met Lieu Val Asn Lieu. Glu Glu Pro Lieu Ala Ser 245 250 255

Thir Tyr Glin Asp Ile Lieu. Tyr Glin Ala Lys Glin Asp Llys Met Thr Asn 26 O 265 27 O US 2013/O 189243 A1 Jul. 25, 2013 55

- Continued

Ala Lys Asn Arg Thr Glu Asn. Ser Glu Arg Glu Arg Asp Val Tyr Glu 27s 28O 285 Glu Lieu. Lieu. Thr Glin Ala Glu Ile Glin Gly Asn. Ile Asn Llys Val Asn 29 O 295 3 OO Thir Phe Ser Ala Lieu Ala Asn. Ile Asp Lieu Ala Lieu. Glu Glin Gly Asp 3. OS 310 315 32O Ala Lieu Ala Lieu. Phe Arg Ala Lieu. Glin Ser Pro Ala Lieu. Gly Lieu. Arg 3.25 330 335 Gly Lieu. Glin Glin Glin Asn. Ser Asp Trp Tyr Lieu Lys Glin Lieu. Lieu. Ser 34 O 345 35. O Asp Llys Glin Glin Lys Arg Glin Ser Gly Glin Thr Asp Pro Lieu Gln Lys 355 360 365 Glu Glu Lieu. Glin Ser Gly Val Asp Ala Ala Asn. Ser Ala Ala Glin Glin 37 O 375 38O Tyr Glin Arg Arg Lieu Ala Ala Val Ala Lieu. Ile Asn Ala Ala Ile Glin 385 390 395 4 OO Lys Gly Val Ala Glu Lys Thr Val Lieu. Glu Lieu Met Asn Pro Glu Ala 4 OS 41O 415 Glin Lieu Pro Glin Val Tyr Pro Phe Ala Ala Asp Lieu. Tyr Glin Lys Glu 42O 425 43 O Lieu Ala Thr Lieu. Glin Arg Glin Ser Pro Glu. His Asn Lieu. Thr His Pro 435 44 O 445

Glu Lieu. Ser Wall Ala Wall Glu Met Lieu. Ser Ser Wall Ala Lieu. Ile Asn 450 45.5 460 Arg Ala Lieu. Glu Ser Gly Asp Val Asn Thr Val Trp Llys Glin Lieu. Ser 465 470 47s 48O Ser Ser Val Thr Gly Lieu. Thir Asn. Ile Glu Glu Glu Asn. Cys Glin Arg 485 490 495 Tyr Lieu. Asp Glu Lieu Met Lys Lieu Lys Ala Glin Ala His Ala Glu Asn SOO 505 51O Asn Glu Phe Ile Thir Trp Asn Asp Ile Glin Ala Cys Val Asp His Val 515 52O 525 Asn Lieu Val Val Glin Glu Glu. His Glu Arg Ile Lieu Ala Ile Gly Lieu 53 O 535 54 O Ile Asin Glu Ala Lieu. Asp Glu Gly Asp Ala Glin Llys Thr Lieu. Glin Ala 5.45 550 555 560 Lieu. Glin Ile Pro Ala Ala Lys Lieu. Glu Gly Val Lieu Ala Glu Val Ala 565 st O sts Glin His Tyr Glin Asp Thir Lieu. Ile Arg Ala Lys Arg Glu Lys Ala Glin 58O 585 59 O Glu Ile Glin Asp Glu Ser Ala Val Lieu. Trp Lieu. Asp Glu Ile Glin Gly 595 6OO 605 Gly Ile Trp Glin Ser Asn Lys Asp Thr Glin Glu Ala Glin Llys Phe Ala 610 615 62O Lieu. Gly Ile Phe Ala Ile Asn. Glu Ala Val Glu Ser Gly Asp Val Gly 625 630 635 64 O Llys Thr Lieu. Ser Ala Lieu. Arg Ser Pro Asp Val Gly Lieu. Tyr Gly Val 645 650 655 Ile Pro Glu. Cys Gly Glu Thir Tyr His Ser Asp Lieu Ala Glu Ala Lys 660 665 67 O Llys Llys Llys Lieu Ala Val Gly Asp Asn. Asn. Ser Llys Trp Val Llys His US 2013/O 189243 A1 Jul. 25, 2013 56

- Continued

675 68O 685 Trp Val Lys Gly Gly Tyr Tyr Tyr Tyr His Asn Lieu. Glu Thr Glin Glu 69 O. 695 7 OO Gly Gly Trp Asp Glu Pro Pro Asn Phe Val Glin Asn Ser Met Glin Leu 7 Os 71O 71s 72O Ser Arg Glu Glu Ile Glin Ser Ser Ile Ser Gly Val Thr Ala Ala Tyr 72 73 O 73 Asn Arg Glu Glin Lieu. Trp Lieu Ala Asn. Glu Gly Lieu. Ile Thr Arg Lieu 740 74. 7 O Glin Ala Arg Cys Arg Gly Tyr Lieu Val Arg Glin Glu Phe Arg Ser Arg 7ss 760 765 Met Asin Phe Leu Lys Lys Glin Ile Pro Ala Ile Thr Cys Ile Glin Ser 770 775 78O Glin Trp Arg Gly Tyr Lys Glin Llys Lys Ala Tyr Glin Asp Arg Lieu Ala 78s 79 O 79. 8OO Tyr Lieu. Arg Ser His Lys Asp Glu Val Val Lys Ile Glin Ser Lieu Ala 805 810 815 Arg Met His Glin Ala Arg Lys Arg Tyr Arg Asp Arg Lieu. Glin Tyr Phe 82O 825 83 O Arg Asp His Ile Asn Asp Ile Ile Lys Ile Glin Ala Phe Ile Arg Ala 835 84 O 845 Asn Lys Ala Arg Asp Asp Tyr Lys Thir Lieu. Ile Asn Ala Glu Asp Pro 850 855 860 Pro Met Val Val Val Arg Llys Phe Val His Lieu. Lieu. Asp Glin Ser Asp 865 87O 87s 88O Glin Asp Phe Glin Glu Glu Lieu. Asp Lieu Met Lys Met Arg Glu Glu Val 885 890 895 Ile Thr Lieu. Ile Arg Ser Asn Glin Glin Lieu. Glu Asn Asp Lieu. Asn Lieu. 9 OO 905 91 O Met Asp Ile Lys Ile Gly Lieu. Lieu Val Lys Asn Lys Ile Thr Lieu. Glin 915 92 O 925 Asp Val Val Ser His Ser Llys Llys Lieu. Thir Lys Lys Asn Lys Glu Glin 93 O 935 94 O Lieu. Ser Asp Met Met Met Ile Asn Lys Gln Lys Gly Gly Lieu Lys Ala 945 950 955 96.O Lieu. Ser Lys Glu Lys Arg Glu Lys Lieu. Glu Ala Tyr Gln His Lieu. Phe 965 97O 97. Tyr Lieu. Leu Gln Thr Asn Pro Thr Tyr Lieu Ala Lys Lieu. Ile Phe Glin 98O 985 99 O Met Pro Glin Asn Lys Ser Thr Llys Phe Met Asp Ser Val Ile Phe Thr 995 1OOO 1005 Lieu. Tyr Asn Tyr Ala Ser Asn Glin Arg Glu Glu Tyr Lieu Lleu Lieu. 1010 1015 1 O2O Arg Lieu. Phe Llys Thir Ala Lieu. Glin Glu Glu Ile Llys Ser Llys Val 1025 1O3 O 1035 Asp Glin Ile Glin Glu Ile Val Thr Gly ASn Pro Thr Val Ile Lys 104 O 1045 1 OSO Met Val Val Ser Phe Asin Arg Gly Ala Arg Gly Glin Asn Ala Lieu. 105.5 106 O 1065 Arg Glin Ile Lieu Ala Pro Val Val Lys Glu Ile Met Asp Asp Llys 1070 1075 108 O US 2013/O 189243 A1 Jul. 25, 2013 57

- Continued Ser Lieu. Asn. Ile Llys Thr Asp Pro Val Asp Ile Tyr Lys Ser Trp O85 O9 O O95 Val Asn Gln Met Glu Ser Glin Thr Gly Glu Ala Ser Lys Lieu Pro OO O5 10 Tyr Asp Val Thr Pro Glu Glin Ala Lieu Ala His Glu Glu Wall Lys

Thir Arg Lieu. Asp Ser Ser e Arg Asn Met Arg Ala Val Thr Asp

Llys Phe Lieu. Ser Ala Ile Val Ser Ser Val Asp Llys Ile Pro Tyr

Gly Met Arg Phe Ile Ala Lys Val Lieu Lys Asp Ser Lieu. His Glu

Llys Phe Pro Asp Ala Gly Glu Asp Glu Lieu Lleu Lys Ile Ile Gly

Asn Lieu. Lieu. Tyr Tyr Arg Tyr Met Asn Pro Ala e Wall Ala Pro

Asp Ala Phe Asp Ile Ile Asp Lieu. Ser Ala Gly Gly Glin Lieu. Thr

Thir Asp Glin Arg Arg Asn Lieu. Gly Ser Ile Ala Lys Met Lieu. Glin 22O 225 23 O His Ala Ala Ser Asn Llys Met Phe Lieu. Gly Asp Asn Ala His Lieu. 235 24 O 245 Ser Ile Ile ASn Glu Tyr Lieu. Ser Glin Ser Tyr Gln Llys Phe Arg 250 255 26 O Arg Phe Phe Glin Thir Ala Cys Asp Val Pro Glu Lieu. Glin Asp Llys 265 27 O 27s Phe Asin Val Asp Glu Tyr Ser Asp Leu Val Thr Lieu. Thir Lys Pro 28O 285 29 O Val Ile Tyr Ile Ser Ile Gly Glu Ile Ile Asn Thr His Thr Lieu. 295 3OO 305 Lieu. Lieu. Asp His Glin Asp Ala Ile Ala Pro Glu. His Asn Asp Pro 310 315 32O Ile His Glu Lieu. Lieu. Asp Asp Lieu. Gly Glu Val Pro Thir Ile Glu 3.25 33 O 335 Ser Lieu. Ile Gly Glu Ser Ser Gly Asn Lieu. Asn Asp Pro Asn Llys 34 O 345 350 Glu Ala Lieu Ala Lys Thr Glu Val Ser Lieu. Thir Lieu. Thir Asn Llys 355 360 365 Phe Asp Val Pro Gly Asp Glu Asn Ala Glu Met Asp Ala Arg Thr 37O 375 38O Ile Lieu. Lieu. Asn. Thir Lys Arg Lieu. Ile Val Asp Wal Ile Arg Phe 385 390 395 Gln Pro Gly Glu Thir Lieu. Thr Glu Ile Leu Glu Thr Pro Ala Thr 4 OO 405 41 O Ser Glu Glin Glu Ala Glu. His Glin Arg Ala Met Glin Arg Arg Ala 415 42O 425 Ile Arg Asp Ala Lys Thr Pro Asp Llys Met Lys Llys Ser Lys Ser 43 O 435 44 O Val Lys Glu Asp Ser Asn Lieu. Thir Lieu. Glin Glu Lys Lys Glu Lys 445 450 45.5

Ile Glin Thr Gly Lieu Lys Llys Lieu. Thr Glu Lieu. Gly Thr Val Asp 460 465 47 O US 2013/O 189243 A1 Jul. 25, 2013 58

- Continued

Pro Lys Asn Llys Tyr Glin Glu Luell Ile ASn Asp Ala Arg Asp 47s 48O

Ile Asn Glin Arg Arg yr Glin Arg Arg Ala Glu Lieu. 495

Wall Lieu. Glin Glin Thir Ala Ala Luell Asn Ala Thr 510

Phe Gly Glu Glin Wall Tyr Ser Ile Lys Thr 525

Luell Asp Asn Lieu. Ala Ser Wall Llys Pro 535 54 O

Arg Glu Met Lys Gly Ser Ile Luell 550 555

Thir Ala Arg Lieu. His Glu Gly Wall Lell Lell Glu Ile Glu 565 st O sts

Asp Luell Glin Wall Asn Glin Phe Asn Wall Ile Phe Glu Ile Ser 58O 585 590

Pro Glu Glu Wall Gly Phe Glu Wall Ala Phe Met 595 605

Gly Wall Gln Met Glu Thir Phe Met Luell His Glin Asp Lieu. Luell 610 615 62O

Glin Luell Gln Tyr Glu Gly Ala Wall Met Lell Phe Asp Arg 625 63 O 635

Ala Wall Asn. Wall Asn Luell Luell Ile Phe Lell Lell ASn 64 O 645 650

Phe yr Gly Lys 655

<210s, SEQ ID NO 7 &211s LENGTH: 847 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OO > SEQUENCE: 7 acagagtaala Cttittgctgg gct coaagtg accocccata gttt attata alaggtgactg 6 O caccctgcag ccaccagdac tgcctggctic cacgtgcctic Ctggit ct cag tatggcgctg 12 O t cct gggttc ttacagtic ct gag cct cota Cct ctgctgg aag.cccagat cc cattgttgt 18O gcca acctag taccggtgcc Cat Caccaac gcc accctgg accggat cac tggcaagttgg 24 O ttittatat cq catcggcc tt tcgaaacgag gagtacalata agt cq9ttca ggagatccala 3OO gcaacct tct tttact tcac c cc caacaag acagaggaca cgatctittct cagagagtac 360

Cagaccc.gac aggaccagtg Catctataac accacct acc tgaatgtc.ca gcgggaaaat gggaccatct C Cagatacgt gggaggcCaa gag catttcg ctic acttgct gatcct cagg gacaccaaga cctacatgct tgcttittgac gtgaacgatg agaagaactg ggggctgttct 54 O gtctatgctg acaa.gc.ca.ga gacgaccalag gagcaactgg gagagttcta cgaagct ct c gactgcttgc gcatt.cccaa gtcagatgtc. gtgtacaccg attggaaaaa ggataagtgt 660 gagg cactgg agaagcagca cgagalaggag aggaaac agg aggaggggga atcctagoag 72 O gacacagcct tat cagga cagagacittg ggggg catcc tgc.ccct coa acccgacatg tgtacct cag ctittitt coct cacttgcatc aataaagctt Ctgtgtttgg aac agctaaa 84 O aaaaaaa. 847 US 2013/O 189243 A1 Jul. 25, 2013 59

- Continued

<210s, SEQ ID NO 8 &211s LENGTH: 2O1 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 8 Met Ala Lieu. Ser Trp Val Lieu. Thr Val Lieu. Ser Lieu. Lieu Pro Lieu. Lieu. 1. 5 1O 15 Glu Ala Glin Ile Pro Leu. Cys Ala Asn Lieu Val Pro Val Pro Ile Thr 2O 25 3O Asn Ala Thir Lieu. Asp Arg Ile Thr Gly Lys Trp Phe Tyr Ile Ala Ser 35 4 O 45 Ala Phe Arg Asn. Glu Glu Tyr Asn Llys Ser Val Glin Glu Ile Glin Ala SO 55 6 O Thr Phe Phe Tyr Phe Thr Pro Asn Llys Thr Glu Asp Thr Ile Phe Leu 65 70 7s 8O Arg Glu Tyr Glin Thr Arg Glin Asp Gln Cys Ile Tyr Asn. Thir Thr Tyr 85 90 95 Lieu. Asn Val Glin Arg Glu Asn Gly. Thir Ile Ser Arg Tyr Val Gly Gly 1OO 105 11 O Glin Glu. His Phe Ala His Lieu. Lieu. Ile Lieu. Arg Asp Thir Lys Thr Tyr 115 12 O 125 Met Lieu. Ala Phe Asp Val Asn Asp Glu Lys ASn Trp Gly Lieu. Ser Val 13 O 135 14 O Tyr Ala Asp Llys Pro Glu Thir Thr Lys Glu Gln Leu Gly Glu Phe Tyr 145 150 155 160 Glu Ala Lieu. Asp Cys Lieu. Arg Ile Pro Llys Ser Asp Val Val Tyr Thr 1.65 17O 17s Asp Trp Llys Lys Asp Llys Cys Glu Pro Lieu. Glu Lys Gln His Glu Lys 18O 185 19 O Glu Arg Lys Glin Glu Glu Gly Glu Ser 195 2OO

<210s, SEQ ID NO 9 &211s LENGTH: 1447 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 9 tgtcactgag ggttgactga Ctggagagct Caagtgcagc aaa.gagaagt gtcagagcat 6 O gagggccaag ticcagalacca tagggatt at tagct cot ttcticaaagg gacagcc acg 12 O aggaggggtg gaagaaggcc ctacagtatt gagaaaggct ggtctgcttg agaaact taa 18O agaacaagag ttgatgtga aggattatgg ggacctg.ccc tittgctgaca t c cctaatga 24 O

Cagt cc ctitt Caaattgttga agaatccaag gtctgtggga aaa.gcaa.gcg agcagctggc 3OO tggcaaggtg gCagaagt ca agaagaacgg aagaatcagc Ctggtgctgg gcggagacca 360

Cagtttggca attggaag catct ctggcca to Cagggtc. caccctgat C ttggagt cat 42O ctgggtggat gct cacactg at atcaacac tocactgaca accacaagtg gaaacttgca 48O tggaca acct gtatictitt Co. tcc taagga act aaaagga aagatt.cccg atgtgcc agg 54 O attctic ctgg gtgacticcict gtatatctgc Caaggatatt gtgtatattg gcttgagaga 6OO cgtggaccct ggggaacact acattttgaa aactic taggc attaaatact tttcaatgac 660 US 2013/O 189243 A1 Jul. 25, 2013 60

- Continued tgaagtggac agacitaggaa ttggcaaggt gatggaagaa acact cagct at Ctact agg 72 O aagaaagaaa aggccaattic atctaagttt tdatgttgac gigacitggacc catctitt cac 78O accagctact ggcacaccag ticgtgggagg totgacatac agaga aggt c tict acat cac 84 O agaagaaatc tacaaaac agggctactict c aggattagat ataatggaag talacc catc 9 OO Cctggggaag acaccagaag aagta actic alacagtgaac acagcagttg caataac Ctt 96.O ggcttgtttic ggacttgctic gggagggitaa t caca agcct attgact acc tta acccacc O2O taagtaaatg toggaaacatc cqatataaat ct catagitta atggcataat tagaaagcta O8O at cattttct taa.gcataga gttatcct tc taaag acttg ttctitt caga aaaatgttitt 14 O tccaattagt ataaacticta caaatticcict cittggtgtaa aattcaagat gtggaaattic 2OO taacttittitt gaaatttaaa agcttatatt ttctaacttig gcaaaag act tat cottaga 26 O aagagaagtg tacattgatt to caattaaa aatttgctgg cattaaaaat aag cacactt 32O acataagc cc c catacatag agtgggactic ttggaat cag gagacaaagc taccacatgt 38O ggaaagg tac tatgtgtc.ca tdt cattcaa aaaatgtgat tttittataat aaact ctitta 44 O taacaag 447

<210s, SEQ ID NO 10 &211s LENGTH: 322 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 10 Met Ser Ala Lys Ser Arg Thr Ile Gly Ile Ile Gly Ala Pro Phe Ser 1. 5 1O 15 Lys Gly Glin Pro Arg Gly Gly Val Glu Glu Gly Pro Thr Val Lieu. Arg 2O 25 3O Lys Ala Gly Lieu. Lieu. Glu Lys Lieu Lys Glu Glin Glu. Cys Asp Wall Lys 35 4 O 45 Asp Tyr Gly Asp Lieu Pro Phe Ala Asp Ile Pro Asn Asp Ser Pro Phe SO 55 6 O Glin Ile Val Lys Asn Pro Arg Ser Val Gly Lys Ala Ser Glu Gln Lieu. 65 70 7s 8O Ala Gly Llys Val Ala Glu Val Lys Lys Asn Gly Arg Ile Ser Lieu Val 85 90 95 Lieu. Gly Gly Asp His Ser Lieu Ala Ile Gly Ser Ile Ser Gly His Ala 1OO 105 11 O Arg Val His Pro Asp Lieu. Gly Val Ile Trp Val Asp Ala His Thr Asp 115 12 O 125 Ile Asn Thr Pro Leu. Thir Thr Thr Ser Gly Asn Lieu. His Gly Glin Pro 13 O 135 14 O Val Ser Phe Lieu Lleu Lys Glu Lieu Lys Gly Lys Ile Pro Asp Val Pro 145 150 155 160 Gly Phe Ser Trp Val Thr Pro Cys Ile Ser Ala Lys Asp Ile Val Tyr 1.65 17O 17s Ile Gly Lieu. Arg Asp Val Asp Pro Gly Glu. His Tyr Ile Lieu Lys Thr 18O 185 19 O Lieu. Gly Ile Llys Tyr Phe Ser Met Thr Glu Val Asp Arg Lieu. Gly Ile 195 2OO 2O5

Gly Llys Val Met Glu Glu Thir Lieu. Ser Tyr Lieu. Lieu. Gly Arg Llys Llys

US 2013/O 189243 A1 Jul. 25, 2013 63

- Continued Gly Asp Lieu. Arg Thr Asn Lieu. Thir Asp Arg Glin Lieu Ala Glu Glu Tyr 35 4 O 45 Lieu. Tyr Arg Tyr Gly Tyr Thr Arg Val Ala Glu Met Arg Gly Glu Ser SO 55 6 O Llys Ser Lieu. Gly Pro Ala Lieu. Lieu. Lieu. Lieu Gln Lys Glin Lieu. Ser Lieu. 65 70 7s 8O Pro Glu Thr Gly Glu Lieu. Asp Ser Ala Thir Lieu Lys Ala Met Arg Thr 85 90 95 Pro Arg Cys Gly Val Pro Asp Leu Gly Arg Phe Glin Thr Phe Glu Gly 1OO 105 11 O Asp Leu Lys Trp His His His Asn Ile Thr Tyr Trp Ile Glin Asn Tyr 115 12 O 125 Ser Glu Asp Lieu Pro Arg Ala Val Ile Asp Asp Ala Phe Ala Arg Ala 13 O 135 14 O Phe Ala Leu Trp Ser Ala Val Thr Pro Leu. Thr Phe Thr Arg Val Tyr 145 150 155 160 Ser Arg Asp Ala Asp Ile Val Ile Glin Phe Gly Val Ala Glu. His Gly 1.65 17O 17s Asp Gly Tyr Pro Phe Asp Gly Lys Asp Gly Lieu. Lieu Ala His Ala Phe 18O 185 19 O Pro Pro Gly Pro Gly Ile Glin Gly Asp Ala His Phe Asp Asp Asp Glu 195 2OO 2O5 Lieu. Trp Ser Lieu. Gly Lys Gly Val Val Val Pro Thr Arg Phe Gly ASn 21 O 215 22O Ala Asp Gly Ala Ala Cys His Phe Pro Phe Ile Phe Glu Gly Arg Ser 225 23 O 235 24 O Tyr Ser Ala Cys Thr Thr Asp Gly Arg Ser Asp Gly Lieu Pro Trp Cys 245 250 255 Ser Thir Thr Ala Asn Tyr Asp Thr Asp Asp Arg Phe Gly Phe Cys Pro 26 O 265 27 O Ser Glu Arg Lieu. Tyr Thr Glin Asp Gly Asn Ala Asp Gly Llys Pro Cys 27s 28O 285 Glin Phe Pro Phe Ile Phe Glin Gly Glin Ser Tyr Ser Ala Cys Thr Thr 29 O 295 3 OO Asp Gly Arg Ser Asp Gly Tyr Arg Trp Cys Ala Thir Thr Ala Asn Tyr 3. OS 310 315 32O Asp Arg Asp Llys Lieu. Phe Gly Phe Cys Pro Thr Arg Ala Asp Ser Thr 3.25 330 335 Val Met Gly Gly Asn Ser Ala Gly Glu Lieu. Cys Val Phe Pro Phe Thr 34 O 345 35. O Phe Leu Gly Lys Glu Tyr Ser Thr Cys Thr Ser Glu Gly Arg Gly Asp 355 360 365 Gly Arg Lieu. Trp Cys Ala Thir Thir Ser Asn. Phe Asp Ser Asp Llys Llys 37 O 375 38O Trp Gly Phe Cys Pro Asp Gln Gly Tyr Ser Leu Phe Leu Val Ala Ala 385 390 395 4 OO His Glu Phe Gly His Ala Lieu. Gly Lieu. Asp His Ser Ser Val Pro Glu 4 OS 41O 415 Ala Leu Met Tyr Pro Met Tyr Arg Phe Thr Glu Gly Pro Pro Leu. His 42O 425 43 O Lys Asp Asp Wall Asn Gly Ile Arg His Lieu. Tyr Gly Pro Arg Pro Glu 435 44 O 445 US 2013/O 189243 A1 Jul. 25, 2013 64

- Continued

Pro Glu Pro Arg Pro Pro Thr Thr Thr Thr Pro Gln Pro Thr Ala Pro 450 45.5 460 Pro Thr Val Cys Pro Thr Gly Pro Pro Thr Val His Pro Ser Glu Arg 465 470 47s 48O Pro Thr Ala Gly Pro Thr Gly Pro Pro Ser Ala Gly Pro Thr Gly Pro 485 490 495 Pro Thr Ala Gly Pro Ser Thr Ala Thr Thr Val Pro Leu Ser Pro Val SOO 505 51O Asp Asp Ala Cys Asn Val Asn. Ile Phe Asp Ala Ile Ala Glu Ile Gly 515 52O 525 Asn Glin Lieu. Tyr Lieu. Phe Lys Asp Gly Lys Tyr Trp Arg Phe Ser Glu 53 O 535 54 O Gly Arg Gly Ser Arg Pro Glin Gly Pro Phe Lieu. Ile Ala Asp Llys Trp 5.45 550 555 560 Pro Ala Lieu Pro Arg Llys Lieu. Asp Ser Val Phe Glu Glu Arg Lieu. Ser 565 st O sts Lys Llys Lieu Phe Phe Phe Ser Gly Arg Glin Val Trp Val Tyr Thr Gly 58O 585 59 O Ala Ser Val Lieu. Gly Pro Arg Arg Lieu. Asp Llys Lieu. Gly Lieu. Gly Ala 595 6OO 605 Asp Wall Ala Glin Val Thr Gly Ala Lieu. Arg Ser Gly Arg Gly Lys Met 610 615 62O Lieu. Lieu. Phe Ser Gly Arg Arg Lieu. Trp Arg Phe Asp Wall Lys Ala Glin 625 630 635 64 O Met Val Asp Pro Arg Ser Ala Ser Glu Val Asp Arg Met Phe Pro Gly 645 650 655 Val Pro Lieu. Asp Thr His Asp Val Phe Glin Tyr Arg Glu Lys Ala Tyr 660 665 67 O Phe Cys Glin Asp Arg Phe Tyr Trp Arg Val Ser Ser Arg Ser Glu Lieu. 675 68O 685 Asn Glin Val Asp Glin Val Gly Tyr Val Thr Tyr Asp Ile Lieu. Glin Cys 69 O. 695 7 OO Pro Glu Asp 7 Os

<210s, SEQ ID NO 14 &211s LENGTH: 160 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 14

Met Lieu. Pro Phe Leu Phe Phe Ser Thir Lieu. Phe Ser Ser Ile Phe Thr 1. 5 1O 15 Glu Ala Glin Lys Glin Tyr Trp Val Cys Asn. Ser Ser Asp Ala Ser Ile 2O 25 3O Ser Tyr Thr Tyr Cys Asp Llys Met Glin Tyr Pro Ile Ser Ile Asin Val 35 4 O 45 Asn Pro Cys Ile Glu Lieu Lys Arg Ser Lys Gly Lieu. Lieu. His Ile Phe SO 55 6 O Tyr Ile Pro Arg Arg Asp Lieu Lys Glin Lieu. Tyr Phe Asn Lieu. Tyr Ile 65 70 7s 8O

Thr Val Asn. Thir Met Asn Lieu Pro Lys Arg Lys Glu Val Ile Cys Arg 85 90 95

US 2013/O 189243 A1 Jul. 25, 2013 66

- Continued

Asp Arg Glin Ser Pro Ile Asn. Ile Val Thir Thr Lys Ala Lys Val Asp SO 55 6 O Llys Llys Lieu. Gly Arg Phe Phe Phe Ser Gly Tyr Asp Llys Lys Glin Thr 65 70 7s 8O Trp Thr Val Glin Asn Asn Gly His Ser Val Met Met Leu Lieu. Glu Asn 85 90 95 Lys Ala Ser Ile Ser Gly Gly Gly Lieu Pro Ala Pro Tyr Glin Ala Lys 1OO 105 11 O Glin Lieu. His Lieu. His Trp Ser Asp Lieu Pro Tyr Lys Gly Ser Glu. His 115 12 O 125 Ser Lieu. Asp Gly Glu. His Phe Ala Met Glu Met His Ile Val His Glu 13 O 135 14 O Lys Glu Lys Gly. Thir Ser Arg Asn. Wall Lys Glu Ala Glin Asp Pro Glu 145 150 155 160 Asp Glu Ile Ala Val Lieu Ala Phe Lieu Val Glu Ala Gly Thr Glin Val 1.65 17O 17s Asn Glu Gly Phe Glin Pro Lieu Val Glu Ala Lieu. Ser Asn. Ile Pro Llys 18O 185 19 O Pro Glu Met Ser Thr Thr Met Ala Glu Ser Ser Lieu Lleu. Asp Leu Lieu. 195 2OO 2O5 Pro Lys Glu Glu Lys Lieu. Arg His Tyr Phe Arg Tyr Lieu. Gly Ser Lieu. 21 O 215 22O Thir Thr Pro Thr Cys Asp Glu Lys Val Val Trp Thr Val Phe Arg Glu 225 23 O 235 24 O Pro Ile Glin Lieu. His Arg Glu Glin Ile Lieu Ala Phe Ser Glin Llys Lieu. 245 250 255 Tyr Tyr Asp Llys Glu Glin Thr Val Ser Met Lys Asp Asn Val Arg Pro 26 O 265 27 O Lieu. Glin Glin Lieu. Gly Glin Arg Thr Val Ile Llys Ser Gly Ala Pro Gly 27s 28O 285 Arg Pro Lieu Pro Trp Ala Lieu Pro Ala Lieu. Lieu. Gly Pro Met Lieu Ala 29 O 295 3 OO Cys Lieu. Lieu Ala Gly Phe Lieu. Arg 3. OS 310

<210s, SEQ ID NO 17 &211s LENGTH: 466 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 17 accactgctg gctttittgct gtagcticcac attcc titgc attgaggggit taac attagg 6 O

Ctgggaagat gacaaaactt galaga.gcatc tagggaat ttcaat at C titccaccaat 12 O acticagttcg gaaggggc at tittgacaccc tict ctaaggg tagctgaag cagctgctta 18O caaaggagct togcaaacacc atcaagaata t caaagataa agctgtcatt gatgaaatat 24 O tcca aggcct ggatgctaat Caagatgaac aggtogactt toaagaattic at atcCctgg 3OO tagc cattgc gctgaaggct gcc cattacc acacccacaa agagtaggta gct Ctctgaa 360 ggctttittac cca.gcaatgt cct caatgag gigt cittittct titc cct cacc aaaac ccagc 42O Cttgc.ccgtggggagtaaga gttaataaac acact cacga aaagtt 466 US 2013/O 189243 A1 Jul. 25, 2013

- Continued <210s, SEQ ID NO 18 &211s LENGTH: 92 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 18 Met Thr Lys Lieu. Glu Glu. His Leu Glu Gly Ile Val Asn Ile Phe His 1. 5 1O 15 Glin Tyr Ser Val Arg Lys Gly His Phe Asp Thir Lieu. Ser Lys Gly Glu 2O 25 3O Lieu Lys Glin Lieu. Lieu. Thir Lys Glu Lieu Ala Asn. Thir Ile Lys Asn. Ile 35 4 O 45 Lys Asp Lys Ala Val Ile Asp Glu Ile Phe Glin Gly Lieu. Asp Ala Asn SO 55 6 O Glin Asp Glu Glin Val Asp Phe Glin Glu Phe Ile Ser Lieu Val Ala Ile 65 70 7s 8O Ala Lieu Lys Ala Ala His Tyr His Thr His Lys Glu 85 90

<210s, SEQ ID NO 19 &211s LENGTH: 10 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 19 ttitt ttitt tt 10

What is claimed is: 5. The method of claim 1 or 2, wherein the method is 1. A method for the diagnosis of acute ischemic stroke in a executed on the subject no more than 4.5 hours after onset of Subject, comprising detecting in a biological sample obtained presenting acute ischemic stroke symptoms. from the subject one or more biomarkers selected from the 6. The method of claim 1 or 2, wherein the detecting step group consisting of further comprises contacting the biological sample with a (a) chemokine receptor 7 (CCR7); detection means capable of detecting the biomarker. (b) chondroitin sulfate proteoglycan 2 (CSPG2); 7. The method of claim 6, wherein the biomarker is a (c) IQ motif-containing GTPase activation protein 1 (IQ nucleic acid molecule. GAP1); and 8. The method of claim 7, wherein the nucleic acid mol (d) orosomucoid 1 (ORM1). ecule is mRNA. 2. A method for the diagnosis of acute ischemic stroke in a 9. The method of claim 6, wherein the biomarker is a Subject, comprising detecting in a biological sample obtained polypeptide. from the subject two or more biomarkers selected from the 10. The method of claim 6, wherein the detection means is group consisting of an antibody. (a) chemokine receptor 7 (CCR7); 11. The method claim 6, wherein the detection means is an (b) chondroitin sulfate proteoglycan 2 (CSPG2); oligonucleotide probe. (c) IQ motif-containing GTPase activation protein 1 (IQ 12. The method of claim 6, wherein the detection means is GAP1); a filament-based diagnostic system capable of detecting a (d) orosomucoid 1 (ORM1) polypeptide biomarker. (e) arginase 1 (ARG1); 13. The method of claim 6, wherein the detection means is (f) lymphocyte antigen 96 (LY96); a filament-based diagnostic system capable of detecting a (g) matrix metalloproteinase 9 (MMP9); nucleic acid molecule biomarker. (h) carbonic anhydrase 4 (CA4); and 14. The method according to claim 1 or 2, further compris (i) S100 calcium binding protein A12 (S100A12), ing obtaining brain imaging data of the Subject and evaluating wherein at least one of the biomarkers is (a), (b), (c) or (d). the data to detect an acute ischemic stroke. 3. The method of claim 1 or 2, wherein the sample is whole 15. The method according to claim 14, wherein the brain peripheral blood obtained from the subject. imaging data is obtained by MRI. 4. The method of claim 1 or 2, wherein the method is 16. The method according to claim 14, wherein the brain executed on the subject no more than 3 hours after onset of imaging data is obtained by computerized tomography (CT) presenting acute ischemic stroke symptoms. SCall. US 2013/O 189243 A1 Jul. 25, 2013

17. The method according to claim 1 or 2, further compris 33. The method of claim 21, further comprising obtaining ing treating the Subject with a stroke therapy if the Subject is brain imaging data of the Subject and evaluating the data to diagnosed with an acute ischemic stroke. detect an acute ischemic stroke. 18. The method according to claim 17, wherein the stroke 34. The method according to claim 33, wherein the brain therapy is the administration of a therapeutically effective imaging data is obtained by MRI. amount of recombinant plasminogen activator (rtPA). 35. The method according to claim 33, wherein the brain 19. The method according to claim 6, wherein the one or imaging data is obtained by computerized tomography (CT) more biomarkers detected by the detection means has at least SCall. a 1.5 fold increase or decrease in expression level as com 36. The method of claim 21, further comprising treating the pared to the levels of the one or more biomarkers in a non subject with a stroke therapy if the subject is diagnosed with stroke Subject. an acute ischemic stroke. 20. The method according to claim 6, wherein the one or 37. The method of claim 36, wherein the stroke therapy is more biomarkers detected by the detection means has at least the administration of a therapeutically effective amount of a 2.0 fold increase or decrease in expression level as com recombinant plasminogen activator (rtPA). pared to the levels of the one or more biomarkers in a non 38. The method of claim 21, wherein the one or more stroke Subject. biomarkers detected by the detection means has at least a 1.5 21. A method for differentiating an acute ischemic stroke fold increase or decrease in expression level as compared to from a transient ischemic attack (TIA), a hemorragic stroke the levels of the one or more biomarkers in a non-stroke and a stroke mimic in a subject presenting symptoms charac Subject. teristic of a stroke, comprising: 39. The method of claim 21, wherein the one or more (a) obtaining a biological sample from the patient; biomarkers detected by the detection means has at least a 2.0 fold increase or decrease in expression level as compared to (b) contacting the biological sample with a detection the levels of the one or more biomarkers in a non-stroke means capable of detecting the presence of at least one Subject. biomarker selected from the group consisting of: chemokine receptor 7 (CCR7); chondroitin sulfate pro 40. A kit comprising a means for detecting one or more teoglycan 2 (CSPG2); IQ motif-containing GTPase acti biomarkers diagnostic of acute ischemic stroke, said biomar vation protein 1 (IQGAP1); and orosomucoid 1 kers being selected from the group consisting of: (ORM1), (a) chemokine receptor 7 (CCR7); wherein the presence of at least one of the biomarkers in the (b) chondroitin sulfate proteoglycan 2 (CSPG2); biological sample is indicative of an acute ischemic (c) IQ motif-containing GTPase activation protein 1 (IQ stroke but not indicative of a transient ischemic attack GAP1); and (TIAS), hemorragic stroke or stroke mimic. (d) orosomucoid 1 (ORM1). 22. The method of claim 21, wherein the detection means 41. The kit of claim 40, wherein the biomarker is a nucleic is further capable of detecting the presence of at least one acid molecule. additional biomarker selected from the group consisting of 42. The kit of claim 41, wherein the nucleic acid molecule arginase 1 (ARG1); lymphocyte antigen 96 (LY96); matrix is mRNA. metalloproteinase 9 (MMP9); carbonic anhydrase 4 (CA4); 43. The kit of claim 40, wherein the biomarker is a and s100 calcium binding protein A12 (S100A12). polypeptide. 44. The kit of claim 40, wherein the means for detecting the 23. The method of claim 21, wherein the sample is whole biomarkers is a oligonucleotide capable of binding to the peripheral blood obtained from the subject. nucleic acid molecule biomarker. 24. The method of claims 21, wherein the method is 45. The kit of claim 43, wherein the means for detecting the executed on the subject no more than 3 hours after onset of the biomarkers is an antibody capable of binding to the polypep presenting of the stroke symptoms. tide biomarker. 25. The method of claims 21, wherein the method is 46. The kit of claim 40, wherein the detection means is a executed on the subject no more than 4.5 hours after onset of filament-based diagnostic system capable of detecting a the presenting of the stroke symptoms. polypeptide biomarker. 26. The method of claim 21, wherein the biomarker is a 47. The kit of claim 40, wherein the detection means is a nucleic acid molecule. filament-based diagnostic system capable of detecting a 27. The method of claim 26, wherein the nucleic acid nucleic acid molecule biomarker. molecule is mRNA. 48. The kit of claim 40, wherein the detection means 28. The method of claim 21, wherein the biomarker is a includes a Surface on which is attached at known locations polypeptide. one or more oligonucleotides capable of hybridizing to the 29. The method of claim 21, wherein the detection means biomarkers. is an antibody. 49. The kit of claim 40, wherein the detection means 30. The method claim 21, wherein the detection means is includes a Surface on which is attached at known locations an oligonucleotide probe. one or more antibodies capable of binding to the biomarkers. 31. The method of claim 21, wherein the detection means 50. The kit according to any one of claim 48 or 49, wherein is a filament-based diagnostic system capable of detecting a the Surface is a microarray, microtiter plate, or membrane. polypeptide biomarker. 51. The kit of claim 40 further comprising instructions for 32. The method of claim 21, wherein the detection means SC. is a filament-based diagnostic system capable of detecting a 52. A filament-based diagnostic system comprising a panel nucleic acid molecule biomarker. of detectable polypeptides or functional polypeptide frag US 2013/O 189243 A1 Jul. 25, 2013 69 ments thereof each corresponding to an acute ischemic stroke biomarker selected from the group consisting of: (a) chemokine receptor 7 (CCR7); (b) chondroitin sulfate proteoglycan 2 (CSPG2); (c) IQ motif-containing GTPase activation protein 1 (IQ GAP1); and (d) orosomucoid 1 (ORM1). 53. A filament-based diagnostic system comprising a panel of detectable oligonucleotides each corresponding to an acute ischemic stroke biomarker selected from the group consisting of: (a) chemokine receptor 7 (CCR7); (b) chondroitin sulfate proteoglycan 2 (CSPG2); (c) IQ motif-containing GTPase activation protein 1 (IQ GAP1); and (d) orosomucoid 1 (ORM1). 54. A filament-based diagnostic system comprising a panel of detectable antibodies each capable of specifically binding an acute ischemic stroke biomarker selected from the group consisting of: (a) chemokine receptor 7 (CCR7); (b) chondroitin sulfate proteoglycan 2 (CSPG2); (c) IQ motif-containing GTPase activation protein 1 (IQ GAP1); and (d) orosomucoid 1 (ORM1). k k k k k