bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 HOXA9 promotes MYC-mediated leukemogenesis by
2 maintaining gene expression for multiple anti-apoptotic
3 pathways
4
5 Ryo Miyamoto1, Akinori Kanai2, Hiroshi Okuda1, Satoshi Takahashi1, 3,
6 Hirotaka Matsui4, Toshiya Inaba2, Akihiko Yokoyama1, 5*
7
8 1Tsuruoka Metabolomics Laboratory, National Cancer Center, Tsuruoka, Japan
9 2Department of Molecular Oncology and Leukemia Program Project, Research
10 Institute for Radiation Biology and Medicine, Hiroshima University, Hiroshima,
11 Japan
12 3Department of Hematology and Oncology, Kyoto University Graduate School of
13 Medicine, Kyoto, Japan
14 4Department of Molecular Laboratory Medicine, Graduate School of Medical
15 Sciences, Kumamoto University, Kumamoto, Japan
16 5Division of Hematological Malignancy, National Cancer Center Research Institute,
17 Tokyo, Japan
18
19 *Correspondence: [email protected]
20
21
1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Abstract
2 HOXA9 is often highly expressed in leukemias. However, its precise roles in
3 leukemogenesis remain elusive. Here, we show that HOXA9 maintains gene
4 expression for multiple anti-apoptotic pathways to promote leukemogenesis. In MLL-
5 rearranged leukemia, MLL fusion directly activates the expression of MYC and
6 HOXA9. Combined expression of MYC and HOXA9 induced leukemia, whereas
7 single gene transduction of either did not, indicating a synergy between MYC and
8 HOXA9. HOXA9 sustained expression of the genes implicated to the hematopoietic
9 precursor identity when expressed in hematopoietic precursors, but did not reactivate
10 it once silenced. Among the HOXA9 target genes, BCL2 and SOX4 synergistically
11 induced leukemia with MYC. Not only BCL2, but also SOX4 suppressed apoptosis,
12 indicating that multiple anti-apoptotic pathways underlie cooperative leukemogenesis
13 by HOXA9 and MYC. These results demonstrate that HOXA9 is a key transcriptional
14 maintenance factor which promotes MYC-mediated leukemogenesis, potentially
15 explaining why HOXA9 is highly expressed in many leukemias.
16
17
2 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Introduction
2 Mutations of transcriptional regulators often cause aberrant gene regulation of
3 hematopoietic cells, which leads to leukemia. Structural alterations of the mixed
4 lineage leukemia gene (MLL also known as KMT2A) by chromosomal translocations
5 cause malignant leukemia that often associates with poor prognosis despite the current
6 intensive treatment regimens (1). MLL encodes a transcriptional regulator that
7 maintains segment-specific expression of homeobox (HOX) genes during
8 embryogenesis (2), which determines the positional identity within the body (3-5).
9 During hematopoiesis, MLL also maintains the expression of posterior HOXA genes
10 and MEIS1 (another homeobox gene), which promote the expansion of hematopoietic
11 stem cells and immature progenitors (6-10). The oncogenic MLL fusion protein
12 constitutively activates its target genes by constitutively recruiting transcription
13 initiation/elongation factors thereto (11-13). Consequently, HOXA9 and MEIS1 are
14 highly transcribed in MLL-rearranged leukemia (7). Forced expression of HOXA9
15 (but not MEIS1) immortalize hematopoietic progenitor cells (HPCs) ex vivo (14, 15).
16 Co-expression of HOXA9 with MEIS1 causes leukemia in mice which recapitulates
17 MLL-rearranged leukemia (15). Moreover, HOXA9 is highly expressed in many non-
18 MLL-rearranged leukemias such as those with NPM1 mutation and NUP98 fusion and
19 is associated with poor prognosis (16). These findings highlight HOXA9 as a major
20 contributing factor in leukemogenesis. Nevertheless, the mechanism by which
21 HOXA9 promotes oncogenesis remains elusive.
22 HOXA9 is considered to function as transcription factor, which retains a
23 sequence-specific DNA binding ability. HOX proteins have an evolutionally
24 conserved homeodomain which possesses strong sequence preferences (17). HOXA9
25 associates with other homeodomain proteins such as PBX and MEIS family proteins
3 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 (14, 18). HOXA9 and those HOXA9 cofactors form a stable complex on a DNA
2 fragment harboring consensus sequences for each homeodomain protein (18, 19),
3 suggesting that they form a complex of different combinations in a locus-specific
4 manner depending on the availability of the binding sites. Recently, it has been
5 reported that HOXA9 specifically associates with enhancer apparatuses (e.g.
6 MLL3/4) to regulate gene expression (20-22). However, the mechanisms by which
7 HOXA9 activate gene expression remain largely unclear.
8 In this study, we reveal the oncogenic roles for HOXA9 and its target gene
9 products in leukemogenesis and its unique mode of function as a transcriptional
10 maintenance factor which preserves an identity of a hematopoietic precursor.
11
4 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Results
2 MLL fusion proteins and HOXA9 sustain MYC expression against
3 differentiation-induced transcriptional suppression
4 To identify the direct target genes of MLL fusion proteins, we first examined the
5 genome-wide localization pattern of MLL fusion proteins by chromatin
6 immunoprecipitation (ChIP) followed by deep sequencing (ChIP-seq), using HB1119
7 cells, a cell line expressing a fusion gene of MLL and ENL (MLL-ENL). We observed
8 MLL ChIP signals on the MYC, HOXA9, HOXA10, and MEIS1 loci (Figure 1A) (23),
9 which were further confirmed by ChIP-qPCR analysis (Supplemental Figure 1).
10 To characterize the dynamic changes in MLL target gene expression during
11 differentiation, we isolated bone marrow cells from mice at various differentiation
12 stages ranging from the most immature population (c-Kit+, Sca1+, Lineage–; KSL)
13 containing hematopoietic stem cells to highly differentiated hematopoietic cells (c-
14 Kitlow/Mac1high) by fluorescence activated cell sorting (FACS) and performed qRT-
15 PCR analysis. For comparison, we analyzed leukemia cells (LCs) harvested from
16 mice suffering from MLL-AF10-induced leukemia (MLL-AF10-LCs) and
17 immortalized cells (ICs) transformed by MLL-ENL ex vivo (MLL-ENL-ICs). In
18 accordance with previous reports (7, 24), Hoxa9, Hoxa10, and Meis1 were
19 downregulated during the course of normal hematopoietic differentiation but
20 remained abundant in MLL fusion-expressing cells (Figure 1B). Myc was highly
21 expressed in KSL, common myeloid progenitors (CMP), and granulocyte/macrophage
22 progenitors (GMP), which contain actively dividing populations (25), but was
23 completely suppressed at highly differentiated c-kitlow/Mac1high stages. In the two
24 MLL fusion-expressing cell lines, Myc was expressed at comparable levels to those in
25 the progenitor fractions (CMP and GMP; Figure 1B). Mxd1, a differentiation marker,
5 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 was highly expressed only in differentiated populations. These results indicate that
2 Myc, Hoxa9, Hoxa10, and Meis1 are intrinsically programmed to be silenced in
3 normal hematopoietic differentiation but are aberrantly maintained by MLL fusion
4 proteins.
5 To assess the oncogenic potential of MLL target genes, we performed
6 myeloid progenitor transformation assays, wherein HPCs were isolated from mice,
7 retrovirally transduced with each MLL target gene, and cultured in semi-solid
8 medium supplemented with cytokines promoting myeloid lineage differentiation
9 (Figure 1C, D). HPCs transduced with MLL-ENL and MLL-AF10 produced a large
10 number of colonies in the third and fourth passages with high mRNA levels of Myc,
11 Hoxa9, Hoxa10, and Meis1 in colonies of the first passage, confirming their potent
12 transforming capacities. These cells were considered “immortalized” as they
13 proliferate indefinitely in this ex vivo culture (26, 27). Ectopic expression of MYC
14 immortalized HPCs; therefore, MYC expression is sufficient to induce proliferation of
15 HPCs. Endogenous Myc expression was completely diminished in MYC-ICs,
16 demonstrating that Myc expression is programed to be silenced and cannot be
17 sustained by MYC itself. Ectopic expression of HOXA9 and HOXA10 (but not
18 MEIS1) immortalized HPCs. Endogenous Myc expression was maintained in
19 HOXA9/A10-ICs, indicating that HOXA9/A10 can sustain Myc expression against
20 differentiation-induced transcriptional suppression. It should be noted that the colony
21 size of HOXA9/A10-ICs was relatively small compared to MYC- or MLL fusion-ICs,
22 suggesting a weaker proliferative potential. Knockdown of Myc by shRNA
23 completely repressed the colony-forming ability of MLL-ENL-ICs and HOXA9-ICs
24 (Figure 1E). Taken together, these results demonstrate that MLL fusion proteins and
25 HOXA9 maintain Myc expression in spite of the differentiation-induced
6 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 transcriptional suppression, and the maintenance of MYC expression is indispensable
2 for immortalization of HPCs ex vivo.
3
4
5 Figure 1 | MLL fusion proteins and HOXA9 sustain MYC expression against 6 differentiation-induced transcriptional suppression 7 A, Genomic localization of MLL-ENL in HB1119 cells. ChIP signals at the loci of 8 posterior HOXA genes, MEIS1, MYC, and PITX2 (negative control) are shown using 9 the Integrative Genomics Viewer (The Broad Institute). B, Expression of MLL-target 10 genes and Mxd1 (a differentiation marker) during myeloid differentiation. Bone
7 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 marrow cells at various differentiation stages were obtained by FACS sorting and 2 analyzed by RT-qPCR. Expression levels relative to KSL are shown (Mean with SD, 3 n = 3, PCR replicates). MLL-AF10-LCs and MLL-ENL-ICs were included in the 4 analysis for comparison. KSL: c-Kit+, Sca1+, and Lineage–; CMP: common myeloid 5 progenitor; GMP: granulocyte macrophage progenitor; int: intermediate. C, 6 Transforming potential of MLL target genes. Clonogenic potential of the indicated 7 constructs was analyzed by myeloid progenitor transformation assays. Colony 8 forming unit per 104 cells (CFU) (Mean with SD, n = 3, biological replicates), relative 9 colony size (Mean with SD, n ≥ 100), and relative mRNA levels of indicated genes 10 (Mean with SD, n = 3, PCR replicates) were measured at the indicated time points. #: 11 Both endogenous murine transcripts and exogenous human transcripts were detected 12 by the qPCR primer set used. N.A.: not assessed. D, Morphologies of the colonies and 13 transformed cells. Representative images of bright field (left) and May-Grunwald- 14 Giemsa staining (right) are shown with scale bars. E, Effects of Myc knockdown on 15 MLL-ENL- and HOXA9-ICs. Relative CFU (Mean with SD, n = 3, biological 16 replicates) and mRNA level of Myc (Mean with SD, n = 3 PCR replicates) are shown. 17 Statistical analysis was performed using ordinary one-way ANOVA with the vector 18 control. ****P < 0.0001. 19
20 HOXA9 confers the identity of a hematopoietic precursor while MYC drives
21 anabolic pathways.
22 To identify the genes specifically regulated by HOXA9 but not by MYC, we
23 performed RNA-seq analysis of HOXA9-ICs and MYC-ICs which do not express
24 HOXA9 (Figure 1C). Genes highly expressed in HOXA9-ICs but lowly expressed in
25 MYC-ICs (defined as “HOXA9 high signature”) were associated with hematopoietic
26 identity/functions, whereas genes highly expressed in MYC-ICs and lowly expressed
27 in HOXA9-ICs (defined as “MYC high signature”) were associated with anabolic
28 pathways (Figure 2A, B). MLL-AF10-ICs, which express endogenous Hoxa9 and
29 Myc at high levels (Figure 1C), expressed both HOXA9 high and MYC high signature
30 genes (Figure 2A-C), indicating that MLL-AF10-ICs possess MYC-mediated highly
31 proliferative potential and HOXA9-mediated hematopoietic identity. These
32 differences between the HOXA9 high and MYC high signatures indicate that HOXA9
33 maintains the identity of a hematopoietic precursor.
34
8 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
9 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 2 | HOXA9 confers the identity of a hematopoietic precursor while MYC 2 drives anabolic pathways. 3 A, Relative expression of the top 50 genes categorized as the HOXA9 high signature 4 and the MYC high signature in HOXA9-, MYC-, and MLL-AF10-ICs. B, Pathways 5 related to the HOXA9 high signature (blue) and the MYC high signature (red). The 6 top 500 genes in the HOXA9 high or MYC high signatures were subjected to KEGG 7 pathway analysis. C, Gene set enrichment analysis of the HOXA9 high and MYC 8 high signatures in MLL-AF10-ICs compared with MYC-ICs (top) and HOXA9-ICs 9 (bottom), respectively. 10
11 Apoptosis is induced by MYC, while is alleviated by HOXA9 and MLL-AF10
12 Given that excessive MYC activity promotes apoptosis (28), we evaluated
13 their apoptotic tendencies in immortalized HPCs. MYC-ICs exhibited increased
14 gH2AX, cleaved poly (ADP) ribose polymerase (PARP), and cleaved caspase 3
15 levels, indicative of a high degree of replication stress and apoptosis (Figure 3A).
16 FACS analysis with Annexin V also showed that MYC-ICs had a larger apoptotic
17 fraction than that of HOXA9-ICs (Figure 3B). MLL-AF10-ICs exhibited weak
18 apoptotic tendencies similarly to HOXA9-ICs although their MYC expression tends
19 to be higher than HOXA9-ICs (Figures 1C and 3A). Furthermore, most MYC-ICs
20 underwent massive apoptosis 1d after cytokine removal, whereas HOXA9-ICs and
21 MLL-AF10-ICs showed relative resistance (Figure 3C) and exhibited successful
22 recovery of the live cell population after cytokine reintroduction (Supplemental
23 Figure 2). These results indicate that HOXA9 confers anti-apoptotic properties.
24 Next, we evaluated the leukemogenic potential of HOXA9 and MYC in vivo.
25 Transplantation of HPCs transduced with MLL-AF10 into syngeneic mice induced
26 leukemia with full penetrance (Figure 3D). In contrast, neither MYC nor its
27 homologue MYCN was capable of initiating leukemia within 200 days under these
28 experimental conditions, indicating that activation of the MYC high signature alone is
29 insufficient for leukemogenesis in vivo. Although one recipient mouse of MYC-
30 transduced HPCs became sick and was sacrificed about 150 days after transplantation,
10 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 it did not exhibit any leukemia-associated signs. HOXA9 did not induce leukemia
2 within 200 days either, suggesting that the HOXA9 high signature alone is also
3 insufficient to induce leukemia. Taken together, these results suggest that both high
4 MYC activity and HOXA9-mediated resistance to apoptosis are necessary for driving
5 leukemogenesis in vivo.
6
7
8 Figure 3 | Apoptosis is induced by MYC, while is alleviated by HOXA9 and 9 MLL-AF10 10 A, Protein expression of transgenes and apoptotic markers in HOXA9-, MYC-, and 11 MLL-AF10-ICs. B and C, Apoptotic tendencies of HOXA9-, MYC-, and MLL- 12 AF10-ICs. Representative FACS plots and the summarized data (Mean with SD, n = 13 3, biological replicates) of Annexin V staining of HOXA9-, MYC-, and MLL-AF10- 14 ICs in the presence of cytokines (B) and 1d after their removal (C) are shown. D, In 15 vivo leukemogenic potential of MLL target genes and MLL-AF10. Kaplan-Meier
11 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 curves of mice transplanted with HPCs transduced with the indicated genes and the 2 number of replicates are shown. 3
4 HOXA9 promotes MYC-mediated leukemogenesis
5 We next examined the gene expression of patients with leukemia using publicly
6 available microarray data of the Microarray Innovations in LEukemia (MILE) study
7 (29). Of 108 cases with MLL translocation, 38 were acute myelogenous leukemia
8 [AML] and 70 were acute lymphoblastic leukemia [ALL]. Most of the cases (78.7%)
9 were categorized in the HOXA9high/MEIS1high group, while some were in the
10 HOXA9low/MEIS1high (13.0%) or HOXA9high/MEIS1low (8.3%) group (Figure 4A).
11 MYC was expressed at high levels irrespective of HOXA9 or MEIS1 expression. These
12 data indicate variability in transcriptional profiles among MLL-rearranged leukemia
13 cases, with MYC expression remaining consistently high. HOXA9low/MEIS1high
14 leukemia was predominatly found in ALL, likely due to the MLL-AF4 cases, some of
15 which do not express HOXA genes (30). HOXA9high/MEIS1low leukemia was mainly
16 found in AML (Figure 4B).
17 Next, we assessed the effects of combined expression of MYC, HOXA9, and
18 MEIS1 in mouse leukemia models. The MYC/HOXA9 combination exhibited high
19 clonogenicity ex vivo, with colony-forming capacity and colony size comparable to
20 those of MLL-ENL- and HOXA9/MEIS1-ICs (Figure 4C, D). A weak synergy
21 between MYC and MEIS1 was also observed. HOXA9/MEIS1-ICs showed high Myc
22 expression, indicating essential role of Myc in leukemic transformation of HPCs even
23 by this gene set. In the in vivo leukemogenesis assays, MYC, HOXA9, or MEIS1
24 expression alone did not initiate leukemia, whereas co-expression of HOXA9 and
25 MEIS1 did in all recipient mice as previously reported (Figure 4E) (15). The
26 combined expression of MYC/HOXA9 or MYC/MEIS1 induced leukemia in 38%
12 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 and 18% of recipient mice, respectively, indicating a synergy of MYC with HOXA9
2 and MEIS1. qRT-PCR analysis showed that LCs maintained the expression patterns
3 of endogenous Hoxa9, Meis1, and Myc similar to those of the respective ICs
4 (Supplemental Figure 3). We observed rapid onset of leukemia with full penetrance in
5 the secondary transplantation for the three combinations tested, confirming the
6 presence of leukemia-initiating cells (Figure 4E). These results indicate a cooperative
7 role for HOXA9 and MEIS1 in MYC-mediated leukemogenesis with stronger
8 synergy between HOXA9 and MYC.
9
10
11 Figure 4 | HOXA9 promotes MYC-mediated leukemogenesis 12 A and B, Expression profiles of MLL-rearranged leukemia patients reported in the 13 MILE study (29). Probe intensities of the indicated genes are plotted for all MLL- 14 rearranged leukemia patients (A). Patients in the HOXA9low/MEIS1high (blue) and
13 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 HOXA9high/MEIS1low (red) groups are highlighted. Probe intensities of HOXA9 and 2 MEIS1 are plotted separately by leukemia phenotype (ALL or AML) (B). C, 3 Transforming potential of various combinations of MLL target genes. CFU (Mean 4 with SD, n = 3, biological replicates) and relative colony size (Mean with SD, n ≥ 5 100) are shown as in Figure 1C. D, Morphologies of the colonies and transformed 6 cells. Bright field (left) and May-Grunwald-Giemsa staining (right) images are shown 7 with scale bars. E, In vivo leukemogenic potential of various oncogene combinations. 8 Kaplan-Meier curves of mice transplanted with HPCs transduced with the indicated 9 genes are shown as in Figure 3D. Bone marrow cells from moribund mice were 10 harvested and used for secondary transplantation. 11 12 HOXA9 functions as a transcription maintenance factor
13 Some HOXA9 high signature genes, namely Bcl2, Sox4, and Igf1, have been
14 implicated in leukemogenesis (31-34), suggesting that they may be responsible for the
15 synergy between HOXA9 and MYC. Indeed, Bcl2, Sox4, and Igf1 were highly
16 transcribed in HPCs transformed by the combinations containing HOXA9 (i.e.
17 MYC/HOXA9-ICs, HOXA9/vector-ICs, and HOXA9/MEIS1-ICs) but not those
18 lacking it (i.e. MYC/vector-ICs and MYC/MEIS1-ICs)(Figure 5A and Supplemental
19 Figure 4A). Conditional loss of function experiments using HOXA9 conjugated with
20 estrogen receptor (HOXA9-ER) confirmed direct regulation of these genes by
21 HOXA9 (Figure 5B). However, stepwise transduction of MYC followed by HOXA9
22 failed to upregulate these HOXA9 target genes, indicating that HOXA9 cannot re-
23 activate its target genes once silenced (Figure 5C and Supplemental Figure 4B). These
24 results indicate that HOXA9 is a transcriptional maintenance factor which may be
25 involved in the maintenance of chromatin structure previously activated by other
26 transcriptional/epigenetic factors.
27
14 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Figure 5 | HOXA9 functions as a transcription maintenance factor 3 A. Gene expression of HPCs immortalized by various transgenes. Relative mRNA 4 levels of HOXA9 target genes (Mean with SD, n = 3, PCR replicates) in myeloid 5 progenitors transformed by various combinations of MLL target genes are shown. 6 Two genes were transduced into HPCs in a simultaneous manner. B, Gene expression 7 after inactivation of HOXA9. HOXA9-ER and MYC were doubly transduced into 8 HPCs and cultured in the presence of 4-OHT ex vivo. After 4-OHT withdrawal, RT- 9 qPCR analysis was performed for the indicated genes (Mean, n=4, biological 10 replicates). Statistical analysis was performed using unpaired two-tailed Student’s t- 11 test. **P < 0.01, *P < 0.05. C. Gene expression of HPCs immortalized by step-wise 12 transduction of various transgenes. Relative mRNA levels of HOXA9 target genes in 13 myeloid progenitors transformed by various combinations of MLL target genes are 14 shown as in A. Two genes were transduced into HPCs in a stepwise manner. 15
16 BCL2 and SOX4 promote MYC-mediated leukemogenesis by alleviating
17 apoptosis
15 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 To identify the roles for BCL2 and SOX4 in leukemic transformation, we evaluated
2 the leukemogenic potential of combined expression of BCL2 or SOX4 with MYC. In
3 myeloid progenitor transformation assays, SOX4 by itself showed weak
4 immortalization capacity as previously reported (31), while BCL2 did not transform
5 HPCs (Figure 6A). Co-expression of BCL2 or SOX4 with MYC led to a substantial
6 increase in colony-forming capacity. The combined expression of BCL2 with MYC
7 induced leukemia in vivo with a penetrance similar to that with the MYC/HOXA9
8 combination (Figures 4E and 6B) in accord with previous reports (35, 36). SOX4 also
9 promoted MYC-mediated leukemogenesis in vivo (Figure 6B), while neither MYC,
10 BCL2, nor SOX4 alone induced leukemia within 200 days. It should be noted that
11 single gene transduction of MYC and SOX4 was shown to induce leukemia by others
12 in different settings albeit low penetrance (32, 36). These differences are possibly due
13 to the differences of virus titers and viral genome integration-related gene activation.
14 Furthermore, the combined expression of HOXA9, BCL2, or SOX4 with MYC
15 alleviated apoptotic tendencies (Figure 6C, D). Although SOX4 is reported to
16 modulate transcription of pro/anti-apoptotic genes (37), their expression was not
17 drastically altered by SOX4 in this context (Figure 6E and F). Thus, the mechanism
18 underlying the anti-apoptotic properties of SOX4 in this setting is currently unclear.
19 Taken together, the results indicate that multiple anti-apoptotic pathways mediated by
20 BCL2 and SOX4 promote MYC-mediated leukemic transformation.
21
16 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Figure 6 | BCL2 and SOX4 promote MYC-mediated leukemogenesis by 3 alleviating apoptosis 4 A, Transforming potential of various combinations of MYC and HOXA9 target 5 genes. CFU (Mean with SD, n = 3, biological replicates) is shown as in Figure 1C. B, 6 In vivo leukemogenic potential of various combinations of MYC and HOXA9 target 7 genes. Kaplan-Meier curves of mice transplanted with HPCs transduced with the 8 indicated genes are shown as in Figure 3D. C and D, Apoptotic tendencies of MYC- 9 expressing progenitors co-transduced with HOXA9, BCL2, or SOX4. Representative 10 FACS plots (C) and the summarized data (D) (Mean with SD, n = 3, biological 11 replicates) of Annexin V staining are shown. Statistical analysis was performed using 12 ordinary one-way ANOVA with MYC-ICs. E, Expression of apoptosis-related 13 proteins in HPCs transformed by various combinations of transgenes. Western blots 14 of HPCs transformed by indicated transgenes are shown F, Relative expression levels 15 of apoptosis-related genes in MYC/SOX4-ICs and MYC/vector-ICs. Relative mRNA 16 levels of the indicated apoptosis-related genes (Mean, n = 2, biological replicates) are 17 shown. 18
17 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Endogenous BCL2 and SOX4 support the initiation and maintenance of 2 leukemia 3 To examine the roles for endogenous BCL2 and SOX4 in the initiation and
4 maintenance of LCs, we conducted myeloid progenitor transformation and in vivo
5 leukemogenesis assays using Bcl2- and Sox4-knockout HPCs. We transduced various
6 oncogenes into HPCs isolated from fetal livers of Bcl2- and Sox4-knockout embryos
7 (38, 39) and cultured ex vivo. Neither Bcl2 nor Sox4 deletion affected the
8 proliferation of HPCs transduced with HOXA9, MYC, or MLL-AF10, indicating that
9 BCL2 and SOX4 are dispensable for proliferation ex vivo (Supplemental Figure 5A).
10 On the other hand, Bcl2 deletion delayed the onset of leukemia induced by MLL-
11 AF10 and the HOXA9/MEIS1 combination in vivo (Figure 7A). Sox4 deletion also
12 delayed the onset of HOXA9/MEIS1-induced leukemia, although it did not affect
13 MLL-AF10-induced leukemia (Figure 7B). These results indicate that endogenous
14 BCL2 and SOX4 partially contribute to initiate leukemia in vivo.
15 Next, we examined the roles for endogenous BCL2 and SOX4 in the
16 maintenance of leukemia initiating cells using a mouse leukemia cell line that we
17 previously established with MLL-ENL (23). CRISPR/Cas9-mediated sgRNA
18 competition assays indicated negligible contribution of Bcl2 and Sox4 to MLL-ENL-
19 LC proliferation ex vivo (Supplemental Figure 5B). To test their roles in vivo, we
20 transplanted Bcl2- or Sox4-deficient LCs into syngeneic mice, where we observed
21 delayed onset and reduced incidence rate for both Bcl2- and Sox4-knockout LCs
22 (Figure 7C). Forced expression of sgRNA-resistant cDNAs of BCL2 and SOX4
23 restored leukemogenic potential, validating the on-target effects of sgRNAs (Figure
24 7D). These results suggest that MLL-ENL-LCs are partially dependent on
25 endogenous BCL2 and SOX4 in vivo. Taken together, our results indicate that MLL-
26 rearranged leukemia cells depend on the expression of multiple anti-apoptotic genes
18 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 via HOXA9 to varying degrees to achieve survival advantages for disease initiation
2 and maintenance (Figure 7E).
3
4
5 Figure 7 | Endogenous BCL2 and SOX4 support the initiation and maintenance 6 of leukemia
19 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 A and B, Effects of Bcl2- or Sox4-deficiency on the initiation of leukemogenesis in 2 vivo. HPCs were isolated from Bcl2+/+ or Bcl2–/– (A) or Sox4+/+ or Sox4–/– (B) embryos 3 and transduced with MLL-AF10 or the HOXA9/MEIS1 combination. Kaplan-Meier 4 curves of mice transplanted with the transduced HPCs are shown. Statistical analysis 5 was performed using the log-rank test and Bonferroni correction with the wildtype 6 control. *P ≤ 0.05. C, Effects of Bcl2- or Sox4-deficiency on the maintenance of 7 leukemia initiating cells. Western blots of MLL-ENL leukemia cells transduced with 8 sgRNA for BCL2 or SOX4 are shown on the left. Kaplan-Meier curves of mice 9 transplanted with MLL-ENL leukemia cells transduced with the indicated sgRNAs are 10 shown on the right. Statistical analysis was performed using the log-rank test and 11 Bonferroni correction with the vector control. D, Rescue of in vivo leukemogenic 12 potential by sgRNA-resistant transgenes. Before transduction of sgRNA, MLL-ENL- 13 LCs were transduced with sgRNA-resistant BCL2 or SOX4. In vivo leukemogenesis 14 assay was performed as described in Figure 3D. E, A model illustrating HOXA9- 15 mediated pathogenesis in MLL-rearranged leukemia. 16
17
20 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Discussion
2 In this study, we found that HOXA9 regulates a variety of genes to maintain
3 hematopoietic precursor identity and its associated anti-apoptotic properties. In
4 leukemic transformation, MLL fusion proteins exploit both HOXA9 and MYC
5 downstream pathways. Accordingly, HOXA9 and MYC synergistically induce
6 leukemia in mouse models. Thus, we propose that MLL fusion proteins employ two
7 arms to promote oncogenesis: MYC-mediated proliferation and HOXA9-mediated
8 resistance to differentiation/apoptosis.
9 It is widely accepted that two types of mutations need to occur before
10 leukemia onset; class I mutations that confer proliferative advantages and class II
11 mutations that block differentiation (40). However, it was unclear how MLL
12 mutations fit this theory because MLL-rearranged leukemia does not require
13 additional mutations in many cases (41). A comparison of gene expression profiles of
14 HOXA9- and MYC-transformed HPCs demonstrated that HOXA9 maintains the
15 expression of a wide range of genes associated with hematopoietic precursor identity.
16 Thus, HOXA9 appears to maintain intrinsic transcriptional programs of immature
17 HPCs, which are programed to be silenced during differentiation. On the other hand,
18 MYC upregulates genes involved with de novo protein synthesis or metabolism. This
19 is in line with the known involvement of MYC in proliferation and the associated
20 anabolic processes (42). Furthermore, MLL-AF10 activated both the HOXA9 high
21 and MYC high signature genes to induce leukemia while ectopic expression of
22 HOXA9 and MYC synergistically induced leukemia. Thus, our findings suggest that
23 MLL fusion proteins activate both HOXA9- and MYC-dependent programs as
24 alternative mechanisms to the combination of class I and II mutations.
21 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Therapeutic efficacy of BCL2 inhibitor has been reported in AML including
2 MLL leukemia (43). Because there is a correlation between the expression levels of
3 HOX proteins and the sensitivity to BCL2 inhibitor in AML patient samples, the
4 aberrant expression of HOXA9 is the potential mechanisms for BCL2-dependence of
5 MLL leukemia (44, 45). Oncogenic MYC expression often leads to apoptosis, which
6 need to be alleviated by additional genetic events for leukemic cell survival (28).
7 Indeed, co-expression of HOXA9, BCL2 or SOX4 promoted MYC-mediated
8 leukemogenesis, while MYC alone was insufficient to induce leukemia in vivo.
9 Although the downstream mechanisms could not be addressed, SOX4 also exhibited
10 anti-apoptotic effects on MYC-expressing cells. Importantly, there was a partial effect
11 of single gene knockout of Bcl2 and Sox4 on leukemia initiation and maintenance.
12 This indicates that multiple anti-apoptotic pathways are exploited by MLL fusion
13 proteins and that blocking a single anti-apoptotic pathway may be insufficient to
14 completely abrogate leukemic potential. Thus, simultaneously blocking multiple anti-
15 apoptotic pathways may be required for efficient molecularly targeted therapy of
16 HOXA9-expressing leukemia.
17 Our results also provide an insight into the mode of function of HOXA9. HOX
18 genes are known to express in a position-specific manner, conferring a positional
19 identity to a cell. For example, similarly functional fibroblasts derived from different
20 parts of a body express different HOX genes (5). Thus, it is unlikely that HOXA9
21 functions as a major upstream factor which determines tissue-specific gene expression
22 by turning a silenced chromatin into transcriptionally active chromatin. HOX proteins
23 likely play a supportive role to maintain gene expression which was activated by other
24 transcriptional regulators. Our observation that HOXA9 cannot reactivate gene
25 expression once silenced fits to this hypothesis. Accordingly, HOXA9 maintains a
22 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 subset of genes related to hematopoietic identity when expressed in hematopoietic
2 precursors. Recently, it has been reported that HOXA9 may recruit enhancer
3 apparatuses, as it colocalizes with active enhancer mark (i.e. acetylated histone H3
4 lysine 27). We speculate that HOXA9 may support the maintenance of an active
5 enhancer, but unlikely establishes it on a silenced chromatin. Further functional
6 analysis of HOXA9 is required to understand how HOXA9 regulates gene expression.
7 In summary, our results describe the oncogenic roles for HOXA9 as
8 transcriptional maintenance factor for multiple anti-apoptotic genes, which are
9 necessary to promote MYC-mediated leukemogenesis. In case of MLL-rearranged
10 leukemia, MLL fusion proteins directly activate both MYC and HOXA9, while
11 HOXA9 maintains expression of MYC, BCL2, and SOX4, achieving high MYC
12 activity and anti-apoptotic properties simultaneously (Figure 7E). Thus, MLL-
13 rearranged leukemia cells acquired highly proliferative potentials and survival
14 advantages at the same time, using HOXA9 as a key mediator.
15
23 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Materials and Methods
2
3 Vector constructs
4 For protein expression vectors, cDNAs obtained from Kazusa Genome Technologies
5 Inc. (46) were modified by PCR-mediated mutagenesis and cloned into the pMSCV
6 vector (for virus production) or pCMV5 vector (for transient expression) by
7 restriction enzyme digestion and DNA ligation (Supplemental Table 1). The MSCV-
8 neo MLL-ENL, and MLL-AF10 vectors have been previously described (23).
9 sgRNA-expression vectors were constructed using the pLKO5.sgRNA.EFS.GFP
10 vector (47). shRNA-expression vectors were purchased from Dharmacon. The target
11 sequences are listed in Supplemental Table 2 (sgRNA) and Supplemental Table 3
12 (shRNA).
13
14 Cell lines
15 HEK293T cells were a gift from Michael Cleary and were authenticated by the JCRB
16 Cell Bank in 2019 (Supplemental Table 1). HEK293TN cells were purchased from
17 System Biosciences. The cells were cultured in Dulbecco’s modified Eagle’s medium
18 (DMEM) supplemented with 10% fetal bovine serum (FBS) and penicillin-
19 streptomycin (PS). The Platinum-E (PLAT-E) ecotropic virus packaging cell line—a
20 gift from Toshio Kitamura (48)—was cultured in DMEM supplemented with 10%
21 FBS, puromycin, blasticidin, and PS. The human leukemia cell line HB1119, also a
22 gift from Michael Cleary (49), was cultured in RPMI 1640 medium supplemented
23 with 10% FBS and PS. MLL-ENL leukemia cells (MLL-ENLbm0713) were
24 described previously (23). Cells were incubated at 37 °C and 5% CO2.
25
24 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Animal models
2 For the in vivo leukemogenesis assay, 8-week-old female C57BL/6JJcl (C57BL/6J) or
3 C. B-17/Icr-scid/scidJcl (SCID) mice were purchased from CLEA Japan (Tokyo,
4 Japan). Bcl2-knockout mice were a gift from Yoshihide Tsujimoto and provided via
5 RIKEN BRC (38). Sox4-knockout mice were a gift from Hans Clevers and provided
6 via RIKEN BRC (39).
7
8 Western blotting
9 Western blotting was performed as previously described (50). Antibodies used in this
10 study are listed in Supplemental Table 1.
11
12 Virus production
13 Ecotropic retrovirus was produced using PLAT-E packaging cells (48). Lentiviruses
14 were produced in HEK293TN cells using the pMDLg/pRRE, pRSV-rev, and pMD2.G
15 vectors, all of which were gifts from Didier Trono (51). The virus-containing medium
16 was ha0,rvested 24–48 h following transfection and used for viral transduction.
17
18 Myeloid progenitor transformation assay
19 The myeloid progenitor transformation assay was carried out as previously described
20 (26, 27). Bone marrow cells were harvested from the femurs and tibiae of 5-week-old
21 female C57BL/6J mice. c-Kit+ cells were enriched using magnetic beads conjugated
22 with an anti-c-Kit antibody (Miltenyi Biotec), transduced with a recombinant
23 retrovirus by spinoculation, and then plated (4 × 104cells/ sample) in a
24 methylcellulose medium (Iscove’s modified Dulbecco’s medium, 20% FBS, 1.6%
25 methylcellulose, and 100 µM β-mercaptoethanol) containing murine stem cell factor
25 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 (mSCF), interleukin 3 (mIL-3), and granulocyte-macrophage colony-stimulating
2 factor (mGM-CSF; 10 ng/mL each). During the first culture passage, G418 (1mg/mL)
3 or puromycin (1μg/mL) was added to the culture medium to select for transduced
4 cells. Hoxa9 expression was quantified by qRT-PCR after the first passage. Cells
5 were then re-plated once every 4-6 days with fresh medium; the number of plated
6 cells for the second, third, and fourth passages was 4 × 104, 2 × 104, and 1 × 104
7 cells/well, respectively. CFUs were quantified per 104 plated cells at each passage.
8
9 In vivo leukemogenesis assay
10 In vivo leukemogenesis assays were carried out as previously described (26, 52). c-
11 Kit+ cells (2 ´ 105) prepared from the femurs and tibiae of 5-week-old female
12 C57BL/6J mouse were transduced with retrovirus by spinoculation and intravenously
13 transplanted into sublethally irradiated (5–6 Gy) C57BL/6J mice. For secondary
14 leukemia, leukemia cells (2 ´ 105) cultured ex vivo for more than three passages were
15 transplanted. As for knockouts of Bcl2 and Sox4, mice heterozygous for Bcl2 or Sox4
16 were crossed, and c-Kit+ cells were isolated from fetal livers at E14–15 (for Bcl2) or
17 E13 (for Sox4). The next day, cells were transduced with MLL-AF10 or
18 HOXA9/MEIS1 and transplanted intravenously into sublethally irradiated (2.5 Gy)
19 SCID mice [2 × 105 (for Bcl2) or 1 × 105 cells/mouse (for Sox4)].
20
21 qRT-PCR
22 Total RNA was isolated using the RNeasy Mini Kit (Qiagen) and reverse-transcribed
23 using the Superscript III First Strand cDNA Synthesis System (Thermo Fisher
24 Scientific) with oligo (dT) primers. Gene expression was analyzed by qPCR using
25 TaqMan probes (Thermo Fisher Scientific). Relative expression levels were
26 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 normalized to those of GAPDH/Gapdh or TBP/Tbp and determined using a standard
2 curve and the relative quantification method, according to manufacturer’s instructions
3 (Thermo Fisher Scientific). Commercially available PCR probes used are listed in
4 Supplemental Table 1.
5
6 ChIP-qPCR and ChIP-seq
7 The eluted material obtained by fanChIP was extracted by phenol/chloroform/isoamyl
8 alcohol. DNA was precipitated with glycogen, dissolved in TE buffer, and analyzed
9 by qPCR (ChIP-qPCR) or deep sequencing (ChIP-seq). The qPCR probe/primer
10 sequences are listed in Supplemental Table 4. Deep sequencing was performed using
11 the TruSeq ChIP Sample Prep Kit (Illumina) and HiSeq2500 (Illumina) at the core
12 facility of Hiroshima University and described in our previous publication (23).
13
14 RNA-seq
15 Total RNA was prepared using the RNeasy Kit (Qiagen) and analyzed using a
16 Bioanalyzer (Agilent Technologies). Deep sequencing was performed using a
17 SureSelect Strand Specific RNA Library Prep Kit (Agilent Technologies) and
18 HiSeq2500 (Illumina) with 51-bp single-end reads at the core facility of Hiroshima
19 University. Sequenced reads were mapped to the mouse genome assembly mm9 using
20 TopHat 2.0.14 (53) and read counts were normalized with Cufflinks 2.2.1 2010 (54).
21 Data were trimmed by removing lowly expressed genes whose FKPM values were
22 less than 2, after which the top 50 HOXA9 high and MYC high signature genes were
23 visualized as a heatmap using the Complex Heatmap package (55). GSEA analysis
24 and KEGG pathway analysis was performed on the top 500 genes of the HOXA9 or
25 MYC high signature using the DAVID website (56).
27 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 sgRNA competition assay
3 Cas9 was introduced via lentiviral transduction using the pKLV2-EF1a-Cas9Bsd-W
4 vector (57). Cas9-expressing stable lines were established with blasticidin (10–30
5 µg/mL) selection. The targeting sgRNA was co-expressed with GFP via lentiviral
6 transduction using pLKO5.sgRNA.EFS.GFP vector (47). Percentages of GFP+ cells
7 were initially determined by FACS analysis at 2 or 3 days after sgRNA transduction,
8 and then measured once every 3–5 days.
9
10 FACS analysis and sorting
11 To detect apoptosis, two to five million cells were suspended in 200 µL of reaction
12 buffer (140 mM NaCl, 10 mM HEPES, 2.5 mM CaCl2, and 0.1% BSA) and incubated
13 with APC-Annexin V for 15 min and PE-PI for 5 min at room temperature. The cells
14 were then centrifuged, resuspended in fresh reaction buffer, and analyzed with FACS
15 Melody (BD Bioscience). FACS sorting of mouse bone marrow cells was performed
16 with fluorophore-conjugated antibodies listed in Supplemental Table 1 as previously
17 described (58).
18
19 Accession numbers
20 Deep sequencing data used in this study have been deposited in the DNA Data Bank
21 of Japan (DDBJ) Sequence Read Archive under the accession numbers listed in
22 Supplemental Table 5 (ChIP-seq) and Supplemental Table 6 (RNA-seq).
23
24 Statistics
28 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Statistical analysis was performed using GraphPad Prism 7 software. Data are
2 presented as the mean with standard deviation (SD). Comparisons between two
3 groups were analyzed by unpaired two-tailed Student’s t-test, while multiple
4 comparisons were performed by ordinary one-way ANOVA followed by Dunnett’s
5 test or two-way ANOVA. Mice transplantation experiments were analyzed by the log-
6 rank test and Bonferroni correction was applied for multiple comparisons. P values <
7 0.05 were considered statistically significant. n.s.: P>0.05, *: P ≤ 0.05, **: P ≤ 0.01,
8 ***: P ≤ 0.001, and ****: P ≤ 0.0001.
9
10 Study approval
11 All animal experimental protocols were approved by the National Cancer Center
12 (Tokyo Japan) Institutional Animal Care and Use Committee.
29 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Acknowledgments
2 We thank Yuzo Sato, Makiko Okuda, Megumi Nakamura, Etsuko Kanai, Aya
3 Nakayama, Boban Stanojevic, and Ayako Yokoyama for technical assistance. We
4 thank Drs. Yoshihide Tsujimoto and Hans Clevers for providing us the knockout
5 mouse lines of Bcl2 and Sox4, respectively. We also thank all members of the Shonai
6 Regional Industry Promotion Center for their administrative support. This work was
7 supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI
8 grants (16H05337 and 19H03694 to A.Y.; 19K16791 to R.M.) and in part by research
9 funds from the Yamagata prefectural government, the City of Tsuruoka, Dainippon
10 Sumitomo Pharma Co. Ltd., and the Friends of Leukemia Research Fund.
11
12 Author contributions
13 R.M., H.O., S.T., Y.S., and A.Y. performed the experiments. A.K., H.M., and T.I.
14 performed deep sequencing. A.K. analyzed deep sequencing data. A.Y. conceived of
15 the project. A.Y. and R.M. wrote the paper.
16
17 Competing interests
18 A.Y. received a research grant from Dainippon Sumitomo Pharma Co. Ltd.
19
30 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplemental information
2
3 Supplemental Figure 1 Association of the MLL-ENL complex on target promoters.
4 Supplemental figure 2 Recovery of HOXA9-expressing cells from cytokine
5 withdrawal.
6 Supplemental figure 3 Expression profiles of the LCs established by various gene
7 combinations.
8 Supplemental figure 4 Gene expression of hematopoietic progenitors transformed by
9 various combinations of transgenes.
10 Supplemental figure 5 Roles for endogenous BCL2 and SOX4 in transformation ex
11 vivo.
12 Supplemental Table 1, Reagents details
13 Supplemental Table 2. sgRNA sequences
14 Supplemental Table 3. shRNA sequences
15 Supplemental Table 4. Custom qPCR probe/primer sequences
16 Supplemental Table 5. Accession numbers of ChIP-seq data
17 Supplemental Table 6. Accession numbers of mRNA-seq data
18
19
20
21
31 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Supplemental Figure 1 Association of the MLL-ENL complex on target 3 promoters. 4 Genomic localization of the MLL-ENL complex in HB1119 cells. ChIP-qPCR was 5 performed using anti-MLL and MENIN antibodies. Precipitated DNA was subjected 6 to qPCR using specific probes for the pre-TSS (-1.0 to -0.5 kb from the TSS), TSS (0 7 to 0.5 kb from the TSS), and post-TSS (1.0 to 1.5 kb from the TSS) regions of the 8 indicated genes. ChIP signals were expressed as the percent input (Mean with SD, n = 9 3, PCR replicates). 10
32 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Supplemental figure 2 Recovery of HOXA9-expressing cells from cytokine 3 withdrawal. 4 MYC-, HOXA9-, MLL-AF10-ICs were subjected to cytokine withdrawal for 2 d, then 5 cultured in the presence of cytokines for 7d, and examined by FACS for Annexin V 6 and PI. 7
8
33 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 3 Supplemental figure 3 Expression profiles of the LCs established by various gene 4 combinations. 5 LCs were harvested from moribund mice during the transplantation assay as described 6 in Figure 4E. Relative mRNA levels of the indicated genes (Mean with SD, n=3, PCR 7 replicates) are shown along with those of the respective ICs.
34 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Supplemental figure 4 Gene expression of hematopoietic progenitors 3 transformed by various combinations of transgenes. A and B, Relative mRNA 4 levels of the transgenes and endogenous Myc in the cells used in Figure 5A (A) and 5 5C (B). 6
35 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Supplemental figure 5 Roles for endogenous BCL2 and SOX4 in transformation 3 ex vivo. 4 A, Requirement of BCL2 and SOX4 in transformation ex vivo. Empty vector, MLL- 5 AF10, HOXA9, or MYC were transduced into HPCs isolated from fetal liver of the 6 indicated genotypes. CFU (Mean with SD, n = 3, biological replicates) of myeloid 7 progenitors derived from Bcl2- or Sox4-knockout embryos is shown. B, Effects of 8 Bcl2 or Sox4 knockout on MLL-ENL-leukemia cells. sgRNA/GFP was transduced 9 into Cas9-expressing MLL-ENL-LCs. Changes in GFP+ cells (%) (Mean n=3, 10 biological replicates) are shown with sgMen1 serving as a positive control. 11
36 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplemental Table 1, Reagents details
Reagent or Resource Source Identifier
MNase Sigma-Aldrich N3755-200U
Protein-G Magnetic beads Thermo Fisher Scientific 1004D
FLAG M2 antibody-conjugated beads Sigma-Aldrich M8823
c-Kit magnetic beads Miltenyi Biotec 130-091-224
RNeasy Mini Kit Qiagen 74106
SuperScript™ III First-Strand
Synthesis System Thermo Fisher Scientific 18080051
TruSeq ChIP Sample Prep Kit SetB Illumina IP-202-1024
SureSelect Strand Specific RNA
Library Prep Kit Agilent Technologies G9691A
Protease inhibitor cocktail Roche 11873580001
Antibodies for ChIP, IP, and WB
MLL (50) rpN1
MENIN Bethyl Laboratories A300-105A
RNAP2 Ser5-P Millipore 05-623
MYC Cell Signaling Technology 13987
Caspase3 Cell Signaling Technology 14220
Cleaved Caspase3 Cell Signaling Technology 9664
PARP Cell Signaling Technology 9542
�H2AX Bethyl Laboratories A300-081A
BCL2 Santa Cruz Biotechnology sc-7382
SOX4 Santa Cruz Biotechnology sc-518016
HOXA9 Millipore 07-178
GAPDH Santa Cruz Biotechnology sc-25778
BAK Cell Signaling Technology 12105
BAD Cell Signaling Technology 9239
BCLXL Cell Signaling Technology 2764
37 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
MCL1 Cell Signaling Technology 5453
Reagents for FACS
APC Annexin V BD Biosciences 550475
Propidium iodide Thermo Fisher Scientific P3566
Gr-1 BD Biosciences RB6-8C5
B220 BD Biosciences RA3-6B2
TER119 BD Biosciences TER119
CD3e BD Biosciences 145-2C11
Mac/CD11b BD Biosciences M1/70
c-Kit BD Biosciences 2B8
Sca1 BD Biosciences D7
CD34 BD Biosciences 49E8
CD16/32 BD Biosciences 93
qPCR primers (mouse)
Bcl2 Thermo Fisher Scientific Mm00477631_m1
Bcl2a1b Thermo Fisher Scientific Mm03646861_mH
Bcl2l1 Thermo Fisher Scientific Mm00437783_m1
Bcl2l2 Thermo Fisher Scientific Mm00432054_m1
Gapdh Thermo Fisher Scientific Mm99999915_g1
Hoxa10 Thermo Fisher Scientific Mm00433966_m1
Hoxa9 Thermo Fisher Scientific Mm00439364_m1
Igf1 Thermo Fisher Scientific Mm00439560_m1
Itgam (Cd11b) Thermo Fisher Scientific Mm00434455_m1
Max Thermo Fisher Scientific Mm00484802_g1
Mcl1 Thermo Fisher Scientific Mm01257351_g1
Meis1 Thermo Fisher Scientific Mm00487664_m1
Mxd1 Thermo Fisher Scientific Mm00487504_m1
Myc Thermo Fisher Scientific Mm00487804_m1
Sox4 Thermo Fisher Scientific Mm00486320_s1
38 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Tbp Thermo Fisher Scientific Mm01277042_m1
Recombinant DNA
pMSCV-neo Clontech
pMSCV-puro Clontech
pMSCV-hygro Clontech
Addgene (gift from Benjamin
pLKO5.EFS.GFP Ebert) (47) Addgene #57822
Addgene (gift from Kosuke Yusa)
pKLV2-Cas9.bsd (57) Addgene #68343
Addgene (gift from Didier Trono)
pMDLg/pRRE (51) Addgene #12251
Addgene (gift from Didier Trono)
pRSV-rev (51) Addgene #12253
Addgene (gift from Didier Trono)
pMD2.G (51) Addgene #12259
Addgene (gift from Bob Weinberg)
pLKO.1-puro (59) Addgene #8453
Software
GraphPad Prism7 GraphPad Software Inc.
FlowJo BD Biosciences
Integrative Genomics Viewer (60)
Tophat (53)
Cufflinks (54)
DAVID (56)
Complex heatmap (55)
Cell line
39 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Human: HEK293T Authenticated by
JCRB cell bank in
Gift from Michael Cleary 2019
Human: HB1119 Gift from Michael Cleary (49)
Human: PLAT-E Gift from Toshio Kitamura (48)
Human: HEK293TN System Biosciences
Mouse: MLL-ENL (23) MLL-ENLbm0713
Mouse
Mouse: C57BL/6J CLEA Japan
Mouse: B6.129P2- Gift from Yoshihide Tsujimoto (via
Bcl2
Mouse: STOCK Gift from Hans Clevers (via
Sox4
1
2 Supplemental Table 2. sgRNA sequences
sgRNA Sequence
Bcl2#1 GCCCGCTGTGCACCGGGACA
Bcl2#2 GGTCCATCTGACCCTCCGCC
Sox4#1 CGCGTCGACGGGCGGCAAGG
Sox4#2 GATCGAGCGGCGCAAGATCA
Men1 TCTGCGCTCTATCGACGACG
Ren GGATGATAACTGGTCCGCAG
3
4 Supplemental Table 3. shRNA sequences
shRNA Target Identifier
Myc#1 CGAGAACAGTTGAAACACAAA TRCN0000042513
Myc#2 CGACGAGGAAGAGAATTTCTA TRCN0000042515
5
6 Supplemental Table 4. Custom qPCR probe/primer sequences
40 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Target name Forward Reverse Reporter
PITX2 pre- AGGGCAGTTGCTCTGAA CTGCAGAAGGAGCTCTT ACTGCCTGGCCACTCC
TSS GTC GGA
PITX2 TSS AGAGAGAGTGCGAGACC GCCACTGGCAGTTTCTTT CCTCTCCAGCTTTCTC
GA CTG
PITX2 post- CAGGCCCAAGCGAATTA AGTTGACTGGTGATCAAT CTGGATGCCAAGCTCT
TSS CCT TTAAAGGAGTT
HOXA7 pre- GCCTTCCCCGTCTGGAT ACTCTGCCCAAGTCTTCT CAGGCCGGACTTAGAC
TSS CTCA
HOXA7 TSS GACGCCTACGGCAACCT GCCTTTGGCGAGGTCACT CCCTGCGCCTCCTAC
HOXA7 post- TGCCAGGGTCCATTTCAA CCCTCATCCCCAGGACCT CTCTGTCCTCATTCCC
TSS GATG T
HOXA9 pre- TGGCTGCTTTTTTATGGC CCGCGTGCGAGTGC CCCCTCACATAAAATT
TSS TTCAATT
HOXA9 TSS TCACCACCACCCCTACGT GCAAGCCCGCGAAGGA CAGGAGCGCATGTACC
HOXA9 post- AGTGGCGGCGTAAATCCT TGATCACGTCTGTGGCTT CCCGCAGCCTCATC
TSS ATTTGAA
HOXA10 pre- GGGCCGTCTTTCCATCAA AACTCCTGTCAGTGGACT
TSS G TTGG CAGTCCCGCCAGCCCA
HOXA10 TSS GGCGGTGGCGGTTACTA
C CGACGCTGCCTCATTGC CTGCCCTACGGGCTGC
HOXA10 CCTCAGCTCCCCCTGACT CCCGGCCACAGGAAAGA CAGCGAGCAGGCCCCCT
post-TSS AG G
MEIS1 pre- CGGCGTTGATTCCCAATT CACACAAACGCAGGCAG CCGCCAGCTTTATTTT
TSS TATTTCA TAG
MEIS1 TSS TTTGCTTCAGGTCCCGTA CCTTAACGTCTCCAGCAA ACTGGTCCCAGATCTT
GAC CGT
MEIS1 post- TCTCAGCGCCTCCAAATC TTTGTGTGTGTGAAATTT CCAGGCAGTTATTTTC
TSS TTG AGCTATTTAGGTTTT
MYC pre-TSS GCGGTATCTGCTGCTTTG GCATTATGTATGCACAGC CTGGGTGGAAGGTATCC
G TATCTGGAT
41 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
MYC TSS CCGGCTAGGGTGGAAGA GAGGCGAAGCCCCCTATT CAGGACGCCCGCAGCG
G C
MYC post- GGGTAGGCGCAGGCA GGTTTTTCCAAGTCAACG ATGTGTCCGATTCTCC
TSS ATTCCA
1
2 Supplemental Table 5. Accession numbers of ChIP-seq data
Sample name DRA accession Sample ID
number
HB1119-fanChIP-INPUT DRA004871 SAMD00055689
HB1119-fanChIP-MLLn DRA004871 SAMD00055685
HB1119-fanChIP- RNAP2 Ser5-P DRA002840 SAMD00023553
3
4 Supplemental Table 6. Accession numbers of mRNA-seq data
Sample name DRA accession Sample ID
number
MP-fMLL-AF10-RNA 150916 DRA010090 SAMD00220959
MP-fMLL-AF10-RNA 170719-1 DRA010090 SAMD00220960
MP-fMLL-AF10-RNA 170719-2 DRA010090 SAMD00220961
MP-fHOXA9-RNA 140824 DRA010090 SAMD00220962
MP-fHOXA9-RNA 150812 DRA010090 SAMD00220963
MP-fHOXA9-RNA 170719-1 DRA010090 SAMD00220964
MP-fMYC-RNA 131204 DRA010090 SAMD00220965
MP-fMYC-RNA 141113 DRA010090 SAMD00220966
MP-fMYC-RNA 170719 DRA010090 SAMD00220967
5
6
42 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 References
3 1. Tamai H, Inokuchi K. 11q23/MLL acute leukemia : update of clinical aspects. 4 J Clin Exp Hematop. 2010;50(2):91-8. 5 2. Yu BD, Hanson RD, Hess JL, Horning SE, Korsmeyer SJ. MLL, a 6 mammalian trithorax-group gene, functions as a transcriptional maintenance factor in 7 morphogenesis. Proc Natl Acad Sci U S A. 1998;95(18):10632-6. 8 3. Luo Z, Rhie SK, Farnham PJ. The Enigmatic HOX Genes: Can We Crack 9 Their Code? Cancers (Basel). 2019;11(3). 10 4. Deschamps J, van Nes J. Developmental regulation of the Hox genes during 11 axial morphogenesis in the mouse. Development. 2005;132(13):2931-42. 12 5. Wang KC, Helms JA, Chang HY. Regeneration, repair and remembering 13 identity: the three Rs of Hox gene expression. Trends in cell biology. 2009;19(6):268- 14 75. 15 6. Jude CD, Climer L, Xu D, Artinger E, Fisher JK, Ernst P. Unique and 16 independent roles for MLL in adult hematopoietic stem cells and progenitors. Cell 17 Stem Cell. 2007;1(3):324-37. 18 7. Krivtsov AV, Twomey D, Feng Z, Stubbs MC, Wang Y, Faber J, et al. 19 Transformation from committed progenitor to leukaemia stem cell initiated by MLL- 20 AF9. Nature. 2006;442(7104):818-22. 21 8. McMahon KA, Hiew SY, Hadjur S, Veiga-Fernandes H, Menzel U, Price AJ, 22 et al. Mll has a critical role in fetal and adult hematopoietic stem cell self-renewal. 23 Cell Stem Cell. 2007;1(3):338-45. 24 9. Thorsteinsdottir U, Mamo A, Kroon E, Jerome L, Bijl J, Lawrence HJ, et al. 25 Overexpression of the myeloid leukemia-associated Hoxa9 gene in bone marrow cells 26 induces stem cell expansion. Blood. 2002;99(1):121-9. 27 10. Yagi H, Deguchi K, Aono A, Tani Y, Kishimoto T, Komori T. Growth 28 disturbance in fetal liver hematopoiesis of Mll-mutant mice. Blood. 1998;92(1):108- 29 17. 30 11. Yokoyama A, Lin M, Naresh A, Kitabayashi I, Cleary ML. A higher-order 31 complex containing AF4 and ENL family proteins with P-TEFb facilitates oncogenic 32 and physiologic MLL-dependent transcription. Cancer cell. 2010;17(2):198-212. 33 12. Lin C, Smith ER, Takahashi H, Lai KC, Martin-Brown S, Florens L, et al. 34 AFF4, a component of the ELL/P-TEFb elongation complex and a shared subunit of 35 MLL chimeras, can link transcription elongation to leukemia. Mol Cell. 36 2010;37(3):429-37. 37 13. Okuda H, Kanai A, Ito S, Matsui H, Yokoyama A. AF4 uses the SL1 38 components of RNAP1 machinery to initiate MLL fusion- and AEP-dependent 39 transcription. Nat Commun. 2015;6:8869. 40 14. Schnabel CA, Jacobs Y, Cleary ML. HoxA9-mediated immortalization of 41 myeloid progenitors requires functional interactions with TALE cofactors Pbx and 42 Meis. Oncogene. 2000;19(5):608-16. 43 15. Kroon E, Krosl J, Thorsteinsdottir U, Baban S, Buchberg AM, Sauvageau G. 44 Hoxa9 transforms primary bone marrow cells through specific collaboration with 45 Meis1a but not Pbx1b. Embo J. 1998;17(13):3714-25. 46 16. Collins CT, Hess JL. Role of HOXA9 in leukemia: dysregulation, cofactors 47 and essential targets. Oncogene. 2016;35(9):1090-8.
43 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 17. Berger MF, Badis G, Gehrke AR, Talukder S, Philippakis AA, Pena-Castillo 2 L, et al. Variation in homeodomain DNA binding revealed by high-resolution analysis 3 of sequence preferences. Cell. 2008;133(7):1266-76. 4 18. Shen WF, Rozenfeld S, Kwong A, Kom ves LG, Lawrence HJ, Largman C. 5 HOXA9 forms triple complexes with PBX2 and MEIS1 in myeloid cells. Mol Cell 6 Biol. 1999;19(4):3051-61. 7 19. Chang CP, Brocchieri L, Shen WF, Largman C, Cleary ML. Pbx modulation 8 of Hox homeodomain amino-terminal arms establishes different DNA-binding 9 specificities across the Hox locus. Mol Cell Biol. 1996;16(4):1734-45. 10 20. Sun Y, Zhou B, Mao F, Xu J, Miao H, Zou Z, et al. HOXA9 Reprograms the 11 Enhancer Landscape to Promote Leukemogenesis. Cancer cell. 2018;34(4):643-58 e5. 12 21. Huang Y, Sitwala K, Bronstein J, Sanders D, Dandekar M, Collins C, et al. 13 Identification and characterization of Hoxa9 binding sites in hematopoietic cells. 14 Blood. 2012;119(2):388-98. 15 22. Zhong X, Prinz A, Steger J, Garcia-Cuellar MP, Radsak M, Bentaher A, et al. 16 HoxA9 transforms murine myeloid cells by a feedback loop driving expression of key 17 oncogenes and cell cycle control genes. Blood Adv. 2018;2(22):3137-48. 18 23. Okuda H, Stanojevic B, Kanai A, Kawamura T, Takahashi S, Matsui H, et al. 19 Cooperative gene activation by AF4 and DOT1L drives MLL-rearranged leukemia. J 20 Clin Invest. 2017;127(5):1918-31. 21 24. Somervaille TC, Cleary ML. Identification and characterization of leukemia 22 stem cells in murine MLL-AF9 acute myeloid leukemia. Cancer cell. 2006;10(4):257- 23 68. 24 25. Passegue E, Wagers AJ, Giuriato S, Anderson WC, Weissman IL. Global 25 analysis of proliferation and cell cycle gene expression in the regulation of 26 hematopoietic stem and progenitor cell fates. J Exp Med. 2005;202(11):1599-611. 27 26. Lavau C, Szilvassy SJ, Slany R, Cleary ML. Immortalization and leukemic 28 transformation of a myelomonocytic precursor by retrovirally transduced HRX-ENL. 29 Embo J. 1997;16(14):4226-37. 30 27. Okuda H, Yokoyama A. Myeloid Progenitor Transformation Assay. Bio- 31 protocol. 2017;7(23). 32 28. McMahon SB. MYC and the control of apoptosis. Cold Spring Harb Perspect 33 Med. 2014;4(7):a014407. 34 29. Haferlach T, Kohlmann A, Wieczorek L, Basso G, Kronnie GT, Bene MC, et 35 al. Clinical utility of microarray-based gene expression profiling in the diagnosis and 36 subclassification of leukemia: report from the International Microarray Innovations in 37 Leukemia Study Group. J Clin Oncol. 2010;28(15):2529-37. 38 30. Lin S, Luo RT, Ptasinska A, Kerry J, Assi SA, Wunderlich M, et al. 39 Instructive Role of MLL-Fusion Proteins Revealed by a Model of t(4;11) Pro-B Acute 40 Lymphoblastic Leukemia. Cancer cell. 2016;30(5):737-49. 41 31. Zhang H, Alberich-Jorda M, Amabile G, Yang H, Staber PB, Di Ruscio A, et 42 al. Sox4 is a key oncogenic target in C/EBPalpha mutant acute myeloid leukemia. 43 Cancer cell. 2013;24(5):575-88. 44 32. Du Y, Spence SE, Jenkins NA, Copeland NG. Cooperating cancer-gene 45 identification through oncogenic-retrovirus-induced insertional mutagenesis. Blood. 46 2005;106(7):2498-505. 47 33. Delbridge AR, Grabow S, Strasser A, Vaux DL. Thirty years of BCL-2: 48 translating cell death discoveries into novel cancer therapies. Nat Rev Cancer. 49 2016;16(2):99-109.
44 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 34. Steger J, Fuller E, Garcia-Cuellar MP, Hetzner K, Slany RK. Insulin-like 2 growth factor 1 is a direct HOXA9 target important for hematopoietic transformation. 3 Leukemia. 2015;29(4):901-8. 4 35. Beverly LJ, Varmus HE. MYC-induced myeloid leukemogenesis is 5 accelerated by all six members of the antiapoptotic BCL family. Oncogene. 6 2009;28(9):1274-9. 7 36. Luo H, Li Q, O'Neal J, Kreisel F, Le Beau MM, Tomasson MH. c-Myc 8 rapidly induces acute myeloid leukemia in mice without evidence of lymphoma- 9 associated antiapoptotic mutations. Blood. 2005;106(7):2452-61. 10 37. Ramezani-Rad P, Geng H, Hurtz C, Chan LN, Chen Z, Jumaa H, et al. SOX4 11 enables oncogenic survival signals in acute lymphoblastic leukemia. Blood. 12 2013;121(1):148-55. 13 38. Kamada S, Shimono A, Shinto Y, Tsujimura T, Takahashi T, Noda T, et al. 14 bcl-2 deficiency in mice leads to pleiotropic abnormalities: accelerated lymphoid cell 15 death in thymus and spleen, polycystic kidney, hair hypopigmentation, and distorted 16 small intestine. Cancer Res. 1995;55(2):354-9. 17 39. Schilham MW, Oosterwegel MA, Moerer P, Ya J, de Boer PA, van de 18 Wetering M, et al. Defects in cardiac outflow tract formation and pro-B-lymphocyte 19 expansion in mice lacking Sox-4. Nature. 1996;380(6576):711-4. 20 40. Gilliland DG. Molecular genetics of human leukemias: new insights into 21 therapy. Semin Hematol. 2002;39(4 Suppl 3):6-11. 22 41. Andersson AK, Ma J, Wang J, Chen X, Gedman AL, Dang J, et al. The 23 landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic 24 leukemias. Nat Genet. 2015;47(4):330-7. 25 42. Ji H, Wu G, Zhan X, Nolan A, Koh C, De Marzo A, et al. Cell-type 26 independent MYC target genes reveal a primordial signature involved in biomass 27 accumulation. PloS one. 2011;6(10):e26057. 28 43. Pan R, Hogdal LJ, Benito JM, Bucci D, Han L, Borthakur G, et al. Selective 29 BCL-2 inhibition by ABT-199 causes on-target cell death in acute myeloid leukemia. 30 Cancer Discov. 2014;4(3):362-75. 31 44. Brumatti G, Salmanidis M, Kok CH, Bilardi RA, Sandow JJ, Silke N, et al. 32 HoxA9 regulated Bcl-2 expression mediates survival of myeloid progenitors and the 33 severity of HoxA9-dependent leukemia. Oncotarget. 2013;4(11):1933-47. 34 45. Kontro M, Kumar A, Majumder MM, Eldfors S, Parsons A, Pemovska T, et 35 al. HOX gene expression predicts response to BCL-2 inhibition in acute myeloid 36 leukemia. Leukemia. 2017;31(2):301-9. 37 46. Nagase T, Yamakawa H, Tadokoro S, Nakajima D, Inoue S, Yamaguchi K, et 38 al. Exploration of human ORFeome: high-throughput preparation of ORF clones and 39 efficient characterization of their protein products. DNA Res. 2008;15(3):137-49. 40 47. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey 41 ME, et al. Generation of mouse models of myeloid malignancy with combinatorial 42 genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014;32(9):941- 43 6. 44 48. Morita S, Kojima T, Kitamura T. Plat-E: an efficient and stable system for 45 transient packaging of retroviruses. Gene Ther. 2000;7(12):1063-6. 46 49. Tkachuk DC, Kohler S, Cleary ML. Involvement of a homolog of Drosophila 47 trithorax by 11q23 chromosomal translocations in acute leukemias. Cell. 48 1992;71(4):691-700.
45 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347765; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 50. Yokoyama A, Kitabayashi I, Ayton PM, Cleary ML, Ohki M. Leukemia 2 proto-oncoprotein MLL is proteolytically processed into 2 fragments with opposite 3 transcriptional properties. Blood. 2002;100(10):3710-8. 4 51. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A third- 5 generation lentivirus vector with a conditional packaging system. J Virol. 6 1998;72(11):8463-71. 7 52. Okuda H, Yokoyama A. In vivo Leukemogenesis Model Using Retrovirus 8 Transduction. Bio-protocol. 2017;7(23). 9 53. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: 10 accurate alignment of transcriptomes in the presence of insertions, deletions and gene 11 fusions. Genome Biol. 2013;14(4):R36. 12 54. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et 13 al. Transcript assembly and quantification by RNA-Seq reveals unannotated 14 transcripts and isoform switching during cell differentiation. Nat Biotechnol. 15 2010;28(5):511-5. 16 55. Gu Z, Eils R, Schlesner M. Complex heatmaps reveal patterns and correlations 17 in multidimensional genomic data. Bioinformatics. 2016;32(18):2847-9. 18 56. Jiao X, Sherman BT, Huang da W, Stephens R, Baseler MW, Lane HC, et al. 19 DAVID-WS: a stateful web service to facilitate gene/protein list analysis. 20 Bioinformatics. 2012;28(13):1805-6. 21 57. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey 22 OM, et al. A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and 23 Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016;17(4):1193-205. 24 58. Yokoyama A, Ficara F, Murphy MJ, Meisel C, Hatanaka C, Kitabayashi I, et 25 al. MLL becomes functional through intra-molecular interaction not by proteolytic 26 processing. PloS one. 2013;8(9):e73649. 27 59. Stewart SA, Dykxhoorn DM, Palliser D, Mizuno H, Yu EY, An DS, et al. 28 Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA. 29 2003;9(4):493-501. 30 60. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer 31 (IGV): high-performance genomics data visualization and exploration. Brief 32 Bioinform. 2013;14(2):178-92. 33
46