Mol Biol Rep (2010) 37:1363–1371 DOI 10.1007/s11033-009-9518-2

Molecular characterization, expression profile and association analysis with fat deposition traits of the porcine APOM

Gang Pan Æ Yayuan Fu Æ Bo Zuo Æ Zhuqing Ren Æ Dequan Xu Æ Minggang Lei Æ Rong Zheng Æ Yuan-Zhu Xiong

Received: 5 November 2008 / Accepted: 17 March 2009 / Published online: 27 March 2009 Ó Springer Science+Business Media B.V. 2009

Abstract M (APOM), a novel apolipo- thorax-waist (P \ 0.05), backfat thickness at buttock presented mostly in high-density (HDL) (P \ 0.01) and average backfat thickness over shoulder, in plasma, is involved in lipid and lipoprotein metabolism. thorax-waist and buttock (P \ 0.01). Through comparative mapping, we have mapped this gene to SSC7 p1.1 in which many QTLs affecting fat deposition Keywords Association analysis Pig APOM traits have been reported. As a candidate gene for fat Fat deposition traits Promoter prediction deposition traits, in this study, we obtained the 742-bp mRNA sequence of porcine APOM including the full coding region and encoding a protein of 188 amino acids. Introduction The sequence was deposited into the GenBank under the accession no. DQ329240. Semi-quantitative RT-PCR Apolipoprotein M is a novel high-density lipoprotein results showed that the porcine APOM gene is expressed (HDL) apolipoprotein that was initially isolated from predominantly in liver and kidney tissue. The genomic postprandial triglyceride-rich (TGRLP) and sequence of this gene which contains six exons and five cloned by Xu and Dahlback [1]. It is mainly associated introns, is 3,621 bp in length (DQ272488). Bioinformatic with high-density lipoprotein (HDL) in plasma, and a analysis of the 50 regulatory region has revealed that minor part is also present in triglyceride-rich lipoprotein classical TATA-box element and species conserved (TGRLP) and lowdensity lipoprotein (LDL) [1, 2]. Previ- Hepatocyte nuclear factor-1a (HNF-1a) biding site were ous studies suggested that APOM is involved in lipid represented in this region. A G2289C single nucleotide and/or lipoprotein metabolism in vivo. The proportion of polymorphism (SNP) in the intron 2 of porcine APOM APOM in TGRLP has been shown to be increased in the gene detected as an Eco130I PCR–restriction fragment postprandial phase [1] and plasma APOM level is posi- length polymorphism (PCR–RFLP) showed allele fre- tively correlated to leptin and negatively correlated to quency differences among three purebreds. Association of cholesterol levels in human [3]. Mice deficient in APOM the genotypes with fat deposition traits showed that dif- accumulated cholesterol in large HDL particles and the ferent genotypes of porcine APOM gene were significantly conversion of HDL to preb-HDL was impaired suggesting associated with leaf fat weight (P \ 0.05), backfat that APOM by influencing preb-HDL formation is an thickness at shoulder (P \ 0.05), backfat thickness at important regulator of HDL metabolism and modulates cholesterol efflux [4]. The expression of the APOM gene is strictly regulated by several biological factors which G. Pan Y. Fu B. Zuo Z. Ren D. Xu M. Lei R. Zheng including leptin, leptin receptor, hepatocyte nuclear factor- Y.-Z. Xiong (&) 1a (HNF-1a), liver X receptor (LXR), platelet activating Key Laboratory of Swine Genetics and Breeding of Ministry factor (PAF), transforming growth factor-beta (TGF-b), of Agriculture & Key Laboratory of Agricultural Animal epidermal growth factor (EGF), hepatic growth factor Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural University, 430070 Wuhan, China (HGF) and hyperglycemia in vivo and/or in vitro [5–11]. e-mail: [email protected] HNF-1a is a potent activator of APOM gene promoter and 123 1364 Mol Biol Rep (2010) 37:1363–1371 a specific mutation in the HNF-1 binding site can abolish slaughtered and measured according to the method of transcriptional activation of APOM gene [5]. Xiong and Deng [20] in 2000 at the Swine Testing Center In human, APOM gene has been mapped to p21.33 on of China. The tissue samples (heart, liver, lung, kidney, 6 [2], a region with conserved synteny of spleen, small intestine, ovary, muscle and fat) used to Sus scrofa chromosome (SSC) 7 centromere (p11–q11) detect mRNA expression were collected from a female [12–14]. In this region, many quantitative trait loci (QTLs) 4-month-old Large White pig and were immediately dip- related to fat deposition traits including backfat thickness ped into liquid nitrogen and stored at -80°C. and intramuscular fat content have been documented by several groups [15–18]. In this study, we have mapped this DNA extraction and cDNA synthesis gene to SSC 7p1.1 through comparative mapping method. The mapping result, together with the involvement of this Genomic DNA was isolated according to the standard gene in lipid and/or lipoprotein metabolism, strongly sug- phenol–chloroform method and stored at -20°C. Using gests APOM as a positional and biological candidate gene TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), total for these fat deposition traits. The present investigation was RNA was extracted from various tissues following the aimed at gaining an insight into the function of the APOM manufacturer’s instructions. RNase-free DNase (QIAGEN, gene by isolation and molecular characterization of the Germany) was used to remove DNA contamination. Con- porcine APOM gene, testing the expression profile in dif- centrations of total RNA were quantified by a Biometer ferent tissues and associating the genotypes with fat (Eppendorf, Germany) and verified by electrophoresis on deposition traits. 0.8% agarose gels to ensure that no degradation has occurred. An oligo(dT)15 primer was used to reverse- transcribe mRNA in a final volume of 25 ll using Promega Materials and methods first-strand synthesis system following the manufacturer’s instructions (Promega, USA). Animals and sample collections cDNA and genomic DNA cloning of porcine All pigs in this study were derived from the Experimental APOM gene Pig Station of Huazhong Agricultural University. Screen- ing for polymorphisms in porcine APOM gene were The human APOM gene sequence (GenBank accession no: performed in a total of 104 pigs of Large White (n = 32), NM_019101) was applied to search available ESTs in Landrance (n = 38), Meishan (n = 34) purebreds. For porcine ESTs database with BLAST program (http://www. association study, fat deposition and carcass traits were ncbi.nlm.nih.gov/BLAST/). According to the assembled recorded in 139 pigs of the Large White 9 Meishan F2 contig, two overlapping primer pairs M1F/M1R and M2F/ population. All the F2 pigs were given twice daily diets M2R (Table 1) were designed to amplify the cDNA formulated according to age under a standardized feeding sequence of porcine APOM gene. PCR reactions were regimen and free access to water [19]. The animals were performed in a volume of 25 ll reaction containing 25 ng

Table 1 Primer pairs designed Primer Sequence (50–30) T (°C) Size (bp) for the porcine APOM gene m M1F GTTAAGGCACCAGCCACT 58 672 M1R CCCACAATCTCAGCTTCC M2F ACACAGATCTCAGAACAGAAG 56 369 M2R TTTGAGGATTGAMAAATYATCTTTATT OMP1F ATGTTCCACCAGATTTGGGC 60 1,426 OMP1R CCTCAGACAGGCGGTAGA OMP2F TGCCCCGGAAATGGATCTA 59 916 OMP2R TCAGTTACTAGACAGCTCGCA PF TGAGTGCTCCTAGGGGAATG 61 1,356 PR TGCCATAGAGGTAGAGTAGAG ECOF ATGAACCTGACTAGCATCCGT 60 517 ECOR CAAGGA GGA AAGACTGAGTGA GAPDH-F ACCACAGTCCATGCCATCAC 59 480 GAPDH-R TCCACCACCCTGTTGCTGTA

123 Mol Biol Rep (2010) 37:1363–1371 1365 porcine cDNA derived from liver, 19 PCR buffer, 1.5 Mm OMP1R, OMP2F/OMP2R and PF/PR (Table 1) in Large

MgCl2, 0.2 lM each primer, 0.5 mM of each dNTP and 1U White and Meishan pigs (two animals per breed). The Taq DNA polymerase (Takara, Japan). The thermal cycling polymorphism sites were analysed by sequence compari- program runs as follows: intial denaturation at 94°C for sons using the DNAstar software (DNAstar Inc.). One SNP 4 min, 35 cycles of 94°C for 40 s, annealing temperature designated G2289C was detected and primer pair ECOF/ for 40 s, 72°C for 40 s and a final extention time of 7 min ECOR (Table 1) with a product of 517 bp was ready for at 72°C. PCR–restriction fragment length polymorphism (PCR– As for the genomic sequence of porcine APOM gene, RFLP) analysis. The amplification profiles for primer pair three overlapping primer pairs OMP1F/OMP1R, OMP2F/ ECOF/ECOR were 94°C for 7 min; followed by 35 cycles OMP2Rand PF/PR (Table 1) were designed among which of 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s; with a the primer pair PF/PR was used to amplify the 50 UTR final extention step at 72°C for 10 min. PCR products were region. All the major PCR products were purified, sub- digested with 4U of ECO130I in a 15 ll reaction solution jected to cloning (pGEM T Vector System I, Promega, and the digested products were eletrophoresed on 12% USA) and sequenced. PAGE gels and visualized by silver staining.

Bioinformatic analysis Association analysis of the porcine APOM gene with fat deposition traits Multiple protein sequence alignments were performed using classical ClustalW method and the phylogenetic tree The association between different genotypes and fat was constructed combining the results of ClustalW and deposition traits was performed with the least-squares MEGA 4.0 molecular evolutionary genetic analysis soft- method (GLM procedure, SAS version 8.0, SAS Institute, ware package by bootstrap analysis 1,000 replicates using Inc.). According to the method of Liu (1998) [22], both neighbour-joining method [21]. The functional domains of additive and dominance effects were also estimated using the deduced porcine APOM protein were analyzed with the REG procedure of SAS version 8.0, where the additive the SMART program (http://smart.embl-heidelberg.de/), effect was denoted as 1, 0 and -1 for G2289G, G2289C ProtParam (http://au.expasy.org/tools/protparam.html) was and C2289C, respectively, and the dominance effect was used to calculate the molecular weight, theoretical pI. For represented as -1, 1 and -1 for G2289G, G2289C and the exact localization of the exon–intron boundaries, the C2289C. The model used to analyze the data was assumed

Spidey (http://www.ncbi.nlm.nih.gov/spidey/) was used. to be: Yij = l?Si ? Gj ? bXij ? eij, Where Yij is the Putative promoter regions and factor observation of the trait; l is the least-square means, Si is binding sites predictions were analyzed with several online the effect of i-th sex (i = 1 for male or 2 for female), Gj is tools including NNPP (http://www.fruitfly.org/seq_tools/ the effect of j-th genotype (j = GG, GC and CC), b is the promoter.html); PromoterInspector and MatInspector (Ge- regression coefficient of the slaughter weight, Xij is the nomatix Software GmbH Mu¨nchen, Germany); SIGNAL slaughter weight and eij is the random residue. SCAN Databases and TESS (http://www.cbil.upenn.edu/ cgi-bin/tess/tess). Results Tissue expression analysis of the porcine APOM gene Isolation and sequence analysis of the porcine The mRNA expression of porcine APOM gene in nine APOM gene different tissues from a Large White pig was detected by semi-quantitative RT-PCR using primer pair M1F/M1R Based on the sequence contig retrieved from porcine ESTs (Table 1) with the glyceraldehydes-3-phosphate dehydroge- database, overlapping primer pairs M1F/M1R and M2F/ nase (GAPDH) gene as an endogenous reference gene. The M2R amplified a total of 742 bp sequence (GenBank components for PCR reaction were the same as mentioned accession no. is DQ329240) which including 51 bp of the above. The amplification profiles were 94°C for 4 min; 50-UTR, the complete coding region (encoding a protein of followed by 28 cycles of 94°C for 45 s, 58°C for 40 s, and 188 amino acids) and 124 bp of the 30-UTR with a poly- 72°C for 45 s; with a final extention step at 72°C for 5 min. adenylation signal (AATAAA) in 716 bp (Fig. 1). The predicted protein with a calculated MW of 21.2 kDa and a SNP identification and PCR–RFLP analysis pI of 6.42 shares high homology to the human (90%), cattle (94%) and mouse (85%) orthologues. It contains two typ- Single nucleotide polymorphisms (SNPs) in porcine ical motifs that are conserved among species and APOM gene were detected through primer pairs OMP1F/ one predicted uncleaved signal peptide, 22 amino acids in 123 1366 Mol Biol Rep (2010) 37:1363–1371 length, is also preserved at the N-terminal. In accordance revealed that the porcine APOM gene has the closest with other species, the porcine APOM protein lacks the genetic relationship with that of the cattle (Fig. 3). potential site for N-linked glycosylation at 135 when compared to human orthologue (Fig. 2). So the 742 bp Spatial expression analysis of the porcine APOM gene sequence is denoted as porcine APOM gene. The phylo- genetic tree constructed with the porcine APOM amino The RT-PCR was employed to study the tissue distribution acid sequence and other identified APOM sequences has of the porcine APOM gene. In accordance with the

Fig. 1 Nucleotide and GTTAAGGCACCAGCCACTCCACGCGGAGCACCAGTTCCCTCTTGCCTGAAGATGTTCCAC predicted amino acid sequence M F H of the porcine APOM gene. The CAGATTTGGGCAGCTCTACTCTACCTCTATGGCATTCTCCTTAACTCCATCTACCAGTGCCCT start (ATG) codon is in boldface QIWAALLYLYGILLNSIYQCP and boxed and the stop (TAG) GAGCACAGTCAACTGACAACTGGAGGAGTGGATGGGAAAGAGTTCCCAGAGCCCCACCTG codon is indicated with a EHSQLTTGGVDGKEFPEPHL triangle. The Polyadenylation GGCCAGTGGTACTTTATCGCAGGGGCAGCTCCAACCAAGGAGGAGTTGGCAACTTTTGAC signal (AATAAA) is underlined GQWYFIAGAAPTKEELATFD with boldface type and italics CCTGTGGACAACATTGTCTTCAACATGGCTGCAGGCTCTGTTCCCATGCAGCTCCAGCTT PVDNIVFNMAAGSVPMQLQL CGAGCTACCATCCGCACGAAAAATGGGCTCTGTGTGCCCCGGAAATGGATCTACCGCCTG RATIRTKNGLCVPRKWIYRL TCTGAGGGAAACACAGATCTCAGAACAGAAGGCCGCCCTGACATGAAGACCAAGCTCTTC SEGNTDLRTEGRPDMKTKLF TCTAGCACATGCCCAGGTGGAATCATGCTGAAAGAGACAGGCCAGGGTTACCAGCGCTTC SSTCPGGIMLKETGQGYQRF CTCCTCTACAATCGCTCACCACACCCTCCTGAGAAGTGTGTGGAGGAGTTCCAGTCCCTG LLYNRSPHPPEKCVEEFQSL ACCTCCTGCCTGGACTTTAAGGCCTTCTTACTGACTCCCAGGAATCAAGAGGCCTGCGAG TSCLDFKAFLLTPRNQEACE CTGTCTAGTAACTGACCAATGGCTTCATCTGTGCTCCCAGATGGATACAGTGGAAGCTGA L S S N GATTGTGGGGTCGGGGGGAAAAGCTGGAGAATCCCAAATCCCTTACAAGAGTAATAAAGA TAATTTGTCAATCCTCAAA

Fig. 2 Alignment of deduced amino acid sequences of porcine APOM (GenBank accession no.ABC59064), human APOM (NP 061974), cattle APOM (XP 001790048), dog APOM (XP 532074), mouse APOM (NP 061286) and rat APOM (NP 062246). Multiple alignments were first performed using ClustalW program. The symbol (*) indicates that the aligned residues are identical. Substitutions said to be conservative or semi- conservative by ClustalW are marked by (:) and (.), respectively. The double line at the N-terminal indicates the predicted signal peptide. The typical lipocalin motifs are lined and the potential site for N-linked glycosylation in human at Asn135 is marked by w. The two amino acids insertion in 107 of mouse and rat APOM is boxed

123 Mol Biol Rep (2010) 37:1363–1371 1367

Fig. 3 The phylogenetic tree showing the relationship of the porcine APOM amino acid sequence with other identified APOM sequences.The sequences used for analysis are derived from GenBank, and their accession numbers are shown on the righthand side. The horizontal branch lengths are proportional to the estimated divergence of the sequence from the branch point

APOM gene is surrounded by BAT4 and CSNK2B on one side and BAT3 on the other. Several adjacent to APOM have been previously mapped by in situ hybrid- ization or somatic hybrids methods [24–31] and are presented in Fig. 5. In human, the APOM gene has been mapped to HSA 6p21.33 [2], a region with conserved synteny of SSC 7 p11–q11 region [12–14]. The same gene orders of adjacent genes were also observed between pig and human in this region. Fig. 4 Expression profile analysis of porcine APOM gene. The Combing the conserved synteny, the same gene orders tissue samples include heart, liver, lung, kidney, spleen, intestine, fat, between pig and human in this region and mapping results skeletal muscle and ovary of several adjacent porcine genes, the porcine APOM gene is predicted to be mapped to SSC 7p1.1. previous reports on human [23], the porcine APOM gene was predominantly expressed in liver and kidney with Promoter analysis of the 50 flanking region minor expression detected in fat and ovary. No expression of porcine APOM gene was detected in other tissues including heart, lung, spleen, intestine and skeletal muscle (Fig. 4). To investigate the transcriptional regulation of the porcine APOM gene, the 50-flanking region and the complete first Genomic structure and comparative mapping exon were acquired for further analysis. By sequence of porcine APOM gene comparisons of the promoter regions among different species (human, mouse and pig) and the results of predic- A blastn search of the nr database with the porcine APOM tion, the core promoter sequence with classical TATA gene as a bait retrieved a BAC clone of 101 kb in length element was predicted to lie in -40 to ?10 relative to the (GenBank accession no. BX548169) which completely transcription start site (?1) (Fig. 6). In accordance with encompasses the whole genomic sequence of porcine APOM human [5], several HNF-1 binding sites were predicted gene. Three overlapping primer pairs OMP1F/OMP1R, with the species conserved biding site to be predicted in OMP2F/OMP2R and PF/PR (Table 1) were designed to ?41 to ?57. In addition to multiple putative binding sites amplify the full genomic sequence and 50-flanking region of of several ubiquitous transcription factors, such as SP1, the porcine APOM gene. The amplified 3,621 bp sequence AP1 and AP2, several binding sites for RXR, PPAR and which including a 1,261 bp 50-flanking region was deposited C/EBP that are involved in lipid and lipoprotein metabo- into GenBank with the accession no. of DQ272488. Spidey lisms were also observed in this region. analysis revealed that the porcine APOM gene consists of six exons and five introns and the locations of splice donor/ SNP identification and allele frequencies of the porcine acceptor sites in all introns conform to the GT/AG rule. APOM gene in different purebreds Based on the gene annotations of the BAC clone (BX548169) and the recently finished porcine SSC7 ref- One SNP designated G2289C in intron 2 was identified in erence assembly sequence, the gene orders surrounding the porcine APOM gene by comparative sequencing. Pri- porcine APOM gene were identified (Fig. 5). The porcine mer pair ECOF/ECOR (Table 1) with a product of 517 bp

123 1368 Mol Biol Rep (2010) 37:1363–1371

Fig. 5 Comparative mapping of porcine APOM gene to SSC7p1.1. Not drawn to scale. The previously mapped genes surrounding APOM are in boldface type. Arrows indicate the direction of transcription. The relative location for the BAC clone (BX548169) is lined and the putative porcine Swine Leukocyte Antigens (SLA) class I related antigen 2 (MIC-2) is in dashed line with arrow. TNF, Tumor necrosis factor, alpha; LTA, Tumor necrosis factor, beta; CSNK2B, Casein kinase 2, beta polypeptide; SLA-6, 7, 8, Swine Leukocyte Antigen 6, 7, 8

was designed for genotyping. There are two ECO130I sites Discussion within the 517 bp fragment which are located at the posi- tion of 55 bp and 189 bp, respectively. Only the ECO130I APOM is a novel apolipoprotein presented mostly in HDL site at 55 bp is polymorphic. Because the 55 bp band is too in plasma, with a small proportion present in TGRLP and short to be shown in the PAGE gels, three genotypes were LDL [1, 2]. The expression of APOM gene has high organ presented as: GG (189 and 328 bp), GC (189, 134 and specificity which is confined predominantly to the liver and 328 bp) and CC (134 and 328 bp) by employing a PCR– kidney. Through immunohistochemical staining and in situ RFLP method using the ECO130I restriction enzyme mRNA hybridization analysis, the expression of APOM is (Fig. 7). strictly restrict to the hepatocytes and the tubule epithelial Allele distribution of the porcine APOM gene indicated cells in kidey [23]. Our tissue expression profile analysis of that all the three purebreds in this site are polymorphic with porcine APOM gene has confirmed this conclusion that it is the Chinese indigenous breed Meishan pigs had higher predominantly expressed in liver and kidney (Fig. 4). Also frequency of the C allele whereas the western breeds Large the APOM gene is highly conserved in several mammal White and Landrance pigs had higher frequency of the G species (Fig. 2). In porcine APOM gene, an N-terminal allele (Table 2). signal peptide that cannot be processed by the signal pep- tidase was also identified which is assumed to anchor Association analysis with fat deposition traits APOM to the single phospholipid layer of lipoproteins [1]. of the porcine APOM gene Both the sequence conservation through revolution and high organ specificity of its expression indicate that the APOM The association between the G2289C polymorphism and gene has important functions related with liver and kidney. the fat deposition traits was investigated by association Further in vivo research on mouse models has revealed analysis in one hundred and thirty five pigs of the Large that APOM gene is an important regulator of HDL White 9 Meishan F2 resource family. The results showed metabolism and modulates cholesterol efflux to HDL [4]. that the porcine APOM gene G2289C locus polymorphism Mouse deficient in APOM accumulated cholesterol in large is significantly associated with leaf fat weight (LFW) HDL particles and the cholesterol efflux from macrophages (P \ 0.05), backfat thickness at shoulder (SFT) (P \ 0.05), to HDL was markedly reduced because of the impaired backfat thickness at thorax-waist (TFT) (P \ 0.05), backfat conversion of HDL to preb-HDL [4]. In addition, the thickness at buttock (BFT) (P \ 0.01) and average backfat APOM gene is strictly regulated by several transcriptional thickness over shoulder, thorax-waist and buttock (ABF) factors involved in lipid metabolism in a spatial and time (P \ 0.01) (Table 3). At this locus, the additive effect manner which including leptin, leptin receptor, HNF-1a, seemed to be highly significant (P \ 0.01) and allele G was LXR, TGF-b, EGF, HGF [5–7, 9–11]. Richter et al. associated with a decrease in the trait value. reported that HNF-1a is a potent activator of APOM

123 Mol Biol Rep (2010) 37:1363–1371 1369

Fig. 6 Nucleotide sequence of the 50 flanking region of porcine APOM gene. The putative transcription initiation site (A) is boxed and marked as ?1; arrow indicates the transcription direction. Numbers on the left show bases upstream (-) and downstream (?) from the start of transcription. Shaded sequence indicates the putative core promoter region. Binding sites of the corresponding transcription factors are indicated with double underlines and their abbreviated names. AP1, AP2, activating protein 1, 2; SP1, stimulating protein 1; HNF-1, hepatic nuclear factor 1; CAAT, CCAAT box; TATA, TATA box; C/EBP, CCAAT/enhancer binding protein; PPAR, peroxisome proliferator- activated receptor; RXR, retinoid X receptor. The HIF-1 binding site conserved between human and porcine is indicated by box outlined with dotted lines

gene promoter with a conserved binding site identified in region. A recent research by Zhang et al. has revealed that the promoter region and a specific mutation in the LXR agonist significantly downregulates APOM mRNA HNF-1 binding site abolished transcriptional activation of expression in vivo and in vitro indicating the APOM gene APOM gene [5]. Mutant HNF-1a-/- mice completely is regulated by LXR through LXR/RXR pathway [11]. lack expression of APOM in liver and kidney. Serum Two provisional binding sites for retinoid X receptor APOM levels in HNF-1a?/- mice are reduced by 50% (RXR) were predicted in the 50 flanking region of porcine compared with wild-type animals [5]. Through analysis of APOM gene (Fig. 6) suggesting LXR/RXR may regulate the 50 flanking region of porcine APOM gene, three HNF-1 the expression of APOM gene by directly binding to the binding sites were predicted in this promoter region with promoter region though further experimental verification is the species conserved site lies in ?41 to ?57 relative to the still needed. predicted transcription start site (Fig. 6). It is reasonable to Chromosome painting and radiation hybrid mapping speculate that porcine APOM gene is also regulated by analysis have revealed conserved synteny between SSC7 HNF-1a through specifically binding to the promoter and human 6, 14, and 15 [14, 32]. Particularly,

123 1370 Mol Biol Rep (2010) 37:1363–1371

predicted to be located at centromeric region of SSC7. Based on the gene annotations of the BAC clone (BX548169) and the recently finished porcine SSC7 reference assembly sequence, the gene orders surrounding porcine APOM gene were identified (Fig. 5). Three SLA class I genes including SLA-6, 7 and 8 have been previously mapped [24–27] and are adjacent to the APOM gene. Combining the mapping results of other genes adjacent to it which including LTA, TNF and CSNK2B [28–31], the porcine APOM gene is predicted to be mapped in SSC 7p1.1 in the SLA I region. In this region, many quantitative trait loci (QTLs) related to fat Fig. 7 Genotyping of the porcine APOM gene at G2289C locus by deposition traits including backfat thickness have been employing a PCR- ECO130I–RFLP method. The 189 bp band reported [15–18]. Considering the mapping result and the represents the allele G whereas the 134 bp band (with the 55 bp involvement of APOM gene in lipid and lipoprotein band that is not included in this picture) represents the allele C. Marker used in this assay is the fragments of pBR322 being fully metabolism, it is rather necessary to evaluate the effects of cleavaged by MspI APOM gene on fat deposition traits. Association analysis between the G2289C polymor- phism and fat deposition traits has revealed that signif- icant differences exist among different genotypes in Table 2 Allele frequency differences among three purebreds at the porcine APOM gene intron 2 G2289C locus several fat deposition traits including LFW, SFT, TFT (P \ 0.05), BFT and ABF (P \ 0.01). This further con- Breeds No. of Genotype Allele frequency firmed our conclusion that APOM gene is a positional and animals GG GC CC G C biological candidate gene for these fat deposition traits. Considering the porcine APOM gene being located to Large White 32 17 13 2 0.7344 0.2656 SSC7p1.1 in SLA I region and extensive linkage dis- Landrance 38 15 19 4 0.6447 0.3553 equilibrium in the F2 hybrid, we could not determine Meishan 34 4 6 24 0.2059 0.7941 whether the association is a direct effect or the effect of some tightly linked QTL in the SLA I region. So further investigations are required in other pig populations to extensive conservation exists between the short arm of validate the effect. human and a segment of SSC7 including the In summary, we have isolated and characterized the short arm, where the Swine Leukocyte Antigens (SLA) class porcine APOM gene with the gene being mapped to I and class III regions are located, plus a centromeric part of SSC7p1.1. One G2289C polymorphism with significant the SSC7 long arm containing the SLA classII region association with fat deposition traits was identified. As a [12, 13]. In human, APOM gene has been mapped to p21.33 candidate gene for fat deposition traits, its involvement in on chromosome 6 [2], so the porcine APOM gene is lipid and lipoprotein metabolism needs further study.

Table 3 Association analysis of porcine APOM genotypes with fat deposition traits Trait Genotype (l ± SE) Effect (l ± SE) GG (38) GC (66) CC (31) Additive Dominance

LFW (kg) 0.595 ± 0.036a 0.703 ± 0.027b 0.730 ± 0.040b -0.068 ± 0.027* 0.020 ± 0.019 SFT (cm) 2.959 ± 0.102a 3.017 ± 0.078a 3.315 ± 0.114b -0.178 ± 0.076* -0.060 ± 0.055 RFT (cm) 2.368 ± 0.090 2.468 ± 0.069 2.609 ± 0.101 -0.121 ± 0.067* -0.010 ± 0.044 TFT (cm) 1.694 ± 0.08a 1.803 ± 0.062 1.951 ± 0.090b -0.129 ± 0.060 0.027 ± 0.049 BFT (cm) 1.312 ± 0.085Aa 1.538 ± 0.065b 1.742 ± 0.095B -0.216 ± 0.064** 0.005 ± 0.046 ABF (cm) 2.086 ± 0.076A 2.201 ± 0.059a 2.442 ± 0.086Bb -0.178 ± 0.058* 0.029 ± 0.042 Least square mean values (±SE) with different letters are significantly different with lower case superscripts at * P \ 0.05 and upper case superscripts at ** P \ 0.01 LFW, leaf fat weight; SFT, backfat thickness at shoulder; RFT, 6–7th rib fat thickness; TFT, backfat thickness at thorax-waist; BFT, backfat thickness at buttock; ABF, average backfat thickness over shoulder, thorax-waist and buttock

123 Mol Biol Rep (2010) 37:1363–1371 1371

Acknowledgments This study was funded by the National Natural 16. Rattink AP, De Koning DJ, Faivre M, Harlizius B, van Arendonk Science Foundation of China (No. 30571331) and the National ‘‘973’’ JA, Groenen MA (2000) Fine mapping and imprinting analysis Program of P. R. China (2006CB102102). for fatness trait QTLs in pigs. Mamm Genome 11(8):656–661. doi:10.1007/s003350010117 17. Sanchez MP, Riquet J, Iannuccelli N, Gogue J, Billon Y, Dem- References eure O, Caritez JC, Burgaud G, Feve K, Bonnet M, Pery C (2006) Effects of quantitative trait loci on chromosomes 1, 2, 4, and 7 on 1. Xu N, Dahlback B (1999) A novel human apolipoprotein (apoM). growth carcass, and meat quality traits in backcross Mei- J Biol Chem 274:31286–31290. doi:10.1074/jbc.274.44.31286 shan 9 Large White pigs. J Anim Sci 84:526–537 2. Luo G, Zhang X, Nilsson-Ehle P, Xu N (2004) Apolipoprotein M. 18. Bidanel JP, Milan D, lannuccelli N, Amigues Y, Boscher MY Lipids Health Dis 3:21. doi:10.1186/1476-511X-3-21 (2001) Detection of quantitative trait loci for growth and fatness 3. Xu N, Ahren B, Nilsson-Ehle P (2004) Correlation of apolipo- in pigs. Genet Sel Evol 33:289–309. doi:10.1051/gse:2001120 protein M with leptin and cholesterol in normal and obese 19. Dai LH, Xiong YZ, Deng CY, Jiang SW, Zuo B, Zheng R, Li FE, subjects. J Nutr Biochem 15:579–582. doi:10.1016/j.jnutbio. Lei MG (2006) Association of the A–G polymorphism in porcine 2004.03.001 adiponectin gene with fat deposition and carcass traits. Asian- 4. Wolfrum C, Poy MN, Stoffel M (2005) Apolipoprotein M is australas J Anim Sci 19:779–783 required for prebeta-HDL formation and cholesterol efflux to 20. Xiong YZ, Deng CY (1999) Principle and method of swine HDL and protects against atherosclerosis. Nat Med 11:418–422. testing. Chinese Agriculture Press, Beijing doi:10.1038/nm1211 21. Saitou N, Nei M (1987) The neighbor-joining method: a new 5. Richter S, Shih DQ, Pearson ER, Wolfrum C, Fajans SS, Hat- method for reconstructing phylogenetic trees. Mol Biol Evol tersley AT, Stoffel M (2003) Regulation of apolipoprotein M 4:406–425 by MODY3 gene hepatocyte nuclear factor- 22. Liu BH (1998) Statistical genomics: linkage, mapping. and QTL 1alpha: haploinsufficiency is associated with reduced serum Analysis. CRC Press, LLC, Boca Raton, pp 404–409 apolipoprotein M levels. Diabetes 52:2989–2995. doi:10.2337/ 23. Zhang XY, Dong X, Zheng L, Luo GH, Liu YH, Ekstrom U, diabetes.52.12.2989 Nilsson-Ehle P, Ye Q, Xu N (2003) Specific tissue expression and 6. Xu N, Nilsson-Ehle P, Hurtig M, Ahren B (2004) Both leptin and cellular localization of human apolipoprotein M as determined by leptin-receptor are essential for apolipoprotein M expression in in situ hybridization. Acta Histochem 105:67–72. doi:10.1078/ vivo. Biochem Biophys Res Commun 321:916–921. doi:10. 0065-1281-00687 1016/j.bbrc.2004.06.180 24. Rabin M, Fries R, Singer D, Ruddle FH (1985) Assignment of the 7. Luo G, Hurtig M, Zhang X, Nilsson-Ehle P, Xu N (2005) Leptin porcine major histocompatibility complex to chromosome 7 by in inhibits apolipoprotein M transcription and in human situ hybridisation. Cytogenet Cell Genet 39:206–209. doi:10. hepatoma cell line, HepG2 cells. Biochim Biophys Acta 1159/000132136 1734:198–202 25. Echard G, Yerle M, Gellin J, Dalens M, Gillois M (1986) 8. Xu N, Zhang XY, Dong X, Ekstrom U, Ye Q, Nilsson-Ehle P Assignment of the major histocompatibility complex to the p14– (2002) Effects of platelet-activating factor, tumor necrosis factor, q12 region of chromosome 7 in the pig by in situ hybridisation. and interleukin-1alpha on the expression of apolipoprotein M in Cytogenet Cell Genet 41:126–128. doi:10.1159/000132215 HepG2 cells. Biochem Biophys Res Commun 292:944–950. doi: 26. Sarmiento UM, Sarmiento JI, Lunney JK, Rishi S (1993) Map- 10.1006/bbrc.2002.6755 ping of the porcine SLA class I gene (PD1A) and the associated 9. Xu N, Hurtig M, Zhang XY, Ye Q, Nilsson-Ehle P (2004) repetitive element (C11) by fluorescence in situ hybridisation. Transforming growth factor-beta down-regulates apolipoprotein Mamm Genome 4:64–65. doi:10.1007/BF00364669 M in HepG2 cells. Biochim Biophys Acta 1683:33–37 27. Smith TPL, Rohrer GA, Alexander LJ, Troyer DL, Kirby-Dobbels 10. Xu N, Ahren B, Jiang J, Nilsson-Ehle P (2006) Down-regulation KR, Janzen MA, Cornwell DL, Louis C, Schook LB, Beattie CW of apolipoprotein M expression is mediated by phosphatidylino- (1995) Directed integration of the physical and genetic linkage sitol 3-kinase in HepG2 cells. Biochim Biophys Acta 1761:256– maps of swine chromosome 7 reveals that SLA spans the cen- 260 tromere. Genome Res 5:259–271. doi:10.1101/gr.5.3.259 11. Zhang XY, Zhu ZJ, Luo GH, Zheng L, Nilsson-Ehle P, Xu N 28. Davoli R, Fontanesi L, Zambonelli P, Bigi D, Gellin J, Yerle M, (2008) Liver X receptor agonist downregulates hepatic apoM Milc J, Braglia S, Cenci V, Cagnazzo M, Russo V (2002) Iso- expression in vivo and in vitro. Biochem Biophys Res Commun lation of porcine expressed sequence tags for the construction of a 371:114–117. doi:10.1016/j.bbrc.2008.04.017 first genomic transcript map of the skeletal muscle in pig. Anim 12. Barbosa A, Demeure O, Urien C, Milan D, Chardon P, Renard C Genet 33:3–18. doi:10.1046/j.1365-2052.2002.00800.x (2004) A physical map of large segments of pig chromosome 29. Chardon P, Nunes M, Dezeure F, Andres-Cara D, Vaiman M 7q11–q14: comparative analysis with human chromosome 6p21. (1991) Mapping and genetic organisation of the TNF genes in the Mamm Genome 15:982–995. doi:10.1007/s00335-004-3008-6 swine MHC. Immunogenetics 34:257–260. doi:10.1007/BF002 13. Geneˆt C, Renard C, Cabau C, Rogel-Gaillard C, Gellin J, Milan D 15262 (2001) In the QTL region surrounding porcine MHC, gene order 30. Solinas S, Pauli U, Kuhnert P, Peterhans E, Fries R (1992) is conserved with . Mamm Genome 12:246–249. Assignment of the porcine tumor necrosis factor alpha and beta doi:10.1007/s003350010261 genes to the chromosome region 7p11–q11 by in situ hybridisa- 14. Tanaka M, Matsumoto T, Yanai S et al (2003) Conservation of tion. Anim Genet 23:267–271 the syntenies between porcine chromosome 7 and human chro- 31. Nunes M, Yerle M, Dezeure F, Gellin J, Chardon P, Vaiman M mosomes 6, 14 and 15 demonstrated by radiation hybrid mapping (1993) Isolation of four HSP70 genes in the pig and localization and linkage analysis. Anim Genet 34:255–263. doi:10.1046/ on chromosomes 7 and 14. Mamm Genome 4:247–251. doi: j.1365-2052.2003.00999.x 10.1007/BF00417430 15. Rattink AP, de Koning DJ, Faivre M, Harlizius B, van Arendonk 32. Goureau A, Yerle M, Schmitz A, Riquet J, Milan D (1996) JA, Groenen MA (2000) Fine mapping and imprinting analysis Human and porcine correspondence of chromosome segments for fatness trait QTLs in pigs. Mamm Genome 11:656–661. doi: using bidirectional chromosome painting. Genomics 36:252–262. 10.1007/s003350010117 doi:10.1006/geno.1996.0460

123