Voltage-Gated Calcium Channels in Nociceptors and Their Role in Acute and Inflammatory Nociception
Daniel M DuBreuil B.S., Otterbein University, 2012
THESIS
Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy in the Department of Neuroscience at Brown University
Providence, Rhode Island May 2018
© 2018 Daniel M DuBreuil
ii
This dissertation by Daniel M DuBreuil is accepted in its present form by the Department of Neuroscience as satisfying the dissertation requirement for the degree of Doctor of Philosophy.
______Dr. Diane Lipscombe, Advisor Date
Recommended to the Graduate Council
______Dr. Christopher Moore, Reader Date
______Dr. Julie Kauer, Reader Date
______Dr. Bruce Bean, Outside Reader Date
Approved by the Graduate Council
______Dr. Andrew G. Campbell, Dean of the Graduate School Date
iii
CURRICULUM VITAE
Daniel M DuBreuil [email protected]
EDUCATION Brown University, Providence, RI 2017 Ph.D. in Neuroscience Dissertation: “Voltage-gated calcium channels in nociceptors and their role in acute and inflammatory nociception” Otterbein University, Westerville, OH 2012 B.S. in Biochemistry and Molecular Biology with honors Minor: Chemistry Magna Cum Laude, GPA: 3.879 Honors Thesis: “Characterization of a perilipin-5 splice variant”
RESEARCH EXPERIENCE Brown University, Providence, RI 2013-Present “Voltage-gated calcium channels in nociceptors and their role in acute and inflammatory nociception” Principle investigator: Diane Lipscombe, Ph.D. • Validate transgenic mouse strains for Cre-dependent reporter expression in somatosensory neuron subpopulations Whole-cell electrophysiology, immunohistochemistry, RNAScope® in situ hybridization • Assess nociceptor function in vivo using acute behavioral assays Hargreaves’ radiant heat assay, hotplate assay, von Frey mechanical nociception assay • Assess nociceptor synapse function in vitro in acute spinal cord slices Whole-cell electrophysiology • Induce chronic pain phenotype Spared nerve injury surgery, capsaicin-induced hyperalgesia, CFA-induced hyperalgesia
Otterbein University, Westerville, OH 2009-2012 “Characterization of a perilipin-5 splice variant” Principle investigator: John Tansey, Ph.D. • Identify perilipin-5 splice isoform in C2C12 myoblasts Western blot, RT-PCR, immunofluorescence • Selectively knockdown perilipin-5b RNA-interference, cell culture, DNA transfection
University of Connecticut, Storrs, CT 2011 “Phosphorylation of the X-linked intellectual disability protein BRAG1” Principle investigator: Randall Walikonis, Ph.D. • Examine in vitro regulation of BRAG1 phosphorylation
iv
Primary neuron culture, cell culture, DNA transfection, immunoprecipitation, Western blot GRANTS Ruth L. Kirschstein NRSA Predoctoral Fellowship 2015-2017 NINDS (F31NS093818): “The role of CaV3.2 T-type calcium channel-expressing sensory neurons in nociception and chronic pain”
PUBLICATIONS DuBreuil, et al. “Voltage-gated CaV2.2 N-type calcium channels mediate inflammatory hyperalgesia via peripheral secretion of ATP”. In preparation
DuBreuil, et al. “Prolonged activation of TRPV1-lineage neurons via channelrhodopsin-2 does not elicit thermal hyperalgesia in vivo, but potentiates inhibitory synaptic currents in spinal cord dorsal horn in vitro”. In revision
MENTORING Undergraduate honors theses Maïté van Hentenryck, Brown University 2015 Olena Kuksenko, Brown University 2016
Graduate rotation students Eric Klein, Brown University 2017
TEACHING EXPERIENCE Harriet W Sheridan Center for Teaching and Learning 2013-2016 Brown University, Providence, RI • Certificate I: Introduction to reflective teaching Participant and workshop discussion leader • Certificate II: Integrative course design • Certificate IV: Teaching consultant training
Behavioral Neuroscience, PSYC 302, Guest Lecture 2017 Trinity College, Hartford, CT • Guest lecture in the class of Prof Susan Masino • Enrolls upper level Neuroscience and Pyschology undergraduates • Discussion of rodent models of pain behavior
Principles of Neuroscience, NESC 201, Guest Lecture 2017 Trinity College, Hartford, CT • Guest lecture in the class of Prof Susan Masino • Enrolls declared Neuroscience majors • Lecture on optogenetics techniques and application in dissertation research
Graduate Student Neuro-practicum Teaching Assistant 2015/2016 Brown University-Marine Biological Laboratory, Woods Hole, MA • Assemble electrophysiology rig for cell-attached single channel recording • Prepare reagents for single channel recording experiments
v
Sterile cell culture, DNA transfection • Assist students performing single channel recording Electrode manufacturing, seal formation, data collection, data analysis
Neuro1740: The Diseased Brain Teaching Assistant 2014 Brown University, Providence, RI • Lead weekly study section discussing primary articles • Prepare study guides and quizzes about primary articles • Prepare and grade hourly exams based on lecture material
Organic Chemistry Lab Teaching Assistant 2010-2012 Otterbein University, Westerville, OH • Prepare and organize supplies for laboratory exercises • Prepare and grade weekly quizzes
General Chemistry Supplemental Instruction Leader 2011-2012 Otterbein University, Westerville, OH • Lead extra review sessions of general chemistry Develop lesson plans, prepare example problems
PRESENTATIONS Oral In-house seminar series, Brown University, Providence, RI 2013-2017 Various titles
Current Issues in Neuroscience, Trinity College, Hartford, CT 2016 “Targeting genetic subpopulations of somatosensory neurons to understand nociception and pain”
SNTP Symposium, Tufts University, Boston, MA 2016 “Assessing nociceptor function in vivo and in vitro using optogenetic methods”
Data blitz, Society of General Physiologists, Woods Hole, MA 2014 “Distinct populations of sensory neurons visualized and controlled in spinal dorsal horn using optogenetic methods”
Otterbein University Honors Reporting Day, Westerville, OH 2012 “Characterization of a Perilipin-5 Splice Variant” Poster Society for Neuroscience Annual Meeting, San Diego, CA 2016 “Prolonged activation of TRPV1-lineage neurons via channelrhodopsin-2 does not elicit thermal hyperalgesia in vivo, but potentiates inhibitory synaptic currents in spinal cord dorsal horn in vitro”
Society for Neuroscience Annual Meeting, Chicago, IL 2015 “Functional comparison of CaV3.2-lineage and TRPV1-lineage sensory neuron subpopulations”
European Calcium Channel Conference, Alpbach, Austria 2015
vi
“Elucidating the contribution of defined sensory neuron subpopulations to nociception and chronic pain”
Mind Brain Research Day, Brown University, Providence, RI 2015 “A novel strategy for elucidating the contribution of defined sensory neuron subpopulations to nociception and chronic pain”
Day of Biology, Brown University, Providence, RI 2015 “A novel strategy for elucidating the contribution of defined sensory neuron subpopulations to nociception and chronic pain”
Society of General Physiologists, Woods Hole, MA 2014 “Distinct populations of sensory neurons visualized and controlled in spinal dorsal horn using optogenetic methods”
NSGP Retreat, Brown University, Providence, RI 2014 “Distinct populations of sensory neurons visualized and controlled in spinal dorsal horn using optogenetic methods”
ASBMB Undergraduate Poster Competition, San Diego, CA 2012 “Characterization of a Perilipin-5 Splice Variant”
Research Symposium, University of Connecticut, Storrs, CT 2011 “Phosphorylation of the X-linked intellectual disability protein BRAG1”
ASBMB Undergraduate Poster Competition, Washington, D.C. 2011 “Characterization of a Perilipin-5 Splice Variant”
OFIC Undergraduate Research Symposium, Columbus, OH 2011 “Characterization of a Perilipin-5 Splice Variant”
AWARDS Brown University NSGP Retreat Poster Competition 2016 Otterbein University Priest-Miller Endowed Prize 2012 Otterbein University Torch and Key Senior Prize 2012 ASBMB Competitive Travel Award 2011 Otterbein University Analytical Chemistry Award 2011 Bert and Jane Horn Research Fund Award 2010-2011
HONOR SOCIETIES Chi Omega Lambda ASBMB Honor Society 2012 Torch and Key Honor Society 2012 Alpha Lambda Delta Honor Society 2009 Phi Eta Sigma Honor Society 2009
MEMBERSHIPS Society for Neuroscience 2012-Present American Chemical Society 2011-2012 American Society for Biochemistry and Molecular Biology 2009-2012
vii
ABSTRACT Voltage-gated calcium channels in neurons couple membrane depolarization to calcium- dependent processes, including activity-dependent gene expression and synaptic neurotransmitter release. In nociceptors, CaV2.2 channels are the dominant source of calcium entry mediating synaptic neurotransmitter release in the spinal cord dorsal horn. Inhibition of CaV2.2 channels provides analgesia in rodents and humans suffering from chronic pain, but novel analgesics targeting CaV2.2 channels have been unsuccessful in clinical trials because of low efficacy or excessive side-effects resulting from wide-spread CaV2.2 channel inhibition in the nervous system. In my dissertation work, I examined the contribution of CaV2.2 channels and CaV2.2 channel splice isoforms in a genetically-defined population of nociceptors to nociception and pain related-behavior. Chapter 1 provides an introduction to voltage-gated calcium channels, the neuroanatomy of pain, and the use of CaV2.2 channel inhibitors as analgesics. In Chapter 2, I describe experiments characterizing the novel mouse strain I used to target Trpv1-lineage nociceptors across in vitro and in vivo preparations. These experiments are critical for accurate interpretation of data assessing the role of CaV2.2 channels and CaV2.2 splice isoforms in nociceptor function and pain behavior. In Chapter 3, I present data supporting the role of CaV2.2 channels in mediating neurotransmitter release from central nociceptor terminals in the spinal cord as well as data demonstrating a previously unappreciated role for CaV2.2 channels in peripheral nociceptor terminals in the skin. I conclude that inflammatory hyperalgesia requires CaV2.2-mediated release of inflammatory chemicals, such as ATP. In Chapter 4, I demonstrate that prolonged activation of Trpv1-lineage nociceptors in the absence of inflammation is insufficient to induce hyperalgesia or potentiation of nociceptor synapses in the spinal cord; however, I find that prolonged nociceptor activation does elicit potentiation of inhibitory synapses in spinal cord dorsal horn. This finding solidifies inflammatory signaling as a critical mediator of chronic pain. In Chapter 5, I explore the role of CaV2.2 channel splice 37a 37b isoforms in nociception and inflammatory hyperalgesia. I conclude that CaV2.2 , CaV2.2 , +18a ∆18a CaV2.2 , and CaV2.2 isoforms are all capable of supporting acute nociception, but that 37a CaV2.2 channels play a privileged role in inflammatory hyperalgesia. In the final chapter I discuss the implications of these findings for development of novel chronic pain therapies.
viii
ACKNOWLEDGEMENTS I would like first and foremost to thank my advisor, Diane Lipscombe. When I first joined the lab, I had no idea what graduate school was all about, what I was interested in studying, or where I wanted to go with my career. Diane gave me the freedom to explore many areas of interest, in both research and careers. I have learned so much from Diane about the scientific endeavor, inside the lab and out, and I am so grateful for having had the opportunity to work with her.
I would like to thank all the past and present members of the Lipscombe lab, particularly: Sylvia Denome Kristin Webster Aaron Held Arturo Andrade E Javier Lopez Soto James Heinl Summer Allen Josh Whitt Each and every one of them has taught me so much and none of the work I present here would have been possible without their help. Diane has done an amazing job of choosing lab members and I look forward to working with them more in the future. I would like to thank members of Julie Kauer’s lab, especially Anda Chirila, Bruno Pradier, and Michelle Kloc. Spinal cord slice physiology is not for the faint of heart and your guidance and advice over the years has been incredibly valuable. I would like to thank the members of my thesis committee: Julie Kauer and Chris Moore. Their expertise has been invaluable to my graduate training, as a scientist, teacher, and mentor. I would like to thank Brown University, the Neuroscience Department, the Neuroscience Graduate Program. The outstanding faculty, staff, and students here truly made my time here an absolute pleasure. I would like to thank all my family and friends, whose support of over the past 5 years has been invaluable. Thank you for letting my try to explain my work and forcing me to question everything. Finally, I would like to thank my wife, Lauren. You kept me grounded; you kept me sane; you eased my anxiety; and you kept me motivated to persevere through every challenge. I have no idea where I would be without you.
ix
TABLE OF CONTENTS Curriculum vitae……………………………………………………………………………... iv Abstract……………………………………………………………………………………….. viii Acknowledgements…………………………………………………………………………. ix Table of contents…………………………………………………………………………..... x List of figures and tables…………………………………………………………………... xi Chapter 1: Introduction…………………………………………………………………...... 1 Structure and function of voltage-gated calcium channels in neurons| 2
CaV2.2 channel inhibitors as analgesics | 5
CaV2.2 channels throughout the pain pathway | 7 CaV2.2 channels in rodent models of nociception and chronic pain | 10
Effect of alternative splicing on CaV2.2 channel function | 16
Chapter 2: Targeting Trpv1-lineage neurons for in vivo and in vitro analyses…... 24 Introduction | 25 Results | 27 Discussion | 34
Chapter 3: Role of CaV2.2 channels in nocifensive behavior, nociceptor function, and synaptic activity in spinal cord dorsal horn…………………………… 43 Introduction | 44 Results | 45 Discussion | 52
Chapter 4: Prolonged activation of Trpv1-lineage nociceptors does not modify nocifensive behavior but induces changes in synaptic efficacy in spinal cord dorsal horn...... 65 Introduction | 66 Results | 68 Discussion | 71
Chapter 5: The role of Cacna1b splice isoforms in nocifensive behavior………… 78 Introduction | 79 Results | 80 Discussion | 85
Chapter 6: Discussion..…………………………………………………………………...... 97 Chronic pain: Current analgesic therapies | 99
Chronic pain mechanisms: central sensitization | 104
Future directions | 107
Conclusion | 109
Materials and Methods……………………………………………………………………… 110
References…………………………………………………………………………………….. 127
x
LIST OF FIGURES AND TABLES Figure Title Page
1 Inhibitors of CaV2.2 channel activity provide analgesia 20 2 Nociception and pain circuitry 21 3 The Cacna1b gene is subject to extensive alternative splicing 22 4 Novel mouse strains for analysis of Cacna1b splice isoform contribution to 23 nociceptor function 5 Trpv1 expression, assessed by RNA in situ hybridization, is restricted to a 37 subset of Trpv1-lineage neurons 6 Trpv1-lineage neurons in dissociated DRG display heterogeneous functional 38 properties and can be classified into four groups 7 Trpv1-lineage neurons are nociceptors that innervate hindpaw skin and 40 superficial dorsal horn 8 Optogenetic activation of Trpv1-lineage afferent elicits synaptic currents in 41 lamina II neurons 9 ChR2-EYFP expression allows for direct activation of nocifensive responses 42 by blue light without altering thermal sensitivity
-/- 10 CaV2.2 mice have impaired nociception 58
11 CaV2.2 channels are critical for synaptic transmission from nociceptors to 59 spinal cord dorsal horn neurons
12 CaV2.2 channels increase neurotransmitter release probability from 60 nociceptor terminals
13 CaV2.2 channels do not significantly contribute to the shape of nociceptor 61 action potentials
14 CaV2.2 channels do not significantly contribute to nociceptor excitability 62
15 CaV2.2 channels are critical for inflammatory hyperalgesia resulting from 63 intraplantar CFA and for secretion of IL-1β from hindpaw skin
16 Intradermal release of ATP mediated by capsaicin requires functional CaV2.2 64 channels 17 Prolonged stimulation of Trpv1-lineage afferents is insufficient to elicit 75 thermal hyperalgesia 18 Prolonged nociceptor activation in the presence of a single inflammatory 76 mediator is insufficient to induce thermal hyperalgesia 19 Prolonged stimulation of Trpv1-lineage nociceptor terminals in spinal cord 77 induces potentiation of inhibitory synapses 20 Cacna1b-e37a is expressed in Trpv1-expressing neurons in dorsal root 89 ganglia
xi
21 Alternative splicing at Cacna1b-e37a/b does not impact acute nociception 90
22 Synaptic currents are unaffected by loss of e37a-containing CaV2.2 channels 91
23 Nociceptor synapses lacking e37a-containing CaV2.2 channels are equally 92 sensitive to blue light
24 Nociceptor synapses lacking e37a-containing CaV2.2 channels respond 93 normally to 1 Hz stimulation
25 Nociceptor synapses lacking e37a-containing CaV2.2 channels respond 94 normally to 10 Hz stimulation 26 Removal of Cacna1b-e37a impairs capsaicin-mediated, but not CFA- 95 mediated, thermal hyperalgesia 27 Alternative splicing at Cacna1b-e18a does not impact acute nociception 96 Table Title Page 1 Trpv1 lineage subpopulation cluster analysis statistics 39
-/- +18a ∆18a 2 Primers for generation of CaV2.2 , CaV2.2 , and CaV2.2 mouse strains 113
xii
CHAPTER 1
Introduction Voltage-gated calcium ion (CaV) channels regulate intracellular calcium signaling by controlling calcium influx in response to membrane depolarization. CaV channels are divided into three
main families based on sequence similarity that have overlapping roles in excitation-
1 transcription coupling, neurotransmitter release, and pacemaking. CaV2.2 channels are critical
for behavioral responses to noxious stimuli and are validated targets for treatment of chronic
2,3 pain in humans. In the pain circuitry, CaV2.2 channels mediate neurotransmitter release in the
4 spinal cord from primary sensory neurons that detect noxious stimuli; however, CaV2.2 channels are expressed at other sites within sensory neurons and their functions in these locations is poorly understood.2
In addition to subcellular localization, the role of CaV2.2 channels in sensory neuron function is
likely to be modified by alternative pre-mRNA splicing. The CaV2.2 channel gene is subject to
extensive alternative splicing, alternative splicing can significantly alter CaV2.2 channel properties, and a specific splice isoform of the CaV2.2 channel is preferentially expressed in
5–9 nociceptors. The goal of this thesis work is to elucidate the role of CaV2.2 channels and particular splice isoforms of the CaV2.2 channel in acute nociception and inflammatory
hyperalgesia. In this chapter, I provide a brief overview of the structure and function of voltage-
gated calcium channels in neurons, the use of CaV2.2 channel inhibitors as analgesics, the role
of CaV2.2 channels throughout the pain pathway, the role of CaV2.2 channels in current models of nociception and chronic pain, and the effect of alternative splicing on CaV2.2 channel function.
Structure and function of voltage-gated calcium channels in neurons
- 2 -
1 CaV channels are complexes of α1, α2δ, and β subunits. The α1 subunit forms the channel pore
and 10 principle types have been identified in mammals. The ten CaV channels form three
families—CaV1, CaV2, and CaV3—based on sequence similarity and cellular function. CaV channel α1 subunits are encoded by distinct genes: Cacna1s, Cacna1c, Cacna1d, and Cacna1f
genes for CaV1.1, CaV1.2, CaV1.3 and CaV1.4 channels, respectively; Cacna1a, Cacna1b, and
Cacna1e genes for CaV2.1, CaV2.2, and CaV2.3 channels, respectively; and Cacna1g, Cacna1h, and Cacna1i genes for CaV3.1, CaV3.2, and CaV3.3 channels, respectively. CaV1.1 and CaV1.4
are not present at high levels in the brain, but all other CaV channels are expressed widely in the
10 nervous system. The α2δ and β subunits can significantly impact channel trafficking and
1 current kinetics. CaV channels participate in every aspect of neuronal signaling, from signal
detection in dendritic spines to transmitter release from pre-synaptic nerve terminals.
CaV channels regulate activity dependent gene expression in neurons
CaV channels located at dendritic spines and in neuronal somata couple calcium-influx to
calcium-dependent gene expression.11–13 Excitation-transcription coupling has primarily been
studied through cAMP-responsive element binding protein (CREB)-dependent gene
14 expression. Calcium, entering through CaV channels in response to synaptic input or neuronal
firing, binds to and activates calmodulin kinase (CaMK), which phosphorylates CREB to initiate
gene activation.14 Activity-dependent gene-expression changes have been implicated in
14 learning and memory, drug addiction, and neuronal development. CaV1 channels, which are
primarily located at dendritic and somatic sites within neurons, are the primary mediators of
11–13 excitation-transcription coupling. CaV2 channels can also couple to CaMK and CREB activation, but act at a greater distance compared with CaV1 channels and are relatively minor contributors.13
- 3 -
CaV channels contribute to neuronal pacemaking and excitability
CaV3 channels, which activate near the resting membrane potential, regulate action potential
15–17 firing by promoting rebound bursting following hyperpolarization. A fraction of CaV3 channels is invariably inactivated and brief membrane hyperpolarization allows recovery of inactivated channels. When the membrane potential returns to the resting membrane potential,
CaV3 channels open, depolarizing the membrane and allowing voltage-gated sodium channels to initiate spike firing. CaV3 channels also support a large pulse of calcium entry during rapid hyperpolarization events, due to slow channel closing rates, which can activate calcium- dependent Kv channels. Both CaV2 and CaV3 channels couple with calcium-dependent KV channels to regulate action potential firing frequency and action potential shape.18–21
CaV channels control calcium-dependent neurotransmitter release.
In pre-synaptic nerve terminals throughout the nervous system, CaV2 channels are the dominant class that control evoked neurotransmitter release.22 Incoming action potentials
depolarize pre-synaptic nerve terminals, activating CaV2 channels. Calcium entering the cell
23 through CaV2 channels binds to synaptotagmin, which initiates fusion-pore opening. CaV2.1
and CaV2.2 are the dominant CaV2 channels that mediate neurotransmitter release throughout the central nervous system. A recent review of 42 studies found that, across 51 synapses, 45%
24 have a preferential role for CaV2.1 over CaV2.2 channels. Only 16% preferentially utilize
CaV2.2 channels, but a substantial amount, 31%, rely on the combined activity of both CaV2.2
and CaV2.1 channels. CaV3 channels also contribute to neurotransmitter release from some
25,26 synapses and CaV1 channels are necessary for function of specialized ribbon synapses in
photoreceptors and cochlear inner hair cells.27 Similarly, hormone release from endocrine cells
3 can depend on a variety of CaV channels, including CaV1, CaV2, and CaV3. Primary sensory
- 4 -
nociceptors depend primarily on CaV2.2 channels, rather than CaV2.1 channels, for
2,4 neurotransmitter release in the spinal cord. CaV2.2 channels account for approximately 60%
of somatic calcium current in small sized sensory neurons from dorsal root ganglia (DRG),
whereas all other voltage-gated calcium channels account for the remaining 40%.8
CaV2.2 channel inhibitors as analgesics
The role of CaV2.2 channels in mediating entry of noxious sensory input to the central nervous
system has long garnered interest as a potential target for novel analgesic drugs.28 This interest
was further encouraged by the specificity of toxins available for specific inhibition of CaV2.2 channels. CaV2.1 channels are specifically inhibited by ω-agatoxin IVA, from funnel web spider
Agelenopsis aperta venom, whereas CaV2.2 channels are specifically inhibited by ω-conotoxin
GVIA, from cone snail Conus geographus venom.1 These toxins have been the subject of
intense research to understand how they target CaV2.1 and CaV2.2 channels with incredible
29 specificity and potently inhibit calcium flux. Furthermore, CaV2.2 channels are subject to
potent inhibition by G-protein coupled receptors, such as opioid receptors.8
Direct CaV2.2 channel blockers as analgesics
So far, only one CaV2.2-specific toxin has been approved as a therapeutic for chronic intractable pain.2 Ziconotide, a synthetic version of ω-conotoxin MVIIA, also called SNX-111 and marketed
under the trade name Prialt® by Jazz Pharmaceuticals, is administered directly into the spinal
cord via a surgically implanted intrathecal pump and is only used for treatment of individuals
whose pain is poorly managed by all other treatments and for whom intrathecal therapy is
warranted.2,30,31 Although ziconotide is a powerful analgesic, its utility is limited by severe CNS
side effects, including hallucinations, paranoid reactions, and psychoses.2,30,31 Furthermore,
- 5 -
intrathecal administration is critical to prevent dangerous side-effects on blood pressure and
2,30,31 heart rate due to sympathetic CaV2.2 channel inhibition. Additional venom peptide toxins
are in development or clinical trials, but so far none have been approved.
Small molecule inhibitors of CaV2.2 channels have also been pursued extensively by pharmaceutical companies. Although many compounds with varying potency and selectivity have been generated, only two have been advanced into human clinical evaluation: Z160 from
Zalicus and CNV2197944 from Convergence Pharmaceuticals.2 Z160 completed two Phase II
clinical trials, one for efficacy in post-herpetic neuralgia and a second for efficacy in lumbosacral
radiculopathy. In both cases, Z160 was deemed safe and well-tolerated, but did not show an
effect above placebo. CNV2197944 has also completed two Phase II clinical trials, also for
efficacy in post-herpetic neuralgia and for efficacy in diabetic peripheral neuropathy. Like Z160,
CNV2197944 did not have any effect above placebo for any outcome. Despite these
disappointments, more compounds and toxins are still in development with improved specificity
and potency.
Indirect inhibition of CaV2.2 channel activity for pain relief
CaV2.2 channels are also critical mediators of analgesia by more common chronic pain therapies. Figure 1 illustrates the mechanisms by which ziconotide, morphine, and gabapentin modify CaV2.2 channel activity to provide analgesia. As described above, ziconotide directly
binds to CaV2.2 channels and blocks the ion pore, preventing calcium flux. Morphine acts indirectly to inhibit CaV2.2 channels. Morphine binds to the G-protein coupled µ-opioid receptor.
Upon µ-opioid receptor activation, the Gβγ dimer dissociates from the Gα subunit and diffuses
8,32 along the membrane until it interacts with and inhibits the CaV2.2 channel. Morphine
- 6 -
mediated analgesia depends on co-expression of µ-opioid receptors and CaV2.2 channels and
8,32 can be modified by alternative splicing of the CaV2.2 channel. Morphine and other opiates,
which provide analgesia by a similar mechanism, however, have many problems as a treatment
for chronic pain, including concerns of addiction and decreasing efficacy over time. Gabapentin
is another common treatment for chronic pain, particularly related to diabetic neuropathy and
post-herpetic neuralgia. Gabapentin gained prominence initially as an anti-epileptic drug and
likely acts through many different mechanisms within the central nervous system. With respect
to analgesia, gabapentin interacts with the α2δ1 auxiliary subunit of the CaV2.2 channel complex
32 to limit transport of CaV2.2 channels to the plasma membrane and this action of gabapentin
may account for some of its efficacy.
CaV2.2 channels throughout the pain pathway
Pain is an oft-maligned sensory percept, but one that is critical for survival and well-being. The
perception of pain signals impending tissue damage or injury and elicits a host of behavioral
responses to prevent serious harm. Pain perception is accomplished by information flow from
primary sensory neurons of the peripheral nervous system to the spinal cord and, ultimately, the
brain, where the perception of pain is generated. Synaptic connections with varying dependence
on CaV2.2 channels connect each of these distinct sites. A schematic of the neuroanatomy underlying the sense of pain is provided in Figure 2.
Primary sensory neurons detect noxious stimuli
Primary sensory neurons reside in peripheral structures called dorsal root ganglia (DRG) and
send bifurcated axons that innervate peripheral tissues, such as skin, joints, and gut, as well as
the spinal cord. DRG neurons are highly heterogeneous33,34 and can be loosely divided into two
- 7 -
categories: nociceptors, which detect noxious stimuli, and low-threshold receptors, which are
responsible for our senses of light touch, cool and warm temperature detection, and
proprioception. CaV2.2 channels are primarily responsible for mediating calcium entry leading to
4 neurotransmitter release from nociceptors , whereas CaV2.1 channels are more important for neurotransmitter release from low-threshold sensory neurons.35 Classically, nociceptors have
been identified using morphological features, such as small cell bodies, small diameter axons,
and unmyelinated axons. Furthermore, nociceptors express unique complements of ion
channels, such as the transient receptor potential, vanilloid type 1 (TRPV1) and the voltage-
gated sodium ion channel 1.8 (NaV1.8), and neuropeptides, such as calcitonin-gene related
peptide (CGRP) and substance P. In the skin, nociceptors form free nerve endings in the
epidermis, whereas low-threshold receptors form more intricate terminals associated with
specific end organs and hair follicles which aid in their detection of low-threshold somatosensory
stimuli.36 Sensory neurons can also be classified according to their sensitivity to different
stimulus modalities, such as heat, cold, and mechanical stimuli, but a large number of sensory
neurons are multi-functional and respond to a combination of stimulus modalities.
CaV2 channels are expressed at multiple subcellular locations in primary sensory neurons.
CaV2.1 and CaV2.2 currents are observed in dissociated DRG neurons and provide the bulk of
action potential-mediated calcium influx in the sciatic nerve, indicating functional expression at
8,37,38 DRG cell bodies and at peripheral structures. The function of CaV2.2 channels at these sites is poorly understood.
Spinal cord circuits modulate incoming sensory information and generate reflexive behaviors
- 8 -
DRG neurons carry information to the spinal cord. The spinal cord is arranged such that sensory information arrives in dorsal structures called the dorsal horns and motor information leaves the spinal cord through ventral structures called the ventral horns. The spinal cord is organized into a series of 9 layers based on cytoarchitecture, proceeding from the dorsal horn to the ventral horn.39 Laminae I-VI make up the dorsal horn, whereas ventral horn motor neurons are restricted to lamina IX. Laminae VII and VIII make up the remaining portion of the central spinal cord and ventral horns. A tenth lamina immediately surrounding the central canal is also included in the original description.39 Within the dorsal horn, sensory synaptic input is organized such that direct noxious input is restricted to laminae I and II, whereas non-noxious input is directly relayed to laminae II-VI.40 The cells that make up the spinal cord dorsal horn are diverse and include excitatory projection neurons, local inhibitory interneurons, and local excitatory interneurons.40 Projection neurons are responsible for carrying sensory information to the brain and exist in two distinct pools.40 Projection neurons in lamina I receive monosynaptic input from nociceptors, whereas projection neurons in lamina III-V receive primarily non-noxious input, although they can receive noxious input through intermediate excitatory interneurons.40 Lamina
II is devoid of projection neurons and consists entirely of local interneurons.40 Local interneurons form the bulk of local circuitry in the spinal cord that mediate fast reflexive behavioral responses and modulate primary sensory information.40 Excitatory interneurons relay nociceptor input to ventral areas to activate spinal motor neurons and inhibitory interneurons form a gate that limits the spread of noxious information within the spinal cord.40
In the few instances where it has been evaluated, CaV2.1 channels dominate in controlling neurotransmitter release from spinal cord interneurons, suggesting an especially privileged role
35 for CaV2.2 channels in mediating entry of noxious information into the central nervous system.
The prevalence of CaV2.1 channels in mediating synaptic transmission from spinal cord neurons
- 9 - is fortunate, as it spares spinal cord circuitry from inhibition by analgesics targeting CaV2.2
channels.
Brain circuitry decodes sensory information, integrates sensory information, and generates a
conscious percept
From the spinal cord, sensory input is relayed to a wide variety of anatomic locations in the
brain. The sensation of pain reflects the coordinated activity across many brain regions. Spinal
projection neurons primarily carry sensory information to the thalamus, the peri-aqueductal gray
area (PAG), and the lateral parabrachial nucleus.41 Non-noxious sensory information from
laminae III-V of the spinal cord dorsal horn is preferentially relayed to the thalamus, whereas
noxious sensory information from spinal cord dorsal horn lamina I is primarily carried to PAG
and parabrachial areas.41 From these initial brain regions, the sensory information is carried finally to the cortex, especially the amygdala and somatosensory cortex, where sensory information is integrated and decoded. Processing of sensory input in the brain is highly complex and the exact circuitry that contributes to the perception of pain is poorly understood.42
The contributions of CaV2.2 channels to pain processing in the brain are poorly understood and
targeting CaV2.2 channels in the brain to provide analgesia would almost certainly cause significant side-effects.
CaV2.2 channels in rodent models of nociception and chronic pain
Many models of nociception and chronic pain have been developed for use in mice and rats.
Each model provides different insights into the neurobiology of nociception and pain and
- 10 - selection of the proper model is no easy feat. Here, I draw a distinction between acute nociception, which is the detection of noxious stimuli, and chronic pain, which is a behavioral state characterized by enhanced sensitivity to noxious stimuli, called hyperalgesia, or the perception of non-noxious stimuli as noxious, also known as allodynia. I provide a brief
description of some of these animal models, divided into categories for acute nociception,
neuropathic pain, inflammatory pain, and disease related pain.
Acute nociception
One of the most common complaints of human chronic pain patients is heightened sensitivity to
mechanical stimuli. As such, behavioral tests assessing the sensitivity of rodents to mechanical
stimuli are highly popular. Two tests, the von Frey mechanical nociception assay and the
Randall-Selitto test are by far the most commonly used assays.43 The von Frey mechanical
nociception assay uses a series of filaments which are calibrated to deliver a known force when
applied to the plantar surface of the hindpaw. The range of stimulus intensities applied ranges
from 0.16 g to 2 g in mice and 0.4 g to 15.1 g in rats. The exact methodology can differ, but
usually the 50% withdrawal threshold will be calculated based on the Up-and-Down method
described by Dixon.44 Conversely, relative responsiveness to specific stimulus intensities, for
example a 1 g and a 0.4 g filament, can be used to assess sensitivity across genotypes or over
time. The von Frey test is the gold-standard for assessing allodynia and mechanical nociception
in rodents, but there is considerable variability in assessments across experimenters.43 The
Randall-Selitto method offers greater consistency across experimenters, but requires extensive
experimenter training and suffers from concerns of stress responses due to subject
immobilization during testing. In the Randall-Selitto assay, pressure is applied to the hindpaw by
restraining the mouse in an apparatus and securing the paw between a fixed point and a mobile
blunt point exerting a fixed pressure. The pressure is continually increased until a pre-
- 11 - determined behavior, such as vocalization, struggling, or attempted paw-withdrawal, is observed.
Tests of thermal nociception offer an alternative to tests of mechanical nociception. In each of these tests, sensitivity is assessed by the latency to a pre-determined response, which is proportional to the relative temperature of the skin required to activate thermosensitive nociceptors. The most common test of thermal nociception for assessing general thermal sensitivity is the hot plate assay.43 In this test, the subject is placed onto an enclosed plate set to
a pre-determined temperature, usually between 50°C and 55°C. The latency to hindpaw
withdrawal, attempted escape, or vocalization, is measured. The hot plate assay is very quick
and easy and video recording allows for quantification by several experimenters, however, it is
not suitable for repeated testing as response latencies decrease upon repeated exposure.45 As
an alternative, Hargreaves developed the radiant heat assay in which one hindpaw is stimulated
by a radiant heat source, either infrared light or high-intensity visible light, to increase paw
temperature and elicit a paw withdrawal response.46 This technique allows for independent
assessment of each hindpaw and provides stable measurements over time, allowing for ideal
assessment of thermal hyperalgesia in unilateral models of chronic pain. For global chronic pain
models, the tail flick assay may be a suitable option.43 The tail-flick assay, like the radiant heat
assay, uses either an infrared light beam or a constant temperature water bath, to increase
cutaneous tail temperature until a tail flick response is observed. It should be noted that the tail
flick test may require additional experimenter expertise for proper subject positioning and has
been criticized for assessing tail sensitivity, which lacks an analogous human structure and is
implicated in rodent thermoregulation.
- 12 -
Recently, these classic nociception tasks have come under closer scrutiny for their validity in assessing chronic pain states. Both thermal and mechanical methods quantify evoked behaviors, but ongoing, spontaneous pain is the primary unmet clinical symptom. For these behaviors, more nuanced approaches are required.43 For example, reduced weight bearing,
assessed by measuring the relative force applied by each paw, may be an indication of ongoing
pain in the affected limb independent of any specific stimulus. Similarly, a grimace scale has
been developed to decode rodent facial expressions as a readout of ongoing pain.43 These
approaches, and others that are currently being developed, require more validation and
standardization before they become wide-spread for pre-clinical assessment of pain in rodents.
The role of CaV2.2 channels in mediating acute nociception is still a matter of some debate.
Intrathecal administration of morphine inhibits acute nociception, but intrathecal ziconotide has
31,32 had variable effects. Three strains of CaV2.2-null mice have been generated and conflicting results have been observed regarding their sensitivity to noxious stimuli.47–49 Each strain
displayed some impaired nociception, but the interpretation of these impairments is not
straightforward.
Neuropathic pain
Neuropathic pain is most commonly induced by direct injury of the sciatic nerve.50,51 The sciatic
nerve is an attractive target because both the peripheral and central targets, the hindpaw and
lumbar spinal cord, respectively, are experimentally tractable. The sciatic nerve of the mouse
begins in the periphery as three branches that join in the mid-thigh before separating again to
innervate primarily the L3 and L4 DRG, with some contribution to the L5 ganglia. Three models
of neuropathic pain are most commonly used and differ with respect to the extent and location
- 13 - of injury along the sciatic nerve. In the chronic constriction injury model, the main section of the sciatic nerve, where all three branches are conjoined, is loosely ligated to restrict blood flow, resulting in significant degeneration of sensory axons.50,51 The spinal nerve ligation model differs
in that the branches of the sciatic that enter the L3 and L4 sciatic nerve are tightly ligated just
distal to the DRG.50,51 In a variant of the spinal nerve ligation model, called the spared nerve
injury model, two of the three branches of the distal-most portion of the sciatic nerve are both
ligated and severed distal to the ligation.50–52 Most commonly, the common peroneal and tibial branches of the sciatic nerve are severed, leaving the sural nerve intact. The pain phenotype that has been observed is similar across all three models and usually involves thermal hyperalgesia and mechanical allodynia ipsilateral to the injury, with no change contralateral.50,51
As opposed to the role of CaV2.2 channels in acute nociception, the role of CaV2.2 channels in
neuropathic pain is ironclad. Intrathecal application of CaV2.2 channel inhibitors reverses
hyperalgesia and allodynia in chronic constriction injury, spinal nerve ligation, and spared nerve
31,32,53 injury models of chronic pain. Furthermore, a CaV2.2-null mouse strain was resistant to allodynia induced by spinal nerve ligation injury.54 These data suggest a preferential role for
2 CaV2.2 channels in mediating pathological pain compared with normal nociceptive pain.
Inflammatory pain
In contrast to neuropathic pain models, inflammatory pain models aim to induce a robust
immune response to drive neuronal hypersensitivity in the absence of any real injury. To
achieve this, a variety of substances have been used and are generally injected directly into the
hindpaw, to induce cutaneous inflammation, or into a joint as a model of arthritic pain.50
Furthermore, inflammatory pain models can be extended by repeating injections, thereby
- 14 - customizing the duration of the chronic pain state, which is not possible in neuropathic pain models. One of the most common inflammatory agents is formalin.50 When injected into the
hindpaw, formalin elicits a stereotyped biphasic response of spontaneous pain characterized by
prolonged paw licking and paw withdrawals; however, this model is infrequently used to assess
mechanical allodynia or thermal hyperalgesia. Instead, complete Freund’s adjuvant, a
suspension of heat killed Mycobacterium butyricum or Mycobacterium tuberculosum, or
carrageenan, an irritant polysaccharide isolated from seaweed, are more common inflammatory
substances that elicit both hyperalgesia and allodynia for up to 1 week following injection.50
Capsaicin is another irritant that is commonly used to elicit an inflammatory response, but acts
specifically on nociceptors expressing the TRPV1 channel and induces a transient form of
hyperalgesia and allodynia.55
Similar to the role of CaV2.2 channels in neuropathic pain, inhibition of CaV2.2 channels in the
spinal cord reverses symptoms of inflammatory pain. CaV2.2-null mice have a reduced pain response selectively during phase II of formalin-induced pain and intrathecal ziconotide inhibits both phases of formalin induced pain when administered 72 hr prior to injection of formalin.30,47–
49 Intrathecal injection of ziconotide after induction of mechanical allodynia by CFA reverses
allodynia and pre-treatment with intrathecal ziconotide prevents capsaicin-induced allodynia.53,56
Disease related pain
Additional chronic pain models offer less specificity compared with pure neuropathic pain or
pure inflammatory pain models, but better recapitulate the etiology of some forms of pain in
human patients. For example, diabetes is often accompanied by neuropathy and peripheral
diabetic neuropathy can be modeled using injections of the pancreatic β-cell toxin
- 15 - streptozotocin.50 Streptozotocin injection induces hyperglycemia and ketoacidosis along with
hyperalgesia and allodynia. Anti-cancer therapies can also induce pain in cancer patients and
administration of some chemotherapeutic agents, such as oxaliplatin and cisplatin, elicits
hyperalgesia and allodynia in rodents.50 Intrathecal ziconotide has not been tested in rodent
models of disease-related pain, but ziconotide’s effective pain relief in human patients with a
wide variety of chronic pain disorders demonstrates the role of CaV2.2 channels in disease-
related pain.3
Effect of alternative splicing on CaV2.2 channel function
The Cacna1b gene, which encodes the CaV2.2 channel, contains several sites of alternative splicing. Figure 3A indicates sites of alternative splicing mapped onto the protein structure of the
CaV2.2 channel. With one exception, each of these sites is a cassette exon which can either be included or excluded in the mature mRNA during pre-mRNA splicing (Fig 3B). The remaining
site, e37, is a pair of mutually exclusive exons, e37a and e37b, one of which will be included
during splicing (Fig 3B). Our work has focused on two sites, e18a and e37a/b, which
significantly affect CaV2.2 channel function.
Cassette exon e18a modifies cumulative inactivation
Cassette exon e18a is located between exons 18 and 19 of the mammalian Cacna1b gene. In rat, e18a resides within a large 6125 bp intron between e18 and e19 of the Cacna1b gene.57
Previous work from the lab identified a nearly identical cassette exon within the 9775 bp intron between e18 and e19 of the human CACNA1B gene.5 This alternative exon is well conserved
and has been identified in genomic data from chimp, cow, dog, mouse, and chicken with
extremely high sequence similarity, 96.2%, across species.5 Exons 18, 18a, and 19 encode a
- 16 - portion of the intracellular loops connecting homologous domains II and III of the Cav2.2 channel. This region connects channels to sites of synaptic vesicle fusion and is critical for coupling CaV2.2 channels to transmitter release and for targeting channels to presynaptic nerve
58 terminals. Furthermore, this region also regulates cumulative inactivation of Cav2.2 channels in response to stimulus trains.7 Expression of e18a is both anatomically and developmentally
∆18a regulated, but, within DRG, all neurons express CaV2.2 channels and the clear majority
∆18a +18a 5,6,57 express both CaV2.2 and CaV2.2 channels. There does not seem to be preferential
inclusion or exclusion of e18a in capsaicin-sensitive nociceptors, as no difference in splicing
was observed between capsaicin-sensitive (TRPV1-expressing) and capsaicin-insensitive
6 (TRPV1-lacking) DRG neurons. Inclusion of e18a in Cav2.2 protects the channel from inactivation, specifically by reducing closed-state inactivation, and therefore we predict that
+18a calcium flux through CaV2.2 channels during action potential trains will be maintained relative
∆18a 7 to that through CaV2.2 channels.
Mutually exclusive exons e37a and e37b modify sensitivity to µ-opioid inhibition
Mutually exclusive exons e37a and e37b encode alternative regions of the C-terminal tail of the
CaV2.2 channel. The C-terminus of the Cav2.2 channel coordinates various aspects of calcium
channel function, including inactivation, modulation by G-proteins, modulation by calmodulin,
and protein-protein interactions that regulate activity and/or target the channel to specific cellular
5 37b compartments. CaV2.2 channels are expressed ubiquitously throughout the nervous system,
37a 6 but CaV2.2 channels have a significantly restricted expression profile. Expression of e37a is
6 37a primarily restricted to DRG and is enriched in capsaicin-sensitive nociceptors. Cav2.2
37b channels, as compared with Cav2.2 channels, support larger currents in nociceptive neurons
due to greater CaV2.2 channel expression in the cell membrane and longer single-channel open
- 17 -
6,59 37a times. Cav2.2 channels are also more effectively activated by action potential waveforms
37b and allow a greater amount of calcium influx during action potentials compared with Cav2.2 channels. Furthermore, splicing at e37 impacts the efficacy of analgesics that rely on G-protein-
37a mediated inhibition of CaV2.2 channels. Mice that lack expression of Cav2.2 channels are
significantly less sensitive to morphine, but sensitivity to non-G-protein-coupled analgesics
ziconotide and gabapentin are unaffected.32 Specifically, the sequence encoded by e37e
enables greater voltage-independent inhibition, which dominates during periods of high
nociceptor activity.8
Novel mouse lines for assessing effect of splicing on animal behavior
To study the biological impact of alternative splicing decisions, Sylvia Denome in the Lipscombe
lab generated novel mouse strains that express specific splice isoforms of the Cacna1b gene.
37aa* 37b*b Mice that specifically express e37a or e37b, CaV2.2 and CaV2.2 , respectively, have been
8 37aa* described previously. CaV2.2 mice were generated by inserting the sequence for e37a
37b*b directly into the e37b locus, preserving the flanking intronic regions, and, to generate CaV2.2
37b*b mice, the sequence for e37b was inserted into the e37a locus. CaV2.2 mice express WT
37aa* levels of CaV2.2 channels, but CaV2.2 mice express significantly fewer CaV2.2 channels
37b*b 8,57 compared with WT and CaV2.2 mice due to an increase in e37-lacking channels. Sylvia
+18a ∆18a Denome also generated mice that selectively express or lack e18a, CaV2.2 and CaV2.2 strains, respectively. To generate these mice, targeting constructs containing e18-e18a-e19 or e18-e19 were made and inserted into the appropriate region of the Cacna1b gene. In both strains, intronic regions flanking e18a were eliminated (manuscript in revision). To assess the global role of CaV2.2 channels in nociception and pain, Sylvia Denome generated a constitutive
CaV2.2 knockout mouse by inserting a stop sequence in-frame into exon 1 of the Cacna1b gene.
Each mouse strain selecting specific CaV2.2 channel splice isoforms is shown in Figure 4.
- 18 -
The remainder of this thesis describes my work assessing the role of CaV2.2 channels and
alternative splice isoforms of the CaV2.2 channel to acute and inflammatory nociception.
Chapter 2 describes our strategy for targeting nociceptors for both in vivo and in vitro analyses
-/- of nociceptor function. Chapter 3 describes experiments utilizing our CaV2.2 mouse strain and
demonstrates that CaV2.2 channels are critical for function of both central and peripheral nociceptor terminals. In Chapter 4, we describe attempts to utilize optogenetics to induce hyperalgesia in the absence of nerve injury or inflammation and, in Chapter 5, we describe experiments evaluating nociceptor function in splice isoform selective mouse strains.
- 19 -
Figure 1. Inhibitors of CaV2.2 channel activity provide analgesia. Morphine, ziconotide, and gabapentin provide analgesia by reducing CaV2.2 channel activity. Morphine binds to the G- protein coupled µ-opioid receptor which inhibits CaV2.2 channels via the Gβγ-subunit. Ziconotide (Prialt®, ω−conotoxin MVIIA, SNX- 111) directly binds to the CaV2.2 channel α-subunit and blocks the channel pore, preventing calcium entry. Gabapentin can bind to the CaV2.2 channel α2δ1-accessory subunit and likely regulates channel trafficking and expression at the plasma membrane.32
- 20 -
Figure 2. Nociception and pain circuitry. (a) The pain pathway from peripheral detection to central perception. Stimuli are detected by primary sensory neurons (1) that innervate the skin, joints, and viscera. Sensory neurons encode stimulus features and relay that information to neurons in the spinal cord dorsal horn. Dorsal horn projection neurons (2) carry information up to brain relay centers (3) such as the thalamus and the parabrachial nucleus. Relay centers transmit sensory information to cortical areas (4), including the amygdala and somatosensory cortex, where perception is generated. (b) Detailed anatomy of the spinal cord dorsal horn. The spinal cord dorsal horn is organized into layers based on cytoarchitecture and type of sensory input. Noxious input (solid line) is primarily relayed to superficial layers and non-noxious input (dashed line) is relayed to deeper layers. Projection neurons (P.N.) are the primary output of the spinal cord to the brain and distinct pools of projection neurons are located in lamina I and III-V. Projection neurons in lamina I receive monosynaptic sensory input primarily from nociceptors, whereas projection neurons in lamina III-V receive monosynaptic sensory input primarily from non-nociceptive neurons. Lamina II is comprised entirely of local interneurons that integrate and modulate sensory information in the spinal cord. Excitatory interneurons (E.I., green) receive sensory input from both nociceptors and non-nociceptive neurons and function to spread sensory information throughout the dorsal horn. Inhibitory interneurons (I.I., red) can act as a gate and allow incoming non-noxious stimuli to effectively silence ongoing signaling to lamina I projection neurons.
- 21 -
Figure 3. The Cacna1b gene is subject to extensive alternative splicing. (a) Schematic diagram of the CaV2.2 α-subunit protein structure indicating sites that are encoded by alternatively spliced exons (filled circles). Transmembrane regions are shown as filled cylinders and linker sequences as lines. Our work has focused primarily on two sites of alternative splicing: cassette exon 18a (cyan) and a pair of mutually exclusive exons 37a (yellow) and 37b (magenta). (b) Potential outcomes of alternative splicing at exon 18a (top) and 37 (bottom). Exons are indicated by the filled rectangles with the exon number indicated. Exon 18a can either be included in or excluded from the mature mRNA during splicing of the Cacna1b pre-mRNA. Either e37a or e37b will be included in the mature Cacna1b mRNA. Transcripts containing both exons (e37a AND e37b) or neither exon (e37a NOR e37b) are rare.8
- 22 -
Figure 4. Novel mouse strains for analysis of Cacna1b splice isoform contribution to nociceptor function. Several novel mouse strains were generated and combined to allow for 1) targeting of nociceptors, 2) expression of ChR2-EYFP for identification and manipulation of nociceptors, and 3) manipulation of Cacna1b gene expression and splicing at exons 18a and 37a/b. For each Trpv1-Cre/ChR2-EYFP mouse strain indicated, Trpv1-Cre mice with the indicated Cacna1b isoform (WT, null, 37aa*, 37b*b, +18a, or ∆18a) were bred to ChR2-EYFP mice expressing the same Cacna1b isoform, as indicated for Cacna1bWT mice. Bi-directional arrows (a-c) indicate comparisons assessing the role of CaV2.2 channels in nociceptors(a), the effect of alternative splicing at exon 37 on nociceptor function (b), and the effect of alternative splicing at exon 18a on nociceptor function (c).
- 23 -
CHAPTER 2
Targeting Trpv1-lineage sensory neurons for in vivo and in vitro analyses Introduction
The overall goal of this project is to assess the role of CaV2.2 channels and splice isoforms of
CaV2.2 channels in nociceptor function and in pain-related behaviors. In order to correlate in vitro assessments of nociceptor function with in vivo assessment of pain behavior, it is necessary to be able to targeted a single population of nociceptors across preparations.
Somatosensory neurons are highly heterogenous and many of the features that are used to define nociceptors—small diameter cell body, slow axonal conduction velocity, unmyelinated axons, peripheral free nerve endings, central terminations in superficial dorsal horn—are of limited utility for targeting nociceptors across in vivo and in vitro preparations. Fortunately,
optogenetic techniques have proven useful in other labs for targeting genetically identified
somatosensory neurons in both in vivo and in vitro experiments.60–62 We chose to target TRPV1-
expressing somatosensory neurons because TRPV1 is a classical marker of nociceptive
neurons and a knock-in mouse line expressing Cre-recombinase from the Trpv1 locus had been
generated previously.63,64 We then crossed this Trpv1-Cre mouse strain into previously
-/- generated mouse strains which lack CaV2.2 channels (CaV2.2 ) or constitutively express
37aa* 37b*b +18a ∆18a specific splice isoforms of the CaV2.2 channel (CaV2.2 , CaV2.2 , CaV2.2 , CaV2.2 ).
In this research, we utilize Trpv1-Cre mice to express the light-activated ion channel channelrhodopsin (ChR2H134R-EYFP, hereafter ChR2-EYFP) in a subset of somatosensory
neurons. The Trpv1 (Transient Receptor Potential, Vanilloid type 1) gene is highly expressed in
a subset of nociceptors and encodes a cation channel that is sensitive to heat, acid, and the
chemical capsaicin.65 The Trpv1-Cre mouse strain was generated previously by knocking-in an
IRES-Cre sequence immediately downstream of the endogenous Trpv1 coding sequence.63,64 In
this Trpv1-Cre mouse strain, Trpv1 expression is maintained and the Cre-recombinase coding
sequence does not interrupt the Trpv1 coding sequence.62–64 Cre-recombinase expression
- 25 - provides the ability to manipulate gene expression in a cell-type specific manner using Cre- dependent reporter genes.
The method used to introduce Cre-dependent reporter genes into Cre-expressing mouse strains influences the expression pattern, consistency, and strength. Cre-dependent reporter genes can be packaged into viral vectors and directly injected into Cre-expressing mice. By contrast, transgenic mouse strains harboring Cre-dependent reporter genes can be crossed with Cre- expressing mouse strains. Viral reporter gene transduction provides greater temporal specificity, but spatial consistency varies and reporter expression levels depend on gene copy number, which will vary across cells and injections. By contrast, knock-in reporter mouse strains provide consistent expression levels in consistent populations of cells, but lack temporal specificity.
Temporal specificity can be improved by utilizing conditional Cre-recombinase alleles, but the
Trpv1-Cre mouse strain used here is not conditional. We choose to utilize knock-in Cre-
dependent reporter mouse strains for the work described here to take advantage of highly
consistent reporter expression.
As mentioned previously, our long-term goal is to use this Trpv1-Cre mouse strain and a Cre-
66 dependent ChR2-EYFP mouse strain to evaluate the contribution of CaV2.2 channels and
specific splice isoforms the CaV2.2 channel to nociceptor function and pain behavior. To achieve
this, we individually crossed each CaV2.2-channel mutant mouse strain (mentioned above and diagrammed in Figure 4) to the Trpv1-Cre and ChR2-EYFP mouse strains and used first
mutant generation CaV2.2 /Trpv1/ChR2-EYFP triple transgenic mice in all experiments. In this chapter, I confirm aspects of and expand on the original characterization of Cre-recombinase expression in the DRG of a Trpv1-Cre knock-in mouse strain using single-cell patch clamp
- 26 - electrophysiology and population level imaging analyses.63,64 As expected, I show that Trpv1-
Cre reporters are expressed more broadly than ongoing Trpv1 expression in adolescent and
adult mice, that Trvp1-Cre-expressing neurons are functionally heterogeneous, but that the
majority of Trpv1-Cre-expressing neurons are nociceptors. Furthermore, I demonstrate that the
Trpv1/ChR2-EYFP mouse strain is a useful tool for both in vivo behavioral analyses of
nociception and in vitro physiological analyses of synaptic function within a genetically-identified
population of sensory neurons.
Results
Trpv1 mRNA expression is restricted to a subset of Trpv1-Cre sensory neurons in dorsal root
ganglia
Knock-in mouse strains are ideal for achieving highly reproducible gene expression within
genetically identified neurons, but accurate data interpretation requires validation of reporter
expression. To assess Trpv1-Cre expression relative to ongoing Trpv1 expression, we used
RNAScope® in situ hybridization to detect Trpv1 mRNA within sensory neurons of dorsal root
ganglia from wild-type (WT) mice and find robust expression of Trpv1 (Figure 5A). To confirm
Trpv1 probe specificity, we isolated DRG from Trpv1-/- animals and, as expected, observed no
signal (Figure 5A), indicating that the signal observed in the WT DRG does not reflect non-
specific binding of the probe to non-Trpv1 mRNA.
We next used RNAScope® to examine Trpv1 mRNA expression within the Trpv1-Cre mouse
strain using the fluorescent protein TdTomato (TdT) as a marker of Cre expression. As shown in
Figure 5B, Trpv1/TdT expression is broader than Trpv1 mRNA expression. The Trpv1 mRNA
signal, however, is restricted to TdT-expressing cells, indicating that Cre-recombinase is
- 27 - expressed in all cells that have ongoing expression of the Trpv1 gene. The discrepancy between ongoing Trpv1 mRNA expression and Trpv1/TdT expression is expected based on previous findings63,64 and likely reflects prior transient expression of Trpv1 within these cells. As
such, for the remainder of this work, I will refer to Trpv1-Cre expressing neurons as Trpv1-
lineage neurons. Although Trpv1-lineage neurons are more broad than Trpv1-expressing
neurons, they are a subset of sensory neurons that can be reproducibly interrogated. To better
understand the kinds of neurons that are identified in this mouse strain, we used more in-depth
analyses to classify Trpv1-lineage neurons.
Trpv1-lineage neurons segregate into four functionally distinct classes
Sensory neurons respond to diverse stimuli and they express distinct complements of ion
channels which can be used to divide them into functionally different groups. TRPV1 channels
are enriched in nociceptors and functional TRPV1 expression is defined by capsaicin-
65 responsiveness. The presence of low-voltage activated CaV3 channels, by contrast, is a functional marker of non-nociceptive LTMRs.67,68 We therefore used whole cell voltage-clamp
electrophysiology to characterize dissociated DRG neurons from Trpv1/ChR2-EYFP mice based
on the presence of TRPV1 and CaV3 channel currents (Figure 6A). We measured LED-induced
ChR2-EYFP currents, CaV3 currents evoked by voltage step depolarizations, TRPV1 currents evoked by capsaicin application, and membrane capacitance as a proxy for cell size, sequentially each of 77 individual sensory neurons (Figure 6B).
All Trpv1-lineage cells (n = 65 cells) exhibited light-activated currents, whereas non-Trpv1- lineage cells (n = 12 cells) did not, confirming that ChR2-EYFP is linked exclusively to Trpv1
- 28 - expression. TRPV1, CaV3, and ChR2-EYFP channel expression in all 77 neurons analyzed is summarized in Figure 6B.
To identify functionally homogeneous subpopulations of Trpv1-lineages neurons, we used unbiased clustering to sort 65 Trpv1-lineage cells into n groups based on soma size
(capacitance), capsaicin-evoked current density, and CaV3 current density. We used two
different clustering strategies (see Materials and Methods for a detailed description of clustering
strategies) that clustered cells into four groups (Figure 6C, 6D) and most cells (68%, n = 44/65)
were sorted into equivalent clusters in each strategy. Only unambiguously sorted cells were
used to assess differences between cluster properties.
One cluster of cells (Cluster #3) was characterized by the presence of capsaicin-evoked
currents, the absence of CaV3 currents, and small size (Figure 6C, 6D). A second cluster
expressed CaV3 currents (Cluster #2), lacked capsaicin responses, and had somewhat larger
cell bodies (Figure 6C, 6D). The remaining two populations (Clusters #1 and #4) both lacked
CaV3 currents and a capsaicin response, but differed in cell body size. Cells in cluster #4 had
larger cell bodies than those in cluster #1 (Figure 6C, 6D; p = 2.9*10-9, Table 1). Based on these
properties and published analyses of identified neuronal populations, we can assign identities to
the neurons within each cluster: Cluster #1 likely corresponds to C-fiber, non-peptidergic
nociceptors; cluster #2 to Aδ-fiber LTMRs; cluster #3 to C-fiber, peptidergic nociceptors; and
cluster #4 to mixed Aβ/Aδ-fiber LTMRs. To assess the relative size of each cluster within the
entire Trpv1-lineage population, we imaged and analyzed tissue sections of DRG, skin, and
spinal cord.
- 29 -
TRPV1-lineage neurons are principally nociceptors that terminate as free nerve endings in
hindpaw skin and project predominantly to superficial laminae of spinal cord dorsal horn
To complement our single cell functional analysis of the Trpv1-lineage neuron population, we
used imaging to visualize Trpv1-lineage neurons in DRG. In total, Trpv1-lineage neurons
account for approximately 65% of all DRG neurons (n = 2389 / 3647 cells, Figure 7A). We used
CGRP expression to identify peptidergic nociceptors (neurons in cluster #3), IB4 binding to
identify non-peptidergic nociceptors (neurons in cluster #1), and neurofilament heavy chain
(NF200) expression to identify non-nociceptive neurons with myelinated axons (neurons in
clusters #2 and #4). We assessed the proportion of Trpv1-lineage neurons within each
population (Figure 7B) and the contribution of each population to the Trpv1-lineage (Figure 7C).
As expected, the vast majority of IB4-binding non-peptidergic nociceptors (82.9%) and CGRP
expressing peptidergic nociceptors (84.1%) are from the Trpv1-lineage. A relatively small
percentage of NF200-expressing non-nociceptive neurons (39.7%) is from the Trpv1-lineage,
suggesting that Trpv1 is transiently expressed in non-nociceptive neurons early in
development.63 Within the Trpv1-lineage, nociceptors are the majority (78.7% CGRP and/or
IB4), and a very small percentage of Trpv1-lineage neurons expresses NF200 (8.5%). These
three markers account for 94.3% of Trpv1-lineage neurons, but there is substantial overlap
between IB4 binding and expression of CGRP (20.4% of Trpv1-lineage neurons) or NF200
(7.2% of Trpv1-lineage neurons). Classification of Trpv1-lineage DRG neurons using imaging
analyses generally agrees with our functional analyses. CGRP expressing neurons correspond
to cluster #3 neurons and IB4-binding neurons correspond to cluster #1 neurons, whereas
NF200 expressing neurons encompass clusters #2 and #4.
Sensory neurons innervate both the skin and the spinal cord and properties of these peripheral
and central terminations can be used to identify and classify sensory neurons. Nociceptors form
- 30 - free nerve endings in the epidermis and terminate in superficial layers of the spinal cord dorsal horn (I-II), whereas LTMRs form circumferential nerve endings associated with hair follicles and terminate in deeper layers of the spinal cord dorsal horn (II-V). In hindpaw skin, we observed dense innervation of the epidermis by Trpv1-lineage neurons and showed that these axonal fibers co-express CGRP, confirming that they are nociceptor free nerve endings (Figure 7D).
Due to the presence of LTMR features in some Trpv1-lineage sensory neurons (Figure 6), we hypothesized that terminations of Trpv1-lineage neurons may also associate with hair follicles in hairy skin. Indeed, in sections of hairy skin from Trpv1/TdT mice, Trpv1-lineage free nerve endings densely innervated the epidermis and formed circumferential endings associated with hair follicles (Figure 7E). Epidermal free nerve endings co-expressed CGRP whereas
circumferential endings did not (Figure 7E). In spinal cord slices from Trpv1/ChR2-EYFP or
Trpv1/TdT mouse strains, reporter expression was restricted to pre-synaptic afferents and was
not observed in somata in the dorsal horn (Figure 7F). Trpv1-lineage afferents were
concentrated in superficial dorsal horn and absent from deep dorsal and ventral horns (Figure
7F, inset). We used CGRP expression (lamina I) and IB4 binding (lamina II) to delineate areas
of nociceptive fiber input and found TdT signal highly enriched in these areas, with lower
intensity in the outermost portion of lamina III (Figure 7G). Our data are consistent with the
expression pattern of cytoplasmic EYFP or lacZ reporters in the original descriptions of the
Trpv1-Cre line63,64 and suggest that the Trpv1-lineage neuron population contains both
nociceptive and non-nociceptive neurons, but, in the hindpaw, Trpv1-lineage neurons
exclusively form nociceptor free nerve endings.
By combining high-resolution, single-cell functional assessments with imaging analyses of DRG,
SC, and skin, we have thoroughly demonstrated that Trpv1-lineage sensory neurons are a
subpopulation of somatosensory neurons that is enriched in nociceptors, forms nociceptor free
- 31 - nerve endings in the plantar hindpaw, and carries sensory information to superficial laminae of the spinal cord dorsal horn. To verify using functional methods that Trpv1-lineage afferent fibers carry information to the spinal cord dorsal horn, we used whole cell electrophysiology to record synaptic currents in acute spinal cord slices.
Optical activation of Trpv1-lineage afferent fibers in acute spinal cord slices elicits synaptic currents in lamina II neurons
The power of applying optogenetics to the spinal cord lies in the ability to depolarize genetically identified neurons that cannot be readily isolated and stimulated with traditional methods.
Having thoroughly characterized genetically-identified Trpv1-lineage population, we next sought to verify that blue light activation of Trpv1-lineage afferent fibers in acute slices of spinal cord
drives synaptic activity. To achieve this, we used whole cell patch clamp electrophysiology to
record light-evoked currents in lamina II neurons (Figure 8) in acute spinal cord slices from
Trpv1/ChR2-EYFP mice. Lamina II was identified based on its relatively high luminance under
DIC illumination. Trpv1-lineage afferent fibers were activated using a 1 ms pulse of blue light
focused directly over the patched cell through the 40x microscope objective and controlled by a
shutter.
Blue light elicited apparently monosynaptic excitatory post-synaptic currents (EPSCs) and
application of DNQX, an AMPA-type glutamate receptor blocker, completely blocked the light-
evoked response (Figure 8B, 8C). The finding that DNQX completely inhibited the light-evoked
response in a sample of 12 neurons, along with our previous imaging data, strongly suggests
that ChR2-EYFP elicits synaptic responses in the spinal cord dorsal horn via activation of Trpv1-
lineage neurons.
- 32 -
We next used light to activate ChR2 in epidermal nociceptor terminals to directly activate Trpv1- lineage neurons in awake mice.
Remote light stimulation of TRPV1/ChR2-EYFP mouse hindpaws evokes acute nocifensive responses
Mice respond to noxious stimuli in much the same way as humans: they reflexively withdraw from the stimulus. Nociceptor stimulation activates a reflex circuit in the spinal cord, which in turn signals to muscles to withdraw the affected limb from the stimulus, and sends stimulus information up to the brain where a conscious perception of the stimulus is formed. To understand if direct activation of Trpv1-lineage neurons drives this response in the absence of a physical stimulus, we exposed the hindpaws of male and female mice to blue light (465 nm) from a fiber-coupled LED. Trpv1/ChR2-EYFP mice responded to light stimulation by immediate
(latency <1 sec) hindpaw withdrawal, followed by prolonged licking of the stimulated area.
Trpv1/TdT mice never responded to hindpaw stimulation by maximum intensity LED light (1 mW/mm2). We generated a light intensity-response curve demonstrating the broad range of light
intensities at which nocifensive responses can be elicited (Figure 9A).
To verify that expression of ChR2-EYFP in Trpv1-lineage neurons does not impair normal function, we used two assays to measure sensitivity to thermal stimuli: Hargreaves’ radiant heat assay and the hotplate assay. Latency to paw withdrawal is inversely correlated with sensitivity
(faster responses indicate higher sensitivity) and response latencies of Trpv1/ChR2-EYFP mice were indistinguishable from Trpv1/TdT control mice (Figure 9C). Because the radiant heat
assay uses a high-intensity white light to induce heating of the hindpaw, we applied an orange-
pass filter to the heat source to prevent direct activation of ChR2-EYFP by blue light (Figure
- 33 -
9B). Together, our behavioral results demonstrate that activation of Trpv1-lineage neurons in vivo is sufficient to induce robust nocifensive paw withdrawal responses and does not impair the normal function of Trpv1-lineage nociceptors.
Discussion
In this study, we characterized a novel Trpv1/ChR2-EYFP mouse strain, allowing for light-
dependent activation of Trpv1-lineage neurons in vitro to activate nociceptor synapses in acute
spinal cord slices and in vivo to elicit nocifensive paw withdrawal responses. We thoroughly
characterized the Trpv1-lineage population and conclude that Trpv1-lineage sensory neurons are functionally heterogeneous, but the majority are nociceptors and a relatively small proportion are LTMRs. In the plantar skin of the hindpaw, Trpv1-lineage afferent fibers are exclusively free nerve endings that express CGRP. Based on these assessments, we conclude that the Trpv1/ChR2-EYFP mouse strain is a powerful tool that allows us to assess the role of
CaV2.2 channels and alternative splice isoforms of the CaV2.2 channel in identified nociceptors.
Trpv1-Cre expression is more broad than ongoing Trpv1 expression
TRPV1 is a non-specific cation channel that opens in response to intense heat, acidic pH, and noxious chemicals, such as capsaicin.65 Expression of TRPV1 in sensory neurons confers
temperature sensitivity and defines thermosensitive, peptidergic nociceptors.65 Previously, it
was found that neurons expressing the Trpv1 gene also express a e37a-containing CaV2.2
6 splice isoform. To assess the contribution of e37a-containing CaV2.2 channels to nociceptor function, we used a Trpv1-Cre mouse strain to target the Trpv1-expressing population of nociceptors. Using both an RNA-based imaging technique and a protein based functional readout of Trpv1 expression, we find that Trpv1-Cre reporter expression is more broad than
- 34 - ongoing Trvp1 expression, as expected based on previous studies.62–64 The reason for this is
clear; once the Trpv1 gene is activated and Cre-recombinase is expressed, the Cre-dependent
reporter is permanently activated, even if the Trpv1 gene is subsequently turned off. It has been
shown previously that the Trpv1 gene is activated in a broad population of neurons early in
development before being refined to a subset of nociceptors later in development.63 Although
the Trpv1/ChR2-EYFP mouse strain described here does not accurately represent ongoing
Trpv1 gene expression, it is a robust tool for targeting a subpopulation of sensory neurons
dominated by nociceptors.
Trpv1-lineage neurons are predominantly nociceptors
Consistent with the original description of the Trpv1-Cre mouse strain63,64, we confirm, by
several different approaches, that Cre-recombinase is expressed in the majority of nociceptors
in the Trpv1-Cre mouse strain. We find Cre-reporter expression: in neuronal cell bodies and
termini co-expressing CGRP, which defines peptidergic nociceptors (Figure 7B, 7D)69,70; in
neurons that bind IB4, which defines a subset of non-peptidergic nociceptors (Figure 7B)71; in sensory neuron afferent fibers that provide input to lamina I and II of the spinal cord dorsal horn
(Figure 7F, 7G); in free nerve endings in the epidermis of glabrous and hairy skin (Figure 7D,
7E); in TRPV1-expressing neurons based on overlap with capsaicin-activated currents (Figure
6B); and in small diameter sensory neurons from the dorsal root ganglia (Figure 6D). The Trpv1-
lineage population also contains a subset of LTMRs based on Cre-reporter: co-expression with
68 CaV3-mediated currents (Figure 6D) ; expression in lanceolate termini associated with hair follicles in hairy skin (Figure 7E); and co-expression with neurofilament heavy chain which identifies neurons with myelinated axons that are unlikely to be nociceptors (Figure 7B)72. Based
on imaging analyses of DRG slices, Trpv1-lineage nociceptors far out-number Trpv1-lineage
non-nociceptive neurons and non-nociceptive Trpv1-lineage neurons are restricted to hairy skin.
- 35 -
Trpv1/ChR2-EYFP mice allow for in vivo and in vitro activation of Trpv1-lineage nociceptors
Optogenetics has gained wide popularity for its ability to activate identified populations of neurons across preparations. Here, we show that Trpv1/ChR2-EYFP mice allow for activation of nociceptors in vivo and in vitro, allowing assessments of both nocifensive behavior and synaptic function. The behavioral assay described here utilizing blue light to directly activate nociceptors offers several advantages compared with traditional nociception assays. The behavioral responses of Trpv1/ChR2-EYFP mice to hotplate, radiant heat, or LED light stimulation were qualitatively similar, but LED light stimulation can be used to assess a range of stimulus intensities and to measure nociceptive thresholds, which is not possible with the hotplate or radiant heat assays. Furthermore, in the Hargreaves radiant heat assay, different populations of nociceptors are recruited depending on the rate of skin heating: fast heating yields a 2-3 second response latency, preferentially recruiting Aδ-nociceptors; whereas slow heating yields a 12-14 second response latency, preferentially recruiting C-nociceptors.73 By contrast, LED stimulation
of Trpv1-lineage neurons consistently and simultaneously activates both populations.
In conclusion, the Trpv1/ChR2-EYFP mouse strain is a robust model to assess the behavioral
consequences of direct nociceptor activation, as well as the synaptic connections of a similar
population of sensory neurons in acute spinal cord slices. In the following chapters, we use this
mouse strain as a tool to study the role of CaV2.2 channels in nociceptor function and pain
(Chapter 3), the contribution of prolonged nociceptor activation to hyperalgesia (Chapter 4), and the role of CaV2.2 channel splice isoforms to nociceptor function (Chapter 5).
- 36 -
Figure 5. Trpv1 expression, assessed by RNA in situ hybridization, is restricted to a subset of Trpv1-lineage neurons. (a) Trpv1 probes detect Trpv1 mRNA in DRG from WT mice and have no off- target binding in DRG from mice lacking expression of Trpv1. Trpv1 mRNA signal is shown as magenta dots with grayscale DIC image indicating neuronal cell bodies. (b) In dorsal root ganglia from Trpv1/TdT mice, Trpv1 expression is restricted to Trpv1-lineage neurons, but TdT expression is more broad than Trpv1 mRNA. Left Overlay of Trpv1/TdT (magenta) and Trpv1 mRNA (yellow) shown with grayscale DIC image indicating neuronal cell bodies. Right Individual grayscale images of Trpv1 mRNA (top) and TdT (bottom). Arrowheads indicate cells expressing TdT only and arrows indicate cells expressing both TdT and Trpv1. All scale bars represent 25 µm.
- 37 -
Figure 6. Trpv1-lineage neurons in dissociated DRG display heterogeneous functional properties and can be classified into four groups. (a) Currents through TRPV1, CaV, and ChR2-EYFP ion channels were recorded in dissociated DRG neurons using whole-cell patch clamp electrophysiology. ChR2-EYFP channels were activated by blue light; Trpv1 channels were activated by capsaicin; CaV channels were activated by voltage steps of increasing amplitude. Currents through CaV3 channels were identified based on the low voltage of activation (black trace), whereas high-voltage activated currents (gray trace) reflect mixed contributions of CaV1 and CaV2 channels. (b) 77 DRG neurons analyzed for expression of ChR2-EYFP (green), TRPV1 (red) and CaV3 (blue) channels. Each square represents one cell and cells expressing multiple channels are indicated by mixing the appropriate colors, with cells expressing all three channels indicated in white and cells expressing none of the three channels indicated in black. (c) Unbiased cluster analysis was used to sort 65 Trpv1-lineage cells, indicated by expression of ChR2-EYFP, into 4 clusters (#1-cyan, #2-yellow, #3-magenta, #4- gray) based on cell capacitance, capsaicin response amplitude (normalized to cell size), and low-voltage activated (LVA) current amplitude (as a percentage of high-voltage activated (HVA) current amplitude). Two different clustering methods were used and cells that were sorted into different clusters were used to assess similarity between clusters. Cluster #3 is the most distinct whereas clusters #2 and #4 are the most similar. (d) Differences between clusters along the three different parameters used for clustering: capsaicin response amplitude (left), LVA calcium current (middle), and cell capacitance (right). Statistics shown in Table 1.
- 38 -
Statistical analysis of data shown in Figure 6D. Significant differences between unbiased clusters (see Materials and Methods, Cell clustering analysis) were determined by one-way ANOVA. Top: Interquartile range (IQR) was used to identify significant outliers. Outlying values were excluded from analysis if y ≤ Q1-(3*IQR) or y ≥ Q3+(3*IQR). Middle: There are significant differences (small p-values), in cell capacitance, LVA current ratio, and capsaicin response density among cell clusters. Bottom: All possible pairwise comparisons of clusters were assessed. The Dunnett T3 method was used to correct for multiple comparisons of capsaicin response measures because of the non-homogeneity of group variances. The Tukey Honestly Significant Difference (HSD) method was used to correct for multiple comparisons of capacitance and LVA current measurements among groups because the homogeneity of group variances assumption is met.
- 39 -
Figure 7. Trpv1-lineage neurons are nociceptors that innervate hindpaw skin and superficial dorsal horn. (a-c) Quantification of Trpv1-lineage neurons in whole DRG (a), Trpv1-lineage neurons in established neuronal subtypes (b), and subpopulations of neuronal subtypes within Trpv1-lineage neurons (c). Numbers in parentheses indicate total numbers of cells per group and numbers in bars indicate percentages of total. Scale bars (b) represent 25 μm. (d) Left Overlay showing TdT-expressing (magenta) free nerve endings with CGRP (yellow). Nuclei are identified by DAPI (blue). Right Grayscale images showing Trpv1/TdT (top) and CGRP (bottom) signals independently. Scale bars represent 25 µm. (e) Left Overlay showing that TdT-expressing circumferential and lanceolate endings (red) do not co-express CGRP (green). Nuclei are identified by DAPI stain (blue). Right Individual grayscale images showing CGRP (top) and TdT (bottom) expression in scalp skin. Scale bars represent 25 µm. (f) Transverse section of lumbar spinal cord dorsal horn from WT/Trpv1/ChR2-EYFP mouse showing ChR2-EYFP (yellow) and IB4 (magenta) to identify lamina II. Inset: grayscale image of whole spinal cord section from WT/Trpv1/ChR2-EYFP mouse showing reporter expression restricted to dorsal horns. Scale bars represent 100 µm. (g) Left Overlay showing Trpv1/TdT (red), CGRP (green), and IB4 (blue) in spinal cord dorsal horn. Arrow indicates location and direction for quantification of signal intensity and dashed lines divide laminae. Right Quantification of fluorescence intensity of TdT signal (red) along with CGRP (top, green) and IB4 (bottom, blue). Dashed gray lines indicate edge of slice and divisions between laminae I-II and II-III. Scale bars represent 50 µm.
- 40 -
Figure 8. Optogenetic activation of Trpv1-lineage afferent fibers elicits synaptic currents in lamina II neurons. (a) DIC image showing recording setup with patch electrode sealed onto a lamina II neuron. Laminae are indicated along the bottom of the image with arrowheads indicating lamina borders. Lamina II is identified by high translucence in DIC imaging. (b) Synaptic currents recorded in lamina II neurons by activation of Trpv1-lineage afferent fibers by blue LED light in the absence (gray) and presence (red) of DNQX (10 µm). Scale bars represent 50 ms and 100 pA. (c) Time course of DNQX inhibition of light-evoked synaptic currents. Synaptic currents were elicited every 30s by a 1 ms pulse of blue light. Graph shows means ± standard error black) and individual response amplitudes normalized to largest peak amplitude of each cell (gray) (n = 8 cells).
- 41 -
Figure 9. ChR2-EYFP expression allows for direct activation of nocifensive responses by blue light without altering thermal sensitivity. (a) Remote stimulation of the hindpaws of Trpv1/ChR2-EYFP mice with blue LED light elicits a nocifensive response. Trpv1/TdT mice never respond to light stimulation (not shown). Each point represents average of 12 mice and shaded area reflects standard error. Curve is a four- parameter logistic curve constructed using average values for minimum (- 0.23 ± 1.12 responses), maximum (12.78 ± 4.84 responses), EC50 (5.15 ± 1.38 mW), and Hill-slope (2.68 ±1.46). (b) Transmittance of light through an orange-pass filter measured at different wavelengths with a UV-Vis spectrophotometer (orange points and lines). ChR2-EYFP activation spectrum re-plotted from data in Lin et al., 2009 (black dotted line). An orange-pass filter blocks blue light but passes red and infrared light, validating the use of an orange-pass filter in the radiant heat assay to avoid ChR2-EYFP activation. (c) Response latencies to thermal stimuli using either the radiant heat assay (left) or the hotplate assay (right) in Trpv1/ChR2 and Trpv1/TdT mice. Each point signifies an individual mouse shown with average and standard error as horizontal line and shaded area, respectively. Avg ± s.e. and significance as assessed by Univariate ANOVA are for radiant heat assay (Trpv1/ChR2: 18.36 ± 1.16 s, Trpv1/TdT: 14.44 ± 1.73 s, p = 0.070) and for hotplate assay (Trpv1/ChR2: 11.85 ± 0.69 s, Trpv1/TdT: 11.78 ± 1.04 s, p = 0.954).
- 42 -
CHAPTER 3
Role of CaV2.2 channels in nocifensive behavior, nociceptor function, and synaptic activity in spinal cord dorsal horn Introduction
CaV2.2 (N-type) voltage-gated calcium channels are the primary source of calcium that elicits neurotransmitter release from nociceptor terminals in the spinal cord dorsal horn. Inhibition of
CaV2.2 channels at central nociceptor terminals in the spinal cord relieves pain in humans and
30,31 rodents by reducing nociceptor input to the spinal cord. CaV2.2 channels are also expressed at nociceptor soma in the DRG and in peripheral structures, such as the sciatic nerve, but their
8,38 function in these locations is unclear. Calcium influx through CaV2.2 channels mediates
release of classic fast-acting and slower acting peptidergic neurotransmitters and activates
20,37,74,75 calcium-sensitive SK and BK potassium channels and neuropeptide release. CaV2.2
channels may, therefore, contribute to nociceptor excitability, influence the time course of
nociceptor action potentials, and participate in induction and maintenance of neurogenic
-/- inflammation. Here, we use a CaV2.2 mouse strain to show that functional CaV2.2 channels in the skin are essential for the development of inflammatory hyperalgesia.
CaV2.2 channels are considered interesting targets for novel analgesics because of their
importance in transmission of painful stimuli.76,77 Ziconotide (Prialt®, ω-conotoxin MVIIA, SNX-
111) is the only direct CaV2.2 channel inhibitor approved for treatment of chronic, intractable pain in humans;31 however, its utility is limited by severe side-effects, a narrow therapeutic
window, and the invasive intrathecal route of delivery. Intrathecal delivery is required to avoid
block of sympathetic tone and the narrow therapeutic window of intrathecal ziconotide probably
77 arises from inhibition of CaV2.2 channels in other cell-types within the spinal cord and brain.
Other analgesics, such as morphine and gabapentin, also inhibit CaV2.2 channel activity but their actions are indirect via G-protein coupled receptors or accessory subunits of the CaV2.2 channel complex, respectively.32 The side-effects and tolerance of opioids are well appreciated
- 44 - and gabapentin is only effective for a subset of patients; therefore, there is a demonstrable need for new, non-addictive, broadly effective analgesics to treat chronic pain conditions.
In this study, we determine the role of CaV2.2 channels in nociception and inflammatory
hyperalgesia in spinal cord, DRG and skin applying behavioral, pharmacological, and
electrophysiological approaches. We show that mice lacking CaV2.2 channels are less sensitive
to thermal and mechanical stimuli in behavioral assays and that function of nociceptor pre-
synaptic terminals in the spinal cord is impaired. We discover that CaV2.2 channels in skin are essential for inflammatory hyperalgesia. From these data, we conclude that CaV2.2 channels are critical components of both peripheral and central nociceptor terminals, but that their role in inflammatory hyperalgesia in skin is major. We suggest that inhibitors of CaV2.2 channels in skin could represent a new class of analgesics to prevent hyperalgesia.
Results
CaV2.2 channels are needed for maximum sensitivity to noxious stimuli
CaV2.2 is the dominant class of high voltage-gated CaV channel expressed in nociceptors, but
results from studies assessing their role in acute nocifensive behavior in mice are
4,30,31,48,49,54 -/- inconsistent. We therefore generated a CaV2.2 mouse strain by homologous
-/- recombination (Figure 10A-10C) to test the sensitivity of wild-type (WT) and CaV2.2 mice to
acute thermal, mechanical, and optogenetic stimuli (Figure 10D).
-/- Response latencies to thermal stimuli were somewhat longer in CaV2.2 mice (10.39 ± 0.76 s, n
-/- = 8 mice) compared with WT control mice (7.63 ± 0.45 s, n = 8 mice) and CaV2.2 mice tended
- 45 - to have slightly higher mechanical paw withdrawal thresholds (WT: 0.58 ± 0.07 g, n = 8 mice;
-/- CaV2.2 : 0.99 ± 0.20 g, n = 8 mice).
We next used an optogenetic approach to measure the contribution of CaV2.2 channels to behaviors induced by activating a genetically-identified nociceptor population directly. We
-/- generated WT and CaV2.2 mouse strains that express ChR2-EYFP in Trpv1-lineage neurons
-/- (WT/Trpv1/ChR2-EYFP and CaV2.2 /Trpv1/ChR2-EYFP; Figure 1E). In glabrous skin of the plantar hindpaw, Trpv1-lineage axon fibers co-express CGRP (Figure 7D), identifying them as peptidergic nociceptors, and, in both mouse strains, brief exposure of the plantar hindpaw to blue LED light elicits robust and stereotyped nocifensive paw withdrawal responses that are light-intensity dependent (Figure 10F). Compared with WT/Trpv1/ChR2-EYFP mice (n = 12
-/- mice), CaV2.2 /Trpv1/ChR2-EYFP mice (n = 9 mice) were significantly less responsive to LED stimulation over a wide range of light intensity levels, but particularly at submaximal stimulus intensities (Figure 10G). This approach reveals a clear separation between behavioral
-/- sensitivity of CaV2.2 mice compared with WT mice in response to submaximal stimuli.
We next analyzed synaptic events in postsynaptic dorsal horn neurons evoked by optogenetic
-/- activation of Trpv1-lineage afferents in spinal cord slices from WT and CaV2.2 mice.
Postsynaptic currents in spinal cord dorsal horn neurons elicited by optogenetic stimulation are
-/- attenuated in CaV2.2 mice
CaV2.2 channels are the dominant source of calcium mediating neurotransmitter release in nociceptors as assessed by electrical stimulation of dorsal roots in acute spinal cord slices.4 We
- 46 - measured LED-evoked postsynaptic currents (LED-PSCs) in lamina II neurons of spinal cord
-/- dorsal horn in acute slices from WT/Trpv1/ChR2-EYFP and CaV2.2 /Trpv1/ChR2-EYFP (Figure
14A). The total charge and amplitude of LED-PSCs were significantly reduced in neurons from
-/- +/+ CaV2.2 mice compared with WT controls (Figure 11B, 11C / CaV2.2 : Amplitude: -547.6 ±
-/- 76.0, n = 12 cells; Charge: -20.6 ± 2.5 pC, n = 12 cells / CaV2.2 : Amplitude: -252.1 ± 48.2 pA, n
-/- = 12 cells; Charge: -7.2 ± 1.1 pC, n = 12 cells). LED-PSCs in CaV2.2 neurons decayed more
-/- rapidly as compared to WT (WT: 44.5 ± 5.9 ms, n = 12 cells; CaV2.2 : 27.4 ± 2.3 ms, n = 12 cells; Figure 11D); this was indicated by a more transient and smaller slow component of the
-/- LED-PSC (Decay time: Figure 11E; WT: τ = 123.6 ± 12.9 ms, n = 12 cells; CaV2.2 : τ = 93.1 ±
8.4 ms, n = 12 cells / Decay amplitude: Figure 11G; WT: 29.9 ± 3.0% amplitude, n = 12 cells;
-/- CaV2.2 : 22.0 ± 2.8% amplitude, n = 12 cells). The uniformly small synaptic responses in spinal
-/- cord slices from CaV2.2 mice are consistent with the significantly attenuated LED-evoked
behavioral responses. We next recorded post-synaptic currents in lamina II neurons during
repetitive stimulation of Trpv1-lineage nociceptors to probe the role of CaV2.2 channels in
synaptic transmission during bursts of action potentials, as occur in response to natural
stimulation.
CaV2.2 channels control neurotransmitter release probability in nociceptors
Nociceptor afferent fibers were stimulated by 10 pulses of blue light at 1 and 10 Hz (Figure 12A
and 12D). At 1 Hz, synapses containing (9/9 cells) or lacking (7/7 cells) CaV2.2 channels
perfectly followed stimulation (Figure 12B); however, whereas WT synaptic currents depressed
-/- to about 55% of the initial LED-PSC amplitude, CaV2.2 synapses maintained 87% of the initial
-/- EPSC amplitude (Figure 12C). At 10 Hz stimulation, CaV2.2 synapses generated more post-
+/+ synaptic responses compared with WT control synapses (Figure 12E; CaV2.2 : 4.2 ± 1.0
-/- responses, n = 9 cells; CaV2.2 : 8.3 ± 1.1 responses, n = 7 cells;). Together, these data suggest
- 47 - that loss of CaV2.2 channels from nociceptor pre-synaptic terminals reduces neurotransmitter
release probability, allowing for sustained neurotransmitter release during bursts of action
potentials (Figure 12F).
CaV2.2 channels can influence the shape of action potentials directly via calcium influx during repolarization as well as by influencing the activity of calcium-activated BK and SK channels.20,37,74 Changes to BK and SK channel function may alter cellular excitability and
neurotransmission. To assess the contribution of CaV2.2 channels to nociceptor excitability, we
-/- compared somatic action potentials in Trpv1-lineage neurons from WT and CaV2.2 mice.
CaV2.2 channels do not contribute to the shape of nociceptor action potentials
We recorded action potentials in neurons isolated from DRG of WT/Trpv1/ChR2-EYFP and
-/- CaV2.2 /Trpv1/ChR2-EYFP mice by whole cell patch recording (Figure 13A). The capacitance
-/- of neurons included in our analysis was not different between WT and CaV2.2 samples
+/+ -/- (CaV2.2 : 13.75 ± 0.44 pF, n = 14 cells; CaV2.2 : 13.20 ± 0.29 pF, n = 16 cells) and
represented small-diameter nociceptors (range: 11.2 – 18.0 pF, Figure 13B). The current
-/- required to elicit an action potential in neurons from WT and CaV2.2 mice was similar in
+/+ -/- amplitude (Figure 13C; CaV2.2 : 0.55 ± 0.04 nA, n = 14 cells; CaV2.2 : 0.60 ± 0.03 nA, n = 16
cells), as was the overall shape of action potentials (Figure 13D-13F: AP peak voltage, after-
-/- hyperpolarization voltage, and half-width). Action potentials recorded in neurons of CaV2.2
mice had longer rise times, but hyperpolarization times tended to be shorter in comparison with
-/- WT controls (Rise time: Figure 13G; WT: 4.01 ± 0.14 ms, n = 14 cells; CaV2.2 : 5.25 ± 0.49 ms,
-/- n = 16 cells / Decay time: Figure 13H; WT: 4.35 ± 0.49 ms, n = 14 cells; CaV2.2 : 3.84 ± 0.26 ms, n = 16 cells).
- 48 -
Our data suggest that CaV2.2 channels contribute little to the overall shape of action potentials
but calcium levels can increase within cells during bursts of action potentials to activate calcium-
activated potassium channels that in turn are powerful regulators of burst firing.78,79 We
therefore compared action potentials in Trpv1-lineage neurons of WT and CaV2.2-null mice
during repetitive simulation.
CaV2.2 channels do not significantly contribute to repetitive firing of action potentials in Trpv1- lineage nociceptors
We applied sustained square current pulses and current ramps to dissociated Trpv1-lineage nociceptors (Figure 14A, 14B). In response to sustained square current pulses, WT control and
-/- CaV2.2 nociceptors fired similar numbers of action potentials (WT: 2.5 ± 0.5 action potentials, n
-/- = 14 cells; CaV2.2 : 2.9 ± 0.50 action potentials, n = 16 cells; Figure 14A). Similarly, in response
-/- to ramp depolarization, there was no difference between WT control and CaV2.2 nociceptors in
-/- number of action potentials generated (WT: 3.3 ± 0.5 action potentials, n = 14 cells; CaV2.2 :
3.4 ± 0.3 action potentials, n = 16 cells; Figure 14B) or the inter-spike interval between the first
-/- and second action potentials (WT: 47.6 ± 9.1 ms, n = 14 cells; CaV2.2 : 40.3 ± 10.4 ms, n = 16
cells; Figure 14B). To test the contribution of CaV2.2 channels to nociceptor firing at specific frequencies, we applied 10 brief current injections at 10 Hz and 20 Hz and recorded action potential responses (Figure 14C and 14D). Current injection amplitudes were set at the minimum value required to elicit an action potential. Most neurons perfectly followed 10 Hz
+/+ -/- stimulation (CaV2.2 : 11/14 cells; CaV2.2 : 14/16 cells, Figure 14C), but at 20 Hz stimulation
-/- failures became more frequent. There was no significant difference between WT and CaV2.2
neurons in the number of action potentials generated in response to 20 Hz stimulation (Figure
- 49 -
+/+ -/- 14D; CaV2.2 : 7.0 ± 0.9 action potentials, n = 14 cells; CaV2.2 : 8.3 ± 0.6 action potentials, n =
16 cells; p = 0.327 for genotype assessed by univariate ANOVA). Our data suggest that CaV2.2
channels have little or no influence on nociceptor excitability.
Nociceptor free nerve endings in skin could also express CaV2.2 channels and, although not
previously considered, they could play a role in regulating release of inflammatory mediators
during inflammation. Indeed, CaV2.2 channels have been implicated in the development of
several forms of chronic pain.2
CaV2.2 channels are critical mediators of inflammatory hyperalgesia
To evaluate the role of CaV2.2 channels in inflammatory hyperalgesia, we injected complete
-/- Freund’s adjuvant (CFA) into the plantar hindpaws of WT/Trvp1/ChR2-EYFP and CaV2.2
/Trpv1/ChR2-EYFP mice (Figure 15A). Intraplantar CFA elicits sub-chronic hyperalgesia
involving both immune cell and nociceptor activation. Immediately following intraplantar CFA,
-/- 8/8 WT/Trpv1/ChR2-EYFP and 6/6 CaV2.2 /Trpv1/ChR2-EYFP mice develop thermal hyperalgesia (Figure 15A), suggesting that acute hyperalgesia in response to CFA does not require CaV2.2 channels. In WT/Trpv1/ChR2-EYFP mice, thermal hyperalgesia lasted at least 5
-/- days following CFA exposure, but, in CaV2.2 /Trpv1/ChR2-EYFP mice, thermal sensitivity
returned to baseline levels within 24 hrs (Figure 15A). Our data suggest that CaV2.2 channels are necessary for sustained hyperalgesia. By contrast, paw swelling, measured 24 hr after
-/- intraplantar CFA relative to the contralateral paw, was not significantly impaired in CaV2.2
+/+ /Trpv1/ChR2-EYFP mice compared with WT/Trpv1/ChR2-EYFP mice (Figure 15B; CaV2.2 :
-/- 2.0 ± 0.3-fold change, n = 9 animals; CaV2.2 : 1.8 ± 0.2-fold change, n = 9 animals; p = 0.747 for genotype assessed by univariate ANOVA). Our data indicate that the process of paw
- 50 - swelling, due to increased blood flow, plasma extravasation, and immune cell invasion, occurs by mechanisms that are independent of CaV2.2 channel activation.
Inflammation-induced hyperalgesia involves the release of cytokines, neuropeptides, and lipids prompting us to test the possibility that CaV2.2 channels contribute to this process. We examined the secretion of IL-1β, a prominent inflammatory mediator, from isolated skin
-/- samples. We cultured plantar hindpaw skin from WT/Trpv1/ChR2-EYFP and CaV2.2
/Trpv1/ChR2-EYFP mice for 72 hr, collected conditioned media, and quantified secreted IL-1β
-/- using a cell-based reporter assay. Skin from CaV2.2 /Trpv1/ChR2-EYFP mice secreted 60%
less IL-1β compared with skin from WT/Trpv1/ChR2-EYFP mice (Figure 15C). IL-1β is produced
in and secreted from immune cells leading us to consider the possibility that CaV2.2 channels
may be mediating hyperalgesia via non-neuronal cells.
CaV2.2 channels mediate inflammatory hyperalgesia via ATP release from nociceptors
It has been suggested that CaV2.2 channels in microglia are critical regulators of neuropathic
pain.54 CFA is a complex model of inflammatory hyperalgesia involving contributions from both
nociceptors and immune cells. In order to more specifically determine the site of action of
CaV2.2 channels, we tested additional models of hyperalgesia which specifically activate either nociceptors or immune cells and microglia. Nociceptors are activated by capsaicin, which acts
specifically on neuronal TRPV1 channels;55,65 Immune cells and microglia are activated by
BzATP, which acts through non-neuronal P2X7 receptors.80,81 Intraplantar capsaicin injection
elicited profound thermal hyperalgesia in 10/10 WT/Trpv1/ChR2-EYFP mice, but hyperalgesia
-/- was completely absent in 9 CaV2.2 /Trpv1/ChR2-EYFP mice (Figure 16A). By contrast,
-/- intraplantar BzATP elicited thermal hyperalgesia in both WT/Trpv1/ChR2-EYFP and CaV2.2
- 51 -
/Trpv1/ChR2-EYFP mice (Figure 16B), suggesting that CaV2.2 channels act in nociceptor
terminals to mediate hyperalgesia.
ATP is a pro-inflammatory signaling molecule that is released from nociceptors to activate
immune cells and microglia and stimulate IL-1β production. We hypothesized that ATP release
from nociceptors requires functional CaV2.2 channels and, to test this hypothesis, we co- injected A438079, a P2X7 receptor antagonist, and capsaicin into the hindpaw of 9
WT/Trpv1/ChR2-EYFP mice. We observed no thermal hyperalgesia, suggesting that ATP activation of P2X7 receptors is a critical mediator of capsaicin-induced hyperalgesia (Figure
16C).
To verify that local CaV2.2 channels are critical for hyperalgesia, we co-injected capsaicin with
ziconotide (ω-conotoxin MVIIA), a selective inhibitor of CaV2.2 channels, into the plantar
hindpaw of 11 WT/Trpv1/ChR2-EYFP mice and, again, observed a failure of hyperalgesia
(Figure 16D). It is well established that central administration of ziconotide impairs basal
31 nociception, so, to verify that intraplantar injection of ziconotide does not impact central CaV2.2 channels, we assessed behavioral responses to direct nociceptor activation by LED stimulation and thermal stimuli following intraplantar ziconotide (Figure 16E). Intraplantar ziconotide did not significantly impair behavioral responses evoked by LED light at 15 minutes after injection and response latencies to thermal stimuli were similarly unaffected (Figure 16E). Together, these data suggest a critical role for CaV2.2 channels in the skin where they mediate ATP-release
from capsaicin-sensitive neurons to facilitate hyperalgesia (Figure 16F).
Discussion
- 52 -
CaV2.2 channels are primarily considered as mediators of nociception through their role in nociceptor pre-synaptic nerve terminals in the spinal cord. Here, we propose a model (Figure
12F, 16F) in which CaV2.2 channels are critical mediators of nociception and hyperalgesia via contributions at both central and peripheral nociceptor terminals. In central terminals, CaV2.2
channels detect action potentials and mediate synaptic glutamate release. In the absence of
CaV2.2 channels, or during pharmacological inhibition, synaptic transmission from nociceptors to secondary neurons in the spinal cord dorsal horn is significantly attenuated. In the skin,
CaV2.2 channels are activated in response to membrane depolarization and mediate release of
ATP. ATP binds to P2X7 receptors on the surface of activated immune cells, promoting production and secretion of IL-1β, which in turn drives neuronal hyperexcitability and hyperalgesia. In the absence of CaV2.2 channels or during pharmacological inhibition, ATP
release is impaired, reducing IL-1β production and secretion, and abolishing inflammatory
hyperalgesia.
CaV2.2 channels mediate acute nociception via activity in central nociceptor terminals
The role of CaV2.2 channels in mediating acute nociception and synaptic transmission in the
spinal cord has been firmly established using pharmacology,30,82 but analyses of previously
-/- 47–49 generated CaV2.2 mouse strains have yielded contradictory results. We generated a
-/- CaV2.2 mouse strain and find somewhat reduced sensitivity to noxious thermal and mechanical stimuli. Behavioral abnormalities become much more apparent, however, when using an optogenetic approach to directly target a broad population of nociceptors. There are numerous benefits of this approach: 1) in vivo stimulation intensity can easily be manipulated to
examine behavioral responses to a range of stimulus intensities; 2) the short response latency
removes the potential confound of general activity level, which may skew measurements of
response latency in hyperactive mice;47 3) similar populations of sensory neurons can be
- 53 - activated in vivo and in vitro for direct correlation of nocifensive responses with synaptic
responses in the spinal cord.
In the spinal cord, we observed a reduction in the amplitude of synaptic responses elicited by
stimulation of nociceptor afferent fibers. Elimination of post-synaptic CaV2.2 channels is unlikely
-/- to account for the observed decrease because synaptic depression is reduced at CaV2.2 synapses, suggesting a pre-synaptic mechanism. Furthermore, loss of CaV2.2 channels does not influence nociceptor excitability or action potential shape and acute inhibition of peripheral
CaV2.2 channels does not influence nocifensive behavior. Together, these data confirm that
CaV2.2 channels primarily act in pre-synaptic nociceptor terminals to mediate acute nocifensive behavior.
CaV2.2 channels mediate inflammatory hyperalgesia via activity in peripheral nerve terminals
We have tested three models of inflammatory hyperalgesia involving different mechanisms of
-/- induction in our CaV2.2 mouse model. Capsaicin- and BzATP-mediated hyperalgesia are both
forms of acute inflammation, but act through receptors expressed on distinct cell types in the
skin.65,83 CFA-mediated hyperalgesia is a more complex, sub-chronic model of inflammation that
-/- recruits both nociceptors and immune cells. Surprisingly, CaV2.2 mice are resistant to
hyperalgesia resulting from acute neurogenic inflammation (mediated by capsaicin) and develop
a transient form of hyperalgesia resulting from sub-chronic inflammation (mediated by CFA).
-/- CaV2.2 mice develop hyperalgesia in response to acute non-neurogenic inflammation
(mediated by BzATP) and display normal paw edema during CFA-mediated inflammation.
- 54 -
Central mechanisms have been well established to contribute to hyperalgesia and allodynia resulting from nerve injury84 and they likely contribute to inflammatory hyperalgesia. It is
possible that constitutive loss of CaV2.2 channels in the spinal cord and brain contribute to the
resistance of these mice to inflammatory hyperalgesia, but we provide two critical pieces of
evidence suggesting that peripheral CaV2.2 channels are involved. First, local inhibition of
CaV2.2 channels specifically during capsaicin application completely blocks hyperalgesia without influencing acute nocifensive responses. Second, production and secretion of IL-1β, a critical regulator of hyperalgesia, in the isolated hindpaw skin, independent of the central
-/- nervous system, is reduced in CaV2.2 mice. It is unlikely that CaV2.2 channels are acting
directly in immune cells to influence production and secretion of IL-1β because activation of
-/- immune cells directly effectively induces hyperalgesia in CaV2.2 mice.
Direct demonstration that CaV2.2 channels are present and functional in the skin has proven
surprisingly challenging. Antibodies that detect CaV2.2 channels also show non-specific activity
-/- in CaV2.2 mice, as demonstrated by the additional bands present in Western blots (see Figure
10C). Furthermore, knock-in mice expressing tagged CaV2.2 channels for localization of
68 individual channels have not been generated, as they have for CaV3.2 channels. Recently,
calcium imaging in slices of the sciatic nerve revealed that CaV2.2 channels are a major route of
calcium influx in peripheral axons of somatosensory neurons during action potentials.38 This
demonstrates that CaV2.2 channels are trafficked to peripheral structures of DRG neurons and suggests that they are likely to be found in peripheral terminals in the skin.
CaV2.2 channels mediate release of ATP from nociceptors
- 55 -
In contrast to the consistent analgesic efficacy of pharmacological inhibition of CaV2.2 channels,
-/- CaV2.2 mouse models have yielded somewhat contradictory results. Three independent
-/- 47–49 CaV2.2 mouse strains have been generated and different behavioral deficits noted in each
strain. Only one strain showed any deficit in acute mechanical nociception.49 Although all three
strains showed some reduction in thermal nociception, when multiple techniques were used,
none showed a consistent decrease. All three strains reliably demonstrated a subtle deficit in
inflammatory pain evoked by intraplantar formalin47–49 and, in the one strain in which chronic
pain was induced by nerve injury,47 thermal and mechanical hyperalgesia were significantly
-/- reduced in CaV2.2 mice. These data suggest a privileged role for CaV2.2 channels in inflammatory and neuropathic pain.
Substantial evidence supports the theory that communication between nociceptors, glia, and immune cells are critical for induction and maintenance of pathological pain, both in the central nervous system and in the periphery.85,86 ATP is an important mediator of the immune-neural
interaction and has been linked to hyperalgesia and chronic pain.85 ATP acts through ionotropic
P2X and metabotropic P2Y receptors that are expressed on neurons, glia, and immune cells. In
particular, P2X7 receptors, which are expressed specifically in immune and microglial cells, are
critical for nerve-injury mediated hyperalgesia and allodynia.87 We provide evidence that P2X7
receptors are also critical for capsaicin-induced hyperalgesia. This evidence, along with our data showing that CaV2.2 channels are necessary for capsaicin-induced hyperalgesia and that direct
-/- activation of P2X7 receptors elicits hyperalgesia in CaV2.2 mice, suggests that peripheral ATP
requires CaV2.2 channels for release.
- 56 -
ATP can be packaged into secretory vesicles and acts as a neurotransmitter throughout the
nervous system.88 There are likely to be many mechanisms by which extracellular ATP
increases, including secretion from lysosomes, cytosol release following cell damage, diffusion
through large hemi-channel pores, and calcium-dependent release from secretory vesicles.89–91
At central synapses, ATP can be co-released from synaptic vesicles along with GABA or glutamate or can be packaged alone into purinergic vesicles.92 The calcium channel mediating
calcium-dependent release of ATP has not been identified previously and we suggest that, in
peripheral terminals of nociceptors, CaV2.2 channels are critical regulators of ATP release.
- 57 -
-/- Figure 10. CaV2.2 mice have impaired nociception. (a) Cacna1b mRNA (magenta) is absent in dorsal root ganglia -/- from CaV2.2 mice. Scale bar = 25 μm. (b) Western blot demonstrating absence of CaV2.2 protein (~250 kDa band) in whole brain lysate -/- from CaV2.2 mice (left). Remaining bands reflect non- specific binding of anti-CaV2.2 antibody. Detection of GAPDH (right) performed in same blot following stripping of anti- -/- CaV2.2 antibody. (c) CaV2.2 mice have reduced thermal (left) and mechanical (right) sensitivity. Each point is the median of 3 measurements per mouse (n = 8 mice / genotype, blinded), shown with mean (horizontal line) and standard error (shaded area). Mean ± SE for -/- thermal response latency was WT: 7.63 ± 0.45 s; CaV2.2 : 10.39 ± 0.76 s and for mechanical -/- response threshold was WT: 0.58 ± 0.07 g; CaV2.2 : 0.99 ± 0.20 g. Significance, calculated by univariate ANOVA, for thermal response latency: p = 0.007 and for mechanical response -/- threshold: p = 0.073. (d) CaV2.2 mice are less responsive to direct nociceptor activation by 465 nm LED light. Each point is the mean number of responses, out of 10 stimuli, for 12 -/- WT/Trpv1/ChR2-EYFP mice and 9 CaV2.2 /Trpv1/ChR2-EYFP mice along with standard error (shaded area). Intensity-response curves for each mouse were fit to a four-parameter logistic curve (see Materials and Methods for details). Significance, calculated by repeated measures ANOVA, for response counts p = 0.000011 for genotype.
- 58 -
Figure 11. CaV2.2 channels are critical for synaptic transmission from nociceptors to spinal cord dorsal horn neurons. (a) Synaptic currents in slices from WT/Trpv1/ChR2-EYFP -/- mice (black) and CaV2.2 /Trpv1/ChR2-EYFP mice (red). (b-h) Quantification of total charge (b), peak amplitude (c), weighted time constant (d), slow time constant (e), fast time constant (g), and component contributions to response amplitude (G) and total charge (H). For b-f, each point represents an individual cell, shown with mean (horizontal line) and standard error (shaded area). For g-h, each point represents an individual cell, thick horizontal lines represent mean, thin horizontal lines bound standard error, and shaded and open areas reflect contributions of slow and fast components, -/- respectively. Analysis includes 12 WT and 12 CaV2.2 cells. Mean ± SE and significance, assessed by multivariate ANOVA, for each analysis were for total charge: WT: -20.6 ± 2.5 pC, -/- -/- CaV2.2 : -7.2 ± 1.1 pC, p = 0.000071; peak amplitude: WT: -547.6 ± 76.0 pA, CaV2.2 : -252.1 ± -/- 48.2 pA, p = 0.003; weighted time constant: WT: 44.5 ± 5.9 ms, CaV2.2 : 27.4 ± 2.3 ms, p = -/- 0.012; slow time constant: WT: 123.6 ± 12.9 ms, CaV2.2 : 93.1 ± 8.4 ms, p = 0.060; fast time -/- constant: WT: 11.7 ± 1.6 ms, CaV2.2 : 10.8 ± 0.9 ms, p = 0.631; contribution of slow component -/- to response amplitude: WT: 29.9 ± 3.0%, CaV2.2 : 22.0 ± 2.8%, p = 0.067; and contribution of -/- slow component to total charge: WT: 79.3 ± 3.6%, CaV2.2 : 67.0 ± 3.5%, p = 0.00015.
- 59 -
Figure 12. CaV2.2 channels increase neurotransmitter release probability from nociceptor terminals. (a) Synaptic currents elicited in spinal cord slices from WT/Trpv1/ChR2-EYFP (left, grey) and -/- CaV2.2 /Trpv1/ChR2-EYFP (right, red) mice by optogenetic stimulation at 1 Hz. (b) Synapses of WT (n = 9 slices) and -/- CaV2.2 (n = 7 slices) nociceptors perfectly follow 1 Hz stimulation. Each point represents an individual slice. (c) -/- LED-PSCs from CaV2.2 slices (red, n = 7 slices) depress less than LED-PSCs from WT slices (grey, n = 9 slices). LED-PSC amplitudes were normalized to the initial response. Significance of p = 0.018, assessed by repeated measures ANOVA, for genotype. (d) Synaptic currents elicited in spinal cord slices from WT/Trpv1/ChR2-EYFP (left, grey) and -/- CaV2.2 /Trpv1/ChR2-EYFP (right, red) mice by optogenetic stimulation at 10 Hz. (e) Quantification of synaptic responses to 10 stimuli at 10 Hz in WT (n = 9 slices) -/- and CaV2.2 slices (n = 7 slices). Each point represents an individual slice, shown with mean (horizontal line) and standard error (shaded area). Mean ± SE for WT: 4.2 ± 1.0 responses and KO: 8.3 ± 1.1 responses with significance of p = 0.016, assessed by univariate ANOVA for genotype. (f) Action potentials depolarize pre-synaptic nociceptor terminals in the spinal cord, activating voltage-gated calcium channels and eliciting synaptic -/- neurotransmitter release. In CaV2.2 nociceptor terminals (bottom), fewer calcium channels are present, leading to reduced glutamate release.
- 60 -
Figure 13. CaV2.2 channels do not significantly contribute to the shape of nociceptor action potentials. (a) Action potentials recorded in dissociated nociceptors from WT/Trpv1/ChR2- EYFP mice (grey) and -/- CaV2.2 /Trpv1/ChR2-EYFP mice (red). (b-h) Quantification of whole cell capacitance (b), threshold current injection (c), peak voltage (d), after- hyperpolarization voltage (e), half-width (f), rise time (g), and decay time (h). Each point represents an individual cell, shown with mean (horizontal line) and standard error -/- (shaded area). Analysis includes 14 WT and 16 CaV2.2 nociceptors. Mean ± SE and significance, assessed by multivariate ANOVA, for each analysis were for capacitance: WT: -/- -/- 13.99 ± 0.44 pF, CaV2.2 : 13.33 ± 0.29 pF, p = 0.208; threshold: WT: 0.61 ± 0.04 nA, CaV2.2 : -/- 0.58 ± 0.03 nA, p = 0.619; peak voltage: WT: 43.4 ± 1.8 mV, CaV2.2 : 44.0 ± 1.5 mV, p = -/- 0.820; AHP voltage: WT: -74.1 ± 1.3 mV, CaV2.2 : -73.3 ± 1.95 mV, p = 0.766; half-width: WT: -/- -/- 5.9 ± 0.5 ms, CaV2.2 : 4.9 ± 0.3 ms, p = 0.116; rise time: WT: 4.1 ± 0.1 ms, CaV2.2 : 5.8 ± 0.5 -/- ms, p = 0.004; and decay time: WT: 4.9 ± 0.5 ms, CaV2.2 : 3.9 ± 0.3 ms, p = 0.061.
- 61 -
Figure 14. CaV2.2 channels do not significantly contribute to nociceptor excitability. (a) Action potentials in WT/Trpv1/ChR2-EYFP (grey, top) and -/- CaV2.2 /Trpv1/ChR2-EYPF (red, middle) nociceptors elicited by sustained current injections. Bottom Quantification of action potentials generated. Mean ± SE and significance, assessed by univariate ANOVA, were WT: 2.6 ± 0.5 action potentials, KO: 2.9 ± 0.5 action potentials, p = 0.672. (b) Action potentials in WT/Trpv1/ChR2-EYFP (grey, top) and -/- CaV2.2 /Trpv1/ChR2-EYPF (red, middle) nociceptors elicited by ramp current injections. Bottom Quantification of action potentials generated (left) and interspike interval (right). Mean ± SE and significance, assessed by univariate ANOVA, were for action potentials: WT: -/- 3.3 ± 0.5 action potentials, CaV2.2 : 3.4 ± 0.3 action potentials, p = 0.925 and for interspike interval: WT: 63.8 ± 9.1 ms, -/- CaV2.2 : 55.3 ± 10.4 ms, p = 0.550. (c-d) Action potentials elicited by brief current injections of threshold intensity at 10 Hz (c) and 20 Hz (d) in WT/Trpv1/ChR2- -/- EYFP (grey, left) and CaV2.2 /Trpv1/ChR2-EYFP (red, middle) nociceptors. Right Quantification of action potentials generated. Mean ± SE and significance, assessed by univariate ANOVA, were for 10 Hz: WT: 8.8 ± 0.8 -/- action potentials, CaV2.2 : 9.6 ± 0.2 action potentials, p = 0.385 and for 20 Hz: -/- WT: 7.0 ± 0.9 action potentials, CaV2.2 : 8.3 ± 0.6 action potentials, p = 0.327. For each plot (a- d), points represent individual cells, with mean (horizontal line) and standard error (shaded -/- area). Analyses (a-d) include 14 WT and 16 CaV2.2 nociceptors.
- 62 -
Figure 15. CaV2.2 channels are critical for inflammatory hyperalgesia resulting from intraplantar CFA and for secretion of IL-1β from hindpaw skin. (a) Changes in thermal sensitivity in WT/Trpv1/ChR2- -/- EYFP (grey, left, n = 8 mice) and CaV2.2 /Trpv1/ChR2-EYFP (red, right, n = 6 mice) mice following intraplantar injection of CFA. Mean response latency for ipsilateral paws are shown as closed circles and for contralateral paws as open circles. Shaded areas represent standard error. Significance for main effect of genotype, assessed by repeated measures ANOVA, was p = 0.000024. (b) Each point represents one mouse shown with mean (horizontal line) and standard error (shaded area). Left Ipsilateral and contralateral hindpaw volume was measured 24 hr after intraplantar injection of CFA in WT/Trpv1/ChR2-EYFP (grey, n = 9) and -/- CaV2.2 /Trpv1/ChR2-EYFP mice (red, n = 9). Significance for main effect of genotype, assessed by multivariate ANOVA, was for ipsilateral paws: p = 0.716 and for contralateral paws: p = 0.708. Right Ipsilateral paw volume normalized to contralateral paw volume. Significance for main effect of genotype, assessed by multivariate ANOVA, was p = 0.747. (c) IL-1β release from plantar hindpaw skin from WT/Trpv1/ChR2- -/- EYFP and CaV2.2 /Trpv1/ChR2-EYFP mice was quantified using a cell-based reporter assay. Left Data from individual experiment with technical triplicates showing reduced IL-1β reporter -/- activity using media conditioned with CaV2.2 skin. Right Summary showing results from 3 independent biological samples, normalized to WT reporter activity by experiment.
- 63 -
Figure 16. Intradermal release of ATP mediated by capsaicin requires functional CaV2.2 channels. (a-d) Change in thermal sensitivity following intraplantar injection of capsaicin (a); -/- n = 10 WT, 9 CaV2.2 mice, p = 0.014 for genotype*time interaction) or BzATP (b; n = 6 WT, 7 -/- CaV2.2 mice; p = 0.974 for genotype*time interaction) in WT/Trpv1/ChR2-EYFP -/- and CaV2.2 /Trpv1/ChR2- EYFP mice or co-injection of capsaicin with A438079 (c; n = 9 mice; p = 0.178 for foot*time interaction) or ω-conotoxin MVIIA (d; n = 11 mice; p = 0.313 for foot*time interaction) in WT/Trpv1/ChR2-EYFP. Significance was assessed by repeated measures ANOVA for each experiment. Points and lines reflect mean response latency with ipsilateral and contralateral hindpaws shown as closed and open circles, respectively. Shaded area reflects standard error. (e) Effect of intraplantar ω-conotoxin MVIIA on paw withdrawal responses of WT/Trpv1/ChR2-EYFP mice to LED stimulation (left) or radiant heat (right). (f) Proposed mechanism of CaV2.2 channel involvement in capsaicin-induced hyperalgesia. 1: Capsaicin binds to Trpv1 channels causing membrane depolarization and activating CaV2.2 channels. 2: Calcium entry through CaV2.2 channels induces release of ATP from secretory vesicles. Local inhibition of CaV2.2 channels blocks capsaicin-induced hyperalgesia. 3: ATP binds to P2X7 receptors on immune cells to induce synthesis and secretion of IL-1β. Block of P2X7 receptors prevents capsaicin-induced hyperalgesia and direct activation of P2X7 -/- -/- receptors in CaV2.2 mice elicits hyperalgesia. 4: Secreted IL-1β induces hyperalgesia. CaV2.2 hindpaw skin secretes less IL-1β in culture compared with WT hindpaw skin.
- 64 -
CHAPTER 4
Prolonged activation of Trpv1- lineage nociceptors does not modify nocifensive behavior but induces changes in synaptic efficacy in spinal cord dorsal horn Introduction
Hyperalgesia is a complex biological response that involves a multitude of biological processes and signaling pathways in both experimental animal models and in humans. Subcutaneous injection of capsaicin is one of the most straightforward manipulations to induce hyperalgesia.
When injected into the skin, capsaicin triggers action potentials in Trpv1-expressing nociceptors which activate synaptic connections in the spinal cord and induce release of inflammatory mediators from peripheral nerve terminals in the skin.55,65 BzATP, an ATP analogue, acts on
immune cells and microglia to initiate release of inflammatory mediators, which act to increase
nociceptor activity, and the injection itself provides stimulation that activates LTMRs and
mechano-nociceptors.80 Even direct nerve injury, by ligation or peripheral nerve transection, induces both action potential firing and release of inflammatory mediators, as well as genetic changes that dramatically change the function of injured sensory neurons.91,93–95
Data shown in Chapter 3 of this dissertation provide evidence that CaV2.2 channels are critical
mediators of both chemical inflammatory signaling and synaptic neurotransmitter release from
nociceptor terminals in the spinal cord. Weighing the relative importance of these processes in
the induction of chronic pain, however, has proven challenging. In this chapter, I present data
showing that prolonged, direct stimulation of Trpv1-lineage neurons in the absence of
inflammation does not induce hyperalgesia, suggesting that CaV2.2-mediated inflammatory hyperalgesia may be a critical component of many chronic pain conditions.
Two groups have reported that nociceptor activity, in the absence of inflammatory mediators, is
61,62 sufficient for hyperalgesia. In one study, ChR2-EYFP was expressed in NaV1.8-lineage nociceptors and in the other ChR2-EYFP was expressed in Trpv1-lineage nociceptors. Each
- 66 - used prolonged blue light to activate nociceptors in anesthetized mice and within 1 hr of recovery from anesthesia, both strains of mice were hypersensitive to thermal and mechanical stimuli.61,62 There was no evidence of inflammatory responses and in both models an increase in synaptic activity in the spinal cord dorsal horn was observed and proposed as the cellular basis of hyperalgesia.61,62
These findings suggest that, at least for certain forms of chronic pain, neuronal activity during
injury is the primary driver of pathology. Furthermore, they offer an experimental approach to
characterize the molecular and cellular changes that underlie the remodeling that causes
chronic pain. Specifically, we were keen to assess changes in the properties and expression
levels of CaV2.2 channels in naïve and hyperalgesic animals.
We therefore used a mouse strain expressing ChR2-EYFP in Trpv1-lineage neurons to
specifically activate Trvp1-lineage sensory neurons in vivo and in vitro and to assess the
contribution of CaV2.2 channels to the development of hyperalgesia. Unexpectedly, and despite
numerous stimulation protocols, we did not find evidence that prolonged stimulation of Trpv1-
lineage nociceptors in anesthetized mice can induce thermal hyperalgesia. We also failed to
trigger hyperalgesia in mice by combining stimulation of Trpv1-lineage nociceptors by light
stimulation with intraplantar injection of prostaglandin-E2 (PGE2), a pro-inflammatory mediator.
Our findings are inconsistent with previously published data that report nociceptor activity alone
is sufficient to induce hyperalgesia. Our in vitro analyses of synaptic transmission in spinal cord
dorsal horn demonstrate that prolonged nociceptor activation elicits potentiation of inhibitory
synapses in spinal cord dorsal horn, but not of primary sensory inputs. Based on these findings,
- 67 - we conclude that nociceptor activity is insufficient to induce hyperalgesia and hypothesize that both inflammatory signaling and nociceptor activity is critical for induction of pathological pain.
Results
Remote, light activation of TRPV1-lineage neurons in vivo does not induce hyperalgesia
Following nerve injury or tissue damage, ongoing nociceptor activity pairs with chemical signaling of inflammatory mediators to induce pathological pain.96 Our understanding of the
independent contributions of nociceptor activity and inflammatory mediators to the induction of
pathological pain has been hindered by the technical challenge of activating and studying
nociceptor activity and inflammation independently. Using our Trpv1/ChR2-EYFP mouse strain,
we sought to test the hypothesis that nociceptor signaling, in the absence of inflammatory
mediators or tissue damage, is sufficient to induce hyperalgesia. To this end, we anesthetized
Trpv1/ChR2-EYFP mice with 2% isoflurane and stimulated one hindpaw with blue light (Figure
17A). We used Hargreaves’ radiant heat assay to assess thermal sensitivity of the ipsilateral
and contralateral hindpaw prior to and following prolonged blue light stimulation. First, we used
sham stimulation to verify that response latency, in the absence of conditioning stimulation, is
stable over time (Figure 17B). Although there was a small increase in thermal sensitivity over
time indicated by a decrease in response latency (significant effect of time at p = 0.035
assessed by repeated measures ANOVA), both ipsilateral and contralateral feet were similarly
affected (significance for foot*time interaction at p = 0.947 assessed by repeated measures
ANOVA). Thus, for each of the following experiments, we used the contralateral hindpaw as a
within-subject control for effects of repeated testing.
- 68 -
We tested three different stimulation paradigms to determine if nociceptor activity elicits hyperalgesia: 1) LED stimulation at 10 Hz for 10 min (Figure 17C), 2) LED stimulation continuously for 30 min (Figure 17D), and 3) LED stimulation at 2 Hz for 30 min (Figure 10E).
For each stimulation paradigm, LED light intensity was set to the maximum (1 mW/mm2) and all
mice responded to acute LED stimulation. None of the three protocols successfully induced
thermal hyperalgesia in Trpv1/ChR2-EYFP mice (Figure 17C-E). Previous protocols
demonstrating efficacy of these stimulation paradigms61,62 used laser light to stimulate the hindpaw, rather than LED light. To test if laser light, which may transfer a larger amount of heat compared with LED light, is necessary for induction of hyperalgesia, we tested the efficacy of laser light stimulation at 2 Hz for 30 min. Still, no thermal hyperalgesia was observed within 3 hours after stimulation (Figure 17F). Our data suggest that prolonged nociceptor activity, in the absence of inflammatory mediators, is insufficient to induce thermal hyperalgesia. This conclusion implies that the combination of inflammatory mediators and nociceptor activation is critical for induction of hyperalgesia. We next sought to test this hypothesis by combining these two features in a controlled way within a single stimulation paradigm.
Prolonged activation of Trpv1-lineage neurons in the presence of prostaglandin is insufficient to induce thermal hyperalgesia
Inflammatory mediators come in many forms, from neuropeptides to cytokines and lipid mediators. Prostaglandins, especially prostaglandin E2 (PGE2), are a form of lipid mediator that are generated by cyclooxygenase (COX) enzymes and are well known mediators of hyperalgesia during inflammation. We hypothesized that by combining PGE2 signaling with prolonged nociceptor activity we may be able to recapitulate the critical features that drive thermal hypealgesia. To test this, we injected PGE2 (5 µm) into the plantar hindpaw of
Trpv1/ChR2-EYFP. In the absence of any nociceptor stimulation, there was a slight
- 69 - desensitization of the ipsilateral hindpaw relative to the contralateral hindpaw, but no consistent effect of PGE2 injection alone (Figure 18A). The combined action of PGE2 injection with LED light stimulation at 2 Hz for 30 min also failed to elicit hyperalgesia in ipsilateral compared to contralateral hindpaw (Figure 18B). These data suggest that nociceptor activity, even in the presence of an inflammatory mediator, is insufficient to induce hyperalgesia. We reach a different conclusion from two published studies. Prolonged nociceptor activity was also reported by others to induce long-term potentiation of synaptic input to the spinal cord dorsal horn and this is proposed to represent the cellular underpinnings of hyperalgesia. We therefore asked if postsynaptic currents in spinal cord dorsal horn are altered following prolonged activation of
Trpv1-lineage afferents.
Prolonged 2 Hz stimulation of Trpv1-lineage afferents potentiates inhibitory synaptic currents in spinal cord dorsal horn
The spinal cord dorsal horn is highly plastic and changes in the efficacy of synaptic connections between primary nociceptors and secondary neurons in the spinal cord are thought to underlie hyperalgesia.84,96,97 To test if ongoing activity in Trpv1-lineage neurons can induce prolonged
changes in synaptic efficacy, we used patch-clamp electrophysiology to record light-evoked
EPSCs in neurons of lamina I and II of spinal cord dorsal horn (Figure 19). Spinal cord circuitry
is complex and activation of primary sensory neurons will elicit monosynaptic EPSCs in the cell
of interest, as well as polysynaptic inhibitory post-synaptic currents origintating from activation of
inhibitory interneruons (schematized in Figure 19A). In order to observe both inhibitory and
excitatory synaptic events, we used a chloride-based intracellular recording solution which shifts
the reversal potential for chloride to 0 mV. When holding the cell at -70 mV, activation of GABA-
A or Glycine receptors elicits a net efflux of chloride ions (inward current).
- 70 -
Under these conditions, we recorded light-evoked post-synaptic currents prior to and
immediately following 2 min of 2 Hz stimulation of Trpv1-lineage afferent fibers with blue light.
Only the amplitude of the first peak (within 10 ms of optical stimulation) was analyzed and poly-
synaptic events from secondary neuron activation were ignored. We observed potention of the
PSC peak amplitude in 50% of cells (n = 8/16 cells) by an average of 1.5 times baseline
amplitude (Figure 19B).
To determine if the observed potentiation of PSCs originated from excitatory or inhibitory
synapses in the spinal cord, we used two approaches to eliminate inhibitory synaptic input. First,
we repeated recordings using a low-chloride, gluconate-based internal solution (Figure 19A,
19C) and second, we applied picrotoxin to the slice to block GABA-A and Glycine receptors
(Figure 19A, 19D). Picrotoxin abolishes inhibition in the slice completely, resulting in increased
polysynaptic excitatory input (Figure 19D), whereas use of a gluconate-based internal solution
preserves native inhibition in the slice, but reduces the contribution of chloride efflux to the
recorded signal. Under both conditions, 2 min of blue light stimulation at 2 Hz failed to elicit a
change in postsynaptic current peak amplitudes (Figure 19C, 19D). Together, our data
demonstrate that TRPV1-lineage afferent fibers do not undergo long-term potentiation following
prolonged stimulation, but inhibitory synapses in spinal cord dorsal horn do undergo a form of
heterosynaptic potentiation.
Discussion
Nerve and tissue damage cause pathological pain in humans via prolonged nociceptor
activation and inflammation.96 Recently, two studies suggested that inflammation resulting from
- 71 - tissue damage is not critical for induction of pathological pain and that prolonged nociceptor
61,62 activation is sufficient to induce hyperalgesia. Given the important role for CaV2.2 channels in nociceptors, we sought to use this novel model of hyperalgesia to determine if CaV2.2
channel contributions to nociceptor signaling are critical for this form of hyperalgesia.
Surprisingly, we were unable to induce hyperalgesia using any prolonged stimulation paradigm,
or by combining prolonged nociceptor stimulation with the inflammatory mediator PGE2. Rather,
we find that prolonged activation of nociceptors potentiates inhibitory signals in the spinal cord.
From these data, we conclude that the combined effect of inflammatory signaling and nociceptor
activity is required for induction of chronic pain and hypothesize that inhibition of CaV2.2
channels involved in either process may be sufficient to block the induction of chronic pain.
Prolonged activation of nociceptors is insufficient to induce hyperalgesia
The lack of hyperalgesia following prolonged activation of nociceptor terminals in hindpaw skin
of TRPV1/ChR2-EYFP mice by blue LED or laser light reported here is not in agreement with
the robust thermal and mechanical hyperalgesia reported using published protocols.61,62 We
found no hyperalgesia in response to several different stimulation paradigms, light sources, and
even in response to combined stimulation by PGE2 and blue light. Both LED and laser
intensities used to stimulate glabrous hindpaw skin of anesthetized mice were shown to elicit
robust nocifensive behavioral responses in 100 % of awake, non-anesthetized mice. One
potential confound for each of the tested stimulation paradigms is the level of anesthesia,
although this is unlikely because the anesthesia used here is comparable to that used in
published reports.
- 72 -
It is possible that inhaled isoflurane, the anesthetic used in these studies, acts at the level of the spinal cord to block incoming sensory signals, preventing ongoing nociceptor activity from eliciting the required changes in spinal cord connectivity.98 Testing this, however, is not possible
because prolonged blue light stimulation is expected to cause significant pain in the subjects.
Physical restraint, to prevent the subject from moving away from the stimulus, is inconsistent
with IACUC regulations and would induce a stress response that may impact behavior
independent of nociceptor activity.
Prolonged nociceptor activity induces heterosynaptic potentiation of inhibitory interneurons in
the spinal cord
Nociceptor activity is proposed to induce hyperalgesia by eliciting stable changes in spinal cord
circuitry and synaptic connections that reduces inhibition and promotes incoming sensory
signals. Indeed, previous studies found that optical activation of nociceptor terminals in the
spinal cord, using similar protocols as induced hyperalgesia in vivo, also increased synaptic
activity in the spinal cord61,62. Consistent with our behavioral data, but in apparent conflict with
previous reports, we did not observe direct potentiation of excitatory synaptic currents in spinal
cord dorsal horn following 2 Hz stimulation with blue light for 2 mins. Whereas previous
analyses were restricted to field potential recording and observation of spontaneous synaptic
activity, we examined the direct, light-activated synaptic input to individual neurons in lamina II
of spinal cord dorsal horn. Our approach offers superb resolution as well as a clearer picture of
where the synaptic activity is originating. Increased field potential amplitude and increased
spontaneous activity may be due to reduced inhibition or increased output from local excitatory
interneurons, rather than increased sensory input to the spinal cord.
- 73 -
We did, however, observe a change in synaptic activity in the spinal cord following conditioning
stimulation. Our experiments demonstrate that synaptic potentiation depends on intact inhibitory
transmission, suggesting that inhibitory input undergoes heterosynaptic potentiation during
periods of prolonged nociceptor activation. High-frequency (100 Hz) bursts of electrical
stimulation were shown previously to induce heterosynaptic potentiation of inhibitory synapses
in spinal cord dorsal horn, in addition to homosynaptic potentiation of primary afferent synapses
onto lamina I projection neurons.99,100 The potentiation observed in our study is evoked by 2 Hz
stimulation which, compared to 100 Hz bursts, more closely models naturalistic firing of
nociceptors during inflammation that is thought to contribute to hyperalgesia in vivo.101 To the best of our knowledge, our data represents the first demonstration of heterosynaptic LTP in spinal cord dorsal horn following prolonged stimulation at relatively low frequencies.
- 74 -
Figure 17. Prolonged stimulation of Trpv1-lineage afferents is insufficient to elicit thermal hyperalgesia. (a) Trpv1/ChR2-EYFP mice were anesthetized using 2% isoflurane and one hindpaw was stimulated by blue light using various stimulation parameters. (b-f) Response latency from a thermal stimulus before and after sham stimulation (b) or prolonged stimulation of one hindpaw with LED light at 10 Hz for 10 min (c), continuously for 30 min (d), 2 Hz for 30 min (e), or with laser light at 2 Hz for 30 min (f). For each graph, average and standard error are shown as filled circles and shaded area, respectively, for the number of mice indicated. Ipsilateral paw is shown in red and contralateral paw is shown in black. Significance assessed using repeated measures ANOVA for a foot*time interaction is for sham (p = 0.947), 10 Hz/10 min (p = 0.793), continuous (p = 0.694), 2 Hz/30 min LED (p = 0.687), and 2 Hz/30 min laser (p = 0.619).
- 75 -
Figure 18. Prolonged nociceptor activation in the presence of a single inflammatory mediator is insufficient to induce thermal hyperalgesia. (a,b) Response latency from a thermal stimulus for Trpv1/ChR2-EYFP mice following injection of PGE2 (a) or injection of PGE2 with 2 Hz LED stimulation for 30 min (b). Ipsilateral hindpaw is shown in red and contralateral hindpaw is shown in black. Lines and symbols show average and shaded area represents standard error. Significance assessed using repeated measures ANOVA for a foot*time interaction is for PGE2 alone (p = 0.517) and PGE2 with 2 Hz stimulation(p = 0.923).
- 76 -
Figure 19. Prolonged stimulation of Trpv1-lineage nociceptor terminals in spinal cord induces potentiation of inhibitory synapses. (a) Schematic detailing recording setup in spinal cord dorsal horn. Currents are recorded in lamina II interneurons (gray) held at a voltage of -70 mV and elicited by activation of nociceptor afferent fibers (green) by blue light. Synaptic currents observed primarily correspond to net influx of sodium. Nociceptors also synaptically activate local inhibitory interneurons (red), which provide synaptic input to the recorded cell and contribute longer latency current as net chloride efflux, due to high chloride content in the pipette recording solution. Polysynaptic inhibition can be blocked by inclusion of gluconate, rather than chloride, in the pipette recording solution (right), or by applying picrotoxin to block GABA-A and Glycine receptors. (b-d) Effect of 2 Hz stimulation for 2 min on synaptic input to neurons in lamina II of spinal cord dorsal horn. Left Mixed monosynaptic and polysynaptic synaptic currents (b), or monosynaptic currents isolated by internal gluconate (c) or external picrotoxin (d) recorded in dorsal horn interneurons. Gray traces show an example baseline synaptic current and red traces show an example synaptic current after 2 Hz stimulation. Right Initial peak current amplitude measured over time. Circles show average and error bars represent standard error. Dashed gray lines indicate 0.8- and 1.2-fold change from average of baseline.
- 77 -
CHAPTER 5
The role of Cacna1b splice isoforms in nocifensive behavior Introduction
Alternative pre-mRNA splicing can have a significant impact on protein function, but it is difficult to assess the contribution of individual splicing events to neuronal function, circuit function, and overall behavior. Neurons use alternative splicing to customize protein function by adding or subtracting discrete modules to suit a particular need; inclusion of alternatively spliced exons in ion channels and receptors permits novel interactions that control channel gating and receptor targeting.9,102,103 The challenge of understanding how alternative splicing contributes to neuronal
function and behavior becomes apparent when considering the multitude of alternative splicing
events, the heterogeneity of neuronal populations, and the complexity of neuronal circuits
underlying behavior. To overcome these challenges, we study specific sites of alternative
splicing within an individual gene (e37a/b and e18a in the Cacna1b gene) in a genetically-
identified population of neurons (Trpv1-lineage nociceptors) which underlie a simple and critical
behavior (nocifensive paw withdrawal behavior).
We have already demonstrated that CaV2.2 channels, encoded by the Cacna1b gene, are important for nociceptor function and pain behavior (Chapter 2). Previous analyses of CaV2.2 channel splice isoforms in artificial expression systems have demonstrated that alternative splicing at exons 37a/b and 18a significantly impacts channel function.5,7–9,32,57,59,104,105 Inclusion
of e37a, as opposed to the more common e37b, is specific to dorsal root ganglia and increases
channel open time and expression at the plasma membrane.6,59 Additionally, e37a facilitates
opioid-mediated analgesia by enabling activity-independent CaV2.2 channel inhibition by µ-
opioid receptors.8 Cassette exon e18a is not restricted to dorsal root ganglia, but is included in
6 approximately half of Cacna1b transcripts in adult DRG. CaV2.2 channels containing e18a are protected from cumulative inactivation and show increased sensitivity to GS-mediated voltage-
independent inhibition.7
- 79 -
In this study, we use triple transgenic mouse strains that express individual splice isoforms of the CaV2.2 channel as well as ChR2-EYFP in Trpv1-lineage nociceptors to assess the
contribution of CaV2.2 channel splice isoforms to nociceptor function and pain-related behavior.
37b*b +18a ∆18a We crossed CaV2.2 , CaV2.2 , and CaV2.2 mouse strains into the Trpv1-Cre and ChR2-
EYFP mouse strains independently and used first generation triple transgenic mice in all
37aa* 37aa* experiments. A CaV2.2 mouse strain was excluded from analysis because CaV2.2 mice
8 +18a ∆18a 37b express reduced levels of CaV2.2 protein. We find that CaV2.2 , CaV2.2 , and CaV2.2 channel isoforms are all capable of supporting acute nociception. Furthermore, we find that
Trpv1-lineage nociceptor synapses function normally in the absence of e37a-containing CaV2.2
channels. We find that capsaicin-mediated inflammatory hyperalgesia is attenuated in the
absence of e37a-containing CaV2.2 channels, but that CFA-mediated inflammatory hyperalgesia is independent of splicing at e37. These findings suggest a specific role for the DRG specific isoform of CaV2.2 channels containing e37a in neurogenic inflammation, potentially through
their action in peripheral nociceptor terminals.
Results
Cacna1b-e37a is expressed in many neurons in DRG
Previous analyses of Cacna1b mRNA isolated from various tissues suggested that exon 37b is
expressed throughout the nervous system, whereas e37a was specifically found in DRG.6
Furthermore, e37a was more frequently found in cells that responded to application of
capsaicin, suggesting that e37a is enriched in Trpv1-expressing nociceptors.6 Until recently, it had been impossible to monitor e37a expression in intact tissue because antibodies raised against CaV2.2 channels are not specific and are unable to differentiate alternative splice isoforms. Using a novel RNA in situ hybridization method (BaseScope), however, we detected
- 80 -
Cacna1b transcripts containing e37a in fixed slices of DRG (Figure 20A). These probes are specific for Cacna1b transcripts containing e37a, because very little signal was detected in DRG
37b*b from CaV2.2 mice (Figure 20A) with the limited signal remaining reflecting non-specific
binding. Combining RNAScope® to detect Trpv1 mRNA with BaseScope® to detect Cacna1b-
e37a mRNA, we determined the extent to which e37a transcripts are restricted to Trpv1-
expressing nociceptors (Figure 20B). We found that e37a expression was much more broad
than Trpv1-expression, but that Trpv1 and e37a were frequently expressed in the same neuron.
To quantify the expression of Trpv1 and e37a, individual cells were selected using DIC
illumination and Trpv1 and Cacna1b-e37a signal were quantified using CellProfiler software
(Figure 20C). There was no relationship between e37a signal and Trpv1 signal. These results,
however, should be interpreted with caution. RNAScope® and BaseScope® are not quantitative
methods and parallel data from Eduardo Javier López Soto, a post-doctoral researcher in the
Lipscombe lab, utilizing qRT-PCR has found an enrichment of Cacna1b-e37a transcripts in
Trpv1-lineage neurons.
Constitutive expression of CaV2.2 channels containing e37b does not impact thermal
nociception
37a 37b CaV2.2 channels allow for greater calcium influx compared with CaV2.2 channels due to
longer channel open times and higher expression at the neuronal membrane. Based on these
37a differences in channel function and the enriched expression of CaV2.2 channels in
37a nociceptors, we hypothesized that blocking the generation of CaV2.2 channels might impair
37b*b 37aa* nociceptor function. Previous data suggested that CaV2.2 and CaV2.2 mice have normal
thermal nociception8, therefore, we measured responsiveness to direct nociceptor activation
with our novel, highly-sensitive optogenetic assay, as well as sensitivity to thermal stimuli, in
WT 37b*b CaV2.2 /Trpv1/ChR2-EYFP and CaV2.2 /Trpv1/ChR2-EYFP mice (Figure 21A, 21B). We
- 81 - found no difference in the sensitivity of WT and 37b-only mice to direct activation of Trpv1- lineage nociceptors by LED stimulation of the plantar hindpaw (Figure 21A). Nor did we find a difference in the response latency from noxious thermal stimuli (Figure 21B). Based on these
37b data, we conclude that CaV2.2 channels are sufficient for acute nociceptive behavior.
Sensory information leading to nocifensive behavioral responses passes through several
synaptic connections. Decreased function of one of these synaptic connections due to loss of
e37a-containing CaV2.2 channels may be masked or compensated for by normal or enhanced
function downstream in the circuit. CaV2.2 channels containing e37a are specifically expressed
in primary sensory neurons, thus, we decided to specifically examine the function of synaptic
connections between Trpv1-lineage nociceptors and secondary neurons in spinal cord dorsal
37a horn to determine if loss of CaV2.2 channels impairs nociceptor synaptic function.
Nociceptor synapses function normally in response to acute or prolonged activation in the
37a absence of CaV2.2 channels
In order to directly assess synaptic connections between primary sensory neurons and
secondary spinal cord dorsal horn neurons, we used blue light to activate Trpv1-lineage afferent
fibers in acute spinal cord slices from WT and e37b-only Trpv1/ChR2-EYFP mice. We recorded
post-synaptic currents in individual neurons in lamina II of spinal cord dorsal horn using a
gluconate-based internal to isolate monosynaptic light-evoked EPSCs (Figure 22A). Under
these conditions, we observed no change in post-synaptic currents recorded in slices from
37b*b CaV2.2 /Trpv1/ChR2-EYFP mice compared with currents recorded in slices from
WT CaV2.2 /Trpv1/ChR2-EYFP mice (Figure 22B-22D). The amplitude of post-synaptic currents
(Figure 22B), the overall charge that flows across the membrane (Figure 22C), and the
- 82 - weighted time constant of the EPSC decay fit by a double exponential (Figure 22D) were all similar, suggesting no impairment of synaptic function. However, the effect of e37a removal on synaptic function is likely to be subtle. Stimuli near the threshold for neuronal activation, as opposed to supramaximal stimuli, may provide better resolution and prolonged stimulation of afferent fibers may amplify subtle effects in synaptic function.
We used neutral density filters in the microscope light path to adjust stimulus intensity and measured EPSC amplitude at different light intensity levels (Figure 23A). Reducing light intensity effectively reduced post-synaptic current amplitude, however, there was no difference
WT between the intensity-amplitude curves for slices from CaV2.2 /Trpv1/ChR2-EYFP and
37b*b CaV2.2 /Trpv1/ChR2-EYFP mice (Figure 23B). Furthermore, we recorded light-evoked
EPSCs in spinal cord dorsal horn neurons in lamina II in response to 1 Hz (Figure 24) and 10
Hz stimulation (Figure 25). Most neurons followed 1 Hz stimulation perfectly (Figure 24B) and
WT the depression of EPSC amplitude was similar between slices from CaV2.2 /Trpv1/ChR2-
37b*b EYFP and CaV2.2 /Trpv1/ChR2-EYFP mice (Figure 24C). In response to 10 Hz stimulation, failures were more frequent, but there was still no difference between the response likelihood for
WT 37b*b 37b CaV2.2 synapses and CaV2.2 synapses (Figure 25B). These data suggest that CaV2.2
channels are sufficient for nociceptor synapse function in spinal cord dorsal horn. In order to
determine if e37a-containing CaV2.2 channels are particularly critical for the function of
peripheral nociceptor terminals, we used inflammatory compounds to induce thermal
WT 37b*b hyperalgesia in CaV2.2 /Trpv1/ChR2-EYFP and CaV2.2 /Trpv1/ChR2-EYFP mice.
37a CaV2.2 channels contribute to capsaicin-mediated hyperalgesia, but not CFA-mediated
hyperalgesia
- 83 -
CaV2.2 channels are critical for induction of capsaicin-mediated thermal hyperalgesia as well as the maintenance of CFA-mediated thermal hyperalgesia. Capsaicin specifically activates nociceptors to induce neurogenic inflammation, whereas CFA initiates a broad inflammatory response including nociceptors and immune cells. Loss of CaV2.2 channels has a more
pronounced impact on capsaicin-mediated hyperalgesia (Figure 19A), so we first injected
WT capsaicin (0.1%) into one hindpaw of CaV2.2 /Trpv1/ChR2-EYFP (Figure 26A) and
37b*b CaV2.2 /Trpv1/ChR2-EYFP (Figure 26B) mice and measured sensitivity to thermal stimuli.
Mice from both strains developed thermal hyperalgesia, although the effect was less severe in
37b*b WT CaV2.2 /Trpv1/ChR2-EYFP mice compared with CaV2.2 /Trpv1/ChR2-EYFP mice (Figure
26A, 26B). Quantifying the overall hyperalgesia by calculating the percent maximum possible
37b*b effect reveals that CaV2.2 /Trpv1/ChR2-EYFP mice develop less severe thermal
WT hyperalgesia compared with CaV2.2 /Trpv1/ChR2-EYFP mice 15 min after capsaicin injection
and actually become somewhat hypoalgesic by 30 minutes after injection (Figure 26C). This
37a suggests that CaV2.2 channels are involved in neurogenic inflammation.
To determine if CaV2.2 channels containing e37a are involved in inflammatory hyperalgesia
WT broadly, we injected 100% CFA into the hindpaw of CaV2.2 /Trpv1/ChR2-EYFP (Figure 26D)
37b*b and CaV2.2 /Trpv1/ChR2-EYFP (Figure 26E) mice and measured thermal sensitivity over several days. There was no significant difference between WT and e37b-only mice at any time point tested and quantification of the percent maximum possible effect (Figure 26F) did not
37b reveal any subtle differences. This suggests that CaV2.2 channels are sufficient for non-
37a neurogenic inflammation and these data point to a privileged role for CaV2.2 channels in
neurogenic inflammation.
- 84 -
Constitutive expression or removal of exon 18a from CaV2.2 channels does not impair acute nociception
+18a CaV2.2 channels have a β-subunit-dependent depolarizing shift in the steady state
inactivation curve and are protected from cumulative inactivation during sustained trains of
7,57 +18a action potentials. CaV2.2 channels are highly expressed in DRG, so constitutive
expression or removal of e18 from CaV2.2 channels may have a large influence on overall nociceptor function.6 Based on differences in channel inactivation, we hypothesized that
+18a nociceptors constitutively expressing CaV2.2 channels would show reduced channel
∆18a inactivation and increased function, whereas nociceptors constitutively expressing CaV2.2 channels would show increased channel inactivation and reduced function. To test this, we
+18a assessed nocifensive behavioral responses of CaV2.2 /Trpv1/ChR2-EYFP and
∆18a CaV2.2 /Trpv1/ChR2-EYFP mice to hindpaw stimulation by blue light as well as thermal stimuli (Figure 27). Compared with WT mice, there was a slight, but not significant, shift towards reduced responsiveness to direct nociceptor activation in mice constitutively expressing
+18a CaV2.2 channels only (Figure 27A). Mice lacking e18a were comparable in sensitivity to WT
mice (Figure 27C). Regarding thermal sensitivity, there was no difference between either
+18a ∆18a WT CaV2.2 /Trpv1/ChR2-EYFP or CaV2.2 /Trpv1/ChR2-EYFP mice and CaV2.2 /Trpv1/ChR2-
+18a ∆18a EYFP mice (Figure 27B, 27D). These data suggest that both CaV2.2 and CaV2.2
channels are sufficient for nociceptor function. Additional experiments will be required to
determine the role of e18a in the function of nociceptor synapses or inflammatory hyperalgesia,
but the broad expression pattern of e18a compared with e37a does not point to a specific
+18a ∆18a function of CaV2.2 or CaV2.2 channels in the pain pathway.
Discussion
- 85 -
Alternative splicing alters protein function to better suit the needs of individual cell types. The role that alternative splicing plays in complex biological functions, however, has been difficult to elucidate due to the complexity of neuronal circuits, the heterogeneity of neuronal subtypes
within individual tissues, the vast number of alternatively spliced genes, and the multitude of
alternative isoforms generated from each gene. In this study, we use triple transgenic mouse
strains that express individual splice isoforms of the CaV2.2 channel as well as ChR2-EYFP in
Trpv1-lineage nociceptors to assess the contribution of CaV2.2 channel splice isoforms to
nociceptor function and pain-related behavior. We find that all tested CaV2.2 channel splice
37a 37b +18a ∆18a isoforms tested—CaV2.2 , CaV2.2 , CaV2.2 , and CaV2.2 —are sufficient to mediate
37b nocifensive behavioral responses and that CaV2.2 channels are sufficient for nociceptor
synaptic function. We find that capsaicin-mediated inflammatory hyperalgesia is attenuated in
the absence of e37a-containing CaV2.2 channels, but that CFA-mediated inflammatory hyperalgesia is independent of splicing at e37. These findings suggest a specific role for the
DRG specific isoform of CaV2.2 channels containing e37a in neurogenic inflammation, potentially through their action in peripheral nociceptor terminals.
CaV2.2 channel splicing at e37 and e18a does not impact acute nociception
CaV2.2 channels significantly contribute to behavioral responses to noxious stimuli. Mice lacking
CaV2.2 channels are somewhat less sensitive to thermal and mechanical stimuli, but are dramatically less sensitive to direct activation of Trpv1-lineage nociceptors. Based on the
6,7,57,59 functional alterations associated with CaV2.2 channel splicing decisions, we hypothesized
that manipulation of alternative splicing of the CaV2.2 channel might influence acute nociception.
We found that mice constitutively expressing CaV2.2 channels containing e37b or e18a or
constitutively lacking e18a were equally sensitive to direct nociceptor activation as wild-type
mice. Direct comparisons between splice isoform selective mouse strains, for example
- 86 -
∆18a +18a CaV2.2 /Trpv1/ChR2-EYFP mice compared with CaV2.2 /Trpv1/ChR2-EYFP mice, are not possible because each mouse strain was generated on a different genetic background. For this reason, each mouse strain was compared against a wild-type mouse strain developed from the same genetic background to control for potential off-target effects. We anticipated that there would likely be no observable effect on thermal nociception based on the relatively small
-/- impairment of thermal nociception observed in CaV2.2 mice; however, the lack of change in sensitivity to direct nociceptor was somewhat surprising. These data indicate that, although
CaV2.2 channels are important for acute pain responses, the many CaV2.2 channel isoforms are
capable of supporting sufficient calcium entry to mediate neurotransmitter release.
CaV2.2 channels containing e37a are not necessary for function of Trpv1-lineage nociceptor synapses
-/- In CaV2.2 mice, we observed a significant impairment of synaptic currents in spinal cord dorsal
horn accompanying decreased behavioral responses to nociceptor activation. Although we
observed no change in pain behavior in e37b-only mice, we tested for potential changes in
synaptic function resulting from loss of CaV2.2 channels containing e37a. We found no change
in the amplitude or shape of synaptic currents, the sensitivity of pre-synaptic terminals to blue
light, or the fidelity of synaptic transmission during periods of rapid stimulation. These results
suggest that even during periods of intense activation of Trpv1-lineage neurons, which might
amplify effects of reduced CaV2.2 channel inactivation, synaptic function is not impaired by loss of e37a containing CaV2.2 channels.
CaV2.2 channels contribute to capsaicin-mediated inflammatory hyperalgesia, but not CFA- mediated hyperalgesia
- 87 -
CaV2.2 channels were not critical for any aspect of sensory neuron excitability, but peripheral
CaV2.2 channels played a significant role in capsaicin- and CFA-mediated inflammatory
hyperalgesia. We hypothesized that the larger calcium currents that are generated by CaV2.2 channels containing e37a might be necessary to drive sufficient exocytosis of inflammatory mediators to mediate inflammatory hyperalgesia. Indeed, following intradermal injection of capsaicin, mice lacking CaV2.2 channels containing e37a developed a less severe form of
hyperalgesia; however, hyperalgesia resulting from intradermal CFA was completely normal.
The attenuation of capsaicin-mediated hyperalgesia, rather than complete abolition as observed
-/- in CaV2.2 mice, suggests that either inflammatory mediators are released at lower levels in
e37b-only mice or that the release of some mediators requires CaV2.2 channels containing
e37a, whereas release of others does not. From these experiments, we cannot distinguish
between these two possibilities and future experiments addressing this would be of great
interest.
37a In conclusion, we find a novel role for CaV2.2 channels in mediating neurogenic inflammation.
- 88 -
Figure 20. Cacna1b-e37a is expressed in Trpv1- expressing neurons in dorsal root ganglia. (a) RNA in situ hybridization detection of Cacna1b transcripts WT containing exon 37a in DRG from CaV2.2 and 37b*b CaV2.2 mice. Exon 37a signal (red) is widespread WT throughout CaV2.2 DRG and absent in DRG from 37b*b CaV2.2 mice. RNA signal is shown with grayscale DIC image to identify neuronal cell bodies. (b) Simultaneous detection of Cacna1b-e37a and Trpv1 mRNA transcripts WT in DRG from CaV2.2 mice. Left Overlay of Cacna1b- e37a (magenta) and Trpv1 (yellow) mRNA shown with grayscale DIC image to identify neuronal cell bodies. Right Individual grayscale images of Cacna1b-e37a (top) and Trpv1 (bottom) mRNA signals. All scale bars represent 25 µm. (c) Relationship between Trpv1 expression and e37a expression in DRG. Trpv1 and Cacna1b-e37a mRNA were quantified in individual cells automatically using CellProfiler software. Each point represents an individual cell.
- 89 -
Figure 21. Alternative splicing at Cacna1b- e37a/b does not impact acute nociception. (a-b) WT 37b*b CaV2.2 and CaV2.2 mice were tested for sensitivity to Trpv1- lineage nociceptor activation (a) and thermal stimuli (b). For A, symbols represent average, shaded area reflects standard error, and solid lines are average sigmoidal fit. Significance calculated by 37b*b repeated measures ANOVA for genotype*intensity interaction was p = 0.998 for 8 CaV2.2 WT mice and 5 CaV2.2 mice. For B, each point is an individual mouse, with average response latency and standard error shown as line and shaded area respectively. Significance calculated 37b*b WT by univariate ANOVA for response latency was p = 0.098 for 8 CaV2.2 mice and 5 CaV2.2 mice.
- 90 -
Figure 22. Synaptic currents are unaffected by loss of e37a-containing CaV2.2 channels. (a) Synaptic currents were elicited by brief pulses of blue light and recorded in neurons of spinal cord dorsal horn lamina II. (b-d) Amplitude (b), total charge (c), and weighted time-constant of EPSC decay fit by a double exponential (d) are not WT significantly different between CaV2.2 and 37b*b CaV2.2 neurons. Each point represents an individual cell shown with average and standard error as horizontal line and shaded area, respectively. Average ± SE and significance assessed by multivariate ANOVA are for amplitude WT 37b*b (CaV2.2 : -458.1 ± 82.1 pA, CaV2.2 : -479.8 ± WT 94.8 pA, p = 0.865), charge (CaV2.2 : -15.5 ± 1.6 37b*b pA, CaV2.2 : -14.3 ± 1.9 pA, p = 0.641), and WT 37b*b time constant (CaV2.2 : 38.9 ± 5.0 pA, CaV2.2 : 32.7 ± 5.7 pA, p = 0.426) with n = 8 cells per 37b*b genotype. Two cells from the CaV2.2 genotype were poorly fit by a double exponential and are excluded from the charge and time-constant analyses.
- 91 -
Figure 23. Nociceptor synapses lacking e37a-containing CaV2.2 channels are equally sensitive to blue light. (a) Neutral density filters were used to reduce light intensity for spinal cord slice stimulation. Example traces shown are from individual cells and represent 100% light intensity (no filters), 1.5% light intensity (ND4 + ND16), and 0.2% light intensity (ND4 + ND8 + ND16). (b) Quantification of peak EPSC amplitude using different light intensity. Response amplitudes were normalized to the mean peak amplitude using no filters. There is no WT 37b*b significant difference between CaV2.2 (gray, n = 8 cells) and CaV2.2 (red, n = 8 cells) intensity-response curves (p = 0.423 assessed by repeated measures ANOVA). Each dot represents the group average and the shaded area represents standard error.
- 92 -
Figure 24. Nociceptor synapses lacking e37a-containing CaV2.2 channels respond normally to 1 Hz stimulation. (a) Acute spinal cord slices were stimulated 10 times at 1 Hz using blue light. (b) The number of detectable post-synaptic responses was counted. Responses were detected if at least 10% of initial peak amplitude. All cells, 8 per genotype, with one exception, perfectly followed 1 Hz stimulation. (c) Post-synaptic currents depress equally between WT 37b*b CaV2.2 and CaV2.2 slices. Points reflect average of 8 cells per genotype and shaded area represents standard WT error for CaV2.2 (gray) and 37b*b CaV2.2 (red). Significance assessed by repeated measures ANOVA was p = 0.464
- 93 -
Figure 25. Nociceptor synapses lacking e37a-containing CaV2.2 channels respond normally to 10 Hz stimulation. (a) Synaptic currents were elicited at a rate of 10 Hz in WT b*b CaV2.2 and CaV2.2 slices by 10 pulses of blue light. (b) Number of responses was similar in WT 37b*b 8 slices per genotype from CaV2.2 (gray) and CaV2.2 (red) mice. Significance assessed by univariate ANOVA was p = 0.576. Individual cells are shown as points along with average and standard error as horizontal line and shaded area, respectively.
- 94 -
Figure 26. Removal of Cacna1b-e37a impairs capsaicin- mediated, but not CFA-mediated, thermal hyperalgesia. (a,b) Response latency from a thermal stimulus was measured following hindpaw injection of capsaicin in WT CaV2.2 (a) and 37b*b CaV2.2 (b) mice. Ipsilateral paws are indicated by closed circles and contralateral paws are indicated by open circles. Significance calculated by repeated measures ANOVA for 37b*b WT genotype*time interaction was p = 0.498 for 7 CaV2.2 mice and 10 CaV2.2 mice. (c) WT 37b*b Percent maximum possible effect of capsaicin in CaV2.2 (black) and CaV2.2 (red) mice calculated by the formula Percent MPE = x 100. Average and standard error are Latency0−Latencyt represented as symbols and shaded area respectively.Latency0 Significance calculated by repeated 37b*b measures ANOVA for genotype*time interaction was p = 2.7E-5 for 7 CaV2.2 mice and 10 WT CaV2.2 mice. (d,e) Response latency from a thermal stimulus was measured following WT 37b*b hindpaw injection of CFA in CaV2.2 (d) and CaV2.2 (e) mice. Ipsilateral paws are indicated by closed circles and contralateral paws are indicated by open circles. Significance calculated 37b*b by repeated measures ANOVA for genotype was p = 0.139 for 8 CaV2.2 mice and 8 WT CaV2.2 mice. (f) Percent maximum possible effect of CFA, calculated as described above, in 37b*b WT (black) and CaV2.2 (red) mice. Significance calculated by repeated measures ANOVA 37b*b WT for genotype*time interaction was p = 0.500 CaV2.2 mice and 8 CaV2.2 mice.
- 95 -
Figure 27. Alternative splicing at Cacna1b- e18a does not impact acute nociception. (a,b) WT +18a CaV2.2 and CaV2.2 mice were tested for sensitivity to Trpv1- lineage nociceptor activation (a) and thermal stimuli (b). (c,d) WT ∆18a CaV2.2 and CaV2.2 mice were tested for sensitivity to Trpv1- lineage nociceptor activation (c) and thermal stimuli (d). For A and C, symbols represent average, shaded area reflects standard error, and solid lines are average sigmoidal fit. Significance calculated by repeated measures ANOVA for +18a ∆18a genotype*intensity interaction was for CaV2.2 (p = 0.386) and for CaV2.2 (p = 0.573). For B and C, each point is an individual mouse, with average response latency and standard error shown as line and shaded area respectively. Significance calculated by univariate ANOVA for +18a ∆18a response latency was for CaV2.2 (p = 0.881) and for CaV2.2 (p = 0.045).
- 96 -
CHAPTER 6
Discussion
In my dissertation research, I sought to determine how CaV2.2 channels and specific isoforms of
CaV2.2 channels contribute to acute nociception and inflammatory hyperalgesia. Acute nociception is the detection of noxious stimuli, whereas inflammatory hyperalgesia is a state of heightened sensitivity to noxious stimuli resulting from inflammation. CaV2.2 channels are mediators of hyperalgesia resulting from nerve injury, but a role for CaV2.2 channels in acute
47,106,107 nociception is debated. I present evidence that CaV2.2 channels are involved in acute thermal and mechanical nociception, but show that they are most critical at sub-maximal stimulus intensities. I also demonstrate that CaV2.2 channels have an unappreciated role in epidermal nociceptor terminals where I found that they are critical for inflammatory hyperalgesia.
5,102 Alternative pre-mRNA splicing generates functionally diverse CaV2.2 channel isoforms.
CaV2.2 channel isoforms are cell-type specific and regulated by developmental age, but the
differential contribution of CaV2.2 channel isoforms to specific neuronal functions is poorly
5,8,32,102 understood. Focusing on two splice sites, I find that all CaV2.2 channel isoforms tested—
+18a ∆18a 37b 37a CaV2.2 , CaV2.2 , CaV2.2 , and CaV2.2 —are capable of supporting acute nociception,
37a and, in addition, I demonstrate that CaV2.2 isoforms have a privileged role in inflammatory
hyperalgesia.
A critical role for CaV2.2 channels in inflammatory hyperalgesia suggests that CaV2.2 channel inhibitors may be effective therapies for a wide-range of inflammatory pain conditions.
37a Furthermore, future compounds with high efficacy against CaV2.2 channels might be
especially effective at relieving pain stemming from cutaneous inflammation. In this chapter, I
discuss the current state of chronic pain therapies and how novel CaV2.2 channel inhibitors may
- 98 - represent a new generation of analgesics with fewer side effects, to treat certain forms of inflammatory pain.
Chronic pain: Current analgesic therapies
Typical medications for pain management generally fall into three categories: non-opioid, opioid, and adjuvant analgesics.108 Pain management usually begins with non-opioid over-the-counter
pain relievers such as acetaminophen or non-steroidal anti-inflammatory drugs (NSAIDs),
including ibuprofen, naproxen, or aspirin. Each of these treatments reduces inflammatory
signaling by inhibiting cyclooxygenase (COX) enzymes which generate prostaglandins during
inflammation.108 COX enzymes come in two forms, COX-1 and COX-2, and each NSAID may
differentially inhibit each isoform.108 Acetaminophen is a relatively weaker analgesic compared
with NSAIDs owing to less potent inhibition of COX-1 and COX-2, but is usually better tolerated
by patients. Acetaminophen and NSAIDs are highly effective against inflammatory pain, but
ineffective for relieving neuropathic pain and can only be used sparingly due to detrimental
effects on the gastrointestinal tract, liver toxicity, and increased risk of cardiovascular disease
associated with prolonged usage.108
Opioids have been used to relieve pain for centuries. Opioid analgesics bind to opioid receptors
in the nervous system and gastrointestinal tract and provide analgesia, in part, by opioid
8,32,108 receptor-mediated inhibition of CaV2 channels in nociceptors. Over the years, many
different synthetic opioids have been developed with varying degrees of selectivity for different
opioid receptors.108 Opioid receptor specificity contributes to the efficacy and side-effects of
opioid drugs, which is why significant resources have been spent modifying natural opioids to
increase analgesic efficacy and reduce side-effects.108 The widespread usage of opioids for pain
- 99 -
management is a matter of some debate due to significant problems with abuse and
tolerance.108 Along with pain relief, opioids induce strong feelings of euphoria, promoting their
recreational use. Recreational use often leads to addiction and dependence, which is the
adaptation of the body to the presence of the drug.108 Following cessation of opioid treatment,
patients may experience withdrawal symptoms, such as irritability, sweating, nausea, and
vomiting. Opioid tolerance requires increasing doses of opioids to maintain analgesia,
increasing side-effects and the risk of addiction and dependence. For these reasons, prolonged
opioid usage is not recommended, but absent better options they continue to be used.108
Adjuvant therapies are those that are designed and intended for other disorders, but have some efficacy for reducing chronic pain symptoms.108 Anti-depressants and anti-convulsants are most
common, but anti-psychotic or benzodiazepine treatments have also been used.108 These therapies generally require a lot of trial-and-error for matching individual patients with the particular therapy that works best for them. Some anti-depressant drugs act by increasing serotonin or norepinephrine signaling and descending input from the brain to the spinal cord uses both of these neurotransmitters.108 Descending serotonergic and noradrenergic input in the
spinal cord inhibits pain signals, thus, increasing serotonin or norepinephrine signaling may
provide analgesia.108 In contrast to anti-depressant therapies, the mechanisms by which anti-
convulsants relieve pathological pain are poorly understood. Generally, anti-convulsants act to
reduce neural activity to prevent seizure initiation and reducing neural activity in the spinal cord
may help prevent pathological pain signals from reaching the brain.108 Anti-depressant or anti- convulsant therapies will not work for all patients or all forms of chronic pain and some side- effects may be severe. Anti-psychotic and benzodiazepine treatments are generally not recommended for chronic pain, as neither provides analgesia, but may help to relieve fringe symptoms, such as anxiety and loss of sleep.108
- 100 -
The variety of potential treatment options demonstrates the challenge for physicians and
patients. Each therapeutic strategy offers some advantages, but also substantial drawbacks
and, for most patients, it is necessary to empirically test several approaches before choosing
the regimen with acceptable side-effects and pain relief. Below, I discuss two novel approaches
for chronic pain relief targeting CaV2.2 channels: peripheral CaV2.2 channel inhibition to relieve
chronic inflammation and isoform specific CaV2.2 channel inhibition.
Inflammatory pain relief by peripheral inhibition of CaV2.2 channels
We demonstrate here that peripheral inhibition of CaV2.2 channels prevents inflammatory hyperalgesia without interrupting acute nociception. This distinction is critically important for applying this strategy in human patients. Currently, lidocaine patches, topical ointments, or injections can be used to relieve pain, but also block acute nociception and all other somatosensation from the targeted area, providing a feeling of numbness. Lidocaine inhibits voltage-gated sodium channels, preventing action potential initiation in primary sensory
109,110 neurons. By contrast, a similar approach targeting CaV2.2 channels would specifically prevent release of inflammatory mediators, sparing the normal function of primary somatosensory neurons.
The principle benefits of this approach would be the ease of drug application and the reduced potential for neurological and cardiac side-effects. One of the major challenges for developing novel drugs targeting the central nervous system is the blood-brain barrier.111 The blood-barrier
acts as a filter to prevent toxins from reaching the brain via the blood stream, but is also highly
effective at blocking pharmacological agents from entering the central nervous system.111
Current pain management via ziconotide circumvents the blood-brain barrier by direct injection
- 101 - into the spinal cord through a surgically implanted micropump. Peripheral use of ziconotide would also circumvent this challenge because peripheral nerves are not protected by the blood- brain barrier and would also obviate the need for surgical pump implantation. Furthermore, the blood-brain barrier may actually be a benefit by preventing epidermal ziconotide from entering the central nervous system. Current side effects of ziconotide treatment arise from wide-spread
31 inhibition of CaV2.2 channels in the brain and sympathetic nervous system. Ziconotide applied to the epidermis should be excluded from these locations.
A major drawback of this approach is the relatively small area treated by local application. For several severe chronic pain conditions, pain is not localized to a single site, but is widespread across the body. In contrast to acetaminophen or NSAIDs, which can be administered systemically for widespread inflammatory pain, topical ziconotide would need to be applied to each site individually to reduce inflammation. Furthermore, most complaints of inflammatory pain are not from epidermal inflammation, but inflammation of deep tissues, such as joints. This could be remedied by use of acute injections, as is done for treatment of arthritis by steroids, but would require frequent doctor visits for pain management and multiple injections would be required to treat several joints, reducing the convenience this strategy offers.112
Translation of this approach to the clinic would be relatively easy. CaV2.2 channel inhibitors have already been developed and advanced to clinical trials.2 By contrast, the second novel approach, isoform specific of inhibition of CaV2.2 channels, would require significantly more effort to translate to the clinic.
Isoform specific CaV2.2 channel inhibition for analgesia
- 102 -
5,102 CaV2.2 channels come in many forms due to alternative splicing of the Cacna1b mRNA.
Splicing is cell-type specific, resulting in expression of specific splice isoforms of CaV2.2
channels in distinct neuronal populations.5,102 In nociceptors, e37a can be included in Cacna1b
mRNA, but inclusion of e37a throughout the rest of the nervous system is repressed.6 By
37a developing drugs that specifically target the CaV2.2 channel isoform, analgesia may be
accompanied by fewer side-effects. Previous work form the Lipscombe lab demonstrated that
37a 37b thermal nociception in mice expressing only CaV2.2 or CaV2.2 channels is similar to wild-
8 37b type mice. Here, we confirmed this for mice expressing only CaV2.2 channels and extended
∆18a +18a this to mice only expressing CaV2.2 and CaV2.2 channels. Furthermore, mice expressing
37b ∆18a +18a only CaV2.2 , CaV2.2 , or CaV2.2 channels have normal sensitivity to direct activation of
nociceptors.
37b ∆18a Although we find no difference in acute nociception in CaV2.2 -only, CaV2.2 -only, or
+18a CaV2.2 -only mice, it may still be possible that isoform-selective CaV2.2 channel inhibition
provides analgesia. Isoform-specific inhibition would reduce total calcium influx, whereas
37b ∆18a calcium influx is normal in CaV2.2 -only mice and expected to be normal in CaV2.2 -only,
+18a and CaV2.2 -only mice. This degree of inhibition may be sufficient to disrupt pathological pain signals with reduced side-effects in the central nervous system, but so far no isoform-selective drugs have been developed.
A somewhat different approach may be to manipulate the splicing of CaV2.2 channels during chronic pain to provide or promote analgesia. Previous and ongoing work from the Lipscombe
37a lab demonstrated a down-regulation of the CaV2.2 channel isoform following nerve injury,
contributing to a decrease in morphine-mediated analgesia.8 By reversing this change in splicing
- 103 -
to promote inclusion of e37a, morphine analgesia may be restored. Furthermore, increasing
inclusion of e37a would further improve efficacy of isoform-specific CaV2.2 channel inhibitors.
Ongoing work in the lab by Dr. E. Javier López Soto suggests that DNA methylation contributes
to regulation of e37a inclusion in Cacna1b mRNA and targeted de-methylation may be able to
rescue e37a inclusion following nerve injury.
The approaches described above, peripheral CaV2.2 channel inhibition and isoform-specific
CaV2.2 channel inhibition, focus on preventing pathological pain signals from entering the central nervous system. However, a wealth of literature points to central changes in the spinal cord and brain that drive pathological pain. Collectively, these changes are known as central sensitization.84 Prevention or reversal of central sensitization may be one of the most effective
methods for reversing chronic pain symptoms and below I discuss my findings in the context of
central sensitization.
Chronic pain mechanisms: central sensitization
Central sensitization may be most simply described as an uncoupling of central pain circuitry in
the spinal cord from primary sensory input.84 In normal nociception, the intensity and location of
painful stimuli are encoded by primary sensory neurons and faithfully transmitted to secondary
neurons in the spinal cord; in the context of central sensitization, this is no longer the case. Low-
threshold sensory inputs to the spinal cord feel painful due to a conversion of secondary
nociceptive neurons in the spinal cord into wide-dynamic range neurons.84 Noxious stimuli
disproportionately activate spinal cord neurons because of increased temporal windup and
synaptic summation.84 Spinal cord neuron receptive fields increase in size, allowing individual
stimuli to activate large swathes of the spinal cord and resulting in poorly localized pain.84
- 104 -
Central sensitization is an activity dependent process. The key trigger for central sensitization
appears to be an increase above some critical limit in intracellular calcium in spinal cord
neurons.84 This critical feature of central sensitization allows for a broad range of specific molecules, signaling pathways, and neuronal activities to participate. Glutamate released from sensory neurons may bind to NMDA-type glutamate receptors, increasing intracellular calcium, but the same glutamate may also bind to AMPA-type and metabotropic glutamate receptors to activate voltage-gated calcium channels and promote calcium release from intracellular stores.84
Even inflammatory signaling through BDNF, nitric oxide, bradykinin, substance P, or CGRP can contribute to intracellular calcium increases in the spinal cord and drive central sensitization.84
One potential mechanism by which central sensitization may be initiated is via a combination of peripheral sensitization and ongoing sensory input. We provide evidence that ongoing sensory input in the absence of peripheral sensitization is insufficient to induce hyperalgesia, suggesting that normal sensory input, even for extended amounts of time, may not sufficiently increase intracellular calcium in spinal cord neurons to induce central sensitization. However, in the presence of inflammation, peripheral neurons become hyperexcitable and this increase in activity may be critical for driving high levels of intracellular calcium that initiate central sensitization. In this regard, CaV2.2 channels may be critical regulators of central sensitization by contributing both to synaptic function, the primary source of glutamate for activating NMDA,
AMPA, and metabotropic glutamate receptors, and inflammation, the primary driver of peripheral sensitization.
For the clinic, the numerous ways that central sensitization can be induced could be a benefit or a challenge. It may suggest that blocking any one of several components is sufficient to prevent
- 105 -
central sensitization or it may suggest that many approaches employed simultaneously are
necessary. One attractive approach to preventing chronic pain would be to block central
sensitization at its source. This may be achieved through reducing inflammation or blocking
neuronal signaling. Such a strategy would be ideal for surgery or other planned injuries when
appropriate precautions can be taken prior to and during the initial injury. However, this will be
challenging for the vast majority of chronic pain patients whose pain results from nerve damage
or an injury. Specific therapeutic strategies directly combatting central sensitization will be
critical for effective pain relief in these patients.
Spinal cord plasticity and central sensitization
A dominant feature of central sensitization in the spinal cord is an overall increase of synaptic
activity. Because of this, many researchers draw a parallel between cortical long-term
potentiation (LTP) and central sensitization, suggesting that central sensitization is a form of
LTP induced in the spinal cord that mediates chronic pain.84,97,113 Cortical LTP can be induced
using a variety of conditioning stimuli and is persistent long beyond the termination of
conditioning stimulation.84,97,113 Similar LTP has been observed in the spinal cord in response to
both high-frequency and low-frequency nociceptor stimulation.84,97,113 NMDA receptors and
NMDA receptor-mediated calcium influx are necessary for classical cortical LTP as well as
central sensitization and spinal LTP.84,97,113 These similarities support a link between LTP and
central sensitization, but equating the two is an oversimplification.84,97,113
Cortical LTP is a purely homosynaptic phenomenon, whereas central sensitization is a heterosynaptic phenomenon.84 Homosynaptic signifies that the synapses that are activated by
the conditioning stimulus are the synapses that express the potentiation; by contrast,
- 106 -
heterosynaptic potentiation is when conditioning stimuli are applied to a primary synapse, but
the potentiation is observed at a distinct, secondary synapse. An example of homosynaptic
potentiation in the spinal cord is that evoked neurotransmitter release from C-fibers is increased
following 100 Hz stimulation of C-fiber afferents in acute spinal cord slices. Heterosynaptic
potentiation is exemplified by the data I present in Chapter 4: optogenetic stimulation of Trpv1-
lineage nociceptors at 2 Hz potentiates inhibitory synapses in the spinal cord. In this example,
conditioning stimuli are only applied to sensory synapses, whereas potentiation is observed at
secondary synapses in the spinal cord.
The physiological results of these two forms are potentiation are radically different. Classic LTP
at nociceptor synapses could be readily expected to elicit hyperalgesia, increased
responsiveness to noxious stimuli. None of the features described as central sensitization,
however, including conversion of spinal nociceptive neurons to wide-dynamic range neurons,
increasing size of spinal receptive fields, or increased wind-up at non-nociceptive synapses, are
easily explainable only through homosynaptic potentiation.84 Both homosynaptic and
heterosynaptic forms of potentiation occur in the spinal cord and focusing solely on one form or
the other will not result in a clear understanding of central sensitization or chronic pain.84,97,113
Future directions
The findings described here suggest interesting new directions for future work aimed at understanding the role of CaV2.2 channels and alternative splicing in chronic pain. In Chapter 3,
I demonstrate that CaV2.2 channels are critical for inflammatory pain, but are not required for inflammatory edema. This data, and the differential efficacy of acetaminophen and NSAIDs to alleviate inflammatory swelling, suggest multiple parallel signaling pathways mediated by
- 107 -
-/- inflammation. CaV2.2 mice may provide an interesting tool to investigate signaling pathways
critical for swelling and signaling pathways for pain during inflammation. Unbiased proteomic
+/+ -/- screens of inflammatory mediators present in inflamed skin from CaV2.2 and CaV2.2 mice
would reveal CaV2.2-dependent signaling pathways critical for inflammatory hyperalgesia. Drugs
specifically targeting these pathways may provide analgesia comparable to conventional
NSAIDs without concerns for gastrointestinal health.
37a A second interesting direction would be to investigate how the CaV2.2 channel isoform
37a uniquely contributes to inflammatory pain. CaV2.2 channels are both more efficiently trafficked
to the neuronal membrane and give rise to larger currents due to longer single channel open
37b times compared with CaV2.2 channels. The more facile channel trafficking may result in an
37a 37b enrichment of CaV2.2 channels at peripheral nociceptor terminals relative to CaV2.2
channels, thereby promoting inflammatory hyperalgesia. Testing this poses a substantial
technical challenge. Previous work from the Dolphin lab has utilized tagged CaV2.2 channel
constructs to monitor channel trafficking in real time in neuronal cell lines and cultured DRG
114 neurons. However, transient transfection of tagged CaV2.2 channel constructs alters the
37a 37b 37aa* normal balance of CaV2.2 and CaV2.2 channel isoforms. Instead, the CaV2.2 and
37b*b CaV2.2 mice described previously in this thesis may be a better tool. Using these mice, we
could examine CaV2.2 channel expression at nociceptor terminals in the skin and quantify
relative expression levels in e37a-only and e37b-only strains. The challenge, however, is finding
a method that can specifically detect CaV2.2 channels in situ; antibodies raised against CaV2.2
channels are not specific.
- 108 -
An alternative explanation for how CaV2.2 channels facilitate inflammatory hyperalgesia is by
driving greater calcium entry at peripheral nociceptor terminals. To test this, we could express
GCaMP6f in Trpv1-lineage neurons and quantify changes in fluorescence intensity in response
to application of capsaicin, mechanical stimuli, or electrical stimuli to isolated skin sections.
37b*b Reduced calcium influx in skin from CaV2.2 mice, or increased calcium influx from
37aa* WT CaV2.2 skin, compared to CaV2.2 mice might reflect the increased calcium flux through
37a CaV2.2 channels. A change in CaV2.2 channel expression in peripheral nociceptor terminals, however, might yield similar results; thus, it would be necessary to first ensure that CaV2.2
WT 37aa* 37b*b channel expression at peripheral terminals is similar in CaV2.2 , CaV2.2 , and CaV2.2
mice.
Conclusion
Voltage-gated calcium channels are important mediators of nociception and pain. The goal of this dissertation work was to elucidate the contributions of CaV2.2 channels and specific channel
splice isoforms to nociception and pain. The canonical role of CaV2.2 channels is mediating
neurotransmitter release from sensory nerve terminals in the spinal cord. I demonstrate here a
novel, critical role for CaV2.2 channels in peripheral nociceptor terminals in the skin where they
37a facilitate inflammatory hyperalgesia. Furthermore, I demonstrate that CaV2.2 channels, which are expressed primarily in nociceptors, contribute to the ability of nociceptors to drive inflammatory pain. These findings suggest a new path for future analgesics by targeting peripheral CaV2.2 channels or CaV2.2 channel splice isoforms. Although the field of pain research is well established, novel analgesic therapies have lagged behind basic research and chronic pain represents a significant unmet clinical need. Studies such as these that further our understanding of basic mechanisms underlying pain and nociception will help to bridge the gap between the lab and the clinic.
- 109 -
Materials and Methods Mice
All mice used in this work were bred at Brown University, with the exception of Trvp1-/- mice
(Jackson Laboratory: 003770), and all protocols and procedures were approved by the Brown
University Institutional Animal Care and Use Committee. For all behavioral experiments, both
male and female mice were included. For physiology experiments, sex was not identified prior to
tissue collection. Blinding was used when indicated.
Generation of novel CaV2.2 mouse strains. All primers used in creation of novel CaV2.2 mouse strains are shown in Table 2. All cloning, targeting vector construction, embryonic stem (ES) cell
PCR screening, genotyping, and breeding were carried out by Sylvia Denome. The Transgenic
Facility at Brown University maintains 129Ola ES cell cultures and carried out ES cell
transfections and blastocyst injections.
-/- We generated a CaV2.2 mouse strain by insertion of an EGFP+stop cassette in frame in exon
1 of the Cacna1b gene. To create the ∆CaV2.2+EGFP targeting construct, a 12 kb NsiI fragment from the 129S mouse BAC genomic clone bMQ122-B9 (Source BioScience) was cloned into the
PstI site of pBSSK+. An AgeI site was inserted into exon 1 of Cacna1b by mutagenesis using a
QuickChange II XL site-directed mutagenesis kit (Stratagene) with primers 1-For and 1-Rev.
The EGFP+stop codon was inserted in-frame into exon 1 at the AgeI site following amplification
from pEGFP-C1 (BD Biosciences) using primers 2-For and 2-Rev. The loxP-NeoR-loxP
cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR
amplification from pL452 (Addgene) using primers 3-For and 3-Rev. The final targeting
construct was 14.8kb.
∆18a We generated a CaV2.2 mouse strain by fusing e18 and e19 of the Cacna1b gene. To create
the CaV2.2-∆e18a targeting construct, a 12kb XbaI-KpnI fragment from BAC clone BMQ175b12
(Source BioScience) was cloned into pBSKS-. Digestion with BsaBI and NsiI removed 4.9kb,
- 111 -
leaving ~1.2kb of intron between e18 and e19. The remaining 1.2kb was precisely deleted using
two mutagenesis reactions by QuickChange II XL site-directed mutagenesis kit (Stratagene)
with, first with primers 6-For & 6-Rev, then 7-For & 7-Rev. The loxP-NeoR-loxP cassette was
inserted into an introduced SpeI site between e17 and e18 following PCR amplification from
pL452 (Addgene) using primers 8-For and 8-Rev. The final targeting construct was 10.6kb.
+18a We generated a CaV2.2 mouse strain by fusing e18, e18a, and e19 of the Cacna1b gene. To
create the CaV2.2-e18/e18a/e19 targeting construct, a 12kb XbaI-KpnI fragment from BAC
clone BMQ175b12 (Source BioScience) was cloned into pBSKS-. A long 142bp mutagenesis
primer was amplified from a subclone that contained e18a only, using primers 11-For and 11-
Rev. The mutagenesis primer contained e18-e18a-e19 cDNA only without intronic DNA. The
loxP-NeoR-loxP cassette was into an introduced SpeI site between e17 and e18 following PCR
amplification from pL452 (Addgene) using primers 12-For and 12-Rev. The final targeting
construct was 10.7kb.
37b*b 8 Generation of CaV2.2 mice has been described previously .
For all three mouse strains, mouse 129Ola ES cells derived from a male embryo were grown on
mitotically inactive SNL76/7 feeder cells. Ten million (107) ES cells were electroporated with 20
µg of a construct linearized with PvuI, and G418 selection was initiated after 24 h. Correctly
targeted ES cell clones were identified by PCR and injected in E3.5 blastocysts isolated from
C57Bl/6-Tyrc-Brd female mice. Injected blastocysts were implanted into day 2.5
pseudopregnant females for the generation of chimeras. Male chimeras were mated with
C57BL/6-Tyrc-Brd females to obtain F1 progeny. Germ line transmission was confirmed by PCR
of genomic DNA from each ES cell clone to confirm homologous integration from the long arm
and short arm of the targeting vector using primers indicated in Table 2 for the left and right
arms. The neomycin resistance cassette was subsequently removed from F1 mice by crossing
- 112 -
to a B6.FVB-Tg(EIIa-cre)C5379Lmgd/J (RRID: IMSR_JAX:003724). Deletion of the neomycin cassette was confirmed by PCR amplification of genomic DNA.
-/- +18a ∆18a Table 2: Primers for generation of CaV2.2 , CaV2.2 , and CaV2.2 mouse strains Strain Primer Sequence -/- CaV2.2 1-For GAACTGCTTCACCGTCAACCGGTCGCTCTTCGTCTTCAGC construct 1-Rev GCTGAAGACGAAGAGCGACCGGTTGACGGTGAAGCAGTTC generation 2-For CTAGACCGGTCAATGGTGAGCAAGGGCGAGGAGC 2-Rev CTAGACCGGTGACAAACCACAACTAGAATGC 3-For CATGACGCGTGAATTCCTGCAGCCCAATTCC 3-Rev CTAGACGCGTCCCTCGAGGGACCTAATAACTTCG -/- CaV2.2 4-For-Left GTGCATGTGTTTATCTGTGTG targeting 4-Rev-Left GAACTTCAGGGTCAGCTTGC 5-For-Right CTACCCGGTAGAATTTCGACG 5-Rev-Right GGTCCTGCATGTAGGCCTCC ∆18a CaV2.2 6-For CCAGTGACTAGCCATGATCTCCGGACTGAGCTAGGCTGC construct 6-Rev GCAGCCTAGCTCAGTCCGGAGATCATGGCTAGTCACTGG generation 7-For CCAATATCTCCATCGCTGCCAGGCAGCAGAACTCG 7-Rev CGAGTTCTGCTGCCTGGCAGCGATGGAGATATTGG 8-For CATGCCTAGGGAATTCCTGCAGCCCAATTCC 8-Rev CTAGCCTAGGCCCTCGAGGGACCTAATAACTTCG ∆18a CaV2.2 9-For-Left CGTAAACTCCTCTTCAGACC targeting 9-Rev-Left CAGAGCTCTGAGTGTGGAGG 10-For-Right GGGAAGACAATAGCAGGCATGC 10-Rev-Right TATGACCTCCATGGAGTCTG +18a CaV2.2 11-For CCAATATCTCCATCGCTGCTTTTGTAAAGCAAACTCGAGG construct 11-Rev CGAGTTCTGCTGCCTGGGTGAGTTTACGCTGGAGAC generation 12-For CATGCCTAGGGAATTCCTGCAGCCCAATTCC 12-Rev CTAGCCTAGGCCCTCGAGGGACCTAATAACTTCG +18a CaV2.2 13-For-Left CTACCCGGTAGAATTTCGACG targeting 13-Rev-Left TATGACCTCCATGGAGTCTG 14-For-Right GGGAAGACAATAGCAGGCATGC 14-Rev-Right CAGAGCTCTGAGTGTGGAGG
TRPV1-Cre64 (RRID: IMSR_JAX:017769), lox-STOP-lox-ChR2-EYFP66 (RRID:
IMSR_JAX:012569), and lox-STOP-lox-TdTomato115 (RRID: IMSR_JAX:007908) mice were
purchased from The Jackson Laboratory. Trpv1 is expressed in testes during gamete
production 116–118, inducing Cre-dependent reporter expression in spermatozoa. We confirmed
widespread reporter expression beyond the TRPV1-lineage in offspring of TRPV1+/-/ChR2-
EYFP+/- or TRPV1+/-/TdTomato+/- mice; therefore, all mice used in this study were first-
- 113 - generation progeny of single homozygous parents. TRPV1-Cre+/+ mice were mated with either
ChR2-EYFP+/+ or TdTomato+/+ mice to generate TRPV1+/-/ChR2-EYFP+/- or TRPV1+/-
/TdTomato+/- offspring.
Drugs
Drugs used for in vivo injection or for in vitro application to dissociated DRG neurons or spinal cord slices: CFA (Sigma: F5881-10ML, 100%); Capsaicin (in vivo: Sigma: 1091108, USP reference standard, 0.1% in sterile saline with 5% Tween 20; in vitro: Sigma: M2028, 1 µM in external solution with 0.1% ethanol); PGE2 (Tocris: 2296, 5 µM in sterile saline with 0.1% ethanol); BzATP (Tocris: 3312, 5 mM in water); ω-conotoxin MVIIA (Alomone: C-670, 1 µM in sterile saline); A438079 (Tocris: 2972, 6 mM in sterile saline); Picrotoxin (Sigma: P1675-1G, 50 mM in aCSFR with 0.5% ethanol); DNQX (Sigma: D0540, 10 µM in aCSFR with 0.025% DMSO)
Statistics
All statistics were performed using SPSS Statistics 24 (IBM). Specific statistical analyses are described in the main text. All values shown are mean ± standard error, unless otherwise specified. Exact p-values are included when possible.
Tissue collection and preparation for imaging analyses
Mice between 2 and 6 months old were transcardially perfused with cold phosphate buffered saline (PBS), followed by 4% paraformaldehyde (PFA) in PBS. Spinal cord (L4-L6), dorsal root ganglia (L4-L6, DRG) and skin (hindpaw) were removed and post-fixed in 4% PFA overnight at
4°C. Spinal cord, DRG, and skin samples were cryoprotected in 30% sucrose in PBT at 4°C for
48 hrs. Bilateral L4-L6 DRG from a single mouse were pooled, frozen in OCT media, and cut into 14 µm slices. Spinal cord and skin samples were frozen in OCT media and cut into 14 µm slices.
- 114 -
Immunohistochemistry
Slices were blocked overnight using 5% bovine serum albumin (BSA, Sigma Aldrich) in PBS
with 0.4% Triton X-100 (Sigma, PBST). Primary antibodies were applied in PBST with 5% BSA
at the following dilutions for 48 hrs at 4°C: anti-CGRP (Millipore Cat# PC205L, RRID:
AB_2068524), 1:250 dilution; anti-NF200 (Millipore Cat# MAB5262, RRID: AB_95186), 1:250
dilution. Secondary antibodies (Alexa488 donkey-anti-rabbit (RRID: AB_2571722), Alexa488
donkey-anti-mouse (RRID: AB_2571721)) were applied at 1:200 in PBST with Alexa647-
conjugated Isolectin B4 (SCR_014365) at 1:100 and DAPI (SCR_014366) at 1:1000 for 4 hr at
room temperature. Images were collected using a Zeiss LSM 800 confocal microscope using
ZEN software.
CellProfiler analysis of DRG immunohistochemistry. For each staining condition (NF200+IB4 or
CGRP+IB4), nine DRG slices were analyzed from each of three mice (male, 2 months old).
Individual multi-channel z-stacks were loaded into ImageJ software, a single z-projection was constructed, and contrast was enhanced uniformly across each image. CellProfiler 2.0119 was
used to detect neuronal nuclei and cells containing TdTomato, anti-CGRP immunoreactivity,
anti-NF200 immunoreactivity, or IB4-fluorescence. Image analysis software is freely available
at: http://cellprofiler.org. Only cells completely contained in the image with clear nuclear staining
were included in analysis and all TdTomato, CGRP, NF200, and IB4 signals were related to
neuronal nuclei. In total, 3647 neuronal profiles were examined, 1867 of which were assessed
for CGRP/IB4 immunoreactivity and 1780 of which were assessed for NF200/IB4
immunoreactivity.
RNAScope in situ hybridization
RNAScope (® Advanced Cell Diagnostics) in situ hybridization was performed as instructed,
with the following modifications. Following sectioning, slices were dehydrated with 100% ethanol
- 115 - for 5 min and allowed to air dry. A barrier was drawn around each section using a hydrophobic barrier pen. Slides were incubated at 40°C in Protease III for 30 min. Cacna1b or Trpv1 probes were applied at 40°C for 4 hrs and detected using amplification reagents 1-4, as described in the kit. Images were collected using a Zeiss LSM 800 confocal microscope using ZEN software.
At least 3 slides from 2 mice (2 months old) were used for analysis.
BaseScope in situ hybridization
BaseScope (® Advanced Cell Diagnostics) in situ hybridization was performed as instructed, with the following modifications. Following sectioning, slices were dehydrated with serial washes of 50%, 75%, and 100% ethanol for 5 min each and allowed to air dry. A barrier was drawn around each section using a hydrophobic barrier pen. Slides were incubated in hydrogen peroxide at room temperature for 10 min, followed by Protease III at 40°C for 30 min. Cacna1b- e37a probe was applied at 40°C for 2 hrs and detected as described in the kit. Images were collected using a Zeiss LSM 800 confocal microscope using ZEN software. At least 3 slides from 2 mice (2 months old) were used for analysis.
For combined BaseScope and RNAScope in situ hybridization, tissue was pretreated according to the BaseScope protocol. Cacna1b-e37a probe was applied first and completely processed according to the manufacturer instructions. Following Fast-Red detection of Cacna1b-e37a,
Trpv1 probe was applied and processed according to manufacturer instructions. Images were collected using a Zeiss LSM 800 confocal microscope using ZEN software. At least 3 slides from 2 mice (2 months old) were used for analysis.
CellProfiler analysis of in situ hybridization. Individual multi-channel z-stacks were loaded into
ImageJ software, a single z-projection was constructed, and contrast was enhanced uniformly across each image. CellProfiler 2.0119 was used to detect punctate Cacna1b-e37a, Cacna1b, and Trpv1 mRNA signal. Image analysis software is freely available at: http://cellprofiler.org.
- 116 -
Whole cell recording from acutely dissociated DRG neurons
Acutely dissociated DRG neurons were prepared from mice of unidentified sex between 8 and
21 days old. Under isoflurane anesthesia, mice were euthanized and DRG from the entire
vertebral column removed. Ganglia were dissociated using 0.2 mg/mL collagenase (Cat
no:C9891, Sigma Aldrich) and 0.025% trypsin (Cat no:15090, Gibco) in HBSS (Cat no:24020-
117, Gibco) at 37°C for 18-20 mins, followed by mechanical dissociation. Cells were washed
with DMEM to remove traces of serum, resuspended in DMEM, and maintained at 37°C until
recording. For recording, cells were kept at room temperature and bathed in a solution
containing, in mM: 135 NaCl, 2 CaCl2, 4 MgCl2, 2.5 KCl, 10 HEPES, 10 Glucose, and pH 7.2 adjusted with NaOH. For isolation of whole cell calcium current, following seal formation and breakthrough, cells were lifted into a microperfusion stream of solution containing, in mM: 135
TEA-Cl, 2 CaCl2, 4 MgCl2, 2.5 KCl, 10 HEPES, 10 Glucose, pH adjusted to 7.2 with CsOH. For
experiments described in Fig 6, patch pipettes were filled with an internal solution containing, in
mM: 126 CsCl, 1 EDTA, 10 EGTA, 10 HEPES, 5 Mg-ATP, and pH adjusted to 7.2 with CsOH and had a resistance between 3-5 MΩ.
For all protocols, cells were held at a resting membrane potential of -80 Mv. To test for the
presence of functional TRPV1 channels, 1 mM capsaicin in ethanol was diluted 1:1000 in
external solution to 1 µM and locally applied to the cell via a microperfusion system. To test for
the presence of functional ChR2-EYFP, cells were stimulated using a 465 nm LED light (Plexon)
via a fiber optic cable mounted to the microperfusion system. Voltage steps from -65 mV to 55
mV in 5 mV increments were applied to the cell to distinguish low-voltage activated (LVA) and
high-voltage activated (HVA) calcium currents. Action potentials were elicited from a resting
membrane potential adjusted to -55 mV by direct current injection, and injecting 2 ms square
wave current pulses from 0.1 nA to 2 nA in 0.1 nA intervals. Sustained depolarizations (from 0.1
nA to 2 nA in 0.1 nA intervals) lasted 250 ms and ramp depolarizations continually increased to
- 117 -
a maximum of 2 nA over 500 ms. Capacitance was read from the amplifier following
compensation of whole cell capacitance after establishing whole cell configuration.
Cluster analysis of DRG functional properties. Traces were analyzed using Clampfit 10.6
software (Molecular Devices) and clustering analysis was performed in SPSS Statistics 24
(IBM). Trpv1-lineage cells were clustered based on cell body size (capacitance, pF), expression of CaV3 (T-type) current, and expression of TRPV1 channels. Clustering analysis was
performed using two protocols: manual trace inspection and double clustering.
Manual trace inspection
Cells were manually sorted into three size categories: small (<19 pF), intermediate (19-27 pF),
or large (>27 pF). CaV3 currents were identified in recordings of whole cell calcium current using
three characteristics: 1) peak current amplitude at least 2x noise level on depolarization to -40
mV, 2) peak amplitude latency greater than or equal to 15 ms after depolarization to -40 mV,
and 3) rapid channel inactivation resulting in decreasing current amplitude at -40 mV. Cells in
which current traces exhibited at least two of these three criteria were counted as expressing
CaV3 current. Cells were sorted as TRPV1-expressing if capsaicin application elicited a large
(greater than 150 pA) inward current that rapidly deactivated following washout and exhibited decreasing amplitude on subsequent applications of capsaicin. Two-step clustering in SPSS with three categorical variables (size group, CaV3 current expression, and TRPV1 expression)
was used to sort cells into homogeneous clusters.
Double clustering
All clustering used the two-step clustering method in SPSS. Cells were first sorted into n
unbiased size groups based on capacitance measurements. Three groups were formed: 1- small, 2- intermediate, 3-large. To assess CaV3 expression, peak low-voltage activated (LVA) current amplitude was quantified during steps to -40 mV and peak high-voltage activated (HVA) current amplitude was quantified during steps to 0 mV. Cells were sorted into n clusters based
- 118 -
on both LVA current density (normalized to capacitance) and LVA contribution to total calcium
current (normalized to HVA current). Two groups were formed: 1- present, 2- absent. To assess
TRPV1 expression, peak capsaicin-evoked current amplitude was measured, normalized to
capacitance, and used to sort cells into n groups. Two groups were formed: 1- present, 2-
absent. A final round of unbiased clustering used the previous group assignments (cell size,
CaV3 expression, and TRPV1 expression) as categorical variables to sort cells into homogeneous groups.
All cell clustering was performed in SPSS using two-step clustering with log-likelihood distance as the measure between clusters and Schwarz’s Bayesian criterion. Using both strategies, four clusters were formed. Cells that were assigned to the same cluster in each analysis were used to determine cluster identity, whereas cells that were assigned to different clusters were used to determine the relationship between distinct clusters. Each cell was assigned to one and only one cluster.
Analysis of action potential waveform. Action potentials were analyzed in Clampfit 10.6. Cursors were placed at the initial membrane depolarization from baseline and at the minimum of the after-hyperpolarization (AHP). Only the first elicited action potential was analyzed for each cell.
A brief 2 ms current injection was used to minimize current injection distortion of the rising phase. Measurements of peak voltage (mV), AHP peak voltage (mV), width at half-maximal voltage (ms), rise time from 10% to 90% amplitude (ms), and decay time from 10% to 90% amplitude (ms) were automatically calculated individually for each cell. Cells for which the half- maximal voltage occurred during the passive membrane response to direct current injection were excluded from analysis.
Analysis of action potential failures during repetitive stimulation. Action potentials were elicited by the minimum current pulse required, ranging from 0.4 to 1.0 nA, in 0.1 nA increments. Action potentials were identified by a peak current of greater than 0 mV and contained an inflection
- 119 -
point in the rising phase, indicating a transition from passive membrane depolarization to active
conductance. For the sustained square wave depolarization, the number of action potentials
was counted for the current injection that generated the highest number of action potentials. For
the ramp depolarization, the number of action potentials was counted for the first sweep only.
Whole cell recording from acute spinal cord slices
Transverse spinal cord slices were prepared from mice of unidentified sex between 10 and 21
days old. Mice were anesthetized by ip injection of Beuthanasia-S and transcardially perfused
with cold, oxygenated aCSFS/H containing, in mM: 125 NaCl, 2.5 KCl, 26 NaHCO3, 1.25
NaH2PO4, 1.5 CaCl2, 6 MgCl2, 25 Glucose, 1 Kynurenic acid. The spinal cord was removed,
embedded in 2% low-melting agarose, and cut into 300 um sections using a Leica VT1200S
vibrating blade microtome in the aCSFS/H. Sections were then transferred to holding chamber containing the aCSFS/H at 30°C for 1 hr and maintained at room temperature thereafter. For recording, individual slices were transferred to a recording chamber and continually perfused with oxygenated aCSFR containing, in mM: 119 NaCl, 2.5 KCl, 26 NaHCO3, 1 NaH2PO4, 2.5
CaCl2, 1.3 MgSO4, 25 Glucose, 1.3 Na-Ascorbate. Patch pipettes were filled with an internal
solution containing, in mM: 125 KGluconate, 28 NaCl, 2 MgCl2, 2 Mg-ATP, 0.3 Na-GTP, 0.6
EGTA, 10 HEPES and had a resistance between 3-5 MΩ. When indicated, patch pipettes were
filled with an internal solution containing, in mM: 125 KCl, 28 NaCl, 2 MgCl2, 2 Mg-ATP, 0.3 Na-
GTP, 0.6 EGTA, 10 HEPES. Synaptic responses were elicited by 1 ms pulses of blue light
through the 40x microscope objective controlled by a shutter and the blue light was focused
directly on the recorded cell. Cells were held at -70 mV during all protocols.
Analysis of synaptic response fitting results. For each cell, each individual synaptic traces with
fit with a double exponential using Clampfit 10.6. Fitting area spanned 400 ms from the initial
EPSC peak. The amplitude and time constant (τ), along with respective error measurements, for
- 120 -
each component were automatically calculated. In some cases, excessive spontaneous activity
or high polysynaptic activity interrupted the post-synpatic current, resulting in a poor fit.
Individual fits were discarded from analysis if 1) amplitude values were positive; 2) τ values
were negative; 3) error measurements for amplitude1, τ1, or amplitude2 were greater than 10 or
if error measurement for τ2 was greater than 0.5. Median values for each cell were used for
analysis.
Analysis of synaptic failures during repetitive stimulation. Peak current for each stimulus was
measured between 5 and 10 ms after light stimulation using Clampfit 10.6. Peak current
amplitude of at least 10% of the initial peak current amplitude were counted as a response.
Analysis of light-evoked synaptic potentiation. All amplitude measurements were taken of the initial peak response, occurring within 10 ms after the light pulse. Light stimuli were repeated every 30 s. Peak amplitude of 6-15 baseline sweeps was calculated and all amplitude values for each cell were normalized to the median of the baseline response amplitude. Peak response amplitudes were measured for at least 5 minutes after LTP induction by light stimulation at 2 Hz for 2 mins.
Radiant heat assay
We used a Plantar Analgesia Meter (IITC) to assess thermal responses to radiant heat. Mice,
either male or female, from 2 to 6 months old were placed in Plexiglas containers on an
elevated glass plate and allowed to habituate for 1 hr prior to testing. A visible-light, radiant heat
source was positioned beneath the mice and aimed using low-intensity visible light to the plantar surface of the hindpaw. An orange-pass filter was used to prevent blue-light activation of
channelrhodopsin in sensory nerve terminals. Trials began once the high-intensity light source
was activated and ended once the mouse withdrew their hindpaw and 1) shook their paw, 2)
licked their paw, or 3) continued to withdraw their paw from stimulation46. Immediately upon
- 121 -
meeting response criteria, the high-intensity light-source was turned off. The latency to
response was measured to the nearest 0.01 s for each trial using the built-in timer, which is
activated and de-activated with the high-intensity beam. For all trials, high-intensity beam was
set at 40%, low-intensity beam set at 10%, and maximum trial duration was 30s. Three to five
trials were conducted on each hindpaw for each mouse, with at least 1 minute between trials of
the same hindpaw.
Hotplate assay
We used a Ugo Basile 7280 Hot Plate to assess responses to thermal stimuli. The hot plate was
set to 53°C. Mice, either male or female, from 2 to 6 months old were individually placed onto
the plate. Mice were immediately removed once a clear nocifensive response was observed.
Nocifensive responses included hindpaw shaking, hindpaw licking, or jumping (attempted
escape from chamber). All trials were video recorded for analysis. Trial time began once all four
paws touched the plate and stopped immediately on the first hindpaw response. Times were
recorded to the nearest second.
von Frey mechanical nociception assay
To assess responses to mechanical stimuli, male or female mice between 2 and 6 months old
were placed in an elevated Plexiglas container with a wire mesh bottom. The plantar surface of
the hindpaw was stimulated with calibrated von Frey filaments ranging from 0.008 to 4 g. The
mechanical withdrawal threshold was calculated using the up-and-down method of Dixon44.
Briefly, stimulation begins with a medium intensity stimulus (0.16 g) approximating the 50% withdrawal threshold. Every time the mouse responds to the stimulus, a less intense stimulus follows. Every time the mouse does not respond to the stimulus, a more intense stimulus follows. Stimulation continues until 4 trials past a reversal from no-response to response or from response to no-response (yes/no/x/x/x/x or no/yes/x/x/x/x). The pattern of responses from the
- 122 -
last six trials is used to determine the k-value according to Table 7 in Dixon, et al44 and the 50%
withdrawal threshold calculated according to the formula:
= 10 ( ) ( . ) log 𝑙𝑙𝑙𝑙𝑙𝑙𝑙𝑙 𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓𝑓 + 0 27∗𝑘𝑘 where last filament is the weight𝑇𝑇ℎ𝑟𝑟𝑟𝑟𝑟𝑟 of ℎthe𝑜𝑜𝑜𝑜𝑜𝑜 last stimulus in grams. Threshold was calculated on
three separate days for each mouse and the median threshold value was used for each mouse.
Acute LED stimulation
Male or female mice between 2 and 6 months old were placed in Plexiglas containers on an
elevated glass surface. A fiber-coupled, blue (465 nm) LED light (Plexon) was mounted to a
movable stage at a fixed distance below the glass platform. Light intensity was controlled by the
supplied driver and intensity (1-9 mW, ~0.1-1 mW/mm2) was measured using a light meter
(PM100A, Sensor: S121C, Thor Labs) mounted on top of the glass plate. Mice were allowed to
habituate to the chamber for 1 hr prior to testing. Each mouse was stimulated 10 times, equally
divided between the left and right hindpaw, at each of 6 light intensity levels, for a total of 60
trials per mouse. In each trial, the LED light was directed at the plantar surface of one hindpaw
for 5 seconds or until a nocifensive response was elicited. Nocifensive responses included
hindpaw withdrawal accompanied by at least one of the following: shaking or licking the
stimulated hindpaw or continued hindpaw withdrawal during prolonged stimulation. All
responses occurred within 3 seconds of stimulus onset. The number of nocifensive trials was
counted for each mouse at each light intensity level and response distributions for individual
mice were fit using a 4-parameter logistic curve:
( ) = 1 + 𝑚𝑚𝑚𝑚𝑚𝑚 − 𝑚𝑚𝑚𝑚𝑚𝑚 𝑦𝑦 𝑚𝑚𝑚𝑚𝑚𝑚 − 50 −𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻𝐻 𝑥𝑥 � � Values for minimum, maximum, EC50, and HillSlope𝐸𝐸𝐸𝐸 were calculated automatically and mean
values were used to construct a fit of the average response distribution.
Prolonged LED stimulation
- 123 -
Prolonged light stimulation was used to test whether continued activation of TRPV1-lineage sensory neurons, in the absence of inflammatory mediators or tissue damage, elicits thermal hyperalgesia. Mice of either sex Thermal sensitivity of ipsilateral and contralateral hindpaws was assessed using the radiant heat assay (described above) immediately prior to and at 1, 2, and 3 hours following prolonged stimulation. Both a laser (473 nm, Shanghai Dream Lasers
Technology Co., Ltd.) and LED light source were used. For prolonged LED stimulation, the LED power was set at maximum intensity (9 mW, 1 mW/mm2) and, for laser stimulation, laser intensity was set at 7 mW (2.5 mW/mm2). Mice, both sexes, from 2 to 6 months old, were anesthetized with 2% isoflurane, administered through a nose-cone with active scavenging.
Mice were placed in a prone position and ipsilateral hindpaw was stimulated from below with blue light via a fiber optic cable. Stimulation proceeded according to several different protocols:
1) 10 Hz stimulation for 10 minutes with 20 ms pulse width; 2) 2 Hz stimulation for 30 minutes with 100 ms pulse width; 3) continuous stimulation for 30 minutes. For stimulation following
PGE2, PGE2 was injected as described below and mice were immediately placed into the nosecone for stimulation of the ipsilateral hindpaw at 2 Hz for 30 minutes. The laser source was only used for the 2 Hz stimulation protocol to prevent potential tissue damage. Following stimulation, mice were removed from the nose cone and allowed to recover in the radiant heat testing chamber. All mice were awake and mobile within 10 min of anesthesia termination and showed no obvious effects of stimulation (guarding hindpaw, limp, trouble walking). For assessment of thermal sensitivity, median response latency of 5 trials at each time point was used. Ipsilateral and contralateral feet were analyzed separately.
Hindpaw injections
Mice of either sex between 2 and 6 months old were briefly anesthetized with isoflurane. Once respiration slowed to 1 breath per second, mice were removed from isoflurane chamber, placed in a prone position on their back, and an insulin syringe was inserted at a shallow angle into the
- 124 -
plantar hindpaw. A total volume of 20 µL was injected slowly before the mouse recovers from
anesthesia. Mice were replaced in the radiant heat testing chamber and recovered within
minutes.
Calculation of percent maximum possible effect. Percent maximum possible effect (MPE) for hyperalgesia was calculated according to the formula:
= 100% 0 𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝑡𝑡 − 𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿0 𝑀𝑀𝑀𝑀𝑀𝑀 ∗ or for hypoalgesia: − 𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿0
= 1 100% 30 𝐿𝐿𝐿𝐿𝐿𝐿𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑡𝑡 − 𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿0 𝑀𝑀𝑀𝑀𝑀𝑀 − ∗ ∗ − 𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿𝐿0 Measurement of paw volume
For measuring paw swelling during inflammation, CFA was injected into the plantar hindpaw as
described above. One day later, mice were anesthetized with isoflurane and euthanized by
intraperitoneal injection of euthanasia solution (0.05 mL). The left and right hindpaws were
severed above the ankle joint at the hair line. Each hindpaw was placed into a graduated
cylinder containing 10 mL of mill-qH20. Water exceeding the 10 mL mark was removed using a
1 mL pipet and the mass of the excess water was weighed using an analytical balance. The
volume of the hindpaw was taken as equivalent to the mass of the excess water.
IL-1β cell-based reporter assay
Mice were anesthetized with isoflurane and euthanized via i.p. injection of euthanasia solution.
The plantar skin from the left and right hindpaws was removed and ~20 mg of skin was placed
in 1 mL DMEM supplemented with 10% heat-inactivated fetal bovine serum and Penicillin-
Streptomycin (Gibco). Skin cultures were maintained at 37°C with 5% CO2 for 72 hrs. One day
prior to collection of conditioned media, HEK-Blue IL-1β cells (Invivogen) were split into a 24-
well plate with 0.5 mL DMEM supplemented with 10% heat-inactivated fetal bovine serum,
- 125 -
Hygromycin, and Zeocin. Conditioned media containing IL-1β was collected from skin cultures and 200 μL was added to each well of HEK-Blue cells for 24 hrs. Secreted embryonic alkaline phosphatase was detected by mixing 200 μL Quanti-Blue media with 50 μL HEK-Blue cell media in triplicate in a 96-well plate and quantified by reading the absorbance at 620 nm using a
Biotek Synergy HTX multi-mode microplate reader at 37°C. Quanti-Blue media alone was used as a blank sample.
- 126 -
References 1. Catterall, W. A. Voltage-Gated Calcium Channels. Cold Spring Harb. Perspect. Biol. 3, a003947–a003947 (2011). 2. Lee, S. Pharmacological Inhibition of Voltage-gated Ca(2+) Channels for Chronic Pain Relief. Curr. Neuropharmacol. 11, 606–620 (2013). 3. Zamponi, G. W., Striessnig, J., Koschak, A. & Dolphin, A. C. The Physiology, Pathology, and Pharmacology of Voltage-Gated Calcium Channels and Their Future Therapeutic Potential. Pharmacol. Rev. 67, 821–870 (2015). 4. Motin, L. & Adams, D. J. omega-Conotoxin inhibition of excitatory synaptic transmission evoked by dorsal root stimulation in rat superficial dorsal horn. Neuropharmacology 55, 860–864 (2008). 5. Gray, A., Raingo, J. & Lipscombe, D. Neuronal calcium channels: Splicing for optimal performance. Cell Calcium 42, 409–417 (2007). 6. Bell, T. J., Thaler, C., Castiglioni, A. J., Helton, T. D. & Lipscombe, D. Cell-specific alternative splicing increases calcium channel current density in the pain pathway. Neuron 41, 127–138 (2004). 7. Thaler, C., Gray, A. C. & Lipscombe, D. Cumulative inactivation of N-type CaV2.2 calcium channels modified by alternative splicing. Proc. Natl. Acad. Sci. 101, 5675–5679 (2004). 8. Andrade, A., Denome, S., Jiang, Y.-Q., Marangoudakis, S. & Lipscombe, D. Opioid inhibition of N-type Ca2+ channels and spinal analgesia couple to alternative splicing. Nat. Neurosci. 13, 1249–1256 (2010). 9. Raingo, J., Castiglioni, A. J. & Lipscombe, D. Alternative splicing controls G protein- dependent inhibition of N-type calcium channels in nociceptors. Nat. Neurosci. 10, 285– 292 (2007). 10. Sinnegger-Brauns, M. J. et al. Expression and 1,4-dihydropyridine-binding properties of brain L-type calcium channel isoforms. Mol. Pharmacol. 75, 407–414 (2009). 11. Di Biase, V. et al. Stable membrane expression of postsynaptic CaV1.2 calcium channel clusters is independent of interactions with AKAP79/150 and PDZ proteins. J. Neurosci. Off. J. Soc. Neurosci. 28, 13845–13855 (2008). 12. Jenkins, M. A. et al. Ca2+-dependent facilitation of Cav1.3 Ca2+ channels by densin and Ca2+/calmodulin-dependent protein kinase II. J. Neurosci. Off. J. Soc. Neurosci. 30, 5125– 5135 (2010). 13. Ma, H., Cohen, S., Li, B. & Tsien, R. W. Exploring the dominant role of Cav1 channels in signalling to the nucleus. Biosci. Rep. 33, (2012). 14. Striessnig, J., Pinggera, A., Kaur, G., Bock, G. & Tuluc, P. L-type Ca(2+) channels in heart and brain. Wiley Interdiscip. Rev. Membr. Transp. Signal. 3, 15–38 (2014). 15. Coulter, D. A., Huguenard, J. R. & Prince, D. A. Characterization of ethosuximide reduction of low-threshold calcium current in thalamic neurons. Ann. Neurol. 25, 582–593 (1989). 16. Huguenard, J. R. & Prince, D. A. A novel T-type current underlies prolonged Ca(2+)- dependent burst firing in GABAergic neurons of rat thalamic reticular nucleus. J. Neurosci. Off. J. Soc. Neurosci. 12, 3804–3817 (1992). 17. McCormick, D. A. & Huguenard, J. R. A model of the electrophysiological properties of thalamocortical relay neurons. J. Neurophysiol. 68, 1384–1400 (1992). 18. Berkefeld, H. & Fakler, B. Repolarizing responses of BKCa-Cav complexes are distinctly shaped by their Cav subunits. J. Neurosci. Off. J. Soc. Neurosci. 28, 8238–8245 (2008). 19. Berkefeld, H. et al. BKCa-Cav channel complexes mediate rapid and localized Ca2+- activated K+ signaling. Science 314, 615–620 (2006). 20. Loane, D. J., Lima, P. A. & Marrion, N. V. Co-assembly of N-type Ca2+ and BK channels underlies functional coupling in rat brain. J. Cell Sci. 120, 985–995 (2007). 21. Turner, R. W. & Zamponi, G. W. T-type channels buddy up. Pflugers Arch. 466, 661–675 (2014).
- 128 -
22. Wheeler, D. B., Randall, A. & Tsien, R. W. Roles of N-type and Q-type Ca2+ channels in supporting hippocampal synaptic transmission. Science 264, 107–111 (1994). 23. Sudhof, T. C. Calcium Control of Neurotransmitter Release. Cold Spring Harb. Perspect. Biol. 4, a011353–a011353 (2012). 24. Kamp, M. A., Hänggi, D., Steiger, H.-J. & Schneider, T. Diversity of presynaptic calcium channels displaying different synaptic properties. Rev. Neurosci. 23, 179–190 (2012). 25. Jacus, M. O., Uebele, V. N., Renger, J. J. & Todorovic, S. M. Presynaptic Cav3.2 channels regulate excitatory neurotransmission in nociceptive dorsal horn neurons. J. Neurosci. Off. J. Soc. Neurosci. 32, 9374–9382 (2012). 26. García-Caballero, A. et al. The deubiquitinating enzyme USP5 modulates neuropathic and inflammatory pain by enhancing Cav3.2 channel activity. Neuron 83, 1144–1158 (2014). 27. Koschak, A., Pinggera, A., Schicker, K. & Striessnig, J. Role of L-Type Ca2+ Channels in Sensory Cells. in Pathologies of Calcium Channels (eds. Weiss, N. & Koschak, A.) 47–75 (Springer Berlin Heidelberg, 2014). doi:10.1007/978-3-642-40282-1_3 28. Wallace, M. S. Calcium and sodium channel antagonists for the treatment of pain. Clin. J. Pain 16, S80-85 (2000). 29. Sousa, S. R., Vetter, I. & Lewis, R. J. Venom peptides as a rich source of cav2.2 channel blockers. Toxins 5, 286–314 (2013). 30. Bowersox, S. S. et al. Selective N-type neuronal voltage-sensitive calcium channel blocker, SNX-111, produces spinal antinociception in rat models of acute, persistent and neuropathic pain. J. Pharmacol. Exp. Ther. 279, 1243–1249 (1996). 31. Wang, Y. X., Pettus, M., Gao, D., Phillips, C. & Scott Bowersox, S. Effects of intrathecal administration of ziconotide, a selective neuronal N-type calcium channel blocker, on mechanical allodynia and heat hyperalgesia in a rat model of postoperative pain. Pain 84, 151–158 (2000). 32. Jiang, Y.-Q., Andrade, A. & Lipscombe, D. Spinal morphine but not ziconotide or gabapentin analgesia is affected by alternative splicing of voltage-gated calcium channel CaV2.2 pre-mRNA. Mol. Pain 9, 67 (2013). 33. Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, 145–153 (2014). 34. Hu, G. et al. Single-cell RNA-seq reveals distinct injury responses in different types of DRG sensory neurons. Sci. Rep. 6, 31851 (2016). 35. Heinke, B., Balzer, E. & Sandkuhler, J. Pre- and postsynaptic contributions of voltage- dependent Ca2+ channels to nociceptive transmission in rat spinal lamina I neurons. Eur. J. Neurosci. 19, 103–111 (2004). 36. Djouhri, L. Aδ-fiber low threshold mechanoreceptors innervating mammalian hairy skin: A review of their receptive, electrophysiological and cytochemical properties in relation to Aδ- fiber high threshold mechanoreceptors. Neurosci. Biobehav. Rev. 61, 225–238 (2016). 37. Blair, N. T. & Bean, B. P. Roles of tetrodotoxin (TTX)-sensitive Na+ current, TTX-resistant Na+ current, and Ca2+ current in the action potentials of nociceptive sensory neurons. J. Neurosci. Off. J. Soc. Neurosci. 22, 10277–10290 (2002). 38. Barzan, R., Pfeiffer, F. & Kukley, M. N- and L-Type Voltage-Gated Calcium Channels Mediate Fast Calcium Transients in Axonal Shafts of Mouse Peripheral Nerve. Front. Cell. Neurosci. 10, (2016). 39. Rexed, B. The cytoarchitectonic organization of the spinal cord in the cat. J. Comp. Neurol. 96, 414–495 (1952). 40. Braz, J., Solorzano, C., Wang, X. & Basbaum, A. I. Transmitting pain and itch messages: a contemporary view of the spinal cord circuits that generate gate control. Neuron 82, 522– 536 (2014).
- 129 -
41. Todd, A. J. Anatomy of primary afferents and projection neurones in the rat spinal dorsal horn with particular emphasis on substance P and the neurokinin 1 receptor. Exp. Physiol. 87, 245–249 (2002). 42. Bushnell, M. C., Ceko, M. & Low, L. A. Cognitive and emotional control of pain and its disruption in chronic pain. Nat. Rev. Neurosci. 14, 502–511 (2013). 43. Barrot, M. Tests and models of nociception and pain in rodents. Neuroscience 211, 39–50 (2012). 44. Dixon, W. J. Staircase bioassay: the up-and-down method. Neurosci. Biobehav. Rev. 15, 47–50 (1991). 45. Lai, Y. Y. & Chan, S. H. Shortened pain response time following repeated algesiometric tests in rats. Physiol. Behav. 28, 1111–1113 (1982). 46. Hargreaves, K., Dubner, R., Brown, F., Flores, C. & Joris, J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia: Pain 32, 77–88 (1988). 47. Saegusa, H. et al. Suppression of inflammatory and neuropathic pain symptoms in mice lacking the N-type Ca2+ channel. EMBO J. 20, 2349–2356 (2001). 48. Hatakeyama, S. et al. Differential nociceptive responses in mice lacking the alpha(1B) subunit of N-type Ca(2+) channels. Neuroreport 12, 2423–2427 (2001). 49. Kim, C. et al. Altered nociceptive response in mice deficient in the alpha(1B) subunit of the voltage-dependent calcium channel. Mol. Cell. Neurosci. 18, 235–245 (2001). 50. Jaggi, A. S., Jain, V. & Singh, N. Animal models of neuropathic pain: Animal models of neuropathic pain. Fundam. Clin. Pharmacol. 25, 1–28 (2011). 51. Sorkin, L. S. & Yaksh, T. L. Behavioral models of pain states evoked by physical injury to the peripheral nerve. Neurotherapeutics 6, 609–619 (2009). 52. Decosterd, I. & Woolf, C. J. Spared nerve injury: an animal model of persistent peripheral neuropathic pain. Pain 87, 149–158 (2000). 53. Castro-Junior, C. J. et al. Phα1β toxin prevents capsaicin-induced nociceptive behavior and mechanical hypersensitivity without acting on TRPV1 channels. Neuropharmacology 71, 237–246 (2013). 54. Saegusa, H. & Tanabe, T. N-type voltage-dependent Ca2+ channel in non-excitable microglial cells in mice is involved in the pathophysiology of neuropathic pain. Biochem. Biophys. Res. Commun. 450, 142–147 (2014). 55. Gilchrist, H. D., Allard, B. L. & Simone, D. A. Enhanced withdrawal responses to heat and mechanical stimuli following intraplantar injection of capsaicin in rats. Pain 67, 179–188 (1996). 56. de Souza, A. H. et al. An evaluation of the antinociceptive effects of Phα1β, a neurotoxin from the spider Phoneutria nigriventer, and ω-conotoxin MVIIA, a cone snail Conus magus toxin, in rat model of inflammatory and neuropathic pain. Cell. Mol. Neurobiol. 33, 59–67 (2013). 57. Pan, J. Q. & Lipscombe, D. Alternative splicing in the cytoplasmic II-III loop of the N-type Ca channel alpha 1B subunit: functional differences are beta subunit-specific. J. Neurosci. Off. J. Soc. Neurosci. 20, 4769–4775 (2000). 58. Catterall, W. A. Interactions of presynaptic Ca2+ channels and snare proteins in neurotransmitter release. Ann. N. Y. Acad. Sci. 868, 144–159 (1999). 59. Castiglioni, A. J., Raingo, J. & Lipscombe, D. Alternative splicing in the C-terminus of Ca V 2.2 controls expression and gating of N-type calcium channels: C-terminus splicing in N- type calcium channels. J. Physiol. 576, 119–134 (2006). 60. Wang, H. & Zylka, M. J. Mrgprd-Expressing Polymodal Nociceptive Neurons Innervate Most Known Classes of Substantia Gelatinosa Neurons. J. Neurosci. 29, 13202–13209 (2009). 61. Daou, I. et al. Remote Optogenetic Activation and Sensitization of Pain Pathways in Freely Moving Mice. J. Neurosci. 33, 18631–18640 (2013).
- 130 -
62. Stemkowski, P. et al. TRPV1 Nociceptor Activity Initiates USP5/T-type Channel-Mediated Plasticity. Cell Rep. 17, 2901–2912 (2016). 63. Cavanaugh, D. J. et al. Restriction of Transient Receptor Potential Vanilloid-1 to the Peptidergic Subset of Primary Afferent Neurons Follows Its Developmental Downregulation in Nonpeptidergic Neurons. J. Neurosci. 31, 10119–10127 (2011). 64. Cavanaugh, D. J. et al. Trpv1 Reporter Mice Reveal Highly Restricted Brain Distribution and Functional Expression in Arteriolar Smooth Muscle Cells. J. Neurosci. 31, 5067–5077 (2011). 65. Caterina, M. J. et al. Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 288, 306–313 (2000). 66. Madisen, L. et al. A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. Nat. Neurosci. 15, 793–802 (2012). 67. Michael, G. J. & Priestley, J. V. Differential expression of the mRNA for the vanilloid receptor subtype 1 in cells of the adult rat dorsal root and nodose ganglia and its downregulation by axotomy. J. Neurosci. Off. J. Soc. Neurosci. 19, 1844–1854 (1999). 68. François, A. et al. The Low-Threshold Calcium Channel Cav3.2 Determines Low- Threshold Mechanoreceptor Function. Cell Rep. (2015). doi:10.1016/j.celrep.2014.12.042 69. Gibbins, I. L., Furness, J. B. & Costa, M. Pathway-specific patterns of the co-existence of substance P, calcitonin gene-related peptide, cholecystokinin and dynorphin in neurons of the dorsal root ganglia of the guinea-pig. Cell Tissue Res. 248, 417–437 (1987). 70. Traub, R. J., Allen, B., Humphrey, E. & Ruda, M. A. Analysis of calcitonin gene-related peptide-like immunoreactivity in the cat dorsal spinal cord and dorsal root ganglia provide evidence for a multisegmental projection of nociceptive C-fiber primary afferents. J. Comp. Neurol. 302, 562–574 (1990). 71. Silverman, J. D. & Kruger, L. Selective neuronal glycoconjugate expression in sensory and autonomic ganglia: relation of lectin reactivity to peptide and enzyme markers. J. Neurocytol. 19, 789–801 (1990). 72. Lawson, S. N. & Waddell, P. J. Soma neurofilament immunoreactivity is related to cell size and fibre conduction velocity in rat primary sensory neurons. J. Physiol. 435, 41–63 (1991). 73. Yeomans, D. C. & Proudfit, H. K. Nociceptive responses to high and low rates of noxious cutaneous heating are mediated by different nociceptors in the rat: electrophysiological evidence. Pain 68, 141–150 (1996). 74. de Vrind, V. et al. Interactions between calcium channels and SK channels in midbrain dopamine neurons and their impact on pacemaker regularity: Contrasting roles of N- and L-type channels. Eur. J. Pharmacol. 788, 274–279 (2016). 75. Kress, M., Izydorczyk, I. & Kuhn, A. N- and L- but not P/Q-type calcium channels contribute to neuropeptide release from rat skin in vitro. Neuroreport 12, 867–870 (2001). 76. Bannister, K., Kucharczyk, M. & Dickenson, A. H. Hopes for the Future of Pain Control. Pain Ther. (2017). doi:10.1007/s40122-017-0073-6 77. Yekkirala, A. S., Roberson, D. P., Bean, B. P. & Woolf, C. J. Breaking barriers to novel analgesic drug development. Nat. Rev. Drug Discov. (2017). doi:10.1038/nrd.2017.87 78. Herrik, K. F., Christophersen, P. & Shepard, P. D. Pharmacological Modulation of the Gating Properties of Small Conductance Ca2+-Activated K+ Channels Alters the Firing Pattern of Dopamine Neurons In Vivo. J. Neurophysiol. 104, 1726–1735 (2010). 79. Liu, S. & Shipley, M. T. Multiple Conductances Cooperatively Regulate Spontaneous Bursting in Mouse Olfactory Bulb External Tufted Cells. J. Neurosci. 28, 1625–1639 (2008). 80. Jarvis, M. F. et al. Modulation of BzATP and formalin induced nociception: attenuation by the P2X receptor antagonist, TNP-ATP and enhancement by the P2X 3 allosteric modulator, cibacron blue. Br. J. Pharmacol. 132, 259–269 (2001).
- 131 -
81. Teixeira, J. M., de Oliveira-Fusaro, M. C. G., Parada, C. A. & Tambeli, C. H. Peripheral P2X7 receptor-induced mechanical hyperalgesia is mediated by bradykinin. Neuroscience 277, 163–173 (2014). 82. Vanegas, H. & Schaible, H. Effects of antagonists to high-threshold calcium channels upon spinal mechanisms of pain, hyperalgesia and allodynia. Pain 85, 9–18 (2000). 83. Teixeira, J. M., Oliveira, M. C. G., Parada, C. A. & Tambeli, C. H. Peripheral mechanisms underlying the essential role of P2X7 receptors in the development of inflammatory hyperalgesia. Eur. J. Pharmacol. 644, 55–60 (2010). 84. Latremoliere, A. & Woolf, C. J. Central Sensitization: A Generator of Pain Hypersensitivity by Central Neural Plasticity. J. Pain 10, 895–926 (2009). 85. Fields, R. D. & Burnstock, G. Purinergic signalling in neuron–glia interactions. Nat. Rev. Neurosci. 7, 423–436 (2006). 86. Pinho-Ribeiro, F. A., Verri, W. A. & Chiu, I. M. Nociceptor Sensory Neuron-Immune Interactions in Pain and Inflammation. Trends Immunol. 38, 5–19 (2017). 87. Chessell, I. P. et al. Disruption of the P2X7 purinoceptor gene abolishes chronic inflammatory and neuropathic pain: Pain 114, 386–396 (2005). 88. Burnstock, G. Physiology and pathophysiology of purinergic neurotransmission. Physiol. Rev. 87, 659–797 (2007). 89. Burnstock, G. Purinergic Mechanisms and Pain. in Advances in Pharmacology 75, 91–137 (Elsevier, 2016). 90. Cook, S. P. & McCleskey, E. W. Cell damage excites nociceptors through release of cytosolic ATP. Pain 95, 41–47 (2002). 91. Jung, J., Jo, H. W., Kwon, H. & Jeong, N. Y. ATP release through lysosomal exocytosis from peripheral nerves: the effect of lysosomal exocytosis on peripheral nerve degeneration and regeneration after nerve injury. BioMed Res. Int. 2014, 936891 (2014). 92. Pankratov, Y., Lalo, U., Verkhratsky, A. & North, R. A. Vesicular release of ATP at central synapses. Pflüg. Arch. - Eur. J. Physiol. 452, 589–597 (2006). 93. Lorenzo, L.-E. et al. Spatial and temporal pattern of changes in the number of GAD65- immunoreactive inhibitory terminals in the rat superficial dorsal horn following peripheral nerve injury. Mol. Pain 10, 57 (2014). 94. Moore, K. A. et al. Partial peripheral nerve injury promotes a selective loss of GABAergic inhibition in the superficial dorsal horn of the spinal cord. J. Neurosci. Off. J. Soc. Neurosci. 22, 6724–6731 (2002). 95. Polgár, E., Hughes, D. I., Arham, A. Z. & Todd, A. J. Loss of neurons from laminas I-III of the spinal dorsal horn is not required for development of tactile allodynia in the spared nerve injury model of neuropathic pain. J. Neurosci. Off. J. Soc. Neurosci. 25, 6658–6666 (2005). 96. Basbaum, A. I., Bautista, D. M., Scherrer, G. & Julius, D. Cellular and Molecular Mechanisms of Pain. Cell 139, 267–284 (2009). 97. Ji, R.-R., Kohno, T., Moore, K. A. & Woolf, C. J. Central sensitization and LTP: do pain and memory share similar mechanisms? Trends Neurosci. 26, 696–705 (2003). 98. Takasusuki, T., Yamaguchi, S., Hamaguchi, S. & Yaksh, T. L. Effects of general anesthetics on substance P release and c-Fos expression in the spinal dorsal horn. Anesthesiology 119, 433–442 (2013). 99. Ikeda, H., Heinke, B., Ruscheweyh, R. & Sandkühler, J. Synaptic plasticity in spinal lamina I projection neurons that mediate hyperalgesia. Science 299, 1237–1240 (2003). 100. Fenselau, H., Heinke, B. & Sandkuhler, J. Heterosynaptic Long-Term Potentiation at GABAergic Synapses of Spinal Lamina I Neurons. J. Neurosci. 31, 17383–17391 (2011). 101. Puig, S. & Sorkin, L. S. Formalin-evoked activity in identified primary afferent fibers: systemic lidocaine suppresses phase-2 activity. Pain 64, 345–355 (1996).
- 132 -
102. Lipscombe, D. Neuronal proteins custom designed by alternative splicing. Curr. Opin. Neurobiol. 15, 358–363 (2005). 103. Mu, Y., Otsuka, T., Horton, A. C., Scott, D. B. & Ehlers, M. D. Activity-dependent mRNA splicing controls ER export and synaptic delivery of NMDA receptors. Neuron 40, 581–594 (2003). 104. Altier, C. et al. Differential Role of N-Type Calcium Channel Splice Isoforms in Pain. J. Neurosci. 27, 6363–6373 (2007). 105. Marangoudakis, S. et al. Differential Ubiquitination and Proteasome Regulation of CaV2.2 N-Type Channel Splice Isoforms. J. Neurosci. 32, 10365–10369 (2012). 106. Kim, C. et al. Altered Nociceptive Response in Mice Deficient in the ?1B Subunit of the Voltage-Dependent Calcium Channel. Mol. Cell. Neurosci. 18, 235–245 (2001). 107. Hatakeyama, S. et al. Differential nociceptive responses in mice lacking the alpha(1B) subunit of N-type Ca(2+) channels. Neuroreport 12, 2423–2427 (2001). 108. Feinberg, R., Pohl, M., Bokarius, V., Darnall, B. & Feinberg, S. Chronic Pain Management: An Integrated Guide to Medical, Interventional, Behavioral, Pharmacologic and Rehabilitation Therapies. (2017). 109. Sommer, C. & Cruccu, G. Topical Treatment of Peripheral Neuropathic Pain: Applying the Evidence. J. Pain Symptom Manage. 53, 614–629 (2017). 110. Wood, J. N., Boorman, J. P., Okuse, K. & Baker, M. D. Voltage-gated sodium channels and pain pathways. J. Neurobiol. 61, 55–71 (2004). 111. Bicker, J., Alves, G., Fortuna, A. & Falcão, A. Blood-brain barrier models and their relevance for a successful development of CNS drug delivery systems: a review. Eur. J. Pharm. Biopharm. Off. J. Arbeitsgemeinschaft Pharm. Verfahrenstechnik EV 87, 409–432 (2014). 112. Cheng, O. T., Souzdalnitski, D., Vrooman, B. & Cheng, J. Evidence-based knee injections for the management of arthritis. Pain Med. Malden Mass 13, 740–753 (2012). 113. Sandkühler, J. Understanding LTP in pain pathways. Mol. Pain 3, 9 (2007). 114. Macabuag, N. & Dolphin, A. C. Alternative Splicing in Ca(V)2.2 Regulates Neuronal Trafficking via Adaptor Protein Complex-1 Adaptor Protein Motifs. J. Neurosci. Off. J. Soc. Neurosci. 35, 14636–14652 (2015). 115. Madisen, L. et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat. Neurosci. 13, 133–140 (2010). 116. Maccarrone, M. Characterization of the endocannabinoid system in boar spermatozoa and implications for sperm capacitation and acrosome reaction. J. Cell Sci. 118, 4393–4404 (2005). 117. Mizrak, S. C. & van Dissel-Emiliani, F. M. F. Transient receptor potential vanilloid receptor- 1 confers heat resistance to male germ cells. Fertil. Steril. 90, 1290–1293 (2008). 118. Francavilla, F. et al. Characterization of the endocannabinoid system in human spermatozoa and involvement of transient receptor potential vanilloid 1 receptor in their fertilizing ability. Endocrinology 150, 4692–4700 (2009). 119. Kamentsky, L. et al. Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software. Bioinforma. Oxf. Engl. 27, 1179–1180 (2011).
- 133 -