SPDI: Data Model for Variants and Applications at NCBI 1,* 1 1 1 1 J
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic and Environmental Exposures Constrain Epigenetic Drift Over the Human Life Course
Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Research Genetic and environmental exposures constrain epigenetic drift over the human life course Sonia Shah,1,9 Allan F. McRae,1,9 Riccardo E. Marioni,1,2,3,9 Sarah E. Harris,2,3 Jude Gibson,4 Anjali K. Henders,5 Paul Redmond,6 Simon R. Cox,3,6 Alison Pattie,6 Janie Corley,6 Lee Murphy,4 Nicholas G. Martin,5 Grant W. Montgomery,5 John M. Starr,3,7 Naomi R. Wray,1,10 Ian J. Deary,3,6,10 and Peter M. Visscher1,3,8,10 1Queensland Brain Institute, The University of Queensland, Brisbane, 4072, Queensland, Australia; 2Medical Genetics Section, Centre for Genomic and Experimental Medicine, Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, EH4 2XU, United Kingdom; 3Centre for Cognitive Ageing and Cognitive Epidemiology, University of Edinburgh, Edinburgh, EH8 9JZ, United Kingdom; 4Wellcome Trust Clinical Research Facility, University of Edinburgh, Western General Hospital, Crewe Road, Edinburgh, EH4 2XU, United Kingdom; 5QIMR Berghofer Medical Research Institute, Brisbane, 4029, Queensland, Australia; 6Department of Psychology, University of Edinburgh, Edinburgh, EH8 9JZ, United Kingdom; 7Alzheimer Scotland Dementia Research Centre, University of Edinburgh, Edinburgh, EH8 9JZ, United Kingdom; 8University of Queensland Diamantina Institute, Translational Research Institute, The University of Queensland, Brisbane, 4072, Queensland, Australia Epigenetic mechanisms such as DNA methylation (DNAm) are essential for regulation of gene expression. DNAm is dy- namic, influenced by both environmental and genetic factors. Epigenetic drift is the divergence of the epigenome as a function of age due to stochastic changes in methylation. -
Small Variants Frequently Asked Questions (FAQ) Updated September 2011
Small Variants Frequently Asked Questions (FAQ) Updated September 2011 Summary Information for each Genome .......................................................................................................... 3 How does Complete Genomics map reads and call variations? ........................................................................... 3 How do I assess the quality of a genome produced by Complete Genomics?................................................ 4 What is the difference between “Gross mapping yield” and “Both arms mapped yield” in the summary file? ............................................................................................................................................................................. 5 What are the definitions for Fully Called, Partially Called, Half-Called and No-Called?............................ 5 In the summary-[ASM-ID].tsv file, how is the number of homozygous SNPs calculated? ......................... 5 In the summary-[ASM-ID].tsv file, how is the number of heterozygous SNPs calculated? ....................... 5 In the summary-[ASM-ID].tsv file, how is the total number of SNPs calculated? .......................................... 5 In the summary-[ASM-ID].tsv file, what regions of the genome are included in the “exome”? .............. 6 In the summary-[ASM-ID].tsv file, how is the number of SNPs in the exome calculated? ......................... 6 In the summary-[ASM-ID].tsv file, how are variations in potentially redundant regions of the genome counted? ..................................................................................................................................................................... -
The Variant Call Format Specification Vcfv4.3 and Bcfv2.2
The Variant Call Format Specification VCFv4.3 and BCFv2.2 27 Jul 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 1715701 from that repository, last modified on the date shown above. 1 Contents 1 The VCF specification 4 1.1 An example . .4 1.2 Character encoding, non-printable characters and characters with special meaning . .4 1.3 Data types . .4 1.4 Meta-information lines . .5 1.4.1 File format . .5 1.4.2 Information field format . .5 1.4.3 Filter field format . .5 1.4.4 Individual format field format . .6 1.4.5 Alternative allele field format . .6 1.4.6 Assembly field format . .6 1.4.7 Contig field format . .6 1.4.8 Sample field format . .7 1.4.9 Pedigree field format . .7 1.5 Header line syntax . .7 1.6 Data lines . .7 1.6.1 Fixed fields . .7 1.6.2 Genotype fields . .9 2 Understanding the VCF format and the haplotype representation 11 2.1 VCF tag naming conventions . 12 3 INFO keys used for structural variants 12 4 FORMAT keys used for structural variants 13 5 Representing variation in VCF records 13 5.1 Creating VCF entries for SNPs and small indels . 13 5.1.1 Example 1 . 13 5.1.2 Example 2 . 14 5.1.3 Example 3 . 14 5.2 Decoding VCF entries for SNPs and small indels . 14 5.2.1 SNP VCF record . 14 5.2.2 Insertion VCF record . -
A Pilot Analysis of DNA Methylation in Candidate Genes in Brain
cells Article Epigenetic Study in Parkinson’s Disease: A Pilot Analysis of DNA Methylation in Candidate Genes in Brain Luis Navarro-Sánchez 1 , Beatriz Águeda-Gómez 1, Silvia Aparicio 1 and Jordi Pérez-Tur 1,2,3,* 1 Unitat de Genètica Molecular, Instituto de Biomedicina de Valencia, CSIC, 46010 València, Spain; [email protected] (L.N.-S.); [email protected] (B.Á.-G.); [email protected] (S.A.) 2 Centro de Investigación Biomédica en Red en Enfermedades Neurodegenerativas (CIBERNED), 46010 València, Spain 3 Unidad Mixta de Genética y Neurología, Instituto de Investigación Sanitaria La Fe, 46026 València, Spain * Correspondence: [email protected]; Tel.: +34-96-339-1755 Received: 25 July 2018; Accepted: 21 September 2018; Published: 26 September 2018 Abstract: Efforts have been made to understand the pathophysiology of Parkinson’s disease (PD). A significant number of studies have focused on genetics, despite the fact that the described pathogenic mutations have been observed only in around 10% of patients; this observation supports the fact that PD is a multifactorial disorder. Lately, differences in miRNA expression, histone modification, and DNA methylation levels have been described, highlighting the importance of epigenetic factors in PD etiology. Taking all this into consideration, we hypothesized that an alteration in the level of methylation in PD-related genes could be related to disease pathogenesis, possibly due to alterations in gene expression. After analysing promoter regions of five PD-related genes in three brain regions by pyrosequencing, we observed some differences in DNA methylation levels (hypo and hypermethylation) in substantia nigra in some CpG dinucleotides that, possibly through an alteration in Sp1 binding, could alter their expression. -
A Semantic Standard for Describing the Location of Nucleotide and Protein Feature Annotation Jerven T
Bolleman et al. Journal of Biomedical Semantics (2016) 7:39 DOI 10.1186/s13326-016-0067-z RESEARCH Open Access FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation Jerven T. Bolleman1*, Christopher J. Mungall2, Francesco Strozzi3, Joachim Baran4, Michel Dumontier5, Raoul J. P. Bonnal6, Robert Buels7, Robert Hoehndorf8, Takatomo Fujisawa9, Toshiaki Katayama10 and Peter J. A. Cock11 Abstract Background: Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. Description: We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Conclusions: Our ontology allows -
A Combined RAD-Seq and WGS Approach Reveals the Genomic
www.nature.com/scientificreports OPEN A combined RAD‑Seq and WGS approach reveals the genomic basis of yellow color variation in bumble bee Bombus terrestris Sarthok Rasique Rahman1,2, Jonathan Cnaani3, Lisa N. Kinch4, Nick V. Grishin4 & Heather M. Hines1,5* Bumble bees exhibit exceptional diversity in their segmental body coloration largely as a result of mimicry. In this study we sought to discover genes involved in this variation through studying a lab‑generated mutant in bumble bee Bombus terrestris, in which the typical black coloration of the pleuron, scutellum, and frst metasomal tergite is replaced by yellow, a color variant also found in sister lineages to B. terrestris. Utilizing a combination of RAD‑Seq and whole‑genome re‑sequencing, we localized the color‑generating variant to a single SNP in the protein‑coding sequence of transcription factor cut. This mutation generates an amino acid change that modifes the conformation of a coiled‑coil structure outside DNA‑binding domains. We found that all sequenced Hymenoptera, including sister lineages, possess the non‑mutant allele, indicating diferent mechanisms are involved in the same color transition in nature. Cut is important for multiple facets of development, yet this mutation generated no noticeable external phenotypic efects outside of setal characteristics. Reproductive capacity was reduced, however, as queens were less likely to mate and produce female ofspring, exhibiting behavior similar to that of workers. Our research implicates a novel developmental player in pigmentation, and potentially caste, thus contributing to a better understanding of the evolution of diversity in both of these processes. Understanding the genetic architecture underlying phenotypic diversifcation has been a long-standing goal of evolutionary biology. -
VCF/Plotein: a Web Application to Facilitate the Clinical Interpretation Of
bioRxiv preprint doi: https://doi.org/10.1101/466490; this version posted November 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Manuscript (All Manuscript Text Pages, including Title Page, References and Figure Legends) VCF/Plotein: A web application to facilitate the clinical interpretation of genetic and genomic variants from exome sequencing projects Raul Ossio MD1, Diego Said Anaya-Mancilla BSc1, O. Isaac Garcia-Salinas BSc1, Jair S. Garcia-Sotelo MSc1, Luis A. Aguilar MSc1, David J. Adams PhD2 and Carla Daniela Robles-Espinoza PhD1,2* 1Laboratorio Internacional de Investigación sobre el Genoma Humano, Universidad Nacional Autónoma de México, Querétaro, Qro., 76230, Mexico 2Experimental Cancer Genetics, Wellcome Sanger Institute, Hinxton Cambridge, CB10 1SA, UK * To whom correspondence should be addressed. Carla Daniela Robles-Espinoza Tel: +52 55 56 23 43 31 ext. 259 Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/466490; this version posted November 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. CONFLICT OF INTEREST No conflicts of interest. 2 bioRxiv preprint doi: https://doi.org/10.1101/466490; this version posted November 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Purpose To create a user-friendly web application that allows researchers, medical professionals and patients to easily and securely view, filter and interact with human exome sequencing data in the Variant Call Format (VCF). -
Dbsnp Resources in the UCSC Database Today We Will Discuss
dbSNP resources in the UCSC database Today we will discuss some of the variation data from dbSNP as displayed on the UCSC Genome Browser. We will start at genome.ucsc.edu at the main Browser page and we will ‘reset all user settings’, which brings us to the most recent genome assembly, hg38. [0:28 Set up GB to hg18 defaults] So to begin, let’s go down to hg18, one of the earlier version of the genome, and we will hit the go button. At the Browser graphic page, we will hit the ‘hide all’ button to turn all the data tracks off. [0:45 Turn on SNPs (130) track] Scrolling to the bottom of the screen, to the Variation and Repeats bluebar group, we’ll draw your attention to the dbSNP track, SNPs version 130. In addition, we have earlier versions: 129, 128 and 126. At the time of version 130, before moving to hg19, dbSNP was mapping all new SNPs to the hg18 genome assembly. If we click into the link above the pulldown menu, we can see that this table was last updated in 2009. We’re going to turn the track on to ‘dense’ and then ‘Submit’. This shows us all the SNPs in version 130, and let’s turn on the gene track, UCSC Genes to ‘pack’so we will see the scale. We have 310,000 bases and we have the default gene GABRA3. The region is annotated by many SNPs. Now let’s zoom into one of the exons here in the middle of the screen, and you can that at this resolution, around 5,000 basepairs, there are a dozen or so SNPs in view. -
Infravec2 Open Research Data Management Plan
INFRAVEC2 OPEN RESEARCH DATA MANAGEMENT PLAN Authors: Andrea Crisanti, Gareth Maslen, Andy Yates, Paul Kersey, Alain Kohl, Clelia Supparo, Ken Vernick Date: 10th July 2020 Version: 3.0 Overview Infravec2 will align to Open Research Data, as follows: Data Types and Standards Infravec2 will generate a variety of data types, including molecular data types: genome sequence and assembly, structural annotation (gene models, repeats, other functional regions) and functional annotation (protein function assignment), variation data, and transcriptome data; arbovirus and malaria experimental infection data, linked to archived samples; and microbiome data (Operational Taxonomic Units), including natural virome composition. All data will be released according to the appropriate standards and formats for each data type. For example, DNA sequence will be released in FASTA format; variant calls in Variant Call Format; sequence alignments in BAM (Binary Alignment Map) and CRAM (Compressed Read Alignment Map) formats, etc. We will strongly encourage the organisation of linked data sets as Track Hubs, a mechanism for publishing a set of linked genomic data that aids data discovery, sharing, and selection for subsequent analysis. We will develop internal standards within the consortium to define minimal metadata that will accompany all data sets, following the template of the Minimal Information Standards for Biological and Biomedical Investigations (http://www.dcc.ac.uk/resources/metadata-standards/mibbi-minimum-information-biological- and-biomedical-investigations). Data Exploitation, Accessibility, Curation and Preservation All molecular data for which existing public data repositories exist will be submitted to such repositories on or before the publication of written manuscripts, with early release of data (i.e. -
1 a Primer on Molecular Biology
1APrimer on Molecular Biology Alexander Zien Modern molecular biology provides a rich source of challenging machine learning problems. This tutorial chapter aims to provide the necessary biological background knowledge required to communicate with biologists and to understand and properly formalize a number of most interesting problems in this application domain. The largest part of the chapter (its first section) is devoted to the cell as the basic unit of life. Four aspects of cells are reviewed in sequence: (1) the molecules that cells make use of (above all, proteins, RNA, and DNA); (2) the spatial organization of cells (“compartmentalization”); (3) the way cells produce proteins (“protein expression”); and (4) cellular communication and evolution (of cells and organisms). In the second section, an overview is provided of the most frequent measurement technologies, data types, and data sources. Finally, important open problems in the analysis of these data (bioinformatics challenges) are briefly outlined. 1.1 The Cell The basic unit of all (biological) life is the cell. A cell is basically a watery solution of certain molecules, surrounded by a lipid (fat) membrane. Typical sizes of cells range from 1 µm (bacteria) to 100 µm (plant cells). The most important properties Life of a living cell (and, in fact, of life itself) are the following: It consists of a set of molecules that is separated from the exterior (as a human being is separated from his or her surroundings). It has a metabolism, that is, it can take up nutrients and convert them into other molecules and usable energy. The cell uses nutrients to renew its constituents, to grow, and to drive its actions (just like a human does). -
Semantics of Data for Life Sciences and Reproducible Research[Version 1
F1000Research 2020, 9:136 Last updated: 16 AUG 2021 OPINION ARTICLE BioHackathon 2015: Semantics of data for life sciences and reproducible research [version 1; peer review: 2 approved] Rutger A. Vos 1,2, Toshiaki Katayama 3, Hiroyuki Mishima4, Shin Kawano 3, Shuichi Kawashima3, Jin-Dong Kim3, Yuki Moriya3, Toshiaki Tokimatsu5, Atsuko Yamaguchi 3, Yasunori Yamamoto3, Hongyan Wu6, Peter Amstutz7, Erick Antezana 8, Nobuyuki P. Aoki9, Kazuharu Arakawa10, Jerven T. Bolleman 11, Evan Bolton12, Raoul J. P. Bonnal13, Hidemasa Bono 3, Kees Burger14, Hirokazu Chiba15, Kevin B. Cohen16,17, Eric W. Deutsch18, Jesualdo T. Fernández-Breis19, Gang Fu12, Takatomo Fujisawa20, Atsushi Fukushima 21, Alexander García22, Naohisa Goto23, Tudor Groza24,25, Colin Hercus26, Robert Hoehndorf27, Kotone Itaya10, Nick Juty28, Takeshi Kawashima20, Jee-Hyub Kim28, Akira R. Kinjo29, Masaaki Kotera30, Kouji Kozaki 31, Sadahiro Kumagai32, Tatsuya Kushida 33, Thomas Lütteke 34,35, Masaaki Matsubara 36, Joe Miyamoto37, Attayeb Mohsen 38, Hiroshi Mori39, Yuki Naito3, Takeru Nakazato3, Jeremy Nguyen-Xuan40, Kozo Nishida41, Naoki Nishida42, Hiroyo Nishide15, Soichi Ogishima43, Tazro Ohta3, Shujiro Okuda44, Benedict Paten45, Jean-Luc Perret46, Philip Prathipati38, Pjotr Prins47,48, Núria Queralt-Rosinach 49, Daisuke Shinmachi9, Shinya Suzuki 30, Tsuyosi Tabata50, Terue Takatsuki51, Kieron Taylor 28, Mark Thompson52, Ikuo Uchiyama 15, Bruno Vieira53, Chih-Hsuan Wei12, Mark Wilkinson 54, Issaku Yamada 36, Ryota Yamanaka55, Kazutoshi Yoshitake56, Akiyasu C. Yoshizawa50, Michel -
Practical Guideline for Whole Genome Sequencing Disclosure
Practical Guideline for Whole Genome Sequencing Disclosure Kwangsik Nho Assistant Professor Center for Neuroimaging Department of Radiology and Imaging Sciences Center for Computational Biology and Bioinformatics Indiana University School of Medicine • Kwangsik Nho discloses that he has no relationships with commercial interests. What You Will Learn Today • Basic File Formats in WGS • Practical WGS Analysis Pipeline • WGS Association Analysis Methods Whole Genome Sequencing File Formats WGS Sequencer Base calling FASTQ: raw NGS reads Aligning SAM: aligned NGS reads BAM Variant Calling VCF: Genomic Variation How have BIG data problems been solved in next generation sequencing? gkno.me Whole Genome Sequencing File Formats • FASTQ: text-based format for storing both a DNA sequence and its corresponding quality scores (File sizes are huge (raw text) ~300GB per sample) @HS2000-306_201:6:1204:19922:79127/1 ACGTCTGGCCTAAAGCACTTTTTCTGAATTCCACCCCAGTCTGCCCTTCCTGAGTGCCTGGGCAGGGCCCTTGGGGAGCTGCTGGTGGGGCTCTGAATGT + BC@DFDFFHHHHHJJJIJJJJJJJJJJJJJJJJJJJJJHGGIGHJJJJJIJEGJHGIIJJIGGIIJHEHFBECEC@@D@BDDDDD<<?DB@BDDCDCDDC @HS2000-306_201:6:1204:19922:79127/2 GGGTAAAAGGTGTCCTCAGCTAATTCTCATTTCCTGGCTCTTGGCTAATTCTCATTCCCTGGGGGCTGGCAGAAGCCCCTCAAGGAAGATGGCTGGGGTC + BCCDFDFFHGHGHIJJJJJJJJJJJGJJJIIJCHIIJJIJIJJJJIJCHEHHIJJJJJJIHGBGIIHHHFFFDEEDED?B>BCCDDCBBDACDD8<?B09 @HS2000-306_201:4:1106:6297:92330/1 CACCATCCCGCGGAGCTGCCAGATTCTCGAGGTCACGGCTTACACTGCGGAGGGCCGGCAACCCCGCCTTTAATCTGCCTACCCAGGGAAGGAAAGCCTC + CCCFFFFFHGHHHJIJJJJJJJJIJJIIIGIJHIHHIJIGHHHHGEFFFDDDDDDDDDDD@ADBDDDDDDDDDDDDEDDDDDABCDDB?BDDBDCDDDDD