Mice Diabetes Susceptibility in Nonobese Diabetic Implicates The

Molecular Genetic Analysis of the Idd4 Locus Implicates the IFN Response in Type 1 Diabetes Susceptibility in Nonobese Diabetic Mice This information is current as of September 28, 2021. Evgueni A. Ivakine, Omid M. Gulban, Steven M. Mortin-Toth, Ellen Wankiewicz, Christopher Scott, David Spurrell, Angelo Canty and Jayne S. Danska J Immunol 2006; 176:2976-2990; ; doi: 10.4049/jimmunol.176.5.2976 Downloaded from http://www.jimmunol.org/content/176/5/2976

References This article cites 59 articles, 24 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/176/5/2976.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 28, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Molecular Genetic Analysis of the Idd4 Locus Implicates the IFN Response in Type 1 Diabetes Susceptibility in Nonobese Diabetic Mice1

Evgueni A. Ivakine,*† Omid M. Gulban,* Steven M. Mortin-Toth,* Ellen Wankiewicz,* Christopher Scott,* David Spurrell,* Angelo Canty,‡ and Jayne S. Danska2*†§

High-resolution mapping and identification of the genes responsible for type 1 diabetes (T1D) has proved difficult because of the multigenic etiology and low penetrance of the disease phenotype in linkage studies. Mouse congenic strains have been useful in refining Idd susceptibility loci in the NOD mouse model and providing a framework for identification of genes underlying complex autoimmune syndromes. Previously, we used NOD and a nonobese diabetes-resistant strain to map the susceptibility to T1D to the

Idd4 locus on chromosome 11. Here, we report high-resolution mapping of this locus to 1.4 megabases. The NOD Idd4 locus was Downloaded from fully sequenced, permitting a detailed comparison with C57BL/6 and DBA/2J strains, the progenitors of T1D resistance alleles found in the nonobese diabetes-resistant strain. Gene expression arrays and quantitative real-time PCR were used to prioritize Idd4 candidate genes by comparing macrophages/dendritic cells from congenic strains where allelic variation was confined to the Idd4 interval. The differentially expressed genes either were mapped to Idd4 or were components of the IFN response pathway regulated in trans by Idd4. Reflecting central roles of Idd4 genes in Ag presentation, arachidonic acid metabolism and inflammation, phagocytosis, and lymphocyte trafficking, our combined analyses identified Alox15, Alox12e, Psmb6, Pld2, and Cxcl16 as http://www.jimmunol.org/ excellent candidate genes for the effects of the Idd4 locus. The Journal of Immunology, 2006, 176: 2976–2990.

ype 1 diabetes (T1D)3 is a complex multifactorial disease mans, is the MHC class II haplotype that controls Ag presentation of autoimmune etiology in which susceptibility is con- to CD4ϩ T cells (1). A functional variant of ␤2 microglobulin has T ferred by an interaction between multiple genetic loci and been demonstrated to function as a susceptibility allele in the mu- environmental factors. Through genome-wide linkage studies and rine Idd13.1 region, suggesting that variants affecting MHC class analysis of congenic strains, Ͼ20 insulin-dependent diabetes (Idd) I function also are important in disease (7). A negative regulator of loci have been identified in the diabetes-prone NOD mouse (1–3). T cell activation, Ctla4, has been shown to be a strong candidate by guest on September 28, 2021 Genome scans and association studies in human populations reveal T1D susceptibility gene for the murine Idd5.1 and human IDDM12 similarly complex inheritance (4–6). Despite success in detecting loci (8, 9). The variable-length terminal repeat in the insulin gene many T1D susceptibility loci, identification of the corresponding promoter is strongly associated with T1D susceptibility in humans, genes and elucidation of their immunopathological functions have although it was not detected in genetic linkage studies (10–12). A been complicated by the small effect size of individual loci on the functional variant of the protein tyrosine phosphatase (PTPN22), diabetes phenotype. To date, in mice and humans, five T1D sus- involved in the regulation of T cell activation, was recently iden- ceptibility genes have been characterized at the molecular level. tified in patients with different autoimmune conditions (13) includ- The major susceptibility locus, Idd1 in mice and IDDM1 in hu- ing T1D (14). The remaining T1D susceptibility genes remain un- defined at the DNA sequence level. To analyze contributions of Idd loci predicted to have strong effects *Program in Developmental Biology, Hospital for Sick Children, Toronto, Ontario, on disease susceptibility, we previously compared T1D-prone NOD Canada; †Department of Immunology, University of Toronto, Toronto, Ontario, Can- ada; ‡Department of Mathematics and Statistics, McMaster University, Hamilton, mice with the closely related nonobese diabetes-resistant (NOR) Ontario, Canada; and §Department of Medical Biophysics, and Institute of Medical strain. NOR is a recombinant inbred strain that is 88% identical by Sciences, University of Toronto, Toronto, Ontario, Canada descent to NOD, including the Idd1 locus (H-2g7), but is protected Received for publication November 1, 2005. Accepted for publication December 19, 2005. from T1D by genomic intervals of C57BLKS/J (BKs) origin (15). The costs of publication of this article were defrayed in part by the payment of page C57BLKS/J is a recombinant inbred strain derived from C57BL/6 and charges. This article must therefore be hereby marked advertisement in accordance DBA/2 stocks (16). NOD and NOR mice share all Idd loci identified with 18 U.S.C. Section 1734 solely to indicate this fact. to date, with the exception of Idd4, Idd5, Idd9, and Idd13 (17–20), 1 This work was supported by grants to J.S.D. from the Canadian Institutes of Health which are sufficient to protect NOR animals from both spontaneous Research, the Juvenile Diabetes Research Foundation, the Canadian Genetic Disease Network, National Centers of Excellence, and Genome Canada. E.A.I. was supported and cyclophosphamide-accelerated T1D (CY-T1D). by fellowships from the Banting and Best Diabetes Center, University of Toronto, and CY accelerates T1D onset in NOD males and females from the Research and Training Center, Hospital for Sick Children. months to 2–4 wk, with the cumulative incidence reaching 80– 2 Address correspondence and reprint requests to Dr. Jayne S. Danska, Toronto Med- 100% (20, 21). Similarly, treated NOR mice demonstrate disease ical Discovery Tower 14-313, 101 College Street, Toronto, Ontario, Canada M5G 1L7. E-mail address: [email protected] protection (20). We recently showed that differential susceptibility 3 Abbreviations used in this paper: T1D, type 1 diabetes; NOR, nonobese diabetes- to CY-T1D in NOD and NOR strains resides in the Idd4, Idd5, and resistant; Idd, insulin-dependent diabetes; CY, cyclophosphamide; DC, dendritic cell; Idd9 loci (20). M␾, macrophage; UTR, untranslated; BM, bone marrow; LN, lymph node; SAM, significance analysis of microarrays; FDR, false detection rate; cM, centiMorgans; Here, we report a high-resolution physical map of the Idd4 locus Mb, megabase; SNP, single nucleotide polymorphism. predicated on a series of novel subcongenic strains that refined this

interval to a 1.2- to 1.4-megabase (Mb), gene-dense region. This generated by crossing R1 with R2 mice, intercrossing the resulting progeny, NOD Idd4 locus was sequenced and subjected to detailed genomic and identification of recombinants between D11Mit4 and D11Mit219 markers. comparative analysis with C57BL/6 and DBA/2J strains, the pro- Recombinant mice were backcrossed to the R2 strain, and their progeny was intercrossed to fix NOD-derived subcongenic regions. genitors of the BKs mouse. Gene expression arrays and quantitative real-time PCR were used to prioritize T1D candidate genes by CY treatment and diabetes assessment of congenic mice ␾ comparing macrophages/dendritic cells (M /DCs) from congenic T1D was induced by CY treatment as described previously (20). Blood strains where allelic variation was confined to the Idd4 interval. glucose levels were measured on days 14, 21, 24, 27, and 35 after the first The majority of the differentially expressed genes were either lo- injection using a FastTake blood glucose monitor (LifeScan Canada). Mice Ͼ cated within Idd4 reflecting RNA abundance variations or genes with blood glucose levels 16 mmol/L on two subsequent measurements were considered to be diabetic. The difference in diabetes incidence be- mapped outside the interval that participate in the IFN response tween NOR mice and congenic strains was assessed using Fisher’s exact pathway, suggesting a role in T1D pathogenesis. Integration of test in the statistical software package SPSS for PC version 8.01 (SPSS). gene expression, sequence, and in silico analysis for all genes in Generation and testing of novel markers this interval supports five attractive candidates for the Idd4 locus. To identify novel markers within Idd4, we queried the Idd4 genomic se- Materials and Methods quence from Celera (͗www.celera.org͘) or Ensembl (͗www.ensembl.org/ mouse͘) databases for long (n Ͼ 15) dinucleotide repeats using a software Mice program that we developed called diNucleotide Tandem Repeat Finder ͗ All mice used in this study were maintained in a specific pathogen-free ( http://gchelpdesk.ualberta.ca/servers/tandem_repeat_finder/cgitandem_dtrf. ͘ barrier facility at the Hospital for Sick Children. Spontaneous diabetes php ). The repeats and the corresponding 300-nt flanking sequences were used incidence at age 6 mo in NOD/Jsd animals is 83% in females and 35% in for primer design (Primer Express Version 1.5; Applied Biosystems). To Downloaded from identify informative markers, DNA from NOD, NOR, DBA/2J, and C57BL/6 males and 0% in NOR and (NODxNOR) F1 mice. All procedures performed on these mice followed the guidelines of the institutional animal mice was amplified for 35 cycles with the following conditions: 30 s at 94°C, care committee. 30 s at 55°C, and 1 min at 72°C in 1.5 mM MgCl2. The amplification products were electrophoresed through either 2% NuSieve (American Bioanalytical) Genomic DNA preparation and genotyping and 2% agarose (Invitrogen Life Technologies) or 8% acrylamide gels and were visualized with ethidium bromide. Novel polymorphic microsatellite For microsatellite analysis, genomic DNA was prepared from tail snips markers used in this study are presented in Table I. with a DNeasy kit (Qiagen) and diluted 1/20 for use in PCR amplification. http://www.jimmunol.org/ All microsatellite markers used in this study were amplified with the fol- DBA/2J fragment sequences within Idd4 lowing conditions: 10 cycles (30 s at 94°C, 30 s at 50°C, and 1 min at Idd4 72°C), followed by 35 cycles (30 s at 94°C, 30 s at 55°C, and 1 min at 72°C The sequence representing (1.4 Mb) was downloaded from Ensembl DB and searched against Celera’s fragments database. The search output in 1.5 mM MgCl2). The amplification products were electrophoresed through 2% NuSieve (American Bioanalytical) and 2% agarose (Invitrogen was parsed for the occurrence of the term DBA/2J in the identifier line, Life Technologies) gels and were visualized with ethidium bromide. resulting in 2931 DBA/2J fragments. The DBA/2J fragments were re- BLASTed against the Idd4 locus using standalone BLAST. The best hit for Generation of Idd4 subcongenic mice each fragment was parsed and a genomic position assigned to the alignment relative to the C57BL/6J genome. A total of 603 DBA/2J fragments Previously described NOR.NOD-Idd4 mice (20) were backcrossed with the that had complete alignment with Idd4.1 and 973 fragments with 90–99% NOR strain, their pups were intercrossed, and the resulting progeny geno- alignment were selected for analysis. To further filter false positives, the by guest on September 28, 2021 typed for D11Mit74, D11Mit340, D11Mit230, D11Mit135, D11Mit217, fragments were compared with the Mus musculus genome. Fragments that D11Mit310, D11Mit164, D11Mit157, D11Mit177, D11Mit4, D11Mit368, aligned with Idd4 and returned no other genome hits or fragments that D11Mit30, D11Mit90, D11Mit364, D11Mit219, D11Mit322, and D11Bhm149 to aligned to Idd4 and had a far lower percent identity alignment at another capture recombinant animals. NOR.NOD-Idd4 (R1) and NOR.NOD-Idd4 (R2) site were selected. These selection criteria resulted in 417 DBA/2J frag- subcongenic strains were generated by backcrossing corresponding recombi- ments, with an average length of 746 bp. Of these, 136 aligned with 169 nants to the NOR and intercrossing the progeny to fix NOD-derived subcon- exons residing in 29 genes. These outputs represent all definitive DBA/2J genic intervals. NOR.NOD-Idd4 (R3) and NOR.NOD-Idd4 (R4) strains were exonic sequence available from the Celera database. These fragments were

Table I. Microsatellite markers used to identify Idd4 boundariesa

Marker Forward Primer Reverse Primer Ensembl Start

D11Gul2535 GGTACGGGTAACTCCAGCAG GGAGCCTAACGTGGGAACTA 69560936 D11Gul2537 ACCCAATCAATTATCACCCAG TGATGTACGAAACTCTACCAACTG 69571072 D11Gul2538 CTACTGGGCTCCAAGGGTC TCCTGCCTTCTGCATTTTTA 69576592 D11Gul2539 AGCAGTCAGTGCTTTTAACCC TGTGTTCAGTCTCCAGTGTCC 69629011 D11Gul2560 TTTGTGGGACACTAAGCAGG CCACTTCTTAAGTGAGCTGTAGC 69721859 D11Gul2583 TGTAGAGCGAGGGTATGGG AACTGGTATCAGACACCTGGG 69847285 D11Gul2602 GCAAACCATGCCATACCC TTCCTTGTTCTGCACTCCC 69938022 D11Gul2616 CTTACACAGCAATGGGAATAGC TGAGTTCTCTATGGATTTTGGC 69992257 D11Gul2622 CAGTGAGCTAAATCCTGGTCC AAATCTCCTTTCTCCATGCC 70024282 D11Gul2625 GTTTCCTCCTCAGCTATCTGG AGAGCAAGCAGAAACAGGC 70060109 D11Gul2629 ACTCACATGCACCCACTCC TTGGTTTAGTCAAGTTCAAGGG 70090945 D11Mit90 TCTCCAGCCCCTTCATTATG TGCCAAACACCCATGAGAC 70112196 D11Gul2634 AATCTGTGCTCTCAAGGAAGC TCCCAGAACACATACACATGG 70123640 D11Gul2636 AGCTGCTGTTATGGTCATGG TTACCTGATGTTAACCCTGGC 70147640 D11Gul2657 CATCTTTTTCTTCCTGGACTATAGC TCTTTGGGTTCTGTGGGC 70305497 D11Gul2671 ATGCACACCAGATCAAATGG CCTGCATAAAACAGTGGCC 70374460 D11Gul2694 CCCTCTCTTTACCATGTCCC AGCCATATTTTGAGGTATCTCG 70643109 D11Gul2695 CACAGCTCTAGTTCCTGGGA AAGGCGTCTCACATAGCATC 70709712 D11Gul2700 CCACCCCATGTAAATAGCATAG TCTCCTGAATGATGAGGCAT 70756696 D11Gul2721 TTTGAAAGTCACCCACTTCTG TGTACTTCTAAAAGGCTCTTCTGAG 70950163

a Microsatellite markers used to identify Idd4 boundaries. Sequences for the forward and reverse primers of each marker are shown in the 5Ј to 3Ј direction. Public D11Mit90 (bold font) and novel computationally derived (D11Gul) markers were tested for polymorphism between NOD and NOR mice and found to be polymorphic between these strains. Positions of the markers, according to the Ensembl database (www.ensembl.org), are shown. Public marker D11Mit90 is depicted in bold font. 2978 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE then aligned to identify potential polymorphisms among NOD, C57BL/6, riﬁed and cloned with a PCR cloning kit (Qiagen) according to the man- and DBA/2J. ufacturer’s instructions. Primer design for real-time PCR gene expression analysis Sequencing of candidate genes All genes from the critical Idd4 interval region were queried through the The coding regions of ﬁve genes (Psmb6, Alox15, Cxcl16, Pld2, and Ensembl database. Primers were designed using Primer Express Version C1qbp) with known functions in immunological responses were compared 1.5 with the following requirements: 1) primers were biased toward the by direct sequencing from NOD and NOR strains. cDNA prepared from 3Јend of a gene; 2) one primer overlapped an exon-exon junction for Ն4 activated BM-DC/M␾ was used as a PCR template under the following nt; 3) the predicted PCR product length was between 100 and 150 bp; and conditions: 30 s at 94°C, 30 s at 65°C, and 1 min at 72°C in 1.5 mM

4) primer melting temperature was 60 or 61°C. For genes with several MgSO4 for 30 cycles using High-Fidelity Taq polymerase (Invitrogen Life alternatively spliced transcripts as predicted by Ensembl, we designed Technologies). The 5Ј regulatory (5Јreg) and the untranslated (UTR) re- primers that recognized all of the different isoforms whenever possible. gions of the Psmb6, Alox15, and Pld2 genes also were amplified and se- Alternatively, primers for all predicted individual transcripts were quenced in NOD and NOR strains, using genomic DNA as a template and designed. the same PCR conditions. Sequencing primers were designed using Primer Express 1.5 software (Applied Biosystems) and are listed in Table III. PCR Tissue preparations for gene expression analysis products were purified per the manufacturer’s instructions (Qiagen) and To analyze gene expression within the Idd4 region, the following tissues sequenced on both strands at the Center for Applied Genomics. Sequence from NOR and NOR.NOD-Idd4 male mice were used: RBC-depleted bone files for NOD and NOR strains were then aligned and compared using marrow (BM), RBC-depleted spleen, thymus, lymph node (LN), LN cell Lasergene software (DNASTAR). suspensions cultured in medium for 5 h (no activation), LN cell suspen- Analysis of differential gene expression using microarrays sions cultured in medium with conconavalin A (10 mg/ml) for 5 h (activated), and BM-derived M␾ either activated with LPS (100 ng/ml) and RNA from resting NOR.NOD-Idd4 (R3) (n ϭ 3) and NOR.NOD-Idd4(R4) Downloaded from IFN-␥ (10 ng/ml) for 12 h or cultured in medium without activation. (n ϭ 3) BM-derived DC/M␾ was extracted as described above, with the Preparation of splenocytes, thymocytes, and LN cells. Spleen, thymus, additional purification step (RNeasy kit; Qiagen) according to the manu- and mesenteric LN were aseptically dissected, and single-cell suspensions facturer’s instructions. Microarray target preparation was performed using were prepared in 5 ml of staining medium (1ϫ HBSS (Invitrogen Life standardized protocols as suggested by Affymetrix (͗http://tcag.bioinfo. Technologies), 2% calf serum (Sigma-Aldrich), filtered through a 0.85-␮m sickkids.on.ca/microarray.html͘). RNA was reverse transcribed to generate Nitex mesh (Sefar America), and collected by centrifugation at 400 ϫ g for dscDNA that was then used to synthesize biotin-labeled cRNA using in 5 min at 4°C. To mimic T cell activation, 107 LN cells were cultured in 10 vitro transcription. Fragmented cRNA was hybridized to Affymetrix http://www.jimmunol.org/ ml of DMEM (supplemented with 10% FBS, 10 mM HEPES (pH 7.0), 50 MGU74Av2 arrays and scanned using a confocal scanner (Agilent). Ex- nM 2-mercaptoethanol, 2 mM glutamine, 1ϫ nonessential amino acids, pression values for each probe set were calculated using Affymetrix Mi- and 1% penicillin/streptomycin) in the presence of conconavalin A (10 croarray Suite 5.0 software. mg/ml) in T-25 Falcon flasks for5hofculture, then washed and collected Statistical analysis. Quantile normalization (22) in an R package (Bio- by centrifugation. conductor; (͗www.bioconductor.org͘) was used to remove nonbiological Preparation of BM-derived M␾/DCs. Femurs and tibias were removed, variation across arrays. Robust Multiarray Average (23) was used to cal- flushed with 10 ml of DMEM, clumps dispersed by repeated aspiration, culate an expression value for every probe set. To determine which genes and the suspensions were filtered through a 70-␮m nylon cell strainer. A were differentially expressed between R3 and R4 samples, a significance total of 20 ϫ 106 RBC-depleted cells were used for RNA extraction. The analysis of microarrays (SAM) (24) was performed. SAM assigns a score remaining cells were adjusted to 106 cells/ml in DMEM containing 10 to each probe set based on the change in gene expression relative to the SD ng/ml recombinant mouse GM-CSF (R&D Systems). A total of 20–25 ϫ of the repeated measurements for the probe set and uses a significance by guest on September 28, 2021 106 cells were plated in T-75 Falcon flasks and incubated for 7 days, chang- threshold “␦” to control the proportion of falsely identified genes at a ing to fresh DMEM-10 with GM-CSF every 2 days. Before the medium desired level. The threshold ␦ can be adjusted to identify sets of genes, and change, the flasks were washed twice with PBS. On day 7, half of the flasks the false detection rate (FDR) for each set is estimated from the data. were treated with LPS (100 ng/ml; Sigma-Aldrich) and IFN-␥ (10 ng/ml; The relative difference (d(g)) in gene expression is computed from R&D Systems) for 12 h, and the remaining cells were incubated in fresh Equation 1: medium without stimulation. Flow cytometric analysis demonstrated that X (g) Ϫ X (g) the cells were Ͼ95% CD11bϩ and 10–20% CD11cϩ at the conclusion of ϭ R3 R4 d(g) ϩ , the cultures (data not shown). S(g) S0 RNA extraction and cDNA synthesis where the X-bars indicate the mean expressions for the g-th gene in R3 and R4 samples, S(g) indicates the gene-specific scatter (based on the SDs of

RNA was isolated from mouse tissues and ex vivo-cultured cells using repeated measurements for the gene in the R3 and R4 samples), and S0 is TRIzol (Invitrogen Life Technologies) according to the manufacturer’s in- a constant added to stabilize the variance so that all data can be used in the structions. cDNA was synthesized using Omniscript reverse transcriptase analysis. SAM was used to calculate the observed relative difference for (Qiagen) according to the manufacturer’s instructions. cDNA samples were each gene in each paired comparison. SAM estimated the expected relative diluted 1/25 for use in a quantitative real-time PCR. difference under the “null” assumption that no genes are differentially expressed. The null distribution of the relative differences d(g) was computed Analysis of gene expression by real-time PCR from multiple permutations of the data set. For each permutation, the rel- Expression of genes within the Idd4 was analyzed under the following ative differences were ranked relative to the differences averaged across all conditions: denaturation at 95°C for 15 s, followed by annealing/extension of the permutations. The observed relative differences were ranked by mag- at 59°C for 1 min for 40 cycles. Real-time PCR was performed in 20-␮l nitude and plotted against the averaged relative differences from the per- reactions containing a 4-␮l volume of diluted cDNA, 0.2 ␮M primers (see mutations to generate a SAM plot. The expected number of false positives Table II), and 1ϫ SYBR Green buffer (Applied Biosystems) using the was found by considering each of the permutations and counting the num- ABI/PRIZM 7900 HT cycler (Applied Biosystems). For each gene, serial ber of genes that would be declared significant and averaging these num- dilutions (102–107) of a plasmid containing the gene sequence were used as bers. The FDR is estimated as the expected number of false positives di- a reference for the standard curve calculation. The fluorescence thresholds vided by the number of probe sets declared significant for the original data. and the corresponding cDNA copy numbers were calculated using SDS 2.0 Sequencing of the Idd4 region in the NOD mouse software (Applied Biosystems). For each gene, the reactions were performed in triplicate, and the quantity of cDNA was normalized to the Based on our map of the Idd4 locus, this region of the NOD genome was cDNA amounts of both ␤-actin and Hprt. Idd4-region gene sequences were selected for genomic sequencing at the Wellcome-Sanger Institute (Cam- obtained from the Ensembl database. The National Institute on Aging and bridge, UK) funded by a NOD genomic sequencing subcontract from the RIKEN cDNA clones, corresponding to the genes, were identified by per- National Institutes of Health (Bethesda, MD). Ten NOD bacterial artificial forming basic local alignment sequence tool (BLAST) analyses of cDNA chromosome (BAC) clones spanning the interval between D11Gul2537 libraries available at (͗http://lgsun.grc.nia.nih.gov/cdna͘) and (͗http:// and D11Gul2721 markers were completely sequenced, and the data posted genome.gsc.riken.go.jp͘), respectively. Available clones were obtained for free access at the institute’s web site. Additional information regarding from the Center for Applied Genomics at the Hospital for Sick Children. this project can be found at (͗www.sanger.ac.uk/cgi-bin/projects/ When plasmids were unavailable, the corresponding PCR product was pu- m_musculus/mouse_nod_clones_tpf͘). The Journal of Immunology 2979

Table II. Idd4 and IFN response genes analyzed by real-time PCRa

Ensembl ID Transcript ID ENSMUSG ENSMUST 000000 000000 Gene Name Plasmid Clone Forward Primer Reverse Primer

18569 Cldn7 NIA H3084E04 TGAACGTTAAGTACGAGTTTGGACC GCAAGAGAGCAGGGCACCT 18565 Rai12 NIA H3150E05 AACGTGCAACTTACCAGACTTGG ATGATCCGGGTGTAGCTCAGAA 18559 Dullard Riken 23110001F03 CAGGAGCCACCCAGACAATG ACCTGAGGGCATCCAGCAT 18567 Gabarap Riken 0610041C01 CCGGAAGCGAATTCATCTCC GTGTTCCTGGTACAGCTGACCC 18572 2410141M05Rik Riken 2410141M05 TGGTAGAATCAGGTGACGACTCC TCCACGTCCCACAGAGGC 20888 Dvl2 Direct cloning TGGTGGCTGTGAGAGTTACCTAGTT CAGGGAGTAGCTCCAGGCAGA 18574 Acadvl NIA H3137D08 TTGTCAACGAGCAGTTCCTGC GCCCTCACTCAGGGACCTTG 20886 Digh4 Direct cloning TGACGCAGATGGAAGTGCAC AGGGACACAGGATCCAAACTTGT 20884 Asgr1 Direct cloning CCAGGGATGAGCAGAACTTCCT CTGTTCCATCCACCCATTTCC 40963 Asgr2 Direct cloning CAGGAGCCAGTTTCATATTTGGATA AGGCCCAATTCCTGTAGTTGC 40950 Mgl2 Riken D730047H02 TCCCTGGAGGAGCAGAATTTTC GTCCCATCCACCCATCGC 318 Mql1 NIA H4018A05 GGACTGGGAGGAGGTGAGGAC GCTCCTAGCTCTCCTTGGCC 40938 Slc16a11 Direct cloning CGGAGCACTTTGAACGAAGC CGAGGTTAGGACTCCCCCAA 44367 Slc16a13 NIA H3031G08 ATGCTGCTTGCTTCATTTGCTAC GCCATGGTCGGAGTGAAGGT 317 Bcl6b Direct cloning TTTTGTTCAGGTGGCACACCT GTCTGTAGATGGCGGAAGCG 20831 0610010K14Rik NIA H3017E06 AGATGACGTCCGGTGTCCTCT TGTCACATCAGCCTTCTGTTTCTTT 40904 D11Bwg0434e NIA H3129D04 AGTGATCATGTTGATAATGCTCGG GAGGACCGTTCTCAAAATCTTTCTC 320 Alox12 NIA H3083C09 TGACGATGGAGACCGTGATG TCCTAGAGGTACCATGTCTGGCTG 18907 Alox12e NIA H3060A10 GCCTGTCATGGTGGCCCT CTTGTCCATGATAGCCAGCTCC 18924 Alox15 Direct cloning AGCTCATTGTGTCCCCCTGA CGTACCGATTCATGACTTGCC 18921 19065 4930563C04Rik NIA H3135H07 ACTGAGGGTGGAGGTGACAAAGT CTGTATCATCTTGCTCCTTTTCCTGA Downloaded from 18921 19066 4930563C04Rik Riken 4930563C04 GCAGGTGCTGCAGGTTCTTC GCATTTCTCTGCCTCATCTCTCC 60216 Arrb2 Direct cloning CCATGTCTGCCTGGTGCC ATCCCCAGCACCTCCTTGTT 18923 1110030J09Rik NIA H3067G02 TGGAGGCAGAGCTATCCGC CATTTGACAGTCCTTCCTGGAAGA 18920 Cxcl16 NIA H4058G03 CGTTGTCCATTCTTTATCAGGTTCC TTGCGCTCAAAGCAGTCCA 40829 ZMYND15 Direct cloning AGGGACCCAAGCCTGACCT CTGGCACTCGGAGAGACTGTAAC 18919 Tm4sf5 Riken 2010003F10 GCATCAAGTCTGGAACTTGTGCT CAGTGAGCTGCACCCTCCTT 20830 U6350 MOUSE Direct cloning CTCTGAATGGGATCCGGCTAC AGGCTCACTCCATGAACCCC 40807 C730027E14Rik Direct cloning CACTGTCTTCGCCTTTGCCA CCGCTCCCATGTGATCATAGTC

18286 Psmb6 NIA H3042H05 GTACAGAGAAGATCTGATGGCAGGAATC GGACTGTCTTACCATCATACCCCCC http://www.jimmunol.org/ 20828 Pld2 NIA H3051C07 TTGGTTCTGCGAACATCAATGA CCCATCCATGAGGGATGGTT 20827 Map4k6 Direct cloning CGGCTCAAGGTCATCTATGGC TGTGATCTGGCTCTGGATATGTACA 14609 Chrne Riken 1700027E10 GCCACTGGAGAGGAACTGTCC AGAGTAGAACCAACGCTGAAGAGC 50675 Gp1ba Direct cloning CTGGCCAACAACAAATTGCG GGGTCCCAAAGAAGCCCTTT 14606 Slc25a11 NIA H3008A02 AAAACTAGGATCCAGAATATGCGGA CTGAAGAAACCCTCATAGCGGA 40746 Rnf167 NIA H3141A05 ACTTCCCTGTGCTCATGCTTATCA GACCCCGATGTACAGGCTGTT 18293 Pfn1 Riken 2510040G14 AGCATTACGCCAGCTGAGGTT GTCCCGGATCACAGAACATTTC 60600 Eno3 Riken 0610010124 TTGCACAATCTAATGGCTGGG TTGATCTGTCCTGTGCAGAGTCC 18287 Spaq7 NIA H4001D01 AAGCGGGACACACGGTCC GCGGGATGCCTGGTAGTTG 40712 36299 Camta2 Direct cloning AGGAGAGCAGGGCTTAAGGTTACA TGCTTGGCCAGTGAGATCATG 40712 36311 Camta2 NIA H4034E02 AACAAGGGCACCTTTCTCACC GGTTCTGCTTCAGTTCCCTCATT 20821 Kif1c Direct cloning CCCGCTGACTCAGGATCTTG GTGGTCGTTGGGCACTGTCT

40686 Novel prediction Direct cloning CCGGCCTCATCAGACATCAG GATGGCGGATAAGCTCCGA by guest on September 28, 2021 20817 Rabep1 Direct cloning AGAAAGACAACGACAGCCTCCA TTCCCGGAGCACCTCCAC 40667 35291 Nup88 Direct cloning CAGAAGAGGAAACTGAAGATAACTACGG CATTCCTGACTCAGTCGCAATTACT 40667 35283 Nup88 NIA H3086F12 AACGCCATCAAACAGGTTACTATGA TCGCTGGTAGGCACTGAGAGTAAT 18449 2400006N03Rik Riken 2400006N03 CCCTCATCTGTCCTGTGTGTATAAAG CAGGTCTGTTGAGTGAACAGGGA 18446 C1gbp NIA H3001A04 GCTGAAGAACAGGAGCCAGAAC GGATAGTGACAGTCCAGTACAAGGGT 40633 3110057P17Rik Riken 3110057P17 CAACACAGCTGCTCAGGGATTAC GAGCTGTCCCTTTGGCTGAA 40620 Dhx33 Direct cloning GAGATCCAGAGGTGTAACCTGGC TCTGGAGAAGGTTTGGACATGAA 18442 Der12 NIA H3109G04 CGCATGAACTTCTTTGGTCTTCTAA TGCAATACCCAAAAGGTCCACT 40599 Misc12 NIA H3024E02 CAGAGATTTTCACAGCTGAGAGTGC CAGCAGGCAAGTCTGTGGTGT 18451 6330403K07Rik NIA H3050B10 GGAGGAGGTTTTGTGGTTACCAG CATCTCTGAAGACTTGTGGTCTACTTTTC 40575 48505 Novel prediction Direct cloning CCCCTGGGATGGTTCTGTACA ACCCCTCCAGATTACTGTTGAATTTAA 40575 48514 Novel prediction Direct cloning CTCTGCAGCATGCAGTCTTTGT TCCAACCCCTCCAGATTACTGTT 40575 48523 Novel prediction Direct cloning ACACAGTGTACAGGTGGACCCC CCTCCAGGTTGGTGGTGAATT 40575 48535 Novel prediction Direct cloning TTCTTCTTCAATCTAAAATTCACCACC ACCCCTCCAGATTACTGTTGAATTTAA 40575 48548 Novel prediction Direct cloning GAATCGTGCCTGCAACCTCA TAAGATTGGAGAAGAAAATCTTCCAGC 29561 Oasl2 Direct cloning CTGCAGGTCTGTTGCACGAC CCAGAGTGTCCAATCCACTGTTC 3184 Irf3 Direct cloning AGGAATTTCCGGTCAGCCCT CGCCCCTGGAGTCACAAAC 30107 Usp18 Direct cloning CCACGTTGGGATGGCTGAC TCCTTCCAGGTGACCCAACA 33355 If28 Direct cloning GCAGACAGTGCTTGGCAGGT TGGCCCTGCGATTTCAAAG

a Idd4 and IFN response genes analyzed by real-time PCR. The Ensembl database build 34 was queried to identify genes located within the Idd4 locus, as well as IFN response genes, identiﬁed by microarray analysis. Primers for the expression studies were designed as described in Materials and Methods and presented in 5Ј to 3Ј orientation. To generate a standard curve for the analysis of gene expression, plasmids, carrying a gene of interest, were either obtained from the NIA or RIKEN collections or generated by direct cloning of the corresponding amplicon, as described in Materials and Methods.

Results between D11Mit30 and D11Mit364, an interval sufficient to con- CY-T1D in NOR.NOD-Idd4 subcongenic male mice trol the differential CY-T1D susceptibility phenotype. Previously, we demonstrated that NOR.NOD-Idd4 mice are susceptible to CY-T1D (20). To refine the location of the genes re- Refinement of the Idd4-region boundaries using novel markers sponsible for this effect, four novel recombinant subcongenic mice We analyzed mouse genomic sequence information in the Celera carrying NOD-derived Idd4 intervals were generated and assessed and Ensembl databases across the Idd4 interval for microsatellite for T1D following CY treatment (Fig. 1). Male mice of the R1 repeats using a Perl script and selected flanking sequences for the strain were susceptible to CY-T1D, compared with NOR mice design of amplification primers (see Materials and Methods). PCR ( p ϭ 0.0006), whereas R2 mice were resistant. Double-recombi- amplicons containing the repeats were tested for polymorphism nant R3 animals progressed to T1D after CY treatment in contrast between NOD and NOR strains, and informative markers (Table I) to R4 mice that were resistant to the disease ( p ϭ 0.003). Impor- were used to generate a high-resolution map of the recombination tantly, the R3 and R4 strains differed only for a 2.4-Mb interval boundaries in the subcongenic strains. The centromeric boundary 2980 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE

Table III. Sequencing primers used in our studya

Gene Forward Primer Reverse Primer

Alox15-Promoter-A ATGCGGTCTTGGCCTAGGAGGC AACATCTGGTCCAGTCCCTTCTGCC Alox15-Promoter-B CAACCTTAAGATTATCCCTGGGCATGGG CGAATGCCTCTGTGCACCCTTTCC Alox15-cDNA-C TCTCCACCGGGGACTCCGTGTAC GGGCAGGGAGACAAGTAGACCGC Alox15-cDNA-D GATGGCTGAGCGGGTTCGAAAC TCCTGAACAGCTTGGTCGGTCTTGTAG Alox15-cDNA-E CGAGGACTCCTGGATATTGACACTTGC CAGCAGACTATGGAAAGCGGGCTC Alox15–3ЈUTR-F CCTTATGAGTACCTGCGGCCCAGC CAGACTTGTTACACAGTTTGGAGCTTCCC Cxcl16-cDNA GAATTGGCTGGATGTCGGCTAGGTG ACCACCTCTCCCATGTCATCATCCA Psmb6-Promoter-A TTGTAGCTTCTTCAAAAGTTCTTGTGGGACCC GGCCTAGTACATGTCTTCCGAACTCTGGCTC Psmb6-Promoter-B GGCGTTCCCCTGTACTGAGGCATATAAAGTT ACGTTGTGTCGCAATGTTAACAGGTTGGA Psmb6-cDNA GGCCGCCTTAGCTGTTCGTCGA CTCTTTAACAAACTGTTTATTAGCTTCTGCGTCGG Psmb6–3ЈUTR GGGTCCTCACGTTCAGCTACTAACTCCAAACC GGCTGGAGAGATGGCTCAGTGGTTAAGAG Pld2-Promoter-A AAGGATCTATGGAATTGAATGTGCACCG GCTGTATGAGAAATCGCATTCTTCATTCTTG Pld2-Promoter-B TTCCAGACTGAAATTTACAGGCGATTAGG TGGCTGGAAGCAAGGGTCCG Pld2-cDNA-C GACGCTGTCGGGCTGGAGC GACATGGTCAGGAGGCGGTTGAG Pld2-cDNA-D CATTCTCCAGCCCGAGAGGCAG GCCTTCCTCTTGAGCATAATGTCCAGTC Pld2-cDNA-E GGTGGTTTGTGAATGGGGCAGG GATTGTTTGCAGTGCTGGTGGACTTG Pld2-cDNA-F TGGAGTGGTTGTACACGGAGTAGCTGC TGTGTCCTTGATCAGGATGGCTAGCTC Pld2-cDNA-G CGGGCACCCAATCTCTGAGCTC GCCAGACTTGGGAGTGCTTCCTTTG Pld2–3ЈUTR-H GCCGTTGGGCCCTATCGTGC AGTTATGAACATATGTATCGCTCGCACGC Downloaded from Clqbp-cDNA CGAGGTCACACGGTGCCTTGG TGTTCACTGGCCAAAGCTTGCCAT

a Sequencing primers used in our study. Forward and reverse primers used for sequencing of Alox15, pld2, Cxcl16, Clqbp, and Psmb6 genes in NOD and NOR strains are shown in 5Ј to 3Ј orientation. http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 1. Fine mapping of the Idd4 locus. Different NOR.NOD-Idd4 subcongenic strains were generated, and male mice were tested for CY-T1D as described in Materials and Methods. The strains were genotyped for multiple public (D11Mit) and novel (D11Gul) markers to determine locations of NOD- (gray) and NOR-derived (black) regions. Unresolved boundaries between NOD- and NOR-derived intervals are depicted in shaded gray ovals, and regions identical by descent between parental strains are shown in white. Percentage of diabetic males for each strain as well as a Fisher’s exact test p values vs parental NOR strain (11%, n ϭ 36) as a measure of resistance or susceptibility to CY-T1D are illustrated. Sus- ceptibility (S) or resistance (R) to CY-T1D, relative to the parental NOR strain, also is indicated. The Journal of Immunology 2981 of the Idd4 critical interval was resolved to a 12-kb region between genetic distance of Ͻ0.3 centiMorgans (cM)/Mb between these the D11Gul2535 and D11Gul2537 markers (Fig. 1). The telomeric two strains. boundary was placed in a 200-kb region between the D11Gul2700 and D11Gul2721 markers. Neither boundary region contained Genomic sequence analysis of Idd4 known or predicted genes, according to Ensembl. Thus, Idd4 was Based on our mapping data, the NOD of the Idd4 locus was se- conﬁned to a 1.2- to 1.4-Mb region containing 52 genes (Table quenced at the Wellcome-Sanger Institute. A tile path of 10 NOD IV). Attempts to further reﬁne location of the Idd4 region by an- BAC clones spanning the interval was completely sequenced and alyzing 1031 additional meioses for recombination between the data posted (͗www.sanger.ac.uk/cgi-bin/projects/m_musculus/ D11Gul2537 and D11Gul2700 were not successful, representing a mouse_nod_clones_tpf͘). We performed a comparative sequence

Table IV. Genes within the Idd4 locusa

Ensembl Gene ID Start Gene Name Gene Description

ENSMUSG00000018569 69578057 Cldn7 Claudin-7 ENSMUSG00000018565 69580784 Rai12 S-phase 2 protein ENSMUSG00000018559 69593724 Dullard Dullard homolog ENSMUSG00000018567 69603920 Gabarap ␥-aminobutyric acid receptor associated protein Downloaded from ENSMUSG00000018572 69608333 2410141M05Rik PHD zinc finger containing protein JUNE1 ENSMUSG00000020888 69613182 Dvl2 Segment polarity protein dishevelled homolog DVL-2 ENSMUSG00000018574 69622750 Acadvl Acyl-CoA dehydrogenase, very-long-chain specific, mitochondrial precursor ENSMUSG00000020886 69631416 Dlgh4 Presynaptic density protein 95 (PSD-95); discs, large homolog 4 ENSMUSG00000020884 69666951 Asgr1 Asialoglycoprotein receptor 1 (hepatic lectin 1) ENSMUSG00000040963 69705626 Asgr2 Asialoglycoprotein receptor 2 (hepatic lectin 2) ENSMUSG00000040950 69742976 Mgl2 Macrophage galactose N-acetyl-galactosamine specific lectin 2 http://www.jimmunol.org/ ENSMUSG00000000318 69779330 Mgl2 Macrophage asialoglycoprotein-binding protein 1 ENSMUSG00000040938 69826636 Slc16a11 Solute carrier family 16, member 11 ENSMUSG00000044367 69829348 Slc16a13 Solute carrier family 16 (monocarboxylic acid transporters), member 13 ENSMUSG00000000317 69836684 Bcl6b B cell CLL/lymphoma 6, member B; BcL6-associated zinc finger protein ENSMUSG00000020831 69847764 0610010K14Rik No description ENSMUSG00000040904 69850682 D11Bwg0434c No description ENSMUSG00000000320 69854011 Alox12 Arachidonate 12-lipoxygenase, (platelet-type lipoxygenase 12) ENSMUSG00000018907 69928169 Alox12e Arachidonate 12-lipoxygenase, epidermal-type

ENSMUSG00000018924 69956708 Alox15 Arachidonate 12-lipoxygenase, leukocyte-type by guest on September 28, 2021 ENSMUSG00000018921 70005440 4930563C04Rik Proline-, glutamic acid-, leucine-rich protein 1 ENSMUSG00000060216 70045287 ARR2 ␤-arrestin 2 ENSMUSG00000018923 70064487 1110030J09Rik No description ENSMUSG00000018920 70066790 Cxcl16 Small inducible cytokine 816 precursor (transmembrane chemokine CXCL16) ENSMUSG00000040829 70072178 ZMYND15 Zinc finger MYND domain containing protein 15 (by homology) ENSMUSG00000018919 70117833 Tm4sf5 Transmembrane 4 superfamily member 5 ENSMUSG00000020830 70126124 Novel prediction No description ENSMUSG00000040807 70131752 C730027E14Rik No description ENSMUSG00000018286 70137942 Psmb6 Proteasome subunit ␤ type 6 precursor ENSMUSG00000020828 70152720 Pld2 Phospholipase D2; phosphatidylcholine-hydrolyzing phospholipase D2 ENSMUSG00000020827 70175446 Map4k6 MAPK kinase kinase kinase 6 ENSMUSG00000014609 70227440 Chrne Acetylcholine receptor protein, ␧ chain precursor ENSMUSG00000050675 70251678 Gp1ba Glycoprotein 1b, ␣ polypeptide ENSMUSG00000014606 70256756 Slc25a11 Mitochondrial 2-oxoglutarate/malate carrier protein (OGCP) ENSMUSG00000040746 70260145 5730408C10Rik Ring finger protein (by homology) ENSMUSG00000018293 70264405 Pfn1 Profilin 1 ENSMUSG00000060600 70269760 Eno3 ␤ enolase (2-phospho-D-glycerate hydro-lyase) (skeletal muscle enolase) ENSMUSG00000018287 70276346 Spag7 Sperm associated antigen 7 ENSMUSG00000040712 70282023 Camta2 Calmodulin binding transcription activator 2 ENSMUSG00000057054 70300917 Novel prediction Inhibitor of CDK interacting with cyclin A1 (by homology) ENSMUSG00000020821 70313117 Kif1c Kinesin-like protein KIF1C (fragment) ENSMUSG00000043602 70377003 Novel prediction No description ENSMUSG00000057135 70404055 Novel prediction No description ENSMUSG00000020817 70457338 Rabep1 Rab GTPase binding effector protein 1 ENSMUSG00000040667 70555614 Nup88 nucleoporin 88; preimplantation protein 2 ENSMUSG00000018449 70582769 2400006N03Rik RPA interacting protein (by homology) ENSMUSG00000018446 70590363 C1qbp Complement component 1, Q subcomponent binding protein ENSMUSG00000040620 70596649 Dhx33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 ENSMUSG00000018442 70620001 Flana Carcinoma related gene ENSMUSG00000040599 70637699 Misc12 Homolog of yeast Mis12 ENSMUSG00000018451 70644505 6330403K07Rik UGS148 protein ENSMUSG00000040575 70704819 Novel prediction NACHT-, LRR- and PYD-containing protein 2 (by homology)

a Genes within the Idd4 locus. Gene name, description, chromosomal location, and unique identiﬁer are shown according to the Ensmbl database build 33. 2982 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE

analysis of the coding exonic regions for all 52 genes across the in T1D (27, 28), although they are not absolutely required for the interval and noticed striking similarities between NOD and B6 disease in the NOD model (29) or in humans (30), sharpening our strains: 47 genes showed no variation, 4 showed only silent nu- focus on critical functions of M␾/DC. cleotide substitutions, and only 1, Kif1c, showed a nonsynono- Affymetrix Gene Chip 430 2.0 arrays were used to profile gene mous single nucleotide polymorphism (SNP) affecting amino acid expression variations between the T1D-susceptible R3 and T1D- sequence. Previously, we demonstrated that Idd4 is located within resistant R4 strains. This comparison restricted the heritable vari- the DBA/2J-derived region of the NOR chromosome 11 (20). To ation between samples to the 1.4-Mb Idd4 interval. M␾/DCs were examine sequence variation between NOD and DBA/2J, we used grown from BM precursors for 7 days in GM-CSF supplemented Celera DB to retrieve all available DBA/2J sequence fragments as medium. At the conclusion of the culture, the cells were Ͼ90% described in Materials and Methods. The mined DBA/2J sequence CD11bϩ, MHC class II low, and 15–25% CD11cϩ (data not fragment files covered only 30% of the Idd4 coding sequence. Our shown) suggesting a mixture of monocyte/M␾ and immature DCs. analysis of these data showed that, in contrast to the similarity SAM identified only 12 probe sets that were differentially ex- between NOD and B6 strains in this region, DBA/2J sequence is pressed between R3 and R4 M␾/DCs with a FDR ranging from highly divergent from both NOD and B6 with many synonymous 0.05 for Psmb6 to 0.55 for Usp18 (Table VI). Gene annotation was and missense substitutions (Table V). This analysis suggested that performed, and the data were displayed with probe set identifica- the Idd4 locus mapped in this and our prior study (20) influenced tion, SAM rank, fold change, gene symbol, chromosome position, T1D susceptibility in crosses between NOD and NOR, because the and function (Table VI). Notably, four of the most highly ranked latter is DBA/2J- rather than C57BL/6-derived over this interval. genes were located within the Idd4 locus, suggesting that these

These analyses reinforce the need for the high quality genomic expression differences were mediated by cis-acting elements Downloaded from sequence and haplotype map data for multiple mouse strains to within the region. Among these, differential expression of Psmb6 facilitate identification of susceptibility genes underlying complex and Alox15 between the R3 and R4 congenic lines were of special disease phenotypes, including T1D. interest because of their roles in immune responses. Psmb6 encodes a catalytic subunit of the proteasome involved in Ag pro- ␾ Comparative analysis of M /DC gene expression in R3 and R4 cessing, and Alox15 encodes a lipo-oxygenase operative in bio- mice with Affymetrix arrays genesis of leukotrienes, potent inflammatory mediators. SAM also http://www.jimmunol.org/ We choose to examine Idd4 genotype-dependent differential genes revealed genes that were identical by descent between the T1D- expression in M␾/DCs for several reasons. First, these cells are susceptible R3 and T1D-resistant R4 strains that were affected in crucial in pathogenesis of T1D, because their in vivo depletion trans by allelic differences in the Idd4 region. All of these genes prevents the disease (25). Second, T cells from NOR mice transfer were up-regulated in T1D-prone R3, compared with disease-resis- diabetes to NOD.scid recipients (26), implicating differences in tant R4 strain, and five of them are functionally linked to the “IFN other immune cell types as a source of diabetes resistance in NOR response” pathway. Because of the role of IFN in T1D pathogen- mice. The critical role for M␾/DC nexus between innate immune esis (reviewed in Ref. 31), these data suggest that the Idd4 locus sensing and adaptive Ag-specific immunity focused our interest on control diseases through regulating IFN-responsive genes. Differ- these cells. Importantly, B cells also contribute to Ag-presentation ential expression of IFN-response genes between R3 and R4 by guest on September 28, 2021

Table V. Summary of exonic polymorphisms among NOD, C57BL/6, and DBA/2J strains in coding regions of several ldd4 genesa

Position from Type of Ensembl Gene ID Symbol Start Codon B6 NOD DBA Substitution

ENSMUSG00000018907 Alox12e 351 T T C Silent ENSMUSG00000018907 Alox12e 1239 T T A Silent ENSMUSG00000018907 Alox12e 1357 G G T V453L ENSMUSG00000018907 Alox12e 1362 G G T Silent ENSMUSG00000018924 Alox15 629 G G A S210N ENSMUSG00000014606 Slc25a11 111 C C T Silent ENSMUSG00000014609 Chrne 282 T T C Silent ENSMUSG00000014609 Chrne 544 G G A V182M ENSMUSG00000014609 Chrne 577 G G T D193Y ENSMUSG00000018286 Psmb6 285 G G A Silent ENSMUSG00000018286 Psmb6 387 A A T Silent ENSMUSG00000020827 Map4k6 357 C C T Silent ENSMUSG00000020828 Pld2 639 G G A Silent ENSMUSG00000020828 Pld2 642 C C T Silent ENSMUSG00000020828 Pld2 810 A A G Silent ENSMUSG00000020828 Pld2 1476 C C T Silent ENSMUSG00000040746 5730408C10Rik 333 G G A Silent ENSMUSG00000020821 Kif1c 445 A A G Silent ENSMUSG00000020821 Kif1c 891 C T C Silent ENSMUSG00000020821 Kif1c 1371 T T G Silent ENSMUSG00000020821 Kif1c 1733 C T C P578L ENSMUSG00000040620 Dhx33 1651 A A G I551V ENSMUSG00000018449 2400006N03Rik 291 C C T Silent

a Summary of exonic polymorphisms among NOD, C57BL/6, and DBA/2J strains in coding regions of Idd4. Available coding region sequences of the genes, located in the Idd4 locus, were aligned to identify available polymorphic sites among NOD, C57BL/6, and DBA/2J strains. C57BL/6 data are from Ensembl, NOD data are from the NOD genome sequencing project (www.sanger.ac.uk/cgi-bin/Projects/M_musculus/mouse_NOD_clones_TPF), and DBA/2J data were mined from Celera database (www.celera.org) as described in Materials and Methods. All detected substitutions are shown relative to the start codon of the reference C57BL/6J sequence, with adenine being at the ϩ1 position. For nonsynonomous SNPs relative amino acid substitutions also are shown. The Journal of Immunology 2983

Table VI. Differentially expressed genes in R3 vs R4 macrophages/DCsa

Fold Change Probe Set Rank R3/R4 FDR Symbol Chromosome: Start Cluster/Function

1448822 at 1 2.55 0.05 Psmb6 11: 70137942 ldd4.1 1420338 at 2 0.38 0.09 Alox15 11: 69956708 ldd4.1 1449018 at 3 0.73 0.22 Pfn1 11: 70264405 ldd4.1 1419605 at 4 0.63 0.25 Mgl1 11: 69779330 ldd4.1 1453196 a at 5 1.71 0.4 Oasl2 5: 112309164 IFN response 1428850 x at 6 1.67 0.4 CD99 4 Leukocyte migration 1430514 a at 7 1.65 0.4 CD99 4 Leukocyte migration 1418580 at 8 2.04 0.43 IF28 16: 23454296 IFN response 1426111 x at 9 1.39 0.55 Irf3 7: 32398163 IFN response 1450783 at 10 2.28 0.55 Iﬁt1 19: 33862123 IFN response 1436320 at 11 1.61 0.55 IMAGE:4206343 Unknown No annotation 1418191 at 12 1.72 0.55 Usp18 6: 121658227 IFN response

a Differentially expressed genes in R3 vs R4 M␾/DCs. Gene expression in resting bone marrow-derived M␾/DCs from T1D-susceptible R3 and T1D-resistant R4 was compared using an Affymetrix Gene Chip Mouse Genome 430 2.0 Arrays. Differentially expressed probe sets were identiﬁed by robust multiarray averaging and SAM as described in Materials and Methods. Every probe set was ranked according to the absolute value of relative differences. Gene symbols, chromosomal locations, and cluster/function groups are indicated. Fold change and the local FDR value for every probe set also are shown. M␾/DCs from female mice were used for this experiment. Downloaded from strains was particularly intriguing because the comparisons were BM-derived M␾/DCs was validated for all four genes and showed performed on M␾/DCs grown in parallel from myeloid precursors the Idd4 genotype effect in both male and female mice (Fig. 2a). without experimental activation. These results suggested that in- LPS and IFN-␥ treatment of BM-derived M␾/DCs and peritoneal herent differences in M␾/DC IFN response state result from Idd4 M␾ exacerbated the strain variation in expression Oas12, Irf3, and variation between T1D-prone R3 and T1D-resistant R4 strains. To Usp18, providing additional evidence that Idd4 exerts its effect http://www.jimmunol.org/ examine the behavior of these IFN-response genes under activated through regulation of the IFN response (Fig. 2, b and c). conditions, we stimulated BM-derived M␾/DCs as well as freshly explanted peritoneal M␾ from R3 and R4 strains with LPS and Expression analysis of all Idd4-region genes IFN-␥ and used quantitative real-time PCR to analyze Oas12, SAM identiﬁed four genes mapping within the Idd4 interval that IF28, Irf3, and Usp18 (Fig. 2). The microarray outcome in resting displayed differential expression (Table VI). However, given the by guest on September 28, 2021

FIGURE 2. Expression analysis of Oasl2, If28, Irf3, and Usp18 in resting and activated M␾/DCs. Expression of Oasl2, If28, Irf3, and Usp18 genes was analyzed in BM-derived (a and b) and peritoneal M␾ (c) from NOR.NOD-Idd4 (R3) and NOR.NOD-Idd4 (R4) strains by quantitative RT-PCR as described in Materials and Methods. Cells were either resting (a) or activated (b and c) with LPS and IFN-␥. Samples from individual male (M) and female (F) mice are shown. For each gene, absolute copy numbers of the corresponding cDNA was calculated from a standard curve generated by amplifying serial dilutions of a plasmid containing the gene of interest. PCR was run in triplicate to estimate mean copy number as well as a SD for each gene. Expression of every gene was normalized to the expression of the actin gene from the same cDNA sample. Normalized data for the mean and the SD were multiplied by 1000 for better visual representation. Note that different y-axis scales were required to display three distinct tissues and conditions. Similar results were obtained from two independent experiments. 2984 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE

limited dynamic range of the Affymetrix microarray platform, se- Alox12e and Pld2, expressed at equal levels in NOR and NOR.NOD- lection of a conservative statistical analysis of these data sets, lack Idd4 LN and M␾/DC, were attractive T1D susceptibility gene can- of representation of all Idd4 genes on the array, and the desirability didates because of their functions in arachidonic acid metabolism (32) of independent validation of the SAM results, we performed real- and phagocytosis (33), respectively. Camta2 is a poorly annotated time PCR expression analysis of all 52 genes from the Idd4 region gene encoding a calmodulin binding transcription activator 2. A in multiple immune cell types and conditions. poorly annotated gene of unknown function, 6330403K07, was over- Expression of 26 genes was studied in freshly explanted BM, expressed in the LN, spleen, and thymus of the NOR, compared with ␾ spleen, thymus, and LN and in BM-derived M /DCs from NOR and the NOR.NOD-Idd4 strain. Two genes with immunological func- NOR.NOD-Idd4 mice under alternate treatment conditions (Fig. 3). tions: the chemokine Cxcl16 and complement-binding protein C1qbp, Four of these 26 genes (Cldn7, Slc16a13, 4930563C04Rik, and were expressed at similar levels in both strains in this analysis. Chrne) were expressed at low to undetectable levels in all cells/con- Because differential expression of four genes was best observed ditions tested and were assigned low priority as candidate genes. A in enriched M␾/DC, we prioritized comparisons of the remaining gene was called “differentially expressed” if it displayed a steady-state 26 Idd4 genes in this cell population (Fig. 4). Two genes, Alox15 mRNA level of Ն1 mRNA transcript per 1000 transcripts of actin and Map4k6 a Ͼ2.5-fold difference between Idd4 genotype-disparate strains. By and displayed differential expression in this analysis. In these criteria, we conﬁrmed differential expression of Psmb6 in BM- agreement with the microarray analysis (Table VI), we found that M␾/DCs, validating the microarray analysis. Interestingly, this Idd4- Alox15 was expressed at higher levels in NOR, compared with ␾ dependent difference was speciﬁc for M␾/DCs, because differential NOR.NOD-Idd4 M /DCs. Map4k6 operative in MAPK signaling,

expression was not observed in heterogeneous tissues, such as whole was overexpressed in NOR.NOD-Idd4, compared with NOR sam- Downloaded from spleen or BM that contain low frequencies of M␾/DCs, and not ob- ples. With this locus-comprehensive strategy, we assigned highest served in lymphoid-rich thymus and LN samples (Fig. 3). Similarly, priority to nine genes for sequence and functional analysis: seven Alox12e, Pld2, and Camta2 displayed differential expression in en- were differentially expressed genes between the R3 and R4 strains, riched M␾/DCs that was undetectable in whole spleen or BM. and Cxcl16 and C1qbp, which were expressed at similarly high http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 3. Tissue distribution and comparative analysis of the Idd4 genes expression. Expression of 26 genes located in the Idd4 locus was analyzed in BM, thymus, spleen, LN, resting and activated lymphocytes, as well as resting and activated M␾/DCs from NOR and NOR.NOD-Idd4 males using quantitative real-time PCR. For each gene, absolute copy numbers of the corresponding cDNA was calculated from a standard curve generated by amplifying serial dilutions of a plasmid containing the gene of interest. For gene 4930563C04Rik, both predicted transcripts, T19065 (T1) and T19066 (T2), were evaluated. PCR was run in triplicate to estimate mean copy number as well as a SD for each gene. Expression of every gene was normalized to the expression of the actin gene from the same tissue. Normalized data for the mean and the SD were multiplied by 1000 for better visual representation. Note that different y-axis scales were required to display expression of different genes. The Journal of Immunology 2985 Downloaded from http://www.jimmunol.org/

FIGURE 4. Analysis of gene expression in BM-derived M␾/DCs. Expression analysis of the 26 genes from the Idd4 region, which were not presented ␾ in Fig. 3, was performed in resting and activated BM-derived M /DCs pooled from three individual NOR and NOR.NOD-Idd4 male mice by quantitative by guest on September 28, 2021 RT-PCR as described in Materials and Methods. Resting M␾/DCs (1) and M␾/DCs activated with LPS and IFN-␥ (2) are shown. For every tissue, gene expression was normalized to the expression of the housekeeping gene actin. Normalized data for the mean and the SD were multiplied by 1000 for better visual representation. Note that genes with very low levels of expression in both strains and under both conditions are not presented on this graph.

levels in both strains and were deemed good functional candidates gions from NOR DNA and compared the sequence with NOD and for conveying T1D-associated effects of the Idd4 locus. C57BL/6 strains from the Wellcome-Sanger Institute and Ensembl We considered the possibility that expression analysis of some web sites. Differences in the 5Ј regulatory region may influence Idd4.1 genes could have been affected by differential annealing of transcriptional activity, and changes in the UTR can affect RNA the primers or probe sets from Affymetrix microarray to NOD and stability; both events leading to the different steady state level of NOR sequences. The primers used for these comparative gene ex- mRNA between NOD and NOR strains. pression analyses were designed from the available C57BL/6J se- Psmb6. Seven silent SNPs distinguishing NOD and NOR were quence that we show is extremely similar to the NOD sequence observed in the coding region (Table VII), predicting identical over this interval. Genomic sequence information for the NOR strain spanning the Idd4.1 region (DBA/2J origin) is currently un- PSMB6 protein sequence between the two strains. Comparative Ј available, precluding selection of primers known to be identical analysis of 1000 bp upstream of the ATG start codon, the 5 UTR, Ј between NOD and NOR strains. To mitigate this risk, the primer and 3 UTR regions also was performed. Multiple SNPs and sev- Ј pairs we used were selected for similar high amplification efficien- eral small deletions distinguished the Psmb6 5 regulatory region Ϫ cies in both strains. In addition, we found evidence for tissue/cell in NOD and NOR (Table VII). With exceptions at positions 190 type-specific differential expression as a function of Idd4.1 geno- and Ϫ319, NOD and B6 sequences were identical, consistent with type (Figs. 3 and 4) that argues against an influence of sequence their equal expression patterns in M␾/DCs (data not shown). Six variation within the primer binding sites that would affect ampli- SNPs distinguished the NOD and NOR 3ЈUTR and again, NOD fication outcomes in all samples. and B6 sequences were identical at these positions (Table VII). Because of the lack of experimental evidence for the location of Comparative sequence analysis of the candidate T1D the Psmb6 promoter, we used computational tools to search 1000 susceptibility genes bp upstream of the ATG start codon for potential transcription Five of the nine priority genes were selected for comparative se- factor binding sites. Many transcription factor binding sites were quence analysis: Alox15, Cxcl16, Psmb6, Pld2, and C1qbp. For the predicted using Match (34) and Signal Scan (35) software, but differentially expressed Psmb6, Alox15, Pld2 we sequenced the none were well conserved in human PSMB6. The Pipmaker com- exons, 5ЈUTR, 3ЈUTR, and 5Јregulatory (ϳ1000 bp upstream) re- putational algorithm for phylogenetic conservation (36) was run 2986 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE

Table VII. Polymorphisms among B6, NOD, and NOR in Pld2, 1qbp, Alox15, Cxcl16, and Psmb6 genesa

Position from Type of Ensembl Gene ID Symbol Start Codon B6 NOD NOR Substitution Region

ENSMUSG00000020828 Pld2 Ϫ1273 T T C 5Јreg ENSMUSG00000020828 Pld2 Ϫ812 T T del 5Јreg ENSMUSG00000020828 Pld2 Ϫ627–628 GC GC del 5Јreg ENSMUSG00000020828 Pld2 Ϫ304ϽϾϪ305 ins“GTT” 5ЈUTR ENSMUSG00000020828 Pld2 Ϫ304 G G C 5ЈUTR ENSMUSG00000020828 Pld2 Ϫ259 G G del 5ЈUTR ENSMUSG00000020828 Pld2 Ϫ228 G G del 5ЈUTR ENSMUSG00000020828 Pld2 Ϫ208–209 GT GT AG 5ЈUTR ENSMUSG00000020828 Pld2 Ϫ207ϽϾϪ208 ins“TGTCGC” 5ЈUTR ENSMUSG00000020828 Pld2 Ϫ205–206 GC GC CT 5ЈUTR ENSMUSG00000020828 Pld2 496 T T C SILENT Coding ENSMUSG00000020828 Pld2 639 G G A SILENT Coding ENSMUSG00000020828 Pld2 642 C C T SILENT Coding ENSMUSG00000020828 Pld2 810 A A G SILENT Coding ENSMUSG00000020828 Pld2 1476 C C T SILENT Coding ENSMUSG00000020828 Pld2 2143 C C T H715Y Coding ENSMUSG00000020828 Pld2 2904 T T C 3ЈUTR ENSMUSG00000020828 Pld2 2970 A A G 3ЈUTR Downloaded from ENSMUSG00000020828 Pld2 2972 G G A 3ЈUTR ENSMUSG00000020828 Pld2 3031 T T C 3ЈUTR ENSMUSG00000020828 Pld2 3037 A A T 3ЈUTR ENSMUSG00000020828 Pld2 3143 T T C 3ЈUTR ENSMUSG00000020828 Pld2 3258 A A G 3ЈUTR ENSMUSG00000020828 Pld2 3265 C C G 3ЈUTR

ENSMUSG00000018446 C1qbp 51 C G G SILENT Coding http://www.jimmunol.org/ ENSMUSG00000018446 C1qbp 348 T T A SILENT Coding ENSMUSG00000018446 C1qbp 513 C A A SILENT Coding ENSMUSG00000018924 Alox15 Ϫ959 A A C 5Јreg ENSMUSG00000018924 Alox15 Ϫ628 A A G 5Јreg ENSMUSG00000018924 Alox15 Ϫ561 G G C 5Јreg ENSMUSG00000018924 Alox15 Ϫ465 G G C 5Јreg ENSMUSG00000018924 Alox15 Sart-344 (GA)29(GT)18 (GA)25(GT)18 (GA)17(GT)32 5Јreg ENSMUSG00000018924 Alox15 Ϫ343 T T A 5Јreg ENSMUSG00000018924 Alox15 Ϫ117 A A G 5Јreg ENSMUSG00000018924 Alox15 Ϫ104 A A T 5Јreg ENSMUSG00000018924 Alox15 186 T T C SILENT Coding by guest on September 28, 2021 ENSMUSG00000018924 Alox15 273 G G A SILENT Coding ENSMUSG00000018924 Alox15 629 G G A S210N Coding ENSMUSG00000018924 Alox15 978 T T C SILENT Coding ENSMUSG00000018924 Alox15 1004 T T C L335S Coding ENSMUSG00000018924 Alox15 1053 A A C SILENT Coding ENSMUSG00000018924 Alox15 1846 C C T P616S Coding ENSMUSG00000018924 Alox15 1851 C C T SILENT Coding ENSMUSG00000018924 Alox15 2003 T T del 3ЈUTR ENSMUSG00000018924 Alox15 2054ϽϾ2055 ins “46 nucl” 3ЈUTR ENSMUSG00000018920 Cxcl16 7 C C A SILENT Coding ENSMUSG00000018920 Cxcl16 192 T T C SILENT Coding ENSMUSG00000018920 Cxcl16 228 A A G SILENT Coding ENSMUSG00000018920 Cxcl16 385 T T C S129P Coding ENSMUSG00000018920 Cxcl16 441 A A G SILENT Coding ENSMUSG00000018286 Psmb6 Ϫ831 T T C 5Јreg ENSMUSG00000018286 Psmb6 Ϫ817 C C G 5Јreg ENSMUSG00000018286 Psmb6 Ϫ754 G G T 5Јreg ENSMUSG00000018286 Psmb6 Ϫ744 A A G 5Јreg ENSMUSG00000018286 Psmb6 Ϫ702 C C T 5Јreg ENSMUSG00000018286 Psmb6 Ϫ672 G G del 5Јreg ENSMUSG00000018286 Psmb6 Ϫ621 G G C 5Јreg ENSMUSG00000018286 Psmb6 Ϫ406–408 TTG TTG del 5Јreg ENSMUSG00000018286 Psmb6 Ϫ348 A A C 5Јreg ENSMUSG00000018286 Psmb6 Ϫ348–347 GC GC del 5Јreg ENSMUSG00000018286 Psmb6 Start-319 (CA)9 (C)8 (CA)8 (C)11 (CA)6 (C)11 5Јreg ENSMUSG00000018286 Psmb6 Ϫ270 C C T 5Јreg (Table continues) for the regions 10 kb upstream of the Psmb6 gene using human and that more distant regulatory regions are responsible for differential mouse Ensembl sequence. This analysis revealed phylogenetically expression of Psmb6 between these strains. conserved elements within a short 130-bp stretch immediately upstream of the transcription initiation site (data not shown). How- Alox15. Eight coding SNPs distinguishing NOD and NOR were ever, direct sequence analysis demonstrated that this sequence was observed. Five were synonymous SNPs and three resulted in identical between NOD and NOR mice (Table VII), suggesting amino acid substitutions: S210N, L335S, P616S. At least one of The Journal of Immunology 2987

Table VII. (Table continued)

Position from Type of Ensembl Gene ID Symbol Start Codon B6 NOD NOR Substitution Region

ENSMUSG00000018286 Psmb6 Ϫ253 C C T 5Јreg ENSMUSG00000018286 Psmb6 Ϫ197–198 CC CC TT 5Јreg ENSMUSG00000018286 Psmb6 Ϫ190ϽϾϪ191 ins “T” ins “TTT” 5Јreg ENSMUSG00000018286 Psmb6 Ϫ173 G G T 5Јreg ENSMUSG00000018286 Psmb6 285 G G A SILENT Coding ENSMUSG00000018286 Psmb6 387 A A T SILENT Coding ENSMUSG00000018286 Psmb6 498 G G C SILENT Coding ENSMUSG00000018286 Psmb6 525 G G C SILENT Coding ENSMUSG00000018286 Psmb6 667 T T C SILENT Coding ENSMUSG00000018286 Psmb6 678 A A G SILENT Coding ENSMUSG00000018286 Psmb6 690 C C T SILENT Coding ENSMUSG00000018286 Psmb6 779 T T A 3ЈUTR ENSMUSG00000018286 Psmb6 824 C C A 3ЈUTR ENSMUSG00000018286 Psmb6 848 C C T 3ЈUTR ENSMUSG00000018286 Psmb6 850 T T C 3ЈUTR ENSMUSG00000018286 Psmb6 920 C C T 3ЈUTR ENSMUSG00000018286 Psmb6 945 T T G 3ЈUTR Downloaded from a Polymorphisms among C57BL/6, NOD, and NOR in Pld2, Clqbp, Alox15, Cxc16, and Psmb6 genes. Proximal regulatory (5Ј reg), coding, and UTR regions of Pld2, Clqbp, Alox15, Cxc16, and Psmb6 genes were sequences in both NOD and NOR strains. The positions of nucleotide changes are depicted relative to the ATG start codon of the reference C56BL/6J sequence (www.ensemble.org), with adenine being at the ϩ1 position. C57BL/6 is displayed as the reference sequence variant (www.ensembl.org) against which NOD and NOR variants are compared. del, Delection; ins, insertion. Repeats in noncoding regions are shown in brackets followed by a number. Shading represents C57BL/6ϭNOD. http://www.jimmunol.org/ these substitutions (S210N) is located within a region conserved Discussion among mammalian lipo-oxygenases, suggesting that, in addition to Previously, we identified the Idd4, Idd5, and Idd9 loci as crucial differences in the mRNA abundance, ALOX15 enzymatic activity regulators of susceptibility to CY-accelerated and spontaneous also may differ between NOD and NOR. Seven SNPs distinguish- T1D in NOD mice (20). Here, we present a high-resolution mo- ing NOD and NOR were observed in the 5Ј regulatory region lecular genetic analysis of the Idd4 locus to derive criteria for where NOD was identical with B6 with the exception of a repet- prioritizing candidate T1D susceptibility gene(s) within this gene- itive element at the position Ϫ344. A 46-nt insertion was identified rich region. Using a series of the NOR.NOD-Idd4 subcongenic in the 3ЈUTR of the NOR, compared with NOD Alox15, and could strains, we refined location of the locus to a Ͻ1.4-Mb interval by guest on September 28, 2021 contribute to the much greater abundance of Alox15 mRNA in this containing 52 genes. Complete NOD genomic sequence analysis strain (Fig. 4). of the region revealed a striking similarity between NOD and C57BL/6 strains and striking differences with DBA/2J, suggesting Pld2. Six coding SNPs distinguished Pld2 in NOD and NOR that NOR Idd4-dependent T1D resistance is mediated by alleles of mice. One SNP resulted in H715Y, with potential effect on PLD2 DBA/2J origin that were fixed in the C57BLKS/J (BKs) progenitor enzymatic activity because it is located within the catalytic domain of NOR. Recently, comparative SNP analysis in C57BL/6J, DBA/ of the protein. Numerous changes, including SNP deletions and 2J, and BKs was performed to define genomic boundaries and the insertions, were identified in the NOR Pld2 5Ј regulatory and the genetic origins of the BKs strain. This study showed that BKs 3ЈUTR, compared with both NOD and B6 strains that were iden- SNPs in the portion of chromosome 11 containing our Idd4.1 in- tical in these regions. Additional studies are required to identify terval were identical with DBA/2J (41). These data are consistent sequence variations responsible for the differential expression of with our evidence that coding region sequence in this region of Pld2 in NOD and NOR LN and M␾/DCs. NOR/Lt mice is of DBA/2J origin. In a search for Idd4 candidate Cxcl16 and C1qbp. In addition to the seven differentially ex- genes and biological pathways associated with T1D pathogenesis, pressed genes within Idd4, Cxcl16 and C1qbp, which were ex- we analyzed expression of all genes in M␾/DCs from T1D-sus- pressed similarly in NOR and NOR.NOD-Idd4 mice, were con- ceptible and T1D-resistant subcongenic strains distinguished only sidered good T1D susceptibility candidates because of their known by the Ͻ1.4-Mb Idd4 region. Strikingly, we observed heightened involvement in immune response. CXCL16, expressed at high expression of genes characteristic of an IFN signature in the T1D- levels on M␾/DCs, induces a strong chemotactic attraction of ac- susceptible R3, compared with T1D-resistant R4 strain. These data tivated CD8 cells (37) and a subset of NK-T cells (38) and medi- implicate an inherent difference in threshold for triggering the IFN ates adhesion and phagocytosis of Gram-negative and -positive pathway in NOD diabetes pathogenesis. We examined the mRNA bacteria (39, 40). C1QBP is a ubiquitously expressed, multiligand abundance of the Idd4 genes in multiple immune cell populations binding protein involved the classical complement pathway. The and identified attractive functional candidates displaying tissue- coding regions of both genes were sequenced in NOD and NOR specific differential expression. Direct sequencing of several posi- strains, yielding three synonomous SNPs (Table VII). When con- tional candidates from NOD and NOR strains revealed sequence sidered together with similarity in gene expression pattern between variation in the coding, 5Ј regulatory, and UTR regions of these NOD and NOR, these results reduce interest in C1qbp as a can- genes. Based on our results, we have refined to five the best candidate gene for Idd4. In contrast, five SNPs distinguished NOD didate genes for the Idd4 locus. and NOR Cxcl16 coding sequence (Table VII). A S129P substi- Idd4 was first identified as a 30-cM region in a genome-wide tution was observed between with predicted extracellular localiza- linkage study of (NODxB10H-2g7) ϫ NOD animals and linked to tion and a potential functional impact on this protein, making early onset T1D (43). Subsequent analysis of NOD.B6 congenic Cxcl16 an attractive candidate for Idd4. animals refined Idd4, with the strongest T1D resistance mapping to 2988 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE

9.2 cM (ϳ20 Mb) between the D11Mit30 and D11Mit41 (43). ture response” genes. The gene encoding 2Ј-5Ј-oligoadenylate syn- Recently, we used NOD.NOR-Idd4 mice to further narrow down thetase-like protein 2 (Oasl2) warrants special attention. Oasl2 be- the Idd4 locus to a 6.9-cM (ϳ12-Mb) interval between D11Mit30 longs to the IFN-induced OAS family of genes, with critical and D11Mit33, sufficient to protect NOD mice from both sponta- functions in innate immune responses to viruses (54, 55). OAS neous and CY-accelerated diabetes (20). Grattan et al. (43) sug- proteins produce 2Ј-5Ј-oligoadenylates, required to activate latent gested two subloci within Idd4 (Idd4.1 and Idd4.2), but the genetic ribonucleases, leading to viral RNA degradation and inhibition of map of recombination boundaries in these NOD.B6-Idd4 mice pro- viral replication. Recent evidence suggested that an OAS1 splice vided limited resolution. The 1.2- to 1.4-Mb interval described site polymorphism that affects enzyme activity (55) is associated here lies within this previously predicted Idd4.1. Genomic se- with susceptibility to T1D (56), providing a functional link be- quence analysis of the Idd4 locus presented here showed striking tween antiviral/IFN response and autoimmunity. similarity between NOD and B6 strains and, coupled with in silico We analyzed the expression pattern of all 52 genes in the Idd4.1 analysis of Celera data, provided strong evidence for the DBA/2J region in NOR and NOR.NOD-Idd4 congenic mice. Seven of origin of NOR alleles providing protection from CY-T1D in our these genes were differentially expressed between these two study. However, these analyses cannot rule out the existence of strains, including Psmb6 and Alox15, as predicted by the microar- sequence differences between NOD and both DBA/2J and C57BL/ ray analysis. Of the remaining five genes, Pld2 and Alox12e have 6J, particularly at noncoding regulatory sites of the Idd4.1 genes. confirmed roles in regulating immune responses. PLD2 catalyzes Full genomic sequence of Idd4.1 from NOR/Lt (BKs) will be re- hydrolysis of phosphatidylcholine to phosphatidic acid, and cho- quired to definitively determine whether the same or different ge- line and has been proposed to regulate phagocytosis (33, 57). In- netic variants confer T1D protection in NOR/Lt (this study) and deed, NOD M␾ have been shown to be defective in phagocytosis Downloaded from B6 (43). of apoptotic cells, compared with the T1D-resistant strains (58). Gene expression microarray comparison of T1D-susceptible R3 Therefore, differential expression, or activity, of PLD2 may con- and T1D-resistant R4 congenic strains identified 11 differentially tribute to the T1D susceptibility through the control of phagocy- ␾ expressed genes within in resting BM-derived M /DC samples. tosis. Similarly to ALOX15, ALOX12e is involved in generation Four of these genes were located within Idd4, reflecting differences of the anti-inflammatory lipoxins (32, 51) and was cloned origi- in proximal regulatory elements. These results accord with the nally from murine epidermis, as reflected in the “e” designation http://www.jimmunol.org/ demonstration that transcript abundance can serve as a surrogate (59). Differential expression of Alox12e in NOR v NOR.NOD- phenotype for quantitative traits (44). The authors used differences Idd4 M␾/DC is an interesting finding that requires additional func- in gene expression in maize, mouse, and human as quantitative tional analysis. In addition, we identified a V453L variation in traits to perform classical mapping studies and found that, in many ALOX12e between NOD and NOR strains (Table V) that may cases, the observed expression differences mapped to genomic re- influence enzymatic activity. gions containing the corresponding genes. Among the differen- An important finding from our gene expression studies is the tially expressed genes in our analysis, Psmb6 and Alox15 are good dependence of outcomes on the heterogeneity and physiological candidate T1D susceptibility genes.

status of the samples under study. For example, Psmb6, Pld2, and by guest on September 28, 2021 PSMB6, also known as proteasome subunit ␦ or proteasome Alox12e displayed robust Idd4-genotype-dependent differential ex- subunit Y, is one of three constitutively expressed catalytic sub- pressed in highly enriched M␾/DCs that was not detectable in units of the 20S proteasome (45). Upon IFN-␥ treatment, the whole spleen, where these cells represent a minor fraction. Previ- Psmb6 subunit is replaced with its inducible partner, Lmp2, forming “immunoproteasomes” (46, 47) that are believed to favor the ously, Eaves et al. (60) reported gene expression microarray anal- generation of a “skewed” pool of peptides for MHC class I mol- ysis of NOD, compared with NOD.B6-Idd3,-Idd5, and -Idd9 con- ecules, leading to an enhanced immune response against viral in- genic strains. These experiments compared RNA isolated from fections (reviewed in Ref. 48). Contrary to other strains (46, 47), whole spleen and thymus, tissues that contain developmentally and we found that expression of Psmb6 in the NOD M␾ increases upon lineage-diversified cell types. Selection of these heterogeneous tis- activation (Fig. 3), suggesting that exchange of Lmp-2 for Psmb6 sues may have obscured identification of candidate genes at these in proteosomes may be strain dependent. Because Psmb6 is di- loci or expression profiles indicative of dysregulated pathways rectly involved in the generation of peptides presented to CD8ϩ T present in restricted cell types. Thus, the use of enriched, well- cells, inefficient replacement by Lmp2 in activated APCs may fa- characterized cell types for microarray analysis may be an impor- vor production of distinct diabetogenic peptides contributing to tant component of experimental design in studies of complex traits NOD T1D susceptibility. such as T1D. ALOX15 belongs to a family of lipid-peroxidizing enzymes re- This study provides an experimental framework for evaluating sponsible for the production of lipoxins from arachidonic or lino- positional candidate genes responsible for complex multifactorial leic acid substrates (49). These substrates are elevated during in- disease. Vital resources for high-resolution mapping of complex flammation (50), and multiple lines of evidence suggest that they disease loci include penetrant disease-associated phenotypes ame- exhibit anti-inflammatory activities (32, 51, 52). Moreover, reduced nable to replicated analyses in congenic strains, generation of high- inflammation and tissue damage in a model of acute periodontitis was density polymorphic markers across the interval of interest, and reported in transgenic rabbits overexpressing Alox15 (53). The greater strategies for prioritizing the genes. When restricted to 1.2 Mb, we expression of Alox15 in NOR M␾/DCs may, therefore, protect from report 52 genes in the Idd4 locus that required gene-specific and T1D by production of anti-inflammatory lipoxins. genome-wide expression analysis, genomic and cDNA sequenc- Microarray analysis and real-time PCR also identified genes that ing, and functional annotation to prioritize five best candidates are identical by descent between R3 and R4 congenic mice and (Psmb6, Pld2, Alox15, Alox12e, and Cxcl16) for in-depth func- differentially regulated in trans by gene(s) within the Idd4 locus. tional analysis. Similar challenges were confronted in analyses of These genes represent downstream targets of Idd susceptibility a murine systemic lupus erthyematosus model where a series of genes and reflect molecular pathways differentially regulated in variants affecting the protein sequence and expression in the func- T1D-susceptible vs T1D-resistant strains. Interestingly, five genes tionally related Cd2/Slam complex were shown to underlie auto- overexpressed in the T1D-susceptible R3 strains are “IFN signa- immune phenotypes in the B6.Sle1 strain (61). Identification of the The Journal of Immunology 2989 causal variant(s) at this locus will require in vivo transgenic anal- 15. Prochazka, M., D. V. Serreze, W. N. Frankel, and E. H. Leiter. 1992. NOR/Lt yses. Importantly, Sle1, Idd4, and multiple other autoimmune dis- mice: MHC-matched diabetes-resistant control strain for NOD mice. Diabetes 41: 98–106. ease loci may be due to variant haplotypes rather than single-se- 16. Naggert, J. K., J. L. Mu, W. Frankel, D. W. Bailey, and B. Paigen. 1995. Genomic quence variations. Indeed, loci with sufficiently strong effects to be analysis of the C57BL/Ks mouse strain. Mamm. Genome 6: 131–133. detected by linkage to complex disease traits may often reflect the 17. Serreze, D. V., M. Prochazka, P. C. Reifsnyder, Bridgett, and E. H. Leiter. 1994. Use of recombinant congenic and congenic strains of NOD mice to identify a new coordinated actions of closely linked genetic variants. Finally, by insulin-dependent diabetes resistance gene. J. Exp. Med. 180: 1553–1558. combining congenic resolution of the locus with genome-wide ex- 18. Serreze, D. V., M. Bridgett, H. D. Chapman, E. Chen, S. D. Richard, and E. H. Leiter. 1998. Subcongenic analysis of the Idd13 locus in NOD/Lt mice: pression analyses, our data have revealed that genetic variants in evidence for several susceptibility genes including a possible diabetogenic role Idd4 likely influence diabetes pathogenesis through regulation of for ␤2-microglobulin. J. Immunol. 160: 1472–1478. IFN response thresholds in of M␾/DCs and perhaps other cell 19. Fox, C. J., A. D. Paterson, S. M. Mortin-Toth, and J. S. Danska. 2000. Two genetic loci regulate T cell-dependent islet inflammation and drive autoimmune types. Therapeutic manipulation of this pathway in persons with diabetes pathogenesis. Am. J. Hum. Genet. 67: 67–81. genetic risk for T1D may present a useful avenue for interference 20. Ivakine, E. A., C. J. Fox, A. D. Paterson, S. M. Mortin-Toth, A. Canty, with autoimmune inflammatory progression and preservation of ␤ D. S. Walton, K. Aleksa, S. Ito, and J. S. Danska. 2005. Sex-specific effect of insulin-dependent diabetes 4 on regulation of diabetes pathogenesis in the nono- cell mass. bese diabetic mouse. J. Immunol. 174: 7129–7140. 21. Harada, M., and S. Makino. 1984. Promotion of spontaneous diabetes in nonobese diabetes-prone mice by cyclophosphamide. Diabetologia 27: 604–606. Acknowledgments 22. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison We thank Dr. Jane Rogers, Charles Sawyer, and their colleagues at the of normalization methods for high density oligonucleotide array data based on Wellcome-Sanger Centre for BAC tiling and genomic sequencing of the variance and bias. Bioinformatics 19: 185–193.

NOD Idd4 locus and for many helpful discussions. We thank Drs. 23. Irizarry, R. A., B. M. Bolstad, F. Collin, L. M. Cope, B. Hobbs, and T. P. Speed. Downloaded from 2003. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. C. Guidos, S. Scherer, and R. McInnes for critical comments on the 31: e15. manuscript. 24. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 98: 5116–5121. Disclosures 25. Charlton, B., A. Bacelj, and T. E. Mandel. 1988. Administration of silica particles The authors have no financial conflict of interest. or anti-Lyt2 antibody prevents ␤-cell destruction in NOD mice given cyclophosphamide. Diabetes 37: 930–935. http://www.jimmunol.org/ 26. Fox, C. J. 1999. Genetic regulation of contingent macrophage- and T cell- de- References pendent steps in islet inflammation. Ph.D. thesis, Department of Immunology, 1. Wicker, L. S., J. A. Todd, and L. B. Peterson. 1995. Genetic control of autoim- University of Toronto, Toronto, Canada. mune diabetes in the NOD mouse. Annu. Rev. Immunol. 13: 179–200. 27. Serreze, D. V., H. D. Chapman, D. S. Varnum, M. S. Hanson, P. C. Reifsnyder, 2. Serreze, D. V., and E. H. Leiter. 2001. Genes and cellular requirements for au- S. D. Richard, S. A. Fleming, E. H. Leiter, and L. D. Shultz. 1996. B lymphocytes toimmune diabetes susceptibility in nonobese diabetic mice. Curr. Dir Autoim- are essential for the initiation of T cell-mediated autoimmune diabetes: analysis mun. 4: 31–67. of a new “speed congenic” stock of NOD.Ig mu null mice. J. Exp. Med. 184: 3. Anderson, M. S., and J. A. Bluestone. 2005. The NOD mouse: a model of im- 2049–2053. mune dysregulation. Annu. Rev. Immunol. 23: 447–485. 28. Noorchashm, H., Y. K. Lieu, N. Noorchashm, S. Y. Rostami, S. A. Greeley, 4. Cox, N. J., B. Wapelhorst, V. A. Morrison, L. Johnson, L. Pinchuk, A. Schlachterman, H. K. Song, L. E. Noto, A. M. Jevnikar, C. F. Barker, and R. S. Spielman, J. A. Todd, and P. Concannon. 2001. Seven regions of the ge- A. Naji. 1999. I-Ag7-mediated antigen presentation by B lymphocytes is critical nome show evidence of linkage to type 1 diabetes in a consensus analysis of 767 ␤ in overcoming a checkpoint in T cell tolerance to islet cells of nonobese dia- by guest on September 28, 2021 multiplex families. Am. J. Hum. Genet. 69: 820–830. betic mice. J. Immunol. 163: 743–750. 5. Pociot, F., and M. F. McDermott. 2002. Genetics of type 1 diabetes mellitus. 29. Chiu, P. P., D. V. Serreze, and J. S. Danska. 2001. Development and function of Genes Immun. 3: 235–249. diabetogenic T-cells in B-cell-deficient nonobese diabetic mice. Diabetes 50: 6. Cox, N. J., B. Wapelhorst, V. A. Morrison, L. Johnson, L. Pinchuk, 763–770. R. S. Spielman, J. A. Todd, and P. Concannon. 2001. Seven regions of the ge- 30. Martin, S., D. Wolf-Eichbaum, G. Duinkerken, W. A. Scherbaum, H. Kolb, nome show evidence of linkage to type 1 diabetes in a consensus analysis of 767 J. G. Noordzij, and B. O. Roep. 2001. Development of type 1 diabetes despite multiplex families. Am. J. Hum. Genet. 69: 820–830. severe hereditary B-lymphocyte deficiency. N. Engl. J. Med. 345: 1036–1040. 7. Hamilton-Williams, E. E., D. V. Serreze, B. Charlton, E. A. Johnson, 31. Devendra, D., and G. S. Eisenbarth. 2004. Interferon ␣: a potential link in the M. P. Marron, A. Mullbacher, and R. M. Slattery. 2001. Transgenic rescue im- ␤ pathogenesis of viral-induced type 1 diabetes and autoimmunity. Clin. Immunol. plicates 2-microglobulin as a diabetes susceptibility gene in nonobese diabetic 111: 225–233. (NOD) mice. Proc. Natl. Acad. Sci. USA 98: 11533–11538. 32. Yoshimoto, T., and Y. Takahashi. 2002. Arachidonate 12-lipoxygenases. Pros- 8. Ueda, H., J. M. Howson, L. Esposito, J. Heward, H. Snook, G. Chamberlain, taglandins Other Lipid Mediat. 68–69: 245–262. D. B. Rainbow, K. M. Hunter, A. N. Smith, G. Di Genova, et al. 2003. Associ- 33. Iyer, S. S., J. A. Barton, S. Bourgoin, and D. J. Kusner. 2004. Phospholipases D1 ation of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune and D2 coordinately regulate macrophage phagocytosis. J. Immunol. 173: disease. Nature 423: 506–511. 2615–2623. 9. Wicker, L. S., G. Chamberlain, K. Hunter, D. Rainbow, S. Howlett, P. Tiffen, J. Clark, A. Gonzalez-Munoz, A. M. Cumiskey, R. L. Rosa, et al. 2004. Fine 34. Kel, A. E., E. Gossling, I. Reuter, E. Cheremushkin, O. V. Kel-Margoulis, and mapping, gene content, comparative sequencing, and expression analyses support E. Wingender. 2003. MATCH: a tool for searching transcription factor binding Ctla4 and Nramp1 as candidates for Idd5.1 and Idd5.2 in the nonobese diabetic sites in DNA sequences. Nucleic Acids Res. 31: 3576–3579. mouse. J. Immunol. 173: 164–173. 35. Prestridge, D. S. 1996. SIGNAL SCAN 4.0: additional databases and sequence 10. Bennett, S. T., A. J. Wilson, F. Cucca, J. Nerup, F. Pociot, P. A. McKinney, formats. Comput. Appl. Biosci. 12: 157–160. A. H. Barnett, S. C. Bain, and J. A. Todd. 1996. IDDM2-VNTR-encoded sus- 36. Schwartz, S., Z. Zhang, K. A. Frazer, A. Smit, C. Riemer, J. Bouck, R. Gibbs, ceptibility to type 1 diabetes: dominant protection and parental transmission of R. Hardison, and W. Miller. 2000. PipMaker: a web server for aligning two alleles of the insulin gene-linked minisatellite locus. J. Autoimmun. 9: 415–421. genomic DNA sequences. Genome Res. 10: 577–586. 11. Pugliese, A., M. Zeller, A. Fernandez, Jr., L. J. Zalcberg, R. J. Bartlett, 37. Matloubian, M., A. David, S. Engel, J. E. Ryan, and J. G. Cyster. 2000. A C. Ricordi, M. Pietropaolo, G. S. Eisenbarth, S. T. Bennett, and D. D. Patel. 1997. transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat. Im- The insulin gene is transcribed in the human thymus and transcription levels munol. 1: 298–304. correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for 38. Johnston, B., C. H. Kim, D. Soler, M. Emoto, and E. C. Butcher. 2003. Differ- type 1 diabetes. Nat. Genet. 15: 293–297. ential chemokine responses and homing patterns of murine TCR␣␤ NKT cell 12. Vafiadis, P., S. T. Bennett, J. A. Todd, J. Nadeau, R. Grabs, C. G. Goodyer, subsets. J. Immunol. 171: 2960–2969. S. Wickramasinghe, E. Colle, and C. Polychronakos. 1997. Insulin expression in 39. Shimaoka, T., T. Nakayama, N. Fukumoto, N. Kume, S. Takahashi, human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat. J. Yamaguchi, M. Minami, K. Hayashida, T. Kita, J. Ohsumi, et al. 2003. Cell Genet. 15: 289–292. surface-anchored SR-PSOX/CXC chemokine ligand 16 mediates firm adhesion 13. Begovich, A. B., V. E. Carlton, L. A. Honigberg, S. J. Schrodi, of CXC chemokine receptor 6-expressing cells. J. Leukocyte Biol. A. P. Chokkalingam, H. C. Alexander, K. G. Ardlie, Q. Huang, A. M. Smith, 40. Shimaoka, T., T. Nakayama, N. Kume, S. Takahashi, J. Yamaguchi, M. Minami, J. M. Spoerke, et al. 2004. A missense single-nucleotide polymorphism in a gene K. Hayashida, T. Kita, J. Ohsumi, O. Yoshie, and S. Yonehara. 2003. Cutting encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid edge: SR-PSOX/CXC chemokine ligand 16 mediates bacterial phagocytosis by arthritis. Am. J. Hum. Genet. 75: 330–337. APCs through its chemokine domain. J. Immunol. 171: 1647–1651. 14. Bottini, N., L. Musumeci, A. Alonso, S. Rahmouni, K. Nika, M. Rostamkhani, 41. Davis, R. C., E. E. Schadt, A. C. Cervino, M. Peterfy, and A. J. Lusis. 2005. J. MacMurray, G. F. Meloni, P. Lucarelli, M. Pellecchia, et al. 2004. A functional Ultrafine mapping of SNPs from mouse strains C57BL/6J, DBA/2J, and variant of lymphoid tyrosine phosphatase is associated with type I diabetes. Nat. C57BLKS/J for loci contributing to diabetes and atherosclerosis susceptibility. Genet. 36: 337–338. Diabetes 54: 1191–1199. 2990 MOLECULAR GENETIC ANALYSIS OF THE Idd4 LOCUS IN NOD MICE

42. Ghosh, S., S. M. Palmer, N. R. Rodrigues, H. J. Cordell, C. M. Hearne, 52. Levy, B. D., C. B. Clish, B. Schmidt, K. Gronert, and C. N. Serhan. 2001. Lipid R. J. Cornall, J. B. Prins, P. McShane, G. M. Lathrop, L. B. Peterson, et al. 1993. mediator class switching during acute inflammation: signals in resolution. Nat. Polygenic control of autoimmune diabetes in nonobese diabetic mice. Nat. Genet. Immunol. 2: 612–619. 4: 404–409. 53. Serhan, C. N., A. Jain, S. Marleau, C. Clish, A. Kantarci, B. Behbehani, 43. Grattan, M., Q. S. Mi, C. Meagher, and T. L. Delovitch. 2002. Congenic mapping S. P. Colgan, G. L. Stahl, A. Merched, N. A. Petasis, et al. 2003. Reduced of the diabetogenic locus Idd4 to a 5.2-cM region of chromosome 11 in NOD inflammation and tissue damage in transgenic rabbits overexpressing 15-lipoxy- mice: identification of two potential candidate subloci. Diabetes 51: 215–223. genase and endogenous anti-inflammatory lipid mediators. J. Immunol. 171: 6856–6865. 44. Schadt, E. E., S. A. Monks, T. A. Drake, A. J. Lusis, N. Che, V. Colinayo, 54. Knapp, S., L. J. Yee, A. J. Frodsham, B. J. Hennig, S. Hellier, L. Zhang, T. G. Ruff, S. B. Milligan, J. R. Lamb, G. Cavet, et al. 2003. Genetics of gene M. Wright, M. Chiaramonte, M. Graves, H. C. Thomas, et al. 2003. Polymor- expression surveyed in maize, mouse and man. Nature 422: 297–302. phisms in interferon-induced genes and the outcome of hepatitis C virus infec- 45. Akiyama, K., S. Kagawa, T. Tamura, N. Shimbara, M. Takashina, P. Kristensen, tion: roles of MxA, OAS-1 and PKR. Genes Immun. 4: 411–419. K. B. Hendil, K. Tanaka, and A. Ichihara. 1994. Replacement of proteasome 55. Bonnevie-Nielsen, V., L. Leigh Field, S. Lu, D. J. Zheng, M. Li, ␥ subunits X and Y by LMP7 and LMP2 induced by interferon- for acquirement P. M. Martensen, T. B. Nielsen, H. Beck-Nielsen, Y. L. Lau, and F. Pociot. 2005. of the functional diversity responsible for antigen processing. FEBS Lett. 343: Variation in antiviral 2Ј,5Ј-oligoadenylate synthetase (2Ј5ЈAS) enzyme activity is 85–88. controlled by a single-nucleotide polymorphism at a splice-acceptor site in the 46. Akiyama, K., K. Yokota, S. Kagawa, N. Shimbara, T. Tamura, H. Akioka, OAS1 gene. Am. J. Hum. Genet. 76: 623–633. H. G. Nothwang, C. Noda, K. Tanaka, and A. Ichihara. 1994. cDNA cloning and 56. Field, L. L., V. Bonnevie-Nielsen, F. Pociot, S. Lu, T. B. Nielsen, and interferon-␥ down-regulation of proteasomal subunits X and Y. Science 265: H. Beck-Nielsen. 2005. OAS1 splice site polymorphism controlling antiviral en- 1231–1234. zyme activity influences susceptibility to type 1 diabetes. Diabetes 54: 47. Hisamatsu, H., N. Shimbara, Y. Saito, P. Kristensen, K. B. Hendil, T. Fujiwara, 1588–1591. E. Takahashi, N. Tanahashi, T. Tamura, A. Ichihara, and K. Tanaka. 1996. Newly 57. Melendez, A. J., and J. M. Allen. 2002. Phospholipase D and immune receptor identified pair of proteasomal subunits regulated reciprocally by interferon-␥. signalling. Semin. Immunol. 14: 49–55. J. Exp. Med. 183: 1807–1816. 58. O’Brien, B. A., Y. Huang, X. Geng, J. P. Dutz, and D. T. Finegood. 2002. 48. Groettrup, M., M. van den Broek, K. Schwarz, A. Macagno, S. Khan, R. de Giuli, Phagocytosis of apoptotic cells by macrophages from NOD mice is reduced. Downloaded from and G. Schmidtke. 2001. Structural plasticity of the proteasome and its function Diabetes 51: 2481–2488. in antigen processing. Crit. Rev. Immunol. 21: 339–358. 59. Funk, C. D., D. S. Keeney, E. H. Oliw, W. E. Boeglin, and A. R. Brash. 1996. Functional expression and cellular localization of a mouse epidermal lipoxygen- 49. Kuhn, H., M. Walther, and R. J. Kuban. 2002. Mammalian arachidonate 15- ase. J. Biol. Chem. 271: 23338–23344. lipoxygenases structure, function, and biological implications. Prostaglandins 60. Eaves, I. A., L. S. Wicker, G. Ghandour, P. A. Lyons, L. B. Peterson, J. A. Todd, Other Lipid Mediat. 68 69: 263–290. and R. J. Glynne. 2002. Combining mouse congenic strains and microarray gene 50. Zijlstra, F. J., and J. H. Wilson. 1991. 15-HETE is the main eicosanoid present expression analyses to study a complex trait: the NOD model of type 1 diabetes. in mucus of ulcerative proctocolitis. Prostaglandins. Leukot. Essent. Fatty Acids Genome Res. 12: 232–243. 43: 55–59. 61. Wandstrat, A. E., C. Nguyen, N. Limaye, A. Y. Chan, S. Subramanian, http://www.jimmunol.org/ 51. Funk, C. D., X. S. Chen, E. N. Johnson, and L. Zhao. 2002. Lipoxygenase genes X. H. Tian, Y. S. Yim, A. Pertsemlidis, H. R. Garner, Jr., L. Morel, and and their targeted disruption. Prostaglandins Other Lipid Mediat. 68–69: E. K. Wakeland. 2004. Association of extensive polymorphisms in the SLAM/ 303–312. CD2 gene cluster with murine lupus. Immunity 21: 769–780. by guest on September 28, 2021