DOCSLIB.ORG

Understanding Protein Lists from Proteomics Studies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University [email protected] A typical comparative shotgun proteomics study IPI00375843 IPI00171798 IPI00299485 IPI00009542 IPI00019568 IPI00060627 IPI00168262 IPI00082931 IPI00025084 IPI00412546 IPI00165528 IPI00043992 IPI00384992 IPI00006991 IPI00021885 IPI00377045 IPI00022471 ……. Li et.al. JPR, 2010 2 BCHM352 Omics technologies generate gene/protein lists n Genomics q Genome Wide Association Study (GWAS) q Next generation sequencing (NGS) n Transcriptomics q mRNA profiling ……….. n Microarrays ……….. n Serial analysis of gene expression (SAGE) ……….. n RNA-Seq ……….. q Protein-DNA interaction ………. n Chromatin immunoprecipitation ………. n Proteomics ………. ………. q Protein profiling ……… n LC-MS/MS q Protein-protein interaction ……… n Yeast two hybrid ……… n Affinity pull-down/LC-MS/MS 3 BCHM352 Sample files n Samples files can be downloaded from q http://bioinfo.vanderbilt.edu/zhanglab/?q=node/410 n Significant proteins q hnscc_sig_proteins.txt n Significant proteins with log fold change q hnscc_sig_withLogRatio.txt n All proteins identified in the study q hnscc_all_proteins.txt 4 BCHM352 Understanding a protein list n Level I q What are the proteins/genes behind the IDs and what do we know about the functions of the proteins/genes? 5 BCHM352 Level one: information retrieval Query interface (http://www.ebi.ac.uk/IPI) Output n One-protein-at-a-time n Time consuming n Information is local and isolated n Hard to automate the information retrieval process 6 BCHM352 A typical question n “I’ve attached a spreadsheet of our proteomics results comparing 5 Vehicle and 5 Aldosterone treated patients. We’ve included only those proteins whose summed spectral counts are >30 in one treatment group. Would it be possible to get the GO annotations for these? The Uniprot name is listed in column A and the gene name is listed in column R. If this is a time consuming task (and I imagine that it is), can you tell me how to do it?” 7 BCHM352 Biomart: a batch information retrieval system http://central.biomart.org/ 8 BCHM352 Biomart analysis n Choose dataset q Choose database: Ensembl 75 Genes q Choose dataset: Homo sapiens genes (GRCh37.p13) n Set filters q Gene: a list of genes identified by various database IDs (e.g. IPI IDs) q Gene Ontology: filter for genes with specific GO terms (e.g. cell cycle) q Protein domains: filter for genes with specific protein domains (e.g. SH2 domain, signal domains ) q Region: filter for genes in a specific chromosome region (e.g. chr1 1:1000000 or 11q13) q Others n Select output attributes q Gene annotation information in the Ensembl database, e.g. gene description, chromosome name, gene start, gene end, strand, band, gene name, etc. q External data: Gene Ontology, IDs in other databases q Expression: anatomical system, development stage, cell type, pathology q Protein domains: SMART, PFAM, Interpro, etc. 9 BCHM352 Biomart: sample output 10 BCHM352 Understanding a protein list n Level I q What are the proteins/genes behind the IDs and what do we know about the functions of the proteins/genes? n Level II q Which biological processes and pathways are the most interesting in terms of the experimental question? 11 BCHM352 Enrichment analysis n Enrichment analysis: is a functional group (e.g. cell cycle) significantly associated with the experimental question? MMP9 SERPINF1 Random Observed IPI00375843 A2ML1 9.2 22 IPI00171798 F2 IPI00299485 FN1 IPI00009542 LYZ 180 IPI00019568 TNXB 180 83 83 IPI00060627 FGG IPI00168262 MPO IPI00082931 FBLN1 1305 1305 IPI00025084 THBS1 IPI00412546 Compare HDLBP annotated IPI00165528 GSN IPI00043992 FBN1 All identified Filter for IPI00384992 CA2 proteins (1733) significant IPI00006991 P11 IPI00021885 CCL21 proteins …... FGB …… Differentially Extracellular expressed protein list space (260 proteins) (83 proteins) 12 BCHM352 Enrichment analysis: hypergeometric test Significant Non-significant Total proteins proteins Proteins in the group k j-k j Other proteins n-k m-n-j+k m-j Total n m-n m Hypergeometric test: given a total of m proteins where j proteins are in the functional group, if we pick n proteins randomly, what is the probability of having k or more proteins from the group? Observed # m − j&# j& k min(n, j ) % (% ( $ n − i '$ i' p = n j ∑ # m& i= k % ( m $ n ' Zhang et.al. Nucleic Acids Res. 33:W741, 2005 13 BCHM352 € Commonly used functional groups n Gene Ontology (http://www.geneontology.org) q Structured, precisely defined, controlled vocabulary for describing the roles of genes and gene products q Three organizing principles: molecular function, biological process, and cellular component n Pathways q KEGG (http://www.genome.jp/kegg/pathway.html) q Pathway commons (http://www.pathwaycommons.org) q WikiPathways (http://www.wikipathways.org) n Cytogenetic bands n Targets of transcription factors/miRNAs 14 BCHM352 WebGestalt: Web-based Gene Set Analysis Toolkit 8 organisms Human, Mouse, Rat, Dog, Fruitfly, Worm, Zebrafish, Yeast Microarray Probe IDs Gene IDs Protein IDs • Affymetrix • Gene Symbol • UniProt • Agilent • GenBank • IPI • Codelink • Ensembl Gene • RefSeq Peptide • Illumina • RefSeq Gene • Ensembl Peptide • UniGene • Entrez Gene Genetic Variation IDs • SGD • dbSNP • MGI • Flybase ID • Wormbase ID • ZFIN 196 ID types with mapping to Entrez Gene ID WebGestalt 59,278 functional categories with genes identified by Entrez Gene IDs Gene Ontology Pathway Network module • Biological Process • KEGG • Transcription factor targets • Molecular Function • Pathway Commons • microRNA targets • Cellular Component • WikiPathways • Protein interaction modules http://www.webgestalt.org Disease and Drug Chromosomal location • Disease association genes • Cytogenetic bands Zhang et.al. Nucleic Acids Res. 33:W741, 2005 • Drug association genes Wang et al. Nucleic Acids Res. 41:W77, 2013 15 BCHM352 WebGestalt analysis n Select the organism of interest. n Upload a gene/protein list in the txt format, one ID per row. Optionally, a value can be provided for each ID. In this case, put the ID and value in the same row and separate them by a tab. Then pick the ID type that corresponds to the list of IDs. n Categorize the uploaded ID list based upon GO Slim (a simplified version of Gene Ontology that focuses on high level classifications). n Analyze the uploaded ID list for for enrichment in various biological contexts. You will need to select an appropriate predefined reference set or upload a reference set. If a customized reference set is uploaded, ID type also needs to be selected. After this, select the analysis parameters (e.g., significance level, multiple test adjustment method, etc.). n Retrieve enrichment results by opening the respective results files. You may also open and/or download a TSV file, or download the zipped results to a directory on your desktop. 16 BCHM352 WebGestalt: ID mapping n Input list q 260 significant proteins identified in the HNSCC study (hnscc_sig_withLogRatio.txt) n Mapping result q Total number of User IDs: 260. Unambiguously mapped User IDs to Entrez IDs: 229. Unique User Entrez IDs: 224. The Enrichment Analysis will be based upon the unique IDs. 17 BCHM352 WebGestalt: GOSlim classification Molecular function Biological process Cellular component 18 BCHM352 WebGestalt: top 10 enriched GO biological processes Reference list: CSHL2010_hnscc_all_proteins.txt 19 BCHM352 WebGestalt: top 10 enriched WikiPathways 20 BCHM352 Limitation of the over-representation analysis n Does not account for the order of genes in the significant gene list n Arbitrary thresholding leads to the lose of information 21 BCHM352 Gene Set Enrichment Analysis (GSEA) http://www.broad.mit.edu/gsea/ Subramanian et.al. PNAS 102:15545, 2005 n Test whether the members of a predefined gene set are randomly distributed throughout the ranked gene list q Calculation of an Enrichment Score, modified Kolmogorov Smirnov test q Estimation of Significance Level of ES, permutation test q Adjustment for Multiple Hypothesis Testing, control False Discovery Rate q Leading edge subset: genes contribute to the significance 22 BCHM352 Understanding a protein list n Level I q What are the proteins/genes behind the IDs and what do we know about the functions of the proteins/genes? n Level II q Which biological processes and pathways are the most interesting in terms of the experimental question? n Level III q How do the proteins work together to form a network? 23 BCHM352 Resources n GeneMANIA q http://genemania.org n STRING q http://string-db.org/ n Genes2Networks q http://actin.pharm.mssm.edu/ genes2networks/ 24 BCHM352 Understanding a protein list: summary n Level I q What are the proteins/genes behind the IDs and what do we know about the functions of the proteins/genes? q Biomart (http://www.biomart.org/) n Level II q Which biological processes and pathways are the most interesting in terms of the experimental question? q WebGestalt (http://bioinfo.vanderbilt.edu/webgestalt) q Related tools: DAVID (http://david.abcc.ncifcrf.gov/), GenMAPP (http://www.genmapp.org/), GSEA (http://www.broadinstitute.org/gsea ) n Level III q How do the proteins work together to form a network? q GeneMANIA (http://genemania.org) q Related tools: Cytoscape (http://www.cytoscape.org/), STRING (http://string.embl.de/), Genes2Networks (http://actin.pharm.mssm.edu/genes2networks), Ingenuity ( http://www.ingenuity.com/), Pathway Studio ( http://www.ariadnegenomics.com/products/pathway-studio/) 25 BCHM352 .
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia

    Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia

    ARTICLE DOI: 10.1038/s41467-018-05379-y OPEN Evaluation of chromatin accessibility in prefrontal cortex of individuals with schizophrenia Julien Bryois 1, Melanie E. Garrett2, Lingyun Song3, Alexias Safi3, Paola Giusti-Rodriguez 4, Graham D. Johnson 3, Annie W. Shieh13, Alfonso Buil5, John F. Fullard6, Panos Roussos 6,7,8, Pamela Sklar6, Schahram Akbarian 6, Vahram Haroutunian 6,9, Craig A. Stockmeier 10, Gregory A. Wray3,11, Kevin P. White12, Chunyu Liu13, Timothy E. Reddy 3,14, Allison Ashley-Koch2,15, Patrick F. Sullivan 1,4,16 & Gregory E. Crawford 3,17 1234567890():,; Schizophrenia genome-wide association studies have identified >150 regions of the genome associated with disease risk, yet there is little evidence that coding mutations contribute to this disorder. To explore the mechanism of non-coding regulatory elements in schizophrenia, we performed ATAC-seq on adult prefrontal cortex brain samples from 135 individuals with schizophrenia and 137 controls, and identified 118,152 ATAC-seq peaks. These accessible chromatin regions in the brain are highly enriched for schizophrenia SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. We identify few differences in chromatin accessibility between cases and controls, in contrast to thousands of age-related differential accessible chromatin regions. Altogether, we characterize chromatin accessibility in the human prefrontal cortex, the effect of schizophrenia and age on chromatin accessibility, and provide evidence that our dataset will allow for fine mapping of risk variants. 1 Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, SE-17177 Stockholm, Sweden.
  • Genetic and Pharmacological Approaches to Preventing Neurodegeneration

    Genetic and Pharmacological Approaches to Preventing Neurodegeneration

    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Genetic and Pharmacological Approaches to Preventing Neurodegeneration Marco Boccitto University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Boccitto, Marco, "Genetic and Pharmacological Approaches to Preventing Neurodegeneration" (2012). Publicly Accessible Penn Dissertations. 494. https://repository.upenn.edu/edissertations/494 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/494 For more information, please contact [email protected]. Genetic and Pharmacological Approaches to Preventing Neurodegeneration Abstract The Insulin/Insulin-like Growth Factor 1 Signaling (IIS) pathway was first identified as a major modifier of aging in C.elegans. It has since become clear that the ability of this pathway to modify aging is phylogenetically conserved. Aging is a major risk factor for a variety of neurodegenerative diseases including the motor neuron disease, Amyotrophic Lateral Sclerosis (ALS). This raises the possibility that the IIS pathway might have therapeutic potential to modify the disease progression of ALS. In a C. elegans model of ALS we found that decreased IIS had a beneficial effect on ALS pathology in this model. This beneficial effect was dependent on activation of the transcription factor daf-16. To further validate IIS as a potential therapeutic target for treatment of ALS, manipulations of IIS in mammalian cells were investigated for neuroprotective activity. Genetic manipulations that increase the activity of the mammalian ortholog of daf-16, FOXO3, were found to be neuroprotective in a series of in vitro models of ALS toxicity.
  • A Genome-Wide Association Study Identifies Four Novel Susceptibility Loci Underlying Inguinal Hernia

    A Genome-Wide Association Study Identifies Four Novel Susceptibility Loci Underlying Inguinal Hernia

    UCSF UC San Francisco Previously Published Works Title A genome-wide association study identifies four novel susceptibility loci underlying inguinal hernia. Permalink https://escholarship.org/uc/item/7g06z1k5 Journal Nature communications, 6(1) ISSN 2041-1723 Authors Jorgenson, Eric Makki, Nadja Shen, Ling et al. Publication Date 2015-12-21 DOI 10.1038/ncomms10130 Peer reviewed eScholarship.org Powered by the California Digital Library University of California ARTICLE Received 24 Aug 2015 | Accepted 6 Nov 2015 | Published 21 Dec 2015 DOI: 10.1038/ncomms10130 OPEN A genome-wide association study identifies four novel susceptibility loci underlying inguinal hernia Eric Jorgenson1,*, Nadja Makki2,3,*, Ling Shen1, David C. Chen4, Chao Tian5, Walter L. Eckalbar2,3, David Hinds5, Nadav Ahituv2,3 & Andrew Avins1 Inguinal hernia repair is one of the most commonly performed operations in the world, yet little is known about the genetic mechanisms that predispose individuals to develop inguinal hernias. We perform a genome-wide association analysis of surgically confirmed inguinal hernias in 72,805 subjects (5,295 cases and 67,510 controls) and confirm top associations in an independent cohort of 92,444 subjects with self-reported hernia repair surgeries (9,701 cases and 82,743 controls). We identify four novel inguinal hernia susceptibility loci in the regions of EFEMP1, WT1, EBF2 and ADAMTS6. Moreover, we observe expression of all four genes in mouse connective tissue and network analyses show an important role for two of these genes (EFEMP1 and WT1) in connective tissue maintenance/homoeostasis. Our findings provide insight into the aetiology of hernia development and highlight genetic pathways for studies of hernia development and its treatment.
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases

    A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases

    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
  • Discovery of a Molecular Glue That Enhances Uprmt to Restore

    Discovery of a Molecular Glue That Enhances Uprmt to Restore

    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.17.431525; this version posted February 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Discovery of a molecular glue that enhances UPRmt to restore proteostasis via TRKA-GRB2-EVI1-CRLS1 axis Authors: Li-Feng-Rong Qi1, 2 †, Cheng Qian1, †, Shuai Liu1, 2†, Chao Peng3, 4, Mu Zhang1, Peng Yang1, Ping Wu3, 4, Ping Li1 and Xiaojun Xu1, 2 * † These authors share joint first authorship Running title: Ginsenoside Rg3 reverses Parkinson’s disease model by enhancing mitochondrial UPR Affiliations: 1 State Key Laboratory of Natural Medicines, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. 2 Jiangsu Key Laboratory of Drug Discovery for Metabolic Diseases, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. 3. National Facility for Protein Science in Shanghai, Zhangjiang Lab, Shanghai Advanced Research Institute, Chinese Academy of Science, Shanghai 201210, China 4. Shanghai Science Research Center, Chinese Academy of Sciences, Shanghai, 201204, China. Corresponding author: Ping Li, State Key Laboratory of Natural Medicines, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. Email: [email protected], Xiaojun Xu, State Key Laboratory of Natural Medicines, Jiangsu Key Laboratory of Drug Discovery for Metabolic Diseases, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. Telephone number: +86-2583271203, E-mail: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.17.431525; this version posted February 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
  • Sex-Specific Transcriptome Differences in Human Adipose

    Sex-Specific Transcriptome Differences in Human Adipose

    G C A T T A C G G C A T genes Article Sex-Specific Transcriptome Differences in Human Adipose Mesenchymal Stem Cells 1, 2, 3 1,3 Eva Bianconi y, Raffaella Casadei y , Flavia Frabetti , Carlo Ventura , Federica Facchin 1,3,* and Silvia Canaider 1,3 1 National Laboratory of Molecular Biology and Stem Cell Bioengineering of the National Institute of Biostructures and Biosystems (NIBB)—Eldor Lab, at the Innovation Accelerator, CNR, Via Piero Gobetti 101, 40129 Bologna, Italy; [email protected] (E.B.); [email protected] (C.V.); [email protected] (S.C.) 2 Department for Life Quality Studies (QuVi), University of Bologna, Corso D’Augusto 237, 47921 Rimini, Italy; [email protected] 3 Department of Experimental, Diagnostic and Specialty Medicine (DIMES), University of Bologna, Via Massarenti 9, 40138 Bologna, Italy; fl[email protected] * Correspondence: [email protected]; Tel.: +39-051-2094114 These authors contributed equally to this work. y Received: 1 July 2020; Accepted: 6 August 2020; Published: 8 August 2020 Abstract: In humans, sexual dimorphism can manifest in many ways and it is widely studied in several knowledge fields. It is increasing the evidence that also cells differ according to sex, a correlation still little studied and poorly considered when cells are used in scientific research. Specifically, our interest is on the sex-related dimorphism on the human mesenchymal stem cells (hMSCs) transcriptome. A systematic meta-analysis of hMSC microarrays was performed by using the Transcriptome Mapper (TRAM) software. This bioinformatic tool was used to integrate and normalize datasets from multiple sources and allowed us to highlight chromosomal segments and genes differently expressed in hMSCs derived from adipose tissue (hADSCs) of male and female donors.
  • Prognostic Value of a Novel Glycolysis-Related Gene Expression

    Prognostic Value of a Novel Glycolysis-Related Gene Expression

    Xia et al. Cancer Cell Int (2021) 21:154 https://doi.org/10.1186/s12935-021-01857-4 Cancer Cell International PRIMARY RESEARCH Open Access Prognostic value of a novel glycolysis-related gene expression signature for gastrointestinal cancer in the Asian population Rong Xia1,2†, Hua Tang3†, Jiemiao Shen1,2†, Shuyu Xu1,2, Yinyin Liang1,2, Yuxin Zhang4, Xing Gong1,2, Yue Min1,2, Di Zhang1,2, Chenzhe Tao1,2, Shoulin Wang1,2, Yi Zhang5*, Jinyou Yang6* and Chao Wang1,2* Abstract Background: Globally, gastrointestinal (GI) cancer is one of the most prevalent malignant tumors. However, studies have not established glycolysis-related gene signatures that can be used to construct accurate prognostic models for GI cancers in the Asian population. Herein, we aimed at establishing a novel glycolysis-related gene expression signa- ture to predict the prognosis of GI cancers. Methods: First, we evaluated the mRNA expression profles and the corresponding clinical data of 296 Asian GI cancer patients in The Cancer Genome Atlas (TCGA) database (TCGA-LIHC, TCGA-STAD, TCGA-ESCA, TCGA-PAAD, TCGA-COAD, TCGA-CHOL and TCGA-READ). Diferentially expressed mRNAs between GI tumors and normal tissues were investigated. Gene Set Enrichment Analysis (GSEA) was performed to identify glycolysis-related genes. Then, univariate, LASSO regression and multivariate Cox regression analyses were performed to establish a key prognostic glycolysis-related gene expression signature. The Kaplan-Meier and receiver operating characteristic (ROC) curves were used to evaluate the efciency and accuracy of survival prediction. Finally, a risk score to predict the prognosis of GI cancers was calculated and validated using the TCGA data sets.
  • Download a Subgraph Composed of the Initially 32 Raso- of Proteins Underlying Rasopathies in Order to Iden- Pathy Proteins Selected in This Study

    Download a Subgraph Composed of the Initially 32 Raso- of Proteins Underlying Rasopathies in Order to Iden- Pathy Proteins Selected in This Study

    Montero‑Bullón et al. Orphanet J Rare Dis (2021) 16:303 https://doi.org/10.1186/s13023‑021‑01934‑x RESEARCH Open Access Integrated in silico MS‑based phosphoproteomics and network enrichment analysis of RASopathy proteins Javier‑Fernando Montero‑Bullón1, Óscar González‑Velasco2, María Isidoro‑García3,4,5,6 and Jesus Lacal3,7* Abstract Background: RASopathies are a group of syndromes showing clinical overlap caused by mutations in genes afect‑ ing the RAS‑MAPK pathway. Consequent disruption on cellular signaling leads and is driven by phosphoproteome remodeling. However, we still lack a comprehensive picture of the diferent key players and altered downstream efectors. Methods: An in silico interactome of RASopathy proteins was generated using pathway enrichment analysis/STRING tool, including identifcation of main hub proteins. We also integrated phosphoproteomic and immunoblotting stud‑ ies using previous published information on RASopathy proteins and their neighbors in the context of RASopathy syndromes. Data from Phosphosite database (www. phosp hosite. org) was collected in order to obtain the potential phosphosites subjected to regulation in the 27 causative RASopathy proteins. We compiled a dataset of dysregulated phosphosites in RASopathies, searched for commonalities between syndromes in harmonized data, and analyzed the role of phosphorylation in the syndromes by the identifcation of key players between the causative RASopathy proteins and the associated interactome. Results: In this study, we provide a curated data set of 27 causative RASopathy genes, identify up to 511 protein– protein associations using pathway enrichment analysis/STRING tool, and identify 12 nodes as main hub proteins. We found that a large group of proteins contain tyrosine residues and their biological processes include but are not limited to the nervous system.
  • Platform Abstracts

    Platform Abstracts

    American Society of Human Genetics 65th Annual Meeting October 6–10, 2015 Baltimore, MD PLATFORM ABSTRACTS Wednesday, October 7, 9:50-10:30am Abstract #’s Friday, October 9, 2:15-4:15 pm: Concurrent Platform Session D: 4. Featured Plenary Abstract Session I Hall F #1-#2 46. Hen’s Teeth? Rare Variants and Common Disease Ballroom I #195-#202 Wednesday, October 7, 2:30-4:30pm Concurrent Platform Session A: 47. The Zen of Gene and Variant 15. Update on Breast and Prostate Assessment Ballroom III #203-#210 Cancer Genetics Ballroom I #3-#10 48. New Genes and Mechanisms in 16. Switching on to Regulatory Variation Ballroom III #11-#18 Developmental Disorders and 17. Shedding Light into the Dark: From Intellectual Disabilities Room 307 #211-#218 Lung Disease to Autoimmune Disease Room 307 #19-#26 49. Statistical Genetics: Networks, 18. Addressing the Difficult Regions of Pathways, and Expression Room 309 #219-#226 the Genome Room 309 #27-#34 50. Going Platinum: Building a Better 19. Statistical Genetics: Complex Genome Room 316 #227-#234 Phenotypes, Complex Solutions Room 316 #35-#42 51. Cancer Genetic Mechanisms Room 318/321 #235-#242 20. Think Globally, Act Locally: Copy 52. Target Practice: Therapy for Genetic Hilton Hotel Number Variation Room 318/321 #43-#50 Diseases Ballroom 1 #243-#250 21. Recent Advances in the Genetic Basis 53. The Real World: Translating Hilton Hotel of Neuromuscular and Other Hilton Hotel Sequencing into the Clinic Ballroom 4 #251-#258 Neurodegenerative Phenotypes Ballroom 1 #51-#58 22. Neuropsychiatric Diseases of Hilton Hotel Friday, October 9, 4:30-6:30pm Concurrent Platform Session E: Childhood Ballroom 4 #59-#66 54.
  • Product Size GOT1 P00504 F CAAGCTGT

    Product Size GOT1 P00504 F CAAGCTGT

    Table S1. List of primer sequences for RT-qPCR. Gene Product Uniprot ID F/R Sequence(5’-3’) name size GOT1 P00504 F CAAGCTGTCAAGCTGCTGTC 71 R CGTGGAGGAAAGCTAGCAAC OGDHL E1BTL0 F CCCTTCTCACTTGGAAGCAG 81 R CCTGCAGTATCCCCTCGATA UGT2A1 F1NMB3 F GGAGCAAAGCACTTGAGACC 93 R GGCTGCACAGATGAACAAGA GART P21872 F GGAGATGGCTCGGACATTTA 90 R TTCTGCACATCCTTGAGCAC GSTT1L E1BUB6 F GTGCTACCGAGGAGCTGAAC 105 R CTACGAGGTCTGCCAAGGAG IARS Q5ZKA2 F GACAGGTTTCCTGGCATTGT 148 R GGGCTTGATGAACAACACCT RARS Q5ZM11 F TCATTGCTCACCTGCAAGAC 146 R CAGCACCACACATTGGTAGG GSS F1NLE4 F ACTGGATGTGGGTGAAGAGG 89 R CTCCTTCTCGCTGTGGTTTC CYP2D6 F1NJG4 F AGGAGAAAGGAGGCAGAAGC 113 R TGTTGCTCCAAGATGACAGC GAPDH P00356 F GACGTGCAGCAGGAACACTA 112 R CTTGGACTTTGCCAGAGAGG Table S2. List of differentially expressed proteins during chronic heat stress. score name Description MW PI CC CH Down regulated by chronic heat stress A2M Uncharacterized protein 158 1 0.35 6.62 A2ML4 Uncharacterized protein 163 1 0.09 6.37 ABCA8 Uncharacterized protein 185 1 0.43 7.08 ABCB1 Uncharacterized protein 152 1 0.47 8.43 ACOX2 Cluster of Acyl-coenzyme A oxidase 75 1 0.21 8 ACTN1 Alpha-actinin-1 102 1 0.37 5.55 ALDOC Cluster of Fructose-bisphosphate aldolase 39 1 0.5 6.64 AMDHD1 Cluster of Uncharacterized protein 37 1 0.04 6.76 AMT Aminomethyltransferase, mitochondrial 42 1 0.29 9.14 AP1B1 AP complex subunit beta 103 1 0.15 5.16 APOA1BP NAD(P)H-hydrate epimerase 32 1 0.4 8.62 ARPC1A Actin-related protein 2/3 complex subunit 42 1 0.34 8.31 ASS1 Argininosuccinate synthase 47 1 0.04 6.67 ATP2A2 Cluster of Calcium-transporting
  • Figure S1. Gene Ontology Classification of Abeliophyllum Distichum Leaves Extract-Induced Degs

    Figure S1. Gene Ontology Classification of Abeliophyllum Distichum Leaves Extract-Induced Degs

    Figure S1. Gene ontology classification of Abeliophyllum distichum leaves extract-induced DEGs. The results are summarized in three main categories: Biological process, Cellular component and Molecular function. Figure S2. KEGG pathway enrichment analysis using Abeliophyllum distichum leaves extract-DEGs (A). Venn diagram analysis of DEGs involved in PI3K/Akt signaling pathway and Rap1 signaling pathway (B). Figure S3. The expression (A) and protein levels (B) of Akt3 in AL-treated SK-MEL2 cells. Values with different superscripted letters are significantly different (p < 0.05). Table S1. Abeliophyllum distichum leaves extract-induced DEGs. log2 Fold Gene name Gene description Change A2ML1 alpha-2-macroglobulin-like protein 1 isoform 2 [Homo sapiens] 3.45 A4GALT lactosylceramide 4-alpha-galactosyltransferase [Homo sapiens] −1.64 ABCB4 phosphatidylcholine translocator ABCB4 isoform A [Homo sapiens] −1.43 ABCB5 ATP-binding cassette sub-family B member 5 isoform 1 [Homo sapiens] −2.99 ABHD17C alpha/beta hydrolase domain-containing protein 17C [Homo sapiens] −1.62 ABLIM2 actin-binding LIM protein 2 isoform 1 [Homo sapiens] −2.53 ABTB2 ankyrin repeat and BTB/POZ domain-containing protein 2 [Homo sapiens] −1.48 ACACA acetyl-CoA carboxylase 1 isoform 1 [Homo sapiens] −1.76 ACACB acetyl-CoA carboxylase 2 precursor [Homo sapiens] −2.03 ACSM1 acyl-coenzyme A synthetase ACSM1, mitochondrial [Homo sapiens] −3.05 disintegrin and metalloproteinase domain-containing protein 19 preproprotein [Homo ADAM19 −1.65 sapiens] disintegrin and metalloproteinase