Journal Pre-proof
Morphological and molecular characterization supporting Amblyomma mixtum presence in Cuba
Pedro E. Encinosa Guzman´ (Conceptualization) (Data curation) (Formal analysis) (Investigation) (Methodology) (Supervision)
PII: S1877-959X(20)30472-6 DOI: https://doi.org/10.1016/j.ttbdis.2020.101602 Reference: TTBDIS 101602
To appear in: Ticks and Tick-borne Diseases Received Date: 9 June 2020 Revised Date: 29 September 2020 Accepted Date: 18 October 2020
Please cite this article as: Guzman´ PEE, Mart´ınez YG, Cruz RL, Ramos DA, Afonso YF, Soto YB, la Guardia Cd, Alfaro YG, Garc´ıa AD, Estrada MP, Rodr´ıguez-Mallon A, Morphological and molecular characterization supporting Amblyomma mixtum presence in Cuba, Ticks and Tick-borne Diseases (2020), doi: https://doi.org/10.1016/j.ttbdis.2020.101602
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier.
Morphological and molecular characterization supporting Amblyomma mixtum presence in Cuba
Short Title: Amblyomma mixtum in Cuba
Pedro E. Encinosa Guzmán1, Yuselys García Martínez1, Ricardo Lleonart Cruz2, Daniela Aliaga Ramos1, Yilian Fernández Afonso3, Yamil Bello Soto1, Carolina de la Guardia2, Yorexis González Alfaro3, Angelina Díaz García3, Mario Pablo Estrada1 and Alina Rodríguez-Mallon1*.
1 Animal Biotechnology Department, Center for Genetic Engineering and Biotechnology (CIGB), Havana, Cuba
2 Instituto de Investigaciones Científicas y Servicios de Alta Tecnología (INDICASAT AIP), Panama
3 Centro de Estudios Avanzados de Cuba. *Corresponding Author: [email protected] ; +53 72504407; CIGB, 31st Avenue and 190, P.O. Box 6162, Havana 10600, Cuba
Abstract
Amblyomma cajennense Fabricius, 1787 (Acari: Ixodidae) is a widely distributed tick taxon. Recent studies have reassessed this taxon as a complex of six species. Amblyomma mixtum Koch, 1844 has been suggested by some authors as the only species of this complex that is present in Cuba. Other authors have pointed a niche overlapping for A. mixtum and A. cajennense s.s. in the country. Detailed taxonomic studies on the Cuban species belonging to this complex are needed in order to evaluate their current distribution according to the recent classification. This study aimed to characterize Cuban populations from the A. cajennense complex by using tick samples obtained from 3 occidental provinces and 1 central province of the country. Morphological identification and measurements of the main relevant taxonomic structures were conducted by using Scanning Electron Microscopy. Phylogenetic analyzes were carried out with 16S ribosomal RNA, internal transcribed spacer 2 and the Journalsubunit I of mitochondrial cytochrome Pre-proof c oxidase gene sequences. The results of these studies demonstrated that all samples belonged to the species A. mixtum (Koch, 1844). This study constitutes the first molecular characterization of this Amblyomma species in Cuba. Further studies will be necessary in order to corroborate if A. cajennense s.s. is also present in the island.
Keywords: Amblyomma cajennense; Amblyomma mixtum; molecular tick taxonomy; morphological identification; phylogenetic analysis.
1. Introduction
Amblyomma is the third largest genus of the family Ixodidae (Bowman and Nuttall, 2008). A half of its entire species occur on the American Continent from southern Texas in USA to northern Argentina (Nava et al., 2014). Species of this genus are recognized vectors for pathogens such as Rickettsia rickettsii or Rickettsia parkeri (Labruna et al., 2011a; Venzal and Nava, 2011). The taxonomic status of the Amblyomma cajennense species has been object of debate worldwide. Different morphological (Nava et al., 2014), molecular (Beati et al., 2013) and cross-mating studies among different populations of A. cajennense (Labruna et al., 2011b; Mastropaolo et al., 2011) have demonstrated that the A. cajennense taxon, previously considered a single species, is a complex comprising six different species: A. cajennense (Fabricius, 1787), A. mixtum Koch, 1844, A. sculptum Berlese, 1888, A. interandinum Beati, Nava and Cáceres, 2014, A. tonelliae Nava, Beati and Labruna, 2014 and A. patinoi Labruna, Nava and Beati, 2014 (Nava et al., 2014). A. cajennense sensu lato is the only species of this genus with medical and economic relevance that had been reported in the list of Cuban tick species (Perez-Vigueras, 1954). Further studies reported also the presence of A. cajennense s.l. in the Isla de la Juventud, Camagüey and Santiago de Cuba Provinces in the country (Barros-Battesti et al., 2009). However, after the reassessment of the taxonomic status of Amblyomma cajennense (Fabricius, 1787), a Cuban tick specimen belonging to the U.S. National Tick Collection in Georgia Southern University, USA was classified as A. mixtum (Nava et al., 2014). There are also reports showing that A. mixtum and A. cajennense s.s. may be coexisting in the Caribbean because there is an overlap of their preferred niches (Estrada-Peña et al., 2014). The aim of this study was the morphologic and molecular characterization of 4 Cuban field populations of Amblyomma cajennense s.l., in order to allow their taxonomic classification according Journalto the most recent species description Pre-proof in the complex.
2. Materials and Methods
2.1 Tick samples
Ticks were collected from different geographical localities in the occidental region of Cuba: fully engorged nymphs fed on horses (Equus ferus caballus) in the Artemisa municipality (22° 48′ 49″ N 82° 45′ 48″ W) of the Artemisa province and in the Nueva Gerona locality (21° 53′ 05″ N 82°48′ 04″ W) of the Isla de la Juventud special municipality; an engorged female tick fed on a sheep (Ovis orientalis aries), in the Jatibonico municipality (21° 56′ 47″ N 79° 10′ 03″ W) of the Sancti Spiritus province and fully engorged nymphs fed on a dog (Canis lupus familiaris) in the Ciénaga de Zapata municipality of the Matanzas province (22° 20′ 00″ N 81° 37′ 00″ W) (Figure 1). These tick samples were named Artemisa, Isla de la Juventud, Cienaga de Zapata and Jatibonico, respectively. The collected specimens were kept under controlled conditions (28°C and 75 ± 5% relative humidity) in the Animal Health Laboratory at the Center for Genetic Engineering and Biotechnology (CIGB). All fed collected nymphs were incubated until they reached the adult stage. These adults were used to perform morphological and molecular analyses. Meanwhile, the collected engorged female tick was incubated until oviposition. All immature stages (larvae and nymphs) coming from this egg mass were fed on rabbits (Oryctolagus cuniculus) as previously described by using craft feeding chambers glued to shaved flanks of the animal (Rodríguez-Mallon, 2016). Unfed adults obtained from that egg mass were used to perform morphological and molecular analyses. All procedures involving experimentation animals were carried out in accordance with the Guide for the Care and Use of Laboratory Animals (2011) and were approved by the Ethic Committee at the CIGB (# 0720).
2.2 Morphological analyses
Morphological characterization was carried out with 40 unfed adult specimens (20 female and 20 male ticks) selected randomly from each field sample. Color and ornamentation of the scutum were observed under stereoscope (Kyowa Optical, Model SDZ-8). The terminology used by Nava et al. (2014) was chosen in this study to describe scutal ornamentation. The specimens were photographed by using a digital camera (Power Shot A640, Canon,Journal Japan) coupled to the stereoscope Pre-proof. Main structures with taxonomic value were characterized by using a TESCAN MIRA-3 FE- Scanning Electron Microscope (SEM) operated at 5kV at the Center for Advanced Studies in Cuba. These structures were analyzed and measured by using the Digital Micrograph ™ program (Version 2.32.888.0). Measure averages of these structures from female and male ticks were compared by using a Student's
t test performed on Prism (version 6.0 for Windows; GraphPad Software). Before SEM, ticks were fixed during 20 min at 4°C in 3% of glutaraldehyde solution, washed three times with phosphate-buffered saline (PBS -135 mM NaCl, 8 mM Na2HPO4, 3 mM KCL, 1.5 mM KH2PO4, pH 7.2) and dipped in 1 % of osmium tetroxide (OsO4) during 20 min at 4°C. Subsequently, they were washed again three times with PBS and dehydrated in a bath series of increasing concentrations of ethanol from 50 % to 99 % during 10 min each, at 4°C. Afterward, they were dried in a Freezer Dryer (Model FD-10V) at -62 °C and 1.2 Pa during 18 h and coated with around 10 nm gold layer by using a Desk Sputter Coater DSR1 kit.
2.3 PCR amplifications
Individual genomic DNA was extracted from 5 unfed adults of each field sample selected randomly by using DNeasy Blood & Tissue Kit (Qiagen, Germany) following manufacturer´s instructions. PCR amplifications of 16S rRNA, ITS2 and COXI sequences were performed in a thermal cycler (MinicyclerTM, MJ Research, Inc., USA) by using System GoTaq® Green Master Mix (Promega, USA) and specific oligonucleotides and programs for each gene showed in the Table 1 (Black and Piesman, 1994; Folmer et al., 1994; McLain et al., 1995; Zahler et al., 1995). PCR products were purified by using QIAquick Gel Extraction kit (250) (Qiagen, Germany) and sequenced by Macrogen Advancing Through Genomics (Macrogen, South Korea).
2.4 Phylogenetic analyses
Sequence alignments and phylogenetic inferences were performed by using Clustalw (Thompson et al., 1997) and MEGA 7.0 (Kumar et al., 2016) software, respectively. Phylogenetic trees were constructed by using the “Maximum Likelihood (ML)” method, with 1000 simulations and based on the Tamura 3-parameter nucleotide substitution model (Tamura, 1992) for 16SrRNA and ITS2 sequences and the Tamura-Nei model for COXI sequences (Tamura and Nei, 1993). The GenBank accession numbers of the A. cajennense species sequencesJournal included in the analyses were: Pre-proof A. cajennense s.s. (16S- MH513253, MH513254, MH513255, MH513256, MH513257, MG194733, MG194734, MF353126; ITS2- JN866864, KU169881; COXI- MF363087); A. mixtum (16S- KX544819, KT820359, MF353117, MF353118, MF353120, MF353121, MF353122, MF353123, MF353124, MF353125; ITS2- JN866853, JN866885, KF527295, JN866886; COXI- KY595134, KY595135, KY595136,
KY595137.1, KY595138, KY595139, KT820364); A. sculptum (16S- KT238826, KT820361, KJ557134, MG460313, MG460314, MG460315, MG460316, KY652670, MK059459, MK059460, KT722808, KM519934; ITS2- JN866846, JN866843, JN866842, JN866835; COXI- KT820366, KY595140); A. interandinum (16S- KT820358; ITS2- JN866902, JN866900; COXI- KT820363); A. patinoi (16S- KP036466, KP036467; ITS2- JN866881, JN866882) and A. tonelliae (16S- KM507359, KM507360, KM507361, KM507362, ITS2- JN866895, JN866896, JN866897). Rhipicephalus sanguineus sensu lato (Nava et al., 2015) was used as outgroup (16S- KC203362, ITS2- AF271283; COXI- KX360336). These sequences were selected only if morphologic validations of the species were available according to the most recent species reevaluation of A. cajennense complex (Nava et al., 2014). The estimates of genetic distances among sequences were conducted by using the Tamura 3-parameter model (Tamura, 1992) for 16S and ITS2 genes and the Tamura-Nei model (Tamura and Nei, 1993) for COXI sequences. All these analyses were performed on Mega7 (Kumar et al., 2016).
3. Results
3.1 Morphological analyses
Specimens from the 4 Cuban field samples presented similar morphologic characteristics, therefore only a representative photograph is shown for each analyzed structure (Figure 2). The body of all specimens presented a round outline. Male ticks showed an ornate, smooth and shiny-looking scutum occupying the entire idiosome dorsal surface with brown spots delimited by light stripes (Figure 2 I-A). Cervical spots were large and elongated and antero- accessory spots appeared also large and well-differentiated. The branches of limiting spots were wide and posterior branches not end merged. The first, second and third lateral spots were fused but well differentiated and the last ones were horizontally oriented. The postero- accessory spots were very well defined and the postero-median spots were elongated and narrower in the basal region than the adjacent light regions. The marginal stripe was narrow and brownJournal (Figure 2 I-A). Cervical grooves appeared Pre-proof pronounced, short and orthographic coma shaped (Figure 2 II-A-C). The punctations were narrow and large, moderately distributed towards the scutum posterior end, and were more numerous and deeper towards the light stripes (Figure 2 II-A). Festoons were well delimited by a complete marginal groove until the level of coxae IV. After this point, marginal groove continued as a dotted
line that reached the eyes’ level (Figure 2 II-A). The eyes appeared simple and flattened (Figure 2 I). Eleven festoons longer than wide with few and small punctations were observed. The central festoon or parma was light brown without spots. The inner half of festoons was generally dark brown, but there was some thinner than others. White enameled stripes were also observed on festoons 3, 4, and 5 (Figure 2 I-A and II-A). The capitulum base was observed sub-rectangular with a slightly concave posterior margin and rounded cornua (Figure 2 II-C). Palpi were divided into four segments with setae. A small and blunt posteriorly projecting spur was observed ventrally on segment I. In the ventral hypostome, dental formula 3/3 in 6-7 rows and apex with fine and numerous denticles were observed (Figure 2 II-E-G). In the ventral view, coxae I presented 2 spurs with external longer than internal, coxae II–III were observed with short rounded spur protruding from ridge-like edge and coxae IV showed a long and straight internal spur that didn’t reach the level of anus. Trochanters appeared without spurs (Figure 2 II-E). Spiracular plates were comma- shaped with a caudal process as wide as the adjacent festoon and located posterior to the last pair of coxae (Figure 2 II-E-I). U-shaped genital aperture was located at level of coxae II (Figure 2 II-K). Meanwhile in female ticks, the scutum occupying around a third of the total body length was also ornate with elongated cervical spots without merging. Limiting spots merged with eye spots and the last ones with the accessory spots. Postero-medial area was characterized by a large clear posterior patch with brown spots that were small towards the back and larger towards the scutum central region. Punctuations were uniformly distributed being deeper towards the lateral ends including the scapulae (Figure 2 I-B). Abundant setae distributed in a scattered way were observed in the notum in which 3 narrow and shallow grooves were perceived. Median groove ended at parma and lateral grooves ended between festoons 2 and 3. (Figure 2 I-B). Deep cervical grooves were arranged obliquely outside to inside- oriented (Figure 2 II-B-C). Complete marginal groove delimiting all festoons was observed (Figure 2 II-B). The eyes were flattened (Figure 2 I-B). Eleven festoon longer than wide were also observed,Journal each one with two setae rows (FigurePre-proof 2 II-B). The capitulum base appeared sub-rectangular in its dorsal view with a slightly concave posterior margin and rounded cornua like in male ticks. Porous areas showed oval appearance and were diverging anteriorly (Figure 2 II-D). The palps had 4 segments with setae. In segment I, a small blunt spur posteriorly projected was observed ventrally like in male ticks. In the hypostome, a 3/3
dental formula in 7-8 rows and an apex with fines and numerous denticles were observed (Figure 2 II-H). Two spurs appeared on coxae I. The external ones were approximately twice as long as the internal ones. Coxae II–III appeared with ridge-like edge, coxae IV with a small rounded internal spur and trochanters with no spurs (Figure 2 II-F). Comma-shaped spiracular plates were observed with a small caudal process as wide as the adjacent festoon. These plates were located posterior to the last pair of coxae (Figure 2 II-F-J). The U-shaped genital aperture with 2 narrow lateral flaps was located between the coxae II and III (Figure 2 II-F-K). The morphometric characteristics of male and female ticks from the four tick Cuban samples were summarized on the Table 2. There were no statistically significant differences of the measured structures among populations. Therefore, morphometry showed in Table 2 represents the measure average of all studied specimens.
3.2 Phylogenetic analyses based on molecular markers
GenBank accession numbers for sequences generated in this study were assigned as follows: Artemisa population: 16S- MT462225, ITS2- MT462239 and COXI- MT502896; Isla de la Juventud population: 16S- MT462226, ITS2- MT462242 and COXI- MT502897; Cienaga de Zapata population: 16S- MT462228, ITS2- MT462240 and COXI- MT502899; Jatibonico population: 16S- MT462227, ITS2- MT462241 and COXI- MT502898. After removal of gaps and missing data were eliminated, the final dataset for phylogenetic analyses included 42 nucleotide sequences with 230 positions for 16S rRNA, 16 nucleotide sequences with 469 positions for COXI and 22 nucleotide sequences with 529 positions for ITS2. According to the structure of the obtained phylogenies, the Cuban tick populations were clustered in the A. mixtum clade together with tick populations from Colombia, Mexico, United States, Ecuador and Costa Rica with a reliability of 98%, 84% and 99% from the 16SrRNA, ITS2 and COXI sequence analyses, respectively (Figures 3, 4 and 5). The six species belonging to the A. cajennense complex were congruently identified as distinct clades phylogenetically well delimited in the phylogenies of all studied sequences. A common ancestor wasJournal also consistently identified for thePre-proof A. mixtum, A. sculptum, A. cajennense s.s and A. patinoi clades, however the evolutionary relationships among them were dependent of the analyzed sequence. Amblyomma mixtum and A. cajennense s.s. were sister clades according to the 16S and COXI sequence analyses but if the ITS2 sequence analysis is considered, A. mixtum and A. sculptum resulted sister clades. A summary of genetic distance
estimates among sequences employed in each analysis is presented in the Tables 3, 4 and 5. The intraspecific genetic distances between the sequences of Cuban A. mixtum populations and the sequences of other American A. mixtum strains from GenBank revealed differences ranging from 0 to 3% for 16S and from 0 to 4% for COXI meanwhile there was no polymorphism for ITS2 sequences. On the other hand, interspecific differences among the six species of the A. cajennense complex ranged from 7 to 20% for 16S, from 5 to 21% for
COXI and from 1 to 8% for ITS2 sequences.
4. Discussion
All morphological and morphometric characteristics observed in specimens from the 4 Cuban field populations were consistent with the previous description of species belonging to the Amblyomma cajennense complex (Nava et al., 2014). Despite morphologic similarities among these species, there are characters or combinations of them that allow one species to be distinguished from another (Rivera-Paez et al., 2016). The U-shaped genital aperture of female ticks from these samples allowed differentiation from the A. cajennense s.s., A. tonelliae and A. interandinum species which have V-shaped genital aperture (Nava et al., 2014). The A. patinoi species could be also discarded because even if it has also U-shaped genital aperture, short and bulging lateral flaps in genital aperture and oval-shaped body are observed instead of narrow lateral flaps and rounded body as were observed in female ticks of these samples (Nava et al., 2014). In addition, the combination of these characteristics in the genital aperture of Cuban samples with long and thick setae densely distributed in the posterior notum is typically attributed to A. mixtum (Aguilar-Dominguez et al., 2018; Nava et al., 2014; Rivera-Paez et al., 2016). According morphometry, Cuban tick specimens were slightly smaller than those A. mixtum from Nava et al. (2014). This result is agreed with the statement that tick size tends to be smaller near the equator than the tick size at higher latitudes (Speybroeck et al., 2004). In fact, Cuban R. sanguineus sensu lato ticks were found smaller than other R. sanguineus sensu lato ticks within tropical lineage (Sanches et al., 2016). Journal Pre-proof Phylogenetic analyses conducted with 16S rRNA, ITS2 and COXI sequences as molecular markers further confirmed that these Cuban tick populations belong to the A. mixtum species. These results are congruent with previous reports that had suggested the presence of A. mixtum in Cuba (Chitimia-Dobler et al., 2019; Nava et al., 2014; Noda et al., 2016). All
obtained phylogenies strongly supported the six genetically defined groups that constitute the A. cajennense complex previously described (Beati et al., 2013; Nava et al., 2014). Although phylogenetic reconstructions based on the mitochondrial genes were not topologically fully congruent with that based on the nuclear gene, all evolutionary histories were consistent with a common ancestor for the most recently evolved divergent lineages A cajennense s. s., A. mixtum, A. sculptum and A. patinoi. These results are analogous to other phylogenetic studies published after the reassessment of the taxonomic status of Amblyomma cajennense (Lado et al., 2018; Martins et al., 2016; Rivera-Paez et al., 2016). Phylogenies inferred using mitochondrial genes showed that A. mixtum and A. cajennense s.s. clustered as monophyletic sister clades. However, according to the evolutionary history based on nuclear gene ITS2, A. mixtum and A. sculptum were sister clades. These differences might be related to the different modes of inheritance shown by mitochondrial and nuclear genes (Beati et al., 2013). The ITS2 tree topology (Figure 4) identified the A. interandinum and A. tonelliae species as basal monophyletic clades which are a sister group of the ancestor lineage of the other four species. This tree topology is fully agreed with previous reports (Beati et al., 2013; Lado et al., 2018). Measures of sequence divergences showed that diversity within all clades was very low varying from 0 to 5%. The COXI gene was the most diverse reaching 5%. The ITS2 sequences were the most conserved with 0% of divergence within all clades. In summary, the results of the present study allowed clear identification of all specimens from the four Cuban populations as belonging to the A. mixtum species. This study constitutes the first molecular characterization that confirms the presence of A. mixtum in Cuba. Further tick sampling of this species complex from other regions in the country will be necessary in order to determine if A. cajennense s.s. is also present in the island. Ticks examined so far from Central America and the Caribbean including specimens in this study, have been identified as A. mixtum (Nava et al., 2014). However, there are hundreds of reports of A. cajennense s.l. in this region which will be necessary to re-examine in order to validate orJournal not, the presence of A. cajennense s.s.Pre-proof species. This issue has important implications for health since these ticks are vectors of important pathogens.
5. Acknowledgments: Authors thank Hector Córdova and Flora and Fauna group for their valuable collection of tick specimens in the Artemisa municipality. Authors thank also José
Luis Rodríguez and Provincial Direction of Animal Health in the Isla de la Juventud Special Municipality for their collaboration in tick sampling. This work was supported by the Center for Genetic Engineering and Biotechnology, Havana, Cuba and mobility was supported by CYTED Network INCOGARR 110RT0541. The authors are grateful for the support of the Sistema Nacional de Investigación de Panamá (SNI). 6. Author contributions: Conceptualization: PEEG, RLC and ARM; Data curation: PEEG, DAR and ARM; Formal analysis: PEEG, RLC and ARM; Funding acquisition: RLC, CG, ADG, MPE and ARM; Investigation: PEEG, YGM, DAR, YFA, YBS; Methodology: PEEG, RLC, YFA, YGA and ARM; Project administration: YGA, ADG, MPE and ARM; Supervision: PEEG and ARM; Writing original draft: PEEG, YGM, DAR and ARM; Writing - review & editing: PEEG, RLC and ARM. Acknowledgments: Authors thank Hector Córdova and Flora and Fauna group for their valuable collection of tick specimens in the Artemisa municipality. Authors thank also José Luis Rodríguez and Provincial Direction of Animal Health in the Isla de la Juventud Special Municipality for their collaboration in tick sampling. This work was supported by the Center for Genetic Engineering and Biotechnology, Havana, Cuba and mobility was supported by CYTED Network INCOGARR 110RT0541. The authors are grateful for the support of the Sistema Nacional de Investigación de Panamá (SNI). Author contributions: Conceptualization: PEEG, RLC and ARM; Data curation: PEEG, DAR and ARM; Formal analysis: PEEG, RLC and ARM; Funding acquisition: RLC, CG, ADG, MPE and ARM; Investigation: PEEG, YGM, DAR, YFA, YBS; Methodology: PEEG, RLC, YFA, YGA and ARM; Project administration: YGA, ADG, MPE and ARM; Supervision: PEEG and ARM; Writing original draft: PEEG, YGM, DAR and ARM; Writing - review & editing: PEEG, RLC and ARM.
7. References: 2011. GuideJournal for the Care and Use of Laboratory Animals: Pre-proof Eighth Edition. The National Academies Press. Aguilar-Dominguez, M., Romero-Salas, D., Sanchez-Montes, S., Barradas-Pina, F., Rosas-Saito, G., Cruz-Romero, A., Ibarra-Priego, N., Becker, I., Lohmeyer, K.H., Perez de Leon, A., 2018. Occurrence of Amblyomma mixtum on the water buffalo (Bubalus bubalis) in Mexico. Int J Parasitol Parasites Wildl 7, 405-408.
Barros-Battesti, D.M., Reyes Hernández, M., Famadas, K.M., Onofrio, V.C., Beati, L., Guglielmone, A.A., 2009. The ixodid ticks (Acari: Ixodidae) of Cuba. Syst Appl Acarol 14, 101-128 DOI: 110.11158/saa.11114.11152.11153. Beati, L., Nava, S., Burkman, E.J., Barros-Battesti, D.M., Labruna, M.B., Guglielmone, A.A., Caceres, A.G., Guzman-Cornejo, C.M., Leon, R., Durden, L.A., Faccini, J.L., 2013. Amblyomma cajennense (Fabricius, 1787) (Acari: Ixodidae), the Cayenne tick: phylogeography and evidence for allopatric speciation. BMC Evol Biol 13, 267. Black, W.C., Piesman, J., 1994. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc Natl Acad Sci U S A 91, 10034-10038. Bowman, A., Nuttall, P., 2008. Ticks: Biology, Disease and Control. Cambridge University Press. Chitimia-Dobler, L., Schaper, S., Mansfeld, P., Gonschorrek, J., Bröker, M., Nava, S., 2019. Detection of Amblyomma mixtum (Acari: Ixodidae) in Germany on a human traveler returning from Cuba. J Med Entomol, 1-3 doi: 10.1093/jme/tjz1225. Estrada-Peña, A., Tarragona, E.L., Vesco, U., Meneghi, D., Mastropaolo, M., Mangold, A.J., Guglielmone, A.A., Nava, S., 2014. Divergent environmental preferences and areas of sympatry of tick species in the Amblyomma cajennense complex (Ixodidae). Int J Parasitol 44, 1081-1089. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33, 1870-1874. Labruna, M.B., Mattar, S., Nava, S., Bermudez, S., Venzal, J.M., Dolz, G., Katia, A., Romero, L., De Sousa, R., Oteo, J.A., 2011a. Rickettsioses in Latin America, Caribbean, Spain and Portugal. Rev MVZ Córdoba 16, 2435-2457. Labruna, M.B., Soares, J.F., Martins, T.F., Soares, H.S., Cabrera, R.R., 2011b. Cross-mating experiments with geographically different populations of Amblyomma cajennense (Acari: Ixodidae). Exp Appl Acarol 54, 41-49. Lado, P., Nava, S., Mendoza-Uribe, L., Caceres, A.G., Delgado-de la Mora, J., Licona-Enriquez, J.D., Delgado-de la Mora, D., Labruna, M.B., Durden, L.A., Allerdice, M.E.J., Paddock, C.D., Szabo, M.P.J., Venzal, J.M., Guglielmone, A.A., Beati, L., 2018. The Amblyomma maculatum Koch, 1844 (Acari: Ixodidae) group of ticks: phenotypic plasticity or incipient speciation? Parasites & Vectors 11, 610. Martins, T.F., Barbieri, A.R., Costa, F.B., Terassini, F.A., Camargo, L.M., Peterka, C.R., de, C.P.R., Dias, R.A., Nunes, P.H., Marcili, A., Scofield, A., Campos, A.K., Horta, M.C., Guilloux, A.G., Benatti, H.R., Ramirez, D.G., Barros-Battesti, D.M., Labruna, M.B., 2016. Geographical distribution of Amblyomma cajennense (sensu lato) ticks (Parasitiformes: Ixodidae) in Brazil, with description of the nymph of A. cajennense (sensu stricto). Parasites & Vectors 9, 186. Mastropaolo, M., Nava, S., Guglielmone, A.A., Mangold, A.J., 2011. Biological differences between two allopatric populations of Amblyomma cajennense (Acari: Ixodidae) in Argentina. Exp Appl Acarol 53, 371-375. McLain, D.K., Wesson, D.M., Collins, F.H., Oliver, J.H., Jr., 1995. Evolution of the rDNA spacer, ITS 2, in the ticks Ixodes scapularis and I. pacificus (Acari: Ixodidae). Heredity 75 ( Pt 3), 303-319. Nava, S., Beati, L., Labruna, M.B., Caceres, A.G., Mangold, A.J., Guglielmone, A.A., 2014. ReassessmentJournal of the taxonomic status of AmblyommaPre-proof cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum Koch, 1844, and Amblyomma sculptum Berlese, 1888 (Ixodida: Ixodidae). Ticks Tick Borne Dis 5, 252-276. Nava, S., Estrada-Pena, A., Petney, T., Beati, L., Labruna, M.B., Szabo, M.P., Venzal, J.M., Mastropaolo, M., Mangold, A.J., Guglielmone, A.A., 2015. The taxonomic status of Rhipicephalus sanguineus (Latreille, 1806). Vet Parasitol 208, 2-8.
Noda, A.A., Rodriguez, I., Miranda, J., Contreras, V., Mattar, S., 2016. First molecular evidence of Coxiella burnetii infecting ticks in Cuba. Ticks Tick Borne Dis 7, 68-70. Perez-Vigueras, J. 1954. Lista de los Ixódidos de Cuba. In Circulares del Museo y Biblioteca de Zoología de La Habana, pp. 1389–1390. Rivera-Paez, F.A., Labruna, M.B., Martins, T.F., Sampieri, B.R., Camargo-Mathias, M.I., 2016. Amblyomma mixtum Koch, 1844 (Acari: Ixodidae): First record confirmation in Colombia using morphological and molecular analyses. Ticks Tick Borne Dis 7, 842-848. Rodríguez-Mallon, A., 2016. Developing Anti-tick Vaccines, In: Thomas, S. (Ed.) Vaccine Design: Methods and Protocols, Volume 2: Vaccines for Veterinary Diseases. Springer New York, New York, NY, pp. 243-259. Sanches, G.S., Evora, P.M., Mangold, A.J., Jittapalapong, S., Rodriguez-Mallon, A., Guzman, P.E., Bechara, G.H., Camargo-Mathias, M.I., 2016. Molecular, biological, and morphometric comparisons between different geographical populations of Rhipicephalus sanguineus sensu lato (Acari: Ixodidae). Vet Parasitol 215, 78-87. Speybroeck, N., Madder, M., Thulke, H.H., Mtambo, J., Tirry, L., Chaka, G., Marcotty, T., Berkvens, D., 2004. Variation in body size in the tick complex Rhipicephalusappendiculatus/Rhipicephalus zambeziensis. J. Vector Ecol. 29. Tamura, K., 1992. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Mol Biol Evol 9, 678-687. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10, 512-526. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876-4882. Venzal, J.M., Nava, S., 2011. El género Rickettsia como agente de zoonosis en el Cono Sur de Sudamérica. Rev. Med. Urug 27, 98-106. Zahler, M., Gothe, R., Rinder, H., 1995. Diagnostic DNA amplification from individual tick eggs, larvae and nymphs. Exp Appl Acarol 19, 731-736.
Journal Pre-proof
Figure Legends
Fig. 1. Map of the Republic of Cuba with its 15 provinces and the Isla de la Juventud special municipality represented. Arrows indicate the localities in which tick sampling took place. 1- Artemisa municipality in the Artemisa province (22° 48′ 49″ N 82° 45′ 48″ W); 2- Nueva Gerona locality in the Isla de la Juventud special municipality (21° 53′ 05″ N 82°48′ 04″ W); 3- Ciénaga de Zapata municipality in the Matanzas province (22° 20′ 00″ N 81° 37′ 00″ W) and 4- Jatibonico municipality in the Sancti Spiritus province (21° 56′ 47″ N 79° 10′ 03″ W).
Fig. 2. Morphologic characteristics found on Cuban tick samples of Amblyomma cajennense species complex. (I) Stereoscopy dorsal views of a male tick (A) and a female tick (B). (II) Scanning Electron Microscopy (SEM) images of male and female ticks (A) Male tick dorsal view; (B) Female tick dorsal view; (C) Capitulum dorsal view of a male tick; (D) Capitulum dorsal view of a female tick; (E) Male tick ventral view; (F) Female tick ventral view; (G) Capitulum ventral view of a male tick (H) Capitulum ventral view of a female tick; (I) Spiracular plate of a male tick; (J) Spiracular plate of a female tick; (K) Genital aperture of a male tick; (L) Genital aperture of a female tick. (sc) scutum, (se) setae, (fe) festoons, (h) hypostome, (pal) palp, (pa) porose area, (ag) genital aperture, (cs) coxal spur, (sp) Spiracular plate. Journal Pre-proof
Fig. 3. Molecular phylogenetic analysis inferred from the 16S rRNA gene sequences by using the Maximum Likelihood method based on the Tamura 3-parameter model (Tamura, 1992) in Mega 7 software (Kumar et al., 2016). The tree with the highest log likelihood (-915.17) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number ofJournal substitutions per site. The bar represents Pre-proof 0.05 substitutions per site. The analysis involved 42 nucleotide sequences. There were a total of 230 positions in the final dataset. Sequence data generated in the present study appear highlighted in red. Species names are preceded by GenBank accession numbers and followed by the location where they were collected. Each species of the Amblyomma cajennense complex as published by Nava et al.
(2014) appears with a different color. Rhipicephalus sanguineus sensu lato was used as outgroup.
Journal Pre-proof
Fig. 4. Molecular phylogenetic analysis inferred from nuclear ITS2 sequences analysis by using the Maximum Likelihood method based on the Tamura 3-parameter model (Tamura, 1992) in Mega 7 software (Kumar et al., 2016). The tree with the highest log likelihood (- 2597.26) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The bar represents 0.10 substitutions per site. The analysis involved 22 nucleotide sequences. There were a total of 529 positions in the final dataset. Sequence data generated in the present study appear highlighted in red. Species names are preceded by GenBank accession numbers and followed by the location where they were collected. Each species of the Amblyomma cajennense complex as publish by Nava et al. (2014) is indicated in different colors. Rhipicephalus sanguineus sensu lato was used as outgroup.
Journal Pre-proof Fig. 5. Molecular phylogenetic analysis inferred from the COXI gene sequences by using the Maximum Likelihood method based on the Tamura-Nei model (Tamura and Nei, 1993) in Mega 7 software (Kumar et al., 2016). The tree with the highest log likelihood (-1740.08) is shown. The percentage of trees in which the associated taxa clustered together is shown
next to the branches. The tree is drawn to scale with branch lengths measured in the number of substitutions per site. The bar represents 0.05 substitutions per site. The analysis involved 16 nucleotide sequences. There were a total of 469 positions in the final dataset. Sequence data generated in the present study appear highlighted in red. Species names are preceded by GenBank accession numbers and followed by the location where they were collected. Each species of the Amblyomma cajennense complex as published by Nava et al. (2014) appears with a different color. Rhipicephalus sanguineus sensu lato was used as outgroup.
Journal Pre-proof
Table 1. Primers and conditions used for PCR amplifications
Gen Name Primer Sequence (5’—3’) PCR Conditions Reference
Am16S-(F) CTGCTCAATGATTTTTTAAATTGCTG 950C-2min, 30 x [950C- (Black and Piesman, 16S rRNA 30s, 470C-30s, 720C- 1994) (316pb) GCTGTTATCCCTAGAGTATTTTTAC Am16S-(R) 30s], 720C-5min
CCATCGATGTGAATTGCAGGACA 950C-5min, 36 x [950C- (Zahler et al., 1995) ITS2 AmITS2-(F) 45s, 570C-1min, 720C- (McLain et al., 1995) (1132pb) AmITS2-(R) GTGAATTCTATGCTTAAATTCAGGGGGT 1min 30s], 720C-5min
AmCOXI-(F) 950C 2min, 35 x [950C- (Folmer et al., 1994) COI GGTCAACAAATCATAAAGATATTGG 1min, 400C-1min, 720C- (708pb) AmCOXI-(R) AAACTTCAGGGTGACCAAAAAATCA 1min 30s], 720C-5min
Journal Pre-proof
Table 2. Morphometric data of Cuban field samples of Amblyomma cajennense s.l. ticks Structure# Males (n=40)& Females (n=40)&
Total dorsal length1 3.26 ± 0.27* (2.7-3.5) 3.69 ± 0.48* (2.9-4.3)
Idiosome dorsal length2 2.55 ± 0.19* (2.1-2.7) 2.85 ± 0.34* (2.3-3.25)
Idiosome dorsal width3 2.38 ± 0.16 (2.1-2.64) 2.57 ± 0.34 (2.01-3.09)
Capitulum dorsal length4 0.79 ± 0.08** (0.66-0.88) 0.92 ± 0.10** (0.79-1.13)
Capitulum basis length 0.19 ± 0.07 (0.14-0.25) 0.23 ± 0.05 (0.19-0.25)
Capitulum basis width 0.67 ± 0.04 (0.59-0.72) 0.70 ± 0.05 (0.6-0.79)
Palpi total ventral length 0.69 ± 0.10** (0.64-0.73) 0.89 ± 0.09** (0.8-1) Segment I [length] x [width] [0.16 ± 0.03] x [0.13 ± 0.01] [0.19 ± 0.03] x [0.13 ± 0.02] Segment II [length] x [width] [0.39 ± 0.08]* x [0.18 ± 0.03] [0.49 ± 0.05]* x [0.16 ± 0.03] Segment III [length] x [width] [0.13 ± 0.02]* x [0.21 ± 0.01] [0.23 ± 0.03]* x [0.20 ± 0.03]
Hypostome ventral length 0.58 ± 0.26** (0.41-0.7) 0.80 ± 0.08** (0.74-0.95)
Hypostome ventral width 0.20 ± 0.02 (0.18-0.24) 0.22 ± 0.02 (0.19-0.25)
Spiracular plate length 0.74 ± 0.30* (0.62-0.93) 0.66 ± 0.05* (0.59-0.74)
Spiracular plate width 0.31 ± 0.13* (0.26-0.38) 0.43 ± 0.07* (0.34-0.52)
Tarsi I length 0.43 ± 0.08* (0.34-0.53) 0.50 ± 0.21*(0.31-0.76)
Tarsi I width 0.17 ± 0.03 (0.14-0.22) 0.21 ± 0.08 (0.13-0.28)
Scutum length - 1.61 ± 0.23 (1.2-1.88)
Scutum width - 2.02 ± 0.28 (1.5-2.4)
Distance from eye to the - 1.55 ± 0.25 (1.13-1.95) midpoint of posterior margin Porose area length - 0.11 ± 0.01 (0.09-0.13)
Distance between porose - 0.19 ± 0.02 (0.16-0.22) areas & Each measure represents an average from 40 measurements from 10 female and 10 male ticks of each sample because of the 20 specimens selected by sex from each sample, half were analyzed dorsally and the other half ventrally. # All measures are expressed in mm ± standard deviations. Asterisks mean statistical significant differences (Student's t- test, * P<0.05; ** P<0.01). Numbers in parenthesis represent the minimum and maximum measure values found for each studied structure. 1 From the apex of gnatosoma to the midpoint of posterior body margin. 2 From the scutum apex to the midpoint of posterior body margin. 3 Measured of the greatest idiosome amplitude in dorsal view. 4 From the palp apices to the cornua apices in dorsal view. Journal Pre-proof
Table 3. Summary of distance ranges (in percentage) among 16S rRNA sequences of the Amblyomma cajennense complex species based on the Tamura- 3 parameter model. The A. mixtum sequences from Cuban ticks collected in this work are included.
Tick species As Am Am Cuba Ac At Ai Ap A. sculptum (As) 0-1 A. mixtum (Am) 9-10 0-2 A. mixtum (Cuba) 9-10 0-3 0-2 A. cajennense s.s. (Ac) 13 8-9 7-8 0 A. tonelliae (At) 12-13 16-17 16-17 19-20 0-1 A. interandinum (Ai) 14-15 16-19 16-18 18-19 16 0 A. patinoi (Ap) 10-11 9 8-9 10-11 17-18 17 0 Rhipicephalus sanguineus 29-30 31-33 30-32 30-31 29-30 26 32
Journal Pre-proof
Table 4. Summary of distance ranges (in percentage) among ITS2 sequences of the Amblyomma cajennense complex species based on the Tamura- 3 parameter model. The A. mixtum sequences from Cuban ticks collected in this work are included.
Tick species As Am Am Cuba Ac At Ai Ap A. sculptum (As) 0 A. mixtum (Am) 1 0 A. mixtum (Cuba) 1 0 0 A. cajennense s.s. (Ac) 3 3 3 0 A. tonelliae (At) 6 6 6 8 0 A. interandinum (Ai) 6 6-7 6-7 8 4 0 A. patinoi (Ap) 3 3 3 1 8 8 Rhipicephalus sanguineus 78 76-77 76-77 79 75 76 79
Journal Pre-proof
Table 5. Summary of distance ranges (in percentage) among COXI sequences of the Amblyomma cajennense complex species based on the Tamura- Nei parameter model. The A. mixtum sequences from Cuban ticks collected in this work are included.
Tick species As Am Am Cuba Ac Ai A. sculptum (As) 5 A. mixtum (Am) 16-18 0-4 A. mixtum (Cuba) 17-18 0-4 0-1 A. cajennense s.s. (Ac) 17 16-17 17 A. interandinum (Ai) 18-19 18-21 18 20 Rhipicephalus sanguineus 24 23-25 25 25 23
Journal Pre-proof