Functions of S100A8 in Lung Cancer

Functions of S100A8 in lung cancer

Sze Wing (Alice) Wong

A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy

School of Medical Sciences

Faculty of Medicine

April 2018

I II III Table of contents

List of figures ...... X List of tables ...... XIII Abbreviations ...... XV Acknowledgments ...... XVIII Published work from this thesis ...... XXI Abstract ...... XXII

Chapter 1: Introduction ...... 1 1.1 The S100 protein family ...... 1 1.1.1 The discovery and nomenclature of S100s ...... 1 1.1.2 The gene structure, phylogeny and evolution of S100s ...... 2 1.1.3 The protein structure, oligomerisation and metal ion binding of S100s ...... 4 1.1.4 Post-translational modifications of S100 proteins ...... 9 1.1.4.1 S-nitrosylation and S-glutathionylation ...... 9 1.1.4.2 Oxidation and sulphonamide cross-linking ...... 11 1.1.4.3 Phosphorylation ...... 12 1.1.5 Expression profile of S100 proteins ...... 14 1.1.5.1 Mediators regulating S100A8 and S100A9 expression ...... 16 1.1.6 Intracellular functions of S100 proteins ...... 23 1.1.7 Putative receptors and extracellular functions of S100 proteins ...... 26 1.1.7.1 Proinflammatory functions of S100A8, S100A9 and S100A8/A9 ...... 31 1.1.7.2 Anti-inflammatory functions of S100A8, S100A9 and S100A8/A9 ...... 35

1.2 Development and treatment of lung cancer ...... 38 1.2.1 Development of lung cancer ...... 38 1.2.1.1 Mutations that drive neoplastic transformation in lung cancer ...... 39 1.2.1.2 Lung cancer progression ...... 40 1.2.1.3 The redox microenvironment in lung cancer ...... 46 1.2.1.4 The immune microenvironment in lung cancer ...... 52 1.2.1.5 Metastasis ...... 63 1.2.1.6 Prognosis and treatments for lung cancer ...... 66

1.3 S100 proteins in cancer ...... 69 1.3.1 The clinical implications of S100 protein expression in human cancers ...... 69 1.3.2 Putative S100A8 and S100A9 receptors in lung cancer ...... 75 1.3.3 Functions of S100 proteins in vitro ...... 79 1.3.3.1 Effects of S100 proteins on cancer cell proliferation ...... 79 1.3.3.2 Regulation of cancer cell invasion and migration by S100 proteins ...... 83 1.3.4 Functions of S100 proteins in vivo ...... 86 1.3.4.1 Pro-tumourigenic functions of S100 proteins ...... 86 1.3.4.1.1 Primary tumour growth and survival ...... 86 1.3.4.1.2 Angiogenesis, invasion and metastasis ...... 88 1.3.4.1.3 Regulation of myeloid cell function and immunosuppression ...... 89 1.3.4.2 Anti-tumourigenic functions of S100 proteins ...... 94

1.4 Rationale, hypothesis and aims of this project ...... 97 1.4.1 Rationale of this project ...... 97 1.4.2 Hypothesis ...... 98 1.4.3 Aims ...... 99

Chapter 2: Materials and methods ...... 101 2.1 Preparation and purification of recombinant S100A8 protein ...... 101 2.1.1 Culture of E. coli cells expressing the recombinant murine S100A8 fusion protein ...... 103 2.1.2 Purification of the murine S100A8 protein ...... 103 2.1.3 Quality control and storage of the recombinant murine S100A8 protein ...... 106

2.2 Cell culture and murine orthotopic lung cancer model ...... 109 2.2.1 Cell culture ...... 109 2.2.2 Cell line authentication and mycoplasma testing ...... 109 2.2.3 Cryopreservation of cells ...... 111 2.2.4 Procedures to minimise endotoxin contamination ...... 111 2.2.5 Rationale for choosing the LLC orthotopic mouse model ...... 112 2.2.6 Animal housing, ethics and the LLC mouse model ...... 113

2.3 Assessing effects of S100A8 on murine orthotopic lung cancer ...... 114 2.3.1 Treatment protocols ...... 114 2.3.2 Sample collection ...... 117 2.3.2.1 Differential count of leukocytes in bronchoalveolar lavage fluids ...... 119 2.3.2.2 Processing of lungs and liver for H&E histology staining ...... 119 2.3.2.3 Measurement of tumour sizes ...... 120

2.4 Assessment of gene expression in lung lysates ...... 121 2.4.1 Sample preparation, RNA extraction and single-stranded cDNA synthesis ...... 121 2.4.2 Real-time quantitative polymerase chain reactions (RT-qPCR) ...... 122

2.5 Protein detection ...... 123 2.5.1 Enzyme-linked immunosorbent assay (ELISA) ...... 123 2.5.2 Extraction of lung homogenates ...... 124 2.5.3 Gel electrophoresis, protein transfer and Western blotting ...... 124 2.5.4 Enzyme activity assays ...... 126 2.5.5 Griess assay ...... 127 2.5.6 Immunohistochemistry and analysis ...... 128

2.6 MDSC and lymphocyte quantification in lungs, spleen, lymph nodes and bone marrow ...... 130 2.6.1 Preparation of single cell suspensions ...... 130 2.6.2 Analysis of MDSC and lymphocyte populations by flow cytometry ...... 131

Chapter 3: Effects of S100A8 on lung cancer progression ...... 135 3.1 Introduction ...... 135 3.2 Experimental procedures ...... 138 3.2.1 CellTitre-Blue viability assay ...... 138 3.2.2 Effects of S100A8 on expression of tumour-modulating genes in LLC cells .... 139 3.2.3 Validating methods to measure tumour size in mouse lungs ...... 139 3.2.4 Effects of S100A8 inhalation on tumour growth and progression ...... 140 3.2.5 Data analysis ...... 142 3.3 Results ...... 143

3.3.1 Effects of S100A8 on lung cancer cells in vitro ...... 143 3.3.1.1 S100A8 had little effect on tumour-modulating gene expression ...... 143 3.3.1.2 S100A8 did not alter lung cancer cell viability ...... 145 3.3.2 Effects of S100A8 on lung tumour growth in vivo ...... 148 3.3.2.1 Establishment of total lung mass and relative tumour area as parameters to measure tumour size in orthotopic LLC mouse model...... 148 3.3.2.2 Co-treatment of S100A8 with LLC reduced lung tumour growth ...... 151 3.3.2.3 S100A8 inhalation after LLC implantation prolonged mouse survival ... 155 3.3.3 Effects of S100A8 on metastasis and angiogenesis ...... 158 3.3.3.1 Sustained S100A8 treatment prevented the extra-pulmonary tumour growth in the liver found with intermittent treatment ...... 158 3.3.3.2 S100A8 did not affect vessel numbers in mouse lungs ...... 161 3.3.4 Effects of S100A8 on leukocyte influx ...... 163 3.3.4.1 S100A8 reduced neutrophil influx into BALF ...... 163 3.3.4.2 S100A8 reduced total and PMN-MDSC numbers in lungs and spleen from LLC-bearing mice...... 171 3.3.4.3 S100A8 increased total, CD4, NK-T and double negative T cell numbers in lungs and spleen from LLC-bearing mice ...... 174

Chapter 4: Potential mechanisms whereby S100A8 mediated protective effects in lung cancer ...... 180 4.1 Introduction ...... 180 4.2 Experimental procedures ...... 182 4.2.1 Effects of S100A8 on genes that influence tumour growth, hypoxia and angiogenesis, metastasis, redox and immune modulation ...... 182 4.2.2 Validation of changes in gene expression at the protein levels ...... 182 4.2.3 Data analysis ...... 183 4.3 Results ...... 184 4.3.1 Effects S100A8 on immune surveillance in the lung microenvironment ...... 184 4.3.1.1 S100A8 suppressed mediators that promote MDSC expansion, activation and recruitment ...... 184 4.3.1.2 S100A8 altered genes and/or proteins that modulate immune surveillance ...... 196

VII

4.3.2 S100A8 suppressed nitrite production but had little effect on arginase expression or activity ...... 209 4.3.3 S100A8 induced GAPDH mRNA expression but did not alter its activity ...... 215 4.3.4 S100A8 selectively induced antioxidant activity ...... 218 4.3.4.1 S100A8 induced SOD activity in LLC-bearing mice but had little effect on catalase expression or activity ...... 218 4.3.4.2 S100A8 induced TXNR and PRDX activities in LLC-bearing mice ...... 226 4.3.4.3 S100A8 had little effect on mRNA expression or activity of other key antioxidants ...... 239 4.3.5 S100A8 had little effect on genes that influence tumour growth but altered expression of genes that may influence metastasis ...... 242 4.3.6 S100A8 suppressed genes that influence hypoxia and angiogenesis ...... 250

Chapter 5: General discussion and conclusions ...... 254 5.1 S100A8+ and S100A9+ myeloid cells were positively associated with survival 255 5.2 S100A8 created an anti-inflammatory lung microenvironment ...... 257 5.3 S100A8 created a lung microenvironment with reduced oxidative stress ...... 261 5.4 S100A8 moderated L-arginine availability in lungs ...... 265 5.5 S100A8 created an unfavourable microenvironment for MDSC function ..... 267 5.6 S100A8 may enhance immune function ...... 271 5.7 S100A8 delayed but did not inhibit tumour growth ...... 274 5.8 S100A8 may reduce the metastatic and angiogenic potentials of growing LLC tumours ...... 276 5.9 Implications of this study...... 281 5.10 Limitations and future directions ...... 284 5.11 Conclusions ...... 288

VIII

References ...... 292

Appendices ...... 345 Appendix I: Common chemicals and reagents ...... 345 Appendix II: Mouse primer sequences ...... 347 Appendix III: Effects of S100A8 inhalation on expression of antioxidative genes in healthy lungs over a time course (unpublished data from our laboratory) ...... 350 Appendix IV: S100A8 expression was not detected in LLC tumour cells ...... 351 Appendix V: Genes that influence tumour growth, metastasis, hypoxia and angiogenesis and immune function (not presented in main results) ...... 352

List of figures

Figure 1.1.2: The generic S100 gene structure ...... 3 Figure 1.1.3.1: The general structure of S100 proteins ...... 4 Figure 1.1.3.2: Calcium-dependent S100 dimer interaction with target proteins ...... 6 Figure 1.1.7: The putative receptors for S100 proteins ...... 27 Figure 1.2.1: The three stages of lung carcinogenesis ...... 39 Figure 1.2.1.2.1: The ten hallmarks of cancer ...... 42 Figure 1.2.1.2.2: Adapted responses to hypoxia ...... 43 Figure 1.2.1.2.3: L-arginine metabolic pathways ...... 45 Figure 1.2.1.3: The peroxiredoxin, thioredoxin and thioredoxin reductase antioxidant system .. 49 Figure 1.2.1.4: Summary of the interplay of MDSC, anti-tumour T cells and other immunoinhibitory leukocytes in lung cancer ...... 61 Figure 1.2.1.5: Schematic illustration of cancer metastasis ...... 64

Figure 2.1: Schematic description of the recombinant murine S100A8 purification method ... 102 Figure 2.1.2: Elution of recombinant murine S100A8 from C8-RP-HPLC by RP-HPLC ...... 105 Figure 2.1.3.1: A representative C4-HPLC chromatogram of recombinant murine S100A8 .... 106 Figure 2.1.3.2: A representative mass spectrum of the murine S100A8 preparation...... 107 Figure 2.1.3.3: Verification of monomeric S100A8 in the purified preparation ...... 108 Figure 2.3.1.1: Treatment protocols to determine effects of S100A8 co-treatment on lung microenvironment and/or tumour progression ...... 115 Figure 2.3.1.2: Treatment protocols to determine effects of S100A8 on lung microenvironment and/or tumour progression mimicking clinical settings ...... 116 Figure 2.3.2: Illustrations of sample collection ...... 118 Figure 2.6.2.1: Analysis of MDSC populations in lungs and other lymphoid-associated organs ...... 133 Figure 2.6.2.2: Analysis of T cell populations in lungs and spleen ...... 134

Figure 3.3.1.2.1: S100A8 did not alter viabilities of LLC, H460 and A549 cells in vitro ...... 145 Figure 3.3.1.2.2: Proliferation of LLC cells was dependent on L-arginine ...... 147 Figure 3.3.2.1.1: Microscopic morphology in lungs over a time course...... 149 Figure 3.3.2.1.2: Establishment of total lung mass and relative tumour area as parameters for measuring tumour size ...... 150 Figure 3.3.2.2.1: Co-treatment of S100A8 with LLC reduced endpoint lung tumour growth .. 152 Figure 3.3.2.2.2: Co-treatment of S100A8 with LLC reduced lung tumour growth at midpoint of survival ...... 153 X

Figure 3.3.2.2.3: Co-treatment of S100A8 with LLC reduced tumour size at midpoint of survival ...... 154 Figure 3.3.2.3.1: S100A8 prolonged survival in mice implanted with LLC ...... 155 Figure 3.3.2.3.2: S100A8-treated mice developed extensive lung tumours at endpoint of survival ...... 156 Figure 3.3.2.3.3: Microscopic morphology in lungs at midpoint of survival ...... 157 Figure 3.3.3.1: Sustained S100A8 treatment prevented the extra-pulmonary tumour growth in the liver found with intermittent treatment ...... 159 Figure 3.3.3.2: S100A8 did not affect vessel numbers in lungs ...... 162 Figure 3.3.4.1.1: S100A8 did not alter numbers of neutrophil-like myeloid cells in lungs with early tumours ...... 166 Figure 3.3.4.1.2: S100A8 suppressed tumour-infiltrating S100A8+ neutrophil-like myeloid cells at midpoint of survival ...... 168 Figure 3.3.4.1.3: S100A8 suppressed tumour-infiltrating S100A9+ neutrophil-like myeloid cells at midpoint of survival ...... 169 Figure 3.3.4.1.4: S100A8 reduced the numbers of tumour-infiltrating myeloid cells in lungs at midpoint of survival ...... 170 Figure 3.3.4.2: S100A8 reduced the percentages of total and PMN-MDSC in lungs and spleen of LLC-bearing mice ...... 172

Figure 4.3.1.1.1: S100A8 suppressed cytokines that promote MDSC expansion and activation in LLC-bearing mice ...... 187 Figure 4.3.1.1.2: S100A8 had little effect on HIF-1α protein expression ...... 192 Figure 4.3.1.1.3: S100A8 suppressed IL-12β to sub-control levels ...... 194 Figure 4.3.1.2.1: S100A8 increased IL-10 secretion from lungs of mice with early tumours . 197 Figure 4.3.1.2.2: S100A8 did not alter IL-10 expression in lungs at midpoint of survival ...... 199 Figure 4.3.1.2.3: S100A8 induced IL-10 in lungs from LLC-bearing mice at endpoint of survival ...... 201 Figure 4.3.1.2.4: S100A8 increased IL-10 secretion at endpoint of survival ...... 202 Figure 4.3.1.2.5: Early ICAM-1 expression in lungs ...... 204 Figure 4.3.1.2.6: S100A8 induced ICAM-1 in lungs from LLC-bearing mice at midpoint of survival ...... 206 Figure 4.3.2.1: Effects of S100A8 and/or LLC on nitrite production ...... 210 Figure 4.3.2.2: Effects of S100A8 and/or LLC on arginase protein ...... 211 Figure 4.3.2.3: Effects of S100A8 and/or LLC on arginase activity ...... 212 Figure 4.3.3.1: GAPDH protein was similar in all treatment groups ...... 216

Figure 4.3.3.2: GAPDH activities were similar in all treatment groups ...... 217 Figure 4.3.4.1.1: S100A8 increased SOD activities to baseline in mice with midpoint lung tumours ...... 219 Figure 4.3.4.1.2: S100A8 had little early effect on catalase protein expression in lungs ...... 222 Figure 4.3.4.1.3: S100A8 had little effect on catalase protein expression in lungs at midpoint of survival ...... 223 Figure 4.3.4.1.4: S100A8 had little effect on catalase protein expression ...... 224 Figure 4.3.4.1.5: S100A8 had little effect on catalase activity ...... 225 Figure 4.3.4.2.1: S100A8 increased TXNR activities to baseline but did not alter TXN protein in mice with early tumours ...... 227 Figure 4.3.4.2.2: Expression of TXN in lungs at midpoint of survival ...... 229 Figure 4.3.4.2.3: S100A8 increased TXNR activities to baselines in mice with midpoint tumours ...... 230 Figure 4.3.4.2.4: Early expression of PRDX in lungs ...... 232 Figure 4.3.4.2.5: Early expression of PRDX1 in lung lysates ...... 233 Figure 4.3.4.2.6: PRDX activities at early point of survival ...... 234 Figure 4.3.4.2.7: Expression of PRDX1 in lungs at midpoint of survival ...... 235 Figure 4.3.4.2.8: PRDX1 expression was reduced in lungs from LLC-bearing mice at midpoint of survival ...... 236 Figure 4.3.4.2.9: S100A8 induced PRDX activity in lungs from LLC-bearing mice at midpoint of survival ...... 237 Figure 4.3.4.2.10: S100A8 reduced oxidised PRDX protein expression in LLC-bearing mice 238 Figure 4.3.4.3: S100A8 had little effect on GPX activity ...... 240

Figure 5.11.1: Diagrammatic summary of early anti-tumourigenic effects of S100A8 on the lung microenvironment ...... 288 Figure 5.11.2: Diagrammatic summary of the anti-tumourigenic effects of S100A8 at mid- and endpoints of survival ...... 290

XII

List of tables

Table 1.1.5 Expression of S100A8 and S100A9 in various cell types or body fluids ...... 15 Table 1.1.5.1.1: Inducers, enhancers and suppressors of murine S100A8 and S100A9 expression ...... 21 Table 1.1.5.1.2: Inducers, enhancers and suppressors of human S100A8 and S100A9 expression ...... 22 Table 1.2.1.3: Antioxidants involved in lung cancer ...... 47 Table 1.2.1.4.1 Major mediators of MDSC expansion, activation and recruitment ...... 58 Table 1.2.1.4.2: General functions of key anti-tumour T cells ...... 62 Table 1.3.1.1: The clinico-pathological associations of S100 protein overexpression in common human cancers ...... 73 Table 1.3.1.2: The clinico-pathological associations of S100 protein underexpression in common human cancers ...... 74 Table 1.3.3.1: Effects of S100A8, S100A9 and S100A8/A9 on cancer cell viability in vitro .... 82 Table 1.3.3.2: Effects of S100A8, S100A9 and S100A8/A9 on cancer cell invasion and migration in vitro ...... 85 Table 1.3.4.1: Reported pro-tumourigenic functions of S100A8 and S100A9 proteins in vivo .. 92 Table 1.3.4.2: Reported anti-tumourigenic functions of S100 proteins in vivo ...... 96

Table 2.2.2: Authentication of LLC cell line by short tandem repeat profiling ...... 110

Table 3.3.1.1: Effects of S100A8 on tumour-modulating genes in LLC cells ...... 144 Table 3.3.4.1.1: Total leukocyte numbers and percentages of leukocyte populations in BALF ...... 164 Table 3.3.4.1.2: Expression of S100A8 and S100A9 mRNA in lungs ...... 165 Table 3.3.4.3: S100A8 increased the percentages of total, CD4, NK-T and DNT cells in lungs and spleen of LLC-bearing mice ...... 178

Table 4.3.1.1.1: S100A8 suppressed mediators that promote MDSC expansion and activation ...... 185 Table 4.3.1.1.2: S100A8 suppressed mediators that promote MDSC recruitment ...... 193 Table 4.3.1.2.1: S100A8 and/or LLC markedly induced IL-10 mRNA expression at midpoint of survival ...... 196 Table 4.3.1.2.2: S100A8 and/or LLC markedly induced ICAM-1 mRNA expression at midpoint of survival ...... 203

XIII

Table 4.3.1.2.3: Effects of S100A8 and/or LLC on genes that influence immune surveillance ...... 208 Table 4.3.2: Effects of S100A8 and/or LLC on genes that influence L-arginine availability .. 214 Table 4.3.3: GAPDH mRNA was markedly upregulated in all treatment groups on day 3 ..... 215 Table 4.3.4: S100A8 selectively upregulated antioxidative gene expression ...... 220 Table 4.3.4.3: S100A8 had little effect on GPX, GSTM, Mt or HO-1 mRNA expression ...... 241 Table 4.3.5.1: Effects of S100A8 and/or LLC on genes that influence tumour growth ...... 245 Table 4.3.5.2: S100A8 induced pro-metastatic genes in early tumours ...... 249 Table 4.3.6: S100A8 suppressed genes that promote hypoxia and angiogenesis ...... 252

XIV

Abbreviations

Ala alanine ALK anaplastic lymphoma kinase Arg1 arginase 1 mRNA ATP adenosine triphosphate

β2M β-2-microglobulin BALF bronchoalveolar lavage fluid(s) BCA assay bicinchoninic acid assay 2,3-BDM 2,3-butanedione monoxime BSA bovine serum albumin

Ca2+ calcium ion [Ca2+] calcium levels CAT cationic amino acid transporter CHP cumene hydroperoxide COPD chronic obstructive pulmonary disease COX2 cyclooxygenase 2 CTLA-4 cytotoxic T lymphocyte-associated antigen-4 Cu2+ copper (II) ion Cys cysteine

DMEM Dulbecco's modified eagle medium DMSO dimethyl sulfoxide DNA deoxyribonucleic acid DNT double negative T cell(s) DPBS Dulbecco’s phosphate-buffered saline DTT dithiothreitol

ECM extracellular matrix E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid EGFR epidermal growth factor receptor ELISA enzyme-linked immunosorbent assay

FBS fetal bovine serum Fe2+ iron (II) ion

GAPDH glyceraldehyde 3-phosphate dehydrogenase G-CSF granulocyte colony-stimulating factor GM-CSF granulocyte-macrophage-colony-stimulating factor GPX glutathione peroxidase GST glutathione-S-transferase GSTM glutathione S-transferase mu

H2O2 hydrogen peroxide HBSS Hanks' balanced salt solution H&E haematoxylin and eosin HIF hypoxia-inducible factor(s) His histidine HO-1 heme oxygenase-1 HOCl hypochlorite

HPRT hypoxanthine-guanine phosphoribosyltransferase

ICAM-1 intercellular adhesion molecule-1 IDO indoleamine 2,3-dioxygenase IFN interferon Ig immunoglobulin IL interleukin iNOS inducible nitric oxide synthase IRF interferon regulatory factors

LLC Lewis lung carcinoma LPS lipopolysaccharide LYVE-1 lymphatic endothelium-specific hyaluronan receptor

MAPK mitogen-activated protein kinase M-CSF macrophage colony-stimulating factor MCAM melanoma cell adhesion molecule MDSC myeloid-derived suppressor cell(s) (PMN; M) (neutrophilic; monocytic) Met methionine MMP matrix metalloproteinase(s) Mn2+ manganese ion Mt metallothionein(s)

NADH nicotinamide adenosine dinucleotide (reduced) NADPH nicotinamide adenine dinucleotide phosphate (reduced) Ni2+ nickel (II) ion NK natural killer NO nitric oxide NOS nitric oxide synthase NOX NADPH oxidase NSCLC non-small-cell lung cancer

PBMC peripheral blood mononuclear cell(s) PBS phosphate-buffered saline PD-L1 programmed death-ligand 1 PEG polyethyleneglycol PGE2 prostaglandin E2 PMA phorbol myristate acetate PRDX peroxiredoxin PRDX-SO3 oxidised peroxiredoxin PWM pokeweed mitogen

RAGE receptor for advanced glycation end products RNA ribonucleic acid RNS reactive nitrogen species ROS reactive oxygen species RP-HPLC reverse phase high-performance liquid chromatography RT room temperature RT-qPCR real-time quantitative polymerase chain reactions

SAA serum amyloid A SCLC small-cell lung cancer XVI

SDS-PAGE sodium dodecyl sulphate-polyacrylamide gel electrophoresis SEM standard error of the mean SNO S-nitrosylated SOD superoxide dismutase SSG S-glutathionylated STAT signal transducer and activator of transcription

TGF transforming growth factor TLR Toll-like receptor(s) TNF tumour necrosis factor Treg regulatory T cell(s) TTBS 1 x TBS with 0.1% Tween 20 TXN thioredoxin TXNIP TXN-interacting protein TXNR thioredoxin reductase

UV ultraviolet

VEGF vascular endothelial growth factor

Zn2+ zinc ion

XVII

Acknowledgments

Words cannot express how grateful I am to everyone who has offered guidance, support and encouragement throughout my studies. To my supervisors, Associate Professor

Nicodemus Tedla, Dr Joshua McCarroll, Emeritus Professor Carolyn Geczy and Dr

Kenneth Hsu, I give my thanks for the opportunity to undertake this challenging project.

I am grateful for your taking time out of your busy schedules to provide feedback on experimental design and techniques, data interpretation and academic writing.

To Nicodemus, thank you for your guidance in optimising flow cytometry protocols, educating me on the clinical and immunological aspects of lung cancer, and also for your help when I was struggling to express my ideas clearly and logically.

To Josh, thank you for coaching me in the orthotopic injection of tumour cells into mice, and educating me on the current trends in cancer treatments. Thank you for your clarification when I had difficulties understanding some core concepts of tumour biology.

To Carolyn, I am in awe of your knowledge in multiple disciplines, which led me to this exciting project. I cannot thank you enough for your continuous guidance and support in all aspects of the project. Thank you for clarifying my understanding of S100 proteins and inflammation, and offering me a bridging stipend when my Research Training

Program Scholarship expired in the last months of completing my PhD.

To Ken, thank you for your help with troubleshooting when I was learning and mastering new experimental techniques. I am especially grateful for your guidance in molecular biology, particularly the design and analysis of the RT-qPCR array.

Completing this project would not have been possible without any of you. It has been my privilege to learn from you and develop as a researcher.

XVIII

I also thank Dr Yuka Hiroshima for providing her preliminary data to assist with the understanding of this project; Dr Yuen Ming Chung for sparing her human S100A8 preparations for some experiments; Dr Ling Zhong for her help with mass spectrometry;

Dr Fei Shang for her help with processing histology samples; Drs Sharron Chow and

Annie Luo for their tips on optimising immunohistochemistry protocols; Dr Poornima

Rajeaskariah for her tips to improve Western blots; Dr Paul Witting, from the University of Sydney, for his help with optimising some enzyme activity assays; and Ms Penelope

Ralph for her help in proofreading my thesis. I am grateful to all of the members of the

Mechanisms of Disease and Translational Research Group, especially Dr Naomi

Kawaguchi, Dr Mijeong Park and Dr Hongyan An. It is a pleasure to work with you, and

I thank you all for your support, encouragement and accompany.

I am blessed to have family members who have done doctoral studies and can totally relate to the challenges that I faced. Thank you for keeping me sane during the process.

To my beloved dad, mum and sister, coming to Australia for higher education is one of the most difficult decisions I have ever made. As I left home for the very first time, I must have made you worry a lot about me. Indeed, this long journey has never been smooth and easy. Thank you for your unconditional and unlimited love and support throughout these seemingly endless years of study. Without that, I would not have got to where I am now.

To the memory of my two deceased grandfathers, my gratitude for always believing that

I can succeed. Although you are no longer with me, your belief in me is what made me continue this demanding journey. How I wish you could witness the completion of this thesis and celebrate this achievement with me.

XIX

To my paternal grandfather, you were always that cheerful person who brought joy to others. Thank you for brightening up my day with your smile and words of encouragement. It saddens me that you passed away halfway through my PhD. I will always remember your optimistic attitude to life, which has inspired me to stay positive at times of difficulties.

To my maternal grandfather, thank you for giving me an unforgettable childhood. Sadly,

I lost you to lung cancer before I could ever repay your unwavering love and support.

Even though treatments had not been effective, and you endured ongoing pain and suffering, you stayed strong and never gave up throughout those agonising 8 years. It is your battle with lung cancer that makes me passionate about potential cures. This is why

I would pursue a career in biomedical research.

To my friends, my gratitude for always being there for me, especially when I was struggling with this thesis. Although some of you are living overseas, you always work out a convenient time for us to talk to each other. Thank you for being good listeners when I was frustrated. Your emotional support has been invaluable.

I hope I have made all of you proud. Thank you!

Published work from this thesis Publication(s)

Hiroshima, Y., Hsu, K., Tedla, N., Wong, S.W., Chow, S., Kawaguchi, N., Geczy, C.L. (2017) S100A8/A9 and S100A9 reduce acute lung injury. Immunology and Cell Biology 95:461-472.

Wong, S.W., Hsu, K., McCarroll, J., Geczy, C.L., Tedla, N. S100A8 creates a favourable immune microenvironment in lung cancer (manuscript in preparation).

Abstracts (as presenting authors)

Wong, S.W., Hsu, K., McCarroll, J., Geczy, C.L., Tedla, N. S100A8 inhalation prolongs survival in murine orthotopic lung cancer. Poster presented at the 24th Biennial Congress of the European Association for Cancer Research, Manchester, the United Kingdom (July 2016).

Wong, S.W., Hsu, K., McCarroll, J., Geczy, C.L., Tedla, N. S100A8 inhalation protects against immunosuppression in murine orthotopic lung cancer. Poster and 2 minute fast- forward oral presentation at the 25th Australian Society for Medical Research (ASMR) NSW Scientific Meeting, Sydney, Australia (June 2017).

XXI

Abstract

Accumulating evidence supports a link between inflammation and cancer, in which inflammation contributes to the development of cancer, in part, by immunosuppression.

Sustained chronic inflammation promotes the activation of myeloid-derived suppressor cells (MDSC) to reduce T cell surveillance by producing toxic reactive oxygen species and nitric oxide, and depleting the essential nutrient, L-arginine. MDSC accumulation facilitates tumour progression and is associated with reduced survival in lung cancer.

Inflammation and increased oxidative stress in the lung microenvironment are, thus, key contributors to the pathogenesis of lung cancer. S100A8 and S100A9 are neutrophil- expressing proteins that are also expressed in MDSC and human lung cancer tissues.

Elucidating the functions of S100A8 and S100A9 in lung cancer may help unravel their contributions to this disease. Effects of S100A8, in particular, are the focus of this thesis, because it has more potent anti-inflammatory and antioxidative effects than S100A9 or the S100A8/A9 complex. Inhalation of S100A8 into murine lungs attenuates asthma and endotoxin-mediated acute lung injury in part by oxidant scavenging, induction of IL-10 in airway epithelial cells and suppression of chemokines and cytokines that are important for neutrophil infiltration, and mast cell activation. Together, these findings suggest that

S100A8 inhalation may have anti-tumourigenic functions and improve outcomes in lung cancer.

Remarkably, repeated S100A8 inhalation prolonged survival by up to 40% in mice implanted with orthotopic lung cancer (from 19±1 to 27±1 days). Tumour-bearing mice treated with S100A8 harvested at earlier time points were compared with vehicle-treated controls to identify potential changes in the lung microenvironment. At midpoint of survival, S100A8 significantly suppressed a number of different cytokines that promote XXII

MDSC expansion, activation and recruitment, including IL-1β, IL-4, IL-6, IL-12β and

IFN-γ. Concomitantly, S100A8 reduced total and PMN-MDSC numbers, but increased

CD4 and NK-T cell numbers in lungs and spleen. Notably, S100A8 suppressed nitrite production in lungs from tumour-bearing mice, although it had little effect on arginase expression or activity. Importantly, S100A8 enhanced activities of key antioxidant enzymes, including superoxide dismutase, thioredoxin reductase and peroxiredoxin in tumour-bearing lungs, possibly by preventing their inactivation by oxidation. S100A8 also markedly induced ICAM-1 expression in alveolar epithelial cells, which may facilitate the adhesion of NK-T cells to alveolar epithelium and mediate tumour cell lysis.

At early point of survival, S100A8 upregulated thioredoxin reductase activity and increased IL-10 secretion from tumour-bearing lungs, although IL-10 expression in airway epithelial cells was not evident until endpoint of survival. Collectively, results suggest that S100A8 created a favourable microenvironment for effector T cell recruitment and function.

Interestingly, a single or three intermittent S100A8 treatment(s) promoted extra- pulmonary tumour growth in the liver at endpoint of survival, but continuous S100A8 treatment occurring on every third day did not produce liver tumours, suggesting that

S100A8 has dual roles in metastasis. Although the exact mechanism is not fully elucidated, these data indicate that S100A8 may have created a microenvironment unfavourable for lung tumour progression but facilitated extra-pulmonary tumour growth in the liver, whereas continuous S100A8 treatment may delay tumour progression at a systemic level, suggesting that the concentrations of S100A8 in the lung microenvironment are critical for not only delaying lung tumour growth, but also its metastatic potential. XXIII

S100A8 did not inhibit, but delayed the growth of established lung tumours, indicating that it would not represent an effective curative treatment for lung cancer. However,

S100A8 may represent a new immunotherapeutic option to restore anti-tumour immunity and prolong survival when combined with other treatments. In particular, S100A8 may act as an MDSC and oxidant-depleting agent, and its inhalation, along with other immunotherapies may increase its anti-tumour efficacy. This thesis presented highly novel data demonstrating the protective effects of S100A8 inhalation against the progression of orthotopic murine lung cancer, and identified redox and immune modulation as important potential underlying mechanisms, which may improve the clinical outcomes of lung cancer.

XXIV

Chapter 1: Introduction 1.1 The S100 protein family 1.1.1 The discovery and nomenclature of S100s

S100 proteins (~10 kDa in molecular weight) [1] form the largest subgroup of calcium- binding proteins with at least 25 members (S100A1–S100A18, trichohyalin, filaggrin, repetin, S100P, S100Z, S100B and S100G) in humans [2, 3]. S100 proteins were named for their solubility in 100% ammonium sulphate at neutral pH [4]. S100A1 and S100B proteins were first identified in 1965 as a subcellular fraction from bovine brain [4]. S100 proteins were initially thought to be expressed only in the brain, but have since been found in many organs, tissues and/or cells (reviewed in [5, 6]). Numerous acronyms have denoted S100 proteins based on their sources and functions, but the nomenclature is now standardised based on chromosomal locations. ‘S100A’ genes are located on human chromosome 1q21 or mouse chromosome 3F2′; a single letter after S100, such as B, G, P or Z, designates S100 genes in other locations [2, 7, 8]. An “L” suffix indicates genes with high amino acid sequence homologies to a particular S100 [7, 9], as in the case of

S100A7 [10]. The standardised S100 nomenclature will be used throughout this thesis.

S100A8 and S100A9 are inflammation-associated proteins, identified in myeloid cells in

1983 [2, 11, 12]. They may form a complex, calprotectin, for some intracellular and extracellular functions [13]. For the purposes of this thesis, Sections 1.1.2 to 1.1.7 focus on the gene and protein structures of S100A8 and S100A9, and their intracellular and extracellular functions in inflammation.

1.1.2 The gene structure, phylogeny and evolution of S100s

S100 genes are likely to have evolved from a common ancestor, since most of them have conserved structures and chromosomal clusters [2, 14]. A protein similar to S100A1 was isolated from spiny dogfish, Squalus acanthias, the lowest organism in which S100 was found, suggesting that it may be the ancestor of the S100 family [2]. S100 proteins evolved with other members of the EF-hand superfamily in human and rodent genomes, including the calcium-binding protein subfamily, calmodulin/troponin, profilaggrin and trichohyalin [2]. Compared to other proteins from the EF-hand superfamily, S100 may have evolved fairly recently, being identified only in vertebrates [2]. Sequence alignment analysis classifies most human S100 proteins into four subgroups based on homologies, except for S100A7 and S100G [8]. S100A8 and S100A9 belong to the same subgroup which also includes S100A12 [8]. A recent analysis of some other mammals, including mouse, dog, cow, armadillo, elephant, opossum and platypus, revealed a similar phylogeny and indicated that S100A7 and S100G likely evolved from the common ancestor of S100A8, S100A9 and S100A12 [15].

The S100 gene structure is generally conserved between human and mouse [2]. S100A8 and S100A9, and many other S100 genes, adopt the generic structure, with three exons interspaced by two introns [16]. From 5′ to 3′ direction, Exon 1 encodes untranslated sequences and is terminated by Intron 1; it remains unclear why this interruption occurs.

The two EF-hands are encoded by Exons 2 and 3, and the hinge region by Intron 2 [17].

Exon 2 contains the ATG start codon encoding the N-terminal EF-hand region; Exon 3 encodes the C-terminal EF-hand region [17] (Figure 1.1.2). Some S100 proteins have exceptions to this gene structure (discussed in [14, 18-21]). Transcription of S100A8 and

S100A9 is mediated by transcription factors, including CCAAT/enhancer-binding

proteins [22] and STAT3 [23]. Other transcription factors, including AP-1, TATA box,

NF1, GC box, NF-κB, SPE, IRE, Ets box, Myb and E box, may also be involved because the promoter regions of S100A8 and S100A9 contain binding sites for these transcription factors [23-26].

Figure has been removed due to Copyright restrictions.

Figure 1.1.2: The generic S100 gene structure. S100A8 and S100A9 have the gene structure with three exons (boxes) and two introns (blue lines). Open boxes indicate exons with untranslated sequences; orange boxes indicate the coding region interspaced by introns. Arrows indicate the sites of translation initiation (figure adapted and modified from Heizmann et al. [14]).

1.1.3 The protein structure, oligomerisation and metal ion binding of S100s

S100 proteins have 79 - 114 amino acids [8] with up to 65% sequence homology [27], especially in the regions that encode the EF-hands [28], indicating that most have similar secondary structures [27]. S100 proteins have four hydrophobic alpha-helices from the N to C-terminals [28]. A non-canonical EF-hand, located between Helices I and II, has 14 basic amino acid residues, whereas a canonical EF-hand, located between Helices III and

IV, has 12 acidic amino acid residues [3, 29-32]. The EF-hands contain calcium-binding domains for Ca2+ binding. The hinge region is between Helices II and III [28] (Figure

1.1.3.1). The divergent hinge region and C-terminal domains may enhance the selectivity of S100 interactions with target proteins, allowing functional differences [30]. S100 proteins can also undergo structural modifications, including oligomerisation [6], metal ion binding [33] and post-translational modifications (Section 1.1.4).

Figure has been removed due to Copyright restrictions.

Figure 1.1.3.1: The general structure of S100 proteins. From the N to C-terminals, S100 proteins typically have four helices, with non-canonical EF-hand between Helix I and II, and canonical EF-hand between Helix III and IV. Ca2+ binding occurs at the EF-hands (indicated by arrows) (figure adapted and modified from Eckert et al. [28]).

S100 oligomerisation involves a two-fold axis of rotation and formation of non-covalent bonds, such that oligomers are assembled in antiparallel directions [6]. Except for S100G that remains monomeric [34], S100 proteins, including S100A8, can exist as antiparallel homodimers [6], heterodimers [35-43], or higher oligomers [44-49] within cells. Post- translational modifications stabilise some dimers and oligomers by covalent bonding. For example, the oxidised cysteine residues in S100A8 and S100A9 may form disulphide bridges to stabilise dimeric structures [50-52]. Stable non-covalent S100A8 homodimers

[53] and S100A8/A9 heterodimers [54-58], and S100A8 and S100A9 trimers (L1 antigen)

[54, 55] and tetramers [56-58], are also reported. Formation of some S100 oligomers is generally dependent on Ca2+, as seen with S100P and S100B tetramers [48, 49], indicating that Ca2+ may regulate oligomerisation and interactions of S100 proteins.

Ca2+ levels vary with cell types, stimuli and cellular compartments [59]; the level of intracellular [Ca2+] is 10000 times lower than that of extracellular [Ca2+] [60]. The EF- hands, which are involved in Ca2+ binding to S100 proteins (Figure 1.1.3.1), have different affinities for Ca2+, so different functions may be regulated. For example, Ca2+- sensing in an anaerobic and reducing intracellular environment involves high-affinity

Ca2+-binding with S100A3, whereas low-affinity binding regulates particular functions in aerobic, non-reducing extracellular environments [61]. The N-terminal EF-hand has

100 times lower Ca2+ affinity than the C-terminal one [62]; consequently, Ca2+ binding in S100 induces more significant conformational changes in the C-terminal domain. A shift in Helices III, IV and the hinge region [3] orientates Helix III to be more perpendicular to Helix IV [6], such that the hydrophobic cores within the hinge region and C-terminal become accessible to bind target proteins, possibly by pattern recognition

[6, 29, 63-67]. The exposure of the hydrophobic core upon Ca2+ binding forms clefts at

5 the C-terminal of S100 dimers to allow binding of two target proteins (Figure 1.1.3.2).

The C-terminal of S100A9 is homologous with the anti-thrombotic high molecular weight kininogen, which binds kaolin to inhibit fibrin formation in vitro [68]. The C-terminal domain of S100A9 also has anti-nociceptive activity, but to which target proteins it binds is unclear [69-73]. However, some 100 proteins do not bind Ca2+, or bind with low affinity.

For example, S100A10 has EF-hand mutations that do not allow Ca2+ binding, and which maintain conformations similar to a typical Ca2+-loaded S100 protein for interactions [74].

Similarly, a mutated N-terminal EF-hand in S100A7 impairs its Ca2+ binding capacity so that it binds only one Ca2+ [67]. S100B [75] and S100A1 [76] have low Ca2+ binding affinities and require bound target proteins to facilitate Ca2+ binding.

Figure has been removed due to Copyright restrictions.

Figure 1.1.3.2: Calcium-dependent S100 dimer interaction with target proteins. Upon Ca2+ binding, some S100 dimers expose clefts in the C-terminal region, thereby allowing target proteins to bind in the antiparallel direction (figure from Eckert et al. [28]).

Zn2+ is also reported to bind S100 proteins (reviewed in [33]), and may promote S100 protein interactions with their putative receptors, as seen with S100A7 and S100A15 ligation with the receptor for advanced glycation end products (RAGE) [77, 78]. Zn2+ binding occurs at the His or Cys-rich sites, likely within the N or C-terminal domains [79-

81]. Conserved His-rich sites for Zn2+ binding were identified in S100A6, S100A7,

S100A8/A9, S100A12, S100A15 and S100B (reviewed in [33]), and Cys-rich Zn2+- binding sites were reported in S100A2, S100A3 and S100A4 [82]. Zn2+ binding to S100 proteins may enhance [83] or inhibit Ca2+ binding [84]. Zn2+ binding occurs at a site

distinct from Ca2+ [85], and S100 proteins can still bind Ca2+ after all Zn2+-binding sites are occupied [62], because Zn2+ binding causes little conformational change within the

Ca2+-binding sites [33]. Human S100A8 homodimers bind two Zn2+ ions at two symmetrical His tetra-coordinate sites, which facilitate and stabilise formation of Ca2+- bound S100A8 tetramers by tightening the interface between homodimers [86]. Zn2+ sequestration by S100A8/A9 induces apoptosis of many cell lines by activating caspase-

3 and releasing pro-apoptotic proteins from mitochondria [87, 88], and inhibits some matrix metalloproteinase (MMP) activities [89]. S100A8/A9 also sequestrates Zn2+ to promote antifungal activity [90-94]. Notably, the Ca2+-binding loops of S100A9 contain putative Zn2+-binding sites, which are essential for S100A8/A9-mediated resistance against bacterial invasion in keratinocytes [95], suggesting that Zn2+ sequestration by

S100A8/A9 may be regulated by Ca2+.

S100A8/A9 sequesters Zn2+ and Mn2+ to deplete these essential nutrients, thereby reducing microbial growth [96]. In vivo, Zn2+ and Mn2+ chelation by S100A8/A9 secreted from neutrophils may have an antimicrobial role against induced corneal infection [97].

The two His motifs in the C-terminal of S100A9 promote high Mn2+ binding affinity to the S100A8/A9 complex [96, 98]. Mn2+ binding to S100A8/A9 is more efficient when the complex is Ca2+-loaded [96, 99], with little conformational change [33]. Recently,

S100A8/A9 was also shown to deplete the Fe2+ or Ni2+ ions required for microbial growth by binding them at the His-rich motifs, with affinity enhanced by Ca2+ [100, 101].

Cu2+ is a divalent metal ion that is displaced by Zn2+ [102] and shares similar chemical properties with Zn2+ [33], and X-ray crystal structures of Ca2+-loaded S100A12 show that

Cu2+ binding occurs at the His-rich Zn2+-binding sites with little change in conformation

[103]. While reports of Cu2+-binding activities in S100A4 [104], S100A5 [19], S100A12

[103], S100A13 [105] and S100B [102] have been made, their functional implications remain largely unclear. To date, there is a single report of Cu2+-bound S100A4 promoting inflammation in melanoma cells by enhancing RAGE ligation [104].

1.1.4 Post-translational modifications of S100 proteins

Post-translational modifications of S100A8 and S100A9 have functional implications.

They can be S-nitrosylated and/or S-glutathionylated (Section 1.1.4.1), or undergo oxidative modifications which can markedly alter function [106] (Section 1.1.4.2).

S100A8 and S100A9 may also be phosphorylated to modulate neutrophil signalling [107,

108] (Section 1.1.4.3).

1.1.4.1 S-nitrosylation and S-glutathionylation

S-nitrosylation involves the covalent coupling of a nitric oxide (NO) moiety onto a specific cysteine (Cys) thiol [25]. The physiological NO donor is often S- nitrosoglutathione, which facilitates NO transport and signalling, important in endothelial cell function and homeostasis, neuronal development, apoptosis and transcription [106].

Regulation of transcription and apoptosis by NO may promote defence against microbes and tumours [109]. Some metastasis-related proteins require S-nitrosylation to subsequently promote metastasis (Section 1.2.1.5).

S100A8 has a single Cys residue (Cys42 in human and Cys41 in mouse) that can undergo

S-nitrosylation; mutation to alanine (Ala) abrogates S-nitrosylation [110]. An alternative transcription start site at codon 5 results in four human S100A9 isoforms [111], including full-length and truncated S100A9 (S100A9*) (~25% of S100A9 in neutrophils); the single Cys3 residue is absent in the latter [22]. Conversely, murine S100A9 does not have this alternative transcription start site, and this Cys residue is not conserved [112]. The single Cys residue in S100A8, and human S100A9, can be S-nitrosylated by NO donors that may, in turn, shuttle NO to other proteins [110], although S100A9 may be less susceptible to S-nitrosylation [113]. S-nitrosylated S100A8 (S100A8-SNO) is present in 9 neutrophils, and increases following neutrophil activation. S100A8 is readily S- nitrosylated in the S100A8/A9 complex independent of Ca2+. On the other hand, S100A9

S-nitrosylation requires Ca2+ [110]. S100A8-SNO stabilises NO and shuttles the NO group to haemoglobin and may contribute to vascular homeostasis by suppressing mast cell activation, leukocyte adhesion and extravasation [110]. S100A9-SNO may coordinately regulate S-nitrosylation with S100A8 [114]. S100A8/A9 forms a complex with inducible nitric oxide synthase (iNOS) to regulate glyceraldehyde-3-phosphate dehydrogenase (GAPDH) S-nitrosylation in human peripheral blood mononuclear cells

(PBMC); S-nitrosylation of S100A9 at Cys3 promotes iNOS interaction with GAPDH, whereas S100A8 transports the NO group to GAPDH to promote selective GAPDH S- nitrosylation [114]. NO modifications in GAPDH can promote apoptosis by inducing cell death pathways [115, 116], suggesting that S-nitrosylation of S100A8 and S100A9 contributes to the regulation of cell growth.

S-glutathionylation involves the reversible coupling of a glutathione moiety onto Cys residues by disulphide bonds. Protein S-glutathionylation moderates cellular oxidative damage because glutathione is an antioxidant [117]. S100A8 and S100A9 can be S- glutathionylated (SSG), but only SSG-S100A9 was detected in activated neutrophils

[118]. SSG-S100A9 exhibits more surface hydrophobicity in the Zn2+-bound form and reduces heterodimerisation with S100A8, but does not affect S100A8/A9 binding to pro- inflammatory mediators, such as arachidonic acid [118]. While SSG-S100A9 binds less readily to endothelial cells than S100A9 and does not alter the induction of vascular factors, it increases neutrophil adhesion to fibronectin, an extracellular matrix (ECM) component [118]. However, adhesion is abrogated by S100A8 [118], suggesting that

S100A8 may regulate SSG-S100A9-mediated leukocyte adhesion to endothelial cells, and their transmigration, during inflammation.

1.1.4.2 Oxidation and sulphonamide cross-linking

Superoxide anions are produced by reduced nicotinamide adenine dinucleotide phosphate

(NADPH) in response to phagocyte activation and some stimuli during inflammation; they are converted into oxidants including hypochlorite (HOCl), generated by activated neutrophils and macrophages via myeloperoxidases, and hydrogen peroxide (H2O2) [13].

HOCl is a strong oxidant that can form dithiothreitol (DTT)-resistant complexes with disease mediators, such as low-density lipoprotein [119], and accumulation of these complexes are associated with cardiovascular and neurodegenerative diseases [120].

Similarly, H2O2 contributes to oxidative damage, such as in ultraviolet (UV)-irradiated human keratinocytes [121]. Oxidised forms of S100A8 and S100A9 are reported in activated neutrophils [51], sputum from asthma patients [122], lavage fluids harvested following murine acute lung injury [113], and various extracts from inflammatory disorders (reviewed in [106]), suggesting a role in oxidant-scavenging.

Cys42 (human) and Cys41 (mice) residues are located immediately before the functional hinge domains of S100A8, and their oxidation can promote structural changes that may directly impact on function [113]. S100A8 oxidation by HOCl forms stable and DTT- resistant sulphonamide-bonds, and some Lys residues in murine S100A8, particularly

Lys34/35, contribute to the formation of intramolecular or intermolecular sulphonamide bonds with Cys41 [50, 51]. Notably, HOCl-oxidised S100A8 is a major constituent in human asthmatic sputum [122], supporting its role in scavenging myeloperoxidase-

11 generated oxidants. Oxidation of human S100A9 by HOCl generates methionine sulphoxide and disulphide-linked complexes [123], and DTT-resistant oxidised S100A9 complexes have been identified in chronic inflammatory diseases [52, 124]. Unlike human S100A9, which has a single Cys residue, or is translated to a form with no Cys

[22, 111], native murine S100A9 has Cys residues at positions 79, 90 and 100; intramolecular disulphide bonds can form between Cys79 and Cys90, but no obvious disulphide or sulphonamide complexes were detected following HOCl oxidation [125].

2+ Mild oxidation of murine or human S100A8 by H2O2/Cu occurs [13], forming disulphide-bonded dimers [113]. These were identified in phorbol myristate acetate (PMA)-stimulated HL-60 monocytic cells [51] and lavage fluids from mice with acute lung injury [113], indicating a scavenging role. Similar modifications have, however, not been reported in S100A9. Collectively, these studies indicate that S100A9 has a weaker oxidant-scavenging capacity than S100A8.

1.1.4.3 Phosphorylation

Protein phosphorylation is a post-translational modification whereby protein kinases add a phosphate group to a protein by covalent modifications of serine, threonine or tyrosine residues. It has a vital role in signalling for most physiological functions (reviewed in

[126, 127]). Some S100 proteins are reported to negatively regulate protein phosphorylation by inhibiting substrate binding to kinases (details in [128-158]), but functional implications are largely unknown [6]. S100A8 and S100A9 in plasma membranes and/or cytosol of activated human neutrophils may undergo Ca2+-dependent phosphorylation [107]. Marked S100A9 phosphorylation occurs in the plasma membrane and cytosol of activated human neutrophils, and phosphorylated S100A9 translocates to the plasma membrane [107]. Ca2+ and protein kinase C-dependent S100A9

phosphorylation occurs at Thr113 in N-formyl-methionyl-leucyl-phenylalanine and ionomycin-stimulated human monocytes and neutrophils [107, 111] and may be mediated by p38 mitogen-activated protein kinase (MAPK) [159]. In contrast, the minimal S100A8 phosphorylation that occurs does so only in the cytosol of activated human neutrophils

[107], and reports pertaining to protein kinase C-dependent S100A8 phosphorylation are conflicting [16, 107]. Interestingly, S100A8 can reduce S100A9 phosphorylation in human neutrophils in a Ca2+-dependent manner [159]. In mice, it is unclear whether

S100A8 is phosphorylated in leukocytes, whereas S100A9 is not phosphorylated, likely due to the absence of the MAPK-dependent phosphorylation site that is present in human

S100A9 [112]. The functional implications of S100A8 and S100A9 phosphorylation are not clearly understood. Phosphorylated S100A9 is proposed to reduce S100A8/A9- mediated intracellular assembly of some cytoskeletal elements [107, 160] (Section 1.1.6), or to alter some signalling events in neutrophil chemotaxis [108].

1.1.5 Expression profile of S100 proteins

S100 proteins are expressed in a variety of healthy human organs, tissues and cells [2, 6,

8, 14, 19, 27, 43, 78, 161-197]. S100A8 and S100A9 are constitutively expressed in fetal liver; constitutive S100A8 expression in the kidneys (cortex and medulla) and constitutive S100A9 expression in the uterine cervix and lymph nodes are reported [174,

198-202]. S100A8 and S100A9 are constitutively and highly expressed in murine and human neutrophils [54, 203, 204], comprising approximately 45% of the cytosol [205], and in myeloid-derived suppressor cells (MDSC) [206-209]. They are also constitutively expressed in murine and human hypertrophic chondrocytes [201], osteoclasts [201], and some human epithelial cells, including those from the conjunctiva, tongue and oesophagus [174, 198, 200-202, 210]. Constitutive, but lower, S100A8 and S100A9 co- expression is also detected in human monocytes [203] and platelets [199]. S100A8 and

S100A9 are constitutively expressed in most human dendritic cells [211], except for some corneal dendritic cells [212] (Table 1.1.5).

S100A8 and/or S100A9 expression in some cell types is regulated by mediators, including monocytes/macrophages [204, 213-217], keratinocytes [28, 121, 218-220], fibroblasts [221], endothelial cells [52, 222], airway epithelial cells [223, 224].

Circulating levels of S100A8 and/or S100A9 can increase with inflammatory diseases

[202], and increase in serum and sputum [225] (Table 1.1.5). In addition, murine S100A8 and S100A9 proteins can be induced in embryonic stem cells by stable transfection [226].

Embryonic stem cells are a precursor of trophoblasts, although only transient S100A8 expression was found in murine trophoblasts [227] (Table 1.1.5). Notably, S100A8 is expressed in a small subset of trophoblast-like cells around the ectoplacental cone from

6.5 to 8.5 days post coitum in mouse embryos [227]. The high S100A8 gene but low

protein expression in these trophoblast-like cells suggests that S100A8 is secreted. After

7.5 days, S100A8 is exclusively expressed in cells of the ectoplacental cone and the regions surrounding it, but expression declined after 8.5 days. At 10.5 to 11 days post coitum, S100A8 is exclusively expressed in maternal vasculature-associated cells.

S100A9 is not co-expressed with S100A8 until after 11.5 days, at which time they are found in a subset of liver haematopoietic cells in normal embryos, and may regulate embryonic myeloid cell differentiation [227]. Mediators that regulate S100A8 and

S100A9 expression in cell types or body fluids selected to reflect the lung microenvironment are discussed in Section 1.1.5.1.

Table 1.1.5 Expression of S100A8 and S100A9 in various cell types or body fluids Cell type/body fluid Mouse Human Reference S100A8 S100A9 S100A8 S100A9 Neutrophils C C C C [54, 203, 204] Hypertrophic chondrocytes C C C C [201] Osteoclasts C C C C [201] Myeloid-derived suppressor cells C C C C [206-209] Peripheral blood mononuclear cells - - C C [203] Platelets - - C C [199] Dendritic cells - - C* C* [211, 212] Monocytes/ macrophages I Nil I I [204, 213-217] Keratinocytes I Nil I I [28, 121, 218- 220] Fibroblasts I Nil - - [221] Endothelial cells I I I I [52, 222] Embryonic stem cells I I - - [226] Airway epithelial cells I I - - [223, 224] Trophoblasts T Nil - - [227] Oral epithelial cells - - I I [228, 229] Microglia - - Nil I [124, 230] Sputum and serum - - I I [225] C = constitutive; I = inducible; T = transient; - = not determined; *except for some corneal dendritic cells. Table is adapted and modified from Goyette and Geczy [202].

1.1.5.1 Mediators regulating S100A8 and S100A9 expression

Mediators regulating S100A8 expression have been most extensively studied in murine monocytes and macrophages, but these do not generally induce S100A9 expression.

S100A8 mRNA expression is maximally induced in a murine macrophage cell line (RAW

264.7) by toll-like receptor (TLR)-3, 4 and 9 agonists, lipopolysaccharide (LPS), CpG (E. coli DNA) and Poly (I:C) (synthetic double-stranded DNA), after some 20 hours [23, 213,

214, 231]. S100A8 mRNA expression in RAW 264.7 cells is enhanced by LPS combined with dexamethasone [214] or IL-10 [215], or CpG combined with IL-10 and prostaglandin E2 (PGE2) [231], although IL-10 or PGE2 does not directly induce expression [214, 215, 231]. Importantly, LPS or Poly (I:C) does not induce the S100A8 mRNA in IL-10-/- macrophages from IL-10-/- mice, indicating IL-10-dependent induction

[23]. TGF-β and cAMP enhance S100A8 mRNA expression in RAW 264.7 cells by activation of the ERK1/2 and p38 MAPK pathways [214, 215, 231]. IL-4 and IL-13 suppress induction of S100A8 mRNA by LPS+IL-10 in RAW 264.7 [215], and cycloheximide, an agent that inhibits the transcription and translation of newly- synthesised proteins, completely suppresses induction by CpG [231]. This suggests that

S100A8 mRNA induction is dependent on new protein synthesis (including IL-10), which may represent a different level of transcriptional control that results in protein generated at different concentrations, and with functions unique to S100A8, because there is no formation of the S100A8/A9 complex.

S100A8 mRNA expression in elicited murine macrophages is induced and suppressed in a similar manner to that of RAW 264.7 cells [215, 216] (Table 1.1.5.1.1). Although TNF-

α or IFN-γ induces a low level of S100A8 mRNA expression in elicited macrophages

[215], LPS combined with IFN-γ induces iNOS mRNA, but the S100A8 gene is not 16

upregulated [110]. Unlike RAW 264.7 cells or elicited peritoneal macrophages, dexamethasone directly induces the S100A8 mRNA in a murine alveolar macrophage cell line (MH-S) and primary alveolar M2 macrophages after 24 hours, but LPS does not promote synergy [224]. These findings suggest that S100A8 may be a mediator of M2 macrophage function.

Some mediators that regulate S100A8 mRNA expression in human monocytic cell lines also affect S100A9 mRNA expression. The exception is the Monomac 6 cell line, in which

S100A8 mRNA expression is regulated in a similar manner to murine monocytes/macrophages (unpublished data from our laboratory). LPS and vitamin D3 induce S100A8 mRNA expression in Monomac 6 cells, and IL-10, PGE2 and cAMP enhance expression (unpublished data from our laboratory). In other monocytic cell lines

(HL-60, U937 and THP-1), vitamin D3 is found to induce both genes [232-235]. S100A8 gene is also induced by retinoic acid and dimethyl sulphoxide (DMSO) during granulocytic or monocytic differentiation of HL-60 cells [232, 233], and U937 cells [235], supporting the suggestion that it may be involved in myeloid cell differentiation [236].

S100A8 and S100A9 mRNA expression can also be induced by dexamethasone, norepinephrine and PMA, an agent that promotes macrophage differentiation in U937 cells [234, 235]. Conversely, PMA suppresses S100A8 and S100A9 mRNA expression in

HL-60 cells [232, 233], suggesting that mRNA expression is regulated in a cell line- dependent manner. TGF-β1 can induce or enhance S100A8 and S100A9 mRNA expression in monocytic THP-1 cells, and is an enhancer of both in HL-60 cells [232].

Interestingly, PMA is reported to suppress S100A8 and S100A9 mRNA expression in

THP-1 cells, as in HL-60 cells [232], but to induce them during late stages of terminal differentiation [233], suggesting that expression may be regulated at different stages of

17 differentiation. Interestingly, mediators that regulate S100A8 mRNA expression in murine macrophages are common to those affecting primary human monocytes and macrophages [23, 214, 231, 234, 237, 238] (Tables 1.1.5.1.1 and 1.1.5.1.2), whereas

S100A9 mRNA is only found to be induced by dexamethasone [214]. Monocytes stimulated with pokeweed mitogen (PWM), granulocyte-macrophage-colony-stimulating factor (GM-CSF), IL-1β and LPS secrete S100A8/A9 [237]. Similar to murine macrophages, IL-10 enhances S100A8 mRNA expression and IL-13 suppresses it in human monocytes [23]; S100A8/A9 secretion from monocytes is inhibited by IL-4+IL-

10 [237] (Table 1.1.5.1.2).

S100A8 and S100A9 are expressed at various levels in different human dendritic cell populations [211], except for corneal epithelium [212]; IL-10 induces both genes [211].

S100A8 and S100A9, produced by oral epithelial cells, protect against microbial infection in the oral cavity. In a human oral epithelial cell line (TR146), both genes are induced by anti-inflammatory Japanese herbal medicines (hangeshashinto and shosaikoto), in an IL-

1α-dependent manner [228, 229].

Mediators that regulate S100A8 mRNA expression have also been studied using keratinocytes; some also regulate S100A9 mRNA expression. Similar to elicited macrophages [215], LPS+IL-10+TNF-α induce S100A8 gene in a murine keratinocyte cell line (PAM212) [121]. S100A8 gene is also induced by UVA or H2O2 in PAM212 cells, and suppressed by antioxidants, superoxide dismutase (SOD), SOD-mimicking agent (Tempol) and catalase [121], suggesting that S100A8 is induced in response to oxidative damage. Similarly, S100A8 and S100A9 mRNA expression is induced by TPA, a phorbol ester that promotes oxidant production, and suppressed by dexamethasone in 18

PMK-R3 cells [239] and primary keratinocytes [121, 239]. In contrast, UVA induces only

S100A8 mRNA in primary keratinocytes [121] (Table 1.1.5.1.1). Collectively, these studies suggest that S100A8 and S100A9 may be induced in response to oxidative damage and may be anti-inflammatory. We later reported that both proteins have antioxidative and anti-inflammatory properties (Section 1.1.7.2).

Mediators that regulate S100A8 and S100A9 mRNA expression in human keratinocytes are generally different from those of mice (Table 1.1.5.1.2). Both genes are induced by

IL-1α in a keratinocyte cell line (HaCaT) [240], and synergistically by TNF-α, IL-1β and

IFN-γ [241], or methylprednisolone [242], in primary keratinocytes. However, IL-17 and dexamethasone induce only S100A8 mRNA expression in HaCaT cells, and IL-4 and IL-

13 suppress it [243]. A recent study shows that IL-17α combined with TNF-α induces

S100A8 promoter activity and mRNA expression in primary keratinocytes [244], suggesting that other inducers function in a similar manner.

The S100A8 mRNA expression can also be induced in murine fibroblasts and microvascular endothelial cells (Table 1.1.5.1.1). In a fibroblast cell line (NIH3T3) and primary fibroblasts, S100A8 mRNA expression is induced by LPS and enhanced by dexamethasone, or induced by FGF-2 and IL-1β and enhanced by heparin [214, 221].

Induction of S100A8 mRNA by FGF-2/heparin, but not IL-1β, is suppressed by TGF-β in

NIH3T3 cells [221], but suppressors for primary fibroblasts are undetermined. LPS and

IL-1β also induce S100A8 mRNA expression in microvascular endothelial cells (bEND3, sEND1 and tEND-1) [214, 215, 222], whereas IL-4 and IL-13 suppress it [215]. TNF-α

[222] or dexamethasone [214] synergises with LPS, but not IL-1β, to enhance S100A8

19 mRNA expression in confluent monolayers of microvascular endothelial cells, but TNF-

α does not directly induce S100A8 mRNA expression [222].

S100A8 and S100A9 are highly expressed in a variety of inflammatory diseases [106,

202, 245]. In particular, S100A8 and S100A9 are elevated in bronchoalveolar lavage fluids (BALF), sera and sputa from patients with cystic fibrosis [246-248], and BALF from patients with chronic obstructive pulmonary disease (COPD) [249] and interstitial lung diseases [250, 251]. Importantly, S100A8 and S100A9 are not constitutively expressed in cultured human bronchial epithelial cells (16HBE14o- and NHBE), but induced by LPS and secreted [252]. Similarly, LPS inhalation by healthy subjects elevates

S100A8 and S100A9 levels in sputum and serum [225]. These findings suggest that

S100A8 and S100A9 protein expression in lungs is induced. Notably, S100A8 is not constitutively expressed in naïve murine lungs in vivo, but its intranasal administration progressively induces its own expression in airway epithelial cells, alveolar macrophages and endothelial cells, which peaks at 12 hours [224]. Importantly, S100A8 induces IL-10 in airway epithelial cells in naïve mice after 12 hours, and LPS-treated mice after 4 hours

[224]. Taken together with the IL-10-dependent S100A8 induction in macrophages [23],

S100A8 and IL-10 may form a positive feedback loop to enhance anti-inflammatory responses. S100A9 is also not expressed in naïve murine lungs in vivo, but intranasal administration of S100A8/A9 induces expression in airway epithelial cells after 12 hours

[223]. Collectively, mediators that alter S100A8 expression in many cell types do not affect S100A9 expression (Tables 1.1.5.1.1 and 1.1.5.1.2), indicating distinct intracellular roles. In support of this, the different intracellular roles of S100A8, S100A9 and

S100A8/A9 are discussed in Section 1.1.6.

Table 1.1.5.1.1: Inducers, enhancers and suppressors of murine S100A8 and S100A9 expression Cell type S100 mRNA or Inducer Enhancer Suppressor Reference protein Cell lines S100A8 mRNA LPS IL-10, Dex, IL-4, IL-13 [213-215] Macrophages PGE2, cAMP, (RAW 264.7) TGF-β S100A8 mRNA CpG IL-10, PGE2 CHX [231] S100A8 mRNA Poly (I:C) LPS, IL-10 - [23] Alveolar S100A8 mRNA Dex - - [224] macrophages (MH-S) Fibroblasts S100A8 mRNA LPS Dex - [214] (NIH3T3) S100A8 mRNA FGF-2, IL-1β Heparin TGF-β [221] Microvascular S100A8 mRNA LPS Dex IL-4, IL-13 [214, 215] endothelial S100A8 mRNA LPS, IL-1β TNF-α - [222] cells (bEND3) Keratinocytes S100A8 mRNA UVA, H2O2, - SOD, [121] (PAM212) LPS+TNF-α+ Tempol, IL-10 catalase (PMK-R3) S100A8 and TPA - Dex [239] S100A9 mRNA Primary cells S100A8 mRNA LPS, TNF-α, IL-10, TGF-β, IL-4, IL-13, [215, 216] Elicited IFN-γ cAMP, Dex IFN-γ+LPS [110] macrophages Alternatively S100A8 mRNA Dex - - [224] activated M2 alveolar macrophages Fibroblasts S100A8 mRNA FGF-2, IL-1β Heparin - [221] S100A8 mRNA LPS Dex - [214] Keratinocytes S100A8 mRNA UVA - - [121] S100A8 and TPA - Dex [239] S100A9 mRNA In vivo S100A8 protein S100A8 - - [224] Airway S100A9 protein S100A8/A9 - - [223] epithelial cells Alveolar S100A8 protein S100A8 - - [224] macrophages and endothelial cells Dex = dexamethasone; CHX = cycloheximide; - = not determined. Table is adapted and modified from Lim et al. [106].

Table 1.1.5.1.2: Inducers, enhancers and suppressors of human S100A8 and S100A9 expression Cell type/body S100 mRNA or Inducer Enhancer Suppressor Reference fluid protein Cell lines S100A8 mRNA LPS, Vitamin D3 IL-10, - * Monocyte / PGE2, macrophages cAMP (Monomac 6) (HL-60) S100A8 and Retinoic acid, TGF-β1 PMA [232, 233] S100A9 mRNA Vitamin D3, DMSO (U937) S100A8 and Retinoic acid, - - [234, 235] S100A9 mRNA Vitamin D3, DMSO, Dex, Norepinephrine, PMA, (THP-1) S100A8 and TGF-β1, Vitamin D3, TGF-β1 PMA [232, 233] S100A9 mRNA PMA Keratinocytes S100A8 mRNA IL-17, Dex - IL-4, IL-13 [243] (HaCaT) S100A8 and IL-1α - - [240] S100A9 mRNA Oral epithelial S100A8 and IL-1α, - - [228, 229] cells S100A9 mRNA hangeshashinto, (TR146) shosaikoto Bronchial S100A8 and LPS - - [252] epithelial cells S100A9 (16HBE14o-) proteins Primary cells S100A8 mRNA LPS, IL-1β, TNF-α - - [234, 237] Monocytes S100A8 mRNA Dex, Poly (I:C) IL-10 - [23] S100A8 and PWM, GM-CSF, IL- - IL-4+IL-10 [237, 238] S100A9 1β, LPS proteins Macrophages S100A8 mRNA CpG, Dex - - [214, 231] S100A9 mRNA Dex - - [214] Dendritic cells S100A8 and IL-10 - - [211] S100A9 mRNA Keratinocytes S100A8 mRNA TNF-α, IL-1β, IFN-γ, - - [241, 244] IL-17α S100A9 mRNA TNF-α, IL-1β, IFN-γ - - [241] S100A8 and Methylprednisolone - - [242] S100A9 mRNA Normal human S100A8 and LPS - - [252] bronchial S100A9 epithelial cells proteins (NHBE) Body fluids S100A8 and LPS - - [225] Sputum and S100A9 serum proteins PMA = phorbol myristate acetate; Dex = dexamethasone; * = unpublished data from our laboratory; - = not determined. Table is adapted and modified from Lim et al. [106].

1.1.6: Intracellular functions of S100 proteins

The major intracellular functions of S100 proteins include regulation of Ca2+ homeostasis

(Section 1.1.3), protein phosphorylation (Section 1.1.4), enzyme activities, interactions with cytoskeletal components, cell growth and differentiation; others are reviewed in

[167]. Intrinsic enzymatic activities are not reported for any S100 proteins, but some stimulate or inhibit enzymes involved in energy metabolism, photosynthesis and inflammation [134, 253-262]. Some S100 proteins interact with cytoskeletal microtubules, filaments and myosin, which may directly or indirectly regulate cytoskeletal integrity and dynamics that influence cell invasion and migration [6]. Some regulate normal cell growth and differentiation [45, 46, 193, 263-270], and for this reason, they are implicated in cancer progression (Section 1.3).

Because S100A8 gene deletion in mice is embryonic lethal [227], progress in assessment of its functions has been slow. Some functional differences between S100A8, S100A9 and S100A8/A9 are discussed here. In periodontal ligament cells from patients with generalised aggressive periodontitis, S100A9 or S100A8/A9 promotes nuclear translocation of p65 and NF-ҡB activation to induce some pro-inflammatory genes, whereas S100A8 does not [271]. Interestingly, S100A8/A9, but neither S100A8 nor

S100A9, promotes apoptosis of these periodontal ligament cells [271]. It is worth considering that S100A8/A9 may promote apoptosis by mediating S-nitrosylation of some target proteins. For example, S100A8/A9 regulates the S-nitrosylation of GAPDH in PBMC [114], and S-nitrosylated GAPDH can promote apoptosis [115, 116].

Several studies suggest that S100A8 and/or S100A9 affect cell differentiation. For example, telomerase activity is suppressed by increased intracellular [Ca2+] during

HaCaT cell differentiation, and S100A8 is reported to inhibit telomerase activity in a

Ca2+-dependent manner to promote differentiation, whereas S100A9 abrogates these effects [272]. S100A8/A9 also promotes HaCaT cell differentiation, but by activating NF-

ҡB and inducing differentiation markers [273]. S100A8/A9 inhibits myeloid cell differentiation by inhibiting casein kinase I and II activities in the nucleus [236].

Importantly, S100A9 inhibits dendritic cell and macrophage differentiation in cultured embryonic stem cells and transgenic mice, but promotes the accumulation of immature myeloid cells (MDSC; discussed in Section 1.2.1.4), indicating a mechanism for immunosuppression in cancer [226]. S100A8/A9 inhibits differentiation of embryonic stem cells into dendritic cells to a lesser extent than S100A9, but promotes a more pronounced effect on MDSC accumulation [226]. S100A8 has a less marked inhibitory effect on dendritic cell differentiation than S100A9 or S100A8/A9, but it does not promote MDSC accumulation [226]. These studies suggest that S100A8, S100A9 and

S100A8/A9 have particular roles in differentiation, and effects may be cell type- dependent.

S100A8 is reported to scavenge oxidants, and may modulate intracellular redox balance

[245]. Formation of S100A8-SNO by S-nitrosylation (Section 1.1.4.1) is seen intracellularly in stimulated and activated neutrophils [106], indicating that it may regulate intracellular processes involving NO. We found that S100A8 scavenges intracellular reactive oxygen species (ROS) generated by activated neutrophils, and may stabilise NO in these cells to reduce oxidative damage [106]. S100A8 reduces intracellular Ca2+ and MAPK-dependent S100A9 phosphorylation to regulate transendothelial migration of neutrophils [159], in which phosphorylated S100A9 reduces

S100A8/A9-mediated microtubule polymerisation and F-actin cross-linking to promote

neutrophil migration [107, 160]. S100A9 also modulates Ca2+ signalling in neutrophils, in which Ca2+ is released from neutrophils via induction of inositol trisphosphate in response to inflammatory agonists [274]. S100A9 increases intracellular ROS production by neutrophils [275], but SSG-S100A9 can reduce ROS production in activated neutrophils [117, 118]. S100A8/A9 acts as an intracellular cytoplasmic sensor to sustain

Ca2+-dependent phagosomal ROS production following NADPH oxidase activation [276].

S100A8/A9 may activate NADPH oxidase in leukocytes by directing arachidonic acid to gp91phox [277, 278], or by interactions with p67phox and Rac-2 and conformational changes in cytochrome b558 [277, 279, 280]. S100A8/A9 is reported to promote FcγR-

1-mediated phagocytosis by depleting intracellular Ca2+ and increasing ROS production

[276].

Notably, the intracellular S100A8/A9 complex may influence transendothelial migration of neutrophils by promoting microtubule assembly [58, 160, 238, 281], tubulin polymerisation, F-actin cross-linking [58], and interaction with Type II intermediate filaments [282], which modulates Ca2+-dependent interactions with membranes during migration, chemotaxis, degranulation, phagocytosis and respiratory burst [282].

Interaction of S100A8/A9 with cytoskeletal elements also modulates wound healing, in which it interacts with keratin intermediate filaments [283], mobilises to a filamentous network and colocalises with microtubules to resist the invasion of Porphyromonas gingivalis, Listeria monocytogenes and Salmonella typhimurium; antimicrobial activity is abrogated when microtubules are polymerised [284]. Extracellular effects of S100A8 and/or S100A9 on leukocyte migration are discussed in Section 1.1.7.

1.1.7 Putative receptors and extracellular functions of S100 proteins

S100 proteins are detected in various body fluids [167], which suggests that they are secreted for various extracellular functions. S100A8 and S100A9 may be released following their induction [285-287] for particular functions in acute and chronic inflammatory diseases (reviewed in [106, 202, 245]). Because S100 proteins lack the N- terminal signal peptide typical of secretory proteins [167], it is unlikely that they are secreted through the classical endoplasmic reticulum pathway (reviewed in [288]). Some activators that promote S100 protein secretion have been identified (reviewed in [167]), but the underlying mechanisms are not well characterised. A recent study suggests that secretion of S100A8/A9 from human neutrophils, mediated by MSU crystals (the agent that causes gout), PMA (neutrophil activator), H2O2, nanoparticles, single-wall carbon nanotubes and microbe-derived molecules, requires ROS production and K+ efflux through ATP-sensitive K+ channels [289]. S100A8 and S100A9 secretion from other cell types may be mediated by a similar mechanism.

Secreted S100 proteins bind to their putative receptors to initiate their extracellular functions via signalling events; several S100 proteins, including S100A8 and S100A9, are reported to bind RAGE [167] (Figure 1.1.7). Although S100A8/A9 can co-localise with RAGE [290] to promote extracellular functions in some cell types [291, 292], other studies question these results [290, 293, 294]. It is proposed that S100A8/A9 may bind the carboxylated N-glycans on RAGE, rather than binding RAGE directly [295], to mediate heterogeneous functions. Other putative receptors for S100A8 and/or S100A9 include G-protein-coupled receptor, TLR-4 and scavenger receptor (Figure 1.1.7). LPS is an endotoxin that binds TLR-4, and when given systemically, induces potent systemic inflammation and increases endotoxin levels in the blood (endotoxemia) to provoke

sepsis, whereas local LPS administration promotes acute local injury [296]. S100A9 is also reported to bind TLR-2 to promote human leukaemia cell differentiation [297], leukocyte immunoglobulin-like receptor subfamily B member 1 (LILRB1 or CD85j) to promote NK cell killing of HIV [298], and EMMPRIN (CD147) [299] to promote melanoma metastasis [300]. Recently, EMMPRIN was reported to heterodimerise with neuroplastin-β, a putative S100A8 receptor. S100A8/A9 interaction with the neuroplastin-β/EMMPRIN heterodimer promotes keratinocyte proliferation [301], but the functional significance in melanoma is unclear. Melanoma cell adhesion molecule

(MCAM) is another receptor which S100A8/A9 binds in malignant melanoma cells; the interaction activates NF-ҡB and increases ROS production to facilitate melanoma progression [302]. S100A8/A9 also interacts with leukocyte activation receptor, CD69, to promote Treg differentiation in human PBMC [303].

Figure 1.1.7: The putative receptors for S100 proteins. S100 proteins are reported to bind these receptors for various extracellular functions (figure adapted and modified from Donato et al. [167]). 27

Extracellular functions of S100 proteins include regulation of neuronal cell survival, proliferation and activity [6, 46, 304-310], myocardiocyte survival [311, 312], and leukocyte chemotaxis [78, 313-315]; others are reviewed in [6, 167]. Although some studies suggest that S100A8 and S100A9 co-expression and complex formation are essential for their stability [316, 317], S100A8 has functions distinct from S100A9 and the S100A8/A9 complex, as underscored by studies with knockout mice, in which it is embryonic lethal [227]. In early embryogenesis, myeloid cell infiltration into the decidua and trophoblast proliferation or differentiation in the ectoplacental cone of S100A8-/- mice are unaffected, but maternal leukocytes infiltrate embryos extensively 8.5 days post coitum, and embryo resorption occurs at 9.5 days, indicating a non-redundant role for

S100A8 in modulating maternal-fetal tolerance in embryogenesis [227]. S100A9-/- mice, however, are viable [227], and in functions relating to inflammation, phagocytosis, apoptosis and ROS production they are generally similar to wide-type mice, although leukocyte migration in response to some chemoattractants is compromised [316, 317].

S100A9-/- in mice disrupts S100A8/A9 heterodimerisation [316, 317], and these mice have been considered S100A8- and S100A9-deficient. However, bone marrow cells from

S100A9-/- mice express S100A8 protein [317]. Without examination of S100A8 induction in relevant cells or tissues, S100A8 should not be assumed to be deficient in S100A9-/- mice.

Neutrophils from S100A9-/- mice express levels of S100A8 mRNA comparable to wild- type mice, but protein is not detected and there is no compensatory upregulation of other

S100 proteins [316]. Although neutrophil ultrastructure is similar to that of wild-type mice [316], the lack of S100A8 and S100A9 in S100A9-/- mice reduces neutrophil density, because these comprise 45% of the cytosol [205]. Bone marrow cells from S100A9-/- mice

have lower colony-forming potential than wild-type mice in response to IL-3, GM-CSF or granulocyte-colony-stimulating factor (G-CSF), and neutrophil numbers are lower

[316]. This impaired granulocyte differentiation results in reduced neutrophil influx in response to Staphylococcal pneumonia and impaired bacterial clearance [318, 319], and lower leukocyte influx in caerulein-induced pancreatitis and skin wounds [320]. However, leukocyte influx in thioglycollate-induced peritonitis or LPS-challenged air pouch model is unaffected [316]. The lower neutrophil influx seen in S100A9-/- mice may be due to reduced responses to activation and/or chemoattractants. Ca2+ influx into S100A9-/- neutrophils following N-formyl-methionyl-leucyl-phenylalanine stimulation is normal, whereas concentrations of some chemokines (MIP-2, MIP-1α, KC, C5a and PAF) required to generate response somewhat decrease [316], suggesting that S100A9 in part regulates neutrophil activation. Reductions in inflammatory cytokine and chemokine induction, and phagocyte activation in LPS-induced septic shock in S100A9-/- mice [294], may reflect a reduced capacity of neutrophils to respond to chemokines. In support of this,

S100A9-/- bone marrow-derived neutrophils do not exhibit increased CD11b (a chemotactic marker) in response to IL-8, and intracellular Ca2+ concentration does not increase following chemokine stimulation [274], and chemotactic responses are lower than in neutrophils from wild-type mice ex vivo [317].

Results of studies using S100A9-/- mice indicate pro-inflammatory roles for S100A8 and/or S100A9 in arthritis and neurodegenerative disorders. Although S100A8 and

S100A9 are induced in chondrocytes in inflamed knee joints in experimental arthritis

[321], S100A8 protein is not detected in the synovium of S100A9-/- mice. Although

S100A9-/- mice have cellular and humoral responses similar to wild-type mice, they have reduced joint swelling, proteoglycan depletion (a marker of cartilage destruction), MMP-

3, 9 and 13 mRNA expression in arthritic synovia and MMP-mediated cartilage destruction [322, 323], implicating S100A8/A9 in promoting joint swelling and cartilage destruction. Treating S100A9-/- mice with intra-articular S100A8 promotes joint swelling, proteoglycan depletion and MMP mRNA upregulation [321, 322]. In addition, administration of an anti-S100A9 antibody to wild-type mice with arthritis is reported to reduce leukocyte infiltration and pro-inflammatory cytokine production in serum and joints, and to promote more preserved bone/collagen integrity [324]. These results suggest that S100A8 or S100A9 alone may contribute to joint inflammation and cartilage destruction in arthritis.

S100A9 is highly expressed in the brains of humans and mice with Alzheimer’s disease and proposed to promote inflammation that facilitates neurodegeneration and cognitive impairment [325]. S100A9-/- mice have increased spatial reference memory, and reduced amyloid beta accumulation, concomitant with increased anti-inflammatory IL-10 and decreased pro-inflammatory IL-6 and TNF-α expression [325]. Because S100A9-/- may not delete S100A8 [317], this may indeed be expressed in mice with Alzheimer’s disease.

Because we showed that S100A8, but not S100A9 or S100A8/A9, can induce IL-10 in airway epithelial cells [223, 224], the possibility that S100A8 may contribute to the anti- inflammatory effects seen in this model is worthy of consideration.

The S100A8/A9 complex is expressed in renal cells following experimental renal injury, but is not seen in renal cells from S100A9-/- mice, and renal dysfunction, damage and neutrophil influx shortly after the injury is unaffected compared to wild-type mice [326].

However, S100A9-/- mice subsequently develop more renal damage and sustained inflammation, accompanied by greater induction of M2 (immunosuppressive)

macrophage markers compared to wild-type mice [326], suggesting that S100A8/A9 may modulate macrophage polarisation to promote renal injury repair. Collectively, these studies suggest that S100A8 and S100A9 may have dual roles in inflammation. Pro- inflammatory and anti-inflammatory functions of S100A8, S100A9 and S100A8/A9 are reported in mice and humans (Sections 1.1.7.1 and 1.1.7.2).

1.1.7.1 Pro-inflammatory functions of S100A8, S100A9 and S100A8/A9

Murine S100A8 was initially characterised as a leukocyte chemoattractant, because its intradermal injection provoked a mild inflammatory response resembling a delayed type of hypersensitivity response [327]. S100A8 inhalation into lungs of naïve mice promotes very mild neutrophil influx at 20 hours and lymphocyte influx over 6-20 hours [224].

S100A9 inhalation increases neutrophil and lymphocyte influx which peak at 12 and 6 hours respectively, possibly by CXCL-10 induction at 4 hours [223]. S100A8/A9 inhalation promotes neutrophil and lymphocyte influx into lungs of healthy mice with peak accumulation at 4 hours [223], suggesting that S100A8 and/or S100A9 promotes a mild pro-inflammatory response in healthy lungs, and leukocyte populations are elevated with different kinetics. Murine S100A8 was reported to promote recruitment of neutrophils and monocytes at 10-13-10-11 M [202]. However, unlike classical chemoattractants (N-formyl-methionyl-leucyl-phenylalanine, C5a and IL-8) that promote

Ca2+ influx, murine S100A8 does not promote neutrophil and monocyte chemotaxis by increasing intracellular Ca2+ levels [213, 327, 328]. Cornish et al. [328] showed that pertussis toxin abrogated chemotactic activities, suggesting that S100A8 promotes chemotaxis by Ca2+-independent G-protein signalling [328].

Human S100A8 and S100A9 have contrasting effects on neutrophil chemotaxis.

Although some studies reported that human S100A8, S100A9 and S100A8/A9 are chemotactic at 10-12-10-9 M [202] via a G-protein-coupled mechanism [329], others found little chemotactic activity for neutrophils or monocytes [327, 330], and differences in concentration may be important. Interestingly, oxidation may also influence neutrophil chemotaxis. Oxidised human S100A8 [331] or S100A9 [123] repel neutrophils

(fugetaxis), suggesting a regulatory function for the oxidised counterparts [106].

Collectively, these results indicate that S100A8 and/or S100A9 can influence myeloid cell migration, but responses are cell type- and concentration-dependent. Importantly, their oxidation can moderate responses and thus, reduce leukocyte recruitment.

S100A8 and S100A9 regulate adhesion, migration and chemotaxis of neutrophils in inflammation. S100A8, S100A9 and S100A8/A9 reportedly enhanced integrin expression and binding (Mac-1) and/or shedding (L-selectin) to promote endothelial cell adhesion and migration of human neutrophils [329, 330, 332]. Slow rolling of bone marrow-derived neutrophils from mice was found to promote integrin interactions and

S100A8/A9 secretion, triggering a GTP-dependent pathway that reduces neutrophil rolling velocity and enhances adhesion to endothelial cells [333]. Other studies have, however, questioned these results with findings that S100A8 or S100A8/A9 had no effect on migration, and that S100A8 suppressed S100A9-mediated neutrophil adhesion [329,

330, 332]. S100A9 may promote the release of secretory vesicles and specific gelatinase granules as a consequence of neutrophil activation, through the p38 and JNK MAPK pathways [334].

S100A8/A9 has been reported to promote a thrombo-inflammatory response in human endothelial cells by inducing pro-inflammatory genes and adhesion molecules via the

RAGE-NF-κB-MAPK pathways [335], and to transport arachidonic acid to endothelial cells by complexing with the scavenger receptor [336], thereby influencing endothelial cell permeability. TLR-4 interactions have also been implicated in the increased monolayer permeability of human umbilical endothelial cells stimulated with S100A8 homodimer, in a Ca2+-dependent manner [337]. By contrast, increased monolayer permeability by S100A9 homodimer was preferentially via RAGE activation, whereas

S100A8/A9 increased permeability by acting on both TLR-4 and RAGE [337].

S100A8 was reported to bind the TLR-4-MD2 complex in human embryonic kidney cells

(HEK293) in vitro to promote nuclear translocation of myeloid differentiation factor 88, resulting in activation of NF-κB and TNF-α secretion, and thereby amplifying phagocyte activation [294]. A number of studies have reported pro-inflammatory roles for S100A8 and/or S100A9. Activated monocytes from patients with acute coronary syndrome express high levels of TLR-4, and S100A8, S100A9/A8 or LPS stimulated TNF-α release from these monocytes [338]. Although S100A9 was originally reported not to bind TLR-

4, and indeed to reduce pro-inflammatory cytokine induction in response to S100A8 [294], it has since been found by others to bind TLR-4 and activate NF-ҡB to promote cytokine and NO secretion from human monocytic cells (THP-1) [339], which may delay neutrophil apoptosis by downregulating caspase 9/3 pathway [340]. S100A8/A9 also induced NO production by murine macrophages by mechanisms similar to S100A9 [341].

Pro-inflammatory functions of S100A8, S100A9 and S100A8/A9 are implicated in some diseases. S100A8 may play a role in inflammatory disorders associated with obesity.

S100A8 increases macrophage infiltration and induction of some cytokines and chemokines in adipose tissue from mice fed a high-fat and high-sucrose diet, thereby facilitating the onset of obesity [342]. Transgenic mice expressing human S100A8/A9 in myeloid cells have increased IL-22 secretion, a key cytokine that promotes inflammation in adipose tissue, and impairs cholesterol efflux from peritoneal macrophages [343].

Obesity is strongly correlated with neurodegenerative diseases [344]. Interestingly,

S100A8 is reported to promote inflammation in hippocampi and facilitate Aβ plaque formation and accumulation (precursors of neurodegenerative disorders) in brains of aged mice [345], suggesting its involvement in neurodegenerative disorders. S100A8/A9 induces production of pro-inflammatory cytokines (TNF-α and IL-6) in cultured murine

BV-microglial cells, cell types that contribute to neurodegeneration [346], suggesting that this may also be involved in neurodegenerative disorders. Moreover, S100A8 is implicated in the pathogenesis of arthritis. It upregulates MMP expression in macrophages and chondrocytes in mice with experimental arthritis [321, 322], and enhances actin ring formation in osteoclasts to initiate bone resorption [347], thereby enabling cartilage destruction. TLR-4 deletion in osteoclasts abrogates bone resorption, and it has been suggested that interactions mediated by TLR-4, and S100A8 may contribute to bone resorption [347].

S100A9 and S100A8/A9 may also promote inflammatory responses in other cell types to contribute to disease pathogenesis. They were found to increase IL-6 and IL-8 secretion from periodontal ligament cells from healthy subjects [348] and from those with generalised aggressive periodontitis by ROS-dependent nuclear translocation and activation of NF-ҡB [271]. Likewise, S100A8/A9 induced pro-inflammatory cytokine production (IL-6, IL-8 and IL-1β) from PBMC of healthy controls and patients with

Sjogren’s syndrome (a chronic inflammatory disorder) by similar mechanisms [349, 350].

Notably, some of these cytokines also induced S100A8/A9 secretion from PBMC, which may promote a positive feedback loop that potentiates pro-inflammatory effects [350].

1.1.7.2 Anti-inflammatory functions of S100A8, S100A9 and S100A8/A9

Although traditionally considered pro-inflammatory [294], emerging evidence indicates that S100A8, S100A9 and S100A8/A9 have anti-inflammatory functions [223, 224]. LPS inhalation elevates S100A8 and S100A9 levels in sputum and serum from healthy individuals [225], and the oxidised forms are found in sputum from patients with asthma

[122], supporting an oxidant-scavenging role [106] that may contribute, in part, to anti- inflammatory functions. Intraperitoneal S100A8 prolongs survival of endotoxemic mice; effects were similar to a protease-activated receptor-2 activating peptide which limits inflammation in sepsis [351]. Although another study indicates reduced survival of

S100A9-/- mice treated with intravenous S100A8 following LPS challenge [294], discrepancies may be due to changes in the inflammatory milieu and the poor capacity of

S100A9-/- neutrophils to migrate [317]. LPS inhalation provokes acute lung injury and markedly induces numerous pro-inflammatory cytokines and chemokines, to promote neutrophil influx and mast cell activation after 4 hours [224]. Murine S100A8 [50, 51,

113] scavenges oxidants (Section 1.1.4) to reduce LPS-induced damage in lungs, liver and kidneys, and neutrophil influx in lungs (neutrophilia), in vivo [224, 351]. Importantly, we showed S100A8 to be as effective as dexamethasone in suppressing pro-inflammatory cytokine and chemokine induction, and mast cell activation in acute lung injury [224].

S100A8 had similarly suppressed mast cell activation and eosinophil recruitment in mice with acute asthma [352]. We uncovered a novel mechanism whereby S100A8 inhalation markedly induced IL-10 in airway epithelial cells 12 hours after inhalation in naïve mice,

35 and 4 hours in LPS-challenged mice [224]. IL-10 is an anti-inflammatory cytokine that is constitutively expressed at low levels in normal lungs to defend against inflammatory airway diseases [353, 354]. IL-10 induction by S100A8 has been shown to promote anti- inflammatory effects in lungs by inhibiting cytokine and chemokine induction by LPS

[224]. Interestingly, IL-10 induction by S100A8 is dependent on its reactive Cys42 residue, and did not occur when this was mutated to Ala42 [224]. The Cys42 in S100A8 is essential to oxidant-scavenging [50, 51, 113], suggesting that IL-10 induction in epithelial cells is regulated by redox signalling.

Murine S100A9 and S100A8/A9 also attenuated LPS-provoked acute lung injury [223], although less effectively than S100A8 [224]. While S100A9 and S100A8/A9 suppressed pro-inflammatory cytokine and chemokine induction and neutrophil influx like S100A8

[223, 224], they increased mast cell activation and did not induce IL-10 in airway epithelial cells [224]. The Cys residues in murine S100A9 are less reactive than Cys42 in

S100A8 [113], which may contribute to the lack of IL-10 induction by S100A9. In addition, S100A8/A9 did not induce IL-10, which suggests that complex formation promotes structural changes that impair redox signalling by the Cys42 residue in S100A8.

- Other studies have shown that S100A9 inhibits O2 and H2O2 release from macrophages to impair their activation in granuloma tissue [355], and that human S100A8/A9 purified from leukocytes suppresses IL-6 and NO production from activated neutrophils and macrophages in rat liver following intraperitoneal LPS injection [356].

Importantly, using endotoxin-free S100A8, S100A9 and S100A8/A9 preparations, we showed suppression of LPS-induced acute lung injury [223, 224], which questions the notion that they are TLR-4 agonists [294]. Recombinant S100A8 and S100A9 proteins 36

synthesised from bacterial expression systems may be contaminated with bacterial components [357] if not purified, stored and handled properly. For example, E. coli commonly used for recombinant protein expression [358] is a Gram-negative bacterium with LPS as the major component of the outer surface membrane [359]. Furthermore,

LPS is ubiquitous, and it can easily contaminate preparations if not stored and handled with strict precautions (described in [223]). The findings suggesting S100A8, S100A9 and S100A9 to be TLR-4 agonists (Section 1.1.7.1) may have resulted from endotoxin- contaminated preparations. Moreover, because RAGE activation promotes inflammation, and we found no pro-inflammatory cytokine induction in mice treated with S100A8 [224], the involvement of this receptor, even though highly expressed in the lung [360], is questionable.

In summary, Section 1.1 introduced the S100 protein family, focusing on S100A8 and

S100A9. Importantly, S100A8, S100A9 and S100A8/A9 can function independently and have pro-inflammatory and anti-inflammatory functions. Notably, S100A8, S100A9 or

S100A8/A9 inhalation does not induce pro-inflammatory cytokines and attenuates LPS- induced acute lung injury in mice [223, 224]. Mounting evidence supports links between inflammation and cancer [361, 362]; tumour-promoting inflammation is now recognised as a hallmark of cancer [363]. We questioned whether the anti-inflammatory properties of S100A8 and/or S100A9 may influence the pathogenesis of lung cancer. Section 1.2 discusses the development and treatments of lung cancer, before proceeding to the sections discussing S100 proteins in cancer.

1.2 Development and treatment of lung cancer 1.2.1 Development of lung cancer

A link between inflammation and cancer was first proposed by the German pathologist,

Rudolf Virchow, based on observations of infiltrating inflammatory cells in solid malignancies [361]. Accumulating evidence over the last several decades supports the notion that inflammation contributes to cancer development [362]. COPD is characterised by sustained inflammation of airways and progressive airflow obstruction [364].

Exposure to noxious particles and gases, such as from tobacco smoking, is a predominant risk factor for COPD [364]. Cigarette smoking is also a predominant risk factor for lung cancer, particularly squamous cell carcinoma [364]. There is a suggested link between

COPD and lung cancer because patients with COPD are twice as likely to develop lung cancer compared to healthy controls [365]; 30% of patients with mild to moderate COPD developed lung cancer and died [366]. A similar link is also demonstrated in mice with lung cancer, in which a lack of chronic inflammatory mediators reduces tumour growth and progression in vivo [367].

A proposed mechanism through which COPD contributes to the pathogenesis of lung cancer, relevant to this thesis, is production of excessive ROS and NO (others are reviewed in [364]), which promote oxidative damage to DNA, resulting in gene mutations that dysregulate normal cell functions to initiate development of lung cancer, or carcinogenesis (reviewed in [368]) (Figure 1.2.1). If the accumulated DNA damage in these mutated cells is not successfully repaired, they enter the second stage of carcinogenesis, in which they promote uncontrolled proliferation (hyperplasia) and abnormal cell morphologies (dysplasia), thus acquiring a preneoplastic state (Figure

1.2.1). If these preneoplastic cells are not eliminated by apoptosis, they transform into

neoplastic cells and progress into the third stage, forming carcinoma in situ, and subsequently invade underlying tissues to become malignant tumours [369] (Figure 1.2.1).

Key mediators involved in carcinogenesis, relevant to this thesis, are discussed in

Sections 1.2.1.1 to 1.2.1.5.

Figure has been removed due to Copyright restrictions.

Figure 1.2.1: The three stages of lung carcinogenesis. The first stage is initiated by accumulation of DNA damage in normal cells, which can be caused by carcinogens (e.g. cigarette smoke), inflammation and reactive oxygen species (ROS) or reactive nitrogen species (RNS). Unsuccessful DNA repair prompts cells to enter the second stage of carcinogenesis, in which they acquire mutations that promote uncontrolled proliferation (hyperplasia) and abnormal cell morphologies (dysplasia). These mutated cells form focal lesions and are in the preneoplastic state. If not eliminated by apoptosis, these cells transform into neoplastic cells and progress into the third stage of carcinogenesis, which form carcinoma in situ and subsequently invade through the basement membrane (indicated by arrow) into underlying tissues to become malignant tumours, and metastasise through the vasculature (Section 1.2.1.5; figure adapted and modified from Fuchs-Tarlovsky [369]).

1.2.1.1 Mutations that drive neoplastic transformation in lung cancer

Genomic instability facilitated by some driver mutations promotes dysplasia of normal epithelium and contributes to the transformation of malignant neoplasia in situ [370]. Key genes that drive neoplastic transformation in lung cancer include KRAS, epidermal growth factor receptor (EGFR) and anaplastic lymphoma kinase (ALK); others are reviewed in

[371]. KRAS is a GTPase that regulates cell proliferation, survival and metabolism [372]; it is activated by binding to GTP and deactivated by binding to GDP [373]. Although

KRAS is the most common driver mutation of lung cancer that occurs in approximately 39

30% of adenocarcinomas [372], there are no known KRAS inhibitors. Missense mutations in KRAS on codons 12, 13 and 61 alter protein conformation, such that GTP binds and maintains a constitutively activated state to sustain tumour cell proliferation

[372, 374]. In keeping with NO as a mediator of carcinogenesis initiation (Figure 1.2.1),

KRAS activity may be enhanced by NO because nitric oxide synthase knockout in mice abolishes lung tumour growth induced by KRAS [375]. By contrast, EGFR is a transmembrane tyrosine kinase receptor; EGF and TGF-α are ligands that promote EGFR dimerisation and phosphorylation of effector molecules that promote cell growth and survival (reviewed in [376]). EGFR mutations occur in ~14% of lung cancer cases [372]; the two most common are deletions in exon 19 and a point mutation from leucine to arginine in exon 21 L858R [377]. These mutations, together with EGFR upregulation

[378] and NO [379], activate and sustain pro-survival signals that promote proliferation and migration of lung tumour cells [379-381]. Similarly, ALK, a receptor tyrosine kinase that promotes nervous system development [382], binds midkine and pleiotrophin to promote cell proliferation, differentiation and apoptosis evasion [383]. ALK mutations involve chromosomal translocation of ALK to other proteins (7% of lung cancer cases

[372]), particularly echinoderm microtubule-associated protein-like 4, which enhance

ALK activities [384] and activate cell proliferation and survival pathways [382].

1.2.1.2 Lung cancer progression

Cancer stem cells are an important initiator of lung cancer progression. It is postulated that cancer stem cells are originated from tissue-specific stem cells, the precursors of different cell types found in specific tissues [385]. Tissue-specific stem cells are thought to acquire immortality through mutations that sustain self-renewal capacity (reviewed in

[385]) and become cancer stem cells [386]. Some evidence supports the notion that

dysregulated signalling pathways in normal stem cell homeostasis facilitate cancer stem cell expansion in lung cancer [387-391]. Interestingly, the ECM protein, MMP-10, is upregulated in cancer stem cells to promote their expansion and maintenance for initiation of lung tumour growth [392, 393].

Cancer stem cells were first isolated from patients with acute myeloid leukaemia, and their ability to regrow tumours in nude mice [394] indicates their roles in the initiation of tumour growth [386]. Similarly, cancer stem cells isolated from patients with non-small- cell lung cancer (NSCLC; ~85% [395]) and small-cell lung cancer (SCLC; ~15% [395]) reproduced lung tumours in nude mice [396]. Cancer stem cells from different parts of the lung may initiate different cancer subtypes. Transformation of tracheal and bronchial epithelial stem cells and bronchoalveolar stem cells may produce two of the major subtypes of NSCLC, squamous cell carcinoma and adenocarcinoma, respectively [397,

398], whereas transformation of pulmonary neuroendocrine cells in bronchioles may produce SCLC [398]. Cancer stem cells also contribute to some important hallmarks of cancer, including angiogenesis, invasion and metastasis in lung cancer (reviewed in

[385]).

Six cancer hallmarks were first proposed by Hanahan and Weinberg [399] in 2000 to describe the characteristics of human cancers, including sustained proliferative signalling, enabled replicative immortality, evaded growth suppressors, resisted cell death, induced angiogenesis and activated invasion and metastasis to promote tumour growth and progression by transduction of pro-tumourigenic signals. Subsequently, emerging research suggests that cancer is characterised by additional hallmarks, which include genome instability and mutation, tumour-promoting inflammation, deregulated cellular

41 energetics and avoidance of immune destruction [363] (Figure 1.2.1.2.1). The relevant features of these hallmarks in lung cancer are discussed below.

Figure has been removed due to Copyright restrictions.

Figure 1.2.1.2.1: The ten hallmarks of cancer. This illustration presents the six cancer hallmarks proposed in 2000, including sustaining proliferative signalling, enabling replicative immortality, evading growth suppressors, resisting cell death, inducing angiogenesis and activating invasion and metastasis [399], and the additional four hallmarks proposed from emerging research, including genome instability and mutation, tumour-promoting inflammation, deregulated cellular energetics and avoidance of immune destruction (figure adapted from Hanahan and Weinberg [363]).

After acquiring mutations and signals that sustain proliferation and resist apoptosis, lung cancer cells need to overcome oxygen and nutrient depletion in the tumour microenvironment before growth can continue. Hypoxia occurs when a tumour has insufficient vasculature to supply oxygen and nutrients for growth, which happens when solid tumours reach a volume of 1 to 2 cm3 [400]. Angiogenesis, or formation of new vessels, is needed to sustain tumour growth. Under hypoxia, heat shock protein 90 facilitates hypoxia-inducible factor (HIF)-α binding to HIF-β by inducing conformational changes [401], thereby activating target genes for angiogenesis, glycolysis, cell survival

and proliferation (reviewed in [402, 403]) (Figure 1.2.1.2.2). HIF may induce major mediators of endothelial cell migration, proliferation and permeability to promote angiogenesis, including vascular endothelial growth factor (VEGF) (reviewed in [404]) and chemokines (reviewed in [405]). HIF-1 and 2α overexpression in patients with lung cancer are associated with more VEGF positive vessels [406], although only HIF-1α correlates with reduced disease-free survival [407]. However, elevated VEGF in tumour islets and exhaled breath condensate are associated with decreased survival and increased tumour burden in lung cancer [408, 409]. HIF-2α promotes KRAS-induced lung tumour growth and reduces overall survival [410], and VEGF promotes proliferation and migration of lung cancer cells in vitro [411], indicating that VEGF may be induced by

HIF to increase vasculature within tumours.

Figure has been removed due to Copyright restrictions.

Figure 1.2.1.2.2: Adapted responses to hypoxia. Hypoxia induces HIF-1α, and heat shock protein 90 (Hsp90) facilitates binding of HIF-1α to HIF-1β to induce transcription of target genes, such as VEGF, glycolytic enzymes and genes that promote cell survival and proliferation, thereby increasing in angiogenesis, glycolysis, cell survival and proliferation (figure adapted and modified from Rahimi et al. 2012 [412]).

Notably, induction of chemokines can also affect endothelial cell functions within the tumour microenvironment to influence angiogenesis. CCL-2 is expressed in tumours and stromal cells [413] and promotes endothelial cell migration and vascularisation [414, 415].

CXCL5 secreted by tumour cells increases vascular density within tumours [416], and

CXCL8 secreted by tumour cells enhances endothelial cell survival and migration [417].

By contrast, some chemokines suppress angiogenesis, including CXCL9 and CXCL10, possibly by promoting tumour rejection. CXCL9, secreted by tumour cells, is associated with reduced tumour growth and vasculature in human NSCLC [418]. Similarly,

CXCL10 is associated with reduced lung tumour growth and vasculature in mice [419].

After inducing angiogenesis to overcome oxygen and nutrient depletion in the tumour microenvironment, tumour cells require rapid ATP generation to sustain proliferation and growth. Lung tumour cells upregulate expression of the glucose transporter, GLUT1, to obtain the glucose required for ATP generation [420], and promote a high glycolysis rate followed by lactate fermentation, known as the Warburg effect [421]. Fatty acid and amino acid metabolism is also involved in energy production by tumour cells (reviewed in [422]). For the purposes of this thesis, only arginine metabolism in lung cancer is discussed. L-arginine is an essential amino acid involved in the NO and urea cycles

(Figure 1.2.1.2.3). Notably, L-arginine transport is mediated by cationic amino acid transporters [423]. L-arginine is converted into NO by nitric oxide synthase, or to urea and L-ornithine by arginase I (reviewed in [424]; Figure 1.2.1.2.3). L-ornithine is then converted into α-ketoglutarate by a series of chemical reactions, to facilitate ATP generation through the TCA cycle in mitochondria (reviewed in [422]). L-arginine is, therefore, an important substrate for energy production and supports tumour cell proliferation; its depletion impairs proliferation of many cancer cell lines in vitro, including lung cancer cells [425]. Some tumours, including NSCLC, are arginine auxotrophic and depend entirely on extracellular arginine for growth; L-arginine depletion arrests growth and induces apoptosis (reviewed in [426]).

Figure has been removed due to Copyright restrictions.

Figure 1.2.1.2.3: L-arginine metabolic pathways. Cationic amino acid transporters (CAT) mediate L-arginine trafficking into cells. L-arginine is a substrate common to NOS and arginase I. Nitric oxide synthase (NOS) catalyses arginine conversion into nitric oxide (NO) and L- citrulline, whereas arginase I catalyses arginine conversion into L-ornithine and urea (figure adapted and modified from Katusic et al. 2007 [424]).

1.2.1.3 The redox microenvironment in lung cancer

Induction of angiogenesis supplies oxygen for lung tumour growth (Section 1.2.1.2), and in combination with the increased production of oxidants, particularly ROS and reactive nitrogen species (RNS) [427], the lung microenvironment generally has elevated oxidative stress. Concomitantly, antioxidants are often aberrantly expressed in lung tumours and/or the tumour microenvironment, and altered oxidant-scavenging activities by antioxidants influence tumour progression.

ROS and RNS are generated during mitochondrial oxidative phosphorylation [427]. ROS are largely generated from NADPH oxidase (reviewed in [368]); the major ROS include

H2O2 and superoxide anion [368, 428]. RNS are largely generated from iNOS (reviewed in [368]); the major RNS include NO, and the products of NO metabolism, nitrate and nitrite [429]. ROS and NO are also produced by MDSC [430] to mediate immunosuppression in cancer (reviewed in [431]) (Section 1.2.1.4). In lung cancer, ROS and NO can generate peroxynitrite [432, 433], which confers oxidative stress in the lung microenvironment. Although increased ROS production is often favourable for tumour progression, local elevation of H2O2 and superoxide anions within tumours can induce apoptosis; paclitaxel (chemotherapeutic drug) contributes to apoptosis of lung cancer cells in part by increasing intracellular H2O2 levels [434]. Similarly, depending on the tumour type, stage and local NO concentration, NO may have dual roles in lung cancer

[109, 435, 436]. As indicated by patients with lung cancer, high iNOS protein expression in tumours improves survival, whereas high expression in stroma decreases survival [408].

Importantly, high stromal NO levels increase stromal oxidative stress that favours tumour progression, whereas high NO levels within tumours increase intracellular oxidative

stress to promote apoptosis [437-440], possibly due to S-nitrosylation of particular Cys residues in pro-apoptotic target proteins [115, 116, 441].

Dysregulated expression of some key antioxidants in the lung microenvironment alters their oxidant-scavenging activities and influences tumour progression. Key antioxidants, relevant to this thesis, include superoxide dismutase (SOD), catalase, glutathione peroxidase (GPX), peroxiredoxin (PRDX), thioredoxin (TXN), TXN reductase (TXNR), metallothioneins (Mt) and heme-oxygenase-1 (HO-1) (Table 1.2.1.3).

Table 1.2.1.3: Antioxidants involved in lung cancer Antioxidant Function in normal physiology Function in lung cancer Reference SOD ▪ Converts superoxide anion ▪ ↑ cancer cell migration, invasion and [442-444] into H2O2 and oxygen metastasis Catalase ▪ Converts H2O2 into water ▪ ↓ tumour progression [445, 446] and oxygen GPX ▪ Scavenges H2O2 and ▪ Protects host from oxidative DNA [447] hydroperoxides damage PRDX ▪ Scavenges peroxides and ▪ Tumour suppressor [448, 449] regulates intracellular H2O2 ▪ ↑ tumour growth, invasion and [450, 451] levels chemoresistance TXN ▪ Oxidant-scavenging ▪ ↑ transcription of hypoxia- [452-455] ▪ Controls transcription responsive genes in tumour cells factors, DNA synthesis and ▪ Positively associated with cell proliferation proliferation and differentiation in lung cancer cells TXNR ▪ Oxidant-scavenging ▪ ↑ tumour growth [453, 455, ▪ Controls transcription 456] factors, DNA synthesis and cell proliferation Mt ▪ Binds Zn2+ and Cu2+ for ▪ ↓ murine tumour growth [457-460] biological activities ▪ Positively associated with cancer ▪ Detoxifies ions such as lead cell proliferation and poor prognosis and mercury in human NSCLC ▪ Oxidant-scavenging HO-1 ▪ Degrades heme to carbon ▪ ↓ tumour growth, angiogenesis and [461-463] monoxide metastasis by inducing tumour ▪ Protects against oxidative suppressor genes injury in lungs ▪ Positively associated with invasion and poor outcome ▪ ↑ tumour growth and ↓ apoptosis in a NO-dependent manner SOD = superoxide dismutase; GPX = glutathione peroxidase; PRDX = peroxiredoxin; TXN = thioredoxin; TXNR = thioredoxin reductase; Mt = metallothioneins; HO-1 = heme oxygenase-1; ↑ = increased; ↓ = decreased.

SOD scavenges superoxide anions but generates H2O2 that may promote cancer cell migration, invasion and metastasis [442-444]. It is often upregulated in lung cancer [464] and its inhibition increases lung tumour cell apoptosis and reduces tumour growth in mice

[465]. Low SOD expression, relative to catalase or GPX, in human lung cancer correlates with less advanced disease [464], suggesting that the excessive H2O2 generated by SOD is scavenged by catalase or GPX. In support of this, catalase suppresses tumour growth and metastasis by decreasing oxidative stress [445, 446]; GPX protects against oxidative

DNA damage by scavenging H2O2 and hydroperoxides (reviewed in [447]). PRDX, TXN and TXN reductase (TXNR), enzymes that regulate cellular redox potentials, may also scavenge oxidants in the lung microenvironment.

There are six PRDX isoforms in mammalian cells, classified according to the number and organisation of Cys residues. PRDX1 - 5 have two Cys residues, but PRDX6 only one

(reviewed in [466]). It is known that PRDX regulates intracellular H2O2 to prevent excessive oxidative damage (reviewed in [451]), but more precise specification of their roles in cancer is still emerging. PRDX1 is upregulated in lung cancer cells in vitro [467] and may promote chemoresistance and more invasive tumour growth [448]. A recent study also suggests that PRDX6 may promote lung tumour growth [449]. Conversely, a

PRDX1 knockout in mice promotes progression of several cancers, including lung cancer

[450], suggesting a protective effect.

These discrepancies could be explained by the susceptibility of PRDX inactivation to hyperoxidation [468], thus, high PRDX expression does not necessarily correlate with high oxidant-scavenging capacity. Importantly, PRDX functions jointly with TXN to scavenge peroxides [469], and the TXN system is important for oxidant-scavenging, 48

redox control of transcription factors, deoxyribonucleotide synthesis and cell proliferation

(reviewed in [453]) (Figure 1.2.1.3). Like S100A8 [227], TXN knockout in mice is embryonically lethal at the same time (day 8.5) [470]. H2O2 oxidises PRDX at the susceptible Cys residues to form disulphide bonds. Oxidised PRDX is, in turn, reduced by TXN which becomes oxidised. TXN activity can be inhibited by TXN-interacting protein (TXNIP) [471]. With NADPH input, TXN is reduced by thioredoxin reductase

(TXNR) (reviewed in [453]) (Figure 1.2.1.3.1). TXNR maintains the oxidant-scavenging capacity of PRDX and TXN, because PRDX is inactivated upon oxidation [468], and

TXN is inactivated by oxidised PRDX [472].

Figure has been removed due to Copyright restrictions.

Figure 1.2.1.3: The peroxiredoxin, thioredoxin and thioredoxin reductase antioxidant system. The redox status of peroxiredoxin (PRDX), thioredoxin (TXN) and TXN reductase (TXNR) is critical to peroxide scavenging and prevention of excessive oxidative damage. Notably, TXN activity can be inhibited by oxidised PRDX or TXN-interacting protein (TXNIP). TXN is reduced by TXNR, with the input of NADPH (figure adapted and modified from Karlenius et al. 2010 [453]).

Although the TXN system mediates oxidant-scavenging (reviewed in [453]), TXN is highly expressed in lung carcinoma cells [455] and serum [473] and correlates with more advanced disease [454, 473]. TXNR is also highly expressed in lung carcinoma cells

[455], and TXNR knockdown impairs tumour progression [456]. The TXN system may

49 promote tumour growth by inducing hypoxia and angiogenesis because TXN stabilises

HIF-α and β binding, promoting transcription of hypoxia-responsive genes in lung cancer cells [452], including cyclooxygenase 2 (COX2) [452] and VEGF [474]. TXN inactivation by oxidised PRDX [472] or TXNIP [471] may also contribute to tumour progression due to reduced oxidant-scavenging. However, NADPH generation can restore TXN and TXNR activities [453] (Figure 1.2.1.3), suggesting that they have dual roles in lung cancer, dependent on the oxidation status and/or NADPH concentrations in the lung microenvironment.

Mt and HO-1 are also implicated in the progression of lung cancer and may have dual roles. There are four groups of metallothioneins (Mt1-4); these proteins bind Zn2+ and

Cu2+ essential for biological activities, detoxify ions such as lead and mercury and scavenge oxidants (reviewed in [460]). Mt1 and Mt2 are downregulated in human lung cancer tissues [475], although some isoforms are upregulated and associated with increased growth [458] and poor prognosis [459]. In mice with chemically-induced lung tumours, Mt1/2 knockout reduces growth [457]. HO-1 degrades heme to carbon monoxide and is often downregulated in cancer [461]; its upregulation in lung cancer cells decreases tumour growth, angiogenesis and metastasis in mice by inducing expression of tumour suppressor genes and protecting against oxidative damage [461].

However, HO-1 upregulation has also been associated with more invasion and migration of lung tumour cells, and poor prognosis [462]. HO-1 activation increases lung tumour growth and inhibits NO-induced tumour apoptosis in mice [463].

Collectively, although the antioxidants can reduce oxidative stress in the lung microenvironment to inhibit tumour growth, some are inactivated by oxidation, and this process can promote tumour growth, indicating dual roles in cancer. The oxidation status and NADPH concentration in the lung microenvironment, as well as lung cancer subtypes and the isoforms of antioxidants, are some potential factors that determine whether these antioxidants are pro- or anti-tumourigenic. Importantly, the ROS and NO produced by

MDSC [430] mediate immunosuppression in cancer (reviewed in [431]), indicating that the redox microenvironment influences cancer immunity (Section 1.2.1.4).

1.2.1.4 The immune microenvironment in lung cancer

MDSC are cell types that mediate immunosuppression in various inflammatory lung diseases, including lung cancer [476]. They were first described in mice with lung cancer

30 years ago as suppressor bone marrow cells [477]. Notably, immature myeloid cells normally differentiate into monocytes, neutrophils and dendritic cells, but fail to differentiate into these mature myeloid cells in cancer and acquire immunosuppressive activities [478-480]. These suppressive cell types were referred to as “immature myeloid cells” or “myeloid suppressor cells” but, in 2007, Gabrilovich and colleagues suggested the term “MDSC” to precisely describe the origin and function of these cell types [480].

Theirs was among the first laboratories to report a negative association between dendritic cell differentiation and MDSC accumulation in tumour-bearing mice [226], and in patients with breast, head and neck, and lung cancers [481]. Finding that these immunological abnormalities contribute to the suppression of anti-tumour T cell function, they later proposed that MDSC and T cells are reciprocally related [482]. Gabrilovich and colleagues have since made ground-breaking progress on elucidating the phenotype [483-

485], regulation and function [484, 486-490] of MDSC. This section focuses on these aspects of MDSC, and details of anti-tumour T cells are summarised in Table 1.2.1.4.2 at the end of the section.

MDSC are implicated in the progression of lung cancer in humans and mice [207, 367,

491-497]. MDSC numbers are generally low in the circulation under normal physiological situations, but are elevated in peripheral blood in cancer, and accumulate in bone marrow, spleen, lymph nodes, primary and metastatic tumours [498-500].

Specifically, patients with lung cancer have higher MDSC numbers in PBMC compared to healthy controls [501, 502]. Similarly, mice with lung cancer have up to 10 times more

MDSC in the spleen compared to healthy mice, whereas numbers increase only about 2- fold in peripheral blood and bone marrow [503, 504], suggesting that the spleen is an important organ for MDSC accumulation and immunosuppression in cancer. In support of this, splenectomy in mice depletes MDSC and causes reduced lung tumour growth

[505].

MDSC comprise neutrophilic (PMN-MDSC) or monocytic (M-MDSC) subtypes [483];

M-MDSC can differentiate into PMN-MDSC [506]. PMN-MDSC are the major subtypes reported in cancer, including lung cancer [506]. In humans, MDSC markers include

CD11b, CD33 (surface), arginase, iNOS [431] and S100A9 [206, 207, 493] (intracellular); others are reviewed in [483]. Although several MDSC populations are identified in patients with lung cancer [494-496] and some possible differential markers between

PMN-MDSC and M-MDSC are proposed [483], characterisation of human MDSC subsets remains unclear. In contrast, MDSC characterisation in mice is more well- established, through the surface expression of CD11b and Gr-1 [431, 483], and surface

F4/80 expression differentiates M-MDSC from PMN-MDSC [503]. Intracellularly, murine MDSC are characterised by arginase, iNOS, ROS [431] and S100A9 expression

[208].

The increased MDSC numbers in cancer is generally associated with decreased numbers, and function of key anti-tumour T cell types (CD4, CD8, NK and NK-T cells) (others are reviewed in [507]). Compared to healthy controls, patients with lung cancer have higher

MDSC numbers in blood [501, 502], but lower CD4 [496, 502] and CD8 numbers [501,

502]. Patients with lung cancer also have lower perforin expression in PBMC [508], suggesting reduced activation of CD8 [509], NK and/or NK-T cells [510, 511]. In support 53 of this, MDSC depletion from PBMC of patients with lung cancer restores CD4 and CD8

T cell functions ex vivo [207]. MDSC numbers are also negatively associated with the number and function of CD8 T cells in a co-culture of MDSC, CD8 T cells and tumour cells from patients with lung cancer [502]. These studies suggest that increased numbers of anti-tumour T cells may reverse MDSC-mediated immunosuppression. In support of this, elevated CD8 expression in surgically-resected lung adenocarcinoma, indicating higher CD8 T cell numbers, is associated with prolonged survival [512]. In addition, treatment with cytokine-induced killer cells (injection of T lymphocytes with cytotoxic activities) in patients with lung cancer increases CD4, NK and NK-T cells in PBMC and improves outcomes [513]. Similarly to patients with lung cancer, MDSC accumulation in mice with lung cancer is associated with decreased CD8 T cell numbers [514], and MDSC depletion promotes lung tumour rejection and concomitant increases in numbers and activity of CD8 and NK cells [492]. Although tumour-infiltrating NK cells are sometimes found in patients and mice with lung cancer, they lack a mature phenotype (CD11b+ and

CD27+) that effectively produces IFN-γ to induce cytotoxic T cell activity [515], indicating impaired immune surveillance in the lung microenvironment.

MDSC are proposed to accumulate in tumours and lymphoid-associated organs to suppress immune surveillance by a two-signal model; the first promotes MDSC expansion from immature myeloid cells and the second promotes their activation [486].

It remains unclear whether MDSC recruitment is a precursor or consequence of MDSC activation. Some secreted inflammatory mediators from tumours and/or stromal cells mediate the expansion, activation and recruitment of MDSC. This section describes the most common ones that are also relevant to this thesis; others are listed in Table 1.2.1.4.1 or reviewed in [483, 487, 489, 516-518]. Although not all the mediators discussed were 54

identified in lung cancer specimens, they are likely applicable because they are involved in many cancers and inflammatory disorders [483, 487, 489, 516-518].

Colony-stimulating factors promote the differentiation of mature myeloid cells

(myelopoiesis) in the bone marrow; in cancer, they suppress differentiation of mature myeloid cells but promote the differentiation of immature myeloid cells into MDSC

(reviewed in [519, 520]). As a major mediator of myelopoiesis (reviewed in [519, 520]),

GM-CSF is a key mediator of MDSC expansion in cancer [504, 521]. GM-CSF may act alone or in combination with some pro-inflammatory mediators, including IL-1β [522],

IL-6 [522, 523] and PGE2 (generated via COX2 activation) [522], to expand MDSC by activating key signalling pathways (PI3K, RAS, Jak/STAT and TGF-β) (reviewed in

[516]). Similarly, macrophage colony-stimulating factor (M-CSF) and G-CSF promote

MDSC expansion by activation of the aforementioned key signalling pathways (reviewed in [516]), although it is unclear whether they act in combination with other pro- inflammatory mediators.

Some proinflammatory mediators that promote MDSC expansion also activate MDSC to confer immunosuppression (reviewed in [483, 487, 524]). However, IL-1β [525], IL-6

[526, 527] or TGF-β [431] promotes expansion by signalling pathways such as PI3K,

RAS and Jak/STAT (reviewed in [516]). COX2 may also promote MDSC expansion, because COX2 inhibition reduces MDSC accumulation in mice with lung cancer [528].

Notably, IL-1β [522], IL-6 [522, 523], PGE2 [522] or TNF-α [522] may act in concert with GM-CSF to promote expansion, and COX2 [529] or PGE2 [530, 531] may act in concert with IL-1β to promote expansion. Importantly, the mediators mentioned above

(IL-1β, IL-6, COX2, PGE2, TNF-α and TGF-β [518, 532-534]) also activate MDSC, via 55 the STAT1, STAT6 and NF-ҡB pathways (reviewed in [487, 518, 524]). Interestingly,

HIF-1α and VEGF, factors in hypoxia and angiogenesis (Section 1.2.1.2), also promote

MDSC expansion [431, 522, 535] and activation [518, 535]. VEGF acts alone or in combination with GM-CSF and IL-6 [522]. VEGF may also act in concert with G-CSF because blocking G-CSF increases the effectiveness of anti-VEGF therapy in mice with lung cancer [536].

Although IL-10 can enhance CD8 and NK cell function [537-539], a positive feedback loop of IL-10 and MDSC promotes activation. IL-10 secretion from MDSC induces Treg

[431] and tumour-associated macrophages [540] which, in turn, facilitates activation of more MDSC and secretion of more IL-10 from MDSC. IL-1β secreted from MDSC also enhances IL-10 secretion from these cells to promote activation [540]. However, IL-10 knockout in mice promotes tumour growth and metastasis, accompanied by increases in

MDSC and Treg numbers [541], and IL-6/STAT signalling [542], suggesting additional mediators that activate MDSC, and these include IL-4, IL-13 and IFN-γ [487]. They activate MDSC signalling via the STAT1, STAT6 and NF-ҡB pathways [487]. IL-4 and

IL-13 induce arginase in MDSC, and this can promote arginine depletion in the tumour microenvironment [543]; IL-13 also induces TGF-β that enhances immunosuppression by MDSC [532]. IFN-γ is an essential cytokine for PMN-MDSC activation, whereas M-

MDSC activation is only partially IFN-γ-dependent [544].

Indoleamine 2,3-dioxygenase (IDO), an enzyme that degrades tryptophan to produce toxic catabolites to T cells [545], promotes MDSC expansion, activation and recruitment

[546-548]. The association of IDO upregulation with reduced survival in cancer

(reviewed in [549]) is largely due to immunosuppression by MDSC (reviewed in [550]).

IDO expands MDSC in an IL-6-dependent manner to promote lung tumour growth, angiogenesis and metastasis in mice [547]. Interestingly, suppression of MDSC expansion following IDO knockout in mice with lung cancer was accompanied by a reduction in GM-CSF [548], suggesting that IDO and GM-CSF may be co-dependent.

IDO expression in patients with melanoma correlates positively with MDSC recruitment, and targeted IDO inhibition in vivo reduces MDSC infiltration [546], confirming its role in MDSC recruitment.

Several chemokines and their receptors mediate MDSC recruitment (reviewed in [487,

488]), particularly CCL2, CXCL8 and CXCL12, which are induced by PGE2 [551-557].

Although CXCL9 and CXCL10 may influence recruitment [558, 559], MDSC depletion in lung tumours increases their expression [492], suggesting dual functions. Some cytokines also promote MDSC recruitment, most notably IL-12β (p40), which antagonises the immunostimulatory function by IL-12 [560] to promote MDSC recruitment to orthopaedic bacterial lesions. It may act in conjunction with IL-1β, TNF-

α, G-CSF, CCL5 and CXCL2 [561]. S100A8, S100A9 and S100A8/A9 are also reported to promote MDSC expansion [562], activation [563] and recruitment [487, 497, 564]

(discussed in Section 1.3.4.1.3).

Table 1.2.1.4.1 Major mediators of MDSC expansion, activation and recruitment Mediator Function(s) influencing MDSC Expansion Reference Activation Reference Recruitment Reference GM-CSF ↑ [504, 521] - - - - M-CSF ↑ [519] - - - - G-CSF ↑ [519] - - - - MMP-9 ↑ [487, 565] - - - - Stem cell ↑ [566] - - - - factor S100A9 ↑ [562] - - - - IL-1β ↑ [522, 525] ↑ [518] - - IL-6 ↑ [522, 523, ↑ [534] - - 526, 527] IL-17 ↑ [567, 568] ↑ [567, 568] - - IL-18 ↑ [569] ↑ [569] - - IL-23 ↑ [570] ↑ [570] - - COX2 ↑ [528, 529] ↑ [518] - - PGE2 ↑ [522, 528, ↑ [518] - - 530, 531] TNF-α ↑ [522] ↑ [518] - - TGF-β ↑ [431] ↑ [532, 533] - - HIF-1α ↑ [535] ↑ [535] - - VEGF ↑ [431, 522] ↑ [518] - - IL-4 - - ↑ [543] - - IL-10 - - ↑ [540] - - IL-13 - - ↑ [532] - - IL-33 - - ↑ [571] - - IFN-γ - - ↑ [544] - - S100A8 - - ↑ [563] - - SAA3 ↑ [572] ↑ [572] ↑ [497] IDO ↑ [547, 548] ↑ [546-548] ↑ [546] CCL2 - - - - ↑ [553, 554, 556, 557] CCL3 - - - - ↑ [573] CCL4 - - - - ↑ [574] CCL5 - - - - ↑ [573] CXCL1 - - - - ↑ [575] CXCL2 - - - - ↑ [575] CXCL5 - - - - ↑ [575] CXCL8 - - - - ↑ [555-557] CXCL9 - - - - ↑ [558, 559] CXCL10 - - - - ↑ [558, 559] CXCL12 - - - - ↑ [556, 557] CX3CL1 - - - - ↑ [573] MIF - - - - ↑ [576] IL-5 - - - - ↑ [577] IL-12β - - - - ↑ [561] S100A8/A9 - - - - ↑ [487, 564] IRF-4 ↓ [578] ↓ [578] - - IRF-8 ↓ [579] - - - - IL-12 ↓ [560] ↓ [560] - - ↑ = increased; ↓ = decreased; - = not determined

Negative mediators of MDSC expansion, activation and recruitment are less clear, the best-studied being interferon regulatory factors (IRF) that modulate innate immunity and promote maturation of cells involved in adaptive immune responses [580] (Table

1.2.1.4.1). Although IL-4 may promote MDSC activation [543], it can induce IRF-4 which subsequently impairs MDSC expansion and activation [578]. IRF-8 may inhibit

MDSC expansion by suppressing G-CSF and GM-CSF production and downregulating the STAT pathway [579]. IRF may also reverse immunosuppression by promoting the maturation of anti-tumour CD4, CD8 and NK cells [580].

Immune surveillance by CD4, CD8, NK and NK-T cells in lung cancer is often suppressed by MDSC [581], principally by the production of ROS and NO (reviewed in

[431, 582]). NO can influence MDSC recruitment by inducing factors that increase endothelial permeability, such as VEGF, and suppress T cell activation and infiltration into tumours [430]. ROS and NO generated by MDSC form peroxynitrite to promote nitration of receptors that interferes with T cell binding, thereby inhibiting their cytotoxic activity [583, 584], and promoting T cell apoptosis [585]. In support of this, administration of an oxygen scavenger that mimics SOD reduces MDSC numbers and enhances CD8 T cell responses in mice with lung cancer [514]. PMN-MDSC and M-

MDSC preferentially use different mechanisms to suppress immunity; a ROS-dependent mechanism is implicated in PMN-MDSC, whereas M-MDSC functions are more NO- dependent (reviewed in [482]). MDSC also promote immunosuppression by depleting L- arginine [491, 586], increasing tryptophan degradation [550] and increasing extracellular adenosine that transduces immuno-inhibitory signals [587].

T cells catabolise nutrients to generate energy via oxidative phosphorylation in a quiescent state, whereas in the activated state, they synthesise metabolites to support proliferation by increasing glycolysis [588]. T cell proliferation, metabolism and activation are dependent on L-arginine [499, 589, 590], and the cationic amino acid transporter 1 (CAT1) facilitates its transport into T cells [589]. Therefore, L-arginine depletion by upregulation of arginase-1 and iNOS is another mechanism whereby MDSC facilitate immunosuppression in lung cancer [491, 586]. MDSC also overexpress the arginine transporter, cationic amino acid transporter 2 (CAT2) [591], which may facilitate preferential L-arginine transport to sustain NO production and immunosuppression.

Tryptophan is also implicated in immunosuppression in cancer (reviewed in [550]). Its degradation by IDO produces toxic catabolites that induce T cell apoptosis (reviewed in

[550]). In addition to facilitating MDSC expansion, activation and recruitment [546-548]

(Table 1.2.1.4.1), IDO decreases T cell proliferation and increases apoptosis (reviewed in

[550]). Accordingly, loss of IDO impairs MDSC suppressive activities in mice with lung cancer [547, 548], and enhances CD8 T cell recruitment and responses [548].

Increased extracellular adenosine, a mediator of immunosuppression, may be the result of rapid ATP generation in cancer (reviewed in [587]). Cell surface nucleotidases, CD39 and CD73, facilitate the conversion of ATP into adenosine; adenosine binds its receptors to transduce inhibitory signals to T, NK and NK-T cells (reviewed in [587]). Interestingly, expression of CD73 and the adenosine A(2) receptor on MDSC from mice with lung cancer are increased, and is associated with suppression of anti-tumour T cell responses

[592, 593]. In patients with lung cancer, CD39 and CD73 are expressed on MDSC from

PBMC and tumours [533], indicating that these cells may increase extracellular adenosine levels, thereby promoting immunosuppression.

Notably, MDSC may jointly promote immunosuppression with other immune cells, including Treg [478, 482, 594], tumour-associated macrophages [540, 585, 595, 596], dendritic cells [545-548, 550] and mast cells [568, 597]. Their interplay with MDSC and anti-tumour T cells is summarised in Figure 1.2.1.4; general functions of anti-tumour T cells are summarised in Table 1.2.1.4.2.

Figure 1.2.1.4: Summary of the interplay of MDSC, anti-tumour T cells and other immunoinhibitory leukocytes in lung cancer. MDSC suppress the function of anti-tumour T cells (CD4, CD8, NK and NK-T) by increasing ROS and NO production, depleting L-arginine (the essential T cell nutrient), increasing tryptophan degradation by upregulation of indoleamine 2,3-dioxygenase (IDO) and increasing extracellular adenosine. MDSC may act in conjunction with other immune cells, including Treg, tumour-associated macrophages, some dendritic cell populations and mast cells, to promote immunosuppression.

Table 1.2.1.4.2: General functions of key anti-tumour T cells Cell type General function Regulators of function CD4  ↑ tumour cell lysis by IFN-γ and  IRF: ↑ maturation [580] granzyme B secretion (specific subsets)  IL-2: ↑ expansion [604] [507, 598, 599]  Costimulatory molecules,  ↓ angiogenesis [600] transcription factors and IL-18: ↑  ↑ helper function to CD8 T cells, NK cytokine and granzyme B secretion cells, M1 macrophages and eosinophils [605, 606] [601-603] CD8  ↑ pathogen elimination, including  IRF: ↑ maturation [580] tumour cells, by secretion of cytotoxic  IL-2: ↑ expansion [604] granzyme, perforin and cytokines (e.g.  CXCL-9 and CXCL-10: ↑ recruitment IFN-γ and TNF-α) [509, 607] [608] NK and  ↑ tumour cell cytotoxicity through  IRF: ↑ maturation [580] NK-T natural cytotoxicity receptors and  IL-2: ↑ expansion (some NK production of granzyme, perforin and populations) [604, 609] IFN-γ [510, 511]  IL-18 and/or IL-10: ↑ cytokine production [538, 539]  ICAM-1: ↑ lung tumour cell lysis by NK cells [610] ↑ = increased; ↓ = decreased

1.2.1.5 Metastasis

Cells from primary tumours often invade underlying tissues and extravasate into the circulation. Cell adhesion molecules, including immunoglobulins [611-613], integrins

[613-615], selectins [613, 616, 617] and cadherins [618-620], regulate tissue integrity by maintaining cell to cell contacts, but aberrant expression in cancer disrupts normal cell adhesion, facilitating tumour cell invasion, extravasation and metastasis [621, 622].

Epithelial-mesenchymal transition prompts tumour cell invasion and intravasation into the blood or lymphatic vessels as detached cells [370]. These circulating tumour cells are normally eliminated by anoikis (a form of programmed cell death), but if they resist anoikis, they remain viable in circulation. Anoikis resistance is mediated by inhibition of caspases in the intrinsic and extrinsic apoptosis pathways (reviewed in [623]), or pathways independent of caspases [624, 625]. Subsequently, mesenchymal-epithelial transition allows tumour cell reattachment and proliferation at distant sites [626]. The steps involved in metastasis are summarised in Figure 1.2.1.5.

Figure has been removed due to Copyright restrictions.

Figure 1.2.1.5: Schematic illustration of cancer metastasis. Primary tumours invade into the underlying tissues and intravasate into the blood or lymphatic vessels to become circulating tumour cells, a process called epithelial-mesenchymal transition. Extravasation of viable tumour cells from circulation at distant sites leads to mesenchymal-epithelial transition and metastatic growth (figure adapted and modified from Thiery [370]).

Like primary tumours, metastatic tumours also encounter oxygen and nutrient depletion, and angiogenesis is likely induced in a similar manner. VEGF secreted by tumour cells promotes blood vessel formation and facilitates adhesion and migration of circulating tumour cells (reviewed in [627]). MMP, particularly MMP-2 and MMP-9, are important for angiogenesis in cancer metastasis [628]. Accordingly, MMP-2 or MMP-9 deletion in mice contributes to vascular defects [629, 630]. MMP are synthesised and secreted in inactive forms with a pro-domain, cleavage of which activates the protease activity

(reviewed in [631]) to degrade the ECM and basement membranes, as in tissue remodelling and wound healing. MMP, including MMP-2, 3, 9, 10 and 13, promote invasion and vasculature formation into underlying tissues for migration of lung tumours cells [632, 633]. Interestingly, MMP and VEGF regulate each other to facilitate tumour cell entry into the circulation [634, 635]. In particular, MMP-9 can induce VEGF expression in lung cancer cells [636], and VEGF secreted by primary tumour cells induces

MMP-9 in VEGF-expressing endothelial cells and macrophages [637].

VEGF secreted by tumour cells also promotes lymphangiogenesis, or formation of lymphatic vessels, and facilitates tumour cell migration and settlement at distant sites

[627]. Peritumoural lymphatic vessel formation and remodelling are largely involved in metastatic spread to sentinel lymph nodes [638-640]. Notably, lymphatic endothelium- specific hyaluronan receptor (LYVE-1) is a lymphatic endothelial cell marker overexpressed in sentinel lymph nodes and peritumoural lymphatics. LYVE-1 expression is associated with poor prognosis in patients with lung cancer [641, 642], suggesting lymphatic involvement in metastasis. Although the extent to which lymphatic vessels contribute to metastasis to distant organs is still unclear, postulated mechanisms include

65 formation and enlargement of lymphatic vessels in primary tumours and lymph nodes, and remodelling of lymphatic smooth muscle cells (reviewed in [643]).

Notably, elevated ROS and NO production in the lung microenvironment is a key mediator of cancer cell migration, invasion and metastasis [442-444], in part by conferring anoikis resistance in lung cancer cells [621, 622, 644-646] and oxidatively modifying some pro-metastatic proteins [626]. Caveolin-1 is a structural protein of membrane lipid rafts that facilitates oncogenic protein signalling [647], and oxidative modifications contribute to evasion of apoptosis in human lung cancer cells [648].

Notably, ROS stabilise caveolin-1 to promote anoikis resistance in human lung cancer cells [626, 644-646]. Importantly, NO induces MMP-2 to facilitate invasion, migration and metastasis of human lung cancer cells [649]. Interestingly, MMP and caveolin-1 can be jointly regulated by S-nitrosylation. In a co-culture of human endothelial cells and lung cancer cells, MMP-9 colocalised with caveolin-1, and NO enhanced their co-expression in endothelium for promoting tumour cell invasion and migration [650]. S-nitrosylated caveolin-1 activates MMP-2 and MMP-9 to degrade endothelial cells [651], which may promote intravasation and extravasation. However, high NO concentrations suppress their expression in endothelial cells [650], suggesting that metastasis is regulated by oxidant levels in the lung microenvironment.

1.2.1.6 Prognosis and treatments for lung cancer

Lung cancer has consistently high incidence and mortality rates among men and women worldwide [652, 653]. Cancer deaths are largely a result of metastasis and poor response to chemotherapy drugs [654, 655]. Lung cancer metastasises to regional lymph nodes, liver, adrenal glands, bone marrow and brain [655, 656]. More than half of lung cancers 66

are diagnosed at advanced stages, and 5-year survival rates for patients with stages III and

IV are 24% and 10% respectively [397]. Tumours are often non-resectable in patients with advanced stages, and treatments largely involve radiotherapy and/or chemotherapy

[397].

Cisplatin and paclitaxel are first-line chemotherapeutic drugs for NSCLC [657]. Cisplatin binds and damages DNA in cancer cells to initiate apoptosis [658]. Paclitaxel is a tubulin- binding agent that suppresses microtubule depolymerisation and inhibits cancer cell mitosis [659]. In addition, tyrosine kinase inhibitors target oncogenic kinases that are often mutated in lung cancer [660] (Section 1.2.1.1), but resistance develops after prolonged treatment [658, 660]. For example, the efficacy of EGFR inhibitors is limited by the development of resistance, largely due to a T790M point mutation in exon 20 of

EGFR [377], and efficacy of ALK inhibitors is limited by mutations in the catalytic domain of the ALK protein [382]. Other potential therapies target angiogenesis (reviewed in [402, 661]), glycolysis (reviewed in [662]), arginine metabolism (reviewed in [426]),

NO [432, 663, 664] and cancer stem cells (reviewed in [387]). Host immunity remains, however, suppressed and tumours can redevelop under suitable conditions. Recently, immunotherapy has been used to treat metastatic lung cancer, with a high response rate and significant improvement in survival (double conventional therapy) [665, 666]. In particular, the FDA has approved nivolumab and pembrolizumab for NSCLC treatment

[665, 666]. These are antibodies that act as immune checkpoint inhibitors to target the binding of programmed death-ligand 1 (PD-L1) to PD-1 [665, 666]. Cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) is another target of immune checkpoint inhibitors [665, 666]. Because CTLA-4 and PD-L1 inhibit T cell activation to prevent

67 overstimulation of the immune system, their suppression restores T cell activation and hence, anti-tumour immunity [665, 666].

Section 1.2 discussed lung cancer development, focusing on important processes and mediators involved in the progression phase. Notably, increases in ROS and RNS production by oxidant-producing enzymes and deregulated expression of antioxidants are key contributors to the elevated oxidative stress in the lung microenvironment. ROS and

NO are also produced by MDSC, impairing immune surveillance and promoting tumour progression [431, 582], indicating that the redox and immune microenvironments are tightly regulated. S100A8 and S100A9 are expressed in MDSC, and are proposed to mediate MDSC recruitment in cancer [487, 564], thereby influencing its progression.

Functions of these S100 proteins in cancer are discussed in Section 1.3.

1.3 S100 proteins in cancer Expression of S100 proteins in cancer was first reported in 1980, when S100B was detected in cultured melanoma cells [667]. Since that time, S100B has become a well- established biomarker of melanoma [668]. Patients with high S100B levels in serum often have more advanced stages of melanoma [668], metastasis [669] and reduced survival

[670]. Other S100s (S100A4, S100A13) were subsequently identified in patients with melanoma, and can be potential biomarkers [671-673]. Interestingly, S100 proteins are aberrantly expressed in many other human cancers, including lung, breast, prostate, colorectal, melanoma, liver, pancreas, oesophagus, oral and oropharyngeal, but clinico- pathological implications are still emerging (reviewed in [674, 675]) (Section 1.3.1).

1.3.1 The clinical implications of S100 protein expression in human cancers

S100 proteins, generally expressed in tumour cells, are associated with poor outcomes in human cancers. They are upregulated in the majority of cancers compared to paired normal tissues, but downregulation has been reported in some cancers, particularly in the head and neck region (reviewed in [674, 675]; also refer to Tables 1.3.1.1 and 1.3.1.2).

For the purposes of this thesis, this section focuses on the clinico-pathological associations of S100A8 and S100A9 in lung cancer and other cancers; others are summarised in Tables 1.3.1.1 and 1.3.1.2.

In patients with lung cancer, S100A8 and S100A9 expression has been reported, but their correlation with prognosis is inconclusive. S100A8 is shown to be elevated in BALF from lung cancer patients [676], although the clinical implications are unclear. Expression of

S100A9 in tumour cells [677] or MDSC from patients with lung cancer has been

69 associated with reduced survival [207, 493, 677] and/or poor response to chemotherapy

[207, 493]. Interestingly, in another study, while high S100A8 and S100A9 expression in tumour islets, particularly squamous cell carcinoma, correlated with prolonged survival, their high expression in stroma cells was associated with reduced survival [207]. However,

Su et al. [678] reported a positive correlation between S100A8 and S100A9 expression in tumour cells with advanced adenocarcinoma. Collectively, correlation of S100A8 and

S100A9 with lung cancer outcomes may depend on cancer subtypes and stages, and cell expression profiles.

In some other cancers, associations of S100A8 and S100A9 with clinical outcomes are somewhat more conclusive. Their overexpression in tumour cells predicts a poor prognosis, including more advanced cancer stages, poorly differentiated (higher grade) tumours, invasion and metastasis, and reduced survival, in invasive ductal breast carcinoma [679-681], prostate [682], colorectal [683, 684] and liver cancers [685]. In contrast, the absence of S100A8 and S100A9 in normal oesophageal epithelial cells and well-differentiated tumour cells has been correlated with more poorly-differentiated tumours [686]; S100A9 is dramatically downregulated in a majority of poorly- differentiated oesophageal tumours [687], and S100A8 expression in these tumours also predicts reduced survival [688].

S100A8 and/or S100A9 expression in stromal, or infiltrating cells, may also correlate with cancer outcomes. Their overexpression in inflammatory stromal cells predicts more advanced stages of hepatic cancer [685], and may be diagnostic markers for pancreatic cancer [689]. In breast cancer, elevated stromal S100A8 expression predicts poor outcomes [681]. In particular, infiltrating S100A8+ myeloid cells are associated with more

metastasis and reduced survival [690]. Stromal S100A8 and S100A9 overexpression in colorectal cancer is associated with poor tumour differentiation, progression and metastasis [683, 684], although another study reported an association of S100A8 overexpression in stromal cells with a better prognosis [691]. Similarly, high numbers of

S100A9+ inflammatory cells in stroma predict reduced survival of prostate cancer [692], and S100A9-expressing MDSC may predict poor outcomes of colorectal cancer [206].

Although S100A9 expression in infiltrating neutrophils and macrophages indicates early- stage gastric cancer [693], high numbers of infiltrating stromal S100A9+ cells were associated with reduced lymph node metastasis and invasion, prolonged survival, and a favourable prognosis [693, 694]. Although S100A8 expression in infiltrating stromal cells is also reported in gastric cancer, correlations with clinical outcomes were not identified

[693, 694]. Similarly, MDSC numbers in blood are positively associated with plasma

S100A8/A9 levels in patients with gastric cancer and associated with more advanced disease and reduced survival, but a direct correlation of S100A8/A9 with clinical outcomes was not reported [695]. The types of stromal cells in most of these studies were not identified, and it is possible that S100A8 or S100A9-expressing stromal cell types are predictive of different outcomes in colorectal cancer.

S100A8 and S100A9 are also proposed biomarkers for some cancers. Elevated S100A9 levels in serum was a proposed diagnostic marker for prostate cancer [682], but another study questions whether plasma S100A9 levels are an effective predictor for prostate cancer [696]. S100A8 and S100A9 levels in plasma may be diagnostic markers for colorectal cancer [697]. S100A8 overexpression in tumour cells [698] and elevated levels in saliva [699] are proposed biomarkers for oral squamous cell carcinoma, whereas stromal S100A9 overexpression may predict recurrence at early-stage oral squamous cell

71 carcinoma [700]. However, the absence of S100A8 and S100A9 in gingival tissues from oral lesions may indicate onset of oral squamous cell carcinoma [701]. This indicates that

S100A8 and S100A9 expression can vary with cancer stage.

Collectively, S100A8 is often highly co-expressed with S100A9 in tumours, infiltrating cells and/or various stromal cells, and upregulation has been associated with poor outcomes. S100A8 and S100A9 are proposed biomarkers for some cancers, although more in-depth studies with larger patient cohorts from different stages of cancer are required. Moreover, a major limitation of clinical association studies is a lack of functional information, and an association of a protein with poor cancer outcomes does not necessarily imply pro-tumourigenic functions because a protein may be compensatorily upregulated, and have other uncharacterised functions. The functions of

S100A8 and S100A9 in cancer are of interest given they are, to date, the only reported

S100 proteins expressed in MDSC [209]. S100A8 and S100A9 may modulate various functions in cancer (Sections 1.3.3-1.3.4), although their precise functions are yet to be fully elucidated.

Table 1.3.1.1: Some clinico-pathological associations of S100 protein overexpression in common human cancers S100 Cancer Expression Clinico-pathological associations Reference pattern Cancer Cancer Invasion/ Survival stage grade metastasis S100A2 Lung T - - ↑ ↓ [702-706] Colorectal T - - - ↓ [707] Pancreatic T - - - ↓ [708, 709] Oesophagus T - - ↑ - [710, 711] Gastric T - - - - [712, 713] S100A3 Gastric T ↑ ↑ ↑ - [713] S100A4 Lung T - - - ↓ [714, 715] Breast T - - - ↓ [716-718] Pancreatic T - - ↑ ↓ [719] Prostate T ↑ - ↑ - [720] Colorectal T - - ↑ ↓ [721-724] Oesophagus T - - ↑ - [710, 711, 725] Oral T ↑ - ↑ - [726, 727] S100A6 Liver T ↑ - - - [728] Pancreatic T ↑ - ↑ - [729] Gastric T - - ↑ - [730] S100A7 Lung T ↑ - ↑ - [731] Breast T, I ↑ - - ↓ [732] Oral T ↑ - - ↓ [733, 734] S100A8 Lung BALF - - - - [676] Breast T, S, I - - ↑ ↓ [681, 690] Prostate T - ↑ - - [682] Colorectal S - - ↓ - [691] Gastric I - - - - [693, 694] S100A9 Lung T - - - ↓ [207, 493, 677] Colorectal MDSC - - - - [206] Prostate T, S - ↑ - ↓ [682, 692] Gastric I - - ↓ ↑ [693, 694] S100A8/A9 Lung T - - - ↑ [408] Lung T ↑ - - - [678] Lung S - - - ↓ [408] Breast T - ↑ ↑ ↓ [679, 680] Colorectal T, S ↑ ↑ ↑ - [683, 684] Liver T, I ↑ - - - [685] S100A10 Lung T ↑ ↑ ↑ - [735] S100A11 Lung T - ↑ - ↓ [736] Colorectal T ↑ - - - [737] Pancreatic T - - ↑ - [738] S100A14 Liver T - - - ↓ [739] Breast T - - ↑ ↓ [740, 741] S100A16 Lung T ↑ ↑ ↑ ↓ [742] Breast T - - ↑ ↓ [740, 741] S100B Breast T - - - ↓ [743] Colorectal T ↑ - - ↓ [744] S100P Breast T - - - ↓ [745] Liver T ↑ - - - [746] S100 is overexpressed compared with paired normal tissues. T = tumour cells, S = stromal cells, I = tumour-infiltrating cells; BALF = bronchoalveolar lavage fluids; MDSC = myeloid-derived suppressor cells; ↑ = increased; ↓ = decreased; - = not determined. 73

Table 1.3.1.2: Some clinico-pathological associations of S100 protein underexpression in common human cancers S100 Cancer Expression Clinico-pathological associations Reference pattern Cancer Cancer Invasion/ Survival stage grade metastasis S100A2 Prostate T ↑ - ↑ - [720] Oesophagus T - ↑ - - [711] Gastric T ↑ ↑ ↑ ↓ [747-749] S100A6 Lung T - - - ↓ [750] S100A8 Oro- T - - - ↓ [688] pharyngeal S100A9 Oesophagus T - ↑ - - [687] S100A8/A9 Oesophagus T - ↑ - - [686] Oral G ↑ - - - [701] S100A12 Oro- T - - - ↓ [688] pharyngeal S100A14 Colorectal T - - ↑ ↓ [721] Oesophagus T - ↑ - - [751] S100A16 Oral T - ↑ - ↓ [752] S100 is underexpressed compared with paired normal tissues. T = tumour cells, G = gingiva tissues with oral lesions; ↑ = increased; ↓ = decreased; - = not determined.

1.3.2 Putative S100A8 and S100A9 receptors in lung cancer

Detection of S100 proteins in body fluids from cancer patients (Section 1.3.1) suggests that they may have various extracellular functions in cancer. Some of the putative receptors, including RAGE, TLR, CD69, EMMPRIN and MCAM (described in Section

1.1.7), may contribute to the functions of S100A8 and S100A9 in cancer.

In normal lungs, RAGE is abundant and mediates adhesion of alveolar cells to basement membranes [753]. It is important for alveolar cell differentiation [754], and increases the surface area of alveolar cells for effective gas exchange [755]. RAGE is upregulated in most cancers and associated with poor outcomes [756], possibly because of its link between chronic inflammation and cancer by activation of various downstream pathways, such as ERK, MAPK and NF-ҡB, which transduce pro-tumourigenic signals, including proliferation, growth and invasion (reviewed in [753]). Although RAGE is reported to be downregulated in lung cancer [757], it has been frequently associated with more invasive tumour growth [758, 759]. However, silencing RAGE suppressed growth and metastasis in mice with lung cancer [760], suggesting that its pro-tumourigenic functions are concentration-dependent.

RAGE, a putative S100 receptor, is also expressed on MDSC, and S100A8/A9 has been reported to promote MDSC accumulation in a RAGE-dependent manner in tumour- bearing mice or ex vivo cultures of cancer cells from patients [209, 498, 564, 695, 761].

S100A8/A9 binding to RAGE promoted breast cancer metastasis to lungs in vivo [762].

Taken together with RAGE expression on MDSC, and the pro-metastatic function of these cells [488], S100A8/A9 may bind RAGE on MDSC to influence metastasis. By contrast, S100A8/A9 is also reported to bind RAGE on NK cells, thereby increasing 75 tumour cell killing in mice with colon cancer [763], which suggests that RAGE may also promote anti-tumourigenic functions.

TLR recognise conserved-associated molecular patterns from pathogens and damage- associated molecular patterns from necrotic cells, and activate innate and adaptive immune responses via various downstream pro-tumourigenic pathways, including NF-

ҡB and STAT3 (reviewed in [764, 765]). TLR expression in immune cells and tumour cells is reported; TLR-4 is an LPS receptor and its functions in cancer are widely studied

(reviewed in [765]). S100A9 is reported to bind TLR-4 to promote tumour growth [766]; it also binds TLR-2 to promote human leukaemia cell differentiation [297]. In human lung cancer cells, activation of TLR-4 signalling induces immunosuppressive cytokines to promote immune escape [767] and ROS production that increases metastatic potential

[768]. LPS can promote MDSC expansion in normal lungs [769], suggesting a role for

TLR-4 activation in this response. In support of this, stimulation of murine lung cancer cells with LPS promotes secretion of TGF-β and IL-10 [770], factors that promote MDSC expansion and/or activation (refer to Section 1.2.1.4). In mice, S100A8 was reported to bind TLR-4 to recruit MDSC in lung cancer [771], and to induce SAA3, thereby establishing a niche for pulmonary metastasis [497]. Although TLR-4 generally plays a pro-tumourigenic role, TLR-4 can be anti-tumourigenic (reviewed in [764]). S100A8/A9 activates TLR-4 on CD8 T cells to promote expansion in autoimmune disorders [772], and a similar function may exist in cancer. However, our experiments failed to implicate

S100A8 in TLR-4 and/or RAGE activation in murine lungs [224] (refer to Section

1.1.7.2).

CD69 is expressed on activated leukocytes [773], and its ligation downregulates immune responses. CD69-deficient mice have higher NK cell activity and less tumour growth [774,

775]. In patients with lung cancer, a population of CD69+ Treg accumulates in tumours with a concomitant reduction in NK and NK-T cell numbers, compared to normal lung tissues [776]. This observation is reproduced in mice with lung cancer, where numbers of

CD69+ Treg increase with tumour growth [777]. Recently, S100A8/A9 was shown to bind

CD69 to promote Treg differentiation of PBMC from healthy subjects [303]. Although

S100A8/A9-CD69-mediated Treg expansion is not reported in cancer, a similar function may exist because Treg contributes to immunosuppression in cancer [778].

EMMPRIN (CD147) is a transmembrane glycoprotein expressed in leukocytes, platelets and endothelial cells [779], and is associated with resistance to cisplatin-based chemotherapy in patients with advanced lung cancer [780]. EMMPRIN is often overexpressed in tumour cells and its ability to potently induce MMP suggests a role in promoting metastasis (reviewed in [781]). S100A9, but not S100A8, is reported to bind

EMMPRIN [299] to promote metastasis of melanoma in mice [300]. This may also be relevant in lung cancer because EMMPRIN is overexpressed in lung cancer [781].

MCAM is a receptor expressed in the junctions between endothelial cells and promotes various cellular functions (reviewed in [782]). It is a marker for melanoma [782] with high structural identity to RAGE [302]. Like RAGE, MCAM is reported to bind

S100A8/A9, and activates NF-ҡB with increased ROS production that facilitates melanoma progression and lung metastasis [302]. MCAM overexpression in tumours has been associated with reduced survival in patients with lung cancer [783, 784], which

77 suggests that S100A8/A9 may promote progression by binding MCAM. Functions of

S100A8 and S100A9, reported as a consequence of interactions with some of these receptors in cancer, are discussed in Sections 1.3.3 to 1.3.4.

1.3.3 Functions of S100 proteins in vitro

1.3.3.1 Effects of S100 proteins on cancer cell proliferation

S100 proteins are reported to promote cancer cell proliferation by various mechanisms, including inhibition of the tumour suppressor, p53 [141, 146, 270, 785-789], activation of RAGE and RAGE-mediated downstream pro-tumourigenic pathways (ERK1/2,

MAPK and NF-ҡB) (reviewed in [753]), activation of Akt that promotes cell survival and cell cycle progression [790] and activation of the Wnt/ β-catenin pathway to induce target genes involved in cell survival and proliferation (reviewed in [791]). Zn2+ may promote

S100 protein interactions with their putative receptors, such as S100A7 and S100A15 ligation with RAGE [77, 78], and S100 proteins are reported to promote cancer cell proliferation via RAGE activation [292, 761, 792-796]. Interestingly, Zn2+ chelation in the extracellular compartment by some S100 proteins induces apoptosis of some cancer cell lines [87, 88], although it is unclear if this is RAGE-dependent. For the purposes of this thesis, this section discusses the effects of S100A8 and/or S100A9 on cancer cell viability in vitro.

Effects of S100A8 and S100A9 on lung cancer cells are only reported in one study, in which silencing either protein in murine LLC cells had no obvious effects on proliferation or apoptosis [797], although it was unclear if exogenous S100A8 or S100A9 affected viability. Similar observations are also reported in murine colon cancer cells (MC38)

[797]. However, S100A8 (4 μg/mL) or S100A9 (1 or 4 μg/mL) increased proliferation of murine colon cancer cells (CT26) via Akt activation [798], and S100A8/A9 (1 μg/mL) promotes proliferation of these cells via RAGE [761]; there were no apparent effects at a lower concentration [763]. S100A8 or S100A9 (10 and 20 μg/ml) also caused proliferation of human colon cancer cells (HCT116 and SW480) via activation of the 79

Wnt/β catenin pathway [683]. In contrast, S100A8/A9 (150 μg/mL or above) induced apoptosis of human colon cancer cells (HT29/219 and SW742) by increased Zn2+ chelating in the extracellular compartment [799]. Similar findings are reported with breast cancer cells; a high concentration of S100A8 or S100A9 (20 μM) did not alter viability of murine mammary carcinoma cells (MM46), whereas S100A8/A9 (10 μM) increased apoptosis by chelating extracellular Zn2+ [800]. Stimulation of human breast cancer cells

(MCF-7) with S100A8 (5, 40 and 100 μg/mL) or S100A9 (40 and 100 μg/mL) increased proliferation after 6 days [801]. In contrast, MCF-7 cells transfected with S100A9 had reduced proliferation [801], and S100A9 induction in MCF-7 cells by oncostatin M

(cytokine) activates STAT3 and promotes apoptosis [802], indicating a protective function intracellularly. S100A8/A9 (10 μg/mL) also increased proliferation of human breast cancer cells (MCF-7 and MDA-MB231), and neuroblastoma cells (SHEP and

KELLY), possibly by RAGE and MAPK activation [292], whereas increased apoptosis occurred with 100 μg/mL by a similar mechanism [803].

Transfection of S100A8 into human liver cancer cells (Huh7 and MHCC-97H) increased proliferation, although mechanisms are unknown [804]. S100A9 promotes proliferation of liver cancer cells (HepG2, SMMC-7721 and Huh7) by increasing RAGE and MAPK activation [805]. However, S100A8 did not alter proliferation or apoptosis of murine EL-

4 lymphoma cells treated up to a concentration of 40 µM, which level is reported to have mild cytotoxic effects; S100A9 (≥ 10 μM) and S100A8/A9 (5 μM) promoted apoptosis by chelating extracellular Zn2+ [88]. S100A8/A9 (100 μg/mL) also promoted apoptosis of human leukaemia cells (Jurkat BJAB) by increasing RAGE signalling [803].

Transfection of S100A9 into human oral cancer cells (TW-2.6 and HSC-3) increased proliferation of the former, but not the latter [700]. Similarly, transfection of S100A8/A9 80

into human head and neck carcinoma cells (KB; S100A8/A9-negative) inhibited cell cycle progression, and reduced cell division and proliferation, whereas silencing endogenous S100A8/A9 expression in TR146 cells promoted opposite effects [806].

S100A8 can be induced by PGE2 via activation of protein kinase A and C/EBPβ in human prostate cancer cells (PC-3) [807]. S100A8 and S100A9 can be induced by HIF-α binding to their promoter regions [808]. However, stimulation of PC-3 cells with 10 μg/mL

S100A8/A9 had no obvious effects [809].

Collectively, these studies suggest that S100A8, S100A9 and S100A8/A8 promote proliferation or apoptosis of some cancer cells in a cell line- and concentration-dependent manner; low concentrations generally increase proliferation, whereas high concentrations are apoptotic (summarised in Table 1.3.3.1).

Table 1.3.3.1: Effects of S100A8, S100A9 and S100A8/A9 on cancer cell viability in vitro S100 Species Cell type Conc. Effect Proposed Ref. (μg/mL) P A mechanism S100A8 Mouse Lung: LLC *S / / - [797] Mouse Colon: MC38 *S / / - [797] Mouse CT26 4 ↑ - ↑ Akt1-Smad5-Id3 [798] signalling Human HCT116, SW480 10, 20 ↑ - ↑ Wnt/β-catenin [683] signalling Mouse Breast: MM46 200 / / - [800] Human MCF-7 5, 40, ↑ - - [801] 100 Human Liver: Huh7, MHCC-97H *T ↑ - - [804] Mouse Lymphoma: EL-4 400 - ↑ - [88] S100A9 Mouse Lung: LLC *S / / - [797] Mouse Colon: MC38 *S / / - [797] Mouse CT26 1, 4 ↑ - ↑ Akt1-Smad5-Id3 [798] signalling Human HCT116, SW480 10, 20 ↑ - ↑ Wnt/β-catenin [683] signalling Mouse Breast: MM46 260 / / - [800] Human MCF-7 40, 100 ↑ - - [801] Human MCF-7 *T ↓ - - [801] Human MCF-7 *T - ↑ ↑ STAT3 activation [802] Human Liver: HepG2 20 ↑ - ↑ RAGE and [805] SMMC-7721 MAPK activation Huh7 Mouse Lymphoma: EL-4 ≥ 100 - ↑ ↑ Zn2+ chelating [88] Human Oral: TW-2.6 *T ↑ - - [700] Human HSC-3 *T / / - [700] S100A8/ Mouse Colon: CT26 1 ↑ - ↑ RAGE signalling [761] A9 Mouse CT26 5 x 10-6 / / - [763] Human HT29/219, SW742 ≥ 150 - ↑ ↑ Zn2+ chelating [799] Mouse Breast: MM46 230 - ↑ ↑ Zn2+ chelating [800] Human MCF-7 10 ↑ - ↑ RAGE and [292] MDA-MB231 MAPK activation Human MCF7 100 - ↑ ↑ RAGE signalling [803] MDA-MB231 Human Neuroblastoma: SHEP 10 ↑ - ↑ RAGE and [292] KELLY MAPK activation Human SHEP 100 - ↑ ↑ RAGE signalling [803] KELLY Mouse Lymphoma: EL-4 115 - ↑ ↑ Zn2+ chelating [88] Human Leukemia: Jurkat BJAB 100 - ↑ ↑ RAGE signalling [803] Human Head and neck: KB *T ↓ - ↓ cell cycle [806] progression Human TR146 *S ↑ - ↑ cell cycle [806] progression Human Prostate: PC-3 10 / / - [809] Conc. = concentration; Cancer cells were not stimulated with S100A8 or S100A9 in some studies, but expression was induced by transfection or oncostatin M (*T) or silenced (*S); P = proliferation; A= apoptosis; ↑ = increased; ↓ = decreased; / = no obvious effects; - = not determined; Ref. = reference.

1.3.3.2 Regulation of cancer cell invasion and migration by S100 proteins

Some S100 proteins promote cell invasion and migration; in particular, S100A4 is best characterised by its pro-metastatic role (reviewed in [810]), including in lung cancer [811-

813]. S100A4 also stimulates pro-tumourigenic T cell migration into tumours by inducing cytokines, including GM-CSF and CCL-24, thereby facilitating lung metastasis [814].

S100A8 and/or S100A9 are also reported to promote cancer cell invasion and migration

(reviewed in [167]), and this section discusses these effects.

Manipulation of the S100A8 and/or S100A9 genes, or stimulation of cells with exogenous

S100A8 and/or S100A9, affected the capacity for migration or invasion. Silencing

S100A8 or S100A9 expression in murine lung cancer cells (LLC) reduced the capacity for invasion and migration and concomitantly reduced MMP-2 and MMP-9 expression

[797], suggesting that effects are mediated by MMP. Very low concentrations of exogenous S100A8 (100 pg/mL) or S100A9 (1 ng/mL) promotes migration of LLC cells

(also B16 melanoma cells) via activation of MAPK pathway [815]. TLR receptors are constitutively expressed on LLC cells [770], and S100A8 (0.1 μg/mL) was reported to promote their migration via TLR signalling [771]. When the S100A8 or S100A9 gene was silenced in murine colon cancer (MC38) [797] or human gastric cancer (SNU484) cells [816], their capacity for invasion and migration was compromised, and effects may be MMP-dependent. S100A8 or S100A9 (4 μg/mL) also increased invasion of murine colon cancer cells (CT26) via activation of the Akt pathway [798]. S100A8 or S100A9

(10 μg/mL) also increased migration of human colon cancer cells (HCT116 and SW480), but via the Wnt/β-catenin pathway [683]. S100A8 overexpression in human liver cancer cells (Huh7 and MHCC-97H) by transfection [804], and of S100A9 in oral cancer cells

(TW-2.6 and HSC-3) [700], increased invasion and migration, although the mechanisms

83 are unknown. S100A9 (20 μg/mL) is reported to increase invasion of some human liver cancer cells (HepG2, SMMC-7221 and Huh7) by activating RAGE and the MAPK pathways [805].

The ability of the S100A8/A9 complex to alter invasion and migration has been exclusively reported using human cancer cell lines. It increases migration of melanoma cells (WC62) in response to S100A8/A9 (0.1 μg/mL) [796], and primary epidermal squamous cell carcinoma cells (0.1 and 1 μg/mL), via RAGE signalling [817]. Similarly,

RAGE ligation with S100A8/A9 (10 μg/mL) is implicated in invasion and migration of the breast cancer cells, MCF-7 and MDA-MB-231 [762]. S100A8/A9 may promote these functions by inducing MMP, as shown in gastric cancer cells (SNU216 and SNU484) stimulated with exogenous S100A8/A9 (1 µg/mL) [818], or when expression is silenced in nasopharyngeal cells (CNE1) [819].

Although S100A8, S100A9 and S100A8/A9 increase invasion and migration of some cancer cells (summarised in Table 1.3.3.2), S100A9 (0.1 μg/mL) decreased these responses in gastric cancer cells (BGC-823) [693]. Transfection of S100A8 and S100A9 into an S100A8/A9-negative head and neck cancer cell line (KB) reduced invasion, migration and MMP-2 expression, although silencing endogenous S100A8 and S100A9 expression in another cell line (TR146) promoted opposite effects [820]. Collectively, these studies suggest that S100A8 and S100A9 may promote cancer cell invasion and migration, but again, responses may depend on the particular cancer cell type, concentrations, and/or intracellular expression patterns.

Table 1.3.3.2: Effects of S100A8, S100A9 and S100A8/A9 on cancer cell invasion and migration in vitro S100 Species Cell type Conc. Effect Proposed mechanism Ref. (μg/mL) I M S100A8 Mouse Lung: LLC *S ↓ ↓ ↓ MMP induction [797] Mouse LLC 10-4 - ↑ ↑ MAPK activation [815] Mouse LLC 0.1 - ↑ ↑ TLR signalling [771] Mouse Colon: MC38 *S ↓ ↓ ↓ MMP induction [797] Mouse CT26 4 ↑ - ↑ Akt1-Smad5-Id3 [798] signalling Human HCT116 10 - ↑ ↑ Wnt/β-catenin [683] SW480 signalling Mouse Melanoma: B16 10-4 - ↑ ↑ MAPK activation [815] Human Liver: Huh7 *T ↑ ↑ - [804] MHCC-97H Human Gastric: SNU484 *S ↓ ↓ ↓ MMP induction [816] S100A9 Mouse Lung: LLC *S ↓ ↓ ↓ MMP induction [797] Mouse LLC 10-3 - ↑ ↑ MAPK activation [815] Mouse Colon: MC38 *S ↓ ↓ ↓ MMP induction [797] Mouse CT26 4 ↑ - ↑ Akt1-Smad5-Id3 [798] signalling Human HCT116 10 - ↑ ↑ Wnt/β-catenin [683] SW480 signalling Mouse Melanoma: B16 10-3 - ↑ ↑ MAPK activation [815] Human Liver: HepG2 20 ↑ - ↑ RAGE and MAPK [805] SMMC-7721 activation Huh7 Human Gastric: SNU484 *S ↓ ↓ ↓ MMP induction [816] Human BGC-823 0.1 ↓ ↓ - [693] Human Oral: TW-2.6 *T ↑ ↑ - [700] HSC-3 S100A8/ Human Breast: MCF-7 10 ↑ ↑ ↑ RAGE signalling [762] A9 MDA-MB- 231 Human Prostate: PC-3 10 / / - [809] Human Melanoma: WC62 0.1 - ↑ ↑ RAGE signalling [796] Human Epidermal: 0.1, 1 - ↑ ↑ RAGE signalling [817] Primary squamous cell carcinoma Human Gastric: SNU216 1 ↑ ↑ ↑ NF-ҡB activation and [818] SNU484 MMP induction Human Head and neck: *T ↓ ↓ ↓ MMP-2 expression [820] KB Human TR146 *S ↑ ↑ ↑ MMP-2 expression [820] Human Nasopharyngeal: *S - ↓ ↓ MMP-7 expression [819] CNE1 Conc. = concentration; *T = cancer cells were not stimulated with S100A8 or S100A9, but expression was induced by transfection; *S = cancer cells were not stimulated with S100A8 or S100A9, but expression was silenced; I = invasion; M = migration; ↑ = increased; ↓ = decreased; / = no obvious effects; - = not determined; Ref. = reference.

1.3.4 Functions of S100 proteins in cancer in vivo

Clinico-pathological association studies have, to date, failed to reveal functions of S100 proteins in cancer, and in vivo studies indicating effects of S100 proteins on cancer cell proliferation, invasion and migration must follow in vitro indicators of particular functions. To address this, some S100 protein functions have been investigated in mice with subcutaneous, intravenous or orthotopic tumours, chemically-induced tumours, or in transgenic cancer models. In these, S100 expression in tumour cells may have been increased by transfection, or reduced by a stable knockdown, inhibited by intravenous administration of an S100 neutralising antibody, or using S100 knockout mice.

Interestingly, and consistent with the clinico-pathological associations of S100 in cancer

(Section 1.3.1) and observations in vitro (Section 1.3.3), some in vivo studies report pro- tumourigenic functions of S100 proteins (reviewed in [674]). For the purposes of this thesis, this section will focus on functions of S100A8 and/or S100A9 in lung and other cancers.

1.3.4.1 Pro-tumourigenic functions of S100 proteins

1.3.4.1.1 Primary tumour growth and survival

Although S100A8 silencing in lung tumour cells (LLC) has no obvious effects on proliferation in vitro or on subcutaneous tumour growth in vivo [797], tail vein injection of an anti-S100A8 neutralising antibody had the effect of reducing subcutaneous LLC growth in vivo [771]. It is suggested that this was a result of reduced TLR-4 activation

[771], and that systemic S100A8 may promote tumour growth. S100A9 silencing in LLC

[797], or knockout in mice, did not alter the growth of chemically-induced lung tumours

[821], although survival was prolonged in the latter [821], indicating that S100A9

promotes tumour progression. To date, Ortiz et al. [821] is the only study to report effects of S100 proteins on survival of mice with cancer.

S100A8 alone or the S100A8/A9 complex does not promote the growth of other cancers in vivo in general, except for cutaneous squamous cell carcinoma (Table 1.3.4.1). In this case, S100A8, S100A9 or S100A8/A9 overexpression in SCC12 cells increased the growth of intradermally-implanted tumours [822]. S100A9 is also reported to promote the growth of colorectal, liver, prostate or lymphoma malignancies in vivo [226, 564, 766,

805, 823] (Table 1.3.4.1). S100A9-/- mice have reduced subcutaneous colon tumour growth (MC38), possibly through RAGE ligation reduction, and activation of downstream signalling via MAPK and NF-ҡB [564]. However, silencing S100A9 expression in MC38 cells did not alter subcutaneous tumour growth after implantation

[797], suggesting that systemic S100A9 may influence tumour growth. S100A9-/- mice also display less growth of the following: chemically-induced liver cancer (by reducing phosphorylation of pro-tumourigenic molecules, c-Jun and JNK [823]), transgenic prostate adenocarcinoma (by reducing TLR-4 activation [766]), and subcutaneously implanted lymphoma (by reducing STAT3 induction [226] or TLR-4 activation [766]).

STAT3 is a downstream target of TLR-4 (reviewed in [764, 765]), suggesting that

S100A9 activates TLR-4 to influence STAT3 expression/activation and transduce pro- tumourigenic signals. Interestingly, intratumoural injection of an anti-S100A9 antibody reduced the growth of subcutaneously implanted liver cancer cells (HepG2), by reducing

RAGE signalling [805], suggesting that S100A9 within tumours locally influences the growth of some types.

1.3.4.1.2 Angiogenesis, invasion and metastasis

Little is known about clinical relationships of most S100 with angiogenesis in cancer, except for S100A4 and S100P. S100A4 expression in tumour cells is positively correlated with angiogenesis in patients with breast cancer [717]. Transgenic mice overexpressing

S100A4 have increased production of pro-angiogenic factors, including VEGF-A and tenascin-C, that induce angiogenesis in mice with orthotopic breast cancer (4T1) [824].

Overexpressing or silencing S100A4 expression in MDA-231 breast cancer cells indicates a role in angiogenesis following systemic injection, possibly mediated by induction of MMP-13 activity [825]. A pro-angiogenic role for S100A4 is also reported in melanoma [826], prostate [827] and pancreatic cancer in vivo [826]. S100P also promotes angiogenesis, since silencing its expression in lung adenocarcinoma cells

(HTB56 and HTB58) reduced angiogenesis in subcutaneously implanted tumours [828].

Involvement of S100A8 and/or S100A9 in angiogenesis in cancer is not reported. S100A9 promotes angiogenic sprouting of endothelial cells (HMEC-1) into a collagen matrix in vitro [700], and its overexpression in oral cancer cells (TW-2.6) increased numbers of

CD31+ vessels in murine xenograft tumours [700], suggesting a pro-angiogenic role.

S100A8 (10 μg/mL) also promoted vessel formation in mice transplanted with Matrigel plugs [829], in which transcriptional activation of HIF-1 in myeloid cells enhances VEGF and S100A8 secretion from monocytes to promote neovascularisation [635].

Although the precise roles of S100A8 and/or S100A9 in metastasis in lung cancer are unclear, they promote invasion and migration of lung cancer cells (LLC) in vitro [771,

797, 815] (Table 1.3.3.2). In vivo studies support pro-metastatic roles, because silencing

S100A8 or S100A9 gene expression in LLC cells reduces metastasis of subcutaneous

tumours to the liver [797]. S100A8 and/or S100A9 also promotes metastasis in other cancers. In colorectal cancer, transfection of S100A8 into cancer cells increases metastasis of tail vein-injected tumours to lungs and liver via the Akt pathway [798], whereas silencing of S100A8 expression in cancer cells reduces metastasis of subcutaneous tumours to the liver by suppressing MMP induction [797]. Similarly,

S100A9 knockout in mice or silencing in colon cancer cells (MC38) reduces metastasis of subcutaneous tumours to the liver; pro-metastatic function may be mediated by RAGE ligation and downstream MMP induction [564, 797]. Notably, MMP induction by

S100A9 may occur via binding the EMMPRIN receptor, a reported mechanism whereby invasion and metastasis occur in S100A9 transgenic mice with tail vein-injected melanoma [300]. Consistent with increases in cancer cell invasion and migration in vitro

[762, 830] (Table 1.3.3.2), S100A8/A9 is positively correlated with metastasis of invasive ductal breast carcinoma in vivo [679, 680]. Intra-tumoural S100A8/A9 administration to palpable mammary tumours promotes metastasis to lungs, possibly via RAGE signalling

[762].

1.3.4.1.3 Regulation of myeloid cell function and immunosuppression

Impaired mature myeloid cell differentiation contributes to MDSC accumulation [226,

481]. S100A9 is an important mediator of this dysregulated myeloid cell differentiation in cultured embryonic stem cells and transgenic mice, thereby facilitating immunosuppression [226]. S100A9-/- mice confirm its role in MDSC accumulation in cancer [226, 564, 821]. S100A8/A9 inhibits differentiation of embryonic stem cells into dendritic cells to a lesser extent than S100A9, but promotes a more pronounced effect on

MDSC accumulation [226]. Notably, S100A8 and S100A9 are detected in MDSC isolated from patients with gastric cancer [695]. A positive autocrine feedback loop of 89

S100A8/A9 and MDSC was reported using MDSC isolated from patients with gastric cancer [695]. RAGE binding by S100A8/A9 on MDSC may promote recruitment, and subsequent secretion of more S100A8/A9 from MDSC may potentiate immunosuppression [695]. In vivo, RAGE signalling has been proposed as a mechanism whereby S100A9 or S100A8/A9 promotes MDSC recruitment to breast and colorectal tumours [209, 564, 762]; blocking S100A8/A9 binding to RAGE using an anti-glycan- specific antibody was found to have reduced MDSC accumulation in breast tumours [209].

MAPK, a downstream signalling pathway activated by RAGE (reviewed in [753]), is implicated in S100A8 and/or S100A9-mediated MDSC recruitment, as reported for lung cancer and melanoma in vivo [815]. In mice implanted with intravenous lung cancer (LLC) or melanoma (B16) cells, intravenous administration of anti-S100A8 and S100A8/A9 neutralising antibodies reduced MAPK activation and myeloid cell recruitment into lungs

[815]. However, characterisation of the neutralising anti-S100 antibodies was insufficient in this study, and cross-reactivity with other S100 proteins was not defined.

Notably, tail vein injection of an anti-S100A8 neutralising antibody was claimed to reduce TLR-4-dependent MDSC recruitment following subcutaneous LLC implantation, thereby establishing a metastatic niche [497, 771]. SAA3, a TLR-4 ligand, was reported to contribute to MDSC recruitment by S100A8 in lung cancer, because treatment with an anti-SAA3-antibody abrogated this [497]. Notably, the neutralising anti-S100 antibodies in these studies were, again, not adequately characterised, and might cross-react with other S100 proteins. S100A9-/- mice had less splenic MDSC recruitment in subcutaneous lymphomas, possibly as a result of STAT3 induction [226]. STAT3 is involved in downstream signalling pathway following TLR-4 activation (reviewed in [764, 765]), suggesting that S100A9 may bind TLR-4 on MDSC to promote recruitment. 90

Functions of S100A8 or S100A9 influencing MDSC were also reported in non-cancer settings. In naïve mice given intraperitoneal THC, an exogenous cannabinoid that suppresses anti-tumour immunity, MDSC numbers increased [831]. Interestingly,

S100A8 secretion from MDSC increased following THC treatment, and administration of an anti-S100A8 antibody intraperitoneally significantly reduced PMN-MDSC activation [563]. Because MDSC accumulation may occur via a two-signal model, in which the first signal promotes MDSC expansion, and the second promotes their activation [486], S100A8 may increase MDSC accumulation. It is shown, however, that

S100A8 has a less marked inhibitory effect on dendritic cell differentiation than S100A9 or S100A8/A9, and does not promote MDSC accumulation [226]. The precise roles of

S100A8 in MDSC accumulation, particularly in cancer, require more thorough characterisation. Intraperitoneally injected glucocorticoid induces S100A9, and this promotes PMN-MDSC accumulation and induction of hepatic steatosis in mice [562], whereas silencing S100A9 expression in hepatocytes reduced these [562]. This suggests that S100A9 may promote the suppressive function of MDSC, but whether it has this function in cancer requires further investigation.

Some pro-tumourigenic functions of S100A8, S100A9 and S100A8/A9 are summarised in Table 1.3.4.1. Pro-tumourigenic functions in lung and other cancers are also reported for S100A2 [705, 832], S100A3 [833], S100A4 [824-827, 834-836], S100A6 [837],

S100A7 [838-840], S100A10 [841], S100A11 [842], S100A14 [739] and S100P [828,

843-846].

Table 1.3.4.1: Reported pro-tumourigenic functions of S100A8 and S100A9 proteins in vivo S100 Cancer Murine cancer model Method of administering Effect Reported mechanism Ref. S100 S100A8 Lung LLC tumours (s.c.) in C57BL/6 mice Anti-S100A8 neutralising ↓ growth ↓ TLR-4 activation [771] antibody (i.v.) ↓ MDSC recruitment Lung LLC tumours (s.c.) in C57BL/6 mice Anti-S100A8 neutralising ↓ myeloid cell recruitment ↓ SAA3-TLR-4 [497] antibody (i.v.) activation Lung LLC tumours (i.v.) in C57BL/6 mice Anti-S100A8 neutralising ↓ myeloid cell recruitment ↓ MAPK activation [815] antibody (i.v.) Lung LLC tumours (s.c.) in C57BL/6 mice S ↓ invasion and liver metastasis ↓ MMP induction [797] Colorectal CT26 tumours (i.v.) in nude mice T ↑ lung and liver metastasis ↑ Akt1-Smad5-Id3 [798] activation Colorectal MC38 tumours (s.c.) in C57BL/6 mice S ↓ invasion and liver metastasis ↓ MMP induction [797] Melanoma B16 tumours (i.v.) in C57BL/6 mice Anti-S100A8 neutralising ↓ myeloid cell recruitment ↓ MAPK activation [815] antibody (i.v.) Cutaneous SCC12 tumours (i.d.) in SCID mice T ↑ growth - [822] S100A9 Lung CC10Tg transgenic mice; urethane and S100A9-/- mice ↓ MDSC accumulation in spleen - [821] cigarette smoke-induced tumours and lungs; ↑ survival Lung LLC tumours (s.c.) in C57BL/6 mice S ↓ invasion and liver metastasis ↓ MMP induction [797] Prostate Transgenic adenocarcinoma model S100A9-/- mice ↓ growth ↓ TLR-4 activation [766] Colorectal MC38 tumours (s.c.) in S100A9-/- mice S100A9-/- mice ↓ growth, liver metastasis and ↓ RAGE, MAPK and [564] tumour-infiltrating MDSC NF-κB signalling Colorectal MC38 tumours (s.c.) in C57BL/6 mice S ↓ invasion and liver metastasis ↓ MMP induction [797] Liver diethylnitrosamine-induced tumours S100A9-/- mice ↓ growth ↓ c-Jun and JNK [823] (i.p.) phosphorylation Liver HepG2 tumours (s.c.) in nude mice Intratumoural injection of an ↓ growth ↓ RAGE ligation [805] anti-S100A9 antibody Melanoma SK-MEL-2 or SK-MEL-5 tumours (i.v.) Transgenic mice ↑ invasion and metastasis ↑ EMMPRIN and [300] in mice overexpressing S100A9 MMP induction Cutaneous SCC12 tumours (i.d.) in SCID mice T ↑ growth - [822] Lymphoma EL4 tumours (s.c.) in mice S100A9-/- mice ↓ growth and splenic MDSC ↓ STAT3 induction [226] recruitment ↓ TLR-4 activation [766] Oral TW-2.6 tumours (s.c.) in nude mice T ↑ growth and angiogenesis - [700]

S100A8/ Lung LLC tumours (i.v.) in C57BL/6 mice Anti-S100A8 and S100A9 ↓ myeloid cell recruitment ↓ MAPK activation [815] A9 neutralising antibodies (i.v.) Breast Orthotopic MDA-231 tumours in SCID Intratumour injection of ↑ metastasis to lungs ↑ RAGE signalling [762] mice S100A8/A9 at 100 ng/kg Breast Inoculated 4T1 tumours in abdominal Blocking S100A8/A9 binding ↓ MDSC accumulation ↓ RAGE and NF-ҡB [209] mammary glands to RAGE by an anti-glycan- signalling specific antibody (i.v.) Prostate PC-3 tumours (s.c.) in SCID mice T ↑ tumour-infiltrating - [809] neutrophils Melanoma SCC12 tumours (i.d.) in SCID mice Anti-S100A8 and S100A9 ↓ myeloid cell recruitment ↓ MAPK activation [815] neutralising antibodies (i.v.) Cutaneous B16 tumours (i.v.) in C57BL/6 mice T ↑ growth - [822] s.c. = subcutaneous; i.v. = intraveneous; i.d. = intradermal; i.p. = intraperitoneal; T = transfection into tumour cells; S = silencing expression in tumour cells; ↑ = increased; ↓ = decreased; - = not determined; Ref. = reference.

1.3.4.2 Anti-tumourigenic functions of S100 proteins

Few studies indicate anti-tumourigenic functions for S100 proteins in vivo (summarised in Table 1.3.4.2). Although transgenic mice that overexpress S100A7 have more orthotopic breast tumour growth and metastasis because of induction of pro-inflammatory pathways [839, 840], subcutaneous injection of breast tumour cells overexpressing

S100A7 reduced this growth by downregulation of the β-Catenin/T cell factor 4 protein pathway [847]. The increased tumour growth and metastasis reported in transgenic mice overexpressing S100A7 [839, 840] are considered as possible systemic effects, whereas the reduced growth of tumour cells overexpressing S100A7 [847] may be due to local effects. These reports suggest that S100A7 may have different local and systemic functions in cancer. In addition, the contrasting effects of S100A7 may be attributed to the strains of mice used, as immunocompetent mice were used in the former studies [839,

840], and nude mice were used in the latter [847]. These results suggest that functions of

S100A7 in cancer are also likely to be influenced by the immune system. Moreover, the use of nude mice may also be contributory to the conflicting observations obtained in clinical studies, and in murine xenograft models of oral cancer examining the roles of

S100A2 and S100A7. These are overexpressed in patients with oral cancer and associated with poor outcomes [733, 734, 848] (Table 1.3.1.1), but overexpression of either protein in oral cancer cells by transfection reduces subcutaneous tumour growth and/or metastasis in vivo by reduced COX activity [849] and/or β-catenin signalling [850].

To date, only one in vivo study (Narumi et al. [763]) has reported protective functions of

S100A8 and/or S100A9 in cancer. In this study, S100A8, S100A9 or S100A8/A9 are overexpressed in colon (CT26) or pancreatic cancer cells (Pan02) by transfection, and cells subcutaneously injected into immunocompetent and nude mice. S100A8 alone has

no obvious effects on subcutaneous colon tumour growth, whereas S100A9 or

S100A8/A9 reduces it [763]. Importantly, S100A8, S100A9 or S100A8/A9 reduced subcutaneous pancreatic tumour growth [763] (Table 1.3.4.2). Interestingly, although

RAGE and S100A8/A9 interactions on MDSC facilitate immunosuppression [209, 498,

564, 695, 761], S100A8 and/or S100A9 bind RAGE on NK cells, resulting in increased tumour cell lysis [763]. It is also interesting that S100A8/A9 has immunostimulatory effects in autoimmune disorders, where S100A8/A9 is reported to increase TLR-4- mediated CD8 T cell expansion in mice with cutaneous lupus erythematosus [772], and

S100A8 also increased the cytotoxic activities of CD8 and NK cells in PBMC from patients with Lichen Planus [851]. Altogether, Narumi et al. [763] reproduced the immunostimulatory effects of S100A8 and S100A8/A9 in colon and pancreatic cancer, although more in-depth investigation to determine whether these effects are promoted by

S100A8 and S100A8/A9 in other cancers is warranted.

Section 1.3 presented some clinico-pathological associations of S100 proteins in cancer, and their functions in vitro and in vivo. These proteins have generally been associated with poor outcomes and have pro-tumourigenic functions, but their anti-tumourigenic functions are also emerging. Most in vivo studies used mice with subcutaneously or intravenously implanted tumours, and effects of S100 proteins on orthotopic lung tumour progression and potential changes to the microenvironment require more explicit characterisation.

Table 1.3.4.2: Reported anti-tumourigenic functions of S100 proteins in vivo S100 Cancer Murine cancer model Method of Effect Reported mechanism Ref. administering S100 S100A2 Oral KB tumours (s.c.) in nude mice T ↓ growth ↓ COX2 signalling [849] S100A7 Breast MCF-7 tumours (s.c.) in nude mice T ↓ growth ↑ β-Catenin signalling [847] Oral Orthotopic JMAR and MDA-MB- T ↓ growth and ↓ β-catenin signalling [850] 468 tumours in athymic nude mice metastasis Oral Orthotopic JMAR and MDA-MB- S ↑ growth and ↑ β-catenin signalling [850] 468 tumours in athymic nude mice metastasis S100A8 Pancreas Pan02 tumours (s.c.) in immunocompetent and T ↓ growth ↑ RAGE-mediated NK cell [763] nude BALB/c mice activation S100A9 Pancreas Pan02 tumours (s.c.) in immunocompetent and T ↓ growth ↑ RAGE-mediated NK cell [763] nude BALB/c mice killing Colorectal CT26 tumours (s.c.) in immunocompetent and T ↓ growth ↑ RAGE-mediated NK cell [763] nude BALB/c mice killing S100A8/A9 Pancreas Pan02 tumours (s.c.) in immunocompetent and T ↓ growth ↑ RAGE-mediated NK cell [763] nude BALB/c mice killing Colorectal CT26 tumours (s.c.) in immunocompetent and T ↓ growth ↑ RAGE-mediated NK cell [763] nude BALB/c mice killing s.c. = subcutaneous; T = transfection into tumour cells; S = silencing expression in tumour cells; ↑ = increased; ↓ = decreased; Ref.= reference.

1.4 Rationale, hypothesis and aims of this project

1.4.1 Rationale of this project

Numerous studies have reported elevated expressions of the S100 family of calcium- binding proteins in malignancies and associations with poor outcomes (Section 1.3.1).

Although S100 proteins are generally considered pro-tumourigenic, their roles in cancer are not fully elucidated (reviewed in [674]). Lung cancer has high incidence and mortality worldwide [653] with poor outcomes [852] and limited treatment options. Elucidating the roles of S100 proteins may, therefore, identify new, effective treatments. S100A8 and

S100A9, which are constitutively expressed in neutrophils [202], are of interest because they are also highly expressed in MDSC [209], cell types that promote immunosuppression and progression of lung cancer [207, 367, 491-497], largely by ROS and NO production [431, 582].

Functional studies of S100A9 knockout in mice or S100A9 silencing in tumour cells indicate that S100A9 promotes MDSC accumulation in lung tumours and spleen [821], and liver metastasis [797]. Tail vein injection of an anti-S100A8 antibody or S100A8 silencing in tumour cells suggests that S100A8 promotes lung tumour growth [771],

MDSC recruitment [497, 771, 815] and liver metastasis in vivo [797]. Unlike S100A9, functional roles of S100A8 in lung cancer cannot be validated using knockout mice because of embryonic lethality [227]. Although the majority of studies have indicated that

S100 proteins are pro-tumourigenic, S100A8/A9 is reported to increase NK cell numbers and activity in mice with subcutaneous pancreatic or colon cancer [763]. However, the effects of S100A8 and/or S100A9 on the lung microenvironment are unknown, since in the aforementioned studies, lung tumours in mice were implanted subcutaneously or intravenously.

The effects of S100A8 on orthotopic lung tumours are of interest because S100A8 has more potent anti-inflammatory and antioxidative effects than either S100A9 or

S100A8/A9 in acute lung injury, due to its more reactive Cys residue [223, 224]. S100A8 expression is enhanced by glucocorticoids [214], and attenuates acute lung injury, similarly to glucocorticoids [224]. Local administration (inhalation) of S100A8 to murine lungs attenuates asthma [352] and endotoxin-mediated acute lung injury [224] in part by oxidant-scavenging, which reduces leukocyte transmigration [110], IL-10 induction in airway epithelial cells, and suppression of chemokine and cytokine induction important for neutrophil infiltration and mast cell activation [224, 352]. Inflammation and an increase in oxidative stress are key contributors to the pathogenesis of lung cancer [365,

366], suggesting that S100A8 establishes a protective microenvironment against lung tumour growth and progression.

1.4.2 Hypothesis

We propose that S100A8 improves outcomes of murine orthotopic lung cancer by creating an anti-inflammatory and antioxidative microenvironment that favours immunoprotection.

1.4.3 Aims

The overall aim was to determine whether S100A8 inhalation inhibited tumour growth, prolonged survival, and improved outcomes of murine orthotopic lung cancer (Chapter

3), and to identify some of the mechanisms involved (Chapter 4).

Chapter 3: Effects of S100A8 on lung cancer progression

We aimed to determine if S100A8 altered expression of genes that influence tumour progression (tumour-modulating genes) and proliferation of lung cancer cells in vitro, as well as growth, survival, metastasis, angiogenesis and leukocyte influx over a time course using a well-established murine orthotopic lung cancer model, Lewis lung carcinoma

(LLC) [853]. Specifically, we aimed to

 determine whether S100A8 altered tumour-modulating gene expression or

viability of some murine and human lung cancer cell lines in vitro,

 validate that total lung masses and relative tumour areas were reliable alternatives

to tumour volumes for measuring tumour sizes,

 determine whether S100A8, when administered prior to, or after LLC

implantation, altered growth at midpoint (9 or 10 days) and endpoint of survival

(18 days onwards),

 determine whether S100A8 prolonged survival of LLC-bearing mice,

 determine whether S100A8 promoted extra-pulmonary tumour growth,

particularly in the liver, at endpoint of survival,

 determine whether S100A8 altered the numbers of vessels, indicative of

angiogenesis, in lungs, soon after LLC implantation (3 days) and at midpoint of

survival (10 days), and

 determine whether S100A8 altered leukocyte influx into lungs at 3 and 10 days,

as well as MDSC and T cell numbers in lungs and spleen.

Chapter 4: Potential mechanisms whereby S100A8 mediated protective effects in lung cancer

We presented protective effects of S100A8 that promoted favourable outcomes in LLC- bearing mice in Chapter 3, and we aimed to identify the potential underlying mechanisms, soon after LLC implantation (3 days) or at midpoint of survival (10 days). Specifically, we aimed to:

 determine changes in the expression of 100 genes that influence tumour growth,

hypoxia and angiogenesis, metastasis, redox and immune modulation, and

 validate protein expression of some genes that were markedly affected by

treatment with S100A8 and/or tumours.

100

Chapter 2: Materials and methods

This chapter describes general materials and methods frequently used for experiments throughout this thesis. Specific experimental procedures are detailed in the corresponding chapters. Appendix I lists all common reagents and sources. Reagents for specific assays and sources are described in the text.

2.1 Preparation and purification of recombinant S100A8 protein E. coli BL21QS cells were used to express the full-length recombinant murine S100A8 protein (10 kDa) because of their low cost, high efficiency and high yield [854]. Briefly, murine S100A8 cDNA was amplified by polymerase chain reactions as described [358], digested with BamHI, cloned into a Glutagene pGEX2T-vector (Pharmacia, NY, USA), and transformed into BL21QS cells as a 36 kDa glutathione-S-transferase (GST) fusion protein on the N-terminal [358] (Figure 2.1). Although the size of GST (26 kDa) may influence the physiological properties of a protein [855], to date there are no reports of altered S100A8 structural properties caused by the GST tag, and purification of recombinant S100A8 following cleavage from the GST fusion protein is an established method [358]. The fusion protein was bound to glutathione-agarose beads (GSH; Sigma,

Australia), then cleaved with thrombin at the engineered thrombin-cleavage site in the

S100A8-GST fusion protein. The recombinant S100A8 has a glycine and serine residue at the amino terminus [358]. S100A8 was eluted with a gradient of trifluoroacetic acid

(Sigma, Australia) and acetonitrile (Ajax Finechem, USA) solvents by reverse phase high-performance liquid chromatography (RP-HPLC) using a C8 column followed by an analytical RP-HPLC C4 column (both from Vydac The Separations Group, USA). Protein concentration was determined by the area under the S100A8 peak in the C4 chromatogram (Section 2.1.3). For quality control, mass spectrometry validated the mass

101 of S100A8, silver staining and Western blotting stained with an anti-S100A8 antibody

(generated in-house as previously described [52]) verifying that the preparations contained only monomeric S100A8 (Figure 2.1).

Figure has been removed due to Copyright restrictions.

Figure 2.1: Schematic description of the recombinant murine S100A8 purification method. Murine S100A8 was cloned as a GST fusion protein into a pGEX2T vector and transformed into E. coli. BL21QS cells. Large-scale bacterial growth generated S100A8-GST fusion protein as a soluble cell lysate. The lysate was bound to glutathione-agarose (GSH) beads, and S100A8 was cleaved from the fusion protein by thrombin and eluted by reverse-phase high-performance liquid chromatography (RP-HPLC). Quality control was then performed to determine protein concentration, validate molecular mass and verify that the preparation contained only monomeric S100A8 (illustration adapted and modified from Maity et al. [855]).

102

2.1.1 Culture of E. coli cells expressing the recombinant murine S100A8 fusion protein

A glycerol stock of E. coli cells containing the murine S100A8-fusion protein was streaked and grown on an ampicillin agar plate (37oC, overnight). A single colony was selected and inoculated into 200 mL 1.5% LB medium containing ampicillin (50 μg/mL;

Sigma, Australia) in an Excella E24 bacterial shaker (200 RPM, 37oC, overnight; New

Brunswick Scientific, USA). Bacterial culture topped up to 1L was grown to saturation by shaking (200 RPM, 37oC, 1 hr). We optimised conditions so that bacteria reached the exponential growth phase (0.6-0.8 O.D.) after 4 hours; bacteria were cultured in isopropyl-β-thiogalactosidase (25 mg/L culture; Sigma, Australia) and shaken (200 RPM,

37oC) for 4 hours to induce the expression of fusion protein. Bacteria were pelleted in an

Avanti J-26S centrifuge (5000 RPM, 10 min, 4oC; Beckman Coulter, Australia) and stored at -80oC until use.

2.1.2 Purification of the murine S100A8 protein

Bacterial pellets were sonicated at 50% power in 20 mL cold wash buffer (25 mM Tris,

150 mM NaCl, 0.1% Triton X-100, 1 mM EDTA, pH 7.5) for 20 min (sonicator set at 5 min “on”, 5 min “off”; Branson Ultrasonic, USA). After centrifugation (15000 RPM, 10 min, 4oC; Avanti J-26S centrifuge), soluble lysates containing the fusion protein were filtered using a 0.45 μm syringe filter (Millipore, USA) and bound to the GSH beads

(Sigma, Australia) with gentle mixing (30 min, RT). Unbound lysates were removed by centrifugation (800 RPM, 5 min, brake off; Eppendorf centrifuge), washed three times with wash buffer, and then three times with TBS (25 mM Tris, 150 mM NaCl, pH 7.5).

GST-bound protein was washed once in cleavage buffer (50 mM Tris, pH 8.0; 800 RPM,

5 min, brake off), and S100A8 cleaved from the fusion protein with 100 U thrombin

103

(Thermo Fisher Scientific, Australia) for 4.5 hours. Cleaved S100A8 was removed by centrifugation, and beads were washed with elution buffer (25 mM Tris, 150 mM NaCl,

10 mM dithiothreitol (DTT; prevents oxidation), pH 7.5), and centrifuged (800 RPM, 5 min, brake off). Supernatant containing S100A8 protein was filtered through a 0.22 μm syringe-driven filter (Millipore, USA) to remove any insoluble GSH beads to prevent damage to the RP-HPLC column. A C8 column (300 Å, 20 μm particle size, 10 x 100 mm; Vydac The Separations Group, USA) connected to the Waters 996 Photodiode Array

Detector (American Laboratory Trading, Inc., USA) eluted S100A8 at a flow rate of 3 mL/min at 214 nm, using 0.095% trifluoroacetic acid /99% acetonitrile (v/v) and 5% acetonitrile/0.1% trifluoroacetic acid/94.9% water (v/v/v) as solvents. The C8-HPLC chromatogram of the murine S100A8 protein used in this thesis matched with a standard chromatogram of the protein (Figure 2.1.2).

104

Figure 2.1.2: Elution of recombinant murine S100A8 from C8-RP-HPLC by RP-HPLC. A) A standard C8-HPLC chromatogram of recombinant murine S100A8. Peaks corresponding to salt,

S100A8 and S100A8-GST fusion protein at A214 nm are indicated. B) A representative C8-HPLC chromatogram of recombinant murine S100A8. C8-RP-HPLC was performed in a gradient of 5-

99% acetonitrile and 0.095%-0.1% trifluoroacetic acid; A214 nm absorbance is indicated. The peak corresponding to murine S100A8 is indicated.

105

2.1.3 Quality control and storage of the recombinant murine S100A8 protein

Quality control of the eluted S100A8 protein included analytical C4-RP-HPLC, mass spectrometry, silver staining and Western blotting with anti-S100A8 IgG (generated in- house as previously described [52]). The S100A8 eluate from C8-RP-HPLC was further purified using an analytical C4 column (300 Å, 5 μm particle size, 4.6 mm x 250 mm;

Vydac The Separations Group, USA) at a flow rate of 1 mL/min. The area under the

S100A8 peak in the C4 chromatogram at A214nm (Figure 2.1.3.1) was divided by the injection volume to determine protein concentration as described in Eberlein [856]. We established that the endotoxin levels in S100A8 preparations were <10 pg/10 μg of

S100A8 (determined by the Limulus assay) following C4-RP-HPLC purification [223].

Figure 2.1.3.1: A representative C4-HPLC chromatogram of recombinant murine S100A8. The S100A8 peak collected from C8-RP-HPLC (Figure 2.1.2B) was further purified by analytical

C4-RP-HPLC in a gradient of 5-99% acetonitrile (0.095%-0.1% trifluoroacetic acid) at A214 nm to determine protein concentration. The peak corresponding to S100A8 is indicated. All S100A8 preparations were subject to C4-RP-HPLC purification before use.

106

Mass spectrometry, performed by the Bioanalytical Mass Spectrometry Facility, UNSW, as described [223], validated that the murine S100A8 protein used in this thesis had a mass of 10308 Da, concurring with the theoretical mass (10 kDa) (Figure 2.1.3.2).

Figure 2.1.3.2: A representative mass spectrum of the murine S100A8 preparation. The mass of murine S100A8 is 10308 Da (labelled), which concurs with the theoretical mass.

To verify that the protein preparation contained only monomeric S100A8, a sample (10

μg/20 μL) was loaded on a non-reducing 10% SDS-PAGE gel along with a protein size marker (Precision Plus Protein Dual Colour Standards; Bio-rad, Australia), and silver staining performed after gel electrophoresis (procedures of gel casting and electrophoresis described in Section 2.5.3). The gel was fixed in 50% methanol/5% acetic acid/45% water

(v/v/v) for 10 min and 50% methanol/50% water (v/v) for 10 min. After washing with water (2 x 10 min), the gel was incubated in 0.25 mg/mL sodium thiosulphate (BDH

Chemicals, Australia) for 1 min, washed with water (2 x 1 min), then incubated in 0.1% silver nitrate (Sigma, Australia) for 20 min. Following its brief washing with water, the gel was developed with a solution of 0.24 M anhydrous sodium carbonate/0.025% formaldehyde for 3 min, and reaction stopped with 5% acetic acid/ 95% water (v/v). A sample of recombinant murine S100A8 (500 ng) was loaded, as a control, onto the 10%

107

SDS-PAGE gel for blotting with anti-mouse S100A8 IgG (generated in-house as described [52]). Silver staining and Western blotting confirmed that the protein preparation contained only monomeric S100A8, as indicated by a single band at 10 kDa

(Figures 2.1.3.3A and B).

A) B)

Figure 2.1.3.3: Verification of monomeric S100A8 in the purified preparation. A) Silver staining (10 μg/20 μL) and B) Western blotting of the S100A8 preparation (500 ng) blotted with anti-S100A8 IgG (generated in-house as previously described [52]) showing a single band which corresponds to monomeric S100A8 (as indicated). Molecular weight markers are shown on the left for the gels in A and B.

To prevent oxidation, recombinant S100A8 was stored in 45% acetonitrile/0.1% trifluoroacetic acid (v/v) at -80°C in NUNC-Immuno Polyethylene MiniSorp tubes

(Thermo Fisher Scientific, Australia) under argon until use. We determined that the

NUNC minisorb tubes do not absorb the very hydrophobic S100A8, and S100A8 remains endotoxin-free in these tubes [223]. Aliquots of 1 mL were made to avoid repeated freezing and thawing to prevent protein loss by protease degradation and oxidation.

Protein was lyophilised using an SVC 200H Speed-Vac concentrator (Savant Instruments,

USA) and resuspended in saline or media to the final concentrations required for experimental treatments. 108

2.2 Cell culture and murine orthotopic lung cancer model 2.2.1 Cell culture

Lewis lung carcinoma (LLC) (CRL-1642™) cell line from ATCC was cultured in

o complete DMEM in a T75 flask (Corning Incorporated, USA) (37 C, 5% CO2). DMEM was supplemented with 10% (v/v) fetal bovine serum (FBS), 1% (v/v) penicillin (10000 units/mL), streptomycin (10000 μg/mL) and 1% (v/v) L-glutamine (all from Life

Technologies, Australia). Cells were passaged twice weekly, or when 80-90% confluent, for no more than 20 passages. For each passage, cells were washed twice with DPBS

(Life Technologies, Australia), trypsinised, centrifuged (1200 RPM, 5 min, RT) and resuspended in a fresh complete medium (~0.25 x 106 cells/mL). Cells (10 µL) were mixed with 0.4% trypan blue (10 µL; Life Technologies, Australia), and viable cells counted using a haemocytometer (ProSciTech, Australia). Non-viable cells that stained blue were excluded from cell counts. Only cell passages with viability > 90% were used for experiments.

2.2.2 Cell line authentication and mycoplasma testing

The LLC cell line used in this thesis was authenticated by IDEXX BioResearch (USA) using short tandem repeat profiling in October 2016. Short tandem repeats are short and polymorphic DNA sequences that repeat multiple times at particular DNA loci [857].

Short tandem repeat profiling compares the lengths of short tandem repeat sequences at specific DNA loci in a sample to standard short tandem repeat profiles to confirm identity

[857]. Using a set of 27 microsatellite short tandem repeat markers, the cell line used here was confirmed as LLC since the lengths of short tandem repeats (allele sizes in bp) at all loci matched those of the standard profile (Table 2.2.2), and was of mouse origin with no mammalian interspecies contamination (rat, human, Chinese hamster and African green

109 monkey). Using a MycoAlertTM mycoplasma detection kit (Lonza, Switzerland), all cells were screened to ensure they were mycoplasma-free every 6 months, as described

[858].

Table 2.2.2: Authentication of LLC cell line by short tandem repeat profiling Microsatellite short Short tandem repeat profile of Standard short tandem repeat tandem repeat markers LLC used in this thesis profile of LLC (CRL-1642) (allele sizes in bp) (allele sizes in bp) 4 156 156 5 113, 115, 119 113, 115, 119 136 149 149 78 196, 200 197, 200 134 111, 113 111, 113 14 94, 99, 101 95, 99, 101 94 113 113 16 136 136 139 121, 127 121, 127 144 192 193 25 140, 143 141, 143 163 219 219 133 75, 81 75, 81 138 191, 195 191, 195 27 148, 150 148, 150 39 174, 176 174, 176 141 95 95 165 197, 199 197, 199 74 119 119 111 147, 149 147, 149 20 153, 157 153, 157 31 198, 202, 205 198, 202, 205 137 202, 204 202, 204 143 132 132 53 95, 98 95, 98 171 210 210 47 113 113 A DNA sample of the LLC cell line was authenticated by IDEXX BioResearch, USA by short tandem repeat profiling. Short tandem repeat profiling was generated using a panel of microsatellite markers (numbers in italics) and compared the lengths of short tandem repeat sequences in the LLC sample to those in a standard profile to confirm identity. Differences in allele sizes of 1 bp between the sample and standard represented run-to-run variability and only those of 2 bp or more were considered to be different allele sizes.

110

2.2.3 Cryopreservation of cells

Cells expanded to a total of 10 x 106 in T150 flasks (Corning Incorporated, USA) were cryopreserved in a complete medium with 10% DMSO (Sigma, Australia) in 10 x 1 mL sterile cryovials (NUNC, Denmark). Vials were stored at -80oC overnight in an isopropanol-insulated chamber (Sigma, Australia) and transferred to vapour-phase liquid nitrogen for long-term storage. Cryopreserved cells were revived by rapid thawing at

37oC and centrifuged in 10 mL complete medium (1200 RPM, 5 min, RT) to remove

DMSO before cells were cultured.

2.2.4 Procedures to minimise endotoxin contamination

All work involving recombinant S100A8 was performed in dedicated pre-sterilised fume hoods to prevent endotoxin contamination. Tissue culture plates, flasks and tubes were only used where endotoxin units were < 2.0, otherwise they were gamma-irradiated. Prior to preparation of buffers and media, glassware was treated with 0.1% NaOH, rinsed with sterile water, autoclaved, and baked (250 °C, 30 min) to vapourise endotoxin. Non- commercial buffers and media, or those that were not endotoxin-free, were filtered using

0.2 μm Zetapore membranes (Cuno, Blacktown, NSW, Australia). Cell cultures were incubated in dedicated LPS-minimised incubators (VWR International, Australia) (more details are provided in [223]).

111

2.2.5 Rationale for choosing the LLC orthotopic mouse model

LLC cells originated from a spontaneous lung epidermoid carcinoma in C57/BL6 mice

[859]. Unlike subcutaneous or intravenous injection of cancer cells, implantation of lung cancer cells into the lungs of mice by orthotopic injection (Section 2.2.6) allows the evaluation of effects of S100A8 within the lung microenvironment. In xenograft models of lung cancer, human cancer cells are injected into immunocompromised mice (reviewed in [860]). The LLC model is, however, syngeneic as a murine cell line compatible with the murine immune system. It is a highly reproducible pre-clinical lung cancer model

[860] in which C57/BL6 mice typically survive for 21 days following orthotopic implantation of lung cancer cells [853].

While transgenic models for lung cancer are also commonly used, usually to evaluate the effects of genetic mutations on tumour initiation and progression [860], this was not the focus of this project. Moreover, colonies of transgenic mice are costly to maintain [861] and often have a long latency time to lung tumour development (6-9 months) [862].

Carcinogen-inducible mouse models are used in some studies, but tumours can also take months to develop and are often not reproducible due to variable responses to carcinogens

[860]. The LLC model was, therefore, more suitable for evaluating the effects of S100A8 on tumour growth, progression, and the microenvironment in an immunocompetent setting, at relatively low cost and with high reproducibility. LLC cells have been found to be morphologically similar to human alveolar cell carcinoma [863], a type of non- small-cell lung cancer (NSCLC), which represents 85% of lung cancer cases [395]. LLC cells have also been shown to contain activating KRAS mutations [864], a common genetic driver for lung cancer [372] (Section 1.2.1.1).

112

2.2.6 Animal housing, ethics and the LLC mouse model

Specific-pathogen-free female C57BL/6J mice (6-8 weeks; 18-20 g) obtained from

Australian BioResources (Moss Vale, Australia) were maintained in ventilated cages exposed to a 12-hour light or dark cycle, and given autoclaved food and water ad libitum.

Ethics approvals were obtained from the Animal Care and Ethics Committee of the

UNSW Sydney (reference numbers: 12/148B and 16/142B) prior to experimentation. All procedures were performed according to the guidelines of the National Health and

Medical Research Council of Australia.

LLC cells (4 x 105 /mL in DPBS) or DPBS (vehicle control) were mixed with chilled BD

MatrigelTM Matrix (growth factor reduced; BD Biosciences, Australia) at a 1:1 (v/v) ratio.

Cells were orthotopically injected into the right lung, as described [865, 866]. Briefly, mice were anaesthetised using 4% gaseous isoflurane (Henry Schein, Australia) for induction, and 2.5% for maintenance. To maintain their body temperature throughout surgery, the mice were placed on a heating pad. The surgical area was shaved and sterilised with 70% alcohol swab (Livingstone International, Australia) and betadine

(Orion Laboratories Pty Ltd, Australia). A skin incision of 5 mm at the base of the rib cage was made for injection of 30 μL LLC cells/Matrigel into the right lung, and the incision closed with sterile wound clips (CellPoint Scientific, USA). Each mouse received subcutaneous injections of buprenorphine (0.1 mg/kg; Reckitt Benckiser, Australia) for pain relief, and 0.5 mL 0.9% sterile sodium chloride (Pfizer Australia Pty Ltd, Australia) for hydration. To ensure a sterile environment, all surgical equipment was autoclaved and the surgery conducted in a biological hood. Post-surgery, mice were closely monitored for wound condition and any signs of distress.

113

2.3 Assessing effects of S100A8 on murine orthotopic lung cancer 2.3.1 Treatment protocols

S100A8 (10 μg/50 μL HBSS), or control (50 μL HBSS), was administered intranasally; the S100A8 dose was determined based on previous studies conducted in our laboratory

[224]. The effects of S100A8 on the lung microenvironment and/or tumour progression in mice were assessed through inhalation before or after LLC implantation (Section 2.2.5), in comparison with appropriate vehicle-treated controls. To determine whether S100A8 co-treatment rejected implanted lung tumours in vivo, which mimics protection against the development of lung cancer in patients with high predisposition or relapse after surgery, mice inhaled S100A8 or HBSS (vehicle) 30 min prior to orthotopic LLC injection and were harvested after 20 days, when tumour growth was maximal [853]

(Figure 2.3.1.1A). The effects of S100A8 co-treatment on midpoint tumour growth were examined using the following protocol: after inhalation and LLC implantation on day 0, mice were given S100A8 or HBSS on days 3 and 6, and then harvested on day 9 (Figure

2.3.1.1B). To investigate how S100A8 co-treatment altered the microenvironment soon after LLC implantation to influence progression, the experiment was terminated 3 days after LLC implantation (Figure 2.3.1.1C). Mice implanted with DPBS (vehicle) were harvested after 3 days using the same protocols to determine the effects of S100A8 on healthy lungs.

114

B) C)

Figure 2.3.1.1: Treatment protocols to determine effects of S100A8 co-treatment on lung microenvironment and/or tumour progression. C57BL/6J mice inhaled S100A8 (10 μg) or HBSS (vehicle), as indicated, 30 min prior to orthotopic LLC injection into lungs as described in Section 2.2.5 (n = 3-5/group for all protocols). A) Mice were harvested 20 days post LLC implantation to determine if S100A8 altered tumour growth and progression. B) Mice were given S100A8 (10 μg) or HBSS (vehicle), as indicated, on days 0, 3 and 6 post LLC injection and harvested after 9 days. C) Mice were harvested 3 days post LLC implantation to determine the effects of S100A8 on the lung microenvironment soon after implantation. Mice implanted with vehicle (Matrigel in DPBS) were harvested using the same protocols to determine the effects of S100A8 on healthy lungs.

115

To mimic clinical settings in which patients are treated after lung cancer is diagnosed,

S100A8 was administered post LLC injection to determine its effects on tumour growth and survival of LLC-bearing mice (Figure 2.3.1.2).

Figure 2.3.1.2: Treatment protocols to determine effects of S100A8 on lung microenvironment and/or tumour progression mimicking clinical settings. A) Mice inhaled HBSS (control) or S100A8 on days 3, 6 and 9 (Group 1), or S100A8 every third day (Group 2), post orthotopic LLC implantation. Mice were monitored until morbid, then sacrificed. To determine survival, days taken for mice to become moribund were recorded (n = 5/group). B) Group 1 mice from A) were harvested after 10 days to investigate effects on tumour growth at midpoint of survival. Mice implanted with vehicle (Matrigel in DPBS) were treated using the same protocols to determine effects of S100A8 on healthy lungs (n = 3-6/group).

116

Mice inhaled HBSS (control) or S100A8 3, 6 and 9 days (Group 1), or S100A8 every third day (Group 2) post LLC implantation, were monitored until morbid, and then harvested (Figure 2.3.1.2A). Survival was measured by the number of days before mice became moribund; criteria for morbidity included weight loss equal to or greater than

20%, dehydration, lethargy or laboured breathing. Using the same protocol, Group 1 mice were also harvested after 10 days to investigate changes in tumour growth and lung microenvironment at the midpoint of survival (Figure 2.3.1.2B). Mice implanted with vehicle (Matrigel in DPBS) were treated using the same protocols to determine the effects of S100A8 on healthy lungs after 10 days.

2.3.2 Sample collection

At designated experimental endpoints, mice were humanely killed by intraperitoneal injection of 150 μL lethabarb (10 mg/mL; Virbac Pty Limited, Australia) for sample collection (summarised in Figure 2.3.2). Bronchoalveolar lavage fluid (BALF) (2 mL/mouse) was collected by inserting a 19G cannula (Cadence Science, USA) into the trachea and instillation of chilled DPBS (1 mL x 2) into the lungs. Differential leukocyte counts in BALF performed immediately after harvest (Section 2.3.2.1), and aliquots of

BALF were stored at -80oC until their use in ELISA or Griess assay (Sections 2.5.1 and

2.5.5). Some mice were harvested to collect lungs and liver for haematoxylin and eosin

(H&E) histology staining (Section 2.3.2.2) and/or immunohistochemistry (Section 2.5.6).

Lung tumour sizes were measured by assessing relative tumour areas on H&E-stained sections, and total lung masses recorded immediately after resection (Section 2.3.2.3).

Portions of lungs from each lobe on both sides were collected in RNAlater solution

(Ambion, USA) for extraction of total RNA (Section 2.4.1), or extraction of protein homogenates (Section 2.5.2) for Western blotting (Section 2.5.3) and enzyme activity 117 assays (Section 2.5.4). Some mice were harvested to collect lungs, spleen, regional lymph nodes (mediastinal, axillary and brachial) and bone marrow cells for analysis of T cell and/or MDSC populations by flow cytometry (Section 2.6).

Figure has been removed due to Copyright restrictions.

Figure 2.3.2: Illustrations of sample collection. Mice were implanted with LLC (Section 2.2.6) and treated with S100A8 (10 μg) (Section 2.3.1). At designated experimental endpoints, BALF, lungs, liver, spleen, regional lymph nodes (mediastinal, axillary and brachial) and bone marrow cells were collected for the various analyses described in subsequent sections (figure adapted and modified from Herter-Sprie et al. [867]).

118

2.3.2.1 Differential count of leukocytes in bronchoalveolar lavage fluids

The centrifuged BALF (400 x g, 7 min, 4oC) sedimented leukocytes, and supernatants were collected, aliquoted and stored at -80oC until use. Total leukocyte numbers were counted using a hemocytometer. To determine numbers of particular leukocyte populations in BALF, cytospins of leukocytes (0.5 x 106) in FBS (1:1 v/v) (300 RPM, 3 min; Shandon Life Sciences, England) were stained using a Diff-Quick Stain Set (Lab

Aids, Australia), and a minimum of 100 cells counted microscopically.

2.3.2.2 Processing of lungs and liver for H&E histology staining

Lungs and liver were fixed in 10% neutral buffered formalin (Fronine laboratory suppliers,

Australia) overnight and stored in 70% ethanol at RT until further processing. Paraffin- embedded lungs or liver were sectioned (4 μm) by the Biomedical Imaging Facility

(BMIF) (previously known as the Histology and Microscopy Unit) at UNSW, Sydney.

Lung sections were cut at maximal surface areas, instead of transversely across the bronchi, to preserve tumour histology; liver sections were cut transversely across lobules.

H&E staining was performed to examine tissue morphology using an Olympus DP73 microscope (Olympus Pty Ltd, Australia). Sections were dewaxed in xylene 2 x 2 min and rehydrated with graded ethanol (absolute ethanol for 2 x 1 min and 70% ethanol for

1 min) and water (2 x 1 min), then stained with hematoxylin (Sigma, Australia) for 5 min,

1% acid alcohol for 5 s, Scott’s Blue solution for 1 min, and eosin (all from BMIF, UNSW) for 4 min, with 1 min-washing in running water between each step. Sections were then dehydrated in absolute ethanol for 2 x 2 min. After immersing in xylene (Thermo Fisher

Scientific, Australia) for 2 x 2 min, sections were mounted using DPX mountant solution for histology (Sigma, Australia).

119

2.3.2.3 Measurement of tumour sizes

Tumour sizes were assessed by recording total lung masses immediately after removal, and relative tumour areas on H&E-stained lung sections. From H&E-stained sections, tumour areas relative to total lung areas were calculated using the cellSens software coupled with the Olympus DP73 microscope and 10X objective lens (Olympus Pty Ltd,

Australia).

120

2.4 Assessment of gene expression in lung lysates 2.4.1 Sample preparation, RNA extraction and single-stranded cDNA synthesis

To extract RNA from cell lines, cells were lysed with 0.5 mL Trizol (Ambion, USA).

Lung tissues were homogenised in 400 µL Trizol using a Precellys Tissue Homogeniser

(5500 RPM, 2 x 20s; Bertin Corp Company, USA). Total RNA was extracted using 1- bromo-3-chloropropane (Sigma, Australia) and isopropanol (Ajax Finechem, USA), as detailed in [868]. RNA pellets were washed with 75% ethanol, air-dried and dissolved in ribonuclease-free water (Ambion, USA) by pipetting. RNA concentration and quality were determined using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher

Scientific, USA). RNA samples with A260 nm/A280 nm readings ~2.0 and A260 nm/A230 nm readings > 1.5 were deemed good quality. RNA was stored at -20C for short-term or -

80oC for long-term.

Reverse transcription of 1.5 μg RNA into cDNA was performed using the SuperScript

VILO cDNA synthesis kit (Life Technologies, Australia). In 0.2 mL PCR tubes (Corning

Incorporated, USA); 1 µL 10x Turbo DNase buffer and 0.5 μL 1U Turbo DNase were added to RNA to degrade DNA contaminants at 37oC for 30 min. Ribonuclease-free water was the negative control. Reaction mixtures were then incubated in 1 µL 50 mM EDTA at 75oC for 10 min to inactivate Turbo DNase. Subsequently, 1 µL 5X VILO Reaction

Mix and 0.5 µL 10X SuperScript III Enzyme Mix (Life Technologies, Australia) were added to the reaction mixtures. Single-strand cDNA synthesis was performed using a thermocycler (GeneAmp® PCR System 9700; Applied Biosystems, USA) at 25oC for 10 min, 42oC for 60 min, and 85oC for 5 min. Single-strand cDNA samples were then stored at -20oC until required for further analysis.

121

2.4.2 Real-time quantitative polymerase chain reactions (RT-qPCR)

Based on the gene expression profile of S100A8 in healthy lungs (Appendix III), and lungs with acute injury [224] and asthma [352], a panel of 100 genes was selected to assess the effects of S100A8 on growth, hypoxia, angiogenesis, metastasis, redox, and immune modulation in vivo (Appendix II). Expression of some of these genes in LLC cells in vitro was also assayed, as described in Section 4. Forward and reverse primers (100 μM) from

Sigma or Life Technologies were validated, as described [224]; sequences are listed in

Appendix II. Forward and reverse primers were diluted to 2.5 μM in TE buffer (Ambion,

USA) prior to use. Primer (2.5 μM, 1 μL), cDNA (1.5 μg, 2 μL) and 2X SYBR green (4

μL; Applied Biosystems, USA) added to 384-well PCR plates (Life Technologies,

Australia) were mixed by centrifugation (2000 RPM, 2 min). Using a QuantStudio RT- qPCR machine (Thermo Fisher Scientific, Australia), DNA was denatured at 95°C for 2 min and amplified by 40 cycles of PCR (DNA denaturation at 95°C for 1 sec, primer annealing at 60°C for 30 sec, single-stranded DNA extension by DNA polymerase at

95°C for 15 sec). All CT values had cut-off thresholds of 40. Gene expression normalised against housekeeping genes (β-actin, hypoxanthine-guanine HPRT and β2M) was analysed using a web-based software package and Excel-based analysis tools, as described [224]. We determined that S100A8 treatment and/or LLC implantation markedly upregulated GAPDH mRNA expression (Table 4.3.3), and thus, GAPDH was not used as a housekeeping gene in this study. Fold changes with respect to controls were calculated for each gene.

122

2.5 Protein detection Protein expression of some genes that were markedly affected by S100A8 and/or tumours in lungs was validated. Levels of selected secreted proteins in BALF were measured by enzyme-linked immunosorbent assay (ELISA) (Section 2.5.1). Lung homogenates were extracted (Section 2.5.2) for measuring protein expression by Western blotting (Section

2.5.3) or enzyme activities (Section 2.5.4). Nitrite levels in BALF were quantitated by the

Griess assay (Section 2.5.5). Cell types expressing the proteins of interest were assessed by immunohistochemistry, and sections examined using an Olympus DP73 microscope

(Olympus Pty Ltd, Australia) (Section 2.5.6).

2.5.1 Enzyme-linked immunosorbent assay (ELISA)

Secreted cytokines (IL-1β, IL-4, IL-6, IL-10, IL-12β, IL-13 and IFN-γ) in BALF were measured by ELISA according to the respective manufacturer’s instructions (IL-12β

ELISA kit from BioLegend, USA; others from R&D Systems, USA). Briefly, diluted capture antibody (100 µL/well) in 1 x PBS was coated in flat-bottom 96-well Maxisorp microtitre plates (NUNC, Denmark) overnight at RT (or 4oC for IL-12β detection). Plates were washed 3 times with wash buffer (0.05% v/v Tween 20 in PBS) prior to blocking with Reagent Diluent (1% g/v BSA in PBS or as specified by manufacturer), for 1 hr at

RT. Unless otherwise instructed by the manufacturer, plates were incubated at RT, washed 3 times with wash buffer between each blocking step, and all dilutions made using

Reagent Diluent. After washing, appropriately-diluted samples and standards were incubated for 2 hr (100 µL/well). Highest standards, as specified by the manufacturer, were serially diluted 2-fold to construct a 7-point standard curve. Diluted detection antibody (100 µL/well) was incubated for 2 hr, followed by incubation with streptavidin conjugated to HRP (100 µL/well; R&D Systems, USA) for 20 min in the dark. Following

123 incubation with 100 µL 3,3,5,5-tetramethylbenzidine substrate (Life Technologies,

Australia) for 20 min in the dark, the reaction was stopped with 50 μL 2N H2SO4, and

A450 nm measured by a SpectraMax M3 plate reader (Molecular Devices, USA).

2.5.2 Extraction of lung homogenates

Lung homogenates were prepared in chilled lysis buffer (50 mM PBS, 1 mM EDTA, 10

μM butylated hydroxytoluene and complete proteinase inhibitor mixture) for Western blotting (Section 2.5.3) or enzyme activity assays (Section 2.5.4). Using a Glass-Col

Homogeniser (Glas-Col, USA), lungs (50 mg/1 mL of lysis buffer) were ground by a rotating piston at a low speed, to preserve enzyme activities (500 RPM, 10 min, 4oC).

Lysates were centrifuged (13000 RPM, 8 min, 4oC), and supernatants were collected for quantitation of protein concentrations using a BCA Protein Assay Kit (Thermo Fisher

Scientific, Australia).

2.5.3 Gel electrophoresis, protein transfer and Western blotting

SDS-PAGE gels (10%) were cast using a Mini-PROTEAN® Tetra Handcast System

(Bio-Rad, Australia). Resolving gel was prepared by mixing 1.5 mL 40% acrylamide/bis solution (29:1) (Bio-Rad, Australia), 2.5 mL Tris-SDS buffer (pH 8.45), 2.7 ml water, 1 mL glycerol (Sigma, Australia), 3 μL tetramethylethylenediamine (Bio-Rad, Australia) and 30 μL 10% ammonium persulphate (Bio-Rad, Australia). After solidification, stacking gel was cast by mixing 200 μL acrylamide/bis solution, 650 μL SDS buffer, 1.7 mL water, 3 μL tetramethylethylenediamine and 30 μL 10% ammonium persulphate.

Where appropriate, samples were reduced by 50 mM DTT, boiled at 100oC for 5 min and loaded at 20 μg/well; a standard protein size marker (Precision plus protein dual colour

124

standards; Bio-rad, Australia) was included. Using a Bio-Rad Mini-PROTEAN II

Electrophoresis Apparatus (Bio-Rad, Australia), samples were separated (45 V, 30 min followed by 100 V, 70 min) in SDS running buffer (0.1 M Tris/0.24 M glycine/3.5 mM

SDS) and tank buffer (0.2 M Tris; pH 8.9) [869]. A Bio-Rad Western transfer apparatus

(both from Bio-Rad, Australia) was used to transfer proteins to polyvinylidene difluoride membranes (0.22 μm; Millipore, USA) in a 20% methanol transfer buffer (SOMS, UNSW)

(100 V, 1 hr, 4oC) [869]. Membranes were blocked with 5% skim milk (w/v; Coles,

Australia) in TBS/0.1% Tween 20 (TTBS) for 1 hr at RT.

To identify reactivity of particular proteins in lysates, the following rabbit polyclonal primary antibodies were incubated in 1% skim milk/TTBS at 4oC overnight: anti-arginase

1 (1:1000 v/v), anti-catalase (1:5000 v/v), anti-thioredoxin (1:1000 v/v), anti- peroxiredoxin-SO3 (1:2000 v/v), anti-peroxiredoxin 1 (1:800 v/v) (all from Abcam,

Australia), anti-HIF-1α (1:1000 v/v; Cell Signalling Technologies, Australia) and anti-

GAPDH (1:3000 v/v; Sigma, Australia). Each membrane was stained with mouse monoclonal anti–β-actin (1:25000 v/v; Sigma, Australia) to control for protein loading.

When multiple samples were analysed, one of these was loaded onto gels to normalise protein expression across membranes. Membranes were washed with TTBS for 3 x 5 min and incubated with goat anti-rabbit IgG (H+L)-HRP or goat anti-mouse IgG (H+L)-HRP conjugate (1:3000 v/v; Bio-Rad, Australia) (2 hr, RT, in the dark), then washed with

TTBS for 3 x 5 min and reactivity developed using Western Lightning-enhanced chemiluminescence substrate (Perkin-Elmer, USA) [870]. Images were visualised and saved by ImageQuant LAS4000 CCD camera and ImageGauge software (GE Healthcare,

UK). After detection, membranes were stripped by Restore Plus Western Blot Stripping

125

Buffer (Thermo Fisher Scientific, Australia) for 15 min and some were then reprobed with another antibody. Protein bands were quantified by densitometry using ImageJ.

2.5.4 Enzyme activity assays

Lung homogenates (3.5-10 µL, depending on assays) were used to measure activities of some antioxidants, including glutathione peroxidase (GPX), superoxide dismutase (SOD), catalase, peroxiredoxin (PRDX) and thioredoxin reductase (TXNR) by spectrophotometry. Plates (96 wells) were read using a SpectraMax M3 plate reader at designated wavelengths.

Briefly, GPX activity was measured by β-NADPH (Sigma, Australia) disappearance at

A340 nm upon H2O2 (Ajax Finechem, USA) addition, as described [871].

SOD activity was measured as the formation of purpurogallin species from pyrogallol

(Sigma, Australia) auto-oxidation at A325 nm, as described [871].

Catalase activity was measured by formation of iron (III) xylenol orange (Sigma,

Australia) complexes upon H2O2 addition at A560 nm, and absorbance corrected by a catalase inhibitor, 3-Amino-1,2,4-triazole (Sigma, Australia), as described [872].

PRDX activity was measured in a reaction mixture of cumene hydroperoxide (cH2O2;

Sigma, Australia) and iron (II). PRDX reacts with cH2O2, and cH2O2 also reacts with iron

(II) to form iron (III) xylenol orange complex at A560 nm. PRDX activity was, thus, inversely proportional to the amount of iron (III) xylenol orange complex formed, as described [873].

TXNR activity was measured by 5,5′-dithiobis(2-nitrobenzoic acid) (Sigma, Australia) reduction at A 412 nm, and absorbance corrected by a TXNR inhibitor, auranofin (Abcam,

Australia), as described [874]. Enzyme activities in ∆A/min/mg of protein or ∆ concentration of substance/min/mg of protein were calculated. 126

Arginase activity was measured as urea production from arginine hydrolysis [875, 876] using a 96-well microtitre plate (Corning Incorporated, USA). Urea produces a stable red product upon boiling with diacetyl monoxime (2,3-BDM; Sigma, Australia) supplemented with Fe3+ and strong acids [875, 876]. This 2,3-BDM/Fe3+/H+ reagent was prepared by adding 0.5 mL sulphuric acid (98%), 0.5 mL orthophosphoric acid (85%;

Ajax Finechem, USA), 1 mL 50 μg/mL FeCl3 (Sigma, Australia), 0.04 g thiosemicarbazide (Sigma, Australia) and 0.2 g 2,3-BDM to 18 mL MilliQ water [875,

876]. Lung homogenates containing 10 mM MnCl2 (Sigma, Australia) in Tris-HCl (50 mM, pH 7.5) were mixed in 1:1 (v/v) ratio and heated at 60oC to activate arginase.

Homogenate mixtures (10 μL) in duplicate were then incubated (37oC, 4 hr) with 10 μL

100 mM L-arginine/30 μL 100 mM potassium carbonate buffer (pH 9). Urea (0.01 to

0.625 mg/mL; Sigma, Australia) was used to create a standard curve to measure urea production. Standards and sample mixtures were heated with 200 μL 2,3-BDM/Fe3+/H+

o reagent (95 C, 20 min). Plates were read at A520 nm after cooling for 5 min.

2.5.5 Griess assay

Nitrite levels in BALF were assessed as a measure of NO production in lungs. Sodium nitrite (1.5625 - 200 μM; Sigma, Australia) was used to create a standard curve. Nitrite in duplicate volumes of BALF was detected using the Griess reagent (Sigma, Australia)

[877], and A540 nm recorded using the SpectraMax M3 plate reader.

127

2.5.6 Immunohistochemistry and analysis

Lung sections were rehydrated, as described in Section 2.3.2.2, prior to immunohistochemical staining. Then, permeabilisation with 0.5% Triton X-100 in TBS was required to detect intracellular expression of S100A8 and S100A9. Sections were washed 3 x 5 min with 1X TBS between each blocking step, except after serum blocking.

Antigen retrieval was performed by microwave heating sections in a 0.1 M sodium citrate buffer (pH 6) for 4 min or a 10 mM Tris/1 mM EDTA buffer (pH 9; for anti-ICAM-1 staining) for 10 min. Sections were cooled, then blocked with normal goat or rabbit serum

(1:5 v/v; Sigma, Australia) (1 hr, RT), followed by incubation with the designated primary antibody or IgG control (4oC, overnight). Specific rabbit anti-mouse S100A8 and S100A9

IgG antibodies were generated in-house, as previously described [52], and used at 5

μg/mL. Rabbit anti-catalase (1:100 v/v), PRDX1 (1:800 v/v), TXN (1:500 v/v), LYVE-1

(lymphatic endothelial cell marker; 1:100 v/v) and MMP-10 (1:100 v/v) (all from Abcam,

Australia) were used to detect their expression in lungs. Normal rabbit IgG (Santa Cruz,

USA) at corresponding concentrations constituted the negative controls, and biotinylated goat anti-rabbit IgG (1:500 v/v; Dako, USA) the secondary antibody. IL-10 expression was detected using 10 μg/mL goat anti-IL-10 antibody (R&D Systems, USA) with normal goat IgG (Santa Cruz, USA) as negative control and biotinylated rabbit anti-goat IgG

(1:500 v/v; Dako, USA) as secondary antibody. ICAM-1 expression was detected using a rat anti-ICAM-1 antibody (1:200 v/v; Abcam, Australia) with normal rat IgG

(eBiosciences, USA) as control and biotinylated goat anti-rat (1:200 v/v; Vector

Laboratories, USA) as the secondary antibody. Following secondary antibody incubation

(1 hr, RT), antibody reactivity was detected using the Vectastain ABC-AP KIT (Vector

Laboratories, USA). Sections were incubated in alkaline phosphatase (prepared in 1X

TBS) for 30 min followed by the alkaline phosphatase substrate (prepared in 100 mM

128

Tris-HCl, pH 8.3) in the dark for 10 min. The reaction was stopped by thorough washing in tap water. Sections were counterstained with Mayer’s haematoxylin (Sigma, Australia), and dehydrated and mounted as described in Section 2.3.2.2.

Stained tissue sections were viewed using an Olympus DP73 microscope (Olympus Pty

Ltd, Australia) and representative images photographed using cellSens software. To assess myeloid cell infiltration into lungs, numbers of S100A8+ and S100A9+ myeloid cells in stained sections, excluding leukocytes in blood vessels and tumours, were quantitated from 10 random fields of view at 400X. We determined that the anti-LYVE-

1 antibody detected both blood and lymphatic vessels (endothelial cells) in lungs.

Numbers of LYVE-1+ vessels, indicative of total vessel numbers, were manually counted over 5 consecutive areas of 1.5 mm2 at 100X and averaged. Sections stained with all other antibodies were qualitatively scored as no obvious reactivity, weak, moderate, strong or very strong reactivity.

129

2.6 MDSC and lymphocyte quantification in lungs, spleen, lymph nodes and bone marrow 2.6.1 Preparation of single cell suspensions

Single cell suspensions (106 cells in 50 µL of PBS) were prepared from lungs, regional lymph nodes (mediastinal, axillary and brachial), spleen and bone marrow cells for

MDSC and/or T cell population analysis.

Lungs were dissected into small pieces and digested in 0.7 mg/mL collagenase A, 30

µg/mL bovine pancreatic DNase I and 35 U/mL hyaluronidase (all from Sigma, Australia)

(37oC, 1 hour), followed by grinding with 0.1% BSA/PBS (w/v) in a 100 µm strainer, and then a 40 µm strainer (all from In Vitro Technologies, Australia), over a 50 mL Falcon tube. Cell suspensions were washed with 20 mL wash buffer (0.1% v/v BSA/PBS) (1600

RPM, 10 min, 4oC) and resuspended in 2 mL wash buffer. Percoll centrifugation (1600

RPM, 25 min, brake off, RT) using gradients of 60% and 30% (prepared in cold PBS) separated the lymphocyte/monocyte fractions of the lung suspensions as described [878], and the interface between the 60% and 30% Percoll layers was collected for flow cytometry analysis.

Lymph nodes and spleen were ground in a 40 µm strainer over a 50 mL Falcon tube with

0.1% BSA/PBS. Using a 25G needle connected to a 2 mL syringe (both from BD

Biosciences, Australia), bone marrow cells were collected by flushing femurs 5 times with chilled PBS. Red blood cells in all suspensions were lysed (0.16 M ammonium chloride/0.01 M potassium bicarbonate/0.1 mM EDTA). Cell numbers were counted using trypan blue exclusion.

130

2.6.2 Analysis of MDSC and lymphocyte populations by flow cytometry

MDSC populations in mice are defined as CD11b+/Gr-1+ cells [483]. To analyse MDSC numbers and populations, cells from lungs, spleen, lymph nodes and bone marrow were stained with anti-CD11b (APC clone M1/70), Gr-1 (PE-Cy7, clone RB6-8C5), CD14

(FITC, clone rmC5-3) (all from BD Biosciences, Australia) and F4/80 (PE, clone BM8)

(eBiosciences, USA). Notably, although CD14 is a marker for monocytic human MDSC

[207, 493, 495], the antibody we used also detected murine monocytes, and thus was used as to characterise M-MDSC in this study. Gating on the Gr-1+ population identified the

CD11b+/Gr-1+ (MDSC) population. Further analysis characterised neutrophilic MDSC

(PMN-MDSC; CD14-/F4/80-) and monocytic MDSC (M-MDSC; CD14+ and/or F4/80+)

(Figure 2.6.2.1).

MDSC and T cells are proposed to form a reciprocal relationship (reviewed in [482]).

MDSC numbers were markedly affected by tumours or S100A8 in lungs and spleen, thus

T cell populations in both organs were analysed. Cells were stained with anti-CD3 (FITC, clone 17A2), anti-NK 1.1 (PE, clone PK136), anti-CD4 (Percp, clone RM4-5), anti-CD8

(APC, clone 53-6.7) and anti-CD25 (PE, clone 3C7) (all from BD Biosciences, Australia).

Gating on the CD3+ population identified NK-T cells (CD3+/NK 1.1+). Further analysis of the CD3+/NK 1.1- population identified CD4 T cells (CD3+/NK 1.1-/CD4+), CD8 T cells (CD3+/NK 1.1-/CD8+) and Treg (CD3+/NK 1.1-/CD4+/CD25+) (Figure 2.6.2.2).

Gating on the CD3- population identified NK cells (CD3-/NK 1.1+).

For optimal fluorescence signals, at least 0.3-0.5 x 106 of cells (50 µL) were incubated with 1 µg primary or IgG negative control antibody (BD Biosciences, Australia) (20 min, in the dark) and fixed with 1% paraformaldehyde (Sigma, Australia). Multicolour flow

131 cytometry was performed using a BD FACSCalibur™ (BD Biosciences, Australia), and data analysed using the FlowJo software (Tree Star Inc.).

132

A) B) C) D)

Figure 2.6.2.1: Analysis of MDSC populations in lungs and other lymphoid-associated organs. A representative example of spleen cells showing gating strategies to analyse MDSC populations. MDSC populations in lungs, regional lymph node and bone marrow were analysed using the same approach. A) The side scatter (SSC) against forward scatter (FSC) graph shows the granularity and size of cells. B) Gating on the Gr-1+ population selected all granulocytes. C) Further analysis of this Gr-1+ population classified cells into MDSC (CD11b+/Gr-1+; red rectangle) or neutrophils (CD11b-/Gr-1+; purple rectangle). D) Further analysis of this MDSC population identified PMN-MDSC (F4/80-/CD14-; red rectangle) or M-MDSC (F4/80+ and/or CD14+; purple rectangles).

133

A) B) C) D) E)

Figure 2.6.2.2: Analysis of T cell populations in lungs and spleen. A representative example of spleen cells showing gating strategies to analyse T cell populations. T populations in lungs were analysed using the same approach. A) The side scatter (SSC) against forward scatter (FSC) graph shows the granularity and size of cells. B) Gating on the CD3+ population selects all T lymphocytes (black rectangle), whereas gating on the CD3- population selects all CD3- lymphocytes (not shown). C) Further analysis of the CD3+ population classified NK-T cells (CD3+/NK 1.1+; purple rectangle), and further analysis of the CD3- population classified NK cells (CD3-/NK 1.1+; not shown). D) Further analysis of the CD3+/NK 1.1- population (red rectangle in C) identifies CD4 T cells (CD3+/NK 1.1-/CD4+; red rectangle), CD8 T cells (CD3+/NK 1.1-/CD8+; purple rectangle) or double negative T cells (CD3+/NK 1.1-/CD4-/CD8-; black rectangle). E) Further analysis of the CD4+ population in D) identified Treg (CD3+/NK 1.1-/CD4+/CD25+; red rectangle).

134

Chapter 3: Effects of S100A8 on lung cancer progression

3.1 Introduction Numerous studies have reported elevated expression of S100 proteins in human malignancies (Section 1.3.1). Although generally considered pro-tumourigenic (Section

1.3.4.1), the precise roles of S100 proteins remain unclear (reviewed in [674]). S100A8 and S100A9 are constitutively expressed in neutrophils [202] and are of interest because they are also highly expressed in MDSC [209], cell types that promote immunosuppression and progression of lung cancer [207, 367, 491-497] (Section 1.2.1.4).

Elucidating the functions of S100A8 and S100A9 in lung cancer may help unravel their contributions to this disease.

In human NSCLC, elevated expression of S100A8 and S100A9 in tumour stroma is associated with reduced survival, but elevated expression in tumours is associated with prolonged survival [408]. Similarly, elevated S100A9 expression in tumours [677] or infiltrating MDSC [207, 493] predicts poor outcomes of lung cancer. However, S100A8 is only reported to be elevated in the bronchoalveolar lavage fluid (BALF) of patients with lung cancer, and its associations with outcomes are unclear [676]. Functional studies using S100A9 knockout mice or silencing of S100A9 expression in lung tumour cells suggest that S100A9 promotes MDSC accumulation into sites of lung tumours and spleen

[821] and may contribute to liver metastasis [797]. Systemic injection of an anti-S100A8 antibody, or silencing S100A8 expression in lung tumour cells, suggests that S100A8 promotes lung tumour growth in vivo [771], possibly by causing MDSC recruitment [497,

771, 815], and contributes to liver metastasis [797]. However, unlike S100A9, functional roles of S100A8 in lung cancer cannot be validated using knockout mice because its gene deletion is embryonic lethal [227]. Although most studies indicate that S100A8 and/or

135

S100A9 proteins are pro-tumourigenic, the S100A8/A9 complex has been reported to increase NK cell numbers and activity, reducing the growth of subcutaneous pancreatic or colon cancers in mice [763]. To date, most of these functional studies have investigated the effects of S100A8 and S100A9 proteins on subcutaneous or experimental metastasis- induced lung tumour mouse models, but their effects on the lung microenvironment and orthotopic tumour growth remain unknown.

Inflammation and increased oxidative stress in the lung microenvironment are key contributors to the pathogenesis of lung cancer [365, 366] (Section 1.2.1). The function of S100A8, in particular, on the progression of lung cancer is of interest because its anti- inflammatory and antioxidative effects are more potent than S100A9 or the S100A8/A9 complex [223, 224] (Section 1.1.7.2). Inhalation of S100A8 into murine lungs attenuates asthma [352] and endotoxin-mediated acute lung injury [224], in part by oxidant scavenging, induction of IL-10 in airway epithelial cells and suppression of chemokines and cytokines that are important for neutrophil infiltration, and mast cell activation [224,

352]. Similarly, inhalation of S100A8 into healthy murine lungs promotes prominent induction of IL-10 in airway epithelial cells [224] and antioxidant genes (unpublished data from our laboratory, Appendix III). Results from these studies suggest that local administration of S100A8 may establish a protective lung microenvironment that may modulate tumour growth and progression.

Chapter 3 examined the effects of S100A8 inhalation on tumour growth, length of survival, metastasis, angiogenesis and leukocyte influx in mice with orthotopically- implanted Lewis lung carcinoma (LLC) cells. Results show that S100A8 likely delayed lung tumour progression and prolonged survival by altering the lung microenvironment 136

rather than directly promoting tumour cell death. Importantly, S100A8 reduced numbers of neutrophils in BALF and numbers of S100A8+ and S100A9+ myeloid cells in lungs from LLC-bearing mice at their midpoint of survival. Concomitant with the reduced numbers of MDSC in lungs and spleen, there were increased numbers of CD4 and NK-T cells in both organs. Results suggest that S100A8 promoted an immunoprotective microenvironment in lungs with growing tumours.

137

3.2 Experimental procedures 3.2.1 CellTitre-Blue viability assay

Triplicate samples of LLC cells (CRL-1642™; 1200 cells/well) were stimulated with recombinant murine S100A8 (0.2, 2 and 20 μg/mL; prepared as described in Section 2.1) in 96-well plates and cell viability was measured on days 3, 5 and 7 following treatment using the CellTitre-Blue reagent (Promega, USA), according to the manufacturer’s instructions. Baseline values were established by using unstimulated cells and cell-free culture medium on day 1. In addition, human lung epithelial cancer cells, H460 (HTB-

177™; authenticated by short tandem repeat profiling, as described [879]) and A549

(CCL-185™), were cultured in complete RPMI-1640 medium (Life Technologies,

Australia) under the same conditions as for LLC cells (Section 2.2.1), and stimulated with human recombinant S100A8 (prepared and purified by Dr Yuen Ming Chung [880] using the method described in Section 2.1). Cell viability of H460 or A549 cells on days 3, 5 and 7 following treatment were measured as above. H460 and A549 cells reached confluency more rapidly than LLC cells; thus, 500 cells/well were seeded into 96-well plates in triplicates and stimulated with 0.1, 1 and 10 μg/mL S100A8. Viability, indicative of proliferation, was expressed as the difference between fluorescence A560/590 nm of cells and baseline fluorescence (n = 3). Details of culture conditions for each cell line is described in Chapter 2, Section 2.2.1.

L-arginine is important for tumour cell proliferation and growth of some solid tumours, including NSCLC, which is arginine-dependent [426]. To determine if LLC cell proliferation was L-arginine-dependent, the viability of cells cultured in L-arginine- deficient medium (Life Technologies, Australia) was measured by the CellTitre-Blue reagent, according to the manufacturer’s instructions, and compared to growth in standard

138

cell culture medium or L-arginine-deficient medium supplemented with L-arginine (84 mg/L; amount present in standard medium), on days 2, 3, 5 and 7 (n = 3). To determine if S100A8 influenced cell proliferation of LLC cells following L-arginine depletion, the same protocol was used to measure the viability of LLC cells that were stimulated with

S100A8 (10 µg/mL) in the L-arginine-deficient medium over 7 days.

3.2.2 Effects of S100A8 on expression of tumour-modulating genes in LLC cells

Genes that influence inflammation, growth/proliferation, apoptosis, metastasis and redox potential are known to be altered in lung cancer cells (Table 3.3.1.1). S100A8 (10 µg/mL) was reported to affect proliferation of colon cancer cells in vitro after 3 days [881]. We chose to examine effects of S100A8 on gene expression after relatively short stimulation in an attempt to capture any early changes. LLC cells (2 x 105/mL) were stimulated with

DPBS (control) or S100A8 (10 μg/mL) for 4 or 15 hours and then harvested for RNA extraction, and mRNA expression of tumour-modulating genes was amplified by RT- qPCR (n = 4; Section 2.4). Gene expression normalised against housekeeping genes (β- actin and HPRT) was analysed using a web-based software package and Excel-based analysis tools, as described [224]. Fold changes with respect to controls were calculated for each gene, and fold changes of ≥ 2.5-fold were considered significant.

3.2.3 Validating methods to measure tumour size in mouse lungs

The standard method of measuring tumour size is to measure volumes of resected tumours

[853]. However, orthotopic lung tumours in mice often grow as highly dispersed tumour nodules throughout the lungs and cannot be easily resected; their quantitation requires bioluminescent labelled cells and/or advanced imaging methods [882]. Here, tumour sizes were assessed as total lung mass and relative areas on H&E-stained lung sections (Section 139

2.3.2.3). To validate reliability of these parameters, lungs from mice injected with LLC or DPBS (vehicle) (Section 2.2.6) were harvested after 6, 9, 13 and 19 days (n = 3-

5/group), and tumour sizes, measured as above, were plotted to compare growth patterns with those measured by tumour volumes, as previously reported [853]. Tumour sizes were assessed by recording total lung masses immediately after removal; naïve mice were harvested for baseline measurements (n = 3). Tumour areas relative to total lung areas in

H&E-stained lung sections were calculated using the cellSens imaging software coupled with the Olympus DP73 microscope using the 10X objective (Olympus Pty Ltd,

Australia).

3.2.4 Effects of S100A8 inhalation on tumour growth and progression

To investigate the effects of S100A8 inhalation on tumour growth and progression, mice implanted with LLC or DPBS (vehicle) (Section 2.2.6) were treated with intranasal

S100A8 (10 µg; dose chosen based on our previous study [224]) or HBSS (control), as detailed in Section 2.3.1 (n = 3-6/group). S100A8 was administered 30 min prior to LLC injection to determine if it reduced the growth of implanted LLC cells in vivo, and experiments were terminated after 3, 9 and 20 days, time points corresponding to early, mid- and endpoint LLC tumours in mice (Figure 2.3.1.1). To mimic a more clinically- relevant setting, S100A8 administration commenced 3 days post LLC injection. Lungs from mice were harvested after 10 days, to determine the effects of S100A8 at midpoint of survival, or when animals were morbid (criteria described in Section 2.3.1), to ascertain whether S100A8 altered their survival (Figure 2.3.1.2).

At termination of each experiment, samples were collected, as illustrated in Figure 2.3.2, and tumour size measured to assess growth. Assessment of key functional parameters

140

included metastasis, angiogenesis and leukocyte infiltration into the lungs and lymphoid- associated organs (Section 1.3.4). In particular, S100A8 is reported to promote liver metastasis when LLC cells are subcutaneously implanted into the flank of mice [797], thus livers from LLC-bearing mice were examined macroscopically and microscopically for the presence of tumours. Liver tumours, if any, were measured by their areas relative to total liver areas on macroscopic samples.

To assess angiogenesis, numbers of vessels in lungs were determined using anti-LYVE-

1 antibody (lymphatic endothelial cell marker; Abcam, Australia), a polyclonal antibody which we observed to detect both blood and lymphatic endothelial cells in lungs. Lung sections were stained with anti-LYVE-1 (1:100 v/v) (Section 2.5.6). LYVE-1+ vessels were then manually counted over 5 random areas of 1.5 mm2 at 100X, and values averaged.

Leukocyte influx is reported in many cancers in vivo (Tables 1.3.4.1 and 1.3.4.2) and may indicate tumour progression. Our earlier studies reported that the neutrophil influx and mast cell activation that markedly increase in acute lung injury was totally suppressed by

S100A8 [224]. To determine whether S100A8 promoted similar effects in BALF and lung tissues following LLC implantation, differential counts of leukocytes were performed

(Section 2.3.2.1), and S100A8 and S100A9 were used as neutrophil markers to assess infiltration of these cells into lungs [54, 204]. Expression of S100A8 and S100A9 mRNA in lungs from all groups was measured as described (Section 2.4), and reactivity in lung sections stained with specific anti-mouse S100A8 and S100A9 IgG antibodies (5 µg/mL)

(generated in-house, as previously described [52]) was assessed. Numbers of S100A8+

141 and S100A9+ cells in stained lung sections, excluding leukocytes in blood vessels, were quantitated in 10 random fields of view (400X; 0.1 mm2).

Mast cell activation was assessed by measuring β-hexosaminidase in BALF, an indicator of murine mast cell degranulation [352]. BALF (50 µL) mixed with a 50-mM sodium citrate buffer containing 5 mM p-nitrophenyl N-acetyl-β-D-glucosaminide (pH 4.5; 50

µL; Sigma, Australia) was incubated at 37°C for 2 hours, and the reaction stopped with

200 µL 0.2 M glycine (pH 10.6; Sigma, Australia). β-hexosaminidase was measured by spectrophotometry at A405 nm and values reported as A405 nm.

S100A8/A9 is reported to recruit MDSC to the spleen and lymph nodes of mice with breast cancer [209], but to increase recruitment of tumour-infiltrating NK cells in mice with pancreatic or colon cancer [763]. To determine whether S100A8 mediated similar effects, single cell suspensions prepared from lungs and lymphoid-associated organs were stained with established markers for analysis of MDSC or T cell numbers and populations by flow cytometry (Sections 2.6.1 and 2.6.2).

3.2.5 Data analysis

Statistical analysis was performed by GraphPad Prism (version 7). Mean survival ± SEM of LLC-bearing mice either with or without S100A8 inhalation were compared using the

Mantel-Cox test. For all other experiments, changes between two groups (means ± SEM) were compared using unpaired t-tests. Changes resulting from the different treatments were compared using ANOVA (1-way or 2-way where appropriate), followed by

Bonferroni’s multiple comparison tests. P-values < 0.05 were considered statistically significant.

142

3.3 Results 3.3.1 Effects of S100A8 on lung cancer cells in vitro

3.3.1.1 S100A8 had little effect on tumour-modulating gene expression

It is well established that genes which regulate inflammation, cell growth/proliferation, apoptosis, metastasis and redox potential are aberrantly expressed in lung cancer cells

(Table 3.3.1.1). Changes in expression of these genes likely occur prior to changes in viability or proliferation of cancer cells. At the early time points of 4 and 15 hours following S100A8 treatment, which precede the reported proliferative effects of S100A8

(10 µg/mL) on colon cancer cells in vitro [881], S100A8 had little obvious effect on most genes examined in LLC cells (Table 3.3.1.1). After 4 hours, c-kit, which promotes growth or proliferation and is upregulated in human lung cancer with poor outcomes [883], was reduced 3-fold by S100A8 treatment (Table 3.3.1.1). Although differences with controls were low, S100A8 also reduced the pro-proliferative gene, IGF-1 [884], and the ROS- producing enzyme, NOX2 [885], some 2-fold after 4 hours, but increased mRNA expression of the pro-inflammatory cytokine, TNF-α [886], by 2.3-fold (Table 3.3.1.1).

Some 2-fold suppression of IGF-1 and NOX2 was also manifested in cells stimulated with

S100A8 after 15 hours, whereas the early induction of TNF-α was reduced to 4.6-fold below control (Table 3.3.1.1). Concomitantly, S100A8 significantly suppressed the tumour suppressor gene, p53 [887, 888], by 3.1-fold (P < 0.05), and suppressed the antioxidative gene, PRDX1, by 2.8-fold after 15 hours (Table 3.3.1.1).

143

Table 3.3.1.1: Effects of S100A8 on tumour-modulating genes in LLC cells Gene Expression in lung cancer Reference Major 4 hr 15 hr function S100A8 S100A8 Fold change Fold change S100A8 ↑ in human lung adenocarcinoma [678] Refer to 1.4 ± 0.6 -1.1 ± 0.5 tissues compared to normal lung Section 1.1.7 tissues c-kit ↑ in lung cancer tissues from [883] Growth/ -3.0 ± 0.2 -1.5 ± 0.4 patients with poor prognosis proliferation IGF-1 ↑ in human NSCLC tissues [884] -2.2 ± 0.2 -2.9 ± 0.1 compared with benign pulmonary lesions p53 ↓ in tumour islets of human [887, 888] Apoptosis -1.2 ± 0.3 -3.1 ± 0.1 (*) NSCLC patients with reduced survival PRDX1 ↑ in lung cancer tissues compared [889] Redox 1.6 ± 0.3 -2.8 ± 0.2 to normal tissues modulation Mt1 ↑ in proliferating NSCLC cells [458] 1.0 ± 0.3 -1.0 ± 0.3 from patients with reduced survival HO-1 ↓ in metastatic human NSCLC [461] 1.4 ± 0.4 1.0 ± 0.2 compared to primary tumours NOX2 ↑ in human lung adenocarcinoma [885] -2.0 ± 0.3 -2.3 ± 0.4 epithelial cell line (A549) iNOS ↑ in tumour islets of human [408] 1.7 ± 1.0 2.0 ± 1.5 NSCLC patients with reduced survival IL-6 ↑ in human squamous cell [890] Cytokines -1.4 ± 0.2 1.2 ± 0.6 carcinoma and adenocarcinoma cells from non-smoking patients compared to smoking patients TNF-α ↑ in serum of human NSCLC [886] 2.3 ± 1.4 -4.6 ± 0.2 patients compared to healthy controls MMP-2 ↑ in metastatic-derived LLC cell [632] ECM -1.4 ± 0.4 -1.5 ± 0.2 line compared to primary tumour- degradation derived cell line and MMP-9 ↑ in A549 cell line transfected [633] metastasis -1.4 ± 0.5 1.3 ± 0.5 with integrin-linked kinase compared to control Effects of S100A8 on tumour-modulating genes expressed by LLC cells. Fold changes of mRNA expression in LLC cells stimulated with S100A8 (10 µg/mL) after 4 or 15 hours were normalised to DPBS (control-incubated cells). Data are means ± SEM; blue numbers indicate downregulation ≥ 2.5-fold; n = 4/group; *p < 0.05 compared with control.

144

3.3.1.2 S100A8 did not alter lung cancer cell viability

Although S100A8 may alter genes that affect viability/proliferation marginally in vitro

(Table 3.3.1.1), S100A8 (0.2 – 20 µg/mL) had no apparent effects on the viability of LLC cells over 7 days. Similarly, S100A8 (0.1 – 10 µg/mL) did not alter the viabilities of the human lung cancer cell lines, H460 and A549, over 7 days (Figures 3.3.1.2.1).

Figure 3.3.1.2.1: S100A8 did not alter viabilities of LLC, H460 and A549 cells in vitro. The viabilities after stimulation with different doses of S100A8 (0.2-20 µg/mL for LLC cells; 0.1-10 μg/mL for H460 or A549 cells) were assessed by the CellTitre-Blue assay on days 3, 5 and 7. Data expressed as fluorescence (560/590 nm) are means ± SEM; n = 4; no statistically significant changes were detected.

145

We reported that S100A8 suppresses the LPS-mediated induction of arginase II and iNOS genes in murine lungs [224], which suggests that S100A8 may alter L-arginine availability in lungs. Some solid tumours, including lung cancer, rely on L-arginine for growth (arginine auxotrophic) [426], suggesting that S100A8 may alter L-arginine levels in lungs to influence tumour cell proliferation. An L-arginine-deficient DMEM cell culture medium was used to determine if LLC cells relied on L-arginine to proliferate, and if S100A8 had any effects. LLC cells adhered to culture flasks and proliferated in standard DMEM cell culture medium (Group 1; Figure 3.3.1.2.2A). In an L-arginine- deficient medium, LLC cells ceased to proliferate, with apparent cell shrinkage that resembled apoptotic cells [891] at all time points (Group 2; Figure 3.3.1.2.2A). The viability of LLC cells in this medium (Group 2) remained at baseline (~0-500 fluorescence units) at all time points, and was significantly lower than cells grown in standard (Group 1; P < 0.0001 on day 3, 5 and 7) or L-arginine-supplemented growth medium (Group 3; P < 0.05 on day 2 and P < 0.0001 at other time points; Figure

3.3.1.2.2B). Supplementation of the deficient medium with L-arginine restored proliferation; cell morphology and viability were similar to LLC cells cultured in standard medium (Figure 3.3.1.2.2), indicating that LLC cells were arginine auxotrophic. The viability of LLC cells in each medium after S100A8 stimulation was similar to that of the corresponding untreated cells (not shown), indicating that S100A8 had little compensatory effect on proliferation in an L-arginine-depleted environment.

146

Figure 3.3.1.2.2: Proliferation of LLC cells was dependent on L-arginine. A) Representative images of the cell morphologies of unstimulated LLC cells in standard DMEM (Group 1), L- arginine-deficient medium (Group 2) or L-arginine-deficient medium + L-arginine (84 mg/L) (Group 3) after 2, 3 and 5 days of culture from 3 independent experiments, each performed in triplicate (scale bar = 100 µm; 100X). B) Viability of LLC cells in Groups 1-3 after 2, 3, 5 and 7 days of culture. Data are means ± SEM; n = 3; *p < 0.05 and ****p < 0.0001 as indicated.

147

3.3.2 Effects of S100A8 on lung tumour growth in vivo

3.3.2.1 Establishment of total lung mass and relative tumour area as parameters to measure tumour size in orthotopic LLC mouse model

Total lung mass (weight) and relative tumour areas in lungs from LLC-bearing mice harvested over 19 days were measured to determine whether these were suitable indicators of tumour growth compared to tumour volumes (typically measured via the use of digital callipers). Implantation of DPBS-Matrigel vehicle caused no obvious changes in lung morphology compared to naïve mice, and small tumour nodules became obvious

6 and 9 days following implantation of LLC embedded in Matrigel (Figure 3.3.2.1.1). At

9 days, some tumour nodules appeared to emerge from the airway epithelium, and these developed gradually into solid tumours from 13 days onwards (Figure 3.3.2.1.1).

Compared with control, total lung masses significantly increased 9, 13 and 19 days post

LLC implantation (9 days: P < 0.05; 13 and 19 days: P < 0.0001; Figure 3.3.2.1.2A).

Quantification of relative tumour areas revealed a similar trend. Compared with control, relative tumour areas were apparently greater at 9 days, although these changes were not statistically significant (P = 0.097). After 13 and 19 days, relative tumour areas were significantly increased compared with naïve or control (P < 0.001 and P < 0.0001 respectively) (Figure 3.3.2.1.2B). The LLC growth curves derived from the total lung masses and relative tumour areas (Figures 3.3.2.1.2) were comparable to that derived from tumour volumes, as previously reported [853]. Total lung masses and relative tumour areas were thus used to assess growth in mice with orthotopic LLC tumours.

148

A) B)

C) D)

E) F)

Figure 3.3.2.1.1: Microscopic morphology in lungs over a time course. A) Lungs from mice without treatment (day 0 or naïve, n = 3); B) after orthotopic implantation with vehicle control (DPBS + Matrigel); or LLC (4 x 105/mL) for C) 6, D) 9, E) 13 and F) 19 days (n = 3 to 5/group) were harvested for microscopic examination. H&E images of lung sections are representative for at least 3 mice/group/treatment (scale bar = 10 µm; 10X; dotted lines demark growing LLC tumours).

149

A) B)

Figure 3.3.2.1.2: Establishment of total lung mass and relative tumour area as parameters for measuring tumour size. Lungs from mice without treatment (day 0 or naïve, n = 3), after orthotopic implantation with vehicle control (DPBS + Matrigel) or LLC (4 x 105/mL) for 6, 9, 13 and 19 days (n = 3 to 5/group) were harvested for measurement of total lung mass and relative tumour area. A) Total lung masses (g) and B) relative tumour areas in sections of lungs from LLC-bearing mice over 19 days are means ± SEM, *p < 0.05, ***p < 0.001 and ****p < 0.0001 compared with control. The LLC growth curves in B) and C) are similar to that derived from tumour volumes as previously reported [853].

150

3.3.2.2 Co-treatment of S100A8 with LLC reduced lung tumour growth

Although S100A8 had no obvious effects on lung cancer cell proliferation in vitro

(Section 3.3.1.2), it has been reported to promote the growth of subcutaneous LLC tumours in mice [771], and its influence on the growth of orthotopic LLC tumours in vivo was examined in this chapter. LLC-bearing mice co-treated with inhaled S100A8 or

HBSS (control) were harvested after 20 days, a time point corresponding to large tumours and the endpoint of mouse survival [853]. In these experiments, HBSS-treated mice showed signs of morbidity after 18 days and were harvested. Macroscopically, there were obvious tumour masses in HBSS-treated mice compared to tumour-free control mice

(Figure 3.3.2.2.1A-B). Lungs from S100A8-treated mice harvested on day 20 were somewhat enlarged compared to tumour-free control mice (Figure 3.3.2.2.1C).

Microscopically, HBSS-treated mice were found to have extensive lung tumours, whereas

S100A8-treated mice had only a few small tumour nodules (Figure 3.3.2.2.1B-C).

Relative tumour areas indicated significantly reduced tumour burden in the S100A8- treated group (P < 0.05 compared to HBSS+LLC group) (Figure 3.3.2.2.1D), suggesting that S100A8 impaired tumour growth and progression.

151

A) B)

C) D)

Figure 3.3.2.2.1: Co-treatment of S100A8 with LLC reduced endpoint lung tumour growth. Mice inhaled HBSS or S100A8 (10 µg) 30 min prior to LLC injection. HBSS-treated mice were harvested on day 18 because of dehydration and lethargy; S100A8-treated mice were moribund and sacrificed on day 20. Morphologies of lungs from both groups were compared with tumour- free control mice treated with DPBS + Matrigel. Representative macroscopic (inset; scale bar = 1 cm) and H&E images of A) control, B) HBSS+LLC and C) S100A8+LLC-treated lungs (scale bar = 25 µm; 4X) are from at least 3 mice/group/treatment. Dotted lines demark tumours. D) Relative tumour areas are means ± SEM; n ≥ 3/group; p < 0.05 compared with HBSS+LLC.

152

We next determined whether repeated S100A8 administration (days 3 and 6), following initial co-treatment (day 0), reduced tumour growth after 9 days (midpoint of mouse survival) [853]. Lungs from HBSS-treated mice contained areas of tumour growth, whereas lungs from S100A8-treated mice were morphologically similar to control

(Figures 3.3.2.2.2A-C).

A) B)

Figure 3.3.2.2.2: Co-treatment of S100A8 with LLC reduced lung tumour growth at midpoint of survival. Mice received HBSS or S100A8 inhalation (10 µg) 30 min before LLC injection, and on days 3 and 6, then were harvested on day 9. Morphologies of lungs from both groups were compared with control mice treated with DPBS + Matrigel for 9 days. Representative H&E images of A) control, B) HBSS+LLC and C) S100A8+LLC-treated lungs (scale bar = 10 μm; 10X; dotted lines demark tumours) are from at least 3 mice/group/treatment.

153

Accordingly, lungs from HBSS-treated mice had total lung masses that were significantly greater than tumour-free control mice (P < 0.05), whereas lungs from S100A8-treated mice had total lung masses comparable to tumour-free control mice (Figure 3.3.2.2.3A), and significantly reduced areas of tumours compared to those of HBSS+LLC-treated mice (P < 0.01) (Figure 3.3.2.2.3B). These data suggested that S100A8 co-treatment and repeated administration reduced lung tumour growth.

A) B)

Figure 3.3.2.2.3: Co-treatment of S100A8 with LLC reduced tumour size at midpoint of survival. Mice received HBSS or S100A8 inhalation (10 µg) 30 min before LLC injection, and on days 3 and 6, then lungs harvested on day 9. A) Total lung masses (g) are means ± SEM, n ≥ 5/group; *p < 0.05 compared to vehicle control, #p < 0.05 compared to HBSS+LLC, and B) relative tumour areas are means ± SEM, n ≥ 5/group; **p < 0.01 compared with HBSS+LLC.

154

3.3.2.3 S100A8 inhalation after LLC implantation prolonged mouse survival

Co-treatment of S100A8 with LLC reduced lung tumour growth and prolonged the survival of mice compared to those co-treated with HBSS (control) (Section 3.3.2.2). In an attempt to mimic a clinical setting in which patients have advanced lung cancer, the effects of S100A8 on lung tumour growth and survival post LLC injection were examined.

Consistent with a previous report [853], HBSS+LLC-treated mice (control) survived for

19 ± 1 days. Remarkably, S100A8 prolonged the survival of LLC-bearing mice by up to

40 %; mice receiving S100A8 on days 3, 6 and 9 post LLC injection (Group 1) survived for 27 ± 1 days (P < 0.01 compared with control), and mice receiving S100A8 treatments every third day until moribund (~9 treatments; Group 2) survived for 28 ± 1 days (P <

0.001 compared with control) (Figure 3.3.2.3.1).

Figure 3.3.2.3.1: S100A8 prolonged survival in mice implanted with LLC. LLC was implanted into lungs on day 0, then groups of mice were given HBSS (Control) or S100A8 (10 µg) by inhalation, on days 3, 6 and 9 (Group 1), or every third day post LLC injection (Group 2). The days when mice became moribund were recorded and mice harvested. Survival curves of control, Group 1 and Group 2. Data represent 5 mice/group/treatment. Group 1 (**p < 0.01) and Group 2 (***p < 0.001) compared with Control.

155

Mice from both groups of S100A8-treated mice developed extensive lung tumours, like the control group (Figure 3.3.2.3.2), and there were no significant changes in total lung masses (Group 1: 0.55 ± 0.08 g; Group 2: 0.88 ± 0.11 g) or relative tumour areas (Group

1: 0.07 ± 0.01; Group 2: 0.09 ± 0.01) compared to those of control mice (Total lung mass:

0.74 ± 0.10 g and relative tumour area: 0.06 ± 0.01 respectively).

A) B)

Figure 3.3.2.3.2: S100A8-treated mice developed extensive lung tumours at endpoint of survival. LLC was implanted into lungs on day 0, then groups of mice were given A) HBSS (Control) or B) S100A8 (10 µg) by inhalation, on days 3, 6 and 9 (Group 1), C) or every third day post LLC injection (Group 2). The days on which mice became moribund were recorded and mice harvested. Lungs were harvested for measurement of tumour size. Representative macroscopic (inset; scale bar = 1 cm) and H&E images of lungs are from 5 mice/group/treatment (scale bar = 25 µm; 4X). Dotted lines demark growing LLC tumours.

156

Similarly, when mice were given S100A8 or HBSS on days 3, 6 and 9 post LLC implantation and harvested on day 10 (midpoint of survival [853]), both groups were found to have developed tumour nodules in lungs (Figure 3.3.2.3.3), but there were no statistically significant differences in total lung masses (HBSS+LLC: 0.36 ± 0.05 g and

S100A8+LLC: 0.46 ± 0.03 g) and relative tumour areas (Both groups: 0.003 ± 0.001).

Notably, S100A8 administration to control mice had not caused any apparent changes to normal lung morphology (Figure 3.3.2.3.3). Taken together, the data indicate it is unlikely that S100A8 promoted direct tumour cell death, and that co-treatment with S100A8 likely delayed tumour growth (Section 3.3.2.2) by altering the lung microenvironment.

A) B)

C) D)

Figure 3.3.2.3.3: Microscopic morphology in lungs at midpoint of survival. Mice received HBSS or S100A8 (10 µg) by inhalation 3, 6 and 9 days post LLC injection and lungs harvested on day 10. Representative H&E images of lungs from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC-treated mice are from at least 5 mice/group/treatment (scale bar = 10 μm; 10X; dotted lines demark tumours). 157

3.3.3 Effects of S100A8 on metastasis and angiogenesis

3.3.3.1 Sustained S100A8 treatment prevented the extra-pulmonary tumour growth in the liver found with intermittent treatment

S100A8 is reported to promote invasion and migration of cancer cells in vitro (Table

1.3.3.2), including LLC [771, 815]. Systemic injection of an anti-S100A8 antibody suggests that S100A8 provokes a metastatic niche in lungs in an experimental metastasis mouse model (tumours cells are systemically administered via the tail vein) [497, 815], and that silencing S100A8 expression in LLC cells contributes to the metastasis of subcutaneous tumours to the liver [797]. To date, orthotopic LLC tumours have only been reported to metastasise to regional lymph nodes (mediastinal) at endpoint survival (from day 17 onwards) [853], but not to more distant organs. Livers harvested from all LLC- bearing mice were examined to determine if S100A8 promoted extra-pulmonary tumour growth. There were no obvious liver tumours soon after LLC implantation (3 days), or at midpoint of survival in any of the treatment groups (9 or 10 days). At endpoint of survival

(18-28 days), mice treated with HBSS had developed no obvious liver tumours, whereas mice given one or three S100A8 treatments developed extensive liver tumours (Figure

3.3.3.1A-E), which were measured to 0.41 ± 0.01 and 0.44 ± 0.04, respectively (Figure

3.3.3.1G; P < 0.0001 compared to control for both groups). S100A8 inhalation every third day until endpoint did not, however, produce liver tumours (Figures 3.3.3.1F-G, P <

0.0001 compared to one or three treatments). The results reported here and in Sections

3.3.1, 3.3.2.2 and 3.3.2.3 suggest that S100A8 may establish an unfavourable microenvironment that initially delays tumour growth within the lungs, but if S100A8 inhalation is intermittent, then the lung microenvironment becomes conducive to the promotion of LLC growth in the liver.

158

A) B)

C) D)

E) F)

Figure 3.3.3.1 (legend on next page).

159

Figure 3.3.3.1: Sustained S100A8 treatment prevented the extra-pulmonary tumour growth in the liver found with intermittent treatment. Representative macroscopic (shown in inset) and microscopic H&E images of livers (5 mice/group/treatment) harvested from A) tumour-free control mice (DPBS + Matrigel), B) mice which inhaled HBSS 30 min prior to LLC injection and harvested after 18 days, C) mice which inhaled S100A8 (10 µg) 30 min prior to LLC injection and harvested after 20 days, D) mice which inhaled HBSS or E) S100A8 (10 µg) on days 3, 6 and 9 post LLC injection, F) or every third day post LLC injection until mice became moribund. Scale bar of macroscopic image = 1 cm; scale bar of microscopic image = 10 µm; 10X. Dotted lines demark tumours. G) Relative tumour areas are means ± SEM, n = 3 or 4/group; ****p < 0.0001 compared with control; ++++p < 0.0001 compared to one treatment; ####p < 0.0001 compared to three treatments.

160

3.3.3.2 S100A8 did not affect vessel numbers in mouse lungs

Angiogenesis, or formation of new blood vessels, is one hallmark of cancer [363] that can influence tumour growth and metastasis, because it facilitates sufficient vasculature to transport nutrients and oxygen for primary or metastatic tumour growth [400] (Section

1.2.1.2). Angiogenesis likely occurs at early to midpoint of tumour growth to sustain nutrient and oxygen needs for its progression [400]. The effects of S100A8 inhalation on blood vessel numbers in lungs were assessed in control or LLC-bearing mice after 3 or

10 days, time points corresponding to early and midpoints of survival respectively [853], using an anti-LYVE-1 antibody that detects both blood and lymphatic endothelial cells

(Figures 3.3.3.2A-B). S100A8 administration at either time point to control mice did not alter vessel numbers (Figure 3.3.3.2C). Although LLC implantation significantly increased vessel numbers in lungs from mice harvested on day 3 (from 7 ± 2 to 14 ± 1/

1.5 mm2; P < 0.05 compared to control), S100A8 inhalation had no obvious effect (16 ±

1/ 1.5 mm2; P < 0.01 compared with control or S100A8+DPBS; Figure 3.3.3.2C). This result indicates that while tumours had promoted obvious angiogenesis in lungs on day 3,

S100A8 had no obvious effects. No obvious changes had been produced by S100A8 in vessel numbers in lungs on day 10, and numbers from all groups were similar (~15-17 vessels/ 1.5 mm2) (Figure 3.3.3.2D).

161

A) B)

C) D)

Figure 3.3.3.2: S100A8 did not affect vessel numbers in lungs. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10. A) A representative example of lungs from LLC-bearing mice treated with S100A8 harvested on day 10 showing anti-LYVE- 1 immunoreactivity in endothelial cells of vessels (indicated by arrows and red staining) but B) not within tumours (demarked by dotted lines) (scale bar = 50 μm; 50X). All other samples showed similar expression patterns and numbers of LYVE-1+ vessels per 1.5 mm2 in lungs on C) day 3 and D) day 10 were quantified microscopically. Data are means ± SEM; n ≥ 4/group; *p < 0.05 and **p < 0.01 compared with control (HBSS+DPBS); ++p < 0.01 compared with S100A8+DPBS.

162

3.3.4 Effects of S100A8 on leukocyte influx

3.3.4.1 S100A8 reduced neutrophil influx into BALF

Increased leukocyte influx, including neutrophils [809] and lymphocytes [763], is reported to contribute to the tumour-modulating effects of S100A8 and S100A9 (Section

1.3.4.1.3). We previously reported that S100A8 increases lymphocyte influx into healthy lungs of mice 6 hours post inhalation, but had only weak effects on neutrophil influx

[224]. On the other hand, S100A8 attenuates acute lung injury in part by suppressing the expression of chemokines that influence neutrophil influx [224]. These results suggest that S100A8 may influence tumour growth and progression (Sections 3.3.2.2 and 3.3.2.3) by altering leukocyte influx. We first performed differential counts of leukocytes in

BALF in an initial screen for changes in lymphocyte, neutrophil, monocyte and eosinophil numbers, in samples harvested at early and midpoints of survival, i.e. on days

3 and 10 [853].

S100A8 inhalation by control mice did not significantly alter total leukocyte numbers or populations in BALF at either time-point (Table 3.3.4.1.1). LLC implantation increased total leukocyte numbers in BALF on day 3 (from 0.4 x 106 to 0.9 x 106; P < 0.05 compared to control), whereas mice co-treated with S100A8 and LLC had leukocyte numbers that were similar to baseline control values (P < 0.05 compared to HBSS+LLC; Table

3.3.4.1.1). However, no statistically significant changes in the numbers (not shown) or percentages of monocytes, neutrophils, lymphocytes or eosinophils were obvious on day

3 (Table 3.3.4.1.1).

Total leukocyte numbers in BALF harvested on day 10 were also increased in LLC- bearing mice (1.2 x 106; P < 0.01 compared to control). In contrast, BALF from LLC-

163 bearing mice treated with S100A8 contained significantly fewer leukocytes, with numbers similar to baseline (P < 0.01 compared to HBSS+LLC; Table 3.3.4.1.1).

Differential counts of leukocyte populations indicated no statistically significant changes in the numbers (not shown) or percentages of monocytes, lymphocytes or eosinophils

(Table 3.3.4.1.1). Remarkably, LLC implantation increased neutrophils in BALF from

2.4 ± 1.2 % to 10.9 ± 1.7 % of total cells (P < 0.01 compared to control), whereas BALF from S100A8-treated LLC-bearing mice contained similar percentages to baseline (3.0 ±

1.3 % of total cells; P < 0.05 compared to HBSS+LLC; Table 3.3.4.1.1). These results indicate that S100A8 reduced neutrophil influx into the lungs of LLC-bearing mice at midpoint of survival.

Table 3.3.4.1.1: Total leukocyte numbers and percentages of leukocyte populations in BALF Group Time Monocyte Neutrophil Lymphocyte Eosinophil Total (x 106) point (%) (%) (%) (%) (day) HBSS+ 3 67.3 ± 4.1 3.7 ± 0.6 27.8 ± 4.4 1.1 ± 0.4 0.4 ± 0.1 DPBS 10 68.8 ± 1.3 2.4 ± 1.2 28.4 ± 2.4 0.4 ± 0.4 0.4 ± 0.1 S100A8+ 3 66.4 ± 5.9 5.0 ± 1.4 27.8 ± 6.2 0.8 ± 0.4 0.8 ± 0.0 DPBS 10 63.8 ± 1.9 4.8 ± 2.2 31.3 ± 1.3 0.3 ± 0.3 0.6 ± 0.0 HBSS+ 3 62.1 ± 4.3 4.9 ± 1.7 32.5 ± 3.4 0.5 ± 0.3 0.9 ± 0.1 (*) LLC 10 65.0 ± 3.8 10.9 ± 1.7 (**) 23.3 ± 3.6 0.8 ± 0.4 1.2 ± 0.1 (**) S100A8+ 3 69.9 ± 2.8 2.0 ± 0.8 27.3 ± 2.0 0.7 ± 0.4 0.5 ± 0.1 (#) LLC 10 72.8 ± 4.6 3.0 ± 1.3 (#) 24.0 ± 5.4 0.2 ± 0.1 0.5 ± 0.2 (##) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given HBSS or S100A8 (10 µg) 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10. Total leukocyte numbers (x 106) and percentages of leukocyte populations in BALF determined by differential staining are means ± SEM; n ≥ 5/group; *p < 0.05 and **p < 0.01 compared with control (HBSS+DPBS) (indicated in red); #p < 0.05 and ##p < 0.01 compared with HBSS+LLC (indicated in blue).

164

S100A8 and S100A9 are constitutively expressed in neutrophils and these cells have high expression of the respective mRNAs [54, 204]. On the other hand, S100A8 and S100A9 are not expressed in normal lungs except for neutrophils within vasculature [224]. Here, we used the expression of the S100A8 and S100A9 mRNA in lungs, and numbers of infiltrating S100A8+ and S100A9+ myeloid cells to additionally assess neutrophil-like myeloid cell influx into the lungs of LLC-bearing mice. S100A8 administration to control mice had little effect on S100A8 or S100A9 mRNA expression on day 3, whereas LLC implantation suppressed both genes by some 6-fold (P < 0.05 compared to control for

S100A9 mRNA expression). However, in lungs from mice implanted with LLC and treated with S100A8, expression of both genes was similar to controls (Table 3.3.4.1.2).

Consistent with the absence of change in neutrophil numbers in BALF across all groups

(Table 3.3.4.1.1), few S100A8+ or S100A9+ neutrophil-like myeloid cells were apparent in lungs from any group of mice harvested on day 3 (~2-4 cells/view of 0.1 mm2 for

S100A8; ~4-6 cells/view of 0.1 mm2 for S100A9), and changes in numbers were not statistically significant (Figures 3.3.4.1.1A-B). Neither of the groups of mice implanted with LLC had obvious lung tumour masses on day 3.

Table 3.3.4.1.2: Expression of S100A8 and S100A9 mRNA in lungs Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days S100A8 -1.5 ± 0.2 1.6 ± 0.3 -5.8 ± 0.1 1.2 ± 0.3 1.0 ± 0.3 1.7 ± 0.4 S100A9 -2.0 ± 0.1 1.5 ± 0.4 -6.2 ± 0.0 (*) -1.2 ± 0.2 -1.8 ± 0.1 -2.0 ± 0.2 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given HBSS or S100A8 (10 µg) 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10. Fold changes of S100A8 or S100A9 mRNA expression in lung lysates relative to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Blue numbers indicate downregulation ≥ 2.5-fold, *p < 0.05 compared with control.

165

A) B)

Figure 3.3.4.1.1: S100A8 did not alter numbers of neutrophil-like myeloid cells in lungs with early tumours. Mice received S100A8 (10 µg) or HBSS by inhalation and lungs harvested 3 days after DPBS (vehicle) or LLC injection. Average numbers of A) S100A8+ and B) S100A9+ myeloid cells per 0.1 mm2 of lung sections were quantified microscopically over 10 random fields of view at 400X are means ± SEM, n ≥ 3/group, no statistically significant changes were detected.

166

After 10 days, expression of S100A8 and S100A9 mRNA was similar in all groups (Table

3.3.4.1.2). In keeping with the results from differential counts (Table 3.3.4.1.1), there were no or few S100A8+ or S100A9+ myeloid cells in lungs from control mice treated with HBSS or S100A8 after 10 days (~1 cell/view of 0.1 mm2), whereas similar numbers of S100A8 and S100A9 expressing neutrophil-like myeloid cells (~8 cells/view) infiltrated tumours (P < 0.001 compared to control), and S100A8 profoundly suppressed these to baselines (P < 0.01; Figures 3.3.4.1.2-3.3.4.1.4). S100A8 is expressed in airway epithelial cells, alveolar macrophages and some endothelial cells of naïve mice 12 hours after S100A8 inhalation [224]. Similarly, S100A9 is expressed in airway epithelial cells of naïve mice 12 hours after S100A8/A9 inhalation [223]. Moreover, S100A8 and

S100A9 are expressed in tumour cells in human lung cancer [408, 678]. However, no obvious anti-S100A8 or anti-S100A9 immunoreactivity was detected in other cell types in lungs on days 3 and 10 (Figures 3.3.4.1.2 and 3.3.4.1.3), as well as other time points

(Appendix IV).

Suppression of neutrophil influx by S100A8 in acute lung injury is accompanied by reduced mast cell activation, thereby influencing chemokine production [224]. Mast cells are reported to promote colon cancer progression in mice by promoting IL-17-mediated immunosuppression [568]. To assess whether S100A8 reduced mast cell activation at the

10-day time-point, levels of beta-hexosaminidase (an indicator of mast cell activation in mice) in BALF, reported as OD405, were compared between groups. However, beta- hexosaminidase levels were ~0.30 in all groups, in which S100A8 inhalation and/or LLC implantation had little effect.

167

A) B)

C) D)

E) F)

Figure 3.3.4.1.2: S100A8 suppressed tumour-infiltrating S100A8+ neutrophil-like myeloid cells at midpoint of survival. Mice received S100A8 (10 µg) or HBSS by inhalation 3, 6 and 9 days post DPBS (vehicle control) or LLC injection and lungs harvested on day 10. Anti-S100A8 immunoreactivity of lung sections (red cells indicated by arrows) from mice treated with A) HBSS+DPBS (10X), B) S100A8+DPBS (10X; scale bar = 10 μm), C) HBSS+LLC (10X; scale bar = 10 μm), D) a magnified image of C), indicated by a rectangle (80X; scale bar = 2.5 μm), E) S100A8+LLC (10X) and F) a magnified image of E), indicated by a rectangle (80X). Sections from all groups are representative of lungs from at least 5 mice/group.

168

A) B)

C) D)

E) F)

Figure 3.3.4.1.3: S100A8 suppressed tumour-infiltrating S100A9+ neutrophil-like myeloid cells at midpoint of survival. Mice received S100A8 (10 µg) or HBSS by inhalation 3, 6 and 9 days post DPBS (vehicle control) or LLC injection and lungs harvested on day 10. Anti-S100A9 immunoreactivity of lung sections (red cells indicated by arrows) from mice treated with A) HBSS+DPBS (10X), B) S100A8+DPBS (10X; scale bar = 10 μm), C) HBSS+LLC (10X; scale bar = 10 μm), D) a magnified image of C), indicated by a rectangle (80X; scale bar = 2.5 μm), E) S100A8+LLC (10X) and F) a magnified image of E), indicated by a rectangle (80X). Sections from all groups are representative of lungs from at least 5 mice/group.

169

A) B)

Figure 3.3.4.1.4: S100A8 reduced the numbers of tumour-infiltrating myeloid cells in lungs at midpoint of survival. Mice received S100A8 (10 µg) or HBSS by inhalation 3, 6 and 9 days post DPBS (vehicle control) or LLC injection and lungs harvested on day 10. Average numbers of A) S100A8+ and B) S100A9+ myeloid cells per 0.1 mm2 of lung sections quantified microscopically over 10 random fields of view at 400X are means ± SEM; n ≥ 4/group; **p < 0.01, ***p < 0.001 and ****p < 0.0001 as indicated.

170

3.3.4.2 S100A8 reduced total and PMN-MDSC numbers in lungs and spleen from

LLC-bearing mice

S100A8 and S100A9 are highly expressed in MDSC in cancer [209], and the results in

Section 3.3.4.1 suggest that the tumour-infiltrating S100A8+ and S100A9+ neutrophil-like myeloid cells could be MDSC. In particular, S100A8 may have reduced MDSC infiltration into lungs from LLC-bearing mice after 10 days. We next examined MDSC numbers in lungs, and spleen, regional lymph nodes and bone marrow (lymphoid- associated organs where MDSC accumulation is reported [498-500]), by analysis using established MDSC markers (Section 2.6). Consistent with a previous report [503], PMN-

MDSC (CD11b+/Gr-1+/CD14-/F4/80-) were found to be the predominant population in all organs from all groups, comprising ~90 % of total MDSC in the spleen, regional lymph nodes and bone marrow, and ~75 % in lungs. Accordingly, M-MDSC (CD11b+/Gr-

1+/CD14+ and/or F4/80+) comprised ~10 % of total cells in spleen, regional lymph nodes and bone marrow, and ~25 % in lungs.

Total and PMN-MDSC constituted ~0.7 % of total cells in regional lymph nodes in all groups, and differences in numbers were not statistically significant. In control mice treated with HBSS or S100A8, MDSC and PMN-MDSC constituted ~0.6 % and 0.5 % of total cells in lungs, spleen and bone marrow, respectively (Figure 3.3.4.2). LLC implantation significantly increased percentages of total and PMN-MDSC to ~1.3 % in lungs (P < 0.05), ~1.1 % in spleen (P < 0.05) and ~7.0 % in bone marrow (P < 0.01) compared to control (Figure 3.3.4.2). Remarkably, S100A8 administration to LLC- bearing mice suppressed both total MDSC and PMN-MDSC to baseline levels found in lungs and spleen (P < 0.05 compared to HBSS+LLC; Figures 3.3.4.2A-B).

171

A)(i) (ii)

B)(i) (ii)

C)(i) (ii)

Figure 3.3.4.2: S100A8 reduced the percentages of total and PMN-MDSC in lungs and spleen from LLC-bearing mice. Mice received S100A8 (10 µg) or HBSS by inhalation at 3, 6 and 9 days post DPBS (vehicle) or LLC injection and A) lungs, B) spleen and C) bone marrow harvested on day 10 and stained with MDSC markers (Section 2.6). Percentages of (i) total (CD11b+/Gr-1+) and (ii) PMN-MDSC (CD11b+/Gr-1+/F4/80-/CD14-) in each organ, analysed by flow cytometry (refer to Figure 2.6.2.1), are means ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001 compared to HBSS+DPBS (control) or as indicated; ++p < 0.01 compared to S100A8+DPBS.

172

By contrast, percentages of both total MDSC and PMN-MDSC in bone marrow increased to ~8 % in LLC-bearing mice, but no statistically significant differences were observed in LLC-bearing mice treated with S100A8 (Figures 3.3.4.2C). Taken together, these data suggest that while S100A8 inhalation reduced MDSC infiltration into lungs and spleen in

LLC-bearing mice at midpoint of survival, there was no effect on the generation of these cells within the bone marrow.

173

3.3.4.3 S100A8 increased total, CD4, NK-T and double negative T cell numbers in lungs and spleen from LLC-bearing mice

It is established that increases in MDSC numbers in tumours are associated with decreases in the numbers and function of key anti-tumour T cell populations (CD4, CD8, NK and

NK-T cells) (reviewed in [507]) and expansion of immunosuppressive Treg cells

(reviewed in [482]). We next tested whether S100A8 increased T cell numbers in lungs and spleen at the 10-day time-point using established cell markers (Section 2.6). T cells constituted 10 % of total cells in lungs from control mice (Table 3.3.4.3). Although

S100A8 administration to control mice decreased the percentage of T cells to ~5 % in lungs, changes were not statistically significant (Table 3.3.4.3). LLC implantation increased total T cell numbers in lungs (17.6 ± 3.1 % of total) compared to control (10.0

± 1.4 % of total), but these changes were, similarly, not statistically significant (Table

3.3.4.3). Remarkably, S100A8 administration to LLC-bearing mice tripled T cell numbers in lungs compared to control (32.2 ± 1.6 % of total), to levels that were significantly greater than in any other groups (P < 0.001; Table 3.3.4.3). T cells constituted ~20 % of total cells in spleen from control mice, and numbers were similar in all groups (Table 3.3.4.3).

CD4 T cells constituted 3.6 ± 0.6 % of total cells in lungs from control mice, and changes followed a comparable trend to those for total T cells, which measured 5.9 ± 1.5 % in lungs from LLC-bearing mice (Table 3.3.4.3). In line with the increased total T cell numbers, percentages of CD4 T cells in lungs from LLC-bearing mice treated with

S100A8 were elevated (11.8 ± 0.8 %), and significantly higher than numbers in any other groups (P < 0.01; Table 3.3.4.3). Percentages of CD4 T cells in spleens from LLC-bearing mice treated with S100A8 were also significantly increased compared to control (9.3 ±

174

0.6 % compared to 6.7 ± 0.4 %, P < 0.05), but not significantly higher than the numbers in spleen from HBSS-treated LLC-bearing mice (8.0 ± 0.6 %; Table 3.3.4.3).

S100A8/A9 is reported to induce autoreactive CD8+ T cells in mice with autoimmune disorders [772], suggesting that administering S100A8 to mice may have increased CD8

T cells in lungs and spleen. However, S100A8 administration to control mice slightly decreased numbers from 2.3 ± 0.4 % to 1.2 ± 0.2% in lungs, and percentages of CD8 T cells in lungs from LLC-bearing mice treated with HBSS (3.2 ± 0.5 %) were similar to those treated with S100A8 (3.1 ± 0.5 %) (Table 3.3.4.3). CD8 T cell numbers comprised higher percentages in spleen (~7-8 %) and were not statistically different after any treatments (Table 3.3.4.3).

S100A8 is reported to increase NK cell numbers and lysis of pancreatic tumours in mice

[763], suggesting that S100A8 may have increased NK cells in lungs and spleen. S100A8 administration to control mice did not affect NK cell percentages in lungs (Table 3.3.4.3).

Interestingly, LLC implantation significantly increased NK cell percentages from 6.3 ±

0.8% to 12.7 ± 0.8% (P < 0.001), whereas S100A8 reduced percentages to baseline levels

(6.7 ± 0.5%; P < 0.001 compared to HBSS+LLC; Table 3.3.4.3). However, NK cell percentages in spleen were similar in all groups (~3%; Table 3.3.4.3). NK-T cell percentages in lungs from control mice (0.8 ± 0.3 %) were somewhat greater than those treated with S100A8 (0.3 ± 0.0%), and LLC implantation did not alter NK-T cell percentages in lungs (0.9 ± 0.2%) (Table 3.3.4.3). Importantly, S100A8 administration to

LLC-bearing mice significantly increased percentages of NK-T cells to 2.3 ± 0.2 % in lungs (P < 0.01 compared to all other groups; Table 3.3.4.3). S100A8 administration to

175 control mice significantly decreased percentages of NK-T cells in spleen from 0.5 % to

0.4 % (P < 0.05 compared to control). LLC-bearing mice also showed significantly lower percentages of NK-T cells in spleen (0.2 %; P < 0.0001 compared to control), and percentages were increased to baseline levels with S100A8 treatment (0.5 %; P < 0.05 compared to S100A8+DPBS or HBSS+LLC; Table 3.3.4.3). Treg numbers comprised

0.5 – 0.6 % of total cells in lungs and spleen from control mice, and in lungs from mice treated with S100A8, percentages were somewhat less (0.1 %; Table 3.3.4.3). LLC implantation significantly increased Treg numbers to 3.2 ± 0.3 % in lungs (P < 0.0001) and to 1.7 ± 0.1 % in spleen (P < 0.0001) compared to control, whereas S100A8 treatment had little effect in lungs or spleen from LLC-bearing mice (Table 3.3.4.3).

Unexpectedly, we identified a T cell population in lungs and spleen that was CD3+ but unreactive with the CD4 and CD8 markers (double negative T cells, DNT). This population was also unreactive with the NK 1.1 marker, and may represent an NK-T population negative for NK 1.1 [892]. DNT comprised 3.9 ± 0.6 % and 2.6 ± 0.3 % of total cells in lungs and spleen, respectively. S100A8-treated control mice contained fewer of these cells in lungs (1.5 ± 0.2 %), whereas levels in spleen were similar (2.4 ± 0.3 %;

Table 3.3.4.3). LLC implantation increased DNT cell numbers in lungs (7.4 ± 1.7 %) but changes were not statistically different from control values, and numbers in spleen were similar to control (Table 3.3.4.3). Numbers of DNT cells in LLC-bearing mice treated with S100A8 dramatically increased to 15.3 ± 1.4 % in lungs (P < 0.01 compared to all other groups). Lower, but nonetheless significant increases were also found in spleen from these mice (3.5 ± 0.1 %; P < 0.05 compared to all other groups; Table 3.3.4.3).

Collectively, these data show that S100A8 may enhance anti-tumour immunity by

176

reducing pro-tumourigenic MDSC infiltration, coupled with concomitant increases in protective T cell populations, particularly CD4 and NK-T cells.

177

Table 3.3.4.3: S100A8 increased the percentages of total, CD4, NK-T and DNT cells in lungs and spleen of LLC-bearing mice % of total HBSS+DPBS S100A8+DPBS HBSS+LLC S100A8+LLC cells Lungs Spleen Lungs Spleen Lungs Spleen Lungs Spleen Total T cells 10.0 ± 1.4 16.8 ± 0.9 5.3 ± 0.4 20.1 ± 1.8 17.6 ± 3.1 17.7 ± 0.8 32.2 ± 1.6 21.8 ± 1.0 (**** ++++ ###) CD4 T cells 3.6 ± 0.6 6.7 ± 0.4 2.6 ± 0.3 7.8 ± 0.2 5.9 ± 1.5 8.0 ± 0.6 11.8 ± 0.8 9.3 ± 0.6 (**** ++++ ##) (*)

CD8 T cells 2.3 ± 0.4 7.2 ± 0.5 1.2 ± 0.2 8.2 ± 0.5 3.2 ± 0.5 7.6 ± 0.2 3.1 ± 0.5 7.4 ± 0.1 (+)

NK-T cells 0.8 ± 0.3 0.5 ± 0.0 0.3 ± 0.0 0.4 ± 0.0 0.9 ± 0.2 0.2 ± 0.0 2.3 ± 0.2 0.5 ± 0.0 (*) (****) (** +++ ##) (+ ####)

Treg 0.5 ± 0.2 0.6 ± 0.1 0.1 ± 0.0 0.9 ± 0.0 3.2 ± 0.3 1.7 ± 0.1 3.8 ± 0.2 1.6 ± 0.1 (****) (****) (**** ++++) (**** ++)

DNT cells 3.9 ± 0.6 2.6 ± 0.3 1.5 ± 0.2 2.4 ± 0.3 7.4 ± 1.7 2.0 ± 0.1 15.3 ± 1.4 3.5 ± 0.1 (**** ++++ ##) (* + ##)

NK cells 6.3 ± 0.8 4.0 ± 0.5 5.2 ± 0.6 3.2 ± 0.3 12.7 ± 0.8 3.1 ± 0.1 6.7 ± 0.5 3.2 ± 0.3 (***) (***)

Mice inhaled S100A8 (10 µg) or HBSS 3, 6 and 9 days post DPBS (vehicle) or LLC injection, were harvested on day 10, and single cell suspensions from

+ + + + + lungs and spleen stained with identifying T cell surface markers. Percentages of total (CD3+), CD4 (CD3 /CD4 ), CD8 (CD3 /CD8 ), NK-T (CD3 /NK

+ + + + - - - 1.1 ), Treg (CD4 /CD25 ), double-negative T (DNT; (CD3 /NK 1.1 /CD4 /CD8 )) and NK (CD3-/NK 1.1+) cells in each organ, analysed by flow cytometry (refer to Figure 2.6.2.2), are means ± SEM; n ≥ 3/group; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 compared to HBSS+DPBS

## ### #### (control); +p < 0.05, ++p < 0.01, +++p < 0.001, ++++p < 0.0001 compared to S100A8+DPBS; p < 0.01, p < 0.001, p < 0.0001 compared to HBSS+LLC. Significant increases are indicated in red, and significant decreases in blue.

178

In summary, S100A8 did not promote direct tumour cell lysis, but likely delayed lung tumour progression by altering the microenvironment of the lungs. When given as three intermittent treatments, or continuous treatments on every third day, S100A8 prolonged the survival of LLC-bearing mice by up to 40 %. However, LLC-bearing mice in the former, but not the latter group, developed extra-pulmonary tumour growth in the liver.

This result suggests that S100A8 may have systemic tumour-protective effects when administered continuously; testing this possibility requires intravenous S100A8 administration. Although S100A8 affected intrapulmonary and extra-pulmonary tumour progression, it did not alter vessel numbers, an important indicator of angiogenesis, in lungs. Further studies are warranted to determine if S100A8 influences other parameters of angiogenesis, including blood flow and vessel size [893-895]. Importantly, S100A8 was observed to reduce numbers of neutrophils in BALF and numbers of S100A8+ and

S100A9+ myeloid cells in lungs from LLC-bearing mice at the midpoint of survival.

Concomitantly, there were lower numbers of MDSC in lungs and spleen, but higher numbers of CD4 and NK-T cells in both organs. S100A8 has been reported to suppress the induction of pro-inflammatory cytokines and chemokines in acute lung injury and induces IL-10 in airway epithelial cells [224]. Many of these mediators regulated by

S100A8 in acute lung injury also mediate MDSC expansion, activation and recruitment

(Section 1.2.1.4). We chose to examine some of these parameters, and other potential underlying mechanisms whereby S100A8 contributed to a protective microenvironment unfavourable to lung tumour progression, as set out in Chapter 4.

179

Chapter 4: Potential mechanisms whereby S100A8 mediated protective effects in lung cancer

4.1 Introduction

S100A8 is not constitutively expressed in human or murine lung tissue (Section 1.1.5.1), but is upregulated in sputum from patients with airway inflammatory diseases, including cystic fibrosis, asthma, acute respiratory distress disorder and COPD [246, 896, 897].

Contrasting with numerous studies which suggest that S100A8 binds TLR-4 [294] or

RAGE [291], promoting inflammation, our previous studies found little evidence of pro- inflammatory effect when S100A8 was inhaled into the lungs of mice [224, 352]. In murine lungs, S100A8 is found in infiltrating myeloid cells 4 hours after LPS inhalation, and in airway epithelial cells 12 hours after S100A8 inhalation [224]. Although S100A8 is generally considered to be pro-tumourigenic, one study suggests an anti-tumourigenic role, in which S100A8 binds to RAGE on NK cells to increase killing of murine pancreatic tumour cells in vivo [763]. Therefore, mechanisms through which S100A8 may protect against tumour progression require in-depth evaluation.

Chapter 3 contains the first evidence indicating that S100A8 significantly prolonged the survival of mice with orthotopically-growing lung tumours, and suggests that its ability to reduce PMN-MDSC infiltration to lungs and spleen (Figure 3.3.4.2), and concomitantly increase CD4 and NK-T cell numbers (Table 3.3.4.3) may contribute to its tumour-protective effect. Many of the pro-inflammatory cytokines and chemokines suppressed by S100A8 in acute lung injury [224] are key mediators of MDSC expansion, activation and recruitment (Section 1.2.1.4). Furthermore, the IL-10 induced by S100A8

[224] may not only reduce inflammation, but may also enhance NK-T cell proliferation

180

and killing capacity [538, 539]. Moreover, we showed that S100A8 induces antioxidant genes in the lungs of healthy mice (Appendix III) and has oxidant-scavenging functions

[13]. Altogether, these observations suggest that S100A8 may counteract the suppressive effects of MDSC and modulate the lung redox microenvironment to favour apoptosis of anti-tumour T cells [431, 482, 483].

Results presented in this chapter show that S100A8 suppressed cytokines which promote

MDSC expansion, activation and recruitment, including IL-1β, IL-4, IL-6, IL-12β and

IFN-γ, in mice with growing lung tumours at the midpoint of their survival, although it had little effect on chemokine gene expression. In keeping with an anti-inflammatory role,

S100A8 increased IL-10 secretion into BALF from mice implanted with LLC at early and endpoints of survival, but IL-10 induction in airway epithelial cells was evident only at the endpoint. S100A8 also induced ICAM-1 expression in the alveolar epithelium in lungs from LLC-bearing mice at midpoint of survival. Induction of ICAM-1 [610] and

IL-10 [538, 539] may facilitate NK-T cell-mediated tumour lysis and influence tumour progression. Moreover, S100A8 suppressed nitrite levels in BALF and induced the activities of the antioxidants SOD, TXNR and PRDX in lungs from LLC-bearing mice at their midpoint of survival. Taken together, these data suggest that S100A8 may reduce oxidative stress in the lung microenvironment to facilitate immunoprotection, coupled with suppression of mediators that regulate pro-tumourigenic MDSC infiltration and function, and the concomitant induction of mediators that facilitate the function of protective T cell populations.

181

4.2 Experimental procedures 4.2.1 Effects of S100A8 on genes that influence tumour growth, hypoxia and angiogenesis, metastasis, redox and immune modulation

To determine early changes in the lung microenvironment that may contribute to protective effects mediated by S100A8 (Chapter 3), mice implanted with LLC or DPBS

(vehicle) (Section 2.2.6) were given intranasal S100A8 (10 µg; dose determined based on our previous study [224]) or HBSS (control), and then harvested soon after implantation

(3 days) and at midpoint of survival (10 days), as described in Section 2.3.1 (n = 4-6 mice/group). At the termination of each experiment, samples were collected, as illustrated in Figure 2.3.2. One hundred genes that influence tumour growth, hypoxia and angiogenesis, metastasis, redox and immune modulation were selected (listed in

Appendix II) and measured by RT-QPCR (Section 2.4). Gene expression normalised against housekeeping genes (β-actin, β2m and HPRT) was analysed using a web-based software package and Excel-based analysis tools, as described [224]. Fold changes with respect to controls were calculated for each gene, and fold changes of ≥ 2.5-fold were considered significant.

4.2.2 Validation of changes in gene expression at the protein levels

Protein expression of most genes that were markedly affected by S100A8 and/or LLC in mouse lungs were validated. Secreted proteins in BALF (IL-1β, IL-4, IL-6, IL-10, IL-12β,

IL-13 and IFN-γ) were measured by enzyme-linked immunosorbent assay (ELISA), according to the respective manufacturer’s instructions (Section 2.5.1). Western blotting was performed on lung homogenates (Section 2.5.2) using rabbit polyclonal primary antibodies, anti-arginase 1 (1:1000 v/v), anti-catalase (1:5000 v/v), anti-TXN (1:1000 v/v), anti-PRDX-SO3 (1:2000 v/v), anti-PRDX1 (1:800 v/v) (all from Abcam, Australia),

182

anti-HIF-1α (1:1000 v/v; Cell Signalling Technologies, Australia) and anti-GAPDH

(1:3000 v/v; Sigma, Australia), as described in Section 2.5.3. Protein bands normalised to β-actin (mouse monoclonal anti–β-actin; 1:25000 v/v; Sigma, Australia) were quantified by densitometry using ImageJ analysis software. TXN forms a complex with

TXNIP; the gel was run under non-reducing conditions to detect TXN-TXNIP complexes

(~62 kDa) in lung homogenates [898], and Western blotting performed with the anti-TXN

(1:1000 v/v) antibody.

Enzyme activities of SOD, catalase, TXNR, PRDX, GPX and arginase were measured by spectrophotometry, as described in Section 2.5.4. GAPDH activity in lung homogenates was measured as the disappearance of NADH at A340 nm, using spectrophotometry as described [899]. Nitrite levels in BALF were quantitated by the Griess assay (Section

2.5.5). Cell types that expressed catalase, TXN, PRDX, ICAM-1 and IL-10 were assessed by immunohistochemistry (Section 2.5.6), and sections examined and photographed using an Olympus DP73 microscope (Olympus Pty Ltd, Australia).

4.2.3 Data analysis

Statistical analysis was performed by GraphPad Prism (version 7). Changes between two groups (means ± SEM) were compared using unpaired t-tests, whereas changes resulting from different treatments were compared using ANOVA (1-way or 2-way as appropriate), followed by Bonferroni’s multiple comparison tests). P-values < 0.05 were considered statistically significant.

183

4.3 Results 4.3.1 Effects of S100A8 on immune surveillance in the lung microenvironment

4.3.1.1 S100A8 suppressed mediators that promote MDSC expansion, activation and recruitment

Of the 100 genes that influence growth, hypoxia and angiogenesis, metastasis, redox and immune modulation, we noted that key genes which promote MDSC expansion, activation and recruitment, and ICAM-1 and IL-10, were most affected by growing lung tumours, with or without S100A8 treatment (Tables 4.3.1.1.1, 4.3.1.1.2, 4.3.1.2.1 and

4.3.1.2.2). Colony-stimulating factors promote the differentiation of mature myeloid cells

(myelopoiesis) in bone marrow, and are key mediators of MDSC expansion in cancer

(reviewed in [519, 520]). S100A8 had little effect on mRNA expression of colony- stimulating factors (M-CSF, GM-CSF and G-CSF) in control mice at either time point

(Table 4.3.1.1.1). M-CSF mRNA expression was reduced some 3-fold in lungs 3 days after LLC implantation, whereas G-CSF mRNA expression was induced some 6-fold (P

< 0.05 compared to control) in mice implanted with LLC and treated with S100A8, although expression was not maintained after 10 days (Table 4.3.1.1.1). The data suggest that colony-stimulating factors were not likely contributors to MDSC expansion in LLC- bearing mice at the time points evaluated, and S100A8 unlikely to have reduced MDSC accumulation in lungs (Figure 3.3.4.2) by altering colony-stimulating factors.

184

Table 4.3.1.1.1: S100A8 suppressed mediators that promote MDSC expansion and activation Gene Function S100A8+DPBS HBSS+LLC S100A8+LLC affecting 3 days 10 days 3 days 10 days 3 days 10 days MDSC M-CSF E -1.7 ± 0.1 1.7 ± 0.3 -3.1 ± 0.1 1.1 ± 0.3 1.1 ± 0.1 -1.1 ± 0.2 GM-CSF E -1.9 ± 0.1 1.4 ± 0.3 -1.4 ± 0.1 -1.3 ± 0.2 -1.2 ± 0.1 -2.0 ± 0.1 G-CSF E -1.4 ± 0.3 1.6 ± 0.9 1.3 ± 0.5 -1.7 ± 0.4 6.0 ± 2.2 1.5 ± 0.7 (*) IFN-γ A 1.6 ± 0.5 3.6 ± 2.0 -2.8 ± 0.2 34.6 ± 19.7 -1.1 ± 0.3 7.0 ± 3.8 (*) IL-4 A -7.1 ± 0.1 3.3 ± 0.9 1.4 ± 0.6 136.8 ± 97.9 -1.5 ± 0.3 7.7 ± 2.3 (*) IL-13 A 1.1 ± 0.8 -6.5 ± 0.1 5.2 ± 4.1 -54.0 ± 0.0 4.0 ± 3.4 -21.5 ± 0.0 IL-1β E, A -2.1 ± 0.1 -2.2 ± 0.2 -3.6 ± 0.1 -1.7 ± 0.2 -1.7 ± 0.2 -3.9 ± 0.1 COX-2 E, A 1.5 ± 0.6 -1.7 ± 0.3 -1.8 ± 0.3 2.8 ± 1.2 5.1 ± 2.2 -1.4 ± 0.3 PTGS2 E, A -1.5 ± 0.2 -4.7 ± 0.1 1.1 ± 0.4 1.8 ± 0.4 1.8 ± 0.5 -1.3 ± 0.2 IL-6 E, A -1.4 ± 0.2 -4.3 ± 0.1 1.5 ± 0.3 -1.4 ± 0.2 1.8 ± 0.3 -2.5 ± 0.1 IDO E, A -1.9 ± 0.4 1.2 ± 0.4 -4.6 ± 0.2 6.2 ± 1.9 -1.4 ± 0.6 1.4 ± 0.4 (*) IL-18 E, A -17.4 ± 0.1 8.7 ± 5.1 -1.8 ± 0.3 35.5 ± 14.0 -1.3 ± 0.4 17.0 ± 8.7 SAA3 E, A -2.0 ± 0.2 2.2 ± 0.7 -2.0 ± 0.2 1.2 ± 0.3 -1.7 ± 0.2 1.4 ± 0.4 TGF-β1 E, A -1.9 ± 0.1 5.5 ± 1.5 1.0 ± 0.2 3.5 ± 1.0 1.9 ± 0.2 3.4 ± 1.0 (*) IL-17β E, A 1.2 ± 1.1 -21.9 ± 0.0 6.9 ± 5.7 8.1 ± 5.6 5.3 ± 4.9 8.4 ± 7.0 HIF-1α E, A 4.2 ± 1.0 -1.3 ± 0.5 -1.4 ± 0.3 12.8 ± 7.7 1.1 ± 0.4 2.3 ± 1.5 VEGFα E, A -2.1 ± 0.1 1.6 ± 0.4 -1.6 ± 0.1 5.4 ± 1.5 1.1 ± 0.2 1.3 ± 0.4 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given intranasal S100A8 3, 6 and 9 days post LLC and harvested 10 days later, to determine changes in genes that promote MDSC expansion (E) and activation (A) in lung lysates (refer to Section 1.2.1.4 for descriptions of their functions). Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5- fold; blue indicates downregulation ≥ 2.5-fold, n ≥ 4/group, *p < 0.05 compared to control.

185

In keeping with the suppression of cytokine gene expression by S100A8 in mice with acute lung injury [224], S100A8 markedly reduced the expression of cytokines that promote MDSC activation, with changes obvious in samples harvested on day 10. IL-4,

IL-13 and IFN-γ are key cytokines that promote MDSC activation [487]. In particular,

IFN-γ is essential for PMN-MDSC activation [544]. S100A8 inhalation produced a 7- fold suppression of IL-4 mRNA in lungs from control mice on day 3, although IFN-γ and

IL-13 mRNA expression was unchanged (Table 4.3.1.1.1). Lungs from mice implanted with LLC harvested on day 3 had somewhat reduced expression of IFN-γ mRNA, and increased expression of IL-13 mRNA, but no significant changes were found in samples from those treated with S100A8 (Table 4.3.1.1.1). S100A8 induced IFN-γ and IL-4 mRNA some 3-fold in lungs from control mice harvested on day 10 (Table 4.3.1.1.1), although protein levels in BALF were similar to controls (~30 pg/mL and 200 pg/mL respectively; Figures 4.3.1.1.1A-B). In LLC-bearing lungs harvested on day 10, IFN-γ and IL-4 mRNA expression was markedly increased, by ~35 and 140-fold respectively

(Table 4.3.1.1.1). Concomitantly, protein levels of IFN-γ increased to 121.5 ± 16.5 pg/mL

(P < 0.0001 compared to control) and IL-4 to 381.0 ± 66.6 pg/mL (not statistically significant) (Figures 4.3.1.1.1A-B). Administration of S100A8 to LLC-bearing mice suppressed IFN-γ and IL-4 mRNA expression to some 7-fold above baseline on day 10

(P < 0.05 compared to control). Protein concentrations were also significantly less, and similar to baseline levels (IFN-γ: 16.6 ± 1.0 pg/mL; P < 0.0001 compared to HBSS+LLC, and IL-4: 167.7 ± 27.7 pg/mL; P < 0.05 compared to HBSS+LLC; Figures 4.3.1.1.1A-B).

186

A) B)

C) D)

Figure 4.3.1.1.1: S100A8 suppressed cytokines that promote MDSC expansion and activation in LLC-bearing mice. Lungs from mice that received HBSS or S100A8 (10 µg) by inhalation 3, 6 and 9 days post LLC or DPBS injection were harvested after 10 days and BALF collected and lung lysates prepared. Concentrations of A) IFN-γ, B) IL-4, C) IL-13, D) IL-1β and E) IL-6 (all pg/mL) in BALF from vehicle control or LLC-bearing mice treated with HBSS or S100A8. Data are means ± SEM., n ≥ 3 group, *p < 0.05 and ****p < 0.0001 as indicated.

187

IL-13 mRNA expression was similar to baseline following S100A8 inhalation in lungs from control mice harvested on day 3 (Table 4.3.1.1.1). However, expression was elevated by some 4 or 5-fold in samples from both groups of LLC-bearing mice (Table

4.3.1.1.1). IL-13 mRNA expression was downregulated in lungs from mice harvested on day 10: there was a 6.5-fold decrease in samples from control mice treated with S100A8

(Table 4.3.1.1.1). LLC implantation caused a 54-fold decrease, and while S100A8 inhalation mitigated this decrease by some 2-fold, expression was 21.5-fold less than in samples from control lungs (Table 4.3.1.1.1). Differences in IL-13 protein levels were not, however, detected in BALF (~300-400 pg/mL in all groups) (Figure 4.3.1.1.1C), which may be attributed to the sensitivity of the assay or the time points of measurement.

Collectively, these results indicate that S100A8 may have reduced MDSC activation in

LLC-bearing lungs at midpoint of survival by suppressing IFN-γ and IL-4 production.

Most other mediators of MDSC expansion also promote their activation and/or recruitment, particularly cytokines. Cytokines that promote MDSC expansion and activation include IL-1β, IL-6, IL-17β, IL-18 and TGF-β1, acting alone or in combination with other factors (Section 1.2.1.4). There was little change in IL-1β mRNA expression at either time point, although it decreased ~4-fold in lung samples from mice implanted with LLC on day 3, and those treated with S100A8 on day 10 (Table 4.3.1.1.1). IL-1β levels in BALF from control mice treated with S100A8 were similar to baseline on day

10 (~40 pg/mL), whereas LLC implantation caused a significant increase to 173.2 ± 41.9 pg/mL (P < 0.05 compared to control). S100A8 administration to LLC-bearing mice suppressed these to almost baseline (65.1 ± 15.8 pg/mL, P = 0.054 compared to

HBSS+LLC; Figure 4.3.1.1.1D). IL-1β may act in conjunction with COX2 [529] or PGE2

[530, 531] to promote MDSC expansion. COX2 promotes the conversion of arachidonic 188

acid into a pro-inflammatory mediator, PGE2 [900]. COX2 is highly expressed in MDSC to mediate PGE2 secretion [900], thereby promoting expansion and function [528].

S100A8 increased COX2 mRNA expression some 5-fold in lung samples from mice implanted with LLC on day 3, whereas it suppressed the ~3-fold induction of COX2 by

LLC after 10 days (Table 4.3.1.1.1). S100A8 suppressed PTGS2, the enzyme that produces PGE2, ~5-fold, in samples harvested from control mice on day 3, but otherwise there was little change at either time point (Table 4.3.1.1.1). The data suggest that IL-1β acting in concert with COX2 may contribute to the increased MDSC expansion and activation in LLC-bearing mice. S100A8 may reduce their accumulation by suppressing both mediators, although additional experiments to assess possible synergistic effects are warranted.

Like IL-1β, IL-18 is a product of the inflammasome (a multi-protein complex that mediates pro-inflammatory responses), and their induction can be caused by endogenous mediators such as the acute-phase reactant, SAA [901]. IL-18 and SAA3 are reported to promote MDSC expansion and activation in tumour-bearing mice [569, 572]. In the samples harvested on day 3, S100A8 had caused a marked reduction of IL-18 mRNA expression (~17-fold) in control mice, which suggests that it can endogenously regulate this gene in lungs; expression in lungs from both groups of LLC-bearing mice was similar to control (Table 4.3.1.1.1). In the 10-day samples, IL-18 mRNA expression was upregulated in all treatment groups: S100A8 inhalation caused an 8-fold increase in the lungs of control mice, and LLC implantation a marked induction of some 35-fold.

However, S100A8 inhalation to LLC-bearing mice reduced the expression to 17-fold above control (Table 4.3.1.1.1). Although IL-18 protein levels were not determined, the reduction of MDSC numbers in lungs by S100A8 (Figure 3.3.4.2) may reflect this 189 suppression of IL-18 mRNA induction. We previously reported that S100A8 suppressed the 200-fold upregulation of SAA3 mRNA in acute lung injury to control level [224]. Here, however, there was little change in SAA3 mRNA expression at either time point (Table

4.3.1.1.1), suggesting that induction of IL-18 mRNA expression may be caused by other mediators.

There was little change in IL-6 mRNA expression across all groups, although the most notable occurred in samples harvested on day 10, in which S100A8 administration decreased it 4.3-fold in control mice, and 2.5-fold in LLC-bearing mice (Table 4.3.1.1.1).

Levels of IL-6 in BALF followed a similar trend to those of IL-1β. Levels in BALF samples harvested from control mice treated with S100A8 were close to baseline on day

10 (79.6 ± 10.1 compared to 66.8 ± 14.6 pg/mL), whereas LLC implantation increased

IL-6 concentrations to 132.6 ± 26.7 pg/mL, and S100A8 administration to LLC-bearing mice suppressed production to baseline (57.3 ± 13.4 pg/mL, P < 0.05 compared to

HBSS+LLC; Figure 4.3.1.1.1E). Consistent with a report that IL-6 and IDO (a tryptophan degrading enzyme; refer to Section 1.2.1.4) co-regulate MDSC function in lung cancer

[547], IDO mRNA expression followed a trend similar to that of IL-6. In samples from both groups of control mice at either time point, IDO mRNA expression was alike, whereas LLC implantation caused a 4.6-fold suppression, but a 6.2-fold induction (P <

0.05 compared to control) in lungs harvested on days 3 and 10, respectively (Table

4.3.1.1.1). In contrast, IDO mRNA expression in lungs from mice implanted with LLC and treated with S100A8 was similar to baseline at either time point, although protein/activity levels were not determined (Table 4.3.1.1.1). These data suggest that IL-

6 and IDO may co-regulate MDSC expansion and activation in LLC-bearing mice at their

190

midpoint of survival, and that suppression by S100A8 may have reduced MDSC accumulation in lungs.

S100A8 administration to control mice did not alter IL-17β mRNA expression in lungs from mice harvested on day 3, but markedly suppressed its expression some 21-fold after

10 days (Table 4.3.1.1.1). LLC implantation increased IL-17β mRNA expression ~5-7- fold on day 3, and ~8-fold on day 10, although S100A8 had no apparent effect (Table

4.3.1.1.1). TGF-β1 mRNA expression was similar in samples from all groups harvested on day 3 (Table 4.3.1.1.1). Although S100A8 increased TGF-β1 mRNA 5.5-fold in lungs from control mice harvested on day 10 (P < 0.05 compared to control), expression in both groups of LLC-bearing mice was similar (~3.5-fold above baseline; Table 4.3.1.1.1).

These results indicate that although S100A8 may directly influence IL-17β and TGF-β1 mRNA expression in healthy lungs, it is unlikely that it contributes to their regulation in

LLC-bearing mice.

The hypoxia and pro-angiogeneic factors, HIF-1α and VEGFα (Section 1.2.1.2), also promote MDSC expansion and activation [431, 522, 535] (Section 1.2.1.4). HIF-1α and

VEGFα mRNA expression was similar to controls in lung samples harvested on day 3, except S100A8 directly induced HIF-1α mRNA 4.2-fold (Table 4.3.1.1.1). However,

Western blotting of lung lysates failed to detect HIF-1α protein in any groups (not shown).

Although S100A8 did not alter mRNA expression of HIF-1α and VEGFα in lungs from control mice harvested on day 10, these genes were upregulated 12.8 ± 7.7 and 5.4 ± 1.5- fold respectively, in LLC-bearing samples (Table 4.3.1.1.1). In contrast, these genes were not increased following S100A8 inhalation by LLC-bearing mice (Table 4.3.1.1.1).

191

However, HIF-1α protein was not detected in samples from both groups of control mice on day 10, although very weak expression was detected in lungs from both groups of

LLC-bearing mice without obvious difference (Figure 4.3.1.1.2). Gene expression of other mediators of MDSC expansion and activation was similar to control in all samples harvested at both time points (Appendix V).

Figure 4.3.1.1.2: S100A8 had little effect on HIF-1α protein expression. Lungs from mice that received HBSS or S100A8 (10 µg) by inhalation 3, 6 and 9 days post LLC or DPBS injection were harvested after 10 days and lung lysates prepared for Western blotting. The Western blot was cropped to indicate only the representative HIF-1α (~120 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to HIF-1α, relative to β-actin, in lung lysates (n ≥ 4/group). No statistically significant changes were detected.

192

S100A8 inhalation suppresses induction of several chemokines that influence leukocyte migration in lungs from mice treated with LPS [224]. Unexpectedly, S100A8 and/or the presence of growing LLC tumours had little effect on chemokines or cytokines that were selected to reflect MDSC recruitment to tumours in samples harvested at either time point

(Table 4.3.1.1.2 and Appendix V). Expression of CCL2, CXCL1 or CXCL5 mRNA was similar at both time points, and slightly less than control values, although there was a ~7- fold reduction in CXCL1 mRNA expression in lungs from LLC-bearing mice harvested on day 3 (Table 4.3.1.1.2). In all samples harvested on day 3, mRNA expression of

CXCL12 and its receptor, CXCR4, was similar (Table 4.3.1.1.2). In lungs harvested on day 10, S100A8 inhalation caused a 2.7 ± 1.1-fold increase in CXCL12 mRNA expression in lungs from control mice, and expression was 3.7 ± 1.5-fold higher in LLC-bearing mice whereas, in mice treated with S100A8, expression was similar to baseline. CXCR4 mRNA was directly reduced to baseline by S100A8 in control samples harvested on day 10, but expression was similar to control in other groups (Table 4.3.1.1.2).

Table 4.3.1.1.2: S100A8 suppressed mediators that promote MDSC recruitment Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days CCL2 -1.2 ± 0.1 -3.9 ± 0.1 1.3 ± 0.3 -4.5 ± 0.1 -1.2 ± 0.2 -2.9 ± 0.1 CXCL1 -1.6 ± 0.2 -1.8 ± 0.1 -6.7 ± 0.1 -2.4 ± 0.1 2.2 ± 0.7 -3.9 ± 0.0 CXCL5 -3.0 ± 0.1 (*) -2.2 ± 0.2 -1.6 ± 0.1 -4.1 ± 0.1 -2.3 ± 0.1 -3.5 ± 0.1 CXCL12 -2.2 ± 0.1 2.7 ± 1.1 -1.4 ± 0.2 3.7 ± 1.5 1.6 ± 0.4 1.7 ± 0.7 CXCR4 -2.4 ± 0.1 -2.8 ± 0.0 1.1 ± 0.2 -2.2 ± 0.1 1.5 ± 0.3 -1.9 ± 0.1 IL-12β 1.6 ± 0.6 -8.4 ± 0.1 1.7 ± 0.7 7.9 ± 4.4 3.1 ± 1.1 -12.0 ± 0.1 RAGE -1.1 ± 0.1 1.4 ± 0.4 -1.7 ± 0.2 -1.2 ± 0.3 1.8 ± 0.3 -1.2 ± 0.2 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given intranasal S100A8 3, 6 and 9 days post LLC and harvested 10 days later, to determine changes in genes that promote MDSC recruitment in lung lysates (refer to Section 1.2 for descriptions of their functions). Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold, n ≥ 4/group, *p < 0.05 compared to control.

193

IL-12β (IL-12 p40 homodimer) is a cytokine that potently antagonises IL-12-mediated

IFN-γ production and NK cell activation [902], and promotes MDSC recruitment to orthopaedic bacterial lesions in mice [561]. We reported that S100A8 suppresses the some 2-fold upregulation of IL-12β mRNA by LPS in lungs [224]. However, there was a

3.1 ± 1.1-fold increase in IL-12β mRNA in lungs from LLC-bearing mice treated with

S100A8 and harvested on day 3, but expression in other groups was similar (Table

4.3.1.1.2). In contrast, in samples harvested on day 10, S100A8 suppressed IL-12β mRNA expression 8.4 ± 0.1-fold when given to control mice (Table 4.3.1.1.2). LLC implantation increased IL-12β mRNA expression 7.9 ± 4.4-fold on day 10, and S100A8 suppressed it

12.0 ± 0.1-fold below control (Table 4.3.1.1.2). IL-12β levels in BALF from LLC-bearing mice were similar to control (56.3 ± 5.1 pg/mL), but IL-12β in BALF was significantly reduced to 30.9 ± 4.2 pg/mL in lungs from control mice that were given S100A8 (P <

0.05 compared to control), and similar decreases were found in samples from LLC- bearing mice treated with S100A8 (31.1 ± 6.0 pg/mL; P < 0.05 compared to HBSS+LLC)

(Figure 4.3.1.1.3). The data suggest that S100A8 may prevent IL-12 binding to receptor to reduce MDSC recruitment to growing lung tumours at midpoint of survival, although additional experiments to measure IL-12 protein and binding to receptor in lungs are warranted. Figure 4.3.1.1.3: S100A8 suppressed IL-12β to sub-control levels. Lungs from mice that received HBSS or S100A8 (10 µg) by inhalation 3, 6 and 9 days post-LLC or DPBS injection were harvested after 10 days and BALF collected. Concentrations of IL-12β (pg/mL) in BALF from vehicle control or tumour-bearing mice treated with HBSS or S100A8 are means ± SEM., n ≥ 3 group, *P < 0.05 as indicated.

194

S100A8 is reported to induce RAGE in human bronchial epithelial cells and lung carcinoma cells to produce mucin protein [903], and RAGE expressed on MDSC is reported to bind S100A8/A9 to promote MDSC recruitment to tumours and lymphoid- associated organs in cancer [487, 564]. However, we found no RAGE mRNA induction in lungs from mice treated with S100A8, and no effect of LLC implantation on its expression (Table 4.3.1.1.2), suggesting little or no effect at the time points evaluated.

MDSC activate NF-ҡB and STAT3 to transduce immunosuppressive signals [904], and we reported that S100A8 suppressed the induction of NF-ҡB and STAT3 mRNA expression by LPS to control levels in acute lung injury [224]. However, expression of both genes was similar to controls in samples harvested at both time points (Appendix V).

Together, these results suggest that S100A8 likely impaired MDSC function by suppressing mediators that promote expansion, activation and recruitment rather than those that influence activation of downstream signalling pathways.

195

4.3.1.2 S100A8 altered genes and/or proteins that modulate immune surveillance

IL-10 is an anti-inflammatory cytokine that is induced in murine lung epithelial cells 12 hours post S100A8 inhalation [224]. IL-10 also enhances NK cell proliferation and activity [538, 539], as well as CD8 T cell expansion and cytotoxicity [537]. Here, we found no increased IL-10 mRNA 3 days post S100A8 inhalation by control mice nor in lungs implanted with LLC, but IL-10 mRNA increased 5.7-fold in lungs implanted with

LLC and treated with S100A8 (Table 4.3.1.2.1). Immunohistochemical examination of lung sections indicated only weak IL-10 reactivity in airway epithelial cells in all groups on day 3, and S100A8 made no obvious difference (Figures 4.3.1.2.1A-D). However, in line with changes in mRNA, IL-10 levels in BALF from LLC-bearing mice treated with

S100A8 were some 6-fold higher than those from control mice (109.1 ± 23.6 pg/mL, P <

0.01 compared to control and other groups; Figure 4.3.1.2.1E), suggesting that S100A8 may reduce inflammation and influence NK-T cell function soon after LLC implantation.

Table 4.3.1.2.1: S100A8 and/or LLC markedly induced IL-10 mRNA expression at midpoint of survival Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days IL-10 -1.1 ± 0.3 107.6 ± 57.2 1.0 ± 0.6 148.7 ± 70.8 5.7 ± 2.5 84.6 ± 40.3 (****) (*) Lung lysates from mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given intranasal S100A8 3, 6 and 9 days post LLC and harvested 10 days later. Fold changes of IL-10 mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold, n ≥ 4/group, *p < 0.05 and ****p < 0.0001 compared to control.

196

A) B)

C) D)

Figure 4.3.1.2.1: S100A8 increased IL-10 secretion from lungs of mice with early tumours. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested on day 3. Anti-IL-10 immunoreactivity in airway epithelial cells (indicated by arrows and red staining) in A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC- treated groups are representative of at least 4 mice/group; scale bar = 10 µm at 10X. E) Concentrations of IL-10 (pg/mL) in BALF are means ± SEM, n ≥ 4 group, ***P < 0.001 compared to control (HBSS+DPBS), ++p < 0.01 compared to S100A8+DPBS and ##p < 0.01 compared to HBSS+LLC. 197

IL-10 mRNA expression on day 10 was strongly induced by S100A8 in lungs that received S100A8 (107.6 ± 57.2-fold), although LLC implantation also increased it 148.7

± 70.8-fold (P < 0.0001 compared to control; Table 4.3.1.2.1). S100A8 inhalation by

LLC-bearing mice reduced IL-10 mRNA expression in lungs some 2-fold, although expression was still 84.6 ± 40.3-fold higher than control (P < 0.05; Table 4.3.1.2.1).

However, immunohistochemistry revealed IL-10 immunoreactivity only in LLC-bearing mice at this time, but failed to reveal increased IL-10 expression in airway epithelial cells by S100A8 in lungs from control or LLC-bearing mice (Figures 4.3.1.2.2A-D). Notably, there was no obvious reactivity within tumours and other cells (Figures 4.3.1.2.2A-D).

IL-10 levels were at ~160 pg/mL in BALF from control mice and ~220 pg/mL in BALF from LLC-bearing mice, regardless of S100A8 treatment, and differences were not statistically significant (Figure 4.3.1.2.2E). S100A8 had no obvious effects on IL-10 protein on day 10, despite markedly upregulated mRNA expression, suggesting that protein upregulation occurred at a later time point.

198

A) B)

C) D)

Figure 4.3.1.2.2: S100A8 did not alter IL-10 expression in lungs at midpoint of survival. Mice received S100A8 (10 µg) or HBSS by inhalation 3, 6 and 9 days post DPBS (vehicle) or LLC injection were harvested on day 10. Anti-IL-10 immunoreactivity in airway epithelial cells (indicated by arrows and red staining) from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC-treated groups are representative of at least 4 mice/group; scale bar = 10 µm at 10X. Tumours showed no obvious immunoreactivity (demarked by dotted lines in inset). E) Concentrations of IL-10 (pg/mL) in BALF are means ± SEM, n ≥ 3 group; no statistically significant changes were detected. 199

We chose to measure IL-10 protein in lungs and BALF from LLC-bearing mice treated with HBSS (control) or S100A8 on days 3, 6 and 9 (Group 1), or S100A8 every third day

(continuous treatment; Group 2), and harvested at endpoint of survival, because IL-10 expression may influence the survival of patients with lung cancer [905, 906]. There was weak IL-10 immunoreactivity in airway epithelial cells and tumours of LLC-bearing mice treated with HBSS (Figure 4.3.1.2.3A). Notably, S100A8 induced IL-10 protein expression in airway epithelial cells and tumours of LLC-bearing mice receiving three

S100A8 treatments (Group 1; Figure 4.3.1.2.3B). However, those receiving S100A8 every third day (Group 2) had apparently less IL-10 protein expression in their airway epithelial cells and tumours, and were similar to control (Figure 4.3.1.2.3C), suggesting that S100A8 promoted IL-10 secretion. Consistent with our hypothesis, IL-10 levels in

BALF from Group 1 mice were 2 times higher than of control (HBSS+LLC) (65.0 ± 7.0 pg/mL, P = 0.2 compared to control), and those of Group 2 mice were 4 times higher

(128.0 ± 10.8 pg/mL, P < 0.01 compared to Group 1 or control; Figure 4.3.1.2.4). Mice from Group 1 and Group 2 survived for longer than control (Figure 3.3.2.3.1), which suggests that IL-10 induction by S100A8 in LLC-bearing mice was likely protective, may reduce inflammation, and influence NK-T cell function.

200

A)(i) (ii)

B)(i) (ii)

C)(i) (ii)

Figure 4.3.1.2.3: S100A8 induced IL-10 in lungs from LLC-bearing mice at endpoint of survival. LLC-bearing mice treated with A) HBSS (control), B) 3 S100A8 treatments (Group 1), or C) S100A8 treatment every third day (Group 2) were harvested when moribund (19-28 days) (see legend, Figure 2.3.1.2A). Anti-IL-10 immunoreactivity in (i) airway epithelial cells (indicated by arrows and red staining) and (ii) tumours (demarked by dotted lines) are representative of at least 3 mice/group; scale bar = 10 µm at 10X; dotted lines demark tumours. Goat IgG was unreactive (inset in B)(i)).

201

Figure 4.3.1.2.4: S100A8 increased IL-10 secretion at endpoint of survival. LLC-bearing mice treated with HBSS (control), 3 S100A8 treatments (Group 1), or S100A8 treatment every third day (Group 2) were harvested when moribund (19-28 days) (see legend, Figure 2.3.1.2A). Concentrations of IL-10 (pg/mL) in BALF are means ± SEM., n ≥ 3 group, ***P < 0.001 compared to HBSS+LLC (Control) and ++p < 0.01 compared to Group 1.

202

ICAM-1 is a transmembrane leukocyte adhesion molecule commonly expressed in lung epithelial cells [907]. ICAM-1 mRNA expression is induced by IFN-γ in human tracheal epithelial cells [908]. We reported that S100A8 suppresses ICAM-1 mRNA induction by

LPS to control, which may contribute to the suppression of neutrophil influx into lungs

[224], given that ICAM-1 adheres neutrophils to alveolar epithelial cells in acute lung injury in rats [909]. ICAM-1 is expressed in alveolar epithelial cells in lung cancer [910] and is reported to enhance lysis of lung tumour cells by lymphokine-activated killer cells

(including NK and NK-T cells) in a co-culture model with both cell types [610]. ICAM-

1 expression in lungs was assessed in all groups of mice to determine if S100A8 altered its expression on days 3 and 10 (early and midpoints of survival respectively). S100A8 inhalation by control mice had little effect on ICAM-1 mRNA expression in lungs harvested on day 3, whereas expression in lungs with LLC was some 4-fold less than control samples (P < 0.05) (Table 4.3.1.2.2). By contrast, expression in samples from

LLC-bearing mice treated with S100A8 was elevated some 7-fold (Table 4.3.1.2.2).

There was, however, only weak ICAM-1 immunoreactivity in the alveolar epithelium of samples from all groups harvested on day 3, with no observable difference between groups (Figure 4.3.1.2.5).

Table 4.3.1.2.2: S100A8 and/or LLC markedly induced ICAM-1 mRNA expression at midpoint of survival Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days ICAM- 1.0 ± 0.5 (5.4 ± 4.8) x 103 -4.4 ± 0.1 (8.4 ± 7.5) x 103 7.3 ± 3.6 (4.1 ± 3.6) x 103 1 (**) (*) (***) Lung lysates from mice treated with HBSS or S100A8 (10 µg) were harvested 3 days or 10 days later. Fold changes of ICAM-1 mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold, n ≥ 4/group, *p < 0.05, **p < 0.01 and ***p < 0.001 compared to control.

203

A) B)

C) D)

Figure 4.3.1.2.5: Early ICAM-1 expression in lungs. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection and lungs and harvested on day 3. Anti-ICAM-1 immunoreactivity in alveolar epithelial cells of lungs from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC-treated groups are representative of at least 5 mice/group; scale bar = 2.5 µm at 80X.

204

By contrast, all treatments profoundly increased ICAM-1 mRNA expression over one thousand-fold in lungs from mice harvested on day 10: S100A8 inhalation by control mice induced ICAM-1 mRNA 5400 ± 4800-fold (P < 0.01 compared to control) and expression was even greater in lungs from LLC-bearing mice (8400 ± 7500-fold), whereas S100A8 administration to LLC-bearing mice reduced expression to 4100 ±

3600-fold above control (P < 0.001 compared to control; Table 4.3.1.2.2). However, increased ICAM-1 protein expression in the alveolar epithelium was apparent only in

LLC-bearing mice treated with S100A8, compared to the weak immunoreactivity found in other groups (Figure 4.3.1.2.6). Notably, there was no obvious ICAM-1 immunoreactivity within tumours and other cells in lungs. ICAM-1 induction by S100A8 in alveolar epithelial cells was not coupled with an increase in neutrophil influx on day

10 (Table 3.3.4.1.1), suggesting that this promoted adhesion of other leukocyte types.

Collectively, the data here and in Table 3.3.4.3 suggest that S100A8 may enhance NK-T cell adhesion to alveolar epithelial cells, although further investigation is warranted.

205

A) B)

C) D)

Figure 4.3.1.2.6: S100A8 induced ICAM-1 in lungs from LLC-bearing mice at midpoint of survival. Mice received S100A8 (10 µg) or HBSS by inhalation 3, 6 and 9 days post DPBS (vehicle) or LLC injection and lungs harvested on day 10. Anti-ICAM-1 immunoreactivity in alveolar epithelial cells of lungs from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC-treated groups are representative of at least 5 mice/group; scale bar = 2.5 µm at 80X. E) Rat IgG control was unreactive.

206

S100A8 also altered genes that promote T cell expansion and function in control mice or mice implanted with LLC at both time points, although its effects were less marked than those of ICAM-1 or IL-10 gene. IL-2 is the cytokine primarily involved in T cell expansion, and it also enhances NK cell activity [911]. Consistent with the slightly lower total T cell numbers detected in lungs (Table 3.3.4.3), S100A8 administration to control mice decreased IL-2 mRNA expression ~4-fold in lungs harvested on day 3, but was close to baseline on day 10 (Table 4.3.1.2.3). On the other hand, IL-2 mRNA expression in lungs from LLC-bearing mice was similar to control on day 3, but showed a 2-fold increase on day 10 (Table 4.3.1.2.3). This somewhat elevated IL-2 mRNA expression may contribute to the slight increase in total T cell numbers seen in lungs from these mice

(Table 3.3.4.3). S100A8 treatment increased IL-2 mRNA expression 2-fold above baseline in LLC-bearing mice harvested on day 3, and 3.6-fold above baseline on day 10

(P = 0.05 compared to control; Table 4.3.1.2.3). Although IL-2 protein levels were not determined, the 3-fold increase in total T cells in lungs may reflect this increase in IL-2 mRNA induction. IFN-α4 [912] and IRF-4 [913] are mediators that promote CD8 expansion and activity. Consistent with the relatively minor changes detected in CD8 T cell numbers in lungs across all treatment groups (Table 3.3.4.3), there was little change in IFN-α4 and IRF-4 mRNA expression at either time point (Table 4.3.1.2.3). The some

8-fold suppression of IFN-α4 mRNA expression detected in lungs from LLC-bearing mice treated with S100A8 harvested on day 3 (Table 4.3.1.2.3) may have contributed to the somewhat lower CD8 T cell numbers in lung samples harvested on day 10 (Table

3.3.4.3).

207

Table 4.3.1.2.3: Effects of S100A8 and/or LLC on genes that influence immune surveillance Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days IL-2 -3.8 ± 0.1 -1.1 ± 0.3 1.3 ± 0.6 2.0 ± 0.6 2.0 ± 0.5 3.6 ± 1.0 IFN-α4 -8.4 ± 0.0 1.9 ± 0.1 -1.4 ± 0.3 1.2 ± 0.0 1.3 ± 0.4 3.6 ± 0.1 IRF-4 1.4 ± 0.5 1.1 ± 0.1 1.1 ± 0.4 -2.7 ± 0.0 1.8 ± 0.7 -2.2 ± 0.1 Lung lysates from vehicle control (DPBS) or LLC-bearing mice treated with HBSS or S100A8 (10 µg) were harvested 3 or 10 days later. Fold changes of genes the influence immune surveillance compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold, n ≥ 4/group. No statistically significant changes were detected.

208

4.3.2 S100A8 suppressed nitrite production but had little effect on arginase expression or activity

NADPH oxidase (NOX) is an important source of ROS [885]; MDSC induce NOX to produce ROS [914]. MDSC express inducible nitric oxide synthase (iNOS) [431] which is an important source of NO [109]. NO is derived from arginine [109], making its production dependent on L-arginine availability. Arginase metabolises L-arginine to produce urea and ornithine, and so its activity may impact upon NO production [915].

Although MDSC express arginase that can deplete L-arginine that is required for T cell proliferation [431], MDSC concomitantly express the cationic transporter 2 (CAT2) that enables L-arginine transport into cells to sustain NO production, and thus, their immunosuppressive activities on T cell function [591]. To determine if S100A8 altered genes and/or proteins that influence ROS, NO and arginase transport in lungs, expression in all groups was measured on days 3 and 10 (early and midpoints of survival respectively).

At both time points, NOX2 mRNA expression was similar in all groups (Table 4.3.2).

Expression of iNOS mRNA in lungs from control mice treated with S100A8, or from

LLC-bearing mice, was similar to control when harvested on day 3, whereas S100A8 administration to LLC-bearing mice increased it 3.5-fold (Table 4.3.2). Nitrite levels in

BALF were, however, similar (~2-3 µM) in all groups, and changes not statistically significant (Figure 4.3.2.1A). In lungs harvested on day 10, iNOS mRNA expression was similar in all groups (Table 4.3.2). However, in BALF from LLC-bearing mice, nitrite levels were higher than those from control mice (from 1.2 ± 0.1 to 2.1 ± 0.4 µM, P = 0.06), whereas following S100A8 administration to LLC-bearing mice, nitrite levels in BALF

209 were significantly less than those in LLC-bearing mice, and close to baseline concentrations (0.9 ± 0.1 µM, P < 0.01; Figure 4.3.2.1B).

A) B)

Figure 4.3.2.1: Effects of S100A8 and/or LLC on nitrite production. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later (early tumours), B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10 (midpoint tumours). Nitrite levels in BALF (µM) are means ± SEM, n ≥ 4/group, **p < 0.01 as indicated.

S100A8 markedly upregulated arginase 1 (Arg1) mRNA expression in lungs from control mice at both time points (11.7-fold on day 3; 34.6-fold on day 10; Table 4.3.2) although protein was similar to control (Figure 4.3.2.2). Arg1 mRNA expression was also upregulated in lungs from LLC-bearing mice on day 10 (34.4-fold), but not on day 3

(Table 4.3.2). Arginase 1 protein expression in lungs from LLC-bearing mice was somewhat lower than control at both time points, although changes were not statistically significant (Figure 4.3.2.2). S100A8-treated LLC-bearing mice had elevated Arg1 mRNA expression at both time points (32.6-fold on day 3; 26.0-fold on day 10, P < 0.05 compared to control; Table 4.3.2). The level of arginase 1 protein in lungs from these mice was similar to control on day 3, and while it was somewhat lower than control on day 10 and similar to LLC-bearing mice, changes were not statistically significant (Figure 210

4.3.2.2B). In contrast to the Arg1 gene, Arg2 mRNA was expressed at a similar level in all groups, at both time points (Table 4.3.2).

A) B)

Figure 4.3.2.2: Effects of S100A8 and/or LLC on arginase protein. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in arginase 1 protein in lung lysates by Western blotting. The Western blot was cropped to indicate only the representative arginase 1 (~35/38 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to arginase 1, relative to β-actin (n ≥ 4/group). No statistically significant changes were detected.

211

Arginase activity in lungs harvested on day 3 followed a similar trend to that of Arg1 mRNA expression, although differences were not significant. While similar to baseline in lungs from control mice treated with S100A8 (~2000 nmol urea/mg of protein), activity was seen to be some 2-fold less in lungs from LLC-bearing mice (~900 nmol urea/mg of protein), whereas in lungs from LLC-bearing mice treated with S100A8, it was similar to baseline (Figure 4.3.2.3A). Arginase activity in lungs harvested on day 10 was markedly lower than that seen on day 3 (~10-50 % of day 3). In lungs from control mice treated with S100A8, arginase activity was similar to control (~250 nmol urea/mg of protein), whereas it was somewhat higher in lungs from LLC-bearing mice (~460 nmol urea/mg of protein) and in those from mice treated with S100A8 (~400 nmol urea/mg of protein), although not significantly (Figure 4.3.2.3B).

A) B)

Figure 4.3.2.3: Effects of S100A8 and/or LLC on arginase activity. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes arginase activities in lung lysates. Arginase activities (urea (nmol)/hour/mg protein) are means ± SEM, n ≥ 4/group. No statistically significant changes were detected.

212

There was marked induction of the arginine transporter gene, CAT2, in lungs from treatment groups harvested on day 3, suggesting increased L-arginine transport. S100A8 administration induced CAT2 mRNA expression 18.9-fold in lungs from control mice, and LLC implantation caused a 30.7-fold induction (P < 0.05 compared to control; Table

4.3.2). Remarkably, in lungs from LLC-bearing mice treated with S100A8, increase in

CAT2 mRNA expression was some 140-fold (P < 0.05 compared to control; Table 4.3.2).

By contrast, S100A8 had no obvious effects on CAT2 mRNA expression in lungs from control mice harvested on day 10, whereas that of LLC-bearing mice was one third of the expression observed on day 3 (10.6-fold above baseline), and S100A8 treatment reduced it to baseline (Table 4.3.2). Changes in CAT2 mRNA expression at this time followed a similar trend to those of MDSC numbers in lungs (Figure 3.3.4.2), suggesting that the elevated CAT2 mRNA expression in lungs from LLC-bearing mice reflected increased L- arginine transport into MDSC, which may have increased NO production in lungs. The high induction of Arg1 and/or CAT2 mRNA expression by S100A8 in lungs from control mice or mice implanted with LLC at both time points suggests that S100A8 may be an endogenous regulator of L-arginine availability.

213

Table 4.3.2: Effects of S100A8 and/or LLC on genes that influence L-arginine availability Gene Function in cancer S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days NOX2 ROS production [885]; MDSC produce ROS by 2.1 ± 0.4 1.1 ± 0.1 -1.1 ± 0.3 1.8 ± 0.4 1.3 ± 0.2 -1.2 ± 0.2 NOX2 induction [914] iNOS Produces NO from arginine [109]; MDSC 1.8 ± 0.7 1.1 ± 0.4 1.8 ± 0.7 -1.9 ± 0.2 3.5 ± 1.7 -1.7 ± 0.2 produce NO by iNOS upregulation [431] Arg1 Produces urea and ornithine from arginine [915]; 11.7 ± 7.1 34.6 ± 27.9 -1.1 ± 0.7 34.4 ± 27.7 32.6 ± 18.4 (*) 26.0 ± 20.7 MDSC upregulate arginase activity to deplete Arg2 1.7 ± 0.3 -1.0 ± 0.2 -1.2 ± 0.2 1.2 ± 0.4 2.1 ± 0.6 1.3 ± 0.3 arginine required for T cell proliferation [431] CAT2 Arginine transporter that regulates lung 18.9 ± 14.4 -1.1 ± 0.4 30.7 ± 19.0 (*) 10.6 ± 7.3 (1.4 ± 0.7) x 102 (*) 1.9 ± 0.9 inflammation [916-918] and promotes MDSC suppressive activities in cancer [591] Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given intranasal S100A8 3, 6 and 9 days post LLC and harvested 10 days later, to determine changes in genes that influence ROS, NO and arginine levels in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold; n ≥ 4/group, *p < 0.05 compared to control.

214

4.3.3 S100A8 induced GAPDH mRNA expression but did not alter its activity

GAPDH is a glycolytic enzyme that converts glyceraldehyde-3-phosphate into 1,3- diphosphoglycerate. GAPDH is upregulated in lung cancer tissues and BALF [919-921], and promotes chemoresistance in lung tumour cells [922]. On the other hand, GAPDH inhibits ROS production [923], and attenuates acute lung injury by suppressing pro- inflammatory mediators and neutrophil recruitment [924], like S100A8. Oxidative stress facilitates GAPDH S-nitrosylation and promotes apoptosis by inducing cell death pathways [115, 116]. The S100A8/A9 complex is reported to regulate GAPDH S- nitrosylation in human PBMC [114], suggesting that S100A8 may alter GAPDH expression and/or activity. S100A8 administration markedly upregulated GAPDH mRNA expression some 700-fold in lungs from control mice harvested on day 3; following LLC implantation, a similar increase was seen, and S100A8 treatment increased expression to

~2 x 104-fold (P < 0.01 compared to control) (Table 4.3.3).

Table 4.3.3: GAPDH mRNA was markedly upregulated in all treatment groups on day 3 S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days (7.7 ± 6.5) x 102 2.4 ± 0.4 (7.3 ± 3.5) x 102 1.2 ± 0.3 (2.1 ± 0.8) x 104 1.4 ± 0.2 (**) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or given intranasal S100A8 3, 6 and 9 days post LLC and harvested 10 days later, to determine changes in GAPDH mRNA expression in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold, n ≥ 4/group, **p < 0.01 compared with control.

215

GAPDH protein expression did not, however, reflect the increases in mRNA expression, and on day 3 was similar in all groups (Figure 4.3.3.1A). The increased GAPDH mRNA expression in all groups declined to baseline on day 10 (Table 4.3.3), and protein expression was similar in all groups (Figure 4.3.3.1B).

A) B)

Figure 4.3.3.1: GAPDH protein was similar in all treatment groups. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested on day 3, B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in GAPDH protein in lung lysates. The Western blot was cropped to indicate only the representative GAPDH (~37 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to GAPDH, relative to β- actin, in lung lysates (n ≥ 4/group). No statistically significant changes were detected.

216

The GAPDH activity in lungs harvested on day 3 was measured to determine whether the marked mRNA induction observed across all treatment groups was reflected in glycolytic activity. However, activity was similar in all samples (Figure 4.3.3.2), and because

GAPDH can lose its glycolytic activity after undergoing post-translational modifications

[925], the data suggest that GAPDH may be post-translationally modified by S100A8 and/or LLC.

Figure 4.3.3.2: GAPDH activities were similar in all treatment groups. GAPDH activities in lung lysates harvested from vehicle control (DPBS) or LLC-bearing mice co-treated with HBSS or S100A8 (10 µg) on day 3 were measured to determine if the profound mRNA upregulation was reflected in the activities. GAPDH activities (∆A/min/mg protein) are means ± SEM (n = 5/group). No statistically significant changes were detected.

217

4.3.4 S100A8 selectively induced antioxidant activity

S100A8 modulates some aspects of immune defence by scavenging oxidants [13, 224,

352]. We next determined whether S100A8 could alter the redox environment by modulating expression of some key antioxidants, including superoxide dismutase (SOD), catalase, thioredoxin (TXN), peroxiredoxin (PRDX), glutathione peroxidase (GPX), glutathione S-transferase mu (GSTM), metallothioneins (Mt) and heme oxygenase-1

(HO-1) (Section 1.2.1.3). Expression of these antioxidants, and the activities of a selected few were measured in lung samples harvested from mice at their early and midpoints of survival (i.e. 3 and 10 days respectively).

4.3.4.1 S100A8 induced SOD activity in LLC-bearing mice but had little effect on catalase expression or activity

Although SOD scavenges superoxide anions, it converts them into H2O2 and oxygen, which can promote cancer cell migration, invasion and metastasis [442-444]. Catalase can conjugate to SOD to scavenge excessive H2O2 production [926], and catalase is reported to suppress tumour development [445, 446]. Administration of S100A8 suppressed SOD1 mRNA expression ~4-fold in lungs from control mice harvested on day

3 (P < 0.05 compared to control), whereas LLC implantation increased mRNA expression

~7-fold, and S100A8 administration to LLC-bearing mice markedly increased SOD1 mRNA expression in the lungs some 200-fold (Table 4.3.4). However, SOD activity was found to be similar in samples from all groups on day 3 (~7 ∆A/min/mg protein), and differences were not statistically significant (Figure 4.3.4.1.1A), suggesting that activity may be upregulated in LLC-bearing mice at later time points. SOD1 mRNA expression was profoundly upregulated in lungs from all treatment groups harvested on day 10:

S100A8 induced SOD1 mRNA expression that was some 300-fold higher than in lungs

218

from control mice (Table 4.3.4), but SOD activity was similar to control levels (~10

∆A/min/mg protein; Figure 4.3.4.1.1B). Although SOD1 mRNA expression in lungs from

LLC-bearing mice was 6.5 x 104-fold above baseline on day 10 (Table 4.3.4), SOD activity was approximately half the level found in control (4.9 ± 0.9 ∆A/min/mg protein, p < 0.05; Figure 4.3.4.1.1B). The inconsistency between mRNA expression and activity may indicate post-transcriptional degradation. Importantly, S100A8 administration to

LLC-bearing mice increased expression of SOD1 mRNA 5.8 x 105-fold (Table 4.3.4), and SOD activity was similar to baseline levels (10.3 ± 1.1 ∆A/min/mg protein, p < 0.05 compared to HBSS+LLC; Figure 4.3.4.1.1B), indicating that S100A8 restored baseline activity in LLC-bearing mice. Results suggest that S100A8 may have compensated for the reduced SOD activity in LLC-bearing mice by inducing high SOD1 mRNA expression, which may increase superoxide anion scavenging.

A) B)

Figure 4.3.4.1.1: S100A8 increased SOD activities to baseline in mice with midpoint lung tumours. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or B) treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine SOD activities in lung lysates. SOD activities (∆A/min/mg protein) are means ± SEM, n ≥ 4/group, *p < 0.05 as indicated.

219

Table 4.3.4: S100A8 selectively upregulated antioxidative gene expression Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days 2 4 (**) 2 5 SOD1 -3.9 ± 0.0 (*) (3.4 ± 3.0) x 10 6.6 ± 2.3 (6.5 ± 1.8) x 10 (2.1 ± 0.9) x 10 (5.8 ± 2.5) x 10 (*) Catalase 19.0 ± 9.8 1.6 ± 0.4 1.1 ± 0.8 2.2 ± 0.7 7.7 ± 4.8 1.3 ± 0.4 4 (****) 5 TXN -3.0 ± 0.1 49.9 ± 36.0 5.6 ± 1.7 (7.9 ± 2.7) x 10 49.0 ± 24.7 (1.5 ± 0.6) x 10 (**) 2 (****) 2 PRDX1 19.2 ± 11.7 93.8 ± 83.7 -1.6 ± 0.4 (3.1 ± 2.6) x 10 7.2 ± 4.4 (1.6 ± 1.4) x 10 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in antioxidative gene expression in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold, *p < 0.05, **p < 0.01 and ****p < 0.0001 compared to control.

220

S100A8 induced catalase mRNA expression in lungs from control and LLC-bearing mice

19.0 ± 9.8 and 7.7 ± 4.8-fold, respectively, 3 days after administration, but the expression in lungs from LLC-bearing mice was similar to control (Table 4.3.4). No significant differences in mRNA expression were found in any samples harvested on day 10 (Table

4.3.4). Catalase immunoreactivity was found in airway epithelial cells, although this was common to all groups at both time points (Figures 4.3.4.1.2-4.3.4.1.3). Catalase protein detected by Western blot of lung lysates was also similar in all groups at both time points

(Figure 4.3.4.1.4).

Catalase activity in lung lysates from control mice treated with S100A8 was similar to control levels on day 3 (~20 µM H2O2/min/mg protein), whereas LLC implantation significantly increased activity to 38.7 ± 4.0 µM H2O2/min/mg (P < 0.001 compared to control), and S100A8 administration to LLC-bearing mice did not significantly alter this activity (33.1 ± 2.2 µM H2O2/min/mg protein; P < 0.01 compared to control; Figure

4.3.4.1.5A). These data suggest a compensatory upregulation of catalase activity in response to early tumours, but S100A8 had little effect. Catalase activities in lung lysates harvested on day 10 were lower than those observed on day 3, and consistent with mRNA and protein expression, activities were similar in all groups (~7 µM H2O2/min/mg protein)

(Figure 4.3.4.1.5B).

221

A) B)

C) D)

Figure 4.3.4.1.2: S100A8 had little early effect on catalase protein expression in lungs. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later. Anti-catalase immunoreactivity (indicated by arrows and red staining) of lung sections from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC, D) S100A8+LLC or E) IgG control. Sections are representative of lungs from at least 4 mice/group; scale bars = 10 μm at 10X.

222

A) B)

C) D)

Figure 4.3.4.1.3: S100A8 had little effect on catalase protein expression in lungs at midpoint of survival. Mice treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10. Anti-catalase immunoreactivity (indicated by arrows and red staining) of lung sections from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC-treated mice. Sections are representative of lungs from at least 4 mice/group; scale bars = 10 μm at 10X.

223

A) B)

Figure 4.3.4.1.4: S100A8 had little effect on catalase protein expression. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in catalase protein expression and activities in lung lysates. The Western blot was cropped to indicate only the representative catalase (~60 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to catalase, relative to β-actin, in lung lysates (n ≥ 4/group). No statistically significant changes were detected.

224

A) B)

Figure 4.3.4.1.5: S100A8 had little effect on catalase activity. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10. Catalase activities (∆A/min/mg protein) in lung lysates are means ± SEM, n ≥ 4/group, **p < 0.01 and ***p < 0.001 compared to control (HBSS+DPBS).

225

4.3.4.2 S100A8 induced TXNR and PRDX activities in LLC-bearing mice

TXN scavenges peroxides [453] and regulates redox control of transcription factors, deoxyribonucleotide synthesis and cell proliferation [453]. We chose to examine TXN expression and its activity in all samples because S100A8 inhalation upregulated TXN mRNA expression by some 2-fold in lungs from control mice after 12 hours (unpublished data from our laboratory; Appendix III). Interestingly, TXN mRNA expression patterns were similar to those of SOD1 mRNA at both time points. TXN mRNA expression was

3-fold less than control in lungs harvested 3 days after S100A8 administration, whereas

LLC implantation increased it 5.6-fold, and S100A8 administration to LLC-bearing mice increased it markedly, to 49-fold above control (Table 4.3.4). However, there was no obvious TXN immunoreactivity in lung sections from any groups on day 3 (not shown).

In lysates of samples harvested on day 3, total TXN protein levels were generally low and similar, excepting that those in LLC-bearing lungs were somewhat lower, but not significantly different (Figure 4.3.4.2.1A), suggesting that protein upregulation may occur at later time points. Similarly, S100A8 had little effect on TXN reductase (TXNR) activity in lung lysates from control mice on day 3 (~0.30 ∆A/min/mg protein), and although activity in LLC-bearing mice was some two-thirds less than control (0.19 ± 0.01

∆A/min/mg protein), differences were not statistically significant (Figure 4.3.4.2.1B).

Importantly, in keeping with the high TXN mRNA expression (Table 4.3.4), S100A8 administration to LLC-bearing mice increased TXNR activity to baseline (0.35 ± 0.04

∆A/min/mg protein, P < 0.05 compared to HBSS+LLC; Figure 4.3.4.2.1B).

226

A) B)

Figure 4.3.4.2.1: S100A8 increased TXNR activities to baseline but did not alter TXN protein in mice with early tumours. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, to determine changes in TXN protein expression and TXN reductase (TXNR) activities in lung lysates. A) The Western blot was cropped to indicate only the representative TXN (~12 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to TXN, relative to β-actin, in lung lysates (n ≥ 4/group). No statistically significant changes were detected. B) TXNR activities (∆A/min/mg protein) are means ± SEM, n ≥ 4/group, *p < 0.05 as indicated.

227

All treatments profoundly induced TXN mRNA expression, and to levels higher than those on day 3, in lungs harvested on day 10: S100A8 administration increased it ~50- fold in control mice, LLC implantation increased it ~8 x 104-fold (P < 0.0001 compared to control), and S100A8 administration to LLC-bearing mice produced an even greater increase (1.5 x 105-fold; P < 0.01 compared to control; Table 4.3.4). However, only weak immunoreactivity of TXN was observed in airway epithelial cells in lungs from control mice treated with or without S100A8, or from LLC-bearing mice, and no obvious immunoreactivity in LLC-bearing mice treated with S100A8 (Figure 4.3.4.2.2). Western blotting indicated that total TXN protein in all groups followed a similar trend, with somewhat less protein detected in S100A8+LLC samples, but differences were not statistically significant (P = ~0.2 compared to other groups; Figure 4.3.4.2.3A). TXNR activity in lung lysates from control mice treated with S100A8 was similar to that of control (~0.20 ∆A/min/mg protein; Figure 4.3.4.2.3B). By contrast, LLC implantation reduced TXNR activity to 0.09 ± 0.03 ∆A/min/mg protein (P < 0.05 compared to control), and S100A8 administration to LLC-bearing mice increased this to baseline levels (0.21 ±

0.02 ∆A/min/mg protein; P < 0.05 compared to HBSS+LLC; Figure 4.3.4.2.3B). Results show that S100A8 administration to LLC-bearing mice likely compensated for the reduced TXNR activity by inducing high TXN mRNA expression, which may contribute to increased peroxide scavenging in LLC-bearing mice at early and midpoints of survival.

228

A) B)

C) D)

Figure 4.3.4.2.2: Expression of TXN in lungs at midpoint of survival. Mice treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in TXN protein expression in lungs. Anti-TXN immunoreactivity (indicated by arrows and red staining) of lung sections from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC, D) S100A8+LLC or E) IgG control. Sections are representative of lungs from at least 4 mice/group; scale bar = 10 μm at 10X.

229

A) B)

Figure 4.3.4.2.3: S100A8 increased TXNR activities to baselines in mice with midpoint tumours. Mice treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in TXN protein expression and TXN reductase (TXNR) activities in lung lysates. A) The Western blot was cropped to indicate only the representative TXN (~12 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to TXN, relative to β-actin, in lung lysates (n ≥ 4/group). No statistically significant changes were detected. B) TXNR activities (∆A/min/mg protein) are means ± SEM, n ≥ 4/group, *p < 0.05 as indicated.

230

The lack of correlation between the protein and activity data on day 10 may be due to the formation of TXN-TXN interacting protein (TXNIP) complexes, which would downregulate TXN activity [471]. While complex formation may occur at a time between days 3 and 10, non-reduced Western blotting indicated no obvious expression of TXN-

TXNIP in any groups on day 3 or day 10 (not shown). TXN may also be degraded post- transcriptionally, or modified post-translationally by S100A8 or LLC.

PRDX works jointly with TXN to scavenge peroxides [453] and may regulate functions of TXN. We next examined if the some 7-fold induction of PRDX1 mRNA expression by

S100A8 in lungs from control mice at 12 hours (unpublished data from our laboratory;

Appendix III) also occurred on days 3 and 10. Interestingly, expression patterns of

PRDX1 mRNA in samples harvested on day 3 were similar to those of catalase; LLC implantation had no obvious effect, whereas administration of S100A8 to control mice and LLC-bearing mice upregulated PRDX mRNA expression 19.2-fold and 7.2-fold, respectively (Table 4.3.4). PRDX1 immunoreactivity was detected in airway epithelial cells in all groups at this time point (Figure 4.3.4.2.4). The marked PRDX1 mRNA induction by S100A8 was not, however, reflected in immunoreactivity, and no obvious differences were apparent across any groups (Figure 4.3.4.2.4).

231

A) B)

C) D)

Figure 4.3.4.2.4: Early expression of PRDX in lungs. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later to determine changes in PRDX protein expression in lungs. Anti-PRDX1 immunoreactivity (indicated by arrows and red staining) of lung sections from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC and D) S100A8+LLC-treated mice. Sections are representative of lungs from at least 4 mice/group; scale bars = 10 μm at 10X.

232

Likewise, PRDX1 protein levels determined by Western blotting were similar in all groups on day 3 (Figure 4.3.4.2.5). We also detected an extra band at some 30 kDa in addition to the theoretical band at 22 kDa, and levels were similar in all groups (Figure

4.3.4.2.5), which may represent covalently-modified PRDX1, as previously reported

[927].

Figure 4.3.4.2.5: Early expression of PRDX1 in lung lysates. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later to determine changes in PRDX protein expression in lung lysates. The Western blot was cropped to indicate only the representative PRDX1 (~22 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to PRDX1 (~22 kDa), relative to β-actin, in lung lysates (n ≥ 4/group). No statistically significant changes were detected. An additional band at ~30 kDa (indicated by arrow) was identified in all samples.

233

Interestingly, PRDX activities in lung lysates also followed a similar trend to those of catalase on day 3, although no statistically significant changes were detected (Figure

4.3.4.2.6). LLC implantation increased PRDX activity ~2-fold, although there was variation between samples (from 5.4 ± 1.3 to 10.4 ± 2.7 ∆CHP-1/min/mg protein), and

S100A8 administration to LLC-bearing mice had little effect (10.8 ± 2.1 ∆CHP-1/min/mg protein; Figure 4.3.4.2.6).

Figure 4.3.4.2.6: PRDX activities at early point of survival. Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later to determine changes in PRDX activities in lung lysates. PRDX activities (∆CHP/min/mg protein) are means ± SEM, n ≥ 4/group. No statistically significant changes were detected.

S100A8 administration increased PRDX1 mRNA expression some 90-fold in lungs from control mice on day 10, although there was variation between samples (Table 4.3.4).

Lungs from LLC-bearing mice had markedly increased expression of some 300-fold (P

< 0.0001 compared to control), and S100A8 administration to LLC-bearing mice reduced this to some 160-fold above control (Table 4.3.4). Unexpectedly, S100A8 administration to control mice made no obvious difference to PRDX1 immunoreactivity in airway epithelial cells, and there was no or little reactivity in samples from both groups of LLC- bearing mice (Figure 4.3.4.2.7).

234

A) B)

C) D)

Figure 4.3.4.2.7: Expression of PRDX1 in lungs at midpoint of survival. Mice treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10 to determine changes in PRDX1 expression in lungs. Anti-PRDX1 immunoreactivity (indicated by arrows and red staining) of lung sections from A) HBSS+DPBS, B) S100A8+DPBS, C) HBSS+LLC, D) S100A8+LLC or E) IgG control. Sections are representative of lungs from at least 4 mice/group; scale bar = 10 μm at 10X.

235

Similarly, Western blotting did not indicate any obvious differences in total PRDX1 protein in lung lysates from control mice treated with S100A8 on day 10, and PRDX1 decreased to ~75 % of control in samples from both groups of LLC-bearing mice (P <

0.01 compared to control for HBSS+LLC; P < 0.05 for S100A8+LLC compared to control; Figure 4.3.4.2.8). Levels of the ~30 kDa bands, which may represent covalently- modified PRDX1 [927], followed a similar trend at this time point (Figure 4.3.4.2.8).

Figure 4.3.4.2.8: PRDX1 expression was reduced in lungs from LLC-bearing mice at midpoint of survival. Mice treated with S100A8 (10 μg) or HBSS 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in PRDX protein expression in lung lysates. The Western blot was cropped to indicate only the representative PRDX1 (~22 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to PRDX1 (~22 kDa), relative to β-actin, in lung lysates (n ≥ 4/group), *p < 0.05 and ***p < 0.001 compared to control (HBSS+DPBS). An additional band at ~30 kDa (indicated by arrow) was identified in all samples.

236

Remarkably, PRDX activities in control or LLC-bearing mice treated with HBSS were at

~7 ∆CHP-1/min/mg of protein on day 10, whereas S100A8 administration to control mice and LLC-bearing mice increased activities to 11.0 ± 1.2 (changes not statistically significant) and 15.5 ± 1.8 ∆CHP-1/min/mg of protein, respectively (P < 0.05 compared to control or HBSS+LLC; Figure 4.3.4.2.9).

Figure 4.3.4.2.9: S100A8 induced PRDX activity in lungs from LLC-bearing mice at midpoint of survival. Mice treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in PRDX activities in lung lysates. PRDX activities (∆CHP/min/mg protein) are means ± SEM, n ≥ 4/group; *p < 0.05 compared to control (HBSS+DPBS) and #p < 0.05 compared to HBSS+LLC.

That no correlation exists between mRNA, protein and activity data at both time points suggests that PRDX could have been post-translationally modified. Indeed, PRDX is susceptible to oxidation, and oxidised PRDX (PRDX-SO3) inactivates its activity [468].

PRDX-SO3 protein detected by Western blotting was slightly lower in samples from control mice treated with S100A8, and in LLC-bearing mice treated with HBSS on day

3, but differences were not statistically significant (Figure 4.3.4.2.10A). Remarkably, there was less PRDX-SO3 (one third of control) in samples harvested 3 days after LLC implantation and treated with S100A8 (P < 0.01 compared to control; Figure 4.3.4.2.10A). 237

While there was little PRDX-SO3 protein in samples harvested on day 10, its expression reflected the trend in samples harvested on day 3, but no statistically significant differences were apparent (Figure 4.3.4.2.10B). The ~30 kDa bands revealed in Western blotting of PRDX1 (Figures 4.3.4.2.5 and 4.3.4.2.8) were also found, at variable levels, in some samples (Figure 4.3.4.2.10). Results suggest that S100A8 may enhance PRDX activity by modulating factors involved in PRDX hyperoxidation.

A) B)

Figure 4.3.4.2.10: S100A8 reduced oxidised PRDX protein expression in LLC-bearing mice. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, B) or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10. The Western blot was cropped to indicate only the representative PRDX-SO3 (~22 kDa) and β-actin (~42 kDa) bands of each group (demarked by solid lines). Densitometry values are means ± SEM of bands corresponding to PRDX-SO3 (~22 kDa), relative to β-actin, in lung lysates (n ≥ 4/group). **p < 0.01 compared to control (HBSS+DPBS). An additional band at ~30 kDa (indicated by arrow) was identified in all samples.

238

4.3.4.3 S100A8 had little effect on mRNA expression or activity of other key antioxidants

GPX scavenges H2O2 and hydroperoxides to protect against DNA damage [447]. S100A8 induces GPX1 mRNA expression in lungs from control mice 12 hours after inhalation

(unpublished data from our laboratory; Appendix III), and thus, we determined whether

S100A8 affected GPX mRNA expression on days 3 and 10. However, expression of GPX mRNA was similar in all groups on day 3 (Table 4.3.4.3), and GPX activities were ~170k

∆A/min/mg protein in all samples (Figure 4.3.4.3A). GPX mRNA expression decreased

~3 and 7-fold in lungs from control mice treated with S100A8, and LLC-bearing mice harvested on day 10, respectively, but S100A8 administration restored mRNA expression of the latter to baseline (Table 4.3.4.3). GPX activity was, however, similar in all samples, and activities were ~10 % of those on day 3 (~20k ∆A/min/mg protein; Figure 4.3.4.3B).

The lack of correlation between GPX1 mRNA and activity in lungs from LLC-bearing mice at this time point may indicate post-transcriptional mRNA degradation or post- translational modifications.

Next, we examined mRNA expression of GSTM, a peroxide-scavenging enzyme that can work jointly with GPX for antioxidant defence, since patients with lung cancer often exhibit a deletion of the GSTM1 gene [928]. However, no detectable expression of GSTM mRNA was observed in any samples harvested on day 3, although it was upregulated ~3-

5-fold in samples harvested on day 10 (Table 4.3.4.3). Results suggest that S100A8 had a negligible effect on key enzymes that participate in glutathione metabolism at the time points evaluated.

239

A) B)

Figure 4.3.4.3: S100A8 had little effect on GPX activity. A) Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later (early tumours), or B) treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10 (midpoint tumours), to determine changes in GPX activities in lung lysates. GPX activities x 1000 (∆A/min/mg protein) are means ± SEM, n ≥ 4/group. No statistically significant changes were detected.

Mt detoxify toxic ions such as lead and mercury and scavenge oxidants [460]. Mt1 and

Mt2 are downregulated in human lung cancer tissues [475], and their expression is associated with fewer chemically-induced lung tumours in mice [457]. We reported that

S100A8 upregulates Mt1 and 2 mRNA expression in lungs of mice with endotoxin- induced acute lung injury 4 hours post inhalation [224], and Mt1 mRNA expression in lungs of naïve mice 1 and 12 hours post inhalation (unpublished data from our laboratory;

Appendix III), suggesting that S100A8 may moderate their expression. However, there was little change in Mt1 mRNA expression in any samples at either time point, other than a ~3-fold mRNA reduction in lungs from control mice treated with S100A8 harvested on day 3, or in lungs from both groups of LLC-bearing mice harvested on day 10 (P < 0.05 compared to control for S100A8+LLC). S100A8 administration to control mice had little effect on Mt2 in lungs harvested on day 3, whereas LLC implantation suppressed its

240

expression 10.6-fold, but following S100A8 inhalation, Mt2 mRNA expression was similar to baseline control (Table 4.3.4.3). By contrast, Mt2 mRNA expression was ~3-

6-fold above baseline in lungs from all treatment groups harvested on day 10, and somewhat higher in S100A8-treated lungs (Table 4.3.4.3).

HO-1 degrades heme to carbon monoxide [461], and it may protect against oxidative injury in lungs [929] and reduce lung tumour growth [461]. We reported that S100A8 suppresses HO-1 mRNA induction by LPS to control values some 2-fold in acute lung injury [224], or in lungs of naïve mice after 1 and 12 hours, but increases expression by some 2-fold after 4 hours (unpublished data from our laboratory; Appendix III). However,

HO-1 mRNA expression remained similar in all samples harvested at both time points

(Table 4.3.4.3), suggesting that it was unlikely to have contributed to the modulation of the redox environment in lungs.

Table 4.3.4.3: S100A8 had little effect on GPX, GSTM, Mt or HO-1 mRNA expression Gene S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days GPX1 -1.7 ± 0.2 -2.7 ± 0.2 1.8 ± 0.7 -7.2 ± 0.1 -1.2 ± 0.3 1.5 ± 0.3 GSTM ND 5.1 ± 2.3 ND 3.8 ± 1.9 ND 2.6 ± 1.2 Mt1 -2.7 ± 0.1 -1.8 ± 0.2 1.0 ± 0.3 -2.9 ± 0.1 1.2 ± 0.3 -3.0 ± 0.1 (*) Mt2 -1.3 ± 0.2 4.6 ± 2.0 -10.6 ± 0.0 3.3 ± 1.4 1.5 ± 0.3 5.6 ± 0.2 HO-1 -2.2 ± 0.1 1.9 ± 0.2 1.2 ± 0.2 1.4 ± 0.3 1.7 ± 0.2 1.1 ± 0.1 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in antioxidative gene expression in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold; ND = not detected. *p < 0.05 compared to control.

241

4.3.5 S100A8 had little effect on genes that influence tumour growth but altered expression of genes that may influence metastasis

Key molecules that promote lung tumour initiation and growth include oncogenic kinase receptors and ligands, growth factors and cell cycle modulators (Table 4.3.5.1 and

Appendix V). On the other hand, tumour-suppressors reverse pro-tumourigenic effects by suppressing tumour initiation and promoting cell cycle arrest and apoptosis (Table 4.3.5.1 and Appendix V). We demonstrated that S100A8 suppressed c-kit mRNA expression in

LLC cells after 4 hours, and IGF-1 and p53 mRNA expression after 15 hours (Table

3.3.1.1), which suggests that S100A8 altered genes that may influence LLC growth in lungs. Expression of oncogenes and tumour suppressor genes in all groups was determined at early and midpoints of survival (3 and 10 days respectively).

Results revealed few marked changes in genes that promote tumour growth in all treatment groups (Table 4.3.5.1; results for other genes are presented in Appendix V).

Accordingly, MMP-10 mRNA expression was strongly upregulated 37.1-fold above control in lungs implanted with LLC on day 3, and administering S100A8 to LLC-bearing mice suppressed that increase to baseline (Table 4.3.5.1). In lungs harvested on day 10,

MMP-10 mRNA expression had decreased to ~10-fold in lungs from control mice treated with S100A8 or from LLC-bearing mice, but was similar to control values in lungs from

LLC-bearing mice treated with S100A8 (Table 4.3.5.1). These results suggest that

S100A8 may suppress tumour initiation soon after implantation. However, no obvious protein expression was detected in any samples through Western blotting or immunohistochemistry (not shown), and activity of this enzyme needs to be determined.

242

Interestingly, expression of EGFR, a gene that is often overexpressed or mutated in lung cancer [372], and promotes uncontrolled proliferation [379-381], was not detected in any samples harvested on day 3, and was similar to baseline in those harvested on day 10

(Table 4.3.5.1). Although S100A8 suppressed c-kit mRNA expression 3-fold in LLC cells at 4 hours (Table 3.3.1.1), neither S100A8 nor LLC affected c-kit mRNA expression at either time point (Table 4.3.5.1). S100A8 did, however, suppress Lck mRNA expression, an oncogenic kinase receptor activated by c-kit, which promotes lung cancer cell proliferation [930], some 2-4-fold in lungs from control mice at both time points (Table

4.3.5.1). In contrast, S100A8 increased Lck mRNA expression ~3-fold in lungs from

LLC-bearing mice on day 3, but this was decreased ~4-fold on day 10 (Table 4.3.5.1).

Lck mRNA expression in lungs from LLC-bearing mice also showed a ~5-fold decrease on day 10 (Table 4.3.5.1). IGF-1 is an oncogenic kinase ligand that promotes lung cancer cell survival and proliferation and inhibits apoptosis [931, 932]. We determined that

S100A8 suppressed IGF-1 mRNA expression in LLC cells at 15 hours (Table 3.3.1.1).

However, while there was only a 2.5-fold decrease in IGF-1 mRNA expression in lungs from control mice treated with S100A8 on day 10, expression was similar to controls in other samples (Table 4.3.5.1).

MKP1 and SIRT1 promote lung tumour proliferation and progression [933, 934]. We previously determined that S100A8 markedly suppressed MKP1 in lungs from naïve mice

1-12 hours post inhalation (some 10 to 25-fold; unpublished data from our group; not shown). However, MKP1 mRNA expression decreased by only some 3-fold in lungs from control mice 3 days after S100A8 inhalation, and was similar to control in samples from other groups (Table 4.3.5.1). In contrast, S100A8 induced MKP1 mRNA expression some

3-fold in lungs from LLC-bearing mice on day 10, but expression was similar to control

243 in samples from other groups (Table 4.3.5.1). Although we previously reported that

S100A8 increased SIRT1 protein to control levels in lungs from LPS-treated mice

(unpublished data from our group; not shown), SIRT1 mRNA expression was 2 or 3-fold below baselines in lungs from control mice treated with S100A8 at both time points

(Table 4.3.5.1).

There were few notable changes in genes that suppress tumour growth in all treatment groups (Table 4.3.5.1; results for other genes are presented in Appendix V). SOCS3 suppresses lung tumour initiation by targeting JAK/STAT pathway [935]. SOCS3 mRNA expression was only slightly deregulated in lungs from LLC-bearing mice harvested on day 3, but little difference was apparent in other samples (Table 4.3.5.1). Cdkn1a promotes cell cycle arrest in response to DNA damage, thereby preventing tumour initiation [936]. Cdkn1a mRNA expression in lungs from control of LLC-bearing mice treated with S100A8 was close to baseline values on day 3, but decreased some 4-fold in

LLC-bearing mice (Table 4.3.5.1). In contrast, Cdkn1a mRNA expression was elevated some 2 to 4-fold in samples harvested on day 10 (Table 4.3.5.1). Although Cdkn1a is activated by p53 to prevent tumour initiation [936], p53 mRNA expression in samples harvested at both time points did not correlate with that of Cdkn1a, and was similar to control values (Table 4.3.5.1).

244

Table 4.3.5.1: Effects of S100A8 and/or LLC on genes that influence tumour growth Gene Function in cancer S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days MMP-10 Maintains lung cancer stem cells and promotes tumour initiation 1.2 ± 0.6 -9.8 ± 0.1 37.1 ± 14.1 -9.8 ± 0.1 1.4 ± 0.6 -1.2 ± 0.5 [392, 937] EGFR Oncogenic kinase receptor that facilitates EGF binding and promotes ND -1.4 ± 0.2 ND -1.3 ± 0.1 ND 1.0 ± 0.1 lung cancer cell proliferation and migration [379-381] c-Kit Oncogenic kinase receptor that binds SCF to promote -2.1 ± 0.1 1.2 ± 0.2 -1.6 ± 0.1 1.5 ± 0.4 -1.2 ± 0.1 -1.7 ± 0.2 autophosphorylation and uncontrolled cell proliferation [888] Lck Oncogenic kinase receptor activated by c-kit; promotes lung cancer -2.4 ± 0.2 -4.3 ± 0.1 1.6 ± 0.8 -4.7 ± 0.1 2.9 ± 1.4 -3.8 ± 0.1 cell line proliferation [930] IGF-1 Oncogenic kinase ligand that promotes lung cancer cell survival and 1.6 ± 0.2 -2.5 ± 0.2 1.2 ± 0.2 -1.8 ± 0.2 -1.4 ± 0.2 -1.7 ± 0.1 proliferation; inhibits apoptosis [931, 932] MKP1 Oncogenic kinase receptor that promotes lung tumour cell -3.3 ± 0.1 2.1 ± 0.8 1.1 ± 0.3 2.1 ± 0.9 2.0 ± 0.4 3.2 ± 1.5 proliferation and growth in mice [933] SIRT1 Promotes lung adenocarcinoma progression [938] and NSCLC cell -2.9 ± 0.1 -2.4 ± 0.1 -1.3 ± 0.2 1.4 ± 0.2 -1.2 ± 0.1 1.1 ± 0.2 migration [939]; tumour lysis by NK cells reported in murine breast cancer [934] SOCS3 Suppresses lung and liver tumour initiation by targeting JAK/STAT -2.2 ± 0.1 1.6 ± 0.5 -2.5 ± 0.1 -1.4 ± 0.2 -1.0 ± 0.1 -1.2 ± 0.3 pathway [935] Cdkn1a Activated by p53 in responses to DNA damage to promotes cell cycle -1.2 ± 0.2 3.9 ± 1.3 -4.2 ± 0.1 4.2 ± 1.2 1.3 ± 0.3 2.8 ± 0.8 arrest, thereby preventing tumour initiation [936] p53 Responses to DNA damages by inducing cell cycle arrest, senescence -2.2 ± 0.1 1.1 ± 0.1 -1.4 ± 0.1 -1.2 ± 0.2 1.5 ± 0.3 -1.3 ± 0.1 and apoptosis, thereby preventing tumour initiation [936] Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in genes that influence tumour growth in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold; ND = not detected. No statistically significant changes were detected.

245

Next, we determined if S100A8 altered mRNA expression of other MMP on days 3 and

10 because it induced several MMP genes in lungs from naïve mice 1 and 6 hours after inhalation [224]. S100A8 administration to lungs from control mice induced mRNA expression of MMP-3 (2.8-fold), MMP-9 (5.0-fold) and MMP-13 (6.6-fold) on day 3

(Table 4.3.5.2). LLC implantation had little effect on these genes at this time, whereas

S100A8 administration induced mRNA expression of MMP-9 (6.7-fold) and MMP-13

(3.6-fold), but had little effect on MMP-3 mRNA expression in lungs from LLC-bearing mice (Table 4.3.5.2). In contrast, the 5-fold induction of MMP-9 mRNA expression by

S100A8 was only maintained in lungs from control mice harvested on day 10, and expression in samples of other groups was similar to control (Table 4.3.5.2). Although

S100A4 may promote metastasis by MMP induction [940], S100A4 mRNA expression was similar to control and not elevated in any samples, and there was a 4.5-fold decrease in lungs from LLC-bearing mice harvested on day 10 (Table 4.3.5.2).

We also examined mRNA expression of mediators that influence metastasis, because extra-pulmonary tumour growth in the liver was observed in LLC-bearing mice receiving three S100A8 treatments but not continuous treatments (every third day until moribund)

(Figure 3.3.3.1). Key pro-metastatic molecules include S100A4, collagens, keratins, caveolin-1 (Cav1) and some cell adhesion molecules (Table 4.3.5.2 and Appendix V).

S100A8 slightly increased or decreased Col11a1, Krt14 and CCL-13 mRNA expression some 2 or 3-fold in lungs from control mice harvested on day 3, but markedly decreased mRNA expression of Col10a1 (5.8-fold), Col11a1 (4.9-fold) and Krt 5 (12.0-fold) on day

10 (Table 4.3.5.2). LLC implantation also slightly increased or decreased Col11a1and

CCL-13 mRNA expression, and markedly induced Krt5 and Krt14 mRNA expression

9.7-fold and 5.8-fold, respectively, in lungs harvested on day 3 (Table 4.3.5.2). In contrast,

246

expression of Krt5 and Krt14 mRNA was suppressed 7.9-fold and 2.9-fold, respectively, in lungs from LLC-bearing mice harvested on day 10, whereas Cav1, which promotes anoikis resistance [644-646], was significantly increased 3-fold above control (P < 0.05;

Table 4.3.5.2). Expression patterns of most pro-metastatic genes showed similarity in lungs from both groups of LLC-bearing mice, at both time points. Expression of Krt5 and

Krt14 mRNA was also increased on day 3 (11.7-fold and 7.7-fold respectively), although there was variation between samples (Table 4.3.5.2). Krt5 mRNA expression was also decreased (4.9-fold) in lungs with LLC that were treated with S100A8 and harvested on day 10, but Krt14 mRNA expression was 5.8-fold above control (Table 4.3.5.2). S100A8 is reported to establish a pre-metastatic niche in mice with lung cancer or melanoma with

SAA3, by recruiting Mac-1+-myeloid cells via the activation of TLR4 [497]. We reported that S100A8 suppressed SAA3 mRNA expression in lungs from mice with endotoxin- mediated injury, which may contribute to anti-inflammatory effects [224]. However,

SAA3 mRNA expression was close to control in samples harvested at both time points

(Table 4.3.5.2).

The tissue inhibitors of MMP (TIMP) are key anti-metastatic molecules, and some cell adhesion molecules may also reduce metastasis (Table 4.3.5.2 and Appendix V). S100A8 induced Cadm1, a gene that may reduce MMP activities [941] (3.4-fold), but had little effect on the TIMP2 gene, in lungs from control mice harvested on day 3 (Table 4.3.5.2).

S100A8 had little effect on Cadm1 and TIMP2 mRNA expression in lungs from control mice harvested on day 10, but provoked a marked increase in Cdh1 mRNA expression

(23.2-fold; P < 0.05 compared to control), which is negatively associated with metastasis

[942] (Table 4.3.5.2). There was a ~3-fold reduction in TIMP2 mRNA expression in lungs from LLC-bearing mice on day 3, and a marked increase in Cdh1 mRNA expression to

247

18.4-fold above control on day 10 (Table 4.3.5.2). Cdh1 and Cadm1 mRNA expression was increased ~3-fold in lungs from LLC-bearing mice treated with S100A8 on day 3 (P

< 0.05 compared to control for Cdh1), and Cdh1 mRNA expression increased to 11.7- fold on day 10 (Table 4.3.5.2). Expression of other measured genes was similar to control values in all groups, at both time points, as presented in Appendix V. Taken altogether, these results suggest that S100A8 may alter the metastatic potential in lungs by early induction of MMP and genes that may reduce MMP activity, although additional experiments to measure MMP protein expression and activity are warranted.

248

Table 4.3.5.2: S100A8 induced pro-metastatic genes in early tumours Gene Function in metastasis S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days MMP-3 Promotes metastasis by ECM degradation [632, 633] 2.8 ± 1.0 -1.9 ± 0.1 1.4 ± 0.5 -1.0 ± 0.2 1.3 ± 0.5 1.0 ± 0.2 MMP-9 5.0 ± 1.3 5.0 ± 1.3 -1.5 ± 0.2 1.8 ± 0.4 6.7 ± 2.4 2.2 ± 0.6 MMP-13 6.6 ± 2.7 1.1 ± 0.3 2.3 ± 0.9 1.9 ± 0.5 3.6 ± 1.3 -1.0 ± 0.3 S100A4 Promotes metastasis; possibly induces MMP [940] -1.3 ± 0.2 -1.3 ± 0.2 -2.1 ± 0.2 -4.5 ± 0.2 -1.5 ± 0.2 1.8 ± 0.4 Col10a1 Correlates with cancer metastasis [943, 944] 1.7 ± 0.2 -5.8 ± 0.1 1.4 ± 0.2 -1.9 ± 0.1 1.2 ± 0.3 -2.3 ± 0.1 Col11a1 Correlates with cancer metastasis [943] 2.9 ± 1.5 -4.9 ± 0.1 2.9 ± 1.2 -1.4 ± 0.2 2.7 ± 1.7 -1.5 ± 0.2 Krt5 Associates with cancer metastasis [945] -1.4 ± 0.6 -12.0 ± 0.1 9.7 ± 6.4 -7.9 ± 0.1 11.7 ± 10.2 -4.9 ± 0.2 Krt14 Acquires cancer cells with metastatic phenotype [946] -3.0 ± 0.3 -1.4 ± 0.6 5.8 ± 3.6 -2.9 ± 0.3 7.7 ± 6.4 5.8 ± 5.6 Cav1 Promotes anoikis resistance [644-646] -2.2 ± 0.1 -1.8 ± 0.1 -1.8 ± 0.2 3.0 ± 0.6 (*) -1.6 ± 0.2 1.4 ± 0.3 CCL-13 Associates with cancer metastasis [947] -2.7 ± 0.2 -1.9 ± 0.2 -3.4 ± 0.1 -2.4 ± 0.1 -2.5 ± 0.2 -2.2 ± 0.1 SAA3 Establishes a pre-metastatic niche in mice with lung -2.0 ± 0.2 2.2 ± 0.7 -2.0 ± 0.2 1.2 ± 0.3 -1.7 ± 0.2 1.4 ± 0.4 cancer or melanoma with S100A8 by increasing TLR- 4-mediated Mac-1+-myeloid cell recruitment [497] TIMP2 Suppresses MMP activity and metastasis [948] -1.8 ± 0.2 1.1 ± 0.3 -3.3 ± 0.1 -1.6 ± 0.2 -1.2 ± 0.1 -2.0 ± 0.1 Cadm1 May downregulate MMP activities to reduce 3.4 ± 0.9 1.1 ± 0.3 -1.3 ± 0.2 2.1 ± 0.5 3.1 ± 1.0 1.1 ± 0.3 metastasis [941] Cdh1 Associates with less cancer metastasis [942] -1.6 ± 0.1 23.2 ± 12.0 (**) -1.6 ± 0.1 18.4 ± 9.9 2.8 ± 0.4 (*) 11.7 ± 6.1 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in genes that influence metastasis in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold, *p < 0.05 and **p < 0.01 compared with control.

249

4.3.6 S100A8 suppressed genes that influence hypoxia and angiogenesis

Although S100A8 had little effect on vessel numbers in lungs on day 3 or day 10 (Figure

3.3.3.2), S100A8 suppressed the induction of HIF-1α (12.8-fold) and VEGF-α (5.4-fold) mRNA expression in the lungs of LLC-bearing mice to control values harvested on day

10 (Table 4.3.6; refer also to Table 4.3.1.1.1), suggesting that S100A8 may contribute to a hypoxic lung microenvironment. We examined mRNA expression of other HIF and mediators that influence hypoxia and angiogenesis in lungs harvested on days 3 and 10.

Interestingly, S100A8 also suppressed mRNA expression of some HIF in lungs from control mice at both time points. There was some 3-fold reduction in HIF-2α and HIF-3α mRNA expression on day 3, and marked reduction in HIF-1β (31.5-fold) and HIF-2α

(24.9-fold) mRNA expression on day 10 (Table 4.3.6). HIF-2α mRNA expression was increased some 8-fold in lungs from LLC-bearing mice harvested on day 3, whereas

S100A8 administration reduced that increase to 4.9-fold above control (Table 4.3.6).

There were decreases of some 4-fold in HIF-1β and HIF-2α mRNA expression in lungs from LLC-bearing mice harvested on day 10, and S100A8 administration increased the former to control expression, but decreased the latter some 14-fold (Table 4.3.6). There was a 5.7-fold induction of HIF-3α mRNA expression in lungs from both groups of LLC- bearing mice harvested on day 10 (Table 4.3.6). ALOX12, which induces HIF and VEGF to promote angiogenesis [949], correlated with the expression patterns of HIF-1α, HIF-

2α and VEGF mRNA. The 4.7-fold induction of ALOX12 mRNA expression in lungs from LLC-bearing mice harvested on day 10 was reduced to control by S100A8 (Table

4.3.6). Some chemokines are also reported to increase or decrease angiogenesis, and there was little change in mRNA expression in samples harvested at both time points (Appendix

250

V). Collectively, these results suggest that S100A8 may promote a hypoxic environment in lungs from LLC-bearing mice that contributed to an initial delay in tumour progression.

251

Table 4.3.6: S100A8 suppressed genes that promote hypoxia and angiogenesis Gene Functions relating to hypoxia and S100A8+DPBS HBSS+LLC S100A8+LLC angiogenesis 3 days 10 days 3 days 10 days 3 days 10 days HIF-1α Promote angiogenesis in response to 4.2 ± 1.0 -1.3 ± 0.5 -1.4 ± 0.3 12.8 ± 7.7 1.1 ± 0.4 2.3 ± 1.5 VEGFα hypoxia -2.1 ± 0.1 1.6 ± 0.4 -1.6 ± 0.1 5.4 ± 1.5 1.1 ± 0.2 1.3 ± 0.4 HIF-1β (Section 1.2.1.2) ND -31.5 ± 0.0 ND -4.4 ± 0.2 ND -1.7 ± 0.5 HIF-2α -3.8 ± 0.4 -24.9 ± 0.0 8.3 ± 7.3 -4.5 ± 0.3 4.9 ± 4.5 -14.2 ± 0.1 HIF-3α -3.1 ± 0.1 1.9 ± 0.6 -1.4 ± 0.3 5.7 ± 0.0 -2.2 ± 0.1 5.7 ± 2.1 ALOX12 Induces HIF and VEGF to promote -2.3 ± 0.1 2.2 ± 0.7 -1.2 ± 0.2 4.7 ± 1.6 1.3 ± 0.3 1.8 ± 0.6 angiogenesis [949] CCL-2 Chemokines that increase angiogenesis -1.2 ± 0.1 -3.9 ± 0.1(*) 1.3 ± 0.3 -4.5 ± 0.1 -1.2 ± 0.2 -2.9 ± 0.1(*) CCL-11 (Section 1.2.1.2) -1.0 ± 0.2 -3.5 ± 0.1 1.1 ± 0.4 -1.6 ± 0.2 1.3 ± 0.2 -1.7 ± 0.2 CXCL-5 -3.0 ± 0.0 (*) -2.2 ± 0.2 -1.6 ± 0.1 -4.1 ± 0.1 -2.3 ± 0.1 -3.5 ± 0.1 CXCL-9 Chemokines that suppress angiogenesis -2.2 ± 0.3 -2.2 ± 0.1 -1.2 ± 0.6 -1.1 ± 0.3 -1.1 ± 0.5 -2.0 ± 0.1 CXCL-10 (Section 1.2.1.2) -1.9 ± 0.2 1.3 ± 0.3 -1.6 ± 0.4 1.2 ± 0.3 1.9 ± 0.9 -1.6 ± 0.1 Mice treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in genes that influence hypoxia and angiogenesis in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5- fold, *p < 0.05 compared to control; ND = not detected.

252

In summary, S100A8 suppressed cytokines that promote MDSC expansion, activation and recruitment in LLC-implanted lungs at midpoint of survival (IL-1β, IL-4, IL-6, IL-

12β and IFN-γ); all except IL-12β were suppressed to control levels, which may be contributory to the lower MDSC numbers seen at this time. S100A8 concomitantly suppressed nitrite production to control levels but induced antioxidant activities: SOD and TXNR to control levels, and PRDX some 2-fold above control. S100A8 also induced

TXNR activities to control levels in lungs soon after LLC implantation. Results suggest that S100A8 may scavenge ROS and NO production, which are essential for MDSC signalling, thereby impairing their immunosuppressive activities. S100A8 may restore a normal redox and immune microenvironment conducive to anti-tumour T cell survival and function. The early elevation of IL-10 levels in BALF by S100A8 may contribute to the increased NK-T cell numbers in LLC-bearing lungs at the midpoint of survival.

Furthermore, increased IL-10 expression in airway epithelial cells and tumours, and IL-

10 levels in BALF, induced by S100A8 at the endpoint of survival may indicate higher

NK-T cell activity, although validation via the use of an NK killing assay is required.

ICAM-1 induction in alveolar epithelial cells by S100A8 may indicate increased NK-T cell adhesion to facilitate killing, and a cell adhesion assay will be necessary to test this possibility. Collectively, the data indicate that S100A8 may establish an immunoprotective microenvironment that delays lung tumour progression.

253

Chapter 5: General discussion and conclusions

Mounting evidence supports a link between inflammation and cancer [361, 362], and tumour-promoting inflammation is now recognised as one of the hallmarks of cancer

[363]. We reported that S100A8 given locally to lungs of mice by inhalation has potent anti-inflammatory and oxidant-scavenging effects in mouse models of lung inflammation

[223, 224, 352] (Section 1.1.7.2). These findings, together with the strong link between chronic inflammatory lung diseases and lung cancer [364-366], have opened the intriguing possibility that S100A8 inhalation may potentially have anti-tumourigenic functions. In contrast to previous studies, which have indicated pro-tumourigenic functions of S100A8 in subcutaneous or intravenous LLC mouse models [497, 771, 797,

815], this thesis presented novel data that demonstrated S100A8 inhalation significantly improved clinical outcomes in an orthotopic model of LLC lung cancer (Chapter 3).

Moreover, a number of potential underlying mechanisms for the protective effects of the

S100A8 in vivo were identified (Chapter 4). S100A8 inhalation delayed lung tumour growth and prolonged survival by up to 40% (Section 3.3.2). Interestingly, a single or three intermittent S100A8 treatment(s) promoted extra-pulmonary tumour growth in the liver at endpoint of survival, but continuous S100A8 treatment given on every third day did not lead to liver metastasis (Section 3.3.3.1). Although the exact mechanisms for the presence or absence of liver metastasis following the two different treatment regimens are not fully elucidated, intermittent local administration of S100A8 into the lungs may have created a microenvironment unfavourable for local implantation and growth of the orthotopically transplanted cancer cells, but allowed extra-pulmonary tumour growth in the liver, whereas continuous S100A8 treatment showed no additional extra-pulmonary implantation, likely due to increased S100A8 levels both locally and systemically.

254

Consistent with S100A8 primarily affecting the tumour microenvironment, the major processes that were modulated in the lungs in response to S100A8 inhalation included induction of antioxidant activities, suppression of nitrite production (Sections 4.3.2 and

4.3.4), suppression of MDSC accumulation by inhibiting the production of cytokines that promote their recruitment, expansion and activation (Section 4.3.1.1), and increased CD4 and NK-T cell numbers (Section 3.3.4.3). Interestingly, treatment with S100A8 had little or no direct effects on the viability of the tumour cells in vitro and in vivo (Sections 3.3.1 and 3.3.2), suggesting indirect effects, further supporting the notion that S100A8 may promote a microenvironment unfavourable for tumour growth and spread.

5.1 S100A8+ and S100A9+ myeloid cells were positively associated with survival

In many human malignancies, S100A8 is upregulated in tumours, stroma and various body fluids and has frequently been associated with poor clinical outcomes (Table

1.3.1.1). In human lung cancer, S100A8 is often highly co-expressed with S100A9 in tumours and stromal cells, and has been reported to have both positive and negative associations with clinical outcomes [408, 678]. High S100A8 and S100A9 expression in tumour islets, particularly squamous cell carcinoma, correlates with prolonged survival, whereas high expression in stroma cells is correlated with reduced survival [408].

However, Su et al. [678] reported a positive correlation between S100A8 and S100A9 expression in tumour cells from patients with advanced adenocarcinoma. Collectively, these conflicting reports might be due to significant differences in methodologies and patient cohorts, but may also depend on the expression pattern and cellular sources of

S100A8 and S100A9. It is also noteworthy that these clinical associations should be interpreted with caution, since they do not present a direct causality, and are not mechanistic studies.

255

Expression patterns of S100A8 and S100A9 in murine lungs are not fully understood, and it is unclear how their expression correlates with cancer progression. We previously reported that S100A8 or S100A9 is not constitutively expressed in naïve lungs, but recombinant S100A8 or S100A8/A9 inhalation can self-induce expression of native mRNA and protein in airway epithelial cells within 12 hours [223, 224]. However, we found no obvious S100A8 expression in airway epithelial cells, irrespective of treatment regimen, at early and midpoints of lung tumour growth (Section 3.3.4.2). While this suggests that S100A8 expression in airway epithelial cells is time point-dependent,

S100A8 may, in our model, have been secreted in response to the orthotopically implanted tumours, although this was not tested here. In keeping with S100A8 and

S100A9 expression in infiltrating myeloid cells in LPS-induced acute lung injury [223,

224], we detected their expression in neutrophil-like myeloid cells infiltrating LLC tumours at midpoint of survival, numbers of which were significantly greater in LLC- bearing mice (Section 3.3.4.2).

In contrast, LLC-bearing mice treated with S100A8 had significantly reduced numbers of both myeloid cell types and survived up to 40% longer than LLC-bearing control mice, indicating that low numbers of S100A8+ or S100A9+ cells predicted prolonged survival, and vice versa. Associations of S100A8+ myeloid cells with reduced survival are reported in human breast cancer [690], whereas those of S100A9 are reported in human lung [207,

493] and prostate cancers [692], and we reproduced these findings in mice with lung cancer. The major limitation of clinical association studies is a lack of functional information, and an association of S100A8 or S100A9 with poor cancer outcomes does not necessarily imply pro-tumourigenic functions, since their upregulation may have a compensatory function. We thus investigated the function of S100A8 through its

256

administration to tumour-bearing mice, because it has more potent anti-inflammatory and antioxidative effects than S100A9 or the S100A8/A9 complex [223, 224].

5.2 S100A8 created an anti-inflammatory lung microenvironment

TLR-4 and RAGE are reported to be putative receptors for S100A8 [167]. LPS, a TLR-4 agonist, can induce TLR-4 expression in lungs [950], and when given intraperitoneally or intranasally, induces pro-inflammatory cytokines and chemokines in plasma or BALF

[224, 951]. In contrast, RAGE is highly and endogenously expressed in the lungs [360] and promotes inflammation by activation of downstream pathways, including ERK,

MAPK and NF-ҡB (reviewed in [753]). Contrary to numerous studies that suggest

S100A8 mediates pro-inflammatory effects by binding and activation of TLR-4 [294] or

RAGE [291], we previously found that S100A8 inhalation had little pro-inflammatory effect on naïve or LPS-treated lungs, and indeed, induced expression of the anti- inflammatory cytokine, IL-10, in airway epithelial cells [224]. Single S100A8 inhalation failed to induce most pro-inflammatory cytokine genes in lungs from naïve mice over 20 hours, apart from a ~7-fold induction of IL-18 mRNA after 20 hours [224].

In line with these observations [224], we found that S100A8 did not induce pro- inflammatory cytokine gene or protein expression in lungs from control mice on days 3 and 10 (early and midpoints of survival), but promoted an early suppression of IL-18 mRNA expression (17-fold) and induction (~9-fold) at midpoint of survival (Section

4.3.1.1). IL-18 is a product of the inflammasome and its induction can be caused by endogenous mediators such as acute-phase reactant, SAA [901]. However, we detected no changes in SAA3 mRNA compared to control at both time points, suggesting that IL-

18 mRNA was regulated by other mediators. 257

We also reported that, in lungs from naïve mice, S100A8 induced mRNA expression of anti-inflammatory cytokines, IL-4 (~20-fold, 6 hours) and IL-10 (~1600-fold, 12 hours), with the latter elevated in BALF after 12 hours [224]. However, in the longer treatments reported here, 3 days after S100A8 inhalation, IL-4 mRNA expression was suppressed

~7-fold in lungs from control mice but IL-10 mRNA expression was unaffected. After 10 days, suppression was upregulated some 3-fold and 100-fold, respectively (Section

4.3.1.1), although protein was not affected at either time point, suggesting that these genes were regulated in a time point-dependent manner. In summary, S100A8 attenuates LPS- induced acute lung injury and asthma, in part, by suppressing production of most pro- inflammatory cytokines and chemokines that influence leukocyte influx, induces IL-10 in airway epithelial cells and alters redox-mediated signalling in lungs [224, 352]. These, together with the data reported here, indicate it is unlikely that S100A8 binds TLR-4 or

RAGE in healthy lungs to promote inflammation.

TLR-4 [764, 765] and RAGE [753] signalling are also implicated in the pathogenesis of lung cancer, particularly by promoting immunosuppression. Activation of TLR-4 signalling in human lung cancer cells induces immunosuppressive cytokines to promote immune escape and resistance to apoptosis [767], and TLR-4 activation by LPS is shown to induce MDSC expansion in lungs from naïve mice [769]. Several TLR receptors, including TLR-4, are constitutively expressed on LLC cells [770], indicating that activation of TLR-4 on LLC tumours may promote secretion of immunosuppressive cytokines that mediate MDSC accumulation. Importantly, there were no marked early changes in gene expression of pro-inflammatory or anti-inflammatory cytokines in lungs injected with LLC (Section 4.3.1.1); incubation of LLC cells with S100A8 in vitro had suppressed TNF-α mRNA expression ~5-fold after 15 hours (Section 3.3.1.1). Activation

258

of TLR-4 on LLC cells may contribute to the marked induction of mRNA and/or proteins of cytokines that promote MDSC expansion, activation and recruitment (IL-1β, IL-4, IL-

6, IL-18, IL-12β and IFN-γ) in LLC-bearing lungs at midpoint of survival, by endogenous

TLR-4 ligands, such as heat shock proteins and fibrinogen [952].

Although S100A8 is reported to bind TLR-4, in which TLR-4 activation recruits MDSC to tumours [771], and induces SAA3 to establish a niche for metastasis in LLC-bearing mice [497], we found that S100A8 had little effect on the gene expression of pro- inflammatory cytokines, and SAA3, in lungs with growing LLC tumours. In fact, S100A8 inhalation significantly increased IL-10 gene expression and concentrations in BALF some 2-fold, indicating an anti-inflammatory lung microenvironment (Section 4.3.1.2).

Moreover, S100A8 inhalation also suppressed a number of different pro-inflammatory genes and/or proteins of IL-1β, IL-4, IL-6, IL-18, IL-12β and IFN-γ to control or sub- control levels (SAA3 expression not affected), at midpoint of survival. The decrease in these genes and proteins was associated with a reduction of MDSC accumulation in the lungs and spleen (Sections 3.3.4.2 and 4.3.1.1). These results suggest it is unlikely that

S100A8 bound to TLR-4 on LLC tumours and/or other TLR-4-expressing cell types in lungs, although validation by receptor binding assays and TLR-4 knockout mouse model are still warranted.

S100A8/A9 is reported to promote MDSC accumulation via RAGE ligation in tumour- bearing mice or ex vivo cultures of cancer cells from patients [209, 498, 564, 695, 761].

However, the lower MDSC numbers seen in lungs and spleen from tumour-bearing mice at midpoint of survival (Figure 3.3.4.2) suggests the unlikeliness of S100A8 binding

RAGE on MDSC. Although RAGE largely mediates pro-tumourigenic functions [753],

259 it can also mediate anti-tumourigenic functions. Importantly, S100A8 is reported to bind

RAGE on NK cells to increase tumour cell killing in mice with pancreatic cancer [763].

We found that S100A8 increased NK-T cell numbers in lungs and spleen from LLC- bearing mice at midpoint of survival (Section 3.3.4.3). Although we detected no obvious change in RAGE mRNA expression in lungs from all treated groups of mice at early and midpoints of survival, S100A8 may activate NK-T cells via RAGE ligation; binding assays and functional studies are required to test this possibility.

The disparities between our findings and others’ may be explained by our stringent recombinant S100A8 protein preparation protocols that eliminate endotoxin (Section 2.1), and implementation of strict laboratory protocols to minimise endotoxin contamination.

This is critical, since E. coli that is commonly used for recombinant S100A8 protein expression [358] is a Gram-negative bacterium with LPS as the major component of its outer surface membrane [359]. Hence, S100A8 preparations can be contaminated with endotoxins if not purified sufficiently, or if procedures to minimise endotoxin contamination are not scrupulously implemented. These endotoxin contaminants may have influenced the results of reports that show TLR4 [294, 337, 338, 347, 497, 771] or

RAGE-mediated extracellular functions of S100A8 [209, 498, 564, 695, 761, 762].

Therefore, our results are most likely representative of effects of S100A8 on the lung microenvironment. Generation of a murine model over-expressing S100A8 in lung epithelial cells, when LPS induction can occur, may clarify this.

260

5.3 S100A8 created a lung microenvironment with reduced oxidative stress

ROS and NO are generated during mitochondrial oxidative phosphorylation [427], and from MDSC [430]. In lung cancer, ROS and NO can generate peroxynitrite [432, 433], which confers oxidative stress in the lung microenvironment to favour tumour progression. Although S100A8 can scavenge ROS [50, 51], we reported no changes in mRNA expression of NOX enzyme(s) in lungs from healthy mice, mice with acute lung injury [224] or LLC (Section 4.3.2), suggesting it is unlikely that S100A8 effects are regulated by suppressing NOX activation, but rather involves other mediators.

We chose to examine antioxidants because these are known to regulate cellular redox levels and are implicated in lung cancer progression (Section 1.2.1.3). SOD scavenges superoxide anions [442-444], and TXNR [453], PRDX [451], catalase [445, 446], GPX

[447] and Mt [460] are key antioxidants that scavenge various peroxide oxidants.

Unpublished data from our group (Appendix III) and data from this study (Section 4.3.4) indicate that S100A8 apparently regulated antioxidant mRNA expression in lungs from control mice in a time point-dependent manner. Except for PRDX1 mRNA which was progressively upregulated some 7 to 90-fold from 12 hours to 10 days, mRNA expression of other antioxidants fluctuated below or above control over a course of 10 days. SOD1 and TXN mRNA expression fluctuated between ~2-4-fold below or above baseline at early time points (1 hour to 3 days), but was markedly induced to 300-fold and ~50-fold respectively after 10 days. In contrast, GPX, catalase and Mt1 mRNA expression was upregulated at early time points only, and was otherwise similar to controls. Mt2 mRNA expression was upregulated only ~5-fold after 10 days. There was, however, a lack of correlation of mRNA expression with proteins and/or activities on days 3 and 10,

261 suggesting that their upregulation may occur at other time points, of which a more extended and stringent time course should be examined for effects.

Some 2-fold induction of Mt1 and Mt2 mRNA expression was also detected in lungs from mice with acute lung injury 4 hours after S100A8 inhalation [224], suggesting that

S100A8 may reduce oxidative stress in the lung microenvironment. SOD1 and TXN mRNA were markedly upregulated in both groups of LLC-bearing mice at both time points, with S100A8 having more pronounced effects (Section 4.3.4). Interestingly, expression of both genes appeared to follow similar patterns. TXN (mRNA or protein in reduced form) is reported to induce SOD2 mRNA in human lung cancer (A549) and breast cancer cells (MCF-7) [953], suggesting that SOD1 mRNA expression may be regulated in a similar manner in lungs from tumour-bearing mice.

TXN and PRDX can function jointly to scavenge peroxides and regulate intracellular

H2O2 that prevents excessive oxidative damage (reviewed in [451]). Accordingly, PRDX1 mRNA expression followed similar expression patterns to those of TXN in both groups of LLC-bearing mice at both time points, although the former was induced to a lesser extent than the latter. Although high mRNA transcription rate can enhance protein synthesis, longer untranslated regions in mRNA and higher numbers of introns can reduce translation efficiency [954]. Moreover, gene transcription and its subsequent translation into protein is regulated by the 3' untranslated region within mRNA, via interaction with microRNA and RNA binding proteins [955-958]. In particular, the 3' untranslated region within SOD1 mRNA is reported to interact with the RNA-binding protein, AUF-1, thereby stabilising mRNA transcripts and promoting protein translation in human pancreatic and oesophageal cancer cells [959]. While it is unclear how the translation of

262

TXN and PRDX1 proteins is regulated, it may be in a similar manner to SOD1 to control cellular redox balance; S100A8 and/or LLC may alter interaction with RNA-binding protein to promote mRNA degradation and/or reduce protein translation. Moreover, translated proteins may be subject to lysosomal or ubiquitin-mediated degradation [960].

In particular, TXN can be degraded by lysosomal proteinase, cathepsin D [961]; the E6- associated protein is shown to bind and ubiquitylate PRDX, thereby promoting protein degradation [962]. Collectively, these may contribute to the lack of correlation between

TXN and PRDX1 mRNA and protein expression at both time points (Section 4.3.4).

Similarly, there was a lack of correlation between SOD1, TXN and PRDX1 mRNA or protein expression or activities at both time points; in particular, activities were downregulated in lungs from LLC-bearing mice at midpoint of survival. In contrast, LLC- bearing mice treated with S100A8 had early induction of TXNR activity, and SOD,

TXNR and PRDX activities were all increased to control or levels above control at midpoint of survival, although TXN and PRDX1 protein expression was lower than control (Section 4.3.4). PRDX is susceptible to hyperoxidation and activity is inactivated by H2O2 [468], and SOD [963] and TXN [472] activities can also be inactivated by H2O2.

We speculated that the disparities may be due to oxidative modifications, because LLC- bearing mice, having the highest MDSC numbers among all groups at midpoint of survival (Section 3.3.4.2), possibly had more ROS and NO production [583, 584], and peroxynitrite (the product of ROS and NO) is generally elevated in lung cancer [432, 433].

We reported that S100A8 can scavenge ROS by forming disulphide-bonds [50, 51], and

NO by S-nitrosylation at its single Cys residue (Cys42 in human and Cys41 in mouse) [964].

Taking these data together with a reduction in MDSC numbers and nitrite levels compared

263 to controls (Sections 3.3.4.2 and 4.3.2) suggests that S100A8 may reduce ROS and NO production in lungs from LLC-bearing mice, and this may cause less inactivation of antioxidant enzymes. In line with our hypothesis, there was a reduction in PRDX-SO3

(oxidised PRDX) in lungs from LLC-bearing mice treated with S100A8 at early and midpoints of survival (Section 4.3.4). TXN activity can be inhibited by oxidised PRDX, and oxidised TXN is reduced by TXNR [453], suggesting that the lower PRDX-SO3 protein expression, but higher TXNR activities, in lungs from LLC-bearing mice treated with S100A8 may prevent TXN oxidation and inactivation. TXN activity can also be inhibited by the formation of a TXN and TXN-interacting protein complex [471].

Although no obvious protein expression was detected in any groups at either time points, activities of TXN-interacting protein and its binding to TXN may be altered, and further studies will be needed to examine these possibilities.

Although SOD can covalently conjugate to catalase to enhance oxidant-scavenging in ischemia-reperfusion injury in the heart [926], in our experiments, catalase mRNA expression and activity did not follow similar patterns to those of SOD (Section 4.3.4).

The early upregulation of catalase activity in LLC-bearing lungs may be compensatory.

Although S100A8 induced catalase mRNA expression ~8-fold in LLC-bearing mice, activity was similar to that in LLC-bearing mice. Results suggest the unlikeliness of catalase being a key moderator of ROS production in lungs from LLC-bearing mice, but

PRDX and TXN may be important.

Interestingly, there was marked upregulation of the GAPDH gene in lungs from mice treated with S100A8 and/or LLC, although protein expression and activities were unaffected (Section 4.3.3), suggesting translational regulation and/or post-translational

264

modification. Several post-translational modifications of GAPDH are reported which, depending on the modifications, may be pro-tumourigenic or anti-tumourigenic

(reviewed in [965]). It is unclear which, if any, post-translational modifications occurred in the LLC-bearing mice, but S-nitrosylation was a likely modification in the S100A8- treated mice, because S100A8/A9 forms a complex with iNOS to regulate GAPDH S- nitrosylation in human PBMC [114]. S-nitrosylated GAPDH is reported to promote apoptosis by inducing cell death pathways [115, 116], and the possibility that S100A8 may shuttle and localise NO [110] to GAPDH, thereby influencing transnitrosylation of target proteins to increase tumour cell apoptosis, is intriguing. Measuring protein S- nitrosylation products by biotin-switch assay [110] is required to test this possibility.

Similarly to S100A8, GAPDH inhibits ROS production [923] and attenuates acute lung injury by suppressing pro-inflammatory mediators and neutrophil recruitment [924].

Although we found that S100A8 inhalation did not alter GAPDH mRNA expression in lungs from naïve (up to 20 hours) or LPS-challenged mice [224], S100A8 may interact with GAPDH to enhance anti-inflammatory and antioxidative functions.

Immunoprecipitation experiments are required to test possible binding in vivo.

5.4 S100A8 moderated L-arginine availability in lungs

L-arginine is an amino acid essential for NO production by nitric oxide synthase (NOS), or for urea and L-ornithine production by arginase I (reviewed in [424]). L-ornithine is then converted into α-ketoglutarate which generates energy through the TCA cycle in mitochondria (reviewed in [422]), making L-arginine an important source of energy for tumour cell proliferation, including lung cancer cells [425]. Similarly, proliferation, metabolism and activation of T cells are dependent on L-arginine [499, 589, 590] and the cationic amino acid transport-1 (CAT1), which transport L-arginine into T cells [589].

265

MDSC deplete L-arginine by inducing arginase-1 and iNOS to mediate immunosuppression in lung cancer [491, 586]. Concurrently, MDSC overexpress the arginine transporter, cationic amino acid transporter 2 (CAT2), to sustain L-arginine availability for NO production and promote tumour cell proliferation [591].

We determined that iNOS mRNA expression and nitrite production (Section 4.3.2), and the influx of myeloid cells (Section 3.3.4.1), in lungs from both groups of mice with early

LLC tumours were similar to controls, suggesting that the high induction of CAT2 mRNA expression (~30-100-fold) had other functions. We confirmed that LLC cells required L- arginine to proliferate (Section 3.3.1.2), and the early induction of CAT2 mRNA expression (~30-100-fold) in both groups of LLC-bearing mice may facilitate tumour growth. However, S100A8 concurrently induced Arg1 mRNA (~30-fold) and somewhat increased arginase activity to control at this time (Section 4.3.2), suggesting that it may delay early tumour growth by altering L-arginine availability. Arg1 mRNA and arginase activity in lungs from both groups of LLC-bearing mice at midpoint of survival were increased to similar levels, whereas iNOS mRNA expression was similar to control mice.

In contrast, S100A8 treatment suppressed the some 10-fold CAT2 mRNA expression in

LLC-bearing mice to baseline, suggesting that it may reduce L-arginine availability.

Collectively, the high induction of CAT2 mRNA in LLC-bearing mice may increase L- arginine availability to increase nitrite production, which favours MDSC function, and

S100A8 may reverse these effects by suppressing CAT2 mRNA expression (Sections

3.3.4.2 and 4.3.2).

Interestingly, Arg1 mRNA also showed early upregulation in lungs from control mice treated with S100A8 (~12-fold), and protein and activity were somewhat increased, which 266

may counteract an increase in L-arginine transport by CAT2 mRNA induction (~20-fold) and contribute to the slightly lower nitrite levels detected at this time. In contrast, the high induction of Arg1 mRNA (~35-fold) by S100A8 in lungs from control mice was not reflected in protein and activity at midpoint of survival, suggesting that it may not function as a key moderator of L-arginine availability at this time point.

5.5 S100A8 created an unfavourable microenvironment for MDSC function

Contrasting effects of S100A8 on chemotaxis are reported, whereby S100A8 is reported to be chemotactic for neutrophils via a G-protein-coupled mechanism in vitro [329], but other studies report little chemotactic activity [327, 330], whereas oxidised S100A8 repels neutrophils (fugetaxis) [331]. Although S100A8 promotes mild neutrophil influx into healthy murine lungs after 20 hours [224], it attenuates acute lung injury and asthma, in part, by oxidant scavenging, and suppression of chemokines, thereby reducing neutrophil influx and mast cell activation [224, 352]. Although S100A8 increased G-CSF mRNA expression 6-fold in lungs with early LLC tumours, neutrophil influx was not altered (Sections 3.3.4.1 and 4.3.1.1), suggesting that the elevated G-CSF mRNA expression may facilitate recruitment of other leukocytes. In contrast, S100A8 suppressed neutrophil influx into lungs of LLC-bearing mice at midpoint of survival, and changes followed similar trends to S100A8+ and S100A9+ myeloid cell infiltration, although mast cell activation was unaffected. Although the S100A8+ and S100A9+ myeloid cells could be neutrophils, because of their constitutive expression in neutrophils [54, 204], S100A8 and S100A9 mRNA expression remained mostly at control levels in lungs and did not correlate with infiltration, suggesting that these myeloid cells may have been recruited from other organs.

267

The S100A8+ and S100A9+ myeloid cells could be PMN-MDSC recruited from the bone marrow, because their proteins are highly expressed in MDSC in cancer [209], and PMN-

MDSC is the predominant MDSC subtype in lung cancer [503]. In keeping with previous reports [503, 506], PMN-MDSC comprised ~75 to 90% of total MDSC in lungs, spleen, regional lymph nodes and bone marrow (Section 3.3.4.2). However, PMN-MDSC and

M-MDSC expand in similar proportions in spleen of mice with subcutaneous LLC tumours in the first two weeks, and M-MDSC progressively differentiate into PMN-

MDSC as tumours develop [506]. The high proportion of PMN-MDSC in spleen (~90%) at midpoint of survival, irrespective of S100A8 treatment, suggests that M-MDSC differentiation into PMN-MDSC occurred at earlier time points in orthotopic tumours.

In contrast to reports indicating that S100A8 promotes MDSC recruitment in mice with lung cancer [497, 771, 815], S100A8 suppressed the elevated numbers of total and PMN-

MDSC in lungs and spleen to control levels at midpoint of survival (Section 3.3.4.2).

However, S100A8 did not alter the elevated numbers of MDSC in the bone marrow, and this may be reflected by there being little change in CSF mRNA expression, which are the key mediators of MDSC expansion in the bone marrow (reviewed in [519, 520]). The discrepancies might be attributed to the method of delivering S100A8. The function of

S100A8 in the aforementioned studies was investigated by tail vein injection of an anti-

S100A8 antibody [497, 771, 815], and results do not represent local effects of S100A8.

Administration of S100A8 directly to lungs by inhalation was likely to have identified effects of S100A8 on orthotopic tumours, because we identified its local anti- inflammatory effects on acute lung injury using this method of delivery [224].

268

MDSC accumulate in tumours and lymphoid-associated organs to suppress anti-tumour immunity [498-500] by a two-signal model, where the first signal promotes MDSC expansion from immature myeloid cells and the second promotes their activation [486].

It remains unclear whether MDSC recruitment occurs before, after or simultaneously with

MDSC expansion and activation. Consistent with many of the pro-inflammatory cytokines and chemokines suppressed by S100A8 inhalation in acute lung injury [763] being mediators of MDSC expansion, activation and recruitment [487], IL-1β, IL-4, IL-

6 and IFN-γ were upregulated in LLC-bearing lungs at midpoint of survival but were suppressed to control levels by S100A8 (Section 4.3.1.1). All these factors promote

MDSC activation, and IL-1β and IL-6 also promote MDSC expansion [522, 523, 525-

527, 543, 544] (Section 1.2.1.4), which suggests that S100A8 may suppress both MDSC expansion and activation. Although IL-4 can also promote CD4 T cell function [603,

966], and IFN-γ can enhance the cytotoxicities of CD8, NK and NK-T cells [510, 511,

607, 967], suppression of these cytokines to control levels suggests that S100A8 likely restored normal anti-tumour immunity without promoting excessive immune activation.

Interestingly, there were no marked changes in most chemokines selected to reflect

MDSC recruitment in all groups at the time points evaluated (Section 4.3.1.1). CXCL12 was the only chemokine whose mRNA expression mirrored changes in MDSC numbers in lungs (Section 3.3.4.2). It is reported MDSC recruitment can occur via the CXCL12 and CXCR4 axis [556, 557], which suggests that the 4-fold induction of CXCL12 mRNA expression may have increased MDSC recruitment to tumours at midpoint of survival.

Although mRNA expression of the receptor for CXCL12, CXCR4, was not upregulated,

CXCL12 may bind with higher affinity to CXCR4. Importantly, CXCL12 is reported to bind CXCR4 and recruit T cells at low concentrations, but repel them at high 269 concentrations [968], suggesting that the concentration of CXCL12 may determine whether T cells or MDSC are recruited. The suppression of CXCL12 mRNA expression to control levels by S100A8 in LLC-bearing lungs may, thus, contribute to the reduced

MDSC recruitment, but increased CD4 and NK-T cell recruitment at midpoint of survival.

Interestingly, S100A8 also upregulated CXCL12 mRNA in control mice (2.7-fold), although there were no changes in influx of any measured leukocyte types (Section 3.3.4).

Further studies will evaluate CXCL12 binding to CXCR4 and the cell types that are recruited.

The other mediator of MDSC recruitment that was reduced by S100A8 was IL-12β, a potent antagonist of IL-12 [561]. IL-12 enhances anti-tumour T cell responses and suppresses MDSC numbers and function [560], but IL-12β can potently antagonise IL-

12 and promote MDSC recruitment to tumours [561]. In line with the reduced MDSC numbers but increased T cell numbers in LLC-bearing lungs treated with S100A8 at midpoint of survival (Sections 3.3.4.2 and 3.3.4.3), lower IL-12β levels may favour IL-

12-mediated immune responses. S100A8 also suppressed IL-12β in control mice, to levels seen in LLC-bearing lungs, although numbers of T cell populations were similar to controls, suggesting that the regulation of IL-12 levels by S100A8 unlikely provoked excessive immune responses in healthy lungs.

Although MDSC depletion using an anti-GR-1 antibody markedly enhances anti-tumour immunity in lungs with orthotopic LLC tumours, numbers of tumour-infiltrating MDSC only reduce to one-third of those seen in isotype control and tumour burden is not totally suppressed (~10% of isotype control) [492]. Given that MDSC accumulation promotes lung tumour progression [207, 367, 491-497], this observation suggests that MDSC

270

accumulation and function are regulated independently, although more studies are required to test this possibility. MDSC mediate immunosuppression by ROS and NO production (reviewed in [431, 582]). ROS and NO in MDSC form peroxynitrite that causes nitration of T cell receptors, which interferes with T cell binding to receptors, thereby inhibiting cytotoxic activity [583, 584] and promoting T cell apoptosis [585].

PMN-MDSC preferentially use ROS to suppress anti-tumour immunity, whereas M-

MDSC preferentially use NO via arginase and iNOS induction [431].

The Cys residue in S100A8 facilitates ROS scavenging by forming disulphide-bonded complexes [50, 51], and S-nitrosylation of S100A8 at this Cys residue forms relatively stable adducts that can transnitrosylate haemoglobin [964]. These oxidative modifications of S100A8 can regulate various redox signalling pathways and influence function [106].

Remarkably, S100A8 suppressed nitrite production in LLC-bearing mice to control levels at midpoint of survival and induced activities of antioxidants, SOD, TXNR and PRDX

(Sections 4.3.2 and 4.3.4). Collectively, the data suggest that S100A8 may reduce ROS and NO, and hence peroxynitrite, production in lungs from LLC-bearing mice, which may suppress function of both PMN-MDSC and M-MDSC.

5.6 S100A8 may enhance immune function

The elevation of MDSC numbers in peripheral blood is often accompanied by lower numbers of CD4 [496, 502] and CD8 T cells [501, 502] in patients with lung cancer, indicating that MDSC and anti-tumour T cells are negatively associated (reviewed in

[482]). MDSC depletion by intraperitoneal injection of an anti-Gr-1 antibody into mice impairs the growth of orthotopic LLC tumours and increases the numbers and activities of CD8 and NK cells [492]. In mice with pancreatic tumours, S100A8, S100A9 and 271

S100A8/A9 suppress growth by increasing tumour cell lysis mediated by infiltrating NK cells [763]. We reported that S100A8 inhalation increases lymphocyte influx (subtype not defined) into healthy lungs after 6-20 hours [224], suggesting that S100A8 may promote a similar function in lung cancer. However, S100A8 reduced the elevated number of NK cells in lungs from LLC-bearing mice to baseline, and had no effect on spleen (Table 3.3.4.3). Interestingly, tumour-infiltrating NK cells have been associated with progression of orthotopic LLC, and these NK cells lack the maturation markers,

CD11b and CD27 [515]. Similarly, in patients with lung cancer, higher number of tumour-infiltrating CD11b-/CD27- NK cells predicts more advanced NSCLC [515].

Because these tumour-infiltrating NK cells have impaired tumourcidal activity [515], they may contribute to an immunosuppressive microenvironment. S100A8 may have delayed LLC progression by reducing infiltration of CD11b-/CD27- NK cells, although validation of this phenotype and assessment of function are needed to test this possibility.

In keeping with the reduction of MDSC numbers, S100A8 increased the numbers of total,

CD4 and NK-T cells in lungs and spleen from LLC-bearing mice at midpoint of survival, whereas the numbers of CD8 and Treg T cells remained unchanged (Sections 3.3.4.2 and

3.3.4.3). IL-2 is a cytokine that generally expands T cells [604] and some NK cell populations [609], and its increase in mRNA expression by S100A8 at midpoint of survival (~3.6-fold) may reflect the increases in T cell numbers and populations.

Unexpectedly, we identified a double-negative T (DNT) cell population that profoundly increased in lungs and spleen (15.3 % and 3.5 % respectively) from LLC-bearing mice treated with S100A8. We speculate that this was an NK 1.1- NK-T cell population, because NK 1.1 is not exclusively expressed on all NK-T cells in which expression is dependent on the NK-gene complex haplotype [892]. Further characterisation of these 272

cells is warranted to assess their capacity to kill tumour cells, and other properties in the context of tumour growth.

S100A8 induces high IL-10 expression in healthy airway epithelial cells and secretion into BALF 12 hours after inhalation, but these reduced to control levels after 20 hours

[224]. Here we found that S100A8 also increased IL-10 levels in BALF in mice with early

LLC tumours, but did not induce IL-10 expression in airway epithelial cells (Section

4.3.1.2), suggesting that IL-10 was secreted at this time point. Interestingly, IL-10 mRNA was markedly upregulated by ~100-fold in all treatment groups at midpoint of survival, but only LLC-bearing mice had apparent IL-10 immunoreactivity in airway epithelial cells, and levels in BALF were not affected. IL-10 has dual roles in cancer, in which it can promote MDSC activation [540], or expansion and activities of CD8 and NK cells

[537-539]. The increased IL-10 expression in airway epithelial cells of LLC-bearing mice at midpoint of survival may contribute to MDSC activation. Importantly, S100A8 increased IL-10 expression in airway epithelial cells and tumours, and/or levels in BALF, in LLC-bearing mice at endpoint of survival. LLC-bearing mice treated with S100A8 survived up to 40% longer than control, and consistent with a clinical study in which IL-

10 expression in tumours positively correlates with survival in patients with NSCLC

[969], IL-10 induction by S100A8 may be protective. Notably, IL-10 has also been associated with poor survival in patients with NSCLC [970], and the role of IL-10 in this context may be clarified by testing this system in IL-10-/- mice.

ICAM-1 is a transmembrane leukocyte adhesion molecule receptor commonly expressed on lung epithelial cells [907], and mRNA expression can be induced by IFN-γ [908]. We

273 reported concomitant ICAM-1 mRNA upregulation in lungs and neutrophil infiltration in

LPS-induced acute lung injury, and S100A8 suppressed these to baseline [224], suggesting that in addition to reducing chemokine production [224], S100A8 may influence neutrophil infiltration by downregulating ICAM-1 mRNA expression. ICAM-1 is expressed on alveolar epithelial cells in lung cancer tissues, but correlation to clinical outcomes is unclear [910]. Upregulation of ICAM-1 on lung tumour cells facilitates tumour cell lysis by lymphokine-activated killer cells (such as NK and NK-T cells [971]) in co-culture in vitro [610], linking to ICAM-1-mediated adhesion and activation of NK cells [972]. Although no obvious ICAM-1 expression was detected on tumours, S100A8 induced ICAM-1 on alveolar epithelial cells in lungs at midpoint of survival (Section

4.3.1.2). However, the absence of increased neutrophil influx into LLC-bearing lungs treated with S100A8 (Section 3.3.4.1) suggests that ICAM-1 upregulation in this context may affect NK-T cell function, by increasing NK-T cell adhesion and localisation [909], although adhesion assay would be required to test this possibility. LLC is thought to be an alveolar carcinoma [863], and increased NK-T cell adhesion to alveolar epithelial cells may facilitate tumour cell lysis. Collectively, S100A8 may moderate the redox and immune microenvironment in lungs from LLC-bearing mice, thereby delaying tumour progression.

5.7 S100A8 delayed but did not inhibit tumour growth

Increases in inflammation and oxidative stress may be key contributors to the pathogenesis of some lung cancer subtypes [365, 366], suggesting that the anti- inflammatory and antioxidative properties of S100A8 may influence tumour progression.

Functional studies have reported that S100A8 promotes lung tumour growth in vivo,

MDSC recruitment and metastasis [497, 771, 797, 815]. Unlike the functional roles of

274

S100A9, those of S100A8 in lung cancer cannot be validated using knockout mice because its gene deletion is embryonic lethal [227]. In addition, the effects of S100A8 on the local lung microenvironment during tumour progression are unknown, since lung cancer cells (LLC) have generally been implanted subcutaneously or administered intravenously. In this study, we could not detect S100A8 protein expression in LLC cells, regardless of intranasal S100A8 treatment (Figure 3.3.4.1.2 and Appendix IV), so implanting LLC cells in which S100A8 expression has been silenced [797], or neutralised by an intravenous antibody [497, 771, 815], was not an appropriate method for identifying its potential functions within the lung microenvironment.

We administered S100A8 by inhalation, using a dose shown to be effective in previous studies (10 μg) [224, 352], and compared effects in lungs from mice with, or without orthotopic LLC tumours. Mice receiving S100A8 and LLC co-treatment developed fewer tumours at mid and endpoint of survival (Section 3.3.2.2). In contrast, there were no obvious changes to tumour size at either time point when S100A8 treatment commenced after mice developed tumours, although survival was prolonged from 19 to 27 or 28 days

(up to 40%) (Section 3.3.2.3), which suggests that S100A8 may have delayed tumour growth, but did not prevent it. Consistent with a previous study [797], we found that

S100A8 had no obvious effects on proliferation of lung cancer cells in vitro (Section

3.3.1.2). S100A8 also had no profound effects on tumour-modulating genes that are aberrantly expressed in LLC cells in vitro (Section 3.3.1.1), suggesting it is unlikely that

S100A8 prolonged survival by promoting direct tumour cell cytotoxicity.

275

5.8 S100A8 may reduce the metastatic and angiogenic potentials of growing LLC tumours

MDSC are recruited to sites of secondary tumours by interactions of particular chemokines with their receptors to promote metastasis (reviewed in [973]). Interestingly,

MDSC accumulate in the liver and to similar extents in the spleen of mice in several primary tumours [974], including LLC, suggesting the possible involvement of MDSC in liver metastasis. However, orthotopic LLC tumours are reported to only metastasise to regional lymph nodes towards the endpoint of survival [853], but not to more distant organs. S100A8 is reported to promote invasion and migration of LLC cells in vitro, or in subcutaneous or intravenous-injected LLC mouse models [771, 797, 815], which may contribute to establishing a metastatic niche in lungs by increasing MDSC recruitment

[497, 815]. Surprisingly, we found that LLC-bearing mice receiving one S100A8, or three

S100A8 treatments (intermittent treatment), developed liver tumours at endpoint of survival, but not when S100A8 treatment occurred every third day (continuous treatment) until moribund, indicating that S100A8 has dual roles in metastasis. S100A8 may have possibly increased the metastatic potential of LLC cells when given intermittently to the lungs, which favoured extra-pulmonary tumour growth in the liver. Because more than

60% of a dose of an inhaled therapeutic drug reaches systemic circulation [975], S100A8, when administered every third day to the lungs, may delay liver tumour growth by systemic effects. The mechanisms through which continuous S100A8 treatment delayed extra-pulmonary liver tumour growth may be similar to those identified in the lungs

(Sections 5.2-5.7), although more investigation is warranted.

It is reported that the high induction of SAA3 mRNA and protein secretion from pre- metastatic lungs may be mediated by S100A8, thereby increasing MDSC recruitment

276

[497]. SAA3 can also promote MDSC expansion and activation [572], although it is unclear if S100A8 contributes to these functions. However, SAA3 mRNA expression was similar to control in lungs from S100A8 and/or LLC-treated mice at early and midpoints of survival (Section 4.3.1.1). Although S100A8 does not induce SAA3 mRNA expression in the liver, it increases promoter activity and transcription of SAA3 mRNA in the bone marrow [572]. Although assessment of S100A8 inhalation on SAA3 mRNA expression in the bone marrow to promote MDSC function is required to clarify any tissue-specific effects, S100A8 indeed did not alter the high numbers of MDSC in bone marrow from

LLC-bearing mice (Section 3.3.4.2). Cessation of S100A8 treatments from day 1, or day

10 onwards in our model likely allowed MDSC recruitment and accumulation to be resumed, particularly in the liver, to promote extra-pulmonary tumour growth. Sustained

S100A8 treatment possibly maintained the low MDSC numbers in lungs and spleen and contributed to a lack of metastatic activity in LLC tumours. Moreover, S100A8 may have suppressed MDSC accumulation in the liver to delay tumour growth, although more investigation is warranted.

MMP induction is a key mechanism for metastasis, because MMP mediate ECM degradation and promote tumour cell invasion and migration [632, 633]. Studies in other systems have linked S100A8 and MMP induction with increased invasion, migration and metastasis [797, 816] (also for S100A8/A9; refer to Table 1.3.3.2). We found that S100A8 promoted early induction of MMP-3 (~3-fold), MMP-9 (~5-7-fold) and MMP-13 (~4-7- fold) mRNA expression in control or LLC-bearing mice (Section 4.3.5). Although these may contribute to invasion and metastasis [632, 633, 797], S100A8 concomitantly induced genes that may reduce MMP activity (Cadm1 [941]) and reduce metastasis (Cdh1

[942]), which may be protective. Importantly, S100A8 markedly suppressed the early

277 induction of MMP-10 mRNA expression (~37-fold decrease) in lungs from LLC-bearing mice. MMP-10 maintains cancer stem cells and promotes lung cancer initiation [392,

937]. While this suggests that S100A8 may delay the initiation of tumour growth, measuring oncosphere formation (an indicator of tumour initiation) is required to test this possibility [392, 937].

Importantly, MMP activities may be influenced by S-nitrosylation. NO may contribute to

MMP-2 and MMP-9 activation to facilitate migration and invasion of lung cancer cells in vitro [649, 651]. NO scavenging by haemoglobin abrogates adhesion of circulating cancer cells to endothelial cells and prevents metastasis [621]. The possibility that

S100A8-SNO may shuttle NO to haemoglobin [110] to modulate metastasis by altering

MMP activity and cancer cell adhesion to the vasculature is intriguing, and worthy of further investigation by the biotin-switch assay (assay to measure protein S-nitrosylation)

[110]. Additional studies are also required to measure MMP and TIMP protein expression, and activities by zymography and reverse zymography respectively [976].

MMP induction by S100A8 may influence cell types other than tumour cells and have other functions in the lungs. S100A8 and S100A8/A9 induce MMP-2, 3, 9 and 13 mRNA in murine bone marrow-derived macrophages and may promote their migration to mediate cartilage destruction in joint inflammation [322]. We also reported that S100A8 inhalation induces MMP-9 mRNA expression in healthy lungs after 1 hour (~3-fold) and

MMP-13 after 6 hours (~6-fold), and MMP-13 in LPS-challenged lungs after 4 hours (~5- fold) [224]. The lung is constantly challenged by harmful inhaled particles or pathogens that cause epithelial injury, and repair of the lung epithelium is essential for maintaining

278

homeostasis [977]. MMP-9 is reported to facilitate the repair of human bronchial epithelial cells [978] and their migration [979] in vitro. Similarly, MMP-13 contributes to the repair of the human and rat alveolar epithelial cells by decreasing adhesion but increasing migration of type 1 collagen following mechanical injury [980]. On the other hand, the role of MMP-3 in airway epithelium cells is unclear. MMP-3 is reported to facilitate wound healing by promoting epithelial regeneration [981], which suggests that it may repair injured airway epithelia. S100A8/A9 may promote wound healing by interaction with keratin intermediate filaments [283], suggesting that MMP mRNA induction by S100A8 may facilitate the repair of lung epithelium and protect against inflammation and tumour growth. Clarification of the cell types producing MMP, and

MMP activities, in response to S100A8, is required.

MDSC can promote angiogenesis (reviewed in [585]), a process of new vessel growth that contributes to primary tumour growth and metastasis by providing the vascular transport of nutrients and oxygen required for proliferation [400]. Both S100A8 and

S100A8/A9 are reported to promote neovascularisation in mice transplanted with

Matrigel plugs [635, 829], but more detailed analysis has not been performed to determine their functions in cancer. We used a lymphatic endothelial marker, LYVE-1, to quantify vessel numbers in lungs, because it can detect both lymphatic and blood vessels, and our

CD31 marker failed to detect any blood vessels. The majority of LYVE-1+ vessels in lungs were likely blood vessels, since lymphatic vessels induced by LLC tumours are found within 1 mm of the tumour margin, and tumour-free mice have limited lymphatic supply (~20% of tumour-bearing mice) [982]. HIF are important inducer of key pro- angiogenic molecules [402, 403] (Section 1.2.1.2); S100A8 induced particular HIF mRNA in lungs from control mice at both time points (Section 4.3.6), suggesting that it

279 may contribute to a hypoxic microenvironment. The ~8-fold induction of HIF-2α mRNA expression in lungs from LLC-bearing mice may contribute to the early increase in vessel numbers (Section 3.3.3.2). Although S100A8 suppressed this early induction of HIF-2α mRNA expression in lungs from LLC-bearing mice (~2-fold decrease), vessel numbers were similar in both groups of LLC-bearing mice.

At midpoint of survival, S100A8 reduced high induction of some genes that promote hypoxia and angiogenesis (HIF-1α, HIF-2α, VEGF-α and ALOX12) (Section 4.3.6), which, coupled with reduced MDSC numbers in lungs from LLC-bearing mice (Section

3.3.4.2), suggests that S100A8 may reduce vasculature in lungs to delay pulmonary and extra-pulmonary tumour growth. However, quantitation failed to indicate changes following S100A8 inhalation (Section 3.3.3.2), and this disparity, which may be explained by the tendency of the nutrient supply to lung tumours to occur via enlargement of bronchial vessels [893, 894], suggests the inadequacy of quantifying vessel numbers in lungs to assess angiogenesis. However, vessel size could not be reliably assessed on histology sections because smooth muscles within pulmonary vessels shrink ex vivo, which changes vessel sizes [983]. An increase in angiogenesis is often accompanied by an increase in blood flow. In mice with orthotopic LLC tumours, blood flow into lungs increases, compared to healthy mice, and correlates positively with tumour growth over a week [895]. Further studies should investigate whether S100A8 alters blood flow to

LLC-bearing lungs. It was also unexpected that there was no obvious infiltration of vessels into tumours in any of the samples, because tumours require vasculature to supply nutrients and oxygen for growth [400]. A previous study identified three types of blood vessels in vascular corrosion casts within subcutaneous LLC tumours using scanning electron microscopy [984], and this method, or other imaging techniques which use 280

fluorescent markers should be employed to examine the effects of S100A8 on the vasculature within tumours.

5.9 Implications of this study

We reported that S100A8 prolonged survival in mice with lung cancer in part through mechanisms similar to attenuation of acute lung injury, suggesting that S100A8 may reduce tumour-promoting inflammation. S100A8 reduced lung tumour growth when administered just prior to LLC injection; in a clinical setting, S100A8 may delay the onset of lung cancer in patients with a high predisposition, such as those with COPD. Patients with COPD are twice as likely to develop lung cancer than healthy controls [365], and

30% of patients with mild to moderate COPD develop lung cancer and die [366]. In addition, lung cancer relapses in up to half of the patients after curative resection, and causes mortality [985]. S100A8 may, by contributing to a protective lung microenvironment, delay rapid relapse after surgical resection.

S100A8 did not inhibit, but delayed the growth of established lung tumours, suggesting that it would not, on its own, represent an effective curative treatment for lung cancer.

However, S100A8 may represent a new immunotherapeutic option for restoring anti- tumour immunity and prolonging survival when combined with other treatments.

Immunotherapies, such as cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) and programmed death-ligand 1 (PD-L1) inhibitors, restore T cell activation and hence anti- tumour immunity (reviewed in [665, 666]). Patients with advanced NSCLC treated with one immunotherapy (without other standard treatments), compared to conventional therapy alone, have doubled response and survival rates [665]. S100A8 may be used in combination with other immunotherapies or conventional therapies to improve clinical 281 outcomes. Immunotherapy combined with chemotherapy has satisfactory response rates and is well-tolerated by patients with NSCLC [986]. In addition, administration of an oxygen scavenger that mimics SOD with gemcitabine (a chemotherapeutic drug) synergistically reduces MDSC numbers and enhances CD8 T cell responses in mice with lung cancer [514]. S100A8 is an oxidant-scavenger [987], although we found no evidence that its effects were direct in the study reported here. We did, however, show that S100A8 induced SOD activity in LLC-bearing lungs (Section 4.3.4.1), and which when combined with chemotherapy may enhance its efficacy. More detailed analysis of the mechanisms of action, and identification of putative S100A8 receptors, would facilitate strategies for clinical use.

Delivering therapeutic agents by inhalation is more favourable than oral delivery because specificity is higher and a lower dose is needed, which reduces systemic adverse effects

[975]. In addition, the large surface areas of the lungs and their high epithelial permeability for effective gaseous exchange are favourable properties for rapid absorption of inhaled therapeutics [988]. Furthermore, drug-metabolising enzymes are substantially lower in lungs than the gastrointestinal tract or liver, and inhaled therapeutics may be degraded to a lesser extent than oral counterparts [989-991].

Symptoms of some lung diseases, such as asthma and COPD, have a rapid onset and inhaled therapeutics are suitable for providing immediate relief [992]. Lung cancer, like other lung diseases, can potentially be treated with inhalation therapy. While there are no clinically-available inhaled therapeutics for lung cancer, pre-clinical studies in mice show promising results. For example, delivery of immunomodulatory agents (TLR9/TLR3 agonists) by inhalation effectively promotes an immunoprotective microenvironment in lungs to prevent metastasis of murine B16 melanoma in vivo [993]. Interestingly, S100A8 282

is highly induced in macrophages by these agonists [23, 231], and may contribute to these effects. Importantly, adding an anti-MDSC antibody (RB6-8C5) to the TLR agonist- inhalant has synergistic anti-tumour effects [993]. Our previous determination that delivering S100A8 by inhalation is an effective anti-inflammatory agent [224, 352], has been reinforced in this study. S100A8 may, in part, act as an MDSC-depleting agent, and its inhalation with other immunotherapies may increase anti-tumour efficacy.

One of the biggest challenges of inhalation therapy is to sustain high therapeutic drug concentrations in the lungs because of susceptibility to rapid clearance [992]. Non-viral nanoparticles can act as delivery vehicles for inhaled therapeutic drugs [994] and could be used to package S100A8 to enhance its retention within the lungs. Indeed, nanoparticles have been used to package doxorubicin (a chemotherapeutic drug), and enhance its tumour penetration and retention in mice with lung cancer [995]. Another strategy for improving the retention time of therapeutic drugs in a solid tumour microenvironment is via chemical conjugation with polyethyleneglycol (PEG), a biologically and immunologically inactive polymer with no toxicity [996, 997].

Pegylation can delay drug clearance and prolong half-life to sustain therapeutic effects

[997]. Pegylation of the S100A8/A9 complex has already been demonstrated to increase its structural stability and may make it less prone to degradation in vivo [997]. Future studies will determine whether S100A8 encapsulated in a nanoparticle or conjugated to

PEG enhances its retention following inhalation in the lungs of mice with LLC tumours.

283

5.10 Limitations and future directions

This section focuses on the major limitations and future direction of this study; other potential work has, where appropriate, been discussed in Sections 5.2-5.9. This study was performed using one well-established lung cancer cell line (LLC) to assess the effects of

S100A8 on lung tumour growth. However, given that lung cancer is a heterogeneous disease, the effects of S100A8 inhalation should be investigated using other lung cancer cell lines. For example, CMT167 is a highly metastatic murine lung cancer cell line that, like LLC, harbours KRAS mutation, and orthotopic tumours can fully develop within four weeks in C57BL/6J mice [864]. Mice with orthotopic CMT167 tumours and treated with intranasal S100A8 using protocols from this study will ascertain the mediation of similar effects by S100A8 over a time course. In addition, lung cancer cells taken from some of the common lung cancer transgenic mouse models could also be orthotopically implanted into mouse lungs to assess the effects of local S100A8 administration. Smoking is a well- known predominant risk factor for COPD and lung cancer [364], and 90% of lung cancer cases are smoking-related [998]. Taken together with the attenuation of acute lung injury and asthma [224, 352] and the protective effects reported in this study, S100A8 may delay the onset of lung cancer. Induction of lung tumours in mice by tobacco smoke (as described in [821]) would elucidate the effects of S100A8 on inflammation-associated lung cancer.

The prevention of extra-pulmonary tumour growth in the liver, when S100A8 was administered every third day, as opposed to only once or three times, indicated possible systemic effects. Notably, it has been reported that more than 60% of a dose of an inhaled therapeutic drug reaches the gastrointestinal tract and hence, systemic circulation [975], and that high doses of inhaled corticosteroids exhibit systemic adverse effects, although 284

less severely than oral corticosteroids [999]. S100A8 may be effective in delaying the growth of both primary and metastatic tumours when administered locally at higher doses or intravenously. Importantly, S100A8 was administered intranasally to LLC-bearing mice only at a dosage effective in attenuating acute lung injury (10 μg) [224], but effects at other doses are unclear, and need to be tested. Although S100A8 (10 μg) treatment was well-tolerated by healthy mice and caused no significant effects, S100A8 may have some side effects at higher doses. S100A8/A9 is reported to expand autoreactive CD8 T cells in skin lesions of mice with lupus erythematosus [772], and S100A8 alone is reported to increase cytotoxic activities of CD8 and NK cells in peripheral blood from patients with lichen planus (an autoimmune disorder) [851], suggesting that S100A8 could overstimulate the immune system at higher doses. The dose of S100A8 that restores anti- tumour immunity without promoting excessive immunostimulatory effects needs to be carefully evaluated.

It is evident that S100A8 suppressed recruitment of neutrophilic cell types involved in tumour progression (Figure 3.3.4.2 and Table 3.3.4.1.1). However, because PMN-MDSC share a similar phenotype with neutrophils [1000], S100A8 may have affected one or both cell types in LLC-bearing mice. PMN-MDSC and neutrophils may be distinguished by some surface and intracellular markers [1000]. For example, neutrophils do not normally express the CD115 and CD244 markers found on PMN-MDSC surface [1001].

Importantly, Gabrilovich’s laboratory has determined that neutrophils, but not PMN-

MDSC, tend to express RB1 (retinoblastoma protein) intracellularly [506], and that neutrophils have higher density than PMN-MDSC [1002]. Further studies will explore these parameters to characterise the cell types affected by S100A8.

285

The changes in DNT cells identified in lungs and spleen followed similar trends to those of NK-T cells (Section 3.3.4.3), and we speculate that it was an NK-T cell population without surface expression of NK 1.1 [892]. Characterisation of this DNT cell population using other markers is warranted and could include the NK restriction marker, CD1d [892,

1003], and the maturation markers, CD11b and CD27 [515]. Although increased in NK-

T cell numbers and induction of IL-10 and ICAM-1 in lungs from LLC-bearing mice

(Section 4.3.1.2) by S100A8 support the possibility of increased NK-T cell killing, tumour-infiltrating NK cells found in patients and mice with lung cancer sometimes lack a mature phenotype (CD11b+, CD27+) that produces IFN-γ to stimulate effective killing

[515], and NK-T and DNT cell killing in tumour-bearing mice by S100A8 requires validation. However, numbers of NK-T cell in lungs isolated by us were insufficient (<

0.4 x 104 in lungs and < 2 x 104 in spleen) for the standard cell killing assays using calcein- labelling method [1004]. NK-T cell killing may be measured indirectly by IFN-γ, granzyme, perforin release from NK-T cells [510, 511, 967], or other cytotoxicity assays as described in the literature [1003, 1005].

Most of the mediators that markedly affected by S100A8 and/or tumours were found to express in epithelial cells: catalase, TXN, PRDX1 (Section 4.3.4), and IL-10 were expressed in airway epithelial cells, and ICAM-1 was expressed on alveolar epithelial cells (Section 4.3.1.2). Results suggested that S100A8 may mediate protective effects by acting principally on epithelial cells. Further studies will need to examine the effects of

S100A8 on primary lung epithelial cells (available commercially in CellBiologics), and whether those effects influence tumour cell proliferation, using a co-culture system in vitro. These investigations could provide more insight into mechanisms. Moreover, these epithelial cells may represent an appropriate source for endeavours to clarify the nature

286

of the putative S100A8 receptors. Identification of the receptor and its interaction with

S100A8 would be key to any future analyses.

Although some studies suggest that S100A8 and S100A9 co-expression and complex formation are essential for their stability [316, 317], S100A8, S100A9 and S100A8/A9 can function independently, and have distinct intracellular and extracellular functions

(Sections 1.1.6 and 1.1.7). Indeed, we reported that S100A8, S100A9 and S100A8/A9 attenuated LPS-provoked acute lung injury, in part, by different mechanisms [223, 224], which indicates that they have different roles in inflammation. Importantly, S100A8 has more potent anti-inflammatory and antioxidative effects than either S100A9 or

S100A8/A9 in acute lung injury, due to its more reactive Cys residue [223, 224]. Similar to S100A8, the majority of studies have indicated that S100A9 and S100A8/A9 promoted the progression of a number of cancers, including lung cancer [797, 815, 821], in vivo

(Section 1.3.4.1), but they increased NK cell numbers and activity in mice with subcutaneous pancreatic or colon cancer [763]. Importantly, since lung tumours in mice were implanted subcutaneously or intravenously in these studies, the effects of S100A9 and S100A8/A9 on the lung microenvironment are unknown. Further studies will examine how intranasal S100A9 and S100A8/A9 affect the progression of orthotopic lung tumours, and whether they have functions independent of S100A8.

287

5.11 Conclusions

Intranasal administration of S100A8 to the lungs prolonged survival of mice with growing lung tumours by up to 40%, possibly by promoting an unfavourable microenvironment for tumour progression rather than direct tumour cell lysis. In lungs with early growing tumours, S100A8 induced TXNR activity and IL-10 secretion, which may reduce oxidative stress and inflammation within the lung microenvironment. S100A8 concomitantly suppressed the high MMP-10 gene induction, which may delay the initiation of tumour growth (Figure 5.11.1). S100A8 also induced high mRNA expression of L-arginine cationic transporter 2 (CAT2) and slightly increased arginase activity, which may contribute to delayed tumour progression by altering L-arginine availability, an essential amino acid for LLC growth.

Figure 5.11.1: Diagrammatic summary of early anti-tumourigenic effects of S100A8 on the lung microenvironment. MMP-10 induction promotes initiation of tumour growth, and increases in inflammation and reactive oxygens species (ROS) within the lung microenvironment facilitate tumour progression. S100A8 increased IL-10 secretion and induced thioredoxin reductase (TXNR) activity, which may reduce inflammation and ROS production within the lung microenvironment. Suppression of MMP-10 expression by S100A8 may delay initiation of tumour growth. Effects of S100A8 are indicated by red arrows; proposed effects of S100A8 are indicated by blue arrows.

288

At midpoint of survival, S100A8 significantly suppressed key cytokines that promote

MDSC expansion and activation, which may have contributed to the reduced MDSC accumulation seen in lungs and spleen. S100A8 concomitantly suppressed nitrite levels and CAT2 mRNA expression, although arginase protein and activity were not affected, and induced activities of some antioxidants, which may indicate lower L-arginine availability and oxidant production within the lung microenvironment. Results suggest that S100A8 may reduce ROS and NO production within the lung microenvironment, which may protect against MDSC-mediated immunosuppression and allow T cell- mediated surveillance. Importantly, S100A8 also increased CD4 and NK-T cell numbers in lungs and spleen. The concomitant ICAM-1 induction on alveolar epithelial cells

(Figure 5.11.2) suggests that S100A8 may promote a microenvironment conducive to

NK-T cell function.

The endpoint induction of IL-10 secretion and/or expression in airway epithelial and tumour cells by S100A8 was positively associated with increased mouse survival (19 to

27 or 28 days; up to 40%). IL-10 induction by S100A8 may be favourable for NK-T cell function, which may contribute to delayed tumour progression (Figure 5.11.2).

Interestingly, intermittent S100A8 treatment(s) (single treatment on day 0 or repeated treatments occurring on days 3, 6 and 9 post LLC implantation) resulted in the appearance of tumours in the liver, but continuous intranasal S100A8 treatments occurring every third day prevented this, suggesting that the concentrations of S100A8 in the lung microenvironment are critical, not only for delaying lung tumour growth, but also its metastatic potential.

289

Figure 5.11.2: Diagrammatic summary of the anti-tumourigenic effects of S100A8 at mid- and endpoints of survival. MDSC are expanded, activated and recruited to tumours by immunomodulatory cytokines, including IL-1β, IL-4, IL-6, IL-12β and IFN-γ, to promote immunosuppression and tumour growth. S100A8 suppressed the production of these cytokines and MDSC infiltration, induced antioxidants (SOD, TXNR and PRDX), suppressed nitrite production, increased CD4 and NK-T cell recruitment, and induced ICAM-1 in alveolar epithelial cells at midpoint of survival. S100A8 induced IL-10 in airway epithelial and tumour cells at endpoint of survival. Taken together, S100A8 reduced cytokines relevant to MDSC recruitment and function, and may reduce ROS and NO production within the lung microenvironment. This may reduce MDSC-mediated immunosuppression and enhance T cell function. Effects of S100A8 are indicated by red arrows; proposed effects of S100A8 are indicated by blue arrows.

290

Notably, S100A8 had little effect on lungs from control mice, except for marked induction of mRNA expression of some antioxidants, arginase and CAT2, but protein and/or activity was unaffected. Although effects need to be examined at more time points and doses, these preliminary data suggest that S100A8 may be a well-tolerated treatment. Further work aims to determine the dose-response effects of intranasal or intravenous S100A8 on lung cancer progression using other mouse models, validate MMP gene induction/suppression by measuring protein and activity and determine the cell types affected, assess angiogenesis in terms of blood flow or using electron microscopy, determine effects of S100A8 on lung epithelial cells, characterise the neutrophilic and

DNT cell population in lungs and spleen, and validate an increase in NK-T cell killing by

S100A8. The functions of S100A9 and S100A8/A9 in orthotopic lung tumours will also be studied. Conjointly, S100A8 may represent a novel immunotherapeutic agent for use in lung cancer, and its local administration combined with chemotherapy or other immunotherapies could enhance treatment outcomes.

291

References

1. Donato, R (1999). Functional roles of S100 proteins, calcium-binding proteins of the EF- hand type. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1450(3):191- 231. 2. Ravasi, T, Hsu, K, Goyette, J, et al. (2004). Probing the S100 protein family through genomic and functional analysis. Genomics 84(1):10-22. 3. Santamaria-Kisiel, L, Rintala-Dempsey, AC, and Shaw, GS (2006). Calcium-dependent and -independent interactions of the S100 protein family. Biochemical Journal 396(2):201-214. 4. Moore, BW (1965). A soluble protein characteristic of the nervous system. Biochemical and Biophysical Research Communications 19(6):739-744. 5. Zimmer, DB, Cornwall, EH, Landar, A, et al. (1995). The S100 protein family: History, function, and expression. Brain Research Bulletin 37(4):417-429. 6. Donato, R (2001). S100: a multigenic family of calcium-modulated proteins of the EF- hand type with intracellular and extracellular functional roles. International Journal of Biochemistry & Cell Biology 33(7):637-668. 7. Marenholz, I, Lovering, RC, and Heizmann, CW (2006). An update of the S100 nomenclature. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1763(11):1282-1283. 8. Marenholz, I, Heizmann, CW, and Fritz, G (2004). S100 proteins in mouse and man: from evolution to function and pathology (including an update of the nomenclature). Biochemical and Biophysical Research Communications 322(4):1111-1122. 9. Schäfer, BW, Wicki, R, Engelkamp, D, et al. (1995). Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics 25(3):638-643. 10. Kulski, JK, Lim, CP, Dunn, DS, et al. (2003). Genomic and phylogenetic analysis of the S100A7 (Psoriasin) gene duplications within the region of the S100 gene cluster on human chromosome 1q21. Journal of Molecular Evolution 56(4):397-406. 11. Odink, K, Cerletti, N, Bruggen, J, et al. (1987). Two calcium-binding proteins in infiltrate macrophages of rheumatoid arthritis. Nature 330(6143):80-82. 12. Dale, I, Fagerhol, MK, and Naesgaard, I (1983). Purification and partial characterization of a highly immunogenic human leukocyte protein, the L1 antigen. European Journal of Biochemistry 134(1):1-6. 13. Lim, SY, Raftery, MJ, and Geczy, CL (2011). Oxidative modifications of DAMPs suppress inflammation: the case for S100A8 and S100A9. Antioxidants & Redox Signalling 15(8):2235-2248. 14. Heizmann, CW, Fritz, G, and Schafer, B (2002). S100 proteins: structure, functions and pathology. Frontiers in Bioscience 7(1):1356-1368. 15. Zimmer, DB, Eubanks, JO, Ramakrishnan, D, et al. (2013). Evolution of the S100 family of calcium sensor proteins. Cell Calcium 53(3):170-179. 16. Kerkhoff, C, Klempt, M, and Sorg, C (1998). Novel insights into structure and function of MRP8 (S100A8) and MRP14 (S100A9). Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1448(2):200-211. 17. Engelkamp, D, Schäfer, BW, Mattei, MG, et al. (1993). Six S100 genes are clustered on human chromosome 1q21: identification of two genes coding for the two previously unreported calcium-binding proteins S100D and S100E. Proceedings of the National Academy of Sciences of the United States of America 90(14):6547-6551. 18. Albertazzi, E, Cajone, F, and Sherbet, GV (1998). Characterization of a splice variant of metastasis-associated h-mtsl (S100A4) gene expressed in human infiltrating carcinomas of the breast. DNA and Cell Biology 17(12):1003-1008. 19. Schäfer, BW, Fritschy, J-M, Murmann, P, et al. (2000). Brain S100A5 is a novel calcium-, zinc-, and copper ion-binding protein of the EF-hand superfamily. Journal of Biological Chemistry 275(39):30623-30630. 292

20. Pietas, A, Schlüns, K, Marenholz, I, et al. (2002). Molecular cloning and characterization of the human S100A14 gene encoding a novel member of the S100 family. Genomics 79(4):513-522. 21. Nakamura, T, Hayashi, M, Kato, A, et al. (1998). A unique exon–intron organization of a porcine S100C gene: close evolutionary relationship to calmodulin genes. Biochemical and Biophysical Research Communications 243(3):647-652. 22. Nacken, W, Lekstrom‐Himes, JA, Sorg, C, et al. (2001). Molecular analysis of the mouse S100A9 gene and evidence that the myeloid specific transcription factor C/EBPepsilon is not required for the regulation of the S100A9/A8 gene expression in neutrophils. Journal of Cellular Biochemistry 80(4):606-616. 23. Endoh, Y, Chung, YM, Clark, IA, et al. (2009). IL-10-dependent S100A8 gene induction in monocytes/macrophages by double-stranded RNA. Journal of Immunology 182(4):2258-2268. 24. Gebhardt, C, Nemeth, J, Angel, P, et al. (2006). S100A8 and S100A9 in inflammation and cancer. Biochemical Pharmacology 72:1622-1631. 25. Passey, RJ, Xu, K, Hume, DA, et al. (1999). S100A8: emerging functions and regulation. Journal of Leukocyte Biology 66(4):549-556. 26. Hsu, K, Champaiboon, C, Guenther, BD, et al. (2009). Anti-infective protective properties of S100 calgranulins. Anti-Inflammatory & Anti-Allergy Agents in Medicinal Chemistry 8(4):290-305. 27. Schäfer, BW and Heizmann, CW (1996). The S100 family of EF-hand calcium-binding proteins: functions and pathology. Trends in Biochemical Sciences 21(4):134-140. 28. Eckert, RL, Broome, AM, Ruse, M, et al. (2004). S100 proteins in the epidermis. Journal of Investigative Dermatology 123(1):23-33. 29. Zimmer, DB, Wright Sadosky, P, and Weber, DJ (2003). Molecular mechanisms of S100- target protein interactions. Microscopy Research and Technique 60(6):552-559. 30. Kligman, D and Hilt, DC (1988). The S100 protein family. Trends in Biochemical Sciences 13(11):437-443. 31. Strynadka, NC and James, MN (1989). Crystal structures of the helix-loop-helix calcium- binding proteins. Annual Review of Biochemistry 58:951-998. 32. Donato, R (2003). Intracellular and extracellular roles of S100 proteins. Microscopy Research and Technique 60(6):540-551. 33. Gilston, BA, Skaar, EP, and Chazin, WJ (2016). Binding of transition metals to S100 proteins. Science China Life Sciences 59(8):792-801. 34. Skelton, NJ, Kordel, J, Akke, M, et al. (1994). Signal transduction versus buffering activity in Ca2+-binding proteins. Nature Structural & Molecular Biology 1(4):239-245. 35. Isobe, T and Okuyama, T (1981). The amino-acid sequence of the alpha subunit in bovine brain S-100a protein. European Journal of Biochemistry 116(1):79-86. 36. Propper, C, Huang, X, Roth, J, et al. (1999). Analysis of the MRP8-MRP14 protein- protein interaction by the two-hybrid system suggests a prominent role of the C-terminal domain of S100 proteins in dimer formation. Journal of Biological Chemistry 274(1):183-188. 37. Hunter, MJ and Chazin, WJ (1998). High level expression and dimer characterization of the S100 EF-hand proteins, migration inhibitory factor-related proteins 8 and 14. Journal of Biological Chemistry 273(20):12427-12435. 38. Deloulme, JC, Assard, N, Mbele, GO, et al. (2000). S100A6 and S100A11 are specific targets of the calcium- and zinc-binding S100B protein in vivo. Journal of Biological Chemistry 275(45):35302-35310. 39. Yang, Q, O'Hanlon, D, Heizmann, CW, et al. (1999). Demonstration of heterodimer formation between S100B and S100A6 in the yeast two-hybrid system and human melanoma. Experimental Cell Research 246(2):501-509. 40. Tarabykina, S, Kriajevska, M, Scott, DJ, et al. (2000). Heterocomplex formation between metastasis-related protein S100A4 (Mts1) and S100A1 as revealed by the yeast two- hybrid system. FEBS Letters 475(3):187-191.

293

41. Wang, G, Rudland, PS, White, MR, et al. (2000). Interaction in vivo and in vitro of the metastasis-inducing S100 protein, S100A4 (p9Ka) with S100A1. Journal of Biological Chemistry 275(15):11141-11146. 42. Isobe, T and Okuyama, T (1978). The amino-acid sequence of S-100 protein (PAP I-b protein) and its relation to the calcium-binding proteins. European Journal of Biochemistry 89(2):379-388. 43. Gribenko, AV, Hopper, JE, and Makhatadze, GI (2001). Molecular characterization and tissue distribution of a novel member of the S100 family of EF-hand proteins. Biochemistry 40(51):15538-15548. 44. Koch, M, Bhattacharya, S, Kehl, T, et al. (2007). Implications on zinc binding to S100A2. Biochimica et Biophysica Acta 1773(3):457-470. 45. Kizawa, K, Takahara, H, Troxler, H, et al. (2008). Specific citrullination causes assembly of a globular S100A3 homotetramer a putative Ca2+ modulator matures human hair cuticle Journal of Biological Chemistry 283(8):5004-5013. 46. Novitskaya, V, Grigorian, M, Kriajevska, M, et al. (2000). Oligomeric forms of the metastasis-related Mts1 (S100A4) protein stimulate neuronal differentiation in cultures of rat hippocampal neurons. Journal of Biological Chemistry 275(52):41278-41286. 47. Sturchler, E, Cox, JA, Durussel, I, et al. (2006). S100A16, a novel calcium-binding protein of the EF-hand superfamily. Journal of Biological Chemistry 281(50):38905- 38917. 48. Ostendorp, T, Leclerc, E, Galichet, A, et al. (2007). Structural and functional insights into RAGE activation by multimeric S100B. EMBO Journal 26(16):3868-3878. 49. Gribenko, AV and Makhatadze, GI (1998). Oligomerization and divalent ion binding properties of the S100P protein: a Ca2+/Mg2+-switch model. Journal of Molecular Biology 283(3):679-694. 50. Raftery, MJ and Geczy, CL (2002). Electrospray low energy CID and MALDI PSD fragmentations of protonated sulfinamide cross-linked peptides. Journal of the American Society for Mass Spectrometry 13(6):709-718. 51. Raftery, MJ, Yang, Z, Valenzuela, SM, et al. (2001). Novel intra- and inter-molecular sulfinamide bonds in S100A8 produced by hypochlorite oxidation. Journal of Biological Chemistry 276(36):33393-33401. 52. McCormick, MM, Rahimi, F, Bobryshev, YV, et al. (2005). S100A8 and S100A9 in human arterial wall: implications for atherogenesis Journal of Biological Chemistry 280(50):41521-41529. 53. Raftery, MJ and Geczy, CL (1998). Identification of noncovalent dimeric complexes of the recombinant murine S100 protein CP10 by electrospray ionization mass spectrometry and chemical cross-linking. Journal of the American Society for Mass Spectrometry 9(5):533-539. 54. Berntzen, HB and Fagerhol, MK (1988). L1, a major granulocyte protein: antigenic properties of its subunits. Scandinavian Journal of Clinical and Laboratory Investigation 48(7):647-652. 55. Teigelkamp, S, Bhardwaj, RS, Roth, J, et al. (1991). Calcium-dependent complex assembly of the myeloic differentiation proteins MRP-8 and MRP-14. Journal of Biological Chemistry 266(20):13462-13467. 56. Strupat, K, Rogniaux, H, Van Dorsselaer, A, et al. (2000). Calcium-induced noncovalently linked tetramers of MRP8 and MRP14 are confirmed by electrospray ionization-mass analysis. Journal of the American Society for Mass Spectrometry 11(9):780-788. 57. Korndörfer, IP, Brueckner, F, and Skerra, A (2007). The crystal structure of the human (S100A8/S100A9)2 heterotetramer, calprotectin, illustrates how conformational changes of interacting α-helices can determine specific association of two EF-hand proteins. Journal of Molecular Biology 370(5):887-898.

294

58. Leukert, N, Vogl, T, Strupat, K, et al. (2006). Calcium-dependent tetramer formation of S100A8 and S100A9 is essential for biological activity. Journal of molecular biology 359(4):961-972. 59. Heizmann, CW (1986). Intracellular Calcium-Binding Proteins: Structure and Possible Functions. Journal of Cardiovascular Pharmacology 8:S7-S12. 60. Bootman, MD, Collins, TJ, Peppiatt, CM, et al. (2001). Calcium signalling—an overview. Seminars in Cell & Developmental Biology 12(1):3-10. 61. Fritz, G, Heizmann, CW, and Kroneck, PM (1998). Probing the structure of the human Ca2+- and Zn2+-binding protein S100A3: spectroscopic investigations of its transition metal ion complexes, and three-dimensional structural model. Biochimica et Biophysica Acta 1448(2):264-276. 62. Donato, R (1986). S-100 proteins. Cell Calcium 7(3):123-145. 63. Ikura, M (1996). Calcium binding and conformational response in EF-hand proteins. Trends in Biochemical Sciences 21(1):14-17. 64. Maler, L, Sastry, M, and Chazin, WJ (2002). A structural basis for S100 protein specificity derived from comparative analysis of apo and Ca(2+)-calcyclin. Journal of Molecular Biology 317(2):279-290. 65. Ishikawa, K, Nakagawa, A, Tanaka, I, et al. (2000). The structure of human MRP8, a member of the S100 calcium-binding protein family, by MAD phasing at 1.9 A resolution. Acta Crystallographica. Section D, Biological Crystallography 56(Pt 5):559-566. 66. Moroz, OV, Antson, AA, Murshudov, GN, et al. (2001). The three-dimensional structure of human S100A12. Acta Crystallographica. Section D, Biological Crystallography 57(Pt 1):20-29. 67. Brodersen, DE, Etzerodt, M, Madsen, P, et al. (1998). EF-hands at atomic resolution: the structure of human psoriasin (S100A7) solved by MAD phasing. Structure 6(4):477-489. 68. Hessian, PA, Wilkinson, L, and Hogg, N (1995). The S100 family protein MRP-14 (S100A9) has homology with the contact domain of high molecular weight kininogen. FEBS Letters 371(3):271-275. 69. Dale, CS, Goncalves, LR, Juliano, L, et al. (2004). The C-terminus of murine S100A9 inhibits hyperalgesia and edema induced by jararhagin. Peptides 25(1):81-89. 70. Dale, CS, Pagano Rde, L, Paccola, CC, et al. (2006). Effect of the C-terminus of murine S100A9 protein on experimental nociception. Peptides 27(11):2794-2802. 71. Dale, CS, Altier, C, Cenac, N, et al. (2009). Analgesic properties of S100A9 C-terminal domain: a mechanism dependent on calcium channel inhibition. Fundamental & Clinical Pharmacology 23(4):427-438. 72. Pagano, RL, Mariano, M, and Giorgi, R (2006). Neutrophilic cell-free exudate induces antinociception mediate by the protein S100A9. Mediators Inflammation 2006(4):36765. 73. Pagano, RL, Sampaio, SC, Juliano, L, et al. (2005). The C-terminus of murine S100A9 inhibits spreading and phagocytic activity of adherent peritoneal cells. Inflammation Research 54(5):204-210. 74. Rety, S, Sopkova, J, Renouard, M, et al. (1999). The crystal structure of a complex of p11 with the annexin II N-terminal peptide. Nature Structural & Molecular Biology 6(1):89-95. 75. Zimmer, DB and Weber, DJ (2010). The calcium-dependent interaction of S100B with its protein targets. Cardiovascular Psychiatry and Neurology 2010(2010):728052. 76. Wright, NT, Prosser, BL, Varney, KM, et al. (2008). S100A1 and calmodulin compete for the same binding site on ryanodine receptor. Journal of Biological Chemistry 283(39):26676-26683. 77. Murray, JI, Tonkin, ML, Whiting, AL, et al. (2012). Structural characterization of S100A15 reveals a novel zinc coordination site among S100 proteins and altered surface chemistry with functional implications for receptor binding. BMC Structural Biology 12(1):16.

295

78. Wolf, R, Howard, OM, Dong, HF, et al. (2008). Chemotactic activity of S100A7 (Psoriasin) is mediated by the receptor for advanced glycation end products and potentiates inflammation with highly homologous but functionally distinct S100A15. Journal of Immunology 181(2):1499-1506. 79. Smith, SP and Shaw, GS (1998). A change-in-hand mechanism for S100 signalling. Biochemistry and Cell Biology 76(2-3):324-333. 80. Clohessy, PA and Golden, BE (1996). His-X-X-X-His motif in S100 protein, calprotectin: relation to microbiostatic activity. Journal of Leukocyte Biology 60(5):674. 81. Kordowska, J, Stafford, WF, and Wang, CL (1998). Ca2+ and Zn2+ bind to different sites and induce different conformational changes in human calcyclin. European Journal of Biochemistry 253(1):57-66. 82. Moroz, OV, Wilson, KS, and Bronstein, IB (2011). The role of zinc in the S100 proteins: insights from the X-ray structures. Amino Acids 41(4):761-772. 83. Dell'Angelica, EC, Schleicher, CH, and Santome, JA (1994). Primary structure and binding properties of calgranulin C, a novel S100-like calcium-binding protein from pig granulocytes. Journal of Biological Chemistry 269(46):28929-28936. 84. Baudier, J, Glasser, N, and Gerard, D (1986). Ions binding to S100 proteins. I. Calcium- and zinc-binding properties of bovine brain S100 alpha alpha, S100a (alpha beta), and S100b (beta beta) protein: Zn2+ regulates Ca2+ binding on S100b protein. Journal of Biological Chemistry 261(18):8192-8203. 85. Baudier, J and Gerard, D (1983). Ions binding to S100 proteins: structural changes induced by calcium and zinc on S100a and S100b proteins. Biochemistry 22(14):3360- 3369. 86. Lin, H, Andersen, GR, and Yatime, L (2016). Crystal structure of human S100A8 in complex with zinc and calcium. BMC Structural Biology 16(1):8. 87. Viemann, D, Barczyk, K, Vogl, T, et al. (2007). MRP8/MRP14 impairs endothelial integrity and induces a caspase-dependent and -independent cell death program. Blood 109(6):2453-2460. 88. Yui, S, Nakatani, Y, Hunter, MJ, et al. (2002). Implication of extracellular zinc exclusion by recombinant human calprotectin (MRP8 and MRP14) from target cells in its apoptosis-inducing activity. Mediators of Inflammation 11(3):165-172. 89. Isaksen, B and Fagerhol, MK (2001). Calprotectin inhibits matrix metalloproteinases by sequestration of zinc. Molecular Pathology 54(5):289-292. 90. Murthy, AR, Lehrer, RI, Harwig, SS, et al. (1993). In vitro candidastatic properties of the human neutrophil calprotectin complex. Journal of Immunology 151(11):6291-6301. 91. Sohnle, PG, Hunter, MJ, Hahn, B, et al. (2000). Zinc-reversible antimicrobial activity of recombinant calprotectin (migration inhibitory factor-related proteins 8 and 14). Journal of Infectious Diseases 182(4):1272-1275. 92. Sroussi, HY, Köhler, GA, Agabian, N, et al. (2009). Substitution of methionine 63 or 83 in S100A9 and cysteine 42 in S100A8 abrogate the antifungal activities of S100A8/A9: potential role for oxidative regulation. FEMS Immunology & Medical Microbiology 55(1):55-61. 93. Steinbakk, M, Naess-Andresen, CF, Lingaas, E, et al. (1990). Antimicrobial actions of calcium binding leucocyte L1 protein, calprotectin. Lancet 336(8718):763-765. 94. Corbin, BD, Seeley, EH, Raab, A, et al. (2008). Metal chelation and inhibition of bacterial growth in tissue abscesses. Science 319(5865):962-965. 95. Champaiboon, C, Sappington, KJ, Guenther, BD, et al. (2009). Calprotectin S100A9 calcium-binding loops I and II are essential for keratinocyte resistance to bacterial invasion. Journal of Biological Chemistry 284(11):7078-7090. 96. Damo, SM, Kehl-Fie, TE, Sugitani, N, et al. (2013). Molecular basis for manganese sequestration by calprotectin and roles in the innate immune response to invading bacterial pathogens. Proceedings of the National Academy of Sciences of the United States of America 110(10):3841-3846.

296

97. Clark, HL, Jhingran, A, Sun, Y, et al. (2016). Zinc and manganese chelation by neutrophil S100A8/A9 (calprotectin) limits extracellular Aspergillus fumigatus hyphal growth and corneal infection. Journal of Immunology 196(1):336-344. 98. Brophy, MB, Nakashige, TG, Gaillard, A, et al. (2013). Contributions of the S100A9 C- terminal tail to high-affinity Mn(II) chelation by the host-defense protein human calprotectin. Journal of the American Chemical Society 135(47):17804-17817. 99. Brophy, MB and Nolan, EM (2015). Manganese and microbial pathogenesis: sequestration by the Mammalian immune system and utilization by microorganisms. ACS Chemical Biology 10(3):641-651. 100. Nakashige, TG, Zhang, B, Krebs, C, et al. (2015). Human calprotectin is an iron- sequestering host-defense protein. Nature Chemical Biology 11(10):765-771. 101. Nakashige, TG, Zygiel, EM, Drennan, CL, et al. (2017). Nickel sequestration by the host- defense protein human calprotectin. Journal of the American Chemical Society 139(26):8828-8836. 102. Nishikawa, T, Lee, IS, Shiraishi, N, et al. (1997). Identification of S100b protein as copper-binding protein and its suppression of copper-induced cell damage. Journal of Biological Chemistry 272(37):23037-23041. 103. Moroz, OV, Antson, AA, Grist, SJ, et al. (2003). Structure of the human S100A12-copper complex: implications for host-parasite defence. Acta Crystallographica. Section D, Biological Crystallography 59(5):859-867. 104. Haase-Kohn, C, Wolf, S, Lenk, J, et al. (2011). Copper-mediated cross-linking of S100A4, but not of S100A2, results in proinflammatory effects in melanoma cells. Biochemical and Biophysical Research Communications 413(3):494-498. 105. Arnesano, F, Banci, L, Bertini, I, et al. (2005). Structural interplay between calcium(II) and copper(II) binding to S100A13 protein. Angewandte Chemie International Edition 44(39):6341-6344. 106. Lim, SY, Raftery, MJ, Goyette, J, et al. (2009). Oxidative modifications of S100 proteins: functional regulation by redox. Journal of Leukocyte Biology 86(3):577-587. 107. Guignard, F, Mauel, J, and Markert, M (1996). Phosphorylation of myeloid-related proteins MRP-14 and MRP-8 during human neutrophil activation. European Journal of Biochemistry 241(1):265-271. 108. Bengis-Garber, C and Gruener, N (1993). Calcium-binding myeloid protein (P8,14) is phosphorylated in fMet-Leu-Phe-stimulated neutrophils. Journal of Leukocyte Biology 54(2):114-118. 109. Lechner, M, Lirk, P, and Rieder, J (2005). Inducible nitric oxide synthase (iNOS) in tumor biology: The two sides of the same coin. Seminars in Cancer Biology 15(4):277- 289. 110. Lim, SY, Raftery, M, Cai, H, et al. (2008). S-nitrosylated S100A8: novel anti- inflammatory properties. Journal of Immunology 181(8):5627-5636. 111. van den Bos, C, Roth, J, Koch, HG, et al. (1996). Phosphorylation of MRP14, an S100 protein expressed during monocytic differentiation, modulates Ca(2+)-dependent translocation from cytoplasm to membranes and cytoskeleton. Journal of Immunology 156(3):1247-1254. 112. Raftery, MJ, Harrison, CA, Alewood, P, et al. (1996). Isolation of the murine S100 protein MRP14 (14 kDa migration-inhibitory-factor-related protein) from activated spleen cells: characterization of post-translational modifications and zinc binding. Biochemical Journal 316 (Pt 1):285-293. 113. Harrison, CA, Raftery, MJ, Walsh, J, et al. (1999). Oxidation regulates the inflammatory properties of the murine S100 protein S100A8. Journal of Biological Chemistry 274(13):8561-8569. 114. Jia, J, Arif, A, Terenzi, F, et al. (2014). Target-selective protein S-nitrosylation by sequence motif recognition. Cell 159(3):623-634.

297

115. Hara, MR, Agrawal, N, Kim, SF, et al. (2005). S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding. Nature Cell Biology 7(7):665-674. 116. Sen, N, Hara, MR, Kornberg, MD, et al. (2008). Nitric oxide-induced nuclear GAPDH activates p300/CBP and mediates apoptosis. Nature Cell Biology 10(7):866-873. 117. Dalle-Donne, I, Rossi, R, Giustarini, D, et al. (2007). S-glutathionylation in protein redox regulation. Free Radical Biology and Medicine 43(6):883-898. 118. Lim, SY, Raftery, MJ, Goyette, J, et al. (2010). S-glutathionylation regulates inflammatory activities of S100A9. Journal of Biological Chemistry 285:14377-14388. 119. Hazell, LJ, van den Berg, JJ, and Stocker, R (1994). Oxidation of low-density lipoprotein by hypochlorite causes aggregation that is mediated by modification of lysine residues rather than lipid oxidation. Biochemical Journal 302(Pt 1):297-304. 120. Uttara, B, Singh, AV, Zamboni, P, et al. (2009). Oxidative stress and neurodegenerative diseases: a review of upstream and downstream antioxidant therapeutic options. Current Neuropharmacology 7(1):65-74. 121. Grimbaldeston, MA, Geczy, CL, Tedla, N, et al. (2003). S100A8 induction in keratinocytes by ultraviolet A irradiation is dependent on reactive oxygen intermediates. Journal of Investigative Dermatology 121(5):1168-1174. 122. Gomes, LH, Raftery, MJ, Yan, WX, et al. (2013). S100A8 and S100A9—oxidant scavengers in inflammation. Free Radical Biology and Medicine 58(0):170-186. 123. Sroussi, HY, Berline, J, and Palefsky, JM (2007). Oxidation of methionine 63 and 83 regulates the effect of S100A9 on the migration of neutrophils in vitro. Journal of Leukocyte Biology 81(3):818-824. 124. Shepherd, CE, Goyette, J, Utter, V, et al. (2006). Inflammatory S100A9 and S100A12 proteins in Alzheimer's disease. Neurobiology of Aging 27(11):1554-1563. 125. Raftery, MJ, Collinson, L, and Geczy, CL (1999). Overexpression, oxidative refolding, and zinc binding of recombinant forms of the murine S100 protein MRP14 (S100A9). Protein Expression and Purification 15(2):228-235. 126. Hunter, T (1995). Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling. Cell 80(2):225-236. 127. Cohen, P (2002). The origins of protein phosphorylation. Nature Cell Biology 4(5):E127- E130. 128. Albert, KA, Wu, W, Nairn, AC, et al. (1984). Inhibition by calmodulin of calcium/phospholipid-dependent protein phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 81(12):3622-3625. 129. Sheu, F-S, Huang, FL, and Huang, K-P (1995). Differential responses of protein kinase C substrates (MARCKS, neuromodulin, and neurogranin) phosphorylation to calmodulin and S100. Archives of Biochemistry and Biophysics 316(1):335-342. 130. Hagiwara, M, Ochiai, M, Owada, K, et al. (1988). Modulation of tyrosine phosphorylation of p36 and other substrates by the S-100 protein. Journal of Biological Chemistry 263(13):6438-6441. 131. Lin, L-H, Van Eldik, LJ, Osheroff, N, et al. (1994). Inhibition of protein kinase C-and casein kinase II-mediated phosphorylation of GAP-43 by S100β. Molecular Brain Research 25(3-4):297-304. 132. Sheu, F-S, Azmitia, EC, Marshak, DR, et al. (1994). Glial-derived S100b protein selectively inhibits recombinant β protein kinase C (PKC) phosphorylation of neuron- specific protein F1/GAP43. Molecular Brain Research 21(1):62-66. 133. Johnsson, N, Van, PN, Söling, H, et al. (1986). Functionally distinct serine phosphorylation sites of p36, the cellular substrate of retroviral protein kinase; differential inhibition of reassociation with p11. EMBO Journal 5(13):3455. 134. Pozdnyakov, N, Margulis, A, and Sitaramayya, A (1998). Identification of effector binding sites on S100β: studies with guanylate cyclase and p80, a retinal phosphoprotein. Biochemistry 37(30):10701-10708.

298

135. Skripnikova, EV and Gusev, NB (1989). Interaction of smooth muscle caldesmon with S‐100 protein. FEBS letters 257(2):380-382. 136. Fujii, T, Machino, K, Andoh, H, et al. (1990). Calcium-dependent control of caldesmon- actin interaction by S100 protein. Journal of Biochemistry 107(1):133-137. 137. Pritchard, K and Marston, SB (1991). Ca2+-dependent regulation of vascular smooth- muscle caldesmon by S. 100 and related smooth-muscle proteins. Biochemical Journal 277(3):819-824. 138. Baudier, J, Mochly-Rosen, D, Newton, A, et al. (1987). Comparison of S100b protein with calmodulin: interactions with melittin and microtubule-associated tau proteins and inhibition of phosphorylation of. tau. proteins by protein kinase C. Biochemistry 26(10):2886-2893. 139. Baudier, J and Cole, RD (1988). Interactions between the microtubule-associated tau proteins and S100b regulate tau phosphorylation by the Ca2+/calmodulin-dependent protein kinase II. Journal of Biological Chemistry 263(12):5876-5883. 140. Ziegler, DR, Innocente, CE, Leal, RB, et al. (1998). The S100B protein inhibits phosphorylation of GFAP and vimentin in a cytoskeletal fraction from immature rat hippocampus. Neurochemical Research 23(10):1259-1263. 141. Baudier, J, Delphin, C, Grunwald, D, et al. (1992). Characterization of the tumor suppressor protein p53 as a protein kinase C substrate and a S100b-binding protein. Proceedings of the National Academy of Sciences of the United States of America 89(23):11627-11631. 142. Rustandi, RR, Drohat, AC, Baldisseri, DM, et al. (1998). The Ca2+-dependent interaction of S100B (ββ) with a peptide derived from p53. Biochemistry 37(7):1951-1960. 143. Wilder, PT, Rustandi, RR, Drohat, AC, et al. (1998). S100B (ββ) inhibits the protein kinase C‐dependent phosphorylation of a peptide derived from p53 in a Ca2+‐dependent manner. Protein Science 7(3):794-798. 144. Scotto, C, Deloulme, JC, Rousseau, D, et al. (1998). Calcium and S100B regulation of p53-dependent cell growth arrest and apoptosis. Molecular and Cellular Biology 18(7):4272-4281. 145. Weber, DJ, Rustandi, RR, Carrier, F, et al (2000). Interaction of dimeric S100B (ββ) with the tumor suppressor protein p53: a model for Ca2+-dependent S100-target protein interactions, in Calcium: The Molecular Basis of Calcium Action in Biology and Medicine. Springer: 521-539. 146. Rust, RR, Baldisseri, DM, and Weber, DJ (2000). Structure of the negative regulatory domain of p53 bound to S100B (ββ). Nature Structural & Molecular Biology 7(7):570- 574. 147. Tsoporis, JN, Marks, A, Kahn, HJ, et al. (1997). S100beta inhibits alpha1-adrenergic induction of the hypertrophic phenotype in cardiac myocytes. Journal of Biological Chemistry 272(50):31915-31921. 148. Tsoporis, JN, Marks, A, Kahn, HJ, et al. (1998). Inhibition of norepinephrine-induced cardiac hypertrophy in s100beta transgenic mice. Journal of Clinical Investigation 102(8):1609-1616. 149. Baudier, J, Bergeret, E, Bertacchi, N, et al. (1995). Interactions of myogenic bHLH transcription factors with calcium-binding calmodulin and S100a (alpha alpha) proteins. Biochemistry 34(24):7834-7846. 150. Kriajevska, M, Tarabykina, S, Bronstein, I, et al. (1998). Metastasis-associated Mts1 (S100A4) protein modulates protein kinase C phosphorylation of the heavy chain of nonmuscle myosin. Journal of Biological Chemistry 273(16):9852-9856. 151. Maelandsmo, GM, Floerenes, VA, Mellingsaeter, T, et al. (1997). Differential expression patterns of S100A2, S100A4, and S100A6 during progression of human malignant melanoma. International Journal of Cancer 74(4):464-469. 152. Grigorian, M, Ambartsumian, N, Lykkesfeldt, AE, et al. (1996). Effect of mts1 (S100A4) expression on the progression of human breast cancer cells. International Journal of Cancer 67(6):831-841.

299

153. Sherbet, G and Lakshmi, M (1997). S100A4 (MTS1) calcium binding protein in cancer growth, invasion and metastasis. Anticancer Research 18(4A):2415-2421. 154. Davies, M, Rudland, PS, Robertson, L, et al. (1996). Expression of the calcium-binding protein S100A4 (p9Ka) in MMTV-neu transgenic mice induces metastasis of mammary tumours. Oncogene 13(8):1631-1637. 155. Takenaga, K, Nakamura, Y, and Sakiyama, S (1997). Expression of antisense RNA to S100A4 gene encoding an S100-related calcium-binding protein suppresses metastatic potential of high-metastatic Lewis lung carcinoma cells. Oncogene 14(3):331-337. 156. Gerke, V and Weber, K (1985). Calcium-dependent conformational changes in the 36- kDa subunit of intestinal protein I related to the cellular 36-kDa target of Rous sarcoma virus tyrosine kinase. Journal of Biological Chemistry 260(3):1688-1695. 157. Seemann, J, Weber, K, and Gerke, V (1996). Structural requirements for annexin I-S100C complex-formation. Biochemical Journal 319 ( Pt 1):123-129. 158. Mailliard, WS, Haigler, HT, and Schlaepfer, DD (1996). Calcium-dependent binding of S100C to the N-terminal domain of annexin I. Journal of Biological Chemistry 271(2):719-725. 159. Lominadze, G, Rane, MJ, Merchant, M, et al. (2005). Myeloid-related protein-14 is a p38 MAPK substrate in human neutrophils. Journal of Immunology 174(11):7257-7267. 160. Vogl, T, Ludwig, S, Goebeler, M, et al. (2004). MRP8 and MRP14 control microtubule reorganization during transendothelial migration of phagocytes. Blood 104(13):4260- 4268. 161. Mandinova, A, Atar, D, Schafer, B, et al. (1998). Distinct subcellular localization of calcium binding S100 proteins in human smooth muscle cells and their relocation in response to rises in intracellular calcium. Journal of Cell Science 111(14):2043-2054. 162. Gonzalez‐Martinez, T, Perez‐Piñera, P, Díaz‐Esnal, B, et al. (2003). S‐100 proteins in the human peripheral nervous system. Microscopy research and technique 60(6):633-638. 163. Hoyaux, D, Decaestecker, C, Heizmann, CW, et al. (2000). S100 proteins in Corpora amylacea from normal human brain. Brain Research 867(1):280-288. 164. McNutt, NS (1998). The S100 family of multipurpose calcium‐binding proteins. Journal of Cutaneous Pathology 25(10):521-529. 165. Tsoporis, JN, Marks, A, Zimmer, DB, et al. (2003). The myocardial protein S100A1 plays a role in the maintenance of normal gene expression in the adult heart. Molecular and cellular biochemistry 242(1-2):27-33. 166. Randazzo, A, Acklin, C, Schäfer, BW, et al. (2001). Structural insight into human Zn 2+- bound S100A2 from NMR and homology modeling. Biochemical and Biophysical Research Communications 288(2):462-467. 167. Donato, R, R. Cannon, B, Sorci, G, et al. (2013). Functions of S100 Proteins. Current Molecular Medicine 13(1):24-57. 168. Fritz, G, Heizmann, CW, and Kroneck, PM (1998). Probing the structure of the human Ca 2+-and Zn 2+-binding protein S100A3: spectroscopic investigations of its transition metal ion complexes, and three-dimensional structural model. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1448(2):264-276. 169. Kizawa, K, Tsuchimoto, S, Hashimoto, K, et al. (1998). Gene expression of mouse S100A3, a cysteine-rich calcium-binding protein, in developing hair follicle. Journal of Investigative Dermatology 111(5):879-886. 170. Rogers, G and Koike, K (2009). Laser capture microscopy in a study of expression of structural proteins in the cuticle cells of human hair. Experimental Dermatology 18(6):541-547. 171. Barraclough, R (1998). Calcium-binding protein S100A4 in health and disease. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1448(2):190-199. 172. Chan, WY, Xia, CL, Dong, DC, et al. (2003). Differential expression of S100 proteins in the developing human hippocampus and temporal cortex. Microscopy Research and Technique 60(6):600-613.

300

173. Mazzucchelli, L (2002). Protein S100A4: too long overlooked by pathologists? American Journal of Pathology 160(1):7-13. 174. Riau, AK, Wong, TT, Beuerman, RW, et al. (2009). Calcium-binding S100 protein expression in pterygium. Molecular Vision 15:335-342. 175. McIntyre, JC, Davis, EE, Joiner, A, et al. (2012). Gene therapy rescues cilia defects and restores olfactory function in a mammalian ciliopathy model. Nature Medicine 18(9):1423-1428. 176. Teratani, T, Watanabe, T, Yamahara, K, et al. (2002). Restricted expression of calcium- binding protein S100A5 in human kidney. Biochemical and Biophysical Research Communications 291(3):623-627. 177. Tiu, S, Chan, W, Heizmann, C, et al. (2000). Differential expression of S100B and S100A6 1 in the human fetal and aged cerebral cortex. Developmental Brain Research 119(2):159-168. 178. Watson, PH, Leygue, ER, and Murphy, LC (1998). Psoriasin (S100A7). International Journal of Biochemistry & Cell Biology 30(5):567-571. 179. Svenningsson, P, Chergui, K, Rachleff, I, et al. (2006). Alterations in 5-HT1B receptor function by p11 in depression-like states. Science 311(5757):77-80. 180. Kaczan-Bourgois, D, Salles, JP, Hullin, F, et al. (1996). Increased content of annexin II (p36) and p11 in human placenta brush-border membrane vesicles during syncytiotrophoblast maturation and differentiation. Placenta 17(8):669-676. 181. Munz, B, Gerke, V, Gillitzer, R, et al. (1997). Differential expression of the calpactin I subunits annexin II and p11 in cultured keratinocytes and during wound repair. Journal of Investigative Dermatology 108(3):307-312. 182. Wu, T, Angus, CW, Yao, XL, et al. (1997). P11, a unique member of the S100 family of calcium-binding proteins, interacts with and inhibits the activity of the 85-kDa cytosolic phospholipase A2. Journal of Biological Chemistry 272(27):17145-17153. 183. Kondo, A, Sakaguchi, M, Makino, E, et al. (2002). Localization of S100C immunoreactivity in various human tissues. Acta Medica Okayama 56(1):31-34. 184. Sakaguchi, M, Miyazaki, M, Kondo, T, et al. (2001). Up-regulation of S100C in normal human fibroblasts in the process of aging in vitro. Experimental Gerontology 36(8):1317- 1325. 185. Hitomi, J, Kimura, T, Kusumi, E, et al. (1998). Novel S100 proteins in human esophageal epithelial cells: CAAF1 expression is associated with cell growth arrest. Archives of Histology and Cytology 61(2):163-178. 186. Hitomi, J, Maruyama, K, Kikuchi, Y, et al. (1996). Characterization of a new calcium- binding protein abundant in amniotic fluid, CAAF2, which is produced by fetal epidermal keratinocytes during embryogenesis. Biochemical and Biophysical Research Communications 228(3):757-763. 187. Ridinger, K, Schäfer, BW, Durussel, I, et al. (2000). S100A13: biochemical characterization and subcellular localization in different cell lines Journal of Biological Chemistry 275(12):8686-8694. 188. Wicki, R, Schäfer, BW, Erne, P, et al. (1996). Characterization of the human and mouse cDNAs coding for S100A13, a new member of the S100 protein family. Biochemical and Biophysical Research Communications 227(2):594-599. 189. Shiras, A, Shepal, V, Bhonde, M, et al. (2001). S100 expression in primary mouse fibroblast cultures. In Vitro Cellular & Developmental Biology - Animal 37(3):172-174. 190. Pietas, A, Schluns, K, Marenholz, I, et al. (2002). Molecular cloning and characterization of the human S100A14 gene encoding a novel member of the S100 family. Genomics 79(4):513-522. 191. Jansen, S, Podschun, R, Leib, SL, et al. (2013). Expression and function of psoriasin (S100A7) and koebnerisin (S100A15) in the brain. Infection and Immunity 81(5):1788- 1797.

301

192. Buchau, AS, Hassan, M, Kukova, G, et al. (2007). S100A15, an antimicrobial protein of the skin: regulation by E. coli through Toll-like receptor 4. Journal of Investigative Dermatology 127(11):2596-2604. 193. Liu, Y, Zhang, R, Xin, J, et al. (2011). Identification of S100A16 as a novel adipogenesis promoting factor in 3T3-L1 cells. Endocrinology 152(3):903-911. 194. Donato, R, Sorci, G, Riuzzi, F, et al. (2009). S100B's double life: intracellular regulator and extracellular signal. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1793(6):1008-1022. 195. Bobryshev, YV and Lord, RS (1995). S-100 positive cells in human arterial intima and in atherosclerotic lesions. Cardiovascular Research 29(5):689-696. 196. Becker, T, Gerke, V, Kube, E, et al. (1992). S100P, a novel Ca(2+)-binding protein from human placenta. cDNA cloning, recombinant protein expression and Ca2+ binding properties. European Journal of Biochemistry 207(2):541-547. 197. Sato, N and Hitomi, J (2002). S100P expression in human esophageal epithelial cells: Human esophageal epithelial cells sequentially produce different S100 proteins in the process of differentiation. Anatomical Record 267(1):60-69. 198. Cross, SS, Hamdy, FC, Deloulme, JC, et al. (2005). Expression of S100 proteins in normal human tissues and common cancers using tissue microarrays: S100A6, S100A8, S100A9 and S100A11 are all overexpressed in common cancers. Histopathology 46(3):256-269. 199. Healy, AM, Pickard, MD, Pradhan, AD, et al. (2006). Platelet expression profiling and clinical validation of myeloid-related protein-14 as a novel determinant of cardiovascular events. Circulation 113(19):2278-2284. 200. Lagasse, E and Weissman, I (1992). Mouse MRP8 and MRP14, two intracellular calcium-binding proteins associated with the development of the myeloid lineage. Blood 79(8):1907-1915. 201. Zreiqat, H, Howlett, CR, Gronthos, S, et al. (2007). S100A8/S100A9 and their association with cartilage and bone. Journal of Molecular Histology 38(5):381-391. 202. Goyette, J and Geczy, C (2011). Inflammation-associated S100 proteins: new mechanisms that regulate function. Amino Acids 41(4):821-842. 203. Robinson, MJ and Hogg, N (2000). A comparison of human S100A12 with MRP-14 (S100A9). Biochemical and Biophysical Research Communications 275(3):865-870. 204. Hessian, PA, Edgeworth, J, and Hogg, N (1993). MRP-8 and MRP-14, two abundant Ca(2+)-binding proteins of neutrophils and monocytes. Journal of Leukocyte Biology 53(2):197-204. 205. Voganatsi, A, Panyutich, A, Miyasaki, KT, et al. (2001). Mechanism of extracellular release of human neutrophil calprotectin complex. Journal of Leukocyte Biology 70(1):130-134. 206. Zhao, F, Hoechst, B, Duffy, A, et al. (2012). S100A9 a new marker for monocytic human myeloid-derived suppressor cells. Immunology 136(2):176-183. 207. Feng, P-H, Lee, K-Y, Chang, Y-L, et al. (2012). CD14+S100A9+ monocytic myeloid- derived suppressor cells and their clinical relevance in non-small cell lung cancer. American Journal of Respiratory and Critical Care Medicine 186(10):1025-1036. 208. Becker, A, Hokamp, NG, Zenker, S, et al. (2015). Optical in vivo imaging of the alarmin S100A9 in tumor lesions allows for estimation of the individual malignant potential by evaluation of tumor–host cell interaction. Journal of Nuclear Medicine 56(3):450-456. 209. Sinha, P, Okoro, C, Foell, D, et al. (2008). Proinflammatory S100 proteins regulate the accumulation of myeloid-derived suppressor cells. Journal of Immunology 181(7):4666- 4675. 210. Kumar, RK, Yang, Z, Bilson, S, et al. (2001). Dimeric S100A8 in human neutrophils is diminished after phagocytosis. Journal of Leukocyte Biology 70(1):59-64. 211. Kumar, A, Steinkasserer, A, and Berchtold, S (2003). Interleukin-10 Influences the Expression of MRP8 and MRP14 in Human Dendritic Cells. International Archives of Allergy and Immunology 132(1):40-47.

302

212. Wilkinson, A, Kawaguchi, N, Geczy, C, et al. (2016). S100A8 and S100A9 proteins are expressed by human corneal stromal dendritic cells. British Journal of Ophthalmology 100(9):1304-1308. 213. Hu, SP, Harrison, C, Xu, K, et al. (1996). Induction of the chemotactic S100 protein, CP- 10, in monocyte/macrophages by lipopolysaccharide. Blood 87(9):3919-3928. 214. Hsu, K, Passey, RJ, Endoh, Y, et al. (2005). Regulation of S100A8 by glucocorticoids. Journal of Immunology 174(4):2318-2326. 215. Xu, K, Yen, T, and Geczy, CL (2001). IL-10 up-regulates macrophage expression of the S100 protein S100A8. Journal of Immunology 166(10):6358-6366. 216. Xu, K and Geczy, CL (2000). IFN-gamma and TNF regulate macrophage expression of the chemotactic S100 protein S100A8. Journal of Immunology 164(9):4916-4923. 217. Santhanagopalan, V, Hahn, BL, and Sohnle, PG (1995). Resistance of zinc-supplemented Candida albicans cells to the growth inhibitory effect of calprotectin. Journal of Infectious Diseases 171(5):1289-1294. 218. Eversole, LR, Miyasaki, KT, and Christensen, RE (1992). The distribution of the antimicrobial protein, calprotectin, in normal oral keratinocytes. Archives of Oral Biology 37(11):963-968. 219. Eversole, LR, Miyasaki, KT, and Christensen, RE (1993). Keratinocyte expression of calprotectin in oral inflammatory mucosal diseases. Journal of Oral Pathology & Medicine 22(7):303-307. 220. Coleman, N and Stanley, MA (1994). Expression of the myelomonocytic antigens CD36 and L1 by keratinocytes in squamous intraepithelial lesions of the cervix. Hum Pathol 25(1):73-79. 221. Rahimi, F, Hsu, K, Endoh, Y, et al. (2005). FGF-2, IL-1beta and TGF-beta regulate fibroblast expression of S100A8. FEBS Journal 272(11):2811-2827. 222. Yen, T, Harrison, CA, Devery, JM, et al. (1997). Induction of the S100 chemotactic protein, CP-10, in murine microvascular endothelial cells by proinflammatory stimuli. Blood 90(12):4812-4821. 223. Hiroshima, Y, Hsu, K, Tedla, N, et al. (2017). S100A8/A9 and S100A9 reduce acute lung injury. Immunology & Cell Biology 95:461–472 224. Hiroshima, Y, Hsu, K, Tedla, N, et al. (2014). S100A8 induces IL-10 and protects against acute lung injury. Journal of Immunology 192(6):2800-2811. 225. Michel, O, Doyen, V, Leroy, B, et al. (2013). Expression of calgranulin A/B heterodimer after acute inhalation of endotoxin: proteomic approach and validation. BMC Pulmonary Medicine 13:65-65. 226. Cheng, P, Corzo, CA, Luetteke, N, et al. (2008). Inhibition of dendritic cell differentiation and accumulation of myeloid-derived suppressor cells in cancer is regulated by S100A9 protein. Journal of Experimental Medicine 205(10):2235-2249. 227. Passey, RJ, Williams, E, Lichanska, AM, et al. (1999). A null mutation in the inflammation-associated S100 protein S100A8 causes early resorption of the mouse embryo. Journal of Immunology 163(4):2209-2216. 228. Hiroshima, Y, Bando, M, Inagaki, Y, et al. (2016). Effect of Hangeshashinto on calprotectin expression in human oral epithelial cells. Odontology 104(2):152-162. 229. Hiroshima, Y, Bando, M, Kataoka, M, et al. (2010). Shosaikoto increases calprotectin expression in human oral epithelial cells. Journal of Periodontal Research 45(1):79-86. 230. Akiyama, H, Ikeda, K, Katoh, M, et al. (1994). Expression of MRP14, 27E10, interferon- alpha and leukocyte common antigen by reactive microglia in postmortem human brain tissue. Journal of Neuroimmunology 50(2):195-201. 231. Hsu, K, Chung, YM, Endoh, Y, et al. (2014). TLR9 ligands induce S100A8 in macrophages via a STAT3-dependent pathway which requires IL-10 and PGE2. PLoS ONE 9(8):e103629. 232. Koike, T, Harada, N, Yoshida, T, et al. (1992). Regulation of myeloid-specific calcium binding protein synthesis by cytosolic protein kinase C. Journal of Biochemistry 112(5):624-630.

303

233. Murao, S-i, Collart, F, and Huberman, E (1990). A protein complex expressed during terminal differentiation of monomyelocytic cells is an inhibitor of cell growth. Cell Growth & Differentiation: The Molecular Biology Journal of the American Association for Cancer Research 1(10):447-454. 234. Kido, Ji, Hayashi, N, Kataoka, M, et al. (2006). Norepinephrine stimulates calprotectin expression in human monocytic cells. Journal of Periodontal Research 41(3):159-164. 235. Sellmayer, A, Krane, SM, Ouellette, AJ, et al. (1992). 1 alpha, 25-(OH) 2 vitamin D3 enhances expression of the genes encoding Ca (2+)-binding proteins MRP-8 and MRP- 14. American Journal of Physiology-Cell Physiology 262(1):C235-C242. 236. Murao, S, Collart, FR, and Huberman, E (1989). A protein containing the cystic fibrosis antigen is an inhibitor of protein kinases. Journal of Biological Chemistry 264(14):8356- 8360. 237. Lügering, N, Kucharzik, T, Lügering, A, et al. (1997). Importance of combined treatment with IL‐10 and IL‐4, but not IL‐13, for inhibition of monocyte release of the Ca2+‐ binding protein MRP8/14. Immunology 91(1):130-134. 238. Rammes, A, Roth, J, Goebeler, M, et al. (1997). Myeloid-related protein (MRP) 8 and MRP14, calcium-binding proteins of the S100 family, are secreted by activated monocytes via a novel, tubulin-dependent pathway. Journal of Biological Chemistry 272(14):9496-9502. 239. Gebhardt, C, Breitenbach, U, Tuckermann, JP, et al. (2002). Calgranulins S100A8 and S100A9 are negatively regulated by glucocorticoids in a c-Fos-dependent manner and overexpressed throughout skin carcinogenesis. Oncogene 21:4266-4276. 240. Bando, M, Hiroshima, Y, Kataoka, M, et al. (2007). Interleukin-1α regulates antimicrobial peptide expression in human keratinocytes. Immunology and Cell Biology 85(7):532-537. 241. Mørk, G, Schjerven, H, Mangschau, L, et al. (2003). Proinflammatory cytokines upregulate expression of calprotectin (L1 protein, MRP‐8/MRP‐14) in cultured human keratinocytes. British Journal of Dermatology 149(3):484-491. 242. Djerbi, N, Dziunycz, PJ, Reinhardt, D, et al. (2013). Influence of cyclosporin and prednisolone on rage, s100a8/a9, and nfκb expression in human keratinocytes. JAMA Dermatology 149(2):236-237. 243. Bai, B, Yamamoto, K, Sato, H, et al. (2007). Complex regulation of S100A8 by IL-17, dexamethasone, IL-4 and IL-13 in HaCat cells (human keratinocyte cell line). Journal of Dermatological Science 47(3):259-262. 244. Mose, M, Kang, Z, Raaby, L, et al. (2013). TNFalpha- and IL-17A-mediated S100A8 expression is regulated by p38 MAPK. Experimental Dermatology 22(7):476-481. 245. Lim, SY, Raftery, MJ, and Geczy, CL (2011). Oxidative modifications of DAMPs suppress inflammation: the case for S100A8 and S100A9. Antioxidants & Redox Signaling 15:2235-2248. 246. Gray, RD, MacGregor, G, Noble, D, et al. (2008). Sputum proteomics in inflammatory and suppurative respiratory diseases. American Journal of Respiratory and Critical Care Medicine 178(5):444-452. 247. Gray, RD, Imrie, M, Boyd, AC, et al. (2010). Sputum and serum calprotectin are useful biomarkers during CF exacerbation. Journal of Cystic Fibrosis 9(3):193-198. 248. McMorran, BJ, Patat, SA, Carlin, JB, et al. (2007). Novel neutrophil-derived proteins in bronchoalveolar lavage fluid indicate an exaggerated inflammatory response in pediatric cystic fibrosis patients. Clinical Chemistry 53(10):1782-1791. 249. Merkel, D, Rist, W, Seither, P, et al. (2005). Proteomic study of human bronchoalveolar lavage fluids from smokers with chronic obstructive pulmonary disease by combining surface-enhanced laser desorption/ionization-mass spectrometry profiling with mass spectrometric protein identification. Proteomics 5(11):2972-2980. 250. Bargagli, E, Olivieri, C, Prasse, A, et al. (2008). Calgranulin B (S100A9) levels in bronchoalveolar lavage fluid of patients with interstitial lung diseases. Inflammation 31(5):351.

304

251. Hesselstrand, R, Wildt, M, Bozovic, G, et al. (2013). Biomarkers from bronchoalveolar lavage fluid in systemic sclerosis patients with interstitial lung disease relate to severity of lung fibrosis. Respiratory Medicine 107(7):1079-1086. 252. Henke, MO, Renner, A, Rubin, BK, et al. (2006). Up-regulation of S100A8 and S100A9 protein in bronchial epithelial cells by lipopolysaccharide. Experimental Lung Research 32(8):331-347. 253. Zimmer, D and Van Eldik, L (1986). Identification of a molecular target for the calcium- modulated protein S100. Fructose-1, 6-bisphosphate aldolase. Journal of Biological Chemistry 261(24):11424-11428. 254. Landar, A, Caddell, G, Chessher, J, et al. (1996). Identification of an S100A1/S100B target protein: phosphoglucomutase. Cell Calcium 20(3):279-285. 255. Millward, TA, Heizmann, CW, Schäfer, BW, et al. (1998). Calcium regulation of Ndr protein kinase mediated by S100 calcium‐binding proteins. EMBO Journal 17(20):5913- 5922. 256. Margulis, A, Pozdnyakov, N, and Sitaramayya, A (1996). Activation of bovine photoreceptor guanylate cyclase by S100 proteins. Biochemical and Biophysical Research Communications 218(1):243-247. 257. Duda, T, Goraczniak, RM, and Sharma, RK (1996). Molecular characterization of S100A1-S100B protein in retina and its activation mechanism of bovine photoreceptor guanylate cyclase. Biochemistry 35(20):6263-6266. 258. Pozdnyakov, N, Goraczniak, R, Margulis, A, et al. (1997). Structural and functional characterization of retinal calcium-dependent guanylate cyclase activator protein (CD- GCAP): identity with S100β protein. Biochemistry 36(46):14159-14166. 259. Rambotti, M, Giambanco, I, Spreca, A, et al. (1999). S100B and S100A1 proteins in bovine retina: their calcium-dependent stimulation of a membrane-bound guanylate cyclase activity as investigated by ultracytochemistry. Neuroscience 92(3):1089-1101. 260. Zimmer, D and Dubuisson, J (1993). Identification of an S100 target protein: glycogen phosphorylase. Cell Calcium 14(4):323-332. 261. Zimmer, DB and Landar, A (1995). Analysis of S100A1 expression during skeletal muscle and neuronal cell differentiation. Journal of Neurochemistry 64(6):2727-2736. 262. Zhao, XQ, Naka, M, Muneyuki, M, et al. (2000). Ca 2+-dependent inhibition of actin- activated myosin ATPase activity by S100C (S100A11), a novel member of the S100 protein family. Biochemical and Biophysical Research Communications 267(1):77-79. 263. Kizawa, K, Inoue, T, Yamaguchi, M, et al. (2005). Dissimilar effect of perming and bleaching treatments on cuticles: advanced hair damage model based on elution and oxidation of S100A3 protein. International Journal of Cosmetic Science 27(6):355-355. 264. Breen, EC and Tang, K (2003). Calcyclin (S100A6) regulates pulmonary fibroblast proliferation, morphology, and cytoskeletal organization in vitro. Journal of Cellular Biochemistry 88(4):848-854. 265. Słomnicki, ŁP and Leśniak, W (2010). S100A6 (calcyclin) deficiency induces senescence‐like changes in cell cycle, morphology and functional characteristics of mouse NIH 3T3 fibroblasts. Journal of Cellular Biochemistry 109(3):576-584. 266. Sakaguchi, M, Miyazaki, M, Inoue, Y, et al. (2000). Relationship between contact inhibition and intranuclear S100C of normal human fibroblasts. Journal of Cell Biology 149(6):1193-1206. 267. Sakaguchi, M, Sonegawa, H, Nukui, T, et al. (2005). Bifurcated converging pathways for high Ca2+-and TGFβ-induced inhibition of growth of normal human keratinocytes. Proceedings of the National Academy of Sciences of the United States of America 102(39):13921-13926. 268. Sakaguchi, M, Sonegawa, H, Murata, H, et al. (2008). S100A11, an dual mediator for growth regulation of human keratinocytes. Molecular Biology of The Cell 19(1):78-85. 269. Selinfreund, RH, Barger, SW, Pledger, WJ, et al. (1991). Neurotrophic protein S100 beta stimulates glial cell proliferation. Proceedings of the National Academy of Sciences of the United States of America 88(9):3554-3558.

305

270. Selinfreund, RH, Barger, SW, Welsh, MJ, et al. (1990). Antisense inhibition of glial S100 beta production results in alterations in cell morphology, cytoskeletal organization, and cell proliferation. Journal of Cell Biology 111(5):2021-2028. 271. Zheng, Y, Hou, J, Peng, L, et al. (2014). The pro-apoptotic and pro-inflammatory effects of calprotectin on human periodontal ligament cells. PLoS ONE 9(10):e110421. 272. Rosenberger, S, Thorey, IS, Werner, S, et al. (2007). A novel regulator of telomerase. S100A8 mediates differentiation-dependent and calcium-induced inhibition of telomerase activity in the human epidermal keratinocyte line HaCaT. Journal of Biological Chemistry 282(9):6126-6135. 273. Voss, A, Bode, G, Sopalla, C, et al. (2011). Expression of S100A8/A9 in HaCaT keratinocytes alters the rate of cell proliferation and differentiation. FEBS Letters 585(2):440-446. 274. McNeill, E, Conway, SJ, Roderick, HL, et al. (2007). Defective chemoattractant-induced calcium signalling in S100A9 null neutrophils. Cell Calcium 41(2):107-121. 275. Simard, JC, Simon, MM, Tessier, PA, et al. (2011). Damage-associated molecular pattern S100A9 increases bactericidal activity of human neutrophils by enhancing phagocytosis. Journal of Immunology 186(6):3622-3631. 276. Steinckwich, N, Schenten, V, Melchior, C, et al. (2011). An essential role of STIM1, Orai1, and S100A8-A9 proteins for Ca2+ signaling and FcgammaR-mediated phagosomal oxidative activity. Journal of Immunology 186(4):2182-2191. 277. Kerkhoff, C, Nacken, W, Benedyk, M, et al. (2005). The arachidonic acid-binding protein S100A8/A9 promotes NADPH oxidase activation by interaction with p67phox and Rac- 2. FASEB Journal 19(3):467-469. 278. Kerkhoff, C, Klempt, M, Kaever, V, et al. (1999). The two calcium-binding proteins, S100A8 and S100A9, are involved in the metabolism of arachidonic acid in human neutrophils. Journal of Biological Chemistry 274(46):32672-32679. 279. Berthier, S, Paclet, MH, Lerouge, S, et al. (2003). Changing the conformation state of cytochrome b558 initiates NADPH oxidase activation: MRP8/MRP14 regulation. Journal of Biological Chemistry 278(28):25499-254508. 280. Benedyk, M, Sopalla, C, Nacken, W, et al. (2007). HaCaT keratinocytes overexpressing the S100 proteins S100A8 and S100A9 show increased NADPH oxidase and NF-kappaB activities. Journal of Investigative Dermatology 127(8):2001-2011. 281. Vogl, T, Pröpper, C, Hartmann, M, et al. (1999). S100A12 is expressed exclusively by granulocytes and acts independently from MRP8 and MRP14. Journal of Biological Chemistry 274(36):25291-25296. 282. Roth, J, Burwinkel, F, Van den Bos, C, et al. (1993). MRP8 and MRP14, S-100-like proteins associated with myeloid differentiation, are translocated to plasma membrane and intermediate filaments in a calcium-dependent manner. Blood 82(6):1875-1883. 283. Thorey, IS, Roth, J, Regenbogen, J, et al. (2001). The Ca2+-binding proteins S100A8 and S100A9 are encoded by novel injury-regulated genes. Journal of Biological Chemistry 276(38):35818-35825. 284. Zaia, AA, Sappington, KJ, Nisapakultorn, K, et al. (2009). Subversion of antimicrobial calprotectin (S100A8/S100A9 complex) in the cytoplasm of TR146 epithelial cells after invasion by Listeria monocytogenes. Mucosal Immunology 2(1):43-53. 285. Foell, D, Frosch, M, Sorg, C, et al. (2004). Phagocyte-specific calcium-binding S100 proteins as clinical laboratory markers of inflammation. Clinica Chimica Acta 344(1– 2):37-51. 286. Foell, D, Hernández-Rodríguez, J, Sánchez, M, et al. (2004). Early recruitment of phagocytes contributes to the vascular inflammation of giant cell arteritis. Journal of Pathology 204(3):311-316. 287. Roth, J, Goebeler, M, and Sorg, C (2001). S100A8 and S100A9 in inflammatory diseases. Lancet 357(9261):1041. 288. Vitale, A and Denecke, J (1999). The endoplasmic reticulum—gateway of the secretory pathway. Plant Cell 11(4):615-628.

306

289. Tardif, MR, Chapeton-Montes, JA, Posvandzic, A, et al. (2015). Secretion of S100A8, S100A9, and S100A12 by neutrophils involves reactive oxygen species and potassium efflux. Journal of Immunology Research 2015:16. 290. Hermani, A, De Servi, B, Medunjanin, S, et al. (2006). S100A8 and S100A9 activate MAP kinase and NF-κB signaling pathways and trigger translocation of RAGE in human prostate cancer cells. Experimental Cell Research 312(2):184-197. 291. Boyd, JH, Kan, B, Roberts, H, et al. (2008). S100A8 and S100A9 mediate endotoxin- induced cardiomyocyte dysfunction via the receptor for advanced glycation end products. Circulation Research 102(10):1239-1246. 292. Ghavami, S, Rashedi, I, Dattilo, BM, et al. (2008). S100A8/A9 at low concentration promotes tumor cell growth via RAGE ligation and MAP-kinase dependent pathway. Journal of Leukocyte Biology 83(6):1484-1492. 293. Robinson, MJ, Tessier, P, Poulsom, R, et al. (2002). The S100 family heterodimer, MRP- 8/14, binds with high affinity to heparin and heparan sulfate glycosaminoglycans on endothelial cells. Journal of Biological Chemistry 277(5):3658-3665. 294. Vogl, T, Tenbrock, K, Ludwig, S, et al. (2007). Mrp8 and Mrp14 are endogenous activators of toll-like receptor 4, promoting lethal, endotoxin-induced shock. Nature Medicine 13(9):1042-1049. 295. Srikrishna, G, Panneerselvam, K, Westphal, V, et al. (2001). Two proteins modulating transendothelial migration of leukocytes recognize novel carboxylated glycans on endothelial cells. Journal of Immunology 166(7):4678-4688. 296. Opal, SM (2010). Endotoxins and other sepsis triggers. Contributions to Nephrology 167:14-24. 297. Barabé, F, Laouedj, M, and Tessier, P (2015). Myeloid-related protein S100A9 induces cellular differentiation in acute myeloid leukemia through TLR2 and TLR4 receptors. Blood 126(23):3858. 298. Arnold, V, Cummings, JS, Moreno-Nieves, UY, et al. (2013). S100A9 protein is a novel ligand for the CD85j receptor and its interaction is implicated in the control of HIV-1 replication by NK cells. Retrovirology 10:122. 299. Muramatsu, T (2016). Basigin (CD147), a multifunctional transmembrane glycoprotein with various binding partners. Journal of Biochemistry 159(5):481-490. 300. Hibino, T, Sakaguchi, M, Miyamoto, S, et al. (2013). S100A9 is a novel ligand of EMMPRIN that promotes melanoma metastasis. Cancer Research 73(1):172-183. 301. Sakaguchi, M, Yamamoto, M, Miyai, M, et al. (2016). Identification of an S100A8 Receptor Neuroplastin-β and its Heterodimer Formation with EMMPRIN. Journal of Investigative Dermatology 136(11):2240-2250. 302. Ruma, IM, Putranto, EW, Kondo, E, et al. (2016). MCAM, as a novel receptor for S100A8/A9, mediates progression of malignant melanoma through prominent activation of NF-kappaB and ROS formation upon ligand binding. Clinical & Experimental Metastasis 33(6):609-627. 303. Lin, C-R, Wei, T-YW, Tsai, H-Y, et al. (2015). Glycosylation-dependent interaction between CD69 and S100A8/S100A9 complex is required for regulatory T-cell differentiation. FASEB Journal 29(12):5006-5017. 304. Huttunen, HJ, Kuja-Panula, J, Sorci, G, et al. (2000). Coregulation of neurite outgrowth and cell survival by amphoterin and S100 proteins through receptor for advanced glycation end products (RAGE) activation. Journal of Biological Chemistry 275(51):40096-40105. 305. Alexanian, A and Bamburg, J (1999). Neuronal survival activity of S100ββ is enhanced by calcineurin inhibitors and requires activation of NF-κB. FASEB Journal 13(12):1611- 1620. 306. Most, P, Boerries, M, Eicher, C, et al. (2003). Extracellular S100A1 protein inhibits apoptosis in ventricular cardiomyocytes via activation of the extracellular signal- regulated protein kinase 1/2 (ERK1/2). Journal of Biological Chemistry 278(48):48404- 48412.

307

307. Leclerc, E, Fritz, G, Weibel, M, et al. (2007). S100B and S100A6 differentially modulate cell survival by interacting with distinct RAGE (receptor for advanced glycation end products) immunoglobulin domains. Journal of Biological Chemistry 282(43):31317- 31331. 308. Mariggio, M, Fulle, S, Calissano, P, et al. (1994). The brain protein S-100ab induces apoptosis in PC12 cells. Neuroscience 60(1):29-35. 309. Fulle, S, Pietrangelo, T, Mariggiò, MA, et al. (2000). Calcium and fos involvement in brain-derived Ca2+-binding protein (S100)-dependent apoptosis in rat phaeochromocytoma cells. Experimental Physiology 85(3):243-253. 310. Hu, J, Ferreira, A, and Van Eldik, LJ (1997). S100β induces neuronal cell death through nitric oxide release from astrocytes. Journal of Neurochemistry 69(6):2294-2301. 311. Schneider, M, Kostin, S, Strøm, CC, et al. (2007). S100A4 is upregulated in injured myocardium and promotes growth and survival of cardiac myocytes. Cardiovascular Research 75(1):40-50. 312. Schneider, M, Hansen, JL, and Sheikh, SP (2008). S100A4: a common mediator of epithelial–mesenchymal transition, fibrosis and regeneration in diseases? Journal of Molecular Medicine 86(5):507-522. 313. Komada, T, Araki, R, Nakatani, K, et al. (1996). Novel specific chemotactic receptor for S100L protein on guinea pig eosinophils. Biochemical and Biophysical Research Communications 220(3):871-874. 314. Emberley, ED, Murphy, LC, and Watson, PH (2004). S100 proteins and their influence on pro-survival pathways in cancer. Biochemistry and Cell Biology 82(4):508-515. 315. Jinquan, T, Vorum, H, Larsen, CG, et al. (1996). Psoriasin: a novel chemotactic protein. Journal of Investigative Dermatology 107(1):5-10. 316. Hobbs, JAR, May, R, Tanousis, K, et al. (2003). Myeloid Cell Function in MRP-14 (S100A9) Null Mice. Molecular and Cellular Biology 23(7):2564-2576. 317. Manitz, M-P, Horst, B, Seeliger, S, et al. (2003). Loss of S100A9 (MRP14) Results in Reduced Interleukin-8-Induced CD11b Surface Expression, a Polarized Microfilament System, and Diminished Responsiveness to Chemoattractants In Vitro. Molecular and Cellular Biology 23(3):1034-1043. 318. De Filippo, K, Neill, DR, Mathies, M, et al. (2014). A new protective role for S100A9 in regulation of neutrophil recruitment during invasive pneumococcal pneumonia. FASEB Journal 28(8):3600-3608. 319. Achouiti, A, Vogl, T, Van der Meer, AJ, et al. (2015). Myeloid-related protein-14 deficiency promotes inflammation in staphylococcal pneumonia. European Respiratory Journal 46(2):464-473. 320. Schnekenburger, J, Schick, V, Kruger, B, et al. (2008). The calcium binding protein S100A9 is essential for pancreatic leukocyte infiltration and induces disruption of cell- cell contacts. Journal of Cellular Physiology 216(2):558-567. 321. van Lent, PL, Grevers, LC, Blom, AB, et al. (2008). Stimulation of chondrocyte-mediated cartilage destruction by S100A8 in experimental murine arthritis. Arthritis & Rheumatology 58(12):3776-3787. 322. van Lent, PL, Grevers, L, Blom, AB, et al. (2008). Myeloid-related proteins S100A8/S100A9 regulate joint inflammation and cartilage destruction during antigen- induced arthritis. Annals of the Rheumatic Diseases 67(12):1750-1758. 323. van Lent, PLEM, Blom, AB, Schelbergen, RFP, et al. (2012). Active involvement of alarmins S100A8 and S100A9 in the regulation of synovial activation and joint destruction during mouse and human osteoarthritis. Arthritis & Rheumatism 64(5):1466- 1476. 324. Cesaro, A, Anceriz, N, Plante, A, et al. (2012). An inflammation loop orchestrated by S100A9 and calprotectin is critical for development of arthritis. PLoS ONE 7(9):e45478.

308

325. Kim, HJ, Chang, K-A, Ha, T-Y, et al. (2014). S100A9 knockout decreases the memory impairment and neuropathology in crossbreed mice of Tg2576 and S100A9 knockout mice model. PLoS ONE 9(2):e88924. 326. Dessing, MC, Tammaro, A, Pulskens, WP, et al. (2015). The calcium-binding protein complex S100A8/A9 has a crucial role in controlling macrophage-mediated renal repair following ischemia/reperfusion. Kidney International 87(1):85-94. 327. Lackmann, M, Rajasekariah, P, Iismaa, SE, et al. (1993). Identification of a chemotactic domain of the pro-inflammatory S100 protein CP-10. Journal of Immunology 150(7):2981-2991. 328. Cornish, CJ, Devery, JM, Poronnik, P, et al. (1996). S100 protein CP-10 stimulates myeloid cell chemotaxis without activation. Journal of Cellular Physiology 166(2):427- 437. 329. Ryckman, C, Vandal, K, Rouleau, P, et al. (2003). Proinflammatory activities of S100: proteins S100A8, S100A9, and S100A8/A9 induce neutrophil chemotaxis and adhesion. Journal of Immunology 170:3233-3242. 330. Newton, RA and Hogg, N (1998). The human S100 protein MRP-14 is a novel activator of the beta 2 integrin Mac-1 on neutrophils. Journal of Immunology 160(3):1427-1435. 331. Sroussi, HY, Berline, J, Dazin, P, et al. (2006). S100A8 triggers oxidation-sensitive repulsion of neutrophils. Journal of Dental Research 85(9):829-833. 332. Anceriz, N, Vandal, K, and Tessier, PA (2007). S100A9 mediates neutrophil adhesion to fibronectin through activation of beta2 integrins. Biochemical and Biophysical Research Communications 354(1):84-89. 333. Pruenster, M, Kurz, ARM, Chung, K-J, et al. (2015). Extracellular MRP8/14 is a regulator of β2 integrin-dependent neutrophil slow rolling and adhesion. Nature Communications 6:6915. 334. Simard, JC, Girard, D, and Tessier, PA (2010). Induction of neutrophil degranulation by S100A9 via a MAPK-dependent mechanism. Journal of Leukocyte Biology 87(5):905- 914. 335. Viemann, D, Strey, A, Janning, A, et al. (2005). Myeloid-related proteins 8 and 14 induce a specific inflammatory response in human microvascular endothelial cells. Blood 105(7):2955-2962. 336. Kerkhoff, C, Sorg, C, Tandon, NN, et al. (2001). Interaction of S100A8/S100A9- arachidonic acid complexes with the scavenger receptor CD36 may facilitate fatty acid uptake by endothelial cells. Biochemistry 40(1):241-248. 337. Wang, L, Luo, H, Chen, X, et al. (2014). Functional characterization of S100A8 and S100A9 in altering monolayer permeability of human umbilical endothelial cells. PLoS ONE 9(3):e90472. 338. Yonekawa, K, Neidhart, M, Altwegg, LA, et al. (2011). Myeloid related proteins activate Toll-like receptor 4 in human acute coronary syndromes. Atherosclerosis 218(2):486-492. 339. Riva, M, Kallberg, E, Bjork, P, et al. (2012). Induction of nuclear factor-kappaB responses by the S100A9 protein is Toll-like receptor-4-dependent. Immunology 137(2):172-182. 340. Lee, NR, Park, BS, Kim, SY, et al. (2016). Cytokine secreted by S100A9 via TLR4 in monocytes delays neutrophil apoptosis by inhibition of caspase 9/3 pathway. Cytokine 86:53-63. 341. Pouliot, P, Plante, I, Raquil, M-A, et al. (2008). Myeloid-related proteins rapidly modulate macrophage nitric oxide production during innate immune response. Journal of Immunology 181(5):3595-3601. 342. Sekimoto, R, Fukuda, S, Maeda, N, et al. (2015). Visualized macrophage dynamics and significance of S100A8 in obese fat. Proceedings of the National Academy of Sciences of the United States of America 112(16):E2058-E2066. 343. Chellan, B, Yan, L, Sontag, TJ, et al. (2014). IL-22 is induced by S100/calgranulin and impairs cholesterol efflux in macrophages by downregulating ABCG1. Journal of Lipid Research 55(3):443-454.

309

344. Mazon, JN, de Mello, AH, Ferreira, GK, et al. (2017). The impact of obesity on neurodegenerative diseases. Life Sciences 182:22-28. 345. Lodeiro, M, Puerta, E, Ismail, MA, et al. (2017). Aggregation of the inflammatory S100A8 precedes abeta plaque formation in transgenic APP mice: positive feedback for S100A8 and abeta productions. Journals of Gerontology. Series A, Biological Sciences and Medical Sciences 72(3):319-328. 346. Ma, L, Sun, P, Zhang, JC, et al. (2017). Proinflammatory effects of S100A8/A9 via TLR4 and RAGE signaling pathways in BV-2 microglial cells. International Journal of Molecular Medicine 40(1):31-38. 347. Grevers, LC, de Vries, TJ, Vogl, T, et al. (2011). S100A8 enhances osteoclastic bone resorption in vitro through activation of Toll-like receptor 4: implications for bone destruction in murine antigen-induced arthritis. Arthritis & Rheumatology 63(5):1365- 1375. 348. Gao, H, Zhang, X, Zheng, Y, et al. (2015). S100A9-induced release of interleukin (IL)-6 and IL-8 through toll-like receptor 4 (TLR4) in human periodontal ligament cells. Molecular Immunology 67(2 Pt B):223-232. 349. Simard, J-C, Cesaro, A, Chapeton-Montes, J, et al. (2013). S100A8 and S100A9 induce cytokine expression and regulate the NLRP3 inflammasome via ROS-dependent activation of NF-κB1. PLoS ONE 8(8):e72138. 350. Nicaise, C, Weichselbaum, L, Schandene, L, et al. (2017). Phagocyte-specific S100A8/A9 is upregulated in primary Sjogren's syndrome and triggers the secretion of pro-inflammatory cytokines in vitro. Clinical and Experimental Rheumatology 35(1):129-136. 351. Sun, Y, Lu, Y, Engeland, CG, et al. (2013). The anti-oxidative, anti-inflammatory, and protective effect of S100A8 in endotoxemic mice. Molecular Immunology 53(4):443-449. 352. Zhao, J, Endoh, I, Hsu, K, et al. (2011). S100A8 modulates mast cell function and suppresses eosinophil migration in acute asthma. Antioxidants & Redox Signaling 14(9):1589-1600. 353. Bonfield, TL, Konstan, MW, Burfeind, P, et al. (1995). Normal bronchial epithelial cells constitutively produce the anti-inflammatory cytokine interleukin-10, which is downregulated in cystic fibrosis. American Journal of Respiratory Cell and Molecular Biology 13(3):257-261. 354. Takanashi, S, Hasegawa, Y, Kanehira, Y, et al. (1999). Interleukin-10 level in sputum is reduced in bronchial asthma, COPD and in smokers. European Respiratory Journal 14:309-314. 355. Aguiar-Passeti, T, Postol, E, Sorg, C, et al. (1997). Epithelioid cells from foreign-body granuloma selectively express the calcium-binding protein MRP-14, a novel down- regulatory molecule of macrophage activation. Journal of Leukocyte Biology 62(6):852- 858. 356. Ikemoto, M, Murayama, H, Itoh, H, et al. (2007). Intrinsic function of S100A8/A9 complex as an anti-inflammatory protein in liver injury induced by lipopolysaccharide in rats. Clinica Chimica Acta 376(1-2):197-204. 357. Tsan, MF and Gao, B (2004). Endogenous ligands of Toll-like receptors. Journal of Leukocyte Biology 76(3):514-519. 358. Iismaa, S, Hu, S, Kocher, M, et al. (1994). Recombinant and cellular expression of the murine chemotactic protein, CP-10. DNA and Cell Biology 13(2):183-192. 359. Alexander, C and Rietschel, ET (2001). Bacterial lipopolysaccharides and innate immunity. Journal of Endotoxin Research 7(3):167-202. 360. Sukkar, MB, Ullah, MA, Gan, WJ, et al. (2012). RAGE: a new frontier in chronic airways disease. British Journal of Pharmacology 167(6):1161-1176. 361. Heidland, A, Klassen, A, Rutkowski, P, et al. (2006). The contribution of Rudolf Virchow to the concept of inflammation: what is still of importance? Journal of Nephrology 19 Suppl 10:S102-S109.

310

362. Shalapour, S and Karin, M (2015). Immunity, inflammation, and cancer: an eternal fight between good and evil. Journal of Clinical Investigation 125(9):3347-3355. 363. Hanahan, D and Weinberg, Robert A (2011). Hallmarks of cancer: the next generation. Cell 144(5):646-674. 364. Bozinovski, S, Vlahos, R, Anthony, D, et al. (2016). COPD and squamous cell lung cancer: aberrant inflammation and immunity is the common link. British Journal of Pharmacology 173(4):635-648. 365. Young, RP, Duan, F, Chiles, C, et al. (2015). Airflow limitation and histology shift in the national lung screening trial. The NLST-ACRIN cohort substudy. American Journal of Respiratory and Critical Care Medicine 192(9):1060-1067. 366. Anthonisen, NR, Connett, JE, Kiley, JP, et al. (1994). Effects of smoking intervention and the use of an inhaled anticholinergic bronchodilator on the rate of decline of FEV1. The Lung Health Study. Jama 272(19):1497-1505. 367. Chang, SH, Mirabolfathinejad, SG, Katta, H, et al. (2014). T helper 17 cells play a critical pathogenic role in lung cancer. Proceedings of the National Academy of Sciences of the United States of America 111(15):5664-5669. 368. Ohshima, H, Tatemichi, M, and Sawa, T (2003). Chemical basis of inflammation-induced carcinogenesis. Archives of Biochemistry and Biophysics 417(1):3-11. 369. Fuchs-Tarlovsky, V (2013). Role of antioxidants in cancer therapy. Nutrition 29(1):15- 21. 370. Thiery, JP (2002). Epithelial-mesenchymal transitions in tumour progression. Nature Reviews Cancer 2(6):442-454. 371. Hirsch, FR, Suda, K, Wiens, J, et al. (2016). New and emerging targeted treatments in advanced non-small-cell lung cancer. Lancet 388(10048):1012-1024. 372. Kerr, EM and Martins, CP (2017). Metabolic rewiring in mutant Kras lung cancer. FEBS Journal 285(1):28-41. 373. Satoh, T, Nakafuku, M, and Kaziro, Y (1992). Function of Ras as a molecular switch in signal transduction. Journal of Biological Chemistry 267:24149-24149. 374. Prior, IA, Lewis, PD, and Mattos, C (2012). A comprehensive survey of Ras mutations in cancer. Cancer Research 72(10):2457-2467. 375. Okayama, H, Saito, M, Oue, N, et al. (2013). NOS2 enhances KRAS-induced lung carcinogenesis, inflammation and microRNA-21 expression. International Journal of Cancer 132(1):9-18. 376. Chen, J, Zeng, F, Forrester, SJ, et al. (2016). Expression and function of the epidermal growth factor receptor in physiology and disease. Physiological Reviews 96(3):1025- 1069. 377. Barnes, TA, O’Kane, GM, Vincent, MD, et al. (2017). Third-generation tyrosine kinase inhibitors targeting epidermal growth factor receptor mutations in non-small cell lung cancer. Frontiers in Oncology 7:113. 378. Laurie, SA and Goss, GD (2013). Role of epidermal growth factor receptor inhibitors in epidermal growth factor receptor wild-type non–small-cell lung cancer. Journal of Clinical Oncology 31(8):1061-1069. 379. Lee, H-C, An, S, Lee, H, et al. (2008). Activation of epidermal growth factor receptor and its downstream signaling pathway by nitric oxide in response to ionizing radiation. Molecular Cancer Research 6(6):996-1002. 380. Harada, D, Takigawa, N, and Kiura, K (2014). The role of STAT3 in non-small cell lung cancer. Cancers 6(2):708-722. 381. Liu, N, Li, Y, Su, S, et al. (2013). Inhibition of cell migration by ouabain in the A549 human lung cancer cell line. Oncology Letters 6(2):475-479 382. Roskoski, R, Jr. (2017). Anaplastic lymphoma kinase (ALK) inhibitors in the treatment of ALK-driven lung cancers. Pharmacological Research 117:343-356. 383. Palmer, Ruth H, Vernersson, E, Grabbe, C, et al. (2009). Anaplastic lymphoma kinase: signalling in development and disease. Biochemical Journal 420(3):345.

311

384. Thomas, A, Liu, SV, Subramaniam, DS, et al. (2015). Refining the treatment of NSCLC according to histological and molecular subtypes. Nature Reviews Clinical oncology 12(9):511-526. 385. Scarpa, E-S and Ninfali, P (2015). Phytochemicals as innovative therapeutic tools against cancer stem cells. International Journal of Molecular Sciences 16(7):15727. 386. Zakaria, N, Satar, NA, Abu Halim, NH, et al. (2017). Targeting lung cancer stem cells: research and clinical impacts. Frontiers in Oncology 7:80. 387. Templeton, AK, Miyamoto, S, Babu, A, et al. (2014). Cancer stem cells: progress and challenges in lung cancer. Stem Cell Investigation 1:9. 388. He, B, You, L, Uematsu, K, et al. (2004). A monoclonal antibody against Wnt-1 induces apoptosis in human cancer cells. Neoplasia 6(1):7-14. 389. You, L, He, B, Xu, Z, et al. (2004). Inhibition of Wnt-2-mediated signaling induces programmed cell death in non-small-cell lung cancer cells. Oncogene 23(36):6170-6174. 390. Yanagi, S, Kishimoto, H, Kawahara, K, et al. (2007). Pten controls lung morphogenesis, bronchioalveolar stem cells, and onset of lung adenocarcinomas in mice. Journal of Clinical Investigation 117(10):2929-2940. 391. Tiozzo, C, Langhe, SD, Yu, M, et al. (2009). Deletion of Pten expands lung epithelial progenitor pools and confers resistance to airway injury. American Journal of Respiratory and Critical Care Medicine 180(8):701-712. 392. Justilien, V, Regala, RP, Tseng, IC, et al. (2012). Matrix metalloproteinase-10 is required for lung cancer stem cell maintenance, tumor initiation and metastatic potential. PLoS ONE 7(4):e35040. 393. Regala, RP, Justilien, V, Walsh, MP, et al. (2011). Matrix metalloproteinase-10 promotes Kras-mediated bronchio-alveolar stem cell expansion and lung cancer formation. PLoS ONE 6(10):e26439. 394. Lapidot, T, Sirard, C, Vormoor, J, et al. (1994). A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367(6464):645-648. 395. Toh, C-K, Gao, F, Lim, W-T, et al. (2007). Differences between small-cell lung cancer and non-small-cell lung cancer among tobacco smokers. Lung Cancer 56(2):161-166. 396. Eramo, A, Lotti, F, Sette, G, et al. (2007). Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death & Differentiation 15(3):504-514. 397. Denton, EJ, Hart, D, Wainer, Z, et al. (2016). Changing trends in diagnosis, staging, treatment and survival in lung cancer: comparison of three consecutive cohorts in an Australian lung cancer centre. Internal Medicine Journal 46(8):946-954. 398. Hardavella, G, George, R, and Sethi, T (2016). Lung cancer stem cells—characteristics, phenotype. Translational Lung Cancer Research 5(3):272-279. 399. Hanahan, D and Weinberg, RA (2000). The hallmarks of cancer. Cell 100(1):57-70. 400. Folkman, J (1990). What is the evidence that tumors are angiogenesis dependent? CancerSpectrum Knowledge Environment 82(1):4-6. 401. Gradin, K, McGuire, J, Wenger, RH, et al. (1996). Functional interference between hypoxia and dioxin signal transduction pathways: competition for recruitment of the Arnt transcription factor. Molecular and Cellular Biology 16(10):5221-5231. 402. Jackson, AL, Zhou, B, and Kim, WY (2010). HIF, hypoxia and the role of angiogenesis in non-small cell lung cancer. Expert Opinion on Therapeutic Targets 14(10):1047-1057. 403. Masoud, GN and Li, W (2015). HIF-1α pathway: role, regulation and intervention for cancer therapy. Acta Pharmaceutica Sinica B 5(5):378-389. 404. Ellis, LM and Hicklin, DJ (2008). VEGF-targeted therapy: mechanisms of anti-tumour activity. Nature Reviews Cancer 8(8):579-591. 405. Rivas-Fuentes, S, Salgado-Aguayo, A, Pertuz Belloso, S, et al. (2015). Role of chemokines in non-small cell lung cancer: angiogenesis and inflammation. Journal of Cancer 6(10):938-952. 406. Giatromanolaki, A, Koukourakis, M, Sivridis, E, et al. (2001). Relation of hypoxia inducible factor 1α and 2α in operable non-small cell lung cancer to angiogenic/molecular profile of tumours and survival. British Journal of Cancer 85(6):881.

312

407. Kim, SJ, Rabbani, ZN, Dewhirst, MW, et al. (2005). Expression of HIF-1α, CA IX, VEGF, and MMP-9 in surgically resected non-small cell lung cancer. Lung Cancer 49(3):325-335. 408. Ohri, CM, Shikotra, A, Green, RH, et al. (2011). The tissue microlocalisation and cellular expression of CD163, VEGF, HLA-DR, iNOS, and MRP 8/14 is correlated to clinical outcome in NSCLC. PLoS ONE 6(7):e21874. 409. Luisa, B, Beatrice, C, Caterina, B, et al. (2014). Inflammatory cytokines and VEGF measured in exhaled breath condensate are correlated with tumor mass in non-small cell lung cancer. Journal of Breath Research 8(2):027110. 410. Kim, WY, Perera, S, Zhou, B, et al. (2009). HIF2α cooperates with RAS to promote lung tumorigenesis in mice. Journal of Clinical Investigation 119(8):2160-2170. 411. Zhang, B, Zhang, Y, Yao, G, et al. (2012). M2-polarized macrophages promote metastatic behavior of Lewis lung carcinoma cells by inducing vascular endothelial growth factor-C expression. Clinics 67(8):901 -906. 412. Rahimi, N (2012). The ubiquitin-proteasome system meets angiogenesis. Molecular Cancer Therapeutics 11(3):538-548. 413. Yoshimura, T, Howard, OZ, Ito, T, et al. (2013). Monocyte chemoattractant protein- 1/CCL2 produced by stromal cells promotes lung metastasis of 4T1 murine breast cancer cells. PLoS ONE 8(3):e58791. 414. Salcedo, R, Ponce, ML, Young, HA, et al. (2000). Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood 96(1):34-40. 415. Stamatovic, SM, Keep, RF, Mostarica-Stojkovic, M, et al. (2006). CCL2 regulates angiogenesis via activation of Ets-1 transcription factor. Journal of Immunology 177(4):2651-2661. 416. Park, JY, Park, KH, Bang, S, et al. (2007). CXCL5 overexpression is associated with late stage gastric cancer. Journal of Cancer Research and Clinical Oncology 133(11):835- 840. 417. Singh, S, Wu, S, Varney, M, et al. (2011). CXCR1 and CXCR2 silencing modulates CXCL8-dependent endothelial cell proliferation, migration and capillary-like structure formation. Microvascular Research 82(3):318-325. 418. Addison, CL, Arenberg, DA, Morris, SB, et al. (2000). The CXC chemokine, monokine induced by interferon-gamma, inhibits non-small cell lung carcinoma tumor growth and metastasis. Human Gene Therapy 11(2):247-261. 419. Arenberg, DA, Kunkel, SL, Polverini, PJ, et al. (1996). Interferon-gamma-inducible protein 10 (IP-10) is an angiostatic factor that inhibits human non-small cell lung cancer (NSCLC) tumorigenesis and spontaneous metastases. Journal of Experimental Medicine 184(3):981-992. 420. Fan, R, Hou, W-J, Zhao, Y-J, et al. (2016). Overexpression of HPV16 E6/E7 mediated HIF-1α upregulation of GLUT1 expression in lung cancer cells. Tumor Biology 37(4):4655-4663. 421. Warburg, O, Wind, F, and Negelein, E (1927). The metabolism of tumors in the body Journal of General Physiology 8(6):519-530. 422. Li, Z and Zhang, H (2016). Reprogramming of glucose, fatty acid and amino acid metabolism for cancer progression. Cellular and Molecular Life Sciences 73(2):377-392. 423. Closs, EI, Boissel, JP, Habermeier, A, et al. (2006). Structure and function of cationic amino acid transporters (CATs). The Journal of Membrane Biology 213(2):67-77. 424. Katusic, ZS (2007). Mechanisms of endothelial dysfunction induced by aging: role of arginase I. Circulation Research 101(7):640-641. 425. Scott, L, Lamb, J, Smith, S, et al. (2000). Single amino acid (arginine) deprivation: rapid and selective death of cultured transformed and malignant cells. British Journal of Cancer 83(6):800-810. 426. Patil, MD, Bhaumik, J, Babykutty, S, et al. (2016). Arginine dependence of tumor cells: targeting a chink in cancer's armor. Oncogene 35(38):4957-4972.

313

427. Ozcan, A and Ogun, M, Biochemistry of reactive oxygen and nitrogen species, in Basic Principles and Clinical Significance of Oxidative Stress, S.J.T. Gowder, Editor. 2015, InTech: Rijeka. p. Ch. 03. 428. Ray, PD, Huang, B-W, and Tsuji, Y (2012). Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cellular Signalling 24(5):981-990. 429. Hebelstrup, KH and Møller, IM, (2015). Mitochondrial signaling in plants under hypoxia: use of reactive oxygen species (ROS) and reactive nitrogen species (RNS), in Reactive Oxygen and Nitrogen Species Signaling and Communication in Plants. Springer International Publishing: 63-77. 430. Jayaraman, P, Parikh, F, Lopez-Rivera, E, et al. (2012). Tumor-expressed inducible nitric oxide synthase controls induction of functional myeloid-derived suppressor cells through modulation of vascular endothelial growth factor release. Journal of Immunology 188(11):5365-5376. 431. Parker, KH, Beury, DW, and Ostrand-Rosenberg, S (2015). Myeloid-derived suppressor cells: critical cells driving immune suppression in the tumor microenvironment. Advances in Cancer Research 128:95-139. 432. Hirst, D and Robson, T (2010). Nitric oxide in cancer therapeutics: interaction with cytotoxic chemotherapy. Current Pharmaceutical Design 16(4):411-420 433. Comhair, SAA and Erzurum, SC (2002). Antioxidant responses to oxidant-mediated lung diseases. American Journal of Physiology - Lung Cellular and Molecular Physiology 283(2):L246-L255. 434. Alexandre, J, Batteux, F, Nicco, C, et al. (2006). Accumulation of hydrogen peroxide is an early and crucial step for paclitaxel-induced cancer cell death both in vitro and in vivo. International Journal of Cancer 119(1):41-48. 435. Fukumura, D, Kashiwagi, S, and Jain, RK (2006). The role of nitric oxide in tumour progression. Nature Reviews: Cancer 6(7):521-534. 436. Ridnour, LA, Thomas, DD, Donzelli, S, et al. (2006). The biphasic nature of nitric oxide responses in tumor biology. Antioxidants & Redox Signaling 8(7&8):1329-1337. 437. Masri, FA, Comhair, SAA, Koeck, T, et al. (2005). Abnormalities in nitric oxide and its derivatives in lung cancer. American Journal of Respiratory and Critical Care Medicine 172(5):597-605. 438. Yasuda, H (2008). Solid tumor physiology and hypoxia-induced chemo/radio-resistance: novel strategy for cancer therapy: nitric oxide donor as a therapeutic enhancer. Nitric Oxide 19(2):205-216. 439. Ye, S, Yang, W, Wang, Y, et al. (2012). Cationic liposome-mediated nitric oxide synthase gene therapy enhances the antitumor effects of cisplatin in lung cancer. International Journal of Molecular Medicine 31(1):33-42. 440. Speranza, L, De Lutiis, M, Shaik, Y, et al. (2007). Localization and activity of iNOS in normal human lung tissue and lung cancer tissue. International Journal of Biological Markers 22(3):226-231. 441. Leon-Bollotte, L, Subramaniam, S, Cauvard, O, et al. (2011). S-nitrosylation of the death receptor Fas promotes Fas ligand–mediated apoptosis in cancer cells. Gastroenterology 140(7):2009-2018.e4. 442. Connor, KM, Hempel, N, Nelson, KK, et al. (2007). Manganese superoxide dismutase enhances the invasive and migratory activity of tumor cells. Cancer Research 67(21):10260-10267. 443. Hempel, N, Carrico, PM, and Melendez, JA (2011). Manganese superoxide dismutase (Sod2) and redox-control of signaling events that drive metastasis. Anti-Cancer Agents in Medicinal Chemistry 11(2):191-201. 444. Nelson, KK, Ranganathan, AC, Mansouri, J, et al. (2003). Elevated SOD2 activity augments matrix metalloproteinase expression: evidence for the involvement of endogenous hydrogen peroxide in regulating metastasis. Clinical Cancer Research 9(1):424-432.

314

445. Gupta, A, Butts, B, Kwei, KA, et al. (2001). Attenuation of catalase activity in the malignant phenotype plays a functional role in an in vitro model for tumor progression. Cancer Letters 173(2):115-125. 446. Nishikawa, M, Tamada, A, Kumai, H, et al. (2002). Inhibition of experimental pulmonary metastasis by controlling biodistribution of catalase in mice. International Journal of Cancer 99(3):474-479. 447. Brigelius-Flohé, R and Kipp, A (2009). Glutathione peroxidases in different stages of carcinogenesis. Biochimica et Biophysica Acta (BBA) - General Subjects 1790(11):1555- 1568. 448. Kim, J-H, Bogner, PN, Baek, S-H, et al. (2008). Up-regulation of peroxiredoxin 1 in lung cancer and its implication as a prognostic and therapeutic target. Clinical Cancer Research 14(8):2326-2333. 449. Yun, H-M, Park, K-R, Park, MH, et al. (2015). PRDX6 promotes tumor development via the JAK2/STAT3 pathway in a urethane-induced lung tumor model. Free Radical Biology and Medicine 80:136-144. 450. Neumann, CA, Krause, DS, Carman, CV, et al. (2003). Essential role for the peroxiredoxin Prdx1 in erythrocyte antioxidant defence and tumour suppression. Nature 424(6948):561-565. 451. Rhee, SG (2016). Overview on peroxiredoxin. Molecules and Cells 39(1):1-5. 452. Csiki, I, Yanagisawa, K, Haruki, N, et al. (2006). Thioredoxin-1 modulates transcription of cyclooxygenase-2 via hypoxia-inducible factor-1α in non–small cell lung cancer. Cancer Research 66(1):143-150. 453. Karlenius, TC and Tonissen, KF (2010). Thioredoxin and cancer: a role for thioredoxin in all states of tumor oxygenation. Cancers 2(2):209-232. 454. Fernandes, AP, Capitanio, A, Selenius, M, et al. (2009). Expression profiles of thioredoxin family proteins in human lung cancer tissue: correlation with proliferation and differentiation. Histopathology 55(3):313-320. 455. Soini, Y, Kahlos, K, Näpänkangas, U, et al. (2001). Widespread expression of thioredoxin and thioredoxin reductase in non-small cell lung carcinoma. Clinical Cancer Research 7(6):1750-1757. 456. Yoo, M-H, Xu, X-M, Carlson, BA, et al. (2006). Thioredoxin reductase 1 deficiency reverses tumor phenotype and tumorigenicity of lung carcinoma cells. Journal of Biological Chemistry 281(19):13005-13008. 457. Takaishi, M, Shimada, A, Suzuki, JS, et al. (2010). Involvement of metallothionein (MT) as a biological protective factor against carcinogenesis induced by benzo [a] pyrene (B [a] P). Journal of Toxicological Sciences 35(2):225-230. 458. Werynska, B, Pula, B, Muszczynska-Bernhard, B, et al. (2011). Correlation between expression of metallothionein and expression of Ki-67 and MCM-2 proliferation markers in non-small cell lung cancer. Anticancer Research 31(9):2833-2839. 459. Werynska, B, Pula, B, Muszczynska-Bernhard, B, et al. (2013). Metallothionein 1F and 2A overexpression predicts poor outcome of non-small cell lung cancer patients. Experimental and Molecular Pathology 94(1):301-308. 460. Werynska, B, Pula, B, Kobierzycki, C, et al. (2015). Metallothioneins in the lung cancer. Folia Histochemica et Cytobiologica 53(1):1-10. 461. Skrzypek, K, Tertil, M, Golda, S, et al. (2013). Interplay between heme oxygenase-1 and miR-378 affects non-small cell lung carcinoma growth, vascularization, and metastasis. Antioxidants & Redox Signaling 19(7):644-660. 462. Tsai, J-R, Wang, H-M, Liu, P-L, et al. (2012). High expression of heme oxygenase-1 is associated with tumor invasiveness and poor clinical outcome in non-small cell lung cancer patients. Cellular Oncology 35(6):461-471. 463. Hirai, K, Sasahira, T, Ohmori, H, et al. (2007). Inhibition of heme oxygenase-1 by zinc protoporphyrin IX reduces tumor growth of LL/2 lung cancer in C57BL mice. International Journal of Cancer 120(3):500-505.

315

464. Miar, A, Hevia, D, Muñoz-Cimadevilla, H, et al. (2015). Manganese superoxide dismutase (SOD2/MnSOD)/catalase and SOD2/GPx1 ratios as biomarkers for tumor progression and metastasis in prostate, colon, and lung cancer. Free Radical Biology and Medicine 85:45-55. 465. Glasauer, A, Sena, LA, Diebold, LP, et al. (2014). Targeting SOD1 reduces experimental non-small-cell lung cancer. Journal of Clinical Investigation 124(1):117-128. 466. Rhee, SG, Kang, SW, Chang, TS, et al. (2001). Peroxiredoxin, a novel family of peroxidases. International Union of Biochemistry and Molecular Biology Life 52(1):35- 41. 467. Chang, JW, Jeon, HB, Lee, JH, et al. (2001). Augmented expression of peroxiredoxin I in lung cancer. Biochemical and Biophysical Research Communications 289(2):507-512. 468. Yang, K-S, Kang, SW, Woo, HA, et al. (2002). Inactivation of human peroxiredoxin I during catalysis as the result of the oxidation of the catalytic site cysteine to cysteine- sulfinic acid. Journal of Biological Chemistry 277(41):38029-38036. 469. Chae, HZ, Chung, SJ, and Rhee, SG (1994). Thioredoxin-dependent peroxide reductase from yeast. Journal of Biological Chemistry 269(44):27670-27678. 470. Matsui, M, Oshima, M, Oshima, H, et al. (1996). Early embryonic lethality caused by targeted disruption of the mouse thioredoxin gene. Developmental Biology 178(1):179- 185. 471. Dunn, LL, Buckle, AM, Cooke, JP, et al. (2010). The emerging role of the thioredoxin system in angiogenesis Arteriosclerosis, Thrombosis, and Vascular Biology 30(11):2089- 2098. 472. Du, Y, Zhang, H, Zhang, X, et al. (2013). Thioredoxin 1 is inactivated due to oxidation induced by peroxiredoxin under oxidative stress and reactivated by the glutaredoxin system. Journal of Biological Chemistry 288(45):32241-32247. 473. Fan, J, Yu, H, Lv, Y, et al. (2016). Diagnostic and prognostic value of serum thioredoxin and DJ-1 in non-small cell lung carcinoma patients. Tumor Biology 37(2):1949-1958. 474. Welsh, SJ, Bellamy, WT, Briehl, MM, et al. (2002). The redox protein thioredoxin-1 (Trx-1) increases hypoxia-inducible factor 1α protein expression Trx-1 overexpression results in increased vascular endothelial growth factor production and enhanced tumor angiogenesis. Cancer research 62(17):5089-5095. 475. Liang, G-Y, Lu, S-X, Xu, G, et al. (2013). Expression of metallothionein and Nrf2 pathway genes in lung cancer and cancer-surrounding tissues. World Journal of Surgical Oncology 11(1):199. 476. Kolahian, S, Öz, HH, Zhou, B, et al. (2016). The emerging role of myeloid-derived suppressor cells in lung diseases. European Respiratory Journal 47(3): 967-977. 477. Young, MR, Newby, M, and Wepsic, HT (1987). Hematopoiesis and suppressor bone marrow cells in mice bearing large metastatic Lewis lung carcinoma tumors. Cancer Research 47(1):100-105. 478. Colombo, MP and Piconese, S (2007). Regulatory T-cell inhibition versus depletion: the right choice in cancer immunotherapy. Nature Reviews Cancer 7(11):880-887. 479. Wynn, T (2013). Myeloid-cell differentiation redefined in cancer. Nature Immunology 14(3):197-199. 480. Gabrilovich, DI, Bronte, V, Chen, S-H, et al. (2007). The terminology issue for myeloid- derived suppressor cells. Cancer Research 67(1):425-425. 481. Almand, B, Resser, JR, Lindman, B, et al. (2000). Clinical significance of defective dendritic cell differentiation in cancer. Clinical Cancer Research 6(5):1755. 482. Nagaraj, S, Youn, J-I, and Gabrilovich, DI (2013). Reciprocal relationship between myeloid-derived suppressor cells and T cells. Journal of Immunology 191(1):17-23. 483. Gabrilovich, DI (2017). Myeloid-derived suppressor cells. Cancer Immunology Research 5(1):3-8. 484. Gabrilovich, DI, Ostrand-Rosenberg, S, and Bronte, V (2012). Coordinated regulation of myeloid cells by tumours. Nature Reviews Immunology 12:253-268.

316

485. Bronte, V, Brandau, S, Chen, S-H, et al. (2016). Recommendations for myeloid-derived suppressor cell nomenclature and characterization standards. Nature Communications 7:12150. 486. Condamine, T, Mastio, J, and Gabrilovich, DI (2015). Transcriptional regulation of myeloid-derived suppressor cells. Journal of Leukocyte Biology 98(6):913-922. 487. Gabrilovich, DI and Nagaraj, S (2009). Myeloid-derived suppressor cells as regulators of the immune system. Nature Reviews Immunology 9(3):162-174. 488. Condamine, T, Ramachandran, I, Youn, J-I, et al. (2015). Regulation of tumor metastasis by myeloid-derived suppressor cells. Annual Review of Medicine 66(1):97-110. 489. Kumar, V, Patel, S, Tcyganov, E, et al. (2016). The nature of myeloid-derived suppressor cells in the tumor microenvironment. Trends in Immunology 37(3):208-220. 490. Marvel, D and Gabrilovich, DI (2015). Myeloid-derived suppressor cells in the tumor microenvironment: expect the unexpected. Journal of Clinical Investigation 125(9):3356-3364. 491. Liu, C-Y, Wang, Y-M, Wang, C-L, et al. (2010). Population alterations of l-arginase- and inducible nitric oxide synthase-expressed CD11b+/CD14-/CD15+/CD33+ myeloid- derived suppressor cells and CD8+ T lymphocytes in patients with advanced-stage non- small cell lung cancer. Journal of Cancer Research & Clinical Oncology 136(1):35-45. 492. Srivastava, MK, Zhu, L, Harris-White, M, et al. (2012). Myeloid suppressor cell depletion augments antitumor activity in lung cancer. PLoS ONE 7(7):e40677. 493. Sharma, S, Dubinett, S, and Salgia, R (2012). CD14+S100A9+ myeloid-derived suppressor cells portend decreased survival in patients with advanced lung cancer. American Journal of Respiratory and Critical Care Medicine 186(10):940-941. 494. Zhang, G, Huang, H, Zhu, Y, et al. (2015). A novel subset of B7-H3+CD14+HLA-DR- /low myeloid-derived suppressor cells are associated with progression of human NSCLC. Oncoimmunology 4(2):e977164. 495. Huang, A, Zhang, B, Wang, B, et al. (2013). Increased CD14+HLA-DR-/low myeloid- derived suppressor cells correlate with extrathoracic metastasis and poor response to chemotherapy in non-small cell lung cancer patients. Cancer Immunology, Immunotherapy 62(9):1439-1451. 496. Vetsika, EK, Koinis, F, Gioulbasani, M, et al. (2014). A circulating subpopulation of monocytic myeloid-derived suppressor cells as an independent prognostic/predictive factor in untreated non-small lung cancer patients. Journal of Immunology Research 2014:659294. 497. Hiratsuka, S, Watanabe, A, Sakurai, Y, et al. (2008). The S100A8-serum amyloid A3- TLR4 paracrine cascade establishes a pre-metastatic phase. Nature Cell Biology 10:1349- 1355. 498. Vernon, PJ, Loux, TJ, Schapiro, NE, et al. (2013). The receptor for advanced glycation end products promotes pancreatic carcinogenesis and accumulation of myeloid-derived suppressor cells. Journal of Immunology 190(3):1372-1379. 499. Ostrand-Rosenberg, S and Sinha, P (2009). Myeloid-derived suppressor cells: linking inflammation and cancer. Journal of Immunology 182(8):4499-4506. 500. Sinha, P, Chornoguz, O, Clements, VK, et al. (2011). Myeloid-derived suppressor cells express the death receptor Fas and apoptose in response to T cell–expressed FasL. Blood 117(20):5381-5390. 501. Liu, C-Y, Wang, Y-M, Wang, C-L, et al. (2010). Population alterations of l-arginase- and inducible nitric oxide synthase-expressed CD11b+/CD14−/CD15+/CD33+ myeloid- derived suppressor cells and CD8+ T lymphocytes in patients with advanced-stage non- small cell lung cancer. Journal of Cancer Research and Clinical Oncology 136(1):35-45. 502. Chen, Y, Pan, G, Tian, D, et al. (2017). Functional analysis of CD14+HLA-DR-/low myeloid-derived suppressor cells in patients with lung squamous cell carcinoma. Oncology Letters 14(1):349-354. 503. Youn, J-I, Nagaraj, S, Collazo, M, et al. (2008). Subsets of myeloid-derived suppressor cells in tumor-bearing mice. Journal of Immunology 181(8):5791-5802.

317

504. Dolcetti, L, Peranzoni, E, Ugel, S, et al. (2010). Hierarchy of immunosuppressive strength among myeloid-derived suppressor cell subsets is determined by GM-CSF. European Journal of Immunology 40(1):22-35. 505. Levy, L, Mishalian, I, Bayuch, R, et al. (2015). Splenectomy inhibits non-small cell lung cancer growth by modulating anti-tumor adaptive and innate immune response. OncoImmunology 4(4):e998469. 506. Youn, J-I, Kumar, V, Collazo, M, et al. (2013). Epigenetic silencing of retinoblastoma gene regulates pathologic differentiation of myeloid cells in cancer. Nature Immunology 14(3):211-220. 507. Kim, H-J and Cantor, H (2014). CD4 T-cell subsets and tumor immunity: the helpful and the not-so-helpful. Cancer Immunology Research 2(2):91-98. 508. Prado-Garcia, H, Aguilar-Cazares, D, Flores-Vergara, H, et al. (2005). Effector, memory and naïve CD8+ T cells in peripheral blood and pleural effusion from lung adenocarcinoma patients. Lung Cancer 47(3):361-371. 509. Mittrücker, H-w, Visekruna, A, and Huber, M (2014). Heterogeneity in the differentiation and function of CD8+ T cells. Archivum Immunologiae et Therapiae Experimentalis 62(6):449-458. 510. Hodge, G, Hodge, S, Li-Liew, C, et al. (2012). Increased natural killer T-like cells are a major source of pro-inflammatory cytokines and granzymes in lung transplant recipients. Respirology 17(1):155-163. 511. Hodge, G, Mukaro, V, Holmes, M, et al. (2013). Enhanced cytotoxic function of natural killer and natural killer T-like cells associated with decreased CD94 (Kp43) in the chronic obstructive pulmonary disease airway. Respirology 18(2):369-376. 512. Ye, SL, Li, XY, Zhao, K, et al. (2017). High expression of CD8 predicts favorable prognosis in patients with lung adenocarcinoma: A cohort study. Medicine (Baltimore) 96(15):e6472. 513. Pan, Y, Wu, Y, Ji, JUN, et al. (2016). Effect of cytokine-induced killer cells on immune function in patients with lung cancer. Oncology Letters 11(4):2827-2834. 514. Sawant, A, Schafer, CC, Jin, TH, et al. (2013). Enhancement of antitumor immunity in lung cancer by targeting myeloid-derived suppressor cell pathways. Cancer Research 73(22):6609-6620. 515. Jin, J, Fu, B, Mei, X, et al. (2013). CD11b−CD27− NK cells are associated with the progression of lung carcinoma. PLoS ONE 8(4):e61024. 516. Trikha, P and Carson Iii, WE (2014). Signaling pathways involved in MDSC regulation. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1846(1):55-65. 517. Grivennikov, SI and Karin, M (2011). Inflammatory cytokines in cancer: tumour necrosis factor and interleukin 6 take the stage. Annals of the Rheumatic Diseases 70(Suppl 1):i104-i108. 518. Umansky, V, Blattner, C, Gebhardt, C, et al. (2016). The role of myeloid-derived suppressor cells (MDSC) in cancer progression. Vaccines 4(4):36. 519. Barreda, DR, Hanington, PC, and Belosevic, M (2004). Regulation of myeloid development and function by colony stimulating factors. Developmental & Comparative Immunology 28(5):509-554. 520. Hamilton, JA (2015). GM-CSF as a target in inflammatory/autoimmune disease: current evidence and future therapeutic potential. Expert Review of Clinical Immunology 11(4):457-465. 521. Morales, JK, Kmieciak, M, Knutson, KL, et al. (2010). GM-CSF is one of the main breast tumor-derived soluble factors involved in the differentiation of CD11b-Gr1- bone marrow progenitor cells into myeloid-derived suppressor cells. Breast Cancer Research and Treatment 123(1):39-49. 522. Lechner, MG, Liebertz, DJ, and Epstein, AL (2010). Characterization of cytokine- induced myeloid-derived suppressor cells from normal human peripheral blood mononuclear cells. Journal of Immunology 185(4):2273-2284.

318

523. Marigo, I, Bosio, E, Solito, S, et al. (2010). Tumor-induced tolerance and immune suppression depend on the C/EBPβ transcription factor. Immunity 32(6):790-802. 524. Goedegebuure, P, Mitchem, JB, Porembka, MR, et al. (2011). Myeloid-derived suppressor cells: general characteristics and relevance to clinical management of pancreatic cancer. Current Cancer Drug Targets 11(6):734-751. 525. Elkabets, M, Ribeiro, VS, Dinarello, CA, et al. (2010). IL-1beta regulates a novel myeloid-derived suppressor cell subset that impairs NK cell development and function. European Journal of Immunology 40(12):3347-3357. 526. Sumida, K, Wakita, D, Narita, Y, et al. (2012). Anti-IL-6 receptor mAb eliminates myeloid-derived suppressor cells and inhibits tumor growth by enhancing T-cell responses. European Journal of Immunology 42(8):2060-2072. 527. Caetano, MS, Zhang, H, Cumpian, AM, et al. (2016). IL6 blockade reprograms the lung tumor microenvironment to limit the development and progression of K-ras–mutant lung cancer. Cancer Research 76(11):3189-3199. 528. Zhang, Y, Liu, Q, Zhang, M, et al. (2009). Fas signal promotes lung cancer growth by recruiting myeloid-derived suppressor cells via cancer cell-derived PGE2. Journal of Immunology 182(6):3801-3808. 529. Kao, A-P, Wang, K-H, Long, C-Y, et al. (2011). Interleukin-1β induces cyclooxygenase- 2 expression and promotes the invasive ability of human mesenchymal stem cells derived from ovarian endometrioma. Fertility and Sterility 96(3):678-684. e1. 530. Eruslanov, E, Daurkin, I, Ortiz, J, et al. (2010). Pivotal Advance: Tumor-mediated induction of myeloid-derived suppressor cells and M2-polarized macrophages by altering intracellular PGE2 catabolism in myeloid cells. Journal of Leukocyte Biology 88(5):839- 848. 531. Sinha, P, Clements, VK, Fulton, AM, et al. (2007). Prostaglandin E2 promotes tumor progression by inducing myeloid-derived suppressor cells. Cancer research 67(9):4507- 4513. 532. Terabe, M, Matsui, S, Park, J-M, et al. (2003). Transforming growth factor-β production and myeloid cells are an effector mechanism through which CD1d-restricted T cells block cytotoxic T lymphocyte–mediated tumor immunosurveillance. Abrogation Prevents Tumor Recurrence 198(11):1741-1752. 533. Li, J, Wang, L, Chen, X, et al. (2017). CD39/CD73 upregulation on myeloid-derived suppressor cells via TGF-beta-mTOR-HIF-1 signaling in patients with non-small cell lung cancer. Oncoimmunology 6(6):e1320011. 534. Wu, C-T, Hsieh, C-C, Lin, C-C, et al. (2012). Significance of IL-6 in the transition of hormone-resistant prostate cancer and the induction of myeloid-derived suppressor cells. Journal of Molecular Medicine 90(11):1343-1355. 535. Corzo, CA, Condamine, T, Lu, L, et al. (2010). HIF-1α regulates function and differentiation of myeloid-derived suppressor cells in the tumor microenvironment. Journal of Experimental Medicine 207(11):2439-2453. 536. Shojaei, F, Wu, X, Qu, X, et al. (2009). G-CSF-initiated myeloid cell mobilization and angiogenesis mediate tumor refractoriness to anti-VEGF therapy in mouse models. Proceedings of the National Academy of Sciences of the United States of America 106(16):6742-6747. 537. Emmerich, J, Mumm, JB, Chan, IH, et al. (2012). IL-10 directly activates and expands tumor-resident CD8+ T cells without de novo infiltration from secondary lymphoid organs. Cancer Research 72(14):3570-3581. 538. Mocellin, S, Marincola, FM, and Young, HA (2005). Interleukin-10 and the immune response against cancer: a counterpoint. Journal of Leukocyte Biology 78(5):1043-1051. 539. Cai, G, Kastelein, RA, and Hunter, CA (1999). IL‐10 enhances NK cell proliferation, cytotoxicity and production of IFN‐γ when combined with IL‐18. European Journal of Immunology 29(9):2658-2665.

319

540. Bunt, SK, Clements, VK, Hanson, EM, et al. (2009). Inflammation enhances myeloid- derived suppressor cell cross-talk by signaling through Toll-like receptor 4. Journal of Leukocyte Biology 85(6):996-1004. 541. Tanikawa, T, Wilke, CM, Kryczek, I, et al. (2012). Interleukin-10 ablation promotes tumor development, growth, and metastasis. Cancer Research 72(2):420-429. 542. Lee, BR, Kwon, BE, Hong, EH, et al. (2016). Interleukin-10 attenuates tumour growth by inhibiting interleukin-6/signal transducer and activator of transcription 3 signalling in myeloid-derived suppressor cells. Cancer Letters 381(1):156-164. 543. Rutschman, R, Lang, R, Hesse, M, et al. (2001). Cutting edge: Stat6-dependent substrate depletion regulates nitric oxide production. Journal of Immunology 166(4):2173-2177. 544. Movahedi, K, Guilliams, M, Van den Bossche, J, et al. (2008). Identification of discrete tumor-induced myeloid-derived suppressor cell subpopulations with distinct T cell– suppressive activity. Blood 111(8):4233-4244. 545. Harden, J and Egilmez, N (2012). Indoleamine 2,3-dioxygenase and dendritic cell tolerogenicity. Immunological Investigations 41(6-7):738-764. 546. Holmgaard, Rikke B, Zamarin, D, Li, Y, et al. (2015). Tumor-expressed IDO recruits and activates MDSCs in a Treg-dependent manner. Cell Reports 13(2):412-424. 547. Smith, C, Chang, MY, Parker, KH, et al. (2012). IDO is a nodal pathogenic driver of lung cancer and metastasis development. Cancer Discovery 2(8):722-735. 548. Schafer, CC, Wang, Y, Hough, KP, et al. (2016). Indoleamine 2,3-dioxygenase regulates anti-tumor immunity in lung cancer by metabolic reprogramming of immune cells in the tumor microenvironment. Oncotarget 7(46):75407-75424. 549. Sucher, R, Kurz, K, Weiss, G, et al. (2010). IDO-mediated tryptophan degradation in the pathogenesis of malignant tumor disease. International Journal of Tryptophan Research : IJTR 3:113-120. 550. Soliman, H, Mediavilla-Varela, M, and Antonia, S (2010). Indoleamine 2,3-dioxygenase: is it an immune suppressor? Cancer Journal 16(4):354-359. 551. Lesokhin, AM, Hohl, TM, Kitano, S, et al. (2012). Monocytic CCR2+ myeloid-derived suppressor cells promote immune escape by limiting activated CD8 T-cell infiltration into the tumor microenvironment. Cancer Research 72(4):876-886. 552. Zhang, J, Patel, L, and Pienta, KJ (2010). CC chemokine ligand 2 (CCL2) promotes prostate cancer tumorigenesis and metastasis. Cytokine & Growth Factor Reviews 21(1):41-48. 553. Izhak, L, Wildbaum, G, Jung, S, et al. (2012). Dissecting the autocrine and paracrine roles of the CCR2-CCL2 axis in tumor survival and angiogenesis. PLoS ONE 7(1):e28305. 554. Huang, B, Lei, Z, Zhao, J, et al. (2007). CCL2/CCR2 pathway mediates recruitment of myeloid suppressor cells to cancers. Cancer Letters 252(1):86-92. 555. Highfill, SL, Cui, Y, Giles, AJ, et al. (2014). Disruption of CXCR2-mediated MDSC tumor trafficking enhances anti-PD1 efficacy. Science Translational Medicine 6(237):237ra67. 556. Obermajer, N, Muthuswamy, R, Odunsi, K, et al. (2011). PGE2-induced CXCL12 production and CXCR4 expression controls the accumulation of human MDSCs in ovarian cancer environment. Cancer research 71(24):7463-7470. 557. Kuroda, E and Yamashita, U (2002). Regulation of immune responses by prostaglandin. Journal of UOEH 24(3):289-299. 558. Jiang, H, Gebhardt, C, Umansky, L, et al. (2015). Elevated chronic inflammatory factors and myeloid-derived suppressor cells indicate poor prognosis in advanced melanoma patients. International Journal of Cancer 136(10):2352-2360. 559. Ding, Y, Shen, J, Zhang, G, et al. (2015). CD40 controls CXCR5-induced recruitment of myeloid-derived suppressor cells to gastric cancer. Oncotarget 6(36):38901-38911. 560. Steding, CE, Wu, ST, Zhang, Y, et al. (2011). The role of interleukin-12 on modulating myeloid-derived suppressor cells, increasing overall survival and reducing metastasis. Immunology 133(2):221-238.

320

561. Heim, CE, Vidlak, D, Scherr, TD, et al. (2015). IL-12 promotes myeloid-derived suppressor cell recruitment and bacterial persistence during Staphylococcus aureus orthopedic implant infection. Journal of Immunology 194(8):3861-3872. 562. Liu, YF, Wei, JY, Shi, MH, et al. (2016). Glucocorticoid induces hepatic steatosis by inhibiting activating transcription factor 3 (ATF3)/S100A9 protein signaling in granulocytic myeloid-derived suppressor cells. Journal of Biological Chemistry 291(41):21771-21785. 563. Sido, JM, Yang, X, Nagarkatti, PS, et al. (2015). Δ(9)-Tetrahydrocannabinol-mediated epigenetic modifications elicit myeloid-derived suppressor cell activation via STAT3/S100A8. Journal of Leukocyte Biology 97(4):677-688. 564. Ichikawa, M, Williams, R, Wang, L, et al. (2011). S100A8/A9 Activate Key Genes and Pathways in Colon Tumor Progression. Molecular Cancer Research 9(2):133-148. 565. Melani, C, Sangaletti, S, Barazzetta, FM, et al. (2007). Amino-biphosphonate-mediated MMP-9 inhibition breaks the tumor-bone marrow axis responsible for myeloid-derived suppressor cell expansion and macrophage infiltration in tumor stroma. Cancer Research 67(23):11438-11446. 566. Pan, P-Y, Wang, GX, Yin, B, et al. (2008). Reversion of immune tolerance in advanced malignancy: modulation of myeloid-derived suppressor cell development by blockade of stem-cell factor function. Blood 111(1):219-228. 567. He, D, Li, H, Yusuf, N, et al. (2010). IL-17 promotes tumor development through the induction of tumor promoting microenvironments at tumor sites and myeloid derived suppressor cells. Journal of Immunology 184(5):2281-2288. 568. Chen, X, Churchill, MJ, Nagar, KK, et al. (2015). IL-17 producing mast cells promote the expansion of myeloid-derived suppressor cells in a mouse allergy model of colorectal cancer. Oncotarget 6(32):32966-32979. 569. Lim, HX, Hong, HJ, Cho, D, et al. (2014). IL-18 enhances immunosuppressive responses by promoting differentiation into monocytic myeloid-derived suppressor cells. Journal of Immunology 193(11):5453-5460. 570. Liu, H, Liu, Y, Song, Y, et al. (2015). IL-23 promotes the development of hepatocellular carcinoma through the induction of IL-17-producing ILC3 (TUM10P.1044). Journal of Immunology 194(1 Supplement):211.25. 571. Lu, B, Yang, M, and Wang, Q (2016). Interleukin-33 in tumorigenesis, tumor immune evasion, and cancer immunotherapy. Journal of Molecular Medicine 94(5):535-543. 572. Lee, JM, Kim, EK, Seo, H, et al. (2014). Serum amyloid A3 exacerbates cancer by enhancing the suppressive capacity of myeloid-derived suppressor cells via TLR2- dependent STAT3 activation. European Journal of Immunology 44(6):1672-1684. 573. Gama, L, Shirk, EN, Russell, JN, et al. (2012). Expansion of a subset of CD14highCD16negCCR2low/neg monocytes functionally similar to myeloid-derived suppressor cells during SIV and HIV infection. Journal of leukocyte biology 91(5):803- 816. 574. Umansky, V, Blattner, C, Gebhardt, C, et al. (2017). CCR5 in recruitment and activation of myeloid-derived suppressor cells in melanoma. Cancer Immunology, Immunotherapy 66(8):1015-1023. 575. Katoh, H, Wang, D, Daikoku, T, et al. (2013). CXCR2-expressing myeloid-derived suppressor cells are essential to promote colitis-associated tumorigenesis. Cancer Cell 24(5):631-644. 576. Simpson, KD, Templeton, DJ, and Cross, JV (2012). Macrophage migration inhibitory factor promotes tumor growth and metastasis by inducing myeloid-derived suppressor cells in the tumor microenvironment. Journal of Immunology 189(12):5533-5540. 577. Stathopoulos, GT, Sherrill, TP, Karabela, SP, et al. (2010). Host-derived interleukin-5 promotes adenocarcinoma-induced malignant pleural effusion. American Journal of Respiratory and Critical Care Medicine 182(10):1273-1281.

321

578. Nam, S, Kang, K, Cha, JS, et al. (2016). Interferon regulatory factor 4 (IRF4) controls myeloid-derived suppressor cell (MDSC) differentiation and function. Journal of Leukocyte Biology 100(6):1273-1284. 579. Waight, JD, Netherby, C, Hensen, ML, et al. (2013). Myeloid-derived suppressor cell development is regulated by a STAT/IRF-8 axis. Journal of Clinical Investigation 123(10):4464-4478. 580. Chen, Y-J, Li, J, Lu, N, et al. (2017). Interferon regulatory factors: A key to tumour immunity. International Immunopharmacology 49:1-5. 581. Remark, R, Becker, C, Gomez, JE, et al. (2015). The non-small cell lung cancer immune contexture: a major determinant of tumor characteristics and patient outcome. American Journal of Respiratory and Critical Care Medicine 191(4):377-390. 582. Lu, T and Gabrilovich, DI (2012). Molecular pathways: tumor-infiltrating myeloid cells and reactive oxygen species in regulation of tumor microenvironment. Clinical Cancer Research 18(18):4877-4882. 583. Nagaraj, S, Gupta, K, Pisarev, V, et al. (2007). Altered recognition of antigen is a mechanism of CD8+ T cell tolerance in cancer. Nature Medicine 13(7):828-835. 584. Nagaraj, S, Schrum, AG, Cho, H-I, et al. (2010). Mechanism of T cell tolerance induced by myeloid-derived suppressor cells. Journal of Immunology 184(6):3106-3116. 585. Ugel, S, De Sanctis, F, Mandruzzato, S, et al. (2015). Tumor-induced myeloid deviation: when myeloid-derived suppressor cells meet tumor-associated macrophages. The Journal of Clinical Investigation 125(9):3365-3376. 586. Rodriguez, PC, Quiceno, DG, Zabaleta, J, et al. (2004). Arginase I production in the tumor microenvironment by mature myeloid cells inhibits T-cell receptor expression and antigen-specific T-cell responses. Cancer Research 64(16):5839-5849. 587. Ohta, A (2016). A metabolic immune checkpoint: adenosine in tumor microenvironment. Frontiers in Immunology 7(109). 588. van der Windt, GJ and Pearce, EL (2012). Metabolic switching and fuel choice during T- cell differentiation and memory development. Immunological Reviews 249(1):27-42. 589. Werner, A, Amann, E, Schnitzius, V, et al. (2016). Induced arginine transport via cationic amino acid transporter-1 is necessary for human T-cell proliferation. European Journal of Immunology 46(1):92-103. 590. Geiger, R, Rieckmann, JC, Wolf, T, et al. (2016). L-arginine modulates T cell metabolism and enhances survival and anti-tumor activity. Cell 167(3):829-842. e13. 591. Bozkus, CC, Elzey, BD, Crist, SA, et al. (2015). Expression of cationic amino acid transporter 2 (CAT2) is required for myeloid derived suppressor cell-mediated control of T cell immunity. Journal of Immunology 195(11):5237-5250. 592. Ryzhov, S, Novitskiy, SV, Goldstein, AE, et al. (2011). Adenosinergic regulation of the expansion and immunosuppressive activity of CD11b(+)Gr1(+) cells. Journal of Immunology 187(11):6120-6129. 593. Cekic, C, Day, Y-J, Sag, D, et al. (2014). Myeloid expression of Adenosine A(2A) receptor suppresses T and NK cell responses in the solid tumor microenvironment. Cancer Research 74(24):7250-7259. 594. Godin-Ethier, J, Hanafi, L-A, Piccirillo, CA, et al. (2011). Indoleamine 2,3-dioxygenase expression in human cancers: clinical and immunologic perspectives. Clinical Cancer Research 17(22):6985-6991. 595. Burke, M, Choksawangkarn, W, Edwards, N, et al. (2013). Exosomes from myeloid- derived suppressor cells carry biologically active proteins. Journal of Proteome Research 13(2):836-843. 596. Oft, M (2014). IL-10: master switch from tumor-promoting inflammation to antitumor immunity. Cancer Immunology Research 2(3):194-199. 597. Morales, JK, Saleem, SJ, Martin, RK, et al. (2014). Myeloid-derived suppressor cells enhance IgE-mediated mast cell responses. Journal of Leukocyte Biology 95(4):643-650.

322

598. Zhu, J and Paul, WE (2008). CD4 T cells: fates, functions, and faults. Blood 112(5):1557- 1569. 599. Golubovskaya, V and Wu, L (2016). Different subsets of T cells, memory, effector functions, and CAR-T immunotherapy. Cancers 8(3):36. 600. Qin, Z and Blankenstein, T (2000). CD4+ T cell--mediated tumor rejection involves inhibition of angiogenesis that is dependent on IFN gamma receptor expression by nonhematopoietic cells. Immunity 12(6):677-686. 601. Corthay, A, Skovseth, DK, Lundin, KU, et al. (2005). Primary antitumor immune response mediated by CD4+ T cells. Immunity 22(3):371-383. 602. Nishimura, T, Iwakabe, K, Sekimoto, M, et al. (1999). Distinct role of antigen-specific T helper type 1 (Th1) and Th2 cells in tumor eradication in vivo. Journal of Experimental Medicine 190(5):617-627. 603. Mattes, J, Hulett, M, Xie, W, et al. (2003). Immunotherapy of cytotoxic T cell-resistant tumors by T helper 2 cells: an eotaxin and STAT6-dependent process. Journal of Experimental Medicine 197(3):387-393. 604. Boyman, O and Sprent, J (2012). The role of interleukin-2 during homeostasis and activation of the immune system. Nature Reviews Immunology 12(3):180-190. 605. Hirschhorn-Cymerman, D, Budhu, S, Kitano, S, et al. (2012). Induction of tumoricidal function in CD4+ T cells is associated with concomitant memory and terminally differentiated phenotype. Journal of Experimental Medicine 209(11):2113-2126. 606. Wawrocki, S, Druszczynska, M, Kowalewicz-Kulbat, M, et al. (2016). Interleukin 18 (IL-18) as a target for immune intervention. Acta Biochimica Polonica 63(1):59-63. 607. Kaech, SM and Cui, W (2012). Transcriptional control of effector and memory CD8+ T cell differentiation. Nature Reviews Immunology 12(11):749-761. 608. Hu, J, Bernatchez, C, Xia, X, et al. (2016). CXCL9, CXCL10 and IFNγ favor the accumulation of infused T cells in tumors following IL-12 plus doxorubicin treatment. Journal of Immunology 196(1 Supplement):212.1-212.1. 609. Cho, D and Campana, D (2009). Expansion and activation of natural killer cells for cancer immunotherapy Korean Journal of Laboratory Medicine 29(2):89-96. 610. Schellhorn, M, Haustein, M, Frank, M, et al. (2015). Celecoxib increases lung cancer cell lysis by lymphokine-activated killer cells via upregulation of ICAM-1. Oncotarget 6(36):39342–39356. 611. Ferjančič, Š, Gil-Bernabé, AM, Hill, SA, et al. (2013). VCAM-1 and VAP-1 recruit myeloid cells that promote pulmonary metastasis in mice. Blood 121(16):3289-3297. 612. Chen, Q, Zhang, Xiang HF, and Massagué, J (2011). Macrophage binding to receptor VCAM-1 transmits survival signals in breast cancer cells that invade the lungs. Cancer Cell 20(4):538-549. 613. Gong, Mi, Zhu, et al. (2012). P-selectin-mediated platelet activation promotes adhesion of non-small cell lung carcinoma cells on vascular endothelial cells under flow. Molecular Medicine Reports 5(4):935-942. 614. Wang, H, Zhu, Y, Zhao, M, et al. (2013). miRNA-29c suppresses lung cancer cell adhesion to extracellular matrix and metastasis by targeting integrin β1 and matrix metalloproteinase2 (MMP2). PLoS ONE 8(8):e70192. 615. Jandova, J, Beyer, TE, Meuillet, EJ, et al. (2012). The matrix protein CCN1/CYR61 is required for αVβ5-mediated cancer cell migration. Cell Biochemistry and Function 30(8):687-695. 616. Läubli, H and Borsig, L (2010). Selectins as mediators of lung metastasis. Cancer Microenvironment 3(1):97-105. 617. Richter, U, Schröder, C, Wicklein, D, et al. (2011). Adhesion of small cell lung cancer cells to E- and P-Selectin under physiological flow conditions: implications for metastasis formation. Histochemistry and Cell Biology 135(5):499-512. 618. Mo, X, Zhang, F, Liang, H, et al. (2014). miR-544a promotes the invasion of lung cancer cells by targeting cadherina 1 in vitro. OncoTargets and Therapy 7:895-900.

323

619. Liu, X, Su, L, and Liu, X (2013). Loss of CDH1 up-regulates epidermal growth factor receptor via phosphorylation of YBX1 in non-small cell lung cancer cells. FEBS Letters 587(24):3995-4000. 620. Gupta, PB, Onder, TT, Jiang, G, et al. (2009). Identification of selective inhibitors of cancer stem cells by high-throughput screening. Cell 138(4):645-659. 621. Lu, Y, Yu, T, Liang, H, et al. (2014). Nitric oxide inhibits hetero-adhesion of cancer cells to endothelial cells: restraining circulating tumor cells from initiating metastatic cascade. Scientific Reports 4(4344):1-9. 622. Powan, P and Chanvorachote, P (2014). Nitric oxide mediates cell aggregation and mesenchymal to epithelial transition in anoikis-resistant lung cancer cells. Molecular and Cellular Biochemistry:1-9. 623. Kim, Y-N, Koo, KH, Sung, JY, et al. (2012). Anoikis resistance: an essential prerequisite for tumor metastasis. International Journal of Cell Biology 2012(2012):306879-306889. 624. Jan, Y, Matter, M, Pai, J-t, et al. (2004). A mitochondrial protein, Bit1, mediates apoptosis regulated by integrins and groucho/TLE corepressors. Cell 116(5):751-762. 625. Yao, X, Jennings, S, Ireland, SK, et al. (2014). The anoikis effector Bit1 displays tumor suppressive function in lung cancer cells. PLoS ONE 9(7):e101564. 626. Luanpitpong, S, Iyer, AKV, Azad, N, et al. (2012). Nitrosothiol signaling in anoikis resistance and cancer metastasis. Forum on Immunopathological Diseases and Therapeutics 3(2):141-154. 627. Avraamides, CJ, Garmy-Susini, B, and Varner, JA (2008). Integrins in angiogenesis and lymphangiogenesis. Nature Reviews Cancer 8(8):604-617. 628. Masson, V, de la Ballina, LR, Munaut, C, et al. (2004). Contribution of host MMP-2 and MMP-9 to promote tumor vascularization and invasion of malignant keratinocytes. FASEB Journal 19(2):234-236. 629. Oh, J, Takahashi, R, Adachi, E, et al. (2004). Mutations in two matrix metalloproteinase genes, MMP-2 and MT1-MMP, are synthetic lethal in mice. Oncogene 23(29):5041-5048. 630. Lambert, V, Wielockx, B, Munaut, C, et al. (2003). MMP-2 and MMP-9 synergize in promoting choroidal neovascularization. FASEB Journal 17(15):2290-2292. 631. Löffek, S, Schilling, O, and Franzke, C-W (2011). Biological role of matrix metalloproteinases: a critical balance. European Respiratory Journal 38(1):191-208. 632. Rask, L, Fregil, M, Høgdall, E, et al. (2013). Development of a metastatic fluorescent Lewis lung carcinoma mouse model: identification of mRNAs and microRNAs involved in tumor invasion. Gene 517(1):72-81. 633. Zhao, M, Gao, Y, Wang, L, et al. (2013). Overexpression of integrin-linked kinase promotes lung cancer cell migration and invasion via NF-κB-mediated upregulation of matrix metalloproteinase-9. International Journal of Medical Sciences 10(8):995-1002. 634. Stockmann, C, Schadendorf, D, Klose, R, et al. (2014). The impact of the immune system on tumor angiogenesis and vascular remodeling. Frontiers in Oncology 4:69. 635. Ahn, G-O, Seita, J, Hong, B-J, et al. (2014). Transcriptional activation of hypoxia- inducible factor-1 (HIF-1) in myeloid cells promotes angiogenesis through VEGF and S100A8. Proceedings of the National Academy of Sciences 111(7):2698-2703. 636. Deryugina, EI and Quigley, JP (2015). Tumor angiogenesis: MMP-mediated induction of intravasation- and metastasis-sustaining neovasculature. Matrix Biology 44–46:94-112. 637. Hiratsuka, S, Nakamura, K, Iwai, S, et al. (2002). MMP9 induction by vascular endothelial growth factor receptor-1 is involved in lung-specific metastasis. Cancer Cell 2(4):289-300. 638. Karnezis, T, Shayan, R, Caesar, C, et al. (2012). VEGF-D promotes tumor metastasis by regulating prostaglandins produced by the collecting lymphatic endothelium. Cancer Cell 21(2):181-195. 639. Gogineni, A, Caunt, M, Crow, A, et al. (2013). Inhibition of VEGF-C modulates distal lymphatic remodeling and secondary metastasis. PLoS ONE 8(7):e68755.

324

640. Hoshida, T, Isaka, N, Hagendoorn, J, et al. (2006). Imaging steps of lymphatic metastasis reveals that vascular endothelial growth factor-C increases metastasis by increasing delivery of cancer cells to lymph nodes: therapeutic implications. Cancer Research 66(16):8065-8075. 641. Renyi-Vamos, F, Tovari, J, Fillinger, J, et al. (2005). Lymphangiogenesis correlates with lymph node metastasis, prognosis, and angiogenic phenotype in human non–small cell lung cancer. Clinical Cancer Research 11(20):7344-7353. 642. Kawai, H, Minamiya, Y, Ito, M, et al. (2008). VEGF121 promotes lymphangiogenesis in the sentinel lymph nodes of non-small cell lung carcinoma patients. Lung Cancer 59(1):41-47. 643. Stacker, S, Williams, S, Karnezis, T, et al. (2014). Lymphangiogenesis and lymphatic vessel remodelling in cancer. Nature Reviews Cancer 14(3):159-172. 644. Chanvorachote, P, Nimmannit, U, Lu, Y, et al. (2009). Nitric oxide regulates lung carcinoma cell anoikis through inhibition of ubiquitin-proteasomal degradation of caveolin-1. Journal of Biological Chemistry 284(41):28476-28484. 645. Rungtabnapa, P, Nimmannit, U, Halim, H, et al. (2011). Hydrogen peroxide inhibits non- small cell lung cancer cell anoikis through the inhibition of caveolin-1 degradation. American Journal of Physiology - Cell Physiology 300(2):C235-C245. 646. Luanpitpong, S, Talbott, SJ, Rojanasakul, Y, et al. (2010). Regulation of lung cancer cell migration and invasion by reactive oxygen species and caveolin-1. Journal of Biological Chemistry 285(50):38832-38840. 647. Staubach, S and Hanisch, F-G (2011). Lipid rafts: signaling and sorting platforms of cells and their roles in cancer. Expert Review of Proteomics 8(2):263-277. 648. Suchaoin, W and Chanvorachote, P (2012). Caveolin-1 attenuates hydrogen peroxide- induced oxidative damage to lung carcinoma cells. Anticancer Research 32(2):483-490. 649. Chen, J-H, Lin, H-H, Chiang, T-A, et al. (2008). Gaseous nitrogen oxide promotes human lung cancer cell line A549 migration, invasion, and metastasis via iNOS-mediated MMP- 2 production. Toxicological Sciences 106(2):364-375. 650. Phillips, PG and Birnby, LM (2004). Nitric oxide modulates caveolin-1 and matrix metalloproteinase-9 expression and distribution at the endothelial cell/tumor cell interface. American Journal of Physiology - Lung Cellular and Molecular Physiology 286(5):L1055-L1065. 651. Song, H, Cheng, Y, Bi, G, et al. (2016). Release of matrix metalloproteinases-2 and 9 by S-nitrosylated caveolin-1 contributes to degradation of extracellular matrix in tPA-treated hypoxic endothelial cells. PLoS ONE 11(2):e0149269. 652. Matsuda, A and Machii, R (2013). Worldwide relative burden of cancer death in 2008 extrapolated from the WHO mortality database. Japanese Journal of Clinical Oncology 43(1):102. 653. Ferlay, J, Soerjomataram, I, Dikshit, R, et al. (2015). Cancer incidence and mortality worldwide: Sources, methods and major patterns in Globocan 2012. International Journal of Cancer 136(5):E359-E386. 654. Chaffer, CL and Weinberg, RA (2011). A perspective on cancer cell metastasis. Science 331(6024):1559-1564. 655. Wood, SL, Pernemalm, M, Crosbie, PA, et al. (2014). The role of the tumor- microenvironment in lung cancer-metastasis and its relationship to potential therapeutic targets. Cancer Treatment Reviews 40(4):558-566. 656. Phillips, RJ, Burdick, MD, Marin, L, et al. (2003). The stromal derived factor- 1/CXCL12-CXC chemokine receptor 4 biological axis in non-small cell lung cancer metastases. American Journal of Respiratory and Critical Care Medicine 167(12):1676- 1686. 657. Oh, I-J, Kim, K-S, Kim, Y-C, et al. (2013). A phase III concurrent chemoradiotherapy trial with cisplatin and paclitaxel or docetaxel or gemcitabine in unresectable non-small cell lung cancer: KASLC 0401. Cancer Chemotherapy and Pharmacology 72(6):1247- 1254.

325

658. Galluzzi, L, Vitale, I, Michels, J, et al. (2014). Systems biology of cisplatin resistance: past, present and future. Cell Death and Disease 5:e1257. 659. Jordan, MA, Toso, RJ, Thrower, D, et al. (1993). Mechanism of mitotic block and inhibition of cell proliferation by taxol at low concentrations. Proceedings of the National Academy of Sciences of the United States of America 90(20):9552-9556. 660. Dagogo-Jack, I, Engelman, JA, and Shaw, AT (2017). Overcoming on-target resistance to tyrosine kinase inhibitors in lung cancer. Annual Review of Cancer Biology 1(1):257- 274. 661. Gacche, RN and Meshram, RJ (2014). Angiogenic factors as potential drug target: efficacy and limitations of anti-angiogenic therapy. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer 1846(1):161-179. 662. Martinez-Outschoorn, UE, Peiris-Pages, M, Pestell, RG, et al. (2017). Cancer metabolism: a therapeutic perspective. Nature Reviews Clinical Oncology 14(11-31). 663. Yasuda, H, Yamaya, M, Nakayama, K, et al. (2006). Randomized phase II trial comparing nitroglycerin plus vinorelbine and cisplatin with vinorelbine and cisplatin alone in previously untreated stage IIIB/IV non–small-cell lung cancer. Journal of Clinical Oncology 24(4):688-694. 664. Yasuda, H, Nakayama, K, Watanabe, M, et al. (2006). Nitroglycerin treatment may enhance chemosensitivity to docetaxel and carboplatin in patients with lung adenocarcinoma. Clinical Cancer Research 12(22):6748-6757. 665. Bansal, P, Osman, D, Gan, GN, et al. (2016). Recent advances in immunotherapy in metastatic NSCLC. Frontiers in Oncology 6:239. 666. Schvartsman, G, Ferrarotto, R, and Massarelli, E (2016). Checkpoint inhibitors in lung cancer: latest developments and clinical potential. Therapeutic Advances in Medical Oncology 8(6):460-473. 667. Gaynor, R, Irie, R, Morton, D, et al. (1980). S100 protein is present in cultured human malignant melanomas. Nature 286(5771):400-401. 668. Zarogoulidis, P, Tsakiridis, K, Karapantzou, C, et al. (2015). Use of proteins as biomarkers and their role in carcinogenesis. Journal of Cancer 6(1):9-18. 669. Weide, B, Richter, S, Buttner, P, et al. (2013). Serum S100B, lactate dehydrogenase and brain metastasis are prognostic factors in patients with distant melanoma metastasis and systemic therapy. PLoS One 8(11):e81624. 670. Mocellin, S, Zavagno, G, and Nitti, D (2008). The prognostic value of serum S100B in patients with cutaneous melanoma: A meta-analysis. International Journal of Cancer 123(10):2370-2376. 671. Nonaka, D, Chiriboga, L, and Rubin, BP (2008). Differential expression of S100 protein subtypes in malignant melanoma, and benign and malignant peripheral nerve sheath tumors. Journal of Cutaneous Pathology 35(11):1014-1019. 672. Andersen, K, Nesland, JM, Holm, R, et al. (2004). Expression of S100A4 combined with reduced E-cadherin expression predicts patient outcome in malignant melanoma. Modern Pathology 17(8):990-997. 673. Massi, D, Landriscina, M, Piscazzi, A, et al. (2010). S100A13 is a new angiogenic marker in human melanoma. Modern Pathology 23(6):804-813. 674. Chen, H, Xu, C, Jin, Qe, et al. (2014). S100 protein family in human cancer. American Journal of Cancer Research 4(2):89–115. 675. Bresnick, AR, Weber, DJ, and Zimmer, DB (2015). S100 proteins in cancer. Nature Reviews. Cancer 15(2):96-109. 676. Almatroodi, SA, McDonald, CF, Collins, AL, et al. (2015). Quantitative proteomics of bronchoalveolar lavage fluid in lung adenocarcinoma. Cancer Genomics Proteomics 12(1):39-48. 677. Kawai, H, Minamiya, Y, and Takahashi, N (2011). Prognostic impact of S100A9 overexpression in non-small cell lung cancer. Tumor Biology 32(4):641-646.

326

678. Su, Y-J, Xu, F, Yu, J-P, et al. (2010). Up-regulation of the expression of S100A8 and S100A9 in lung adenocarcinoma and its correlation with inflammation and other clinical features. Chinese Medical Journal 123(16):2215-2220. 679. Arai, K, Takano, S, Teratani, T, et al. (2008). S100A8 and S100A9 overexpression is associated with poor pathological parameters in invasive ductal carcinoma of the breast. Current Cancer Drug Targets 8(4):243-252. 680. Arai, K, Teratani, T, Kuruto-Niwa, R, et al. (2004). S100A9 expression in invasive ductal carcinoma of the breast: S100A9 expression in adenocarcinoma is closely associated with poor tumour differentiation. European Journal of Cancer 40(8):1179-1187. 681. Miller, P, Kidwell, KM, Thomas, D, et al. (2017). Elevated S100A8 protein expression in breast cancer cells and breast tumor stroma is prognostic of poor disease outcome. Breast Cancer Research and Treatment 166(1):85–94. 682. Hermani, A, Hess, J, De Servi, B, et al. (2005). Calcium-binding proteins S100A8 and S100A9 as novel diagnostic markers in human prostate cancer. Clinical Cancer Research 11(14):5146-5152. 683. Duan, L, Wu, R, Ye, L, et al. (2013). S100A8 and S100A9 are associated with colorectal carcinoma progression and contribute to colorectal carcinoma cell survival and migration via Wnt/beta-catenin pathway. PLoS ONE 8(4):e62092. 684. Başsorgun, Cİ, Ünal, B, Erin, N, et al. (2014). S100A8 and S100A9 positive cells in colorectal carcinoma: clinicopathological analysis. Gastroenterology Research and Practice 2014(2014):943175-943180. 685. Németh, J, Stein, I, Haag, D, et al. (2009). S100A8 and S100A9 are novel nuclear factor kappa B target genes during malignant progression of murine and human liver carcinogenesis. Hepatology 50(4):1251-1262. 686. Kong, J-P, Ding, F, Zhou, C-N, et al. (2004). Loss of myeloid-related proteins 8 and myeloid-related proteins 14 expression in human esophageal squamous cell carcinoma correlates with poor differentiation. World Journal of Gastroenterology 10(8):1093-1097. 687. Pawar, H, Srikanth, SM, Kashyap, MK, et al. (2015). Downregulation of S100 calcium binding protein A9 in esophageal squamous cell carcinoma. ScientificWorldJournal 2015:325721. 688. Funk, S, Mark, R, Bayo, P, et al. (2015). High S100A8 and S100A12 protein expression is a favorable prognostic factor for survival of oropharyngeal squamous cell carcinoma. International Journal of Cancer 136(9):2037-2046. 689. Sheikh, AA, Vimalachandran, D, Thompson, CC, et al. (2007). The expression of S100A8 in pancreatic cancer-associated monocytes is associated with the Smad4 status of pancreatic cancer cells. Proteomics 7(11):1929-1940. 690. Drews-Elger, K, Iorns, E, Dias, A, et al. (2014). Infiltrating S100A8+ myeloid cells promote metastatic spread of human breast cancer and predict poor clinical outcome. Breast Cancer Research and Treatment 148(1):41-59. 691. Li, S, Xu, F, Li, H, et al. (2017). S100A8+ stroma cells predict a good prognosis and inhibit aggressiveness in colorectal carcinoma. OncoImmunology 6(1):e1260213. 692. Tidehag, V, Hammarsten, P, Egevad, L, et al. (2014). High density of S100A9 positive inflammatory cells in prostate cancer stroma is associated with poor outcome. European Journal of Cancer 50(10):1829-1835. 693. Fan, B, Zhang, L-H, Jia, Y-n, et al. (2012). Presence of S100A9-positive inflammatory cells in cancer tissues correlates with an early stage cancer and a better prognosis in patients with gastric cancer. BMC Cancer 12:316-316. 694. Choi, JH, Shin, NR, Moon, HJ, et al. (2012). Identification of S100A8 and S100A9 as negative regulators for lymph node metastasis of gastric adenocarcinoma. Histology and Histopathology 27(11):1439-1448. 695. Wang, L, Chang, EWY, Wong, SC, et al. (2013). Increased myeloid-derived suppressor cells in gastric cancer correlate with cancer stage and plasma S100A8/A9 proinflammatory proteins. Journal of Immunology 190(2):794-804.

327

696. Ludwig, S, Stephan, C, Lein, M, et al. (2007). S100A8, S100A9, and the S100A8/A9 complex in circulating blood are not associated with prostate cancer risk-A re-evaluation study. Prostate 67(12):1301-1307. 697. Kim, H-J, Kang, HJ, Lee, H, et al. (2009). Identification of S100A8 and S100A9 as serological markers for colorectal cancer. Journal of Proteome Research 8(3):1368-1379. 698. Lo, W-Y, Lai, C-C, Hua, C-H, et al. (2007). S100A8 is identified as a biomarker of HPV18-infected oral squamous cell carcinomas by suppression subtraction hybridization, clinical proteomics analysis, and immunohistochemistry staining. Journal of Proteome Research 6(6):2143-2151. 699. Jou, YJ, Hua, CH, Lin, CD, et al. (2014). S100A8 as potential salivary biomarker of oral squamous cell carcinoma using nanoLC-MS/MS. Clinica Chimica Acta 436:121-129. 700. Fang, W-Y, Chen, Y-W, Hsiao, J-R, et al. (2015). Elevated S100A9 expression in tumor stroma functions as an early recurrence marker for early-stage oral cancer patients through increased tumor cell invasion, angiogenesis, macrophage recruitment and interleukin-6 production. Oncotarget 6(29):28401-28424. 701. Reckenbeil, J, Kraus, D, Probstmeier, R, et al. (2016). Cellular distribution and gene expression pattern of metastasin (S100A4), calgranulin A (S100A8), and calgranulin B (S100A9) in oral lesions as markers for molecular pathology. Cancer Investigation 34(6):246-254. 702. Smith, SL, Gugger, M, Hoban, P, et al. (2004). S100A2 is strongly expressed in airway basal cells, preneoplastic bronchial lesions and primary non-small cell lung carcinomas. British Journal of Cancer 91(8):1515-1524. 703. Wang, T, Liang, Y, Thakur, A, et al. (2017). Expression and clinicopathological significance of S100 calcium binding protein A2 in lung cancer patients of Chinese Han ethnicity. Clinica Chimica Acta 464:118-122. 704. Wang, H, Zhang, Z, Li, R, et al. (2005). Overexpression of S100A2 protein as a prognostic marker for patients with stage I non small cell lung cancer. International Journal of Cancer 116(2):285-290. 705. Bulk, E, Sargin, B, Krug, U, et al. (2009). S100A2 induces metastasis in non–small cell lung cancer. Clinical Cancer Research 15(1):22-29. 706. Ren, H, Wang, T, and Chen, M (2016). Expression and clinical significance of S100 calcium binding protein A2 in lung cancer. European Respiratory Journal 48(suppl 60). 707. Masuda, T, Ishikawa, T, Mogushi, K, et al. (2016). Overexpression of the S100A2 protein as a prognostic marker for patients with stage II and III colorectal cancer. International Journal of Oncology 48(3):975-982. 708. Ohuchida, K, Mizumoto, K, Miyasaka, Y, et al. (2007). Over-expression of S100A2 in pancreatic cancer correlates with progression and poor prognosis. Journal of Pathology 213(3):275-282. 709. Biankin, AV, Kench, JG, Colvin, EK, et al. (2009). Expression of S100A2 calcium- binding protein predicts response to pancreatectomy for pancreatic cancer. Gastroenterology 137(2):558-568.e11. 710. Lee, O-J, Hong, S-M, Razvi, MH, et al. (2006). Expression of calcium-binding proteins S100A2, S100A4 in Barrett's adenocarcinomas. Neoplasia 8(10):843-850. 711. Cao, L-Y, Yin, Y, Li, H, et al. (2009). Expression and clinical significance of S100A2 and p63 in esophageal carcinoma. World Journal of Gastroenterology 15(33):4183-4188. 712. El-Rifai, We, Moskaluk, CA, Abdrabbo, MK, et al. (2002). Gastric cancers overexpress S100A calcium-binding proteins. Cancer Research 62(23):6823-6826. 713. Liu, J, Li, X, Dong, GL, et al. (2008). In silico analysis and verification of S100 gene expression in gastric cancer. BMC Cancer 8:261. 714. Tsuna, M, Kageyama, S-I, Fukuoka, J, et al. (2009). Significance of S100A4 as a prognostic marker of lung squamous cell carcinoma. Anticancer Research 29(7):2547- 2554.

328

715. Zhang, H, Liu, J, Yue, D, et al. (2013). Clinical significance of E-cadherin, beta-catenin, vimentin and S100A4 expression in completely resected squamous cell lung carcinoma. Journal of Clinical Pathology 66(11):937-945. 716. Wen-Ying, L, Wu-Chou, S, Pin-Wen, L, et al. (2004). Expression of S100A4 and Met: potential predictors for metastasis and survival in early-stage breast cancer. Oncology 66(6):429-438. 717. de Silva Rudland, S, Martin, L, Roshanlall, C, et al. (2006). Association of S100A4 and osteopontin with specific prognostic factors and survival of patients with minimally invasive breast cancer. Clinical Cancer Research 12(4):1192-1200. 718. Rudland, PS, Platt-Higgins, A, Renshaw, C, et al. (2000). Prognostic significance of the metastasis-inducing protein S100A4 (p9Ka) in human breast cancer. Cancer Research 60(6):1595-1603. 719. Huang, S, Zheng, J, Huang, Y, et al. (2016). Impact of S100A4 expression on clinicopathological characteristics and prognosis in pancreatic cancer: a meta-analysis. Disease Markers 2016:8137378. 720. Kwon, Y-W, Chang, IH, Kim, KD, et al. (2010). Significance of S100A2 and S100A4 expression in the progression of prostate adenocarcinoma. Korean Journal of Urology 51(7):456-462. 721. Wang, HY, Zhang, JY, Cui, JT, et al. (2010). Expression status of S100A14 and S100A4 correlates with metastatic potential and clinical outcome in colorectal cancer after surgery. Oncology Reports 23:45-52. 722. Huang, L-Y, Xu, Y, Cai, G-X, et al. (2011). S100A4 over-expression underlies lymph node metastasis and poor prognosis in colorectal cancer. World Journal of Gastroenterology 17(1):69-78. 723. Gongoll, S, Peters, G, Mengel, M, et al. (2002). Prognostic significance of calcium- binding protein S100A4 in colorectal cancer. Gastroenterology 123(5):1478-1484. 724. Kwak, JM, Lee, HJ, Kim, SH, et al. (2010). Expression of protein S100A4 is a predictor of recurrence in colorectal cancer. World Journal of Gastroenterology 16(31):3897-3904. 725. Xuan, X, Li, Q, Zhang, Z, et al. (2014). Increased expression levels of S100A4 associated with hypoxia-induced invasion and metastasis in esophageal squamous cell cancer. Tumour Biology 35(12):12535-12543. 726. Moriyama-Kita, M, Endo, Y, Yonemura, Y, et al. (2004). Correlation of S100A4 expression with invasion and metastasis in oral squamous cell carcinoma. Oral Oncology 40(5):496-500. 727. Natarajan, J, Hunter, K, Mutalik, VS, et al. (2014). Overexpression of S100A4 as a biomarker of metastasis and recurrence in oral squamous cell carcinoma. Journal of Applied Oral Science 22(5):426-433. 728. Hua, Z, Chen, J, Sun, B, et al. (2011). Specific expression of osteopontin and S100A6 in hepatocellular carcinoma. Surgery 149(6):783-791. 729. Ohuchida, K, Mizumoto, K, Ishikawa, N, et al. (2005). The role of S100A6 in pancreatic cancer development and its clinical implication as a diagnostic marker and therapeutic target. Clinical Cancer Research 11(21):7785-7793. 730. Wang, XH, Zhang, LH, Zhong, XY, et al. (2010). S100A6 overexpression is associated with poor prognosis and is epigenetically up-regulated in gastric cancer. American Journal of Pathology 177(2):586-597. 731. Hu, M, Ye, L, Ruge, F, et al. (2012). The clinical significance of Psoriasin for non-small cell lung cancer patients and its biological impact on lung cancer cell functions. BMC Cancer 12:588. 732. Emberley, ED, Niu, Y, Njue, C, et al. (2003). Psoriasin (S100A7) expression is associated with poor outcome in estrogen receptor-negative invasive breast cancer. Clinical Cancer Research 9(7):2627-2631. 733. Kesting, MR, Sudhoff, H, Hasler, RJ, et al. (2009). Psoriasin (S100A7) up-regulation in oral squamous cell carcinoma and its relation to clinicopathologic features. Oral Oncology 45(8):731-736.

329

734. Kaur, J, Matta, A, Kak, I, et al. (2014). S100A7 overexpression is a predictive marker for high risk of malignant transformation in oral dysplasia. International Journal of Cancer 134(6):1379-1388. 735. Katono, K, Sato, Y, Jiang, SX, et al. (2016). Clinicopathological significance of S100A10 expression in lung adenocarcinomas. Asian Pacific Journal of Cancer Prevention 17(1):289-294. 736. Woo, T, Okudela, K, Mitsui, H, et al. (2015). Up-regulation of S100A11 in lung adenocarcinoma - its potential relationship with cancer progression. PLoS One 10(11):e0142642. 737. Wang, G, Wang, X, Wang, S, et al. (2008). Colorectal cancer progression correlates with upregulation of S100A11 expression in tumor tissues. International Journal of Colorectal Disease 23(7):675-682. 738. Xiao, M-b, Jiang, F, Ni, W-k, et al. (2012). High expression of S100A11 in pancreatic adenocarcinoma is an unfavorable prognostic marker. Medical Oncology 29(3):1886- 1891. 739. Zhao, F-T, Jia, Z-S, Yang, Q, et al. (2013). S100A14 promotes the growth and metastasis of hepatocellular carcinoma. Asian Pacific Journal of Cancer Prevention 14(6):3831- 3836. 740. Xu, C, Chen, H, Wang, X, et al. (2014). S100A14, a member of the EF-hand calcium- binding proteins, is overexpressed in breast cancer and acts as a modulator of HER2 signaling. Journal of Biological Chemistry 289(2):827-837. 741. Tanaka, M, Ichikawa-Tomikawa, N, Shishito, N, et al. (2015). Co-expression of S100A14 and S100A16 correlates with a poor prognosis in human breast cancer and promotes cancer cell invasion. BMC Cancer 15(1):53. 742. Saito, K, Kobayashi, M, Nagashio, R, et al. (2015). S100A16 is a prognostic marker for lung adenocarcinomas. Asian Pacific Journal of Cancer Prevention 16(16):7039-7044. 743. Charmsaz, S, Hughes, E, Bane, FT, et al. (2017). S100beta as a serum marker in endocrine resistant breast cancer. BMC Medicine 15(1):79. 744. Hwang, C-cP, Chai, H-tP, Chen, H-wP, et al. (2011). S100B protein expressions as an independent predictor of early relapse in UICC stages II and III colon cancer patients after curative resection. Annals of Surgical Oncology 18(1):139-145. 745. Wang, G, Platt-Higgins, A, Carroll, J, et al. (2006). Induction of metastasis by S100P in a rat mammary model and its association with poor survival of breast cancer patients. Cancer Research 66(2):1199-1207. 746. Kim, JK, Jung, KH, Noh, JH, et al. (2009). Targeted disruption of S100P suppresses tumor cell growth by down-regulation of cyclin D1 and CDK2 in human hepatocellular carcinoma. International Journal of Oncology 35:1257-1264. 747. Liu, YF, Liu, QQ, Wang, X, et al. (2014). Clinical significance of S100A2 expression in gastric cancer. Tumour Biology 35(4):3731-3741. 748. Zhao, Y, Zhang, TB, and Wang, Q (2013). Clinical significance of altered S100A2 expression in gastric cancer. Oncology Reports 29(4):1556-1562. 749. Luo, J, Zhu, Y, Yang, G, et al. (2011). Loss of Reprimo and S100A2 expression in human gastric adenocarcinoma. Diagnostic Cytopathology 39(10):752-757. 750. De Petris, L, Orre, LM, Kanter, L, et al. (2009). Tumor expression of S100A6 correlates with survival of patients with stage I non-small-cell lung cancer. Lung Cancer 63(3):410- 417. 751. Chen, H, Ma, J, Sunkel, B, et al. (2013). S100A14: novel modulator of terminal differentiation in esophageal cancer. Molecular Cancer Research 11(12):1542-1553. 752. Sapkota, D, Bruland, O, Parajuli, H, et al. (2015). S100A16 promotes differentiation and contributes to a less aggressive tumor phenotype in oral squamous cell carcinoma. BMC Cancer 15:631. 753. Marinakis, E, Bagkos, G, Piperi, C, et al. (2014). Critical role of RAGE in lung physiology and tumorigenesis: a potential target of therapeutic intervention? Clinical Chemistry and Laboratory Medicine (CCLM) 52(2):189-200.

330

754. Stogsdill, JA, Stogsdill, MP, Porter, JL, et al. (2012). Embryonic overexpression of receptors for advanced glycation end-products by alveolar epithelium induces an imbalance between proliferation and apoptosis. American Journal of Respiratory Cell and Molecular Biology 47(1):60-66. 755. Demling, N, Ehrhardt, C, Kasper, M, et al. (2006). Promotion of cell adherence and spreading: a novel function of RAGE, the highly selective differentiation marker of human alveolar epithelial type I cells. Cell and Tissue Research 323(3):475-488. 756. Logsdon, CD, Fuentes, MK, Huang, EH, et al. (2007). RAGE and RAGE ligands in cancer. Current Molecular Medicine 7(8):777-789. 757. Buckley, ST and Ehrhardt, C (2010). The receptor for advanced glycation end products (RAGE) and the lung. Journal of Biomedicine and Biotechnology 2010:917108-917118. 758. Bartling, B, Demling, N, Silber, R-E, et al. (2006). Proliferative stimulus of lung fibroblasts on lung cancer cells is impaired by the receptor for advanced glycation end- products. American Journal of Respiratory Cell and Molecular Biology 34(1):83-91. 759. Bartling, B, Hofmann, H-S, Weigle, B, et al. (2005). Down-regulation of the receptor for advanced glycation end-products (RAGE) supports non-small cell lung carcinoma. Carcinogenesis 26(2):293-301. 760. Yu, YX, Pan, WC, and Cheng, YF (2017). Silencing of advanced glycosylation and glycosylation and product-specific receptor (RAGE) inhibits the metastasis and growth of non-small cell lung cancer. American Journal of Translational Research 9(6):2760- 2774. 761. Turovskaya, O, Foell, D, Sinha, P, et al. (2008). RAGE, carboxylated glycans and S100A8/A9 play essential roles in colitis-associated carcinogenesis. Carcinogenesis 29(10):2035-2043. 762. Yin, C, Li, H, Zhang, B, et al. (2013). RAGE-binding S100A8/A9 promotes the migration and invasion of human breast cancer cells through actin polymerization and epithelial– mesenchymal transition. Breast Cancer Research and Treatment 142(2):297-309. 763. Narumi, K, Miyakawa, R, Ueda, R, et al. (2015). Proinflammatory proteins S100A8/S100A9 activate NK cells via interaction with RAGE. Journal of Immunology 194(11):5539-5548. 764. Kaczanowska, S, Joseph, AM, and Davila, E (2013). TLR agonists: our best frenemy in cancer immunotherapy. Journal of Leukocyte Biology 93(6):847-863. 765. Yeh, D-W, Huang, L-R, Chen, Y-W, et al. (2016). Interplay between inflammation and stemness in cancer cells: the role of toll-like receptor signaling. Journal of Immunology Research 2016:4368101. 766. Källberg, E, Vogl, T, Liberg, D, et al. (2012). S100A9 interaction with TLR4 promotes tumor growth. PLoS ONE 7(3):1. 767. He, W, Liu, Q, Wang, L, et al. (2007). TLR4 signaling promotes immune escape of human lung cancer cells by inducing immunosuppressive cytokines and apoptosis resistance. Molecular Immunology 44(11):2850-2859. 768. Liu, X, Pei, C, Yan, S, et al. (2015). NADPH oxidase 1-dependent ROS is crucial for TLR4 signaling to promote tumor metastasis of non-small cell lung cancer. Tumor Biology 36(3):1493-1502. 769. Arora, M, Poe, SL, Oriss, TB, et al. (2010). TLR4/MyD88-Induced CD11b(+)Gr- 1(int)F4/80(+) Non-Migratory Myeloid Cells Suppress Th2 Effector Function in the Lung. Mucosal Immunology 3(6):578-593. 770. Li, C, Li, H, Jiang, K, et al. (2014). TLR4 signaling pathway in mouse Lewis lung cancer cells promotes the expression of TGF-β1 and IL-10 and tumor cells migration. Bio- medical Materials and Engineering 24(1):869-875. 771. Deguchi, A, Tomita, T, Ohto, U, et al. (2016). Eritoran inhibits S100A8-mediated TLR4/MD-2 activation and tumor growth by changing the immune microenvironment. Oncogene 35(11):1445-1456.

331

772. Loser, K, Vogl, T, Voskort, M, et al. (2010). The Toll-like receptor 4 ligands Mrp8 and Mrp14 are crucial in the development of autoreactive CD8+ T cells. Nature Medicine 16(6):713-717. 773. Testi, R, D'Ambrosio, D, De Maria, R, et al. (1994). The CD69 receptor: a multipurpose cell-surface trigger for hematopoietic cells. Immunology Today 15(10):479-483. 774. Esplugues, E, Sancho, D, Vega-Ramos, J, et al. (2003). Enhanced antitumor immunity in mice deficient in CD69. The Journal of Experimental Medicine 197(9):1093-1106. 775. Esplugues, E, Vega-Ramos, J, Cartoixa, D, et al. (2005). Induction of tumor NK-cell immunity by anti-CD69 antibody therapy. Blood 105(11):4399-4406. 776. Wald, O, Izhar, U, Amir, G, et al. (2006). CD4+CXCR4high CD69+ T cells accumulate in lung adenocarcinoma. The Journal of Immunology 177(10):6983-6990. 777. Han, Y, Guo, Q, Zhang, M, et al. (2009). CD69+CD4+CD25− T cells, a new subset of regulatory T cells, suppress T cell proliferation through membrane-bound TGF-β1. The Journal of Immunology 182(1):111-120. 778. Shields, JD, Kourtis, IC, Tomei, AA, et al. (2010). Induction of lymphoidlike stroma and immune escape by tumors that express the chemokine CCL21. Science 328(5979):749- 752. 779. Zhu, X, Song, Z, Zhang, S, et al. (2014). CD147: a novel modulator of inflammatory and immune disorders. Current Medicinal Chemistry 21(19):2138-2145. 780. Zeng, HZ, Qu, YQ, Liang, AB, et al. (2011). Expression of CD147 in advanced non- small cell lung cancer correlated with cisplatin-based chemotherapy resistance. Neoplasma 58(5):449-454. 781. Xiong, L, Edwards, CK, and Zhou, L (2014). The biological function and clinical utilization of CD147 in human diseases: a review of the current scientific literature. International Journal of Molecular Sciences 15(10):17411-17441. 782. Wang, Z and Yan, X (2013). CD146, a multi-functional molecule beyond adhesion. Cancer Letters 330(2):150-162. 783. Oka, S, Uramoto, H, Chikaishi, Y, et al. (2012). The expression of CD146 predicts a poor overall survival in patients with adenocarcinoma of the lung. Anticancer Research 32(3):861-864. 784. Kristiansen, G, Yu, Y, Schl, et al. (2003). Expression of the cell adhesion molecule CD146/MCAM in non-small cell lung cancer. Analytical Cellular Pathology 25(2):77- 81. 785. Lin, J, Blake, M, Tang, C, et al. (2001). Inhibition of p53 transcriptional activity by the S100B calcium-binding protein. Journal of Biological Chemistry 276(37):35037-35041. 786. Mueller, A, Schäfer, BW, Ferrari, S, et al. (2005). The calcium-binding protein S100A2 interacts with p53 and modulates its transcriptional activity. Journal of Biological Chemistry 280(32):29186-29193. 787. van Dieck, J, Teufel, DP, Jaulent, AM, et al. (2009). Posttranslational modifications affect the interaction of S100 proteins with tumor suppressor p53. Journal of Molecular Biology 394(5):922-930. 788. Grigorian, M, Andresen, S, Tulchinsky, E, et al. (2001). Tumor Suppressor p53 protein is a new target for the metastasis-associated Mts1/S100A4 protein: functional consequences of their interaction Journal of Biological Chemistry 276(25):22699-22708. 789. Słomnicki, ŁP, Nawrot, B, and Leśniak, W (2009). S100A6 binds p53 and affects its activity. International Journal of Biochemistry & Cell Biology 41(4):784-790. 790. Fresno Vara, JA, Casado, E, de Castro, J, et al. (2004). PI3K/Akt signalling pathway and cancer. Cancer Treatment Reviews 30(2):193-204. 791. Xiao, Q, Chen, Z, Jin, X, et al. (2017). The many postures of noncanonical Wnt signaling in development and diseases. Biomedicine & Pharmacotherapy 93:359-369. 792. Jin, e, Chen, H, Luo, A, et al. (2011). S100A14 stimulates cell proliferation and induces cell apoptosis at different concentrations via receptor for advanced glycation end products (RAGE). PLoS ONE 6(4):e19375.

332

793. Arumugam, T, Simeone, DM, Schmidt, AM, et al. (2004). S100P stimulates cell proliferation and survival via receptor for activated glycation end products (RAGE). Journal of Biological Chemistry 279(7):5059-5065. 794. Fuentes, MK, Nigavekar, SS, Arumugam, T, et al. (2007). RAGE activation by S100P in colon cancer stimulates growth, migration, and cell signaling pathways. Diseases of the Colon & Rectum 50(8):1230-1240. 795. Arumugam, T and Logsdon, CD (2011). S100P: a novel therapeutic target for cancer. Amino Acids 41(4):893-899. 796. Shirley, SH, von Maltzan, K, Robbins, PO, et al. (2014). Melanocyte and melanoma cell activation by calprotectin. Journal of Skin Cancer 2014:846249. 797. Lim, SY, Yuzhalin, AE, Gordon-Weeks, AN, et al. (2016). Tumor-infiltrating monocytes/macrophages promote tumor invasion and migration by upregulating S100A8 and S100A9 expression in cancer cells. Oncogene 35(44):5735-5745. 798. Zhang, X, Ai, F, Li, X, et al. (2015). Inflammation-induced S100A8 activates Id3 and promotes colorectal tumorigenesis. International Journal of Cancer 137(12):2803-2814. 799. Ghavami, S, Kerkhoff, C, Los, M, et al. (2004). Mechanism of apoptosis induced by S100A8/A9 in colon cancer cell lines: the role of ROS and the effect of metal ions. Journal of Leukocyte Biology 76(1):169-175. 800. Nakatani, Y, Yamazaki, M, J. Chazin, W, et al. (2005). Regulation of S100A8/A9 (calprotectin) binding to tumor cells by zinc ion and its implication for apoptosis-inducing activity. Mediators of Inflammation 2005(5):280-292. 801. Kevin, C, Jason, H, Rodney, JO, et al. (2014). Intracellular expression of inflammatory proteins S100A8 and S100A9 leads to epithelial-mesenchymal transition and attenuated aggressivity of breast cancer cells. Anti-Cancer Agents in Medicinal Chemistry 14(1):35- 45. 802. Li, C, Zhang, F, Lin, M, et al. (2004). Induction of S100A9 gene expression by cytokine oncostatin M in breast cancer cells through the STAT3 signaling cascade. Breast Cancer Research and Treatment 87(2):123-134. 803. Ghavami, S, Kerkhoff, C, Chazin, WJ, et al. (2008). S100A8/9 induces cell death via a novel, RAGE-independent pathway that involves selective release of Smac/DIABLO and Omi/HtrA2. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1783(2):297-311. 804. Liu, K, Zhang, Y, Zhang, C, et al. (2016). Methylation of S100A8 is a promising diagnosis and prognostic marker in hepatocellular carcinoma. Oncotarget 7(35):56798- 56810. 805. Wu, R, Duan, L, Cui, F, et al. (2015). S100A9 promotes human hepatocellular carcinoma cell growth and invasion through RAGE-mediated ERK1/2 and p38 MAPK pathways. Experimental Cell Research 334(2):228-238. 806. Khammanivong, A, Wang, C, Sorenson, BS, et al. (2013). S100A8/A9 (calprotectin) negatively regulates G2/M cell cycle progression and growth of squamous cell carcinoma. PLoS ONE 8(7):e69395. 807. Miao, L, Grebhardt, S, Shi, J, et al. (2012). Prostaglandin E2 stimulates S100A8 expression by activating protein kinase A and CCAAT/enhancer-binding-protein-beta in prostate cancer cells. International Journal of Biochemistry & Cell Biology 44(11):1919- 1928. 808. Grebhardt, S, Veltkamp, C, Ströbel, P, et al. (2012). Hypoxia and HIF-1 increase S100A8 and S100A9 expression in prostate cancer. International Journal of Cancer 131(12):2785-2794. 809. Grebhardt, S, Müller-Decker, K, Bestvater, F, et al. (2014). Impact of S100A8/A9 Expression on Prostate Cancer Progression In Vitro and In Vivo. Journal of Cellular Physiology 229(5):661-671. 810. Fei, F, Qu, J, Zhang, M, et al. (2017). S100A4 in cancer progression and metastasis: A systematic review. Oncotarget 8(42):73219–73239.

333

811. Luo, C, Wang, X, An, C, et al. (2017). Molecular inhibition mechanisms of cell migration and invasion by coix polysaccharides in A549 NSCLC cells via targeting S100A4. Molecular Medicine Reports 15(1):309-316. 812. Stewart, RL, Carpenter, BL, West, DS, et al. (2016). S100A4 drives non-small cell lung cancer invasion, associates with poor prognosis, and is effectively targeted by the FDA- approved anti-helminthic agent niclosamide. Oncotarget 7(23):34630-34642. 813. Chen, N, Sato, D, Saiki, Y, et al. (2014). S100A4 is frequently overexpressed in lung cancer cells and promotes cell growth and cell motility. Biochemical and Biophysical Research Communications 447(3):459-464. 814. Grum-Schwensen, B, Klingelhöfer, J, Grigorian, M, et al. (2010). Lung metastasis fails in MMTV-PyMT oncomice lacking S100A4 due to a T-cell deficiency in primary tumors. Cancer Research 70(3):936-947. 815. Hiratsuka, S, Watanabe, A, Aburatani, H, et al. (2006). Tumour-mediated upregulation of chemoattractants and recruitment of myeloid cells predetermines lung metastasis. Nature Cell Biology 8:1369 - 1375. 816. Yong, H-Y and Moon, A (2007). Roles of calcium-binding proteins, S100A8 and S100A9, in invasive phenotype of human gastric cancer cells. Archives of Pharmacal Research 30(1):75-81. 817. Iotzova-Weiss, G, Dziunycz, PJ, Freiberger, SN, et al. (2015). S100A8/A9 stimulates keratinocyte proliferation in the development of squamous cell carcinoma of the skin via the receptor for advanced glycation-end products. PLoS ONE 10(3):e0120971. 818. Kwon, C, Moon, H, Park, H, et al. (2013). S100A8 and S100A9 promotes invasion and migration through p38 mitogen-activated protein kinase-dependent NF-κB activation in gastric cancer cells. Molecular Cell 35(3):226-234. 819. Yan, L-L, Huang, Y-J, Yi, X, et al. (2015). Effects of silencing S100A8 and S100A9 with small interfering RNA on the migration of CNE1 nasopharyngeal carcinoma cells. Oncology Letters 9(6):2534-2540. 820. Silva, EJ, Argyris, PP, Zou, X, et al. (2014). S100A8/A9 regulates MMP-2 expression and invasion and migration by carcinoma cells. The International Journal of Biochemistry & Cell Biology 55:279-287. 821. Ortiz, ML, Lu, L, Ramachandran, I, et al. (2014). Myeloid-derived suppressor cells in the development of lung cancer. Cancer Immunology Research 2(1):50-58. 822. Choi, D-K, Li, Z, Chang, I-K, et al. (2014). Clinicopathological roles of S100A8 and S100A9 in cutaneous squamous cell carcinoma in vivo and in vitro. Archives of Dermatological Research:1-8. 823. De Ponti, A, Wiechert, L, Schneller, D, et al. (2015). A pro-tumorigenic function of S100A8/A9 in carcinogen-induced hepatocellular carcinoma. Cancer Letters 369(2):396- 404. 824. O'Connell, JT, Sugimoto, H, Cooke, VG, et al. (2011). VEGF-A and Tenascin-C produced by S100A4+ stromal cells are important for metastatic colonization. Proceedings of the National Academy of Sciences of the United States of America 108(38):16002-16007. 825. Wang, L, Wang, X, Liang, Y, et al. (2012). S100A4 promotes invasion and angiogenesis in breast cancer MDA-MB-231 cells by upregulating matrix metalloproteinase-13. Acta Biochimica Polonica 59(4):593-598. 826. Hernández, JL, Padilla, L, Dakhel, S, et al. (2013). Therapeutic targeting of tumor growth and angiogenesis with a novel anti-S100A4 monoclonal antibody. PLoS ONE 8(9): e72480. 827. Ochiya, T, Takenaga, K, and Endo, H (2014). Silencing of S100A4, a metastasis- associated protein, in endothelial cells inhibits tumor angiogenesis and growth. Angiogenesis 17(1):17-26. 828. Bulk, E, Hascher, A, Liersch, R, et al. (2008). Adjuvant therapy with small hairpin RNA interference prevents non–small cell lung cancer metastasis development in mice. Cancer Research 68(6):1896-1904.

334

829. Li, C, Li, S, Jia, C, et al. (2012). Low concentration of S100A8/9 promotes angiogenesis- related activity of vascular endothelial cells: bridges among inflammation, angiogenesis, and tumorigenesis? Mediators of Inflammation 2012:248574. 830. Moon, A, Yong, HY, Song, JI, et al. (2008). Global gene expression profiling unveils S100A8/A9 as candidate markers in H-ras-mediated human breast epithelial cell invasion. Molecular Cancer Research 6(10):1544-1553. 831. Hegde, VL, Nagarkatti, M, and Nagarkatti, PS (2010). Cannabinoid receptor activation leads to massive mobilization of myeloid-derived suppressor cells with potent immunosuppressive properties. European Journal of Immunology 40(12):3358-3371. 832. Naz, S, Bashir, M, Ranganathan, P, et al. (2014). Protumorigenic actions of S100A2 involve regulation of PI3/Akt signaling and functional interaction with Smad3. Carcinogenesis 35(1):14-23. 833. Kang, M, Lee, HS, Lee, YJ, et al. (2015). S100A3 suppression inhibits in vitro and in vivo tumor growth and invasion of human castration-resistant prostate cancer cells. Urology 85(1):273.e9-273.e15. 834. Klingelhofer, J, Grum-Schwensen, B, Beck, MK, et al. (2012). Anti-S100A4 antibody suppresses metastasis formation by blocking stroma cell invasion. Neoplasia 14(12):1260-1268. 835. Siddique, HR, Adhami, VM, Parray, A, et al. (2013). The S100A4 oncoprotein promotes prostate tumorigenesis in a transgenic mouse model: regulating NFκB through the RAGE receptor. Genes & Cancer 4(5-6):224-234. 836. Dahlmann, M, Sack, U, Herrmann, P, et al. (2012). Systemic shRNA mediated knockdown of S100A4 in colorectal cancer xenografted mice reduces metastasis formation. Oncotarget 3(8):783-797. 837. Duan, L, Wu, R, Zou, Z, et al. (2014). S100A6 stimulates proliferation and migration of colorectal carcinoma cells through activation of the MAPK pathways. International Journal of Oncology 44(3):781-790. 838. Liu, G, Wu, Q, Liu, G, et al. (2014). Knockdown of S100A7 reduces lung squamous cell carcinoma cell growth in vitro and in vivo. International Journal of Clinical and Experimental Pathology 7(11):8279-89. 839. Nasser, MW, Qamri, Z, Deol, YS, et al. (2012). S100A7 enhances mammary tumorigenesis through upregulation of inflammatory pathways. Cancer Research 72(3):604-615. 840. Nasser, MW, Wani, NA, Ahirwar, DK, et al. (2015). RAGE mediates S100A7-induced breast cancer growth and metastasis by modulating the tumor microenvironment. Cancer Research 75(6):974-985. 841. Phipps, KD, Surette, AP, O'Connell, PA, et al. (2011). Plasminogen receptor S100A10 is essential for the migration of tumor-promoting macrophages into tumor sites. Cancer Research 71(21):6676-6683. 842. Hao, J, Wang, K, Yue, Y, et al. (2012). Selective expression of S100A11 in lung cancer and its role in regulating proliferation of adenocarcinomas cells. Molecular and Cellular Biochemistry 359(1):323-332. 843. Hsu, Y-L, Hung, J-Y, Liang, Y-Y, et al. (2015). S100P interacts with integrin α7 and increases cancer cell migration and invasion in lung cancer. Oncotarget 6(30):29585- 29598. 844. Basu, GD, Azorsa, DO, Kiefer, JA, et al. (2008). Functional evidence implicating S100P in prostate cancer progression. International Journal of Cancer 123(2):330-339. 845. Jiang, L, Lai, Y-K, Zhang, J, et al. (2011). Targeting S100P inhibits colon cancer growth and metastasis by lentivirus-mediated RNA interference and proteomic analysis. Molecular Medicine 17(7-8):709-716. 846. Dakhel, S, Padilla, L, Adan, J, et al. (2014). S100P antibody-mediated therapy as a new promising strategy for the treatment of pancreatic cancer. Oncogenesis 3(3):e92.

335

847. Deol, YS, Nasser, MW, Yu, L, et al. (2011). Tumor-suppressive effects of psoriasin (S100A7) are mediated through the β-catenin/T cell factor 4 protein pathway in estrogen receptor-positive breast cancer cells. Journal of Biological Chemistry 286(52):44845- 44854. 848. Kumar, M, Srivastava, G, Kaur, J, et al. (2015). Prognostic significance of cytoplasmic S100A2 overexpression in oral cancer patients. Journal of Translational Medicine 13:8. 849. Tsai, W-C, Tsai, S-T, Jin, Y-T, et al. (2006). Cyclooxygenase-2 is involved in S100A2- mediated tumor suppression in squamous cell carcinoma. Molecular Cancer Research 4(8):539-547. 850. Zhou, G, Xie, TX, Zhao, M, et al. (2008). Reciprocal negative regulation between S100A7/psoriasin and [beta]-catenin signaling plays an important role in tumor progression of squamous cell carcinoma of oral cavity. Oncogene 27(25):3527-3538. 851. de Carvalho, GC, Domingues, R, de Sousa Nogueira, MA, et al. (2016). Up-regulation of proinflammatory genes and cytokines induced by S100A8 in CD8+ T cells in Lichen Planus. Acta Dermato Venereologica 96(4):485-489. 852. Siegel, RL, Miller, KD, and Jemal, A (2016). Cancer statistics, 2016. CA: A Cancer Journal for Clinicians 66(1):7-30. 853. Doki, Y, Murakami, K, Yamaura, T, et al. (1999). Mediastinal lymph node metastasis model by orthotopic intrapulmonary implantation of Lewis lung carcinoma cells in mice. British Journal of Cancer 79(7/8):1121–1126. 854. He, H, Han, L, Guan, W, et al. (2013). An efficient expression and purification strategy for the production of S100 proteins in Escherichia coli. Bioengineered 4(1):55-58. 855. Maity, R, Pauty, J, Krietsch, J, et al. (2013). GST-His purification: a two-step affinity purification protocol yielding full-length purified proteins. Journal of Visualized Experiments (80):e50320. 856. Eberlein, GA (1995). Quantitation of proteins using HPLC-detector response rather than standard curve comparison. Journal of Pharmaceutical and Biomedical Analysis 13(10):1263-1271. 857. Development Organization Workgroup Asn, ATCCS (2010). Cell line misidentification: the beginning of the end. Nature Reviews Cancer 10(6). 858. Denecke, J, Becker, K, Jurgens, H, et al. (1999). Falsification of tetrazolium dye (MTT) based cytotoxicity assay results due to mycoplasma contamination of cell cultures. Anticancer Research 19(2a):1245-1248. 859. Sugiura, K, Stock, CC, and Sugiura, MM (1955). Studies in a tumor spectrum: III. the effect of phosphoramides on the growth of a variety of mouse and rat tumors. Cancer Research 15(1):38-51. 860. Kellar, A, Egan, C, and Morris, D (2015). Preclinical murine models for lung cancer: clinical trial applications. BioMed Research International 2015:17. 861. Teicher, BA (2006). Tumor models for efficacy determination. Molecular Cancer Therapeutics 5(10):2435. 862. Meuwissen, R and Berns, A (2005). Mouse models for human lung cancer. Genes & Development 19(6):643-664. 863. Garcia-Sanz, M, Simon-Marin, R, and Hilario, E (1989). Morphological characterization of Lewis lung carcinoma (3LL). A light and electron microscopic study. Tumori 75(1):23- 27. 864. Li, HY, McSharry, M, Bullock, B, et al. (2017). The tumor microenvironment regulates sensitivity of murine lung tumors to PD-1/PD-L1 antibody blockade. Cancer Immunology Research 5(9):767-777. 865. Jin, H, Yang, R, Fong, S, et al. (2004). Apo2 ligand/tumor necrosis factor-related apoptosis-inducing ligand cooperates with chemotherapy to inhibit orthotopic lung tumor growth and improve survival. Cancer Research 64(14):4900-4905. 866. McCarroll, JA, Dwarte, T, Baigude, H, et al. (2015). Therapeutic targeting of polo-like kinase 1 using RNA-interfering nanoparticles (iNOPs) for the treatment of non-small cell lung cancer. Oncotarget 6(14):12020-12034.

336

867. Herter-Sprie, GS, Korideck, H, Christensen, CL, et al. (2014). Image-guided radiotherapy platform using single nodule conditional lung cancer mouse models. Nature Communications 5:5870. 868. Lee, J, Tsang, W, and Chow, K (2011). Simple modifications to standard TRIzol® protocol allow high-yield RNA extraction from cells on resorbable materials. Journal of Biomaterials and Nanobiotechnology 2011(2):41-48. 869. Mahmood, T and Yang, P-C (2012). Western blot: technique, theory, and trouble shooting. North American Journal of Medical Sciences 4(9):429-434. 870. Chung, YM, Goyette, J, Tedla, N, et al. (2013). S100A12 suppresses pro-inflammatory, but not pro-thrombotic functions of serum amyloid A. PLoS ONE 8(4):e62372. 871. Shlafer, M, Myers, CL, and Adkins, S (1987). Mitochondrial hydrogen peroxide generation and activities of glutathione peroxidase and superoxide dismutase following global ischemia. Journal of Molecular and Cellular Cardiology 19(12):1195-1206. 872. Erel, O (2005). A new automated colorimetric method for measuring total oxidant status. Clinical Biochemistry 38(12):1103-1111. 873. Nelson, KJ and Parsonage, D (2011). Measurement of peroxiredoxin activity. Current Protocols in Toxicology / Editorial Board, Mahin D. Maines (editor-in-chief) ... [et al.] 0 7:Unit7.10. 874. Hill, KE, McCollum, GW, and Burk, RF (1997). Determination of thioredoxin reductase activity in rat liver supernatant. Analytical Biochemistry 253(1):123-125. 875. Dimitriades, V, Rodriguez, PC, Zabaleta, J, et al. (2014). Arginase I levels are decreased in the plasma of pediatric patients with atopic dermatitis. Annals of Allergy, Asthma & Immunology 113(3):271-275. 876. Rahmatullah, M and Boyde, TRC (1980). Improvements in the determination of urea using diacetyl monoxime; methods with and without deproteinisation. Clinica Chimica Acta 107(1):3-9. 877. Ignarro, LJ, Fukuto, JM, Griscavage, JM, et al. (1993). Oxidation of nitric oxide in aqueous solution to nitrite but not nitrate: comparison with enzymatically formed nitric oxide from L-arginine. Proceedings of the National Academy of Sciences of the United States of America 90(17):8103–8107. 878. Wakeham, J, Wang, J, Magram, J, et al. (1998). Lack of both types 1 and 2 cytokines, tissue inflammatory responses, and immune protection during pulmonary infection by Mycobacterium bovis bacille Calmette-Guérin in IL-12-deficient mice. Journal of Immunology 160(12):6101. 879. McCarroll, JA, Gan, PP, Erlich, RB, et al. (2015). TUBB3/βIII-tubulin acts through the PTEN/AKT signaling axis to promote tumorigenesis and anoikis resistance in non–small cell lung cancer. Cancer Research 75(2):415-425. 880. Chung, YM, Intracellular and extracellular functions of S100A12, in Medical Sciences. Faculty of Medicine, Y.M. Chung, et al., Editors. 2013, University of New South Wales Sydney 881. Duan, L, Wu, R, Ye, L, et al. (2013). S100A8 and S100A9 are associated with colorectal carcinoma progression and contribute to colorectal carcinoma cell survival and migration via Wnt/beta-catenin pathway. PLoS ONE 8:e62092. 882. Predina, JD, Judy, B, Kapoor, V, et al. (2012). Characterization of surgical models of postoperative tumor recurrence for preclinical adjuvant therapy assessment. American Journal of Translational Research 4(2):206-218. 883. Micke, P, Basrai, M, Faldum, A, et al. (2003). Characterization of c-kit expression in small cell lung cancer: prognostic and therapeutic implications. Clinical Cancer Research 9(1):188-194. 884. Fu, S, Tang, H, Liao, Y, et al. (2016). Expression and clinical significance of insulin-like growth factor 1 in lung cancer tissues and perioperative circulation from patients with non-small-cell lung cancer. Current Oncology 23(1):12-19.

337

885. Kolárová, H, Binó, L, Pejchalová, K, et al. (2010). The expression of NADPH oxidases and production of reactive oxygen species by human lung adenocarcinoma epithelial cell line A549. Folia Biologica 56(5):211-217. 886. Song, X, Zhou, S, Xiao, N, et al. (2013). Research on the relationship between serum levels of inflammatory cytokines and non-small cell lung cancer. Asian Pacific Journal of Cancer Prevention 14(8):4765-4768. 887. Lee, JS, Yoon, A, Kalapurakal, SK, et al. (1995). Expression of p53 oncoprotein in non- small-cell lung cancer: a favorable prognostic factor. Journal of Clinical Oncology 13(8):1893-1903. 888. Yoo, J, Kim, CH, Song, SH, et al. (2004). Expression of c-kit and p53 in non-small cell lung cancers. Cancer Research and Treatment : Official Journal of Korean Cancer Association 36(3):167-172. 889. Ding, C, Fan, X, and Wu, G (2017). Peroxiredoxin 1 – an antioxidant enzyme in cancer. Journal of Cellular and Molecular Medicine 21(1):193-202. 890. Chen, PH, Chang, H, Chang, JT, et al. (2012). Aryl hydrocarbon receptor in association with RelA modulates IL-6 expression in non-smoking lung cancer. Oncogene 31(20):2555-2565. 891. Bortner, CD and Cidlowski, JA (2002). Apoptotic volume decrease and the incredible shrinking cell. Cell Death and Differentiation 9(12):1307-1310. 892. Hillhouse, EE and Lesage, S (2013). A comprehensive review of the phenotype and function of antigen-specific immunoregulatory double negative T cells. Journal of Autoimmunity 40:58-65. 893. Mitzner, W, Lee, W, Georgakopoulos, D, et al. (2000). Angiogenesis in the mouse lung. The American Journal of Pathology 157(1):93-101. 894. Ley, S, Kreitner, K-F, Morgenstern, I, et al. (2002). Bronchopulmonary shunts in patients with chronic thromboembolic pulmonary hypertension: evaluation with helical CT and MR imaging. American Journal of Roentgenology 179(5):1209-1215. 895. Savai, R, Wolf, JC, Greschus, S, et al. (2005). Analysis of tumor vessel supply in Lewis lung carcinoma in mice by fluorescent microsphere distribution and imaging with micro- and flat-panel computed tomography. The American Journal of Pathology 167(4):937- 946. 896. Gharib, SA, Nguyen, EV, Lai, Y, et al. (2011). Induced sputum proteome in healthy subjects and asthmatic patients. Journal of Allergy and Clinical Immunology 128(6):1176-1184.e6. 897. Lorenz, E, Muhlebach, MS, Tessier, PA, et al. (2008). Different expression ratio of S100A8/A9 and S100A12 in acute and chronic lung diseases. Respiratory Medicine 102(4):567-573. 898. Patwari, P, Higgins, LJ, Chutkow, WA, et al. (2006). The interaction of thioredoxin with Txnip: evidence for formation of a mixed disulfide by disulfide exchange Journal of Biological Chemistry 281(31):21884-21891. 899. Nakajima, H, Itakura, M, Kubo, T, et al. (2017). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) aggregation causes mitochondrial dysfunction during oxidative stress-induced cell death. Journal of Biological Chemistry 292(11):4727-4742. 900. Kalinski, P (2011). Regulation of immune responses by prostaglandin E2. Journal of Immunology 188(1):21. 901. Slaats, J, ten Oever, J, van de Veerdonk, FL, et al. (2016). IL-1β/IL-6/CRP and IL- 18/ferritin: distinct inflammatory programs in infections. PLOS Pathogens 12(12):e1005973. 902. Gillessen, S, Carvajal, D, Ling, P, et al. (1995). Mouse interleukin-12 (IL-12) p40 homodimer: a potent IL-12 antagonist. European Journal of Immunology 25(1):200-206. 903. Kang, JH, Hwang, SM, and Chung, IY (2015). S100A8, S100A9 and S100A12 activate airway epithelial cells to produce MUC5AC via extracellular signal-regulated kinase and nuclear factor-kappaB pathways. Immunology 144(1):79-90.

338

904. Trikha, P and Carson, WE (2014). Signaling pathways involved in MDSC regulation. Biochimica et Biophysica Acta 1846(1):55-65. 905. Wang, R, Lu, M, Zhang, J, et al. (2011). Increased IL-10 mRNA expression in tumor- associated macrophage correlated with late stage of lung cancer. Journal of Experimental & Clinical Cancer Research 30(1):62-70. 906. Miotto, D, Cascio, NL, Stendardo, M, et al. (2010). CD8+ T cells expressing IL-10 are associated with a favourable prognosis in lung cancer. Lung Cancer 69(3):355-360. 907. Wai Wong, C, Dye, DE, and Coombe, DR (2012). The role of immunoglobulin superfamily cell adhesion molecules in cancer metastasis. International Journal of Cell Biology 2012:340296. 908. Look, DC, Pelletier, MR, and Holtzman, MJ (1994). Selective interaction of a subset of interferon-gamma response element-binding proteins with the intercellular adhesion molecule-1 (ICAM-1) gene promoter controls the pattern of expression on epithelial cells. Journal of Biological Chemistry 269(12):8952-8958. 909. Beck-Schimmer, B, Madjdpour, C, Kneller, S, et al. (2002). Role of alveolar epithelial ICAM-1 in lipopolysaccharide-induced lung inflammation. European Respiratory Journal 19(6):1142-1150. 910. Kotteas, EA, Boulas, P, Gkiozos, I, et al. (2014). The intercellular cell adhesion molecule- 1 (icam-1) in lung cancer: implications for disease progression and prognosis. Anticancer Research 34(9):4665-4672. 911. Liao, W, Lin, JX, and Leonard, WJ (2011). IL-2 family cytokines: new insights into the complex roles of IL-2 as a broad regulator of T helper cell differentiation. Current Opinion in Immunology 23(5):598-604. 912. Welsh, RM, Bahl, K, Marshall, HD, et al. (2012). Type 1 interferons and antiviral CD8 T-cell responses. PLoS Pathogens 8(1):e1002352. 913. Yao, S, Buzo, Bruno F, Pham, D, et al. (2013). Interferon regulatory factor 4 sustains CD8+ T cell expansion and effector differentiation. Immunity 39(5):833-845. 914. Lindau, D, Gielen, P, Kroesen, M, et al. (2013). The immunosuppressive tumour network: myeloid-derived suppressor cells, regulatory T cells and natural killer T cells. Immunology 138(2):105-115. 915. Morris, SM (2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual Review of Nutrition 22:87-105. 916. Niese, KA, Chiaramonte, MG, Ellies, LG, et al. (2010). The cationic amino acid transporter 2 is induced in inflammatory lung models and regulates lung fibrosis. Respiratory Research 11(1):87. 917. Rothenberg, ME, Doepker, MP, Lewkowich, IP, et al. (2006). Cationic amino acid transporter 2 regulates inflammatory homeostasis in the lung. Proceedings of the National Academy of Sciences of the United States of America 103(40):14895–14900. 918. Thompson, RW, Pesce, JT, Ramalingam, T, et al. (2008). Cationic amino acid transporter-2 regulates immunity by modulating arginase activity. PLoS Pathogens 4:e1000023. 919. Jiang, Q, Liu, D, and Zheng, R (2002). Comparison of expression levels of S29, 18s rRNA and GAPDH genes in lung tumor tissues. Tumor 22:201-203. 920. Schmidt, B, Engel, E, Carstensen, T, et al. (2005). Quantification of free RNA in serum and bronchial lavage: a new diagnostic tool in lung cancer detection? Lung Cancer 48(1):145-147. 921. Cuezva, JM, Chen, G, Alonso, AM, et al. (2004). The bioenergetic signature of lung adenocarcinomas is a molecular marker of cancer diagnosis and prognosis. Carcinogenesis 25(7):1157-1163. 922. Demarse, NA, Ponnusamy, S, Spicer, EK, et al. (2009). Direct binding of glyceraldehyde 3-phosphate dehydrogenase to telomeric DNA protects telomeres against chemotherapy- induced rapid degradation. Journal of Molecular Biology 394(4):789-803. 923. Baek, D, Jin, Y, Jeong, JC, et al. (2008). Suppression of reactive oxygen species by glyceraldehyde-3-phosphate dehydrogenase. Phytochemistry 69(2):333-338.

339

924. Takaoka, Y, Goto, S, Nakano, T, et al. (2014). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) prevents lipopolysaccharide (LPS)-induced, sepsis-related severe acute lung injury in mice. Scientific Reports 4:5204. 925. Hara, MR, Agrawal, N, Kim, SF, et al. (2005). S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding. Nature Cell Biology 7(7):665-674. 926. Mao, GD, Thomas, PD, Lopaschuk, GD, et al. (1993). Superoxide dismutase (SOD)- catalase conjugates. Role of hydrogen peroxide and the Fenton reaction in SOD toxicity. Journal of Biological Chemistry 268(1):416-420. 927. Sun, Y-L, Cai, J-Q, Liu, F, et al. (2015). Aberrant expression of peroxiredoxin 1 and its clinical implications in liver cancer. World Journal of Gastroenterology 21(38):10840- 10852. 928. Wu, W, Peden, D, and Diaz-Sanchez, D (2012). Role of GSTM1 in resistance to lung inflammation. Free Radical Biology & Medicine 53(4):721-729. 929. Ryter, SW and Choi, AM (2005). Heme oxygenase-1: redox regulation of a stress protein in lung and cell culture models. Antioxid Redox Signal 7(1-2):80-91. 930. Krystal, GW, DeBerry, CS, Linnekin, D, et al. (1998). Lck associates with and is activated by Kit in a small cell lung cancer cell line: inhibition of SCF-mediated growth by the Src family kinase inhibitor PP1. Cancer Research 58(20):4660-4666. 931. Gombos, A, Metzger-Filho, O, Dal Lago, L, et al. (2012). Clinical development of insulin-like growth factor receptor—1 (IGF-1R) inhibitors: At the crossroad? Investigational New Drugs 30(6):2433-2442. 932. Nurwidya, F, Andarini, S, Takahashi, F, et al. (2016). Implications of insulin-like growth factor 1 receptor activation in lung cancer. Malaysian Journal of Medical Sciences 23(3):9-21. 933. Chattopadhyay, S, Machado-Pinilla, R, Manguan-Garcia, C, et al. (2006). MKP1//CL100 controls tumor growth and sensitivity to cisplatin in non-small-cell lung cancer. Oncogene 25(23):3335-3345. 934. Yu, Y, Liu, Y, Zong, C, et al. (2016). Mesenchymal stem cells with Sirt1 overexpression suppress breast tumor growth via chemokine-dependent natural killer cells recruitment. Scientific Reports 6:35998. 935. Baltayiannis, G, Baltayiannis, N, and Tsianos, E (2007). Suppressors of cytokine signaling as tumor repressors. Silencing of SOCS3 facilitates tumor formation and growth in lung and liver. Journal of BU ON.: official journal of the Balkan Union of Oncology 13(2):263-265. 936. Bieging, KT, Mello, SS, and Attardi, LD (2014). Unravelling mechanisms of p53- mediated tumour suppression. Nature Reviews Cancer 14(5):359-370. 937. Kessenbrock, K, Plaks, V, and Werb, Z (2010). Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 141:52-67. 938. Chen, X, Hokka, D, Maniwa, Y, et al. (2014). Sirt1 is a tumor promoter in lung adenocarcinoma. Oncology Letters 8(1):387-393. 939. Han, L, Liang, X-H, Chen, L-X, et al. (2013). SIRT1 is highly expressed in brain metastasis tissues of non-small cell lung cancer (NSCLC) and in positive regulation of NSCLC cell migration. International Journal of Clinical and Experimental Pathology 6(11):2357-2365. 940. Boye, K and Mælandsmo, GM (2010). S100A4 and metastasis : a small actor playing many roles. American Journal of Pathology 176(2):528-535. 941. You, Y, Zhang, J, Li, Y, et al. (2014). CADM1/TSLC1 inhibits melanoma cell line A375 invasion through the suppression of matrix metalloproteinases. Molecular Medicine Reports 10(5):2621-2626. 942. Kim, SA, Inamura, K, Yamauchi, M, et al. (2016). Loss of CDH1 (E-cadherin) expression is associated with infiltrative tumour growth and lymph node metastasis. British Journal of Cancer 114(2):199-206.

340

943. Skubitz, KM, Francis, P, Skubitz, AP, et al. (2012). Gene expression identifies heterogeneity of metastatic propensity in high-grade soft tissue sarcomas. Cancer 118(17):4235–4243. 944. Vázquez-Villa, F, García-Ocaña, M, Galván, JA, et al. (2015). COL11A1/(pro)collagen 11A1 expression is a remarkable biomarker of human invasive carcinoma-associated stromal cells and carcinoma progression. Tumor Biology 36(4):2213-2222. 945. Inanc, M, Ozkan, M, Karaca, H, et al. (2014). Cytokeratin 5/6, c-Met expressions, and PTEN loss prognostic indicators in triple-negative breast cancer. Medical Oncology 31(1):801. 946. Cheung, KJ, Padmanaban, V, Silvestri, V, et al. (2016). Polyclonal breast cancer metastases arise from collective dissemination of keratin 14-expressing tumor cell clusters. Proceedings of the National Academy of Sciences of the United States of America 113(7):E854-E863. 947. Okugawa, Y, Toiyama, Y, Mohri, Y, et al. (2016). Elevated serum concentration of monocyte chemotactic protein 4 (MCP-4) as a novel non-invasive prognostic and predictive biomarker for detection of metastasis in colorectal cancer. Journal of Surgical Oncology 114(4):483-489. 948. Lu, X, Duan, L, Xie, H, et al. (2016). Evaluation of MMP-9 and MMP-2 and their suppressor TIMP-1 and TIMP-2 in adenocarcinoma of esophagogastric junction. OncoTargets and Therapy 9:4343-4349. 949. Krishnamoorthy, S, Jin, R, Cai, Y, et al. (2010). 12-lipoxygenase and the regulation of hypoxia-inducible factor in prostate cancer cells. Experimental Cell Research 316(10):1706-1715. 950. Sender, V and Stamme, C (2014). Lung cell-specific modulation of LPS-induced TLR4 receptor and adaptor localization. Communicative & Integrative Biology 7(4):e29053. 951. Bosmann, M, Russkamp, NF, and Ward, PA (2012). Fingerprinting of the TLR4-induced acute inflammatory response. Experimental and Molecular Pathology 93(3):319-323. 952. Tsan, M-F and Gao, B (2004). Endogenous ligands of Toll-like receptors. Journal of Leukocyte Biology 76(3):514-519. 953. Das, KC, Lewis-Molock, Y, and White, CW (1997). Elevation of manganese superoxide dismutase gene expression by thioredoxin. American Journal of Respiratory Cell and Molecular Biology 17(6):713-726. 954. Tamarkin-Ben-Harush, A, Schechtman, E, and Dikstein, R (2014). Co-occurrence of transcription and translation gene regulatory features underlies coordinated mRNA and protein synthesis. BMC Genomics 15(1):688. 955. Bartel, DP (2009). MicroRNAs: target recognition and regulatory functions. Cell 136(2):215-233. 956. de Moor, CH, Meijer, H, and Lissenden, S (2005). Mechanisms of translational control by the 3' UTR in development and differentiation. Seminars in Cell & Developmental Biology 16(1):49-58. 957. Chen, CY, Gherzi, R, Ong, SE, et al. (2001). AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107(4):451-464. 958. Lukong, KE, Chang, KW, Khandjian, EW, et al. (2008). RNA-binding proteins in human genetic disease. Trends in Genetics 24(8):416-425. 959. Zhang, S, Xue, J, Zheng, J, et al. (2015). The superoxide dismutase 1 (SOD1) 3’UTR maintains high expression of the SOD1 gene in cancer cells: the involvement of the RNA binding protein AUF-1. Free Radical Biology & Medicine 85:33-44. 960. Abreu, RdS, Penalva, LO, Marcotte, EM, et al. (2009). Global signatures of protein and mRNA expression levels. Molecular bioSystems 5(12):1512-1526. 961. Haendeler, J, Popp, R, Goy, C, et al. (2005). Cathepsin D and H2O2 stimulate degradation of thioredoxin-1: implication for endothelial cell apoptosis. Journal of Biological Chemistry 280(52):42945-42951.

341

962. Nasu, J, Murakami, K, Miyagawa, S, et al. (2010). E6AP ubiquitin ligase mediates ubiquitin-dependent degradation of peroxiredoxin 1. Journal of Cellular Biochemistry 111(3):676-685. 963. Hodgson, EK and Fridovich, I (1975). The interaction of bovine erythrocyte superoxide dismutase with hydrogen peroxide: inactivation of the enzyme. Biochemistry 14(24):5294-5299. 964. Lim, SY, Raftery, M, Cai, H, et al. (2008). S-nitrosylated S100A8: novel anti- inflammatory properties. Journal of Immunology 181:5627-5636. 965. Zhang, J-Y, Zhang, F, Hong, C-Q, et al. (2015). Critical protein GAPDH and its regulatory mechanisms in cancer cells. Cancer Biology & Medicine 12(1):10-22. 966. Silva-Filho, JL, Caruso-Neves, C, and Pinheiro, AAS (2014). IL-4: an important cytokine in determining the fate of T cells. Biophysical Reviews 6(1):111-118. 967. Pluhar, GE, Pennell, CA, and Olin, MR (2015). CD8(+) T cell-independent immune- mediated mechanisms of anti-tumor activity. Critical Reviews in Immunology 35(2):153- 172. 968. Poznansky, MC, Olszak, IT, Foxall, R, et al. (2000). Active movement of T cells away from a chemokine. Nature Medicine 6(5):543-548. 969. Soria, J-C, Moon, C, Kemp, BL, et al. (2003). Lack of interleukin-10 expression could predict poor outcome in patients with stage I non-small cell lung cancer. Clinical Cancer Research 9(5):1785-1791. 970. Sung, W-W, Wang, Y-C, Lin, P-L, et al. (2013). IL-10 promotes tumor aggressiveness via upregulation of CIP2A transcription in lung adenocarcinoma. Clinical Cancer Research 19(15):4092-4103. 971. West, EJ, Scott, KJ, Jennings, VA, et al. (2011). Immune activation by combination human lymphokine-activated killer and dendritic cell therapy. British Journal of Cancer 105(6):787-795. 972. Gross, CC, Brzostowski, JA, Liu, D, et al. (2010). Tethering of intercellular adhesion molecule on target cells is required for LFA-1-dependent NK cell adhesion and granule polarization. Journal of Immunology 185(5):2918-2926. 973. Talmadge, JE and Gabrilovich, DI (2013). History of myeloid-derived suppressor cells. Nature Reviews Cancer 13:739-752. 974. Ilkovitch, D and Lopez, DM (2009). The liver is a site for tumor-induced myeloid-derived suppressor cell accumulation and immunosuppression. Cancer Research 69(13):5514- 5521. 975. Lipworth, BJ (1996). Pharmacokinetics of inhaled drugs. British Journal of Clinical Pharmacology 42(6):697-705. 976. Hawkes, SP, Li, H, and Taniguchi, GT (2010). Zymography and reverse zymography for detecting MMPs and TIMPs. Methods in Molecular Biology 622:257-269. 977. Crosby, LM and Waters, CM (2010). Epithelial repair mechanisms in the lung. American Journal of Physiology - Lung Cellular and Molecular Physiology 298(6):L715-L731. 978. Legrand, C, Polette, M, Tournier, J-M, et al. (2001). uPA/plasmin system-mediated MMP-9 activation is implicated in bronchial epithelial cell migration. Experimental Cell Research 264(2):326-336. 979. Wesley, UV, Bove, PF, Hristova, M, et al. (2007). Airway epithelial cell migration and wound repair by ATP-mediated activation of dual oxidase 1. Journal of Biological Chemistry 282(5):3213-3220. 980. Planus, E, Galiacy, S, Matthay, M, et al. (1999). Role of collagenase in mediating in vitro alveolar epithelial wound repair. Journal of Cell Science 112(2):243. 981. Gill, SE and Parks, WC (2008). Metalloproteinases and their inhibitors: regulators of wound healing. The International Journal of Biochemistry & Cell Biology 40(6):1334- 1347. 982. He, Y, Rajantie, I, Ilmonen, M, et al. (2004). Preexisting lymphatic endothelium but not endothelial progenitor cells are essential for tumor lymphangiogenesis and lymphatic metastasis. Cancer Research 64(11):3737-3740.

342

983. Thunnissen, E, Blaauwgeers, HJLG, Cuba, EMVd, et al. (2016). Ex vivo artifacts and histopathologic pitfalls in the lung. Archives of Pathology & Laboratory Medicine 140(3):212-220. 984. Grunt, TW, Lametschwandtner, A, and Karrer, K (1986). The characteristic structural features of the blood vessels of the Lewis lung carcinoma (a light microscopic and scanning electron microscopic study). Scan Electron Microscopy(Pt 2):575-589. 985. Uramoto, H and Tanaka, F (2014). Recurrence after surgery in patients with NSCLC. Translational Lung Cancer Research 3(4):242-249. 986. Jing, W, Li, M, Zhang, Y, et al. (2016). PD-1/PD-L1 blockades in non-small-cell lung cancer therapy. OncoTargets and Therapy 9:489-502. 987. Lim, SY, Raftery, MJ, Goyette, J, et al. (2009). Oxidative modifications of S100 proteins: functional regulation by redox. Journal of Leukocyte Biology 86:577-587. 988. Patton, JS, Fishburn, CS, and Weers, JG (2004). The lungs as a portal of entry for systemic drug delivery. Proceedings of the. American Thoracic Society 1(4):338-344. 989. Keith, IM, Olson, EB, Wilson, NM, et al. (1987). Immunological identification and effects of 3-methylcholanthrene and phenobarbital on rat pulmonary cytochrome P-450. Cancer Research 47(7):1878-1882. 990. Ji, CM, Cardoso, WV, Gebremichael, A, et al. (1995). Pulmonary cytochrome P-450 monooxygenase system and Clara cell differentiation in rats. American Journal of Physiology - Lung Cellular and Molecular Physiology 269(3):L394-L402. 991. Tronde, A, Nordén, Bo, Marchner, H, et al. Pulmonary absorption rate and bioavailability of drugs in vivo in rats: structure-absorption relationships and physicochemical profiling of inhaled drugs. Journal of Pharmaceutical Sciences 92(6):1216-1233. 992. Patton, JS and Byron, PR (2007). Inhaling medicines: delivering drugs to the body through the lungs. Nature Reviews Drug Discovery 6(1):67-74. 993. Le Noci, V, Sommariva, M, Tortoreto, M, et al. (2016). Reprogramming the lung microenvironment by inhaled immunotherapy fosters immune destruction of tumor. Oncoimmunology 5(11):e1234571. 994. Abdelaziz, HM, Gaber, M, Abd-Elwakil, MM, et al. (2017). Inhalable particulate drug delivery systems for lung cancer therapy: nanoparticles, microparticles, nanocomposites and nanoaggregates. Journal of Controlled Release 269:374-392. 995. Garbuzenko, OB, Mainelis, G, Taratula, O, et al. (2014). Inhalation treatment of lung cancer: the influence of composition, size and shape of nanocarriers on their lung accumulation and retention. Cancer Biology & Medicine 11(1):44-55. 996. Milla, P, Dosio, F, and Cattel, L (2012). PEGylation of proteins and liposomes: a powerful and flexible strategy to improve the drug delivery. Current Drug Metabolism 13(1):105-119. 997. Shahsavari, A, Azad, M, Mobarra, N, et al. (2016). Calprotectin pegylation enhanced its physical and structural properties. Protein Journal 35(5):363-370. 998. Hecht, SS, Carmella, SG, Murphy, SE, et al. (2016). Tobacco smoke toxicant and carcinogen biomarkers and lung cancer susceptibility in smokers. Journal of Thoracic Oncology 11(2):S7-S8. 999. Lipworth, BJ (1999). Systemic adverse effects of inhaled corticosteroid therapy: A systematic review and meta-analysis. Archives of Internal Medicine 159(9):941-955. 1000. Zilio, S and Serafini, P (2016). Neutrophils and granulocytic MDSC: The janus god of cancer immunotherapy. Vaccines (Basel) 4(3):31. 1001. Seubert, B, Grunwald, B, Kobuch, J, et al. (2015). Tissue inhibitor of metalloproteinases (TIMP)-1 creates a premetastatic niche in the liver through SDF-1/CXCR4-dependent neutrophil recruitment in mice. Hepatology 61(1):238-248. 1002. Youn, J-I, Collazo, M, Shalova, IN, et al. (2012). Characterization of the nature of granulocytic myeloid-derived suppressor cells in tumor-bearing mice. Journal of Leukocyte Biology 91(1):167-181.

343

1003. Michel, T, Poli, A, Domingues, O, et al. (2012). Mouse lung and spleen natural killer cells have phenotypic and functional differences, in part influenced by macrophages. PLoS ONE 7(12):e51230. 1004. Somanchi, SS, McCulley, KJ, Somanchi, A, et al. (2015). A novel method for assessment of natural killer cell cytotoxicity using image cytometry. PLoS ONE 10(10):e0141074. 1005. Patel, R, Bélanger, S, Tai, L-H, et al. (2010). Effect of Ly49 haplotype variance on NK cell function and education. The Journal of Immunology 185(8):4783. 1006. Taylor, ICA, Roy, S, Yaswen, P, et al. (1995). Mouse mammary tumors express elevated levels of RNA encoding the murine homolog of SKY, a putative receptor tyrosine kinase. Journal of Biological Chemistry 270(12):6872-6880. 1007. Chen, J-T, Huang, C-Y, Chiang, Y-Y, et al. (2008). HGF increases cisplatin resistance via down-regulation of AIF in lung cancer cells. American Journal of Respiratory Cell and Molecular Biology 38(5):559-565. 1008. Berger, W, Setinek, U, Mohr, T, et al. (1999). Evidence for a role of FGF‐2 and FGF receptors in the proliferation of non‐small cell lung cancer cells. International Journal of Cancer 83(3):415-423. 1009. Pardo, OE, Wellbrock, C, Khanzada, UK, et al. (2006). FGF‐2 protects small cell lung cancer cells from apoptosis through a complex involving PKCε, B‐Raf and S6K2. EMBO Journal 25(13):3078-3088. 1010. Cicchini, M, Buza, EL, Sagal, KM, et al. (2017). Context-dependent effects of amplified MAPK signaling during lung adenocarcinoma initiation and progression. Cell Reports 18(8):1958-1969. 1011. Sobecki, M, Mrouj, K, Colinge, J, et al. (2017). Cell cycle regulation accounts for variability in Ki-67 expression levels. Cancer Research. 1012. Zhang, C, Lu, J, Zhang, QW, et al. (2016). USP7 promotes cell proliferation through the stabilization of Ki-67 protein in non-small cell lung cancer cells. International Journal of Biochemistry & Cell Biology 79:209-221. 1013. Xie, M, Doetsch, PW, and Deng, X (2015). Bcl2 inhibition of mitochondrial DNA repair. BMC Cancer 15:586. 1014. Han, B, Park, D, Li, R, et al. (2015). Small-molecule Bcl2 BH4 antagonist for lung cancer therapy. Cancer Cell 27(6):852-863. 1015. Haeger, SM, Thompson, JJ, Kalra, S, et al. (2016). Smad4 loss promotes lung cancer formation but increases sensitivity to DNA topoisomerase inhibitors. Oncogene 35(5):577-586. 1016. Oh, HJ, Lee, K-K, Song, SJ, et al. (2006). Role of the tumor suppressor RASSF1A in Mst1-mediated apoptosis. Cancer Research 66(5):2562. 1017. Zhang, X, Huo, L, Jin, H, et al. (2017). Anti-cancer activity of Annexin V in murine melanoma model by suppressing tumor angiogenesis. Oncotarget 8(26):42602–42612. 1018. Cascio, S and Finn, O (2016). Intra- and extra-cellular events related to altered glycosylation of MUC1 promote chronic inflammation, tumor progression, invasion, and metastasis. Biomolecules 6(4):39. 1019. Schlesinger, M and Bendas, G (2015). Vascular cell adhesion molecule-1 (VCAM-1)— An increasing insight into its role in tumorigenicity and metastasis. International Journal of Cancer 136(11):2504-2514. 1020. Philippova, M, Pfaff, D, Kyriakakis, E, et al. (2013). T-cadherin loss promotes experimental metastasis of squamous cell carcinoma. European Journal of Cancer 49(8):2048-2058.

344

Appendices

Appendix I: Common chemicals and reagents General chemical/reagent Supplier Acetic acid Ajax Finechem, USA Acetonitrile Ajax Finechem, USA 40% Acrylamide/Bis Solution, 29:1 (3.3% C) Bio-Rad Laboratories Inc., Hercules, CA, USA 3-Amino-1,2,4-triazole (3-AT) Sigma, Australia Ammonium chloride BDH Chemicals, Australia Ammonium persulphate Bio-rad Laboratories Inc., Australia Ammonium sulphate (Fe II) Sigma, Australia Ampicillin sodium salt Sigma, Australia BD MatrigelTM Matrix GFR BD Biosciences, Australia Bovine serum albumin (BSA) Sigma, Australia Bromo-3-chloropropane Sigma, Australia Butylated hydroxytoluene Sigma, Australia CellTiter-Blue reagent Promega, USA Complete proteinase inhibitor mixture Roche, Australia Cumene hydroperoxide Sigma, Australia Diacetyl monoxime (2,3-BDM) Sigma, Australia Diethylenetriamine pentaacetic acid (DTPA) Sigma, Australia Dimethylsufoxide (DMSO) Sigma, Australia Dithiothreitol (DTT) Bio-rad, Australia DPX mountant for histology VWR International, Radnor, PA, USA D-Sorbitol Sigma, Australia Dulbecco’s modified Eagle’s medium (DMEM) Life Technologies, Australia Dulbecco’s phosphate-buffered saline (DPBS), Life Technologies, Australia Ca2+ /Mg2+-free Enhanced chemiluminescence reagent Perkin-Elmer, Waltham, MA, USA Ethanol, absolute Ajax Finechem, USA Ethylenediaminetetraacetic (EDTA) 0.5 M School of Medical Sciences, University of New South Wales (SOMS, UNSW) Fetal bovine serum (FBS) Gibco-Life Technologies Formaldehyde Ajax Finechem, USA Glycerol, for molecular biology, minimum 99% Sigma, Australia Glycine Sigma, Australia Glutathione-Agarose (GSH beads) Sigma, Australia Goat serum Sigma, Australia Griess reagent Sigma, Australia Hanks’ balanced salt solution (HBSS) Life Technologies, Australia Hydrochloric acid (10 M) SOMS, UNSW Hydrogen peroxide (H2O2) Ajax Finechem, USA Iron (III) chloride Sigma, Australia Isopropanol Ajax Finechem, USA Isopropyl β-D-1-thiogalactopyranoside >99%; Sigma, Australia ≤0.1% dioxane L-arginine Sigma, Australia Lennox broth (LB) SOMS buffer Manganese chloride (MnCl2) Sigma, Australia Mayer’s haematoxylin Sigma, Australia Methanol absolute Merck KgaA, Germany NADPH β Sigma, Australia Neutral buffered formalin (10%) Fronine laboratory suppliers, Australia Orthophosphoric acid (85%) Ajax Finechem, USA

345

Paraformaldehyde Sigma, Australia Penicillin/Streptomycin Life Technologies, Australia Phosphate-buffered saline (PBS) Life Technologies, Australia Potassium bicarbonate BDH Chemicals, England Precision Plus Protein Dual Colour Standards Bio-rad, Australia (Protein size marker) Pyrogallol Sigma, Australia Rabbit serum Sigma, Australia Restore Plus Western Blot Stripping Buffer Thermo Fisher Scientific, Australia Ribonuclease-free water Ambion, USA RNAlater solution Ambion, USA Silver nitrate Sigma, Australia Skim milk Coles, Australia Sodium carbonate (anhydrous) Ajax Finechem, USA Sodium chloride solution (0.9%, sterile) Pfizer Australia Pty Ltd, Australia Sodium citrate Sigma, Australia Sodium dodecyl sulphate (SDS) Sigma, Australia Sodium hydroxide (5 M) SOMS, UNSW Sodium nitrite Sigma, Australia Sodium thiosulfate BDH Chemicals, Australia Sulphuric acid (H2SO4) 98% Ajax Finechem, USA SYBR green (SYBR Select Master Mix) Applied Biosystems, USA TE buffer Ambion, USA 3,3',5,5' tetramethyl benzidine (TMB Panbio, Sinnamon Park, QLD, AUS chromogen) Tetramethylethylenediamine (TEMED) Bio-Rad, Australia Thiosemicarbazide Sigma, Australia Thrombin Thermo Fisher Scientific, Australia Transfer buffer for Western blotting (10X; 30.3 SOMS, UNSW g Tris Base and 144.1 g glycine) Trifluoroacetic acid Sigma, Australia TripLE (trypsin) Life Technologies, Australia Tris buffered saline (TBS) SOMS, UNSW Tris-HCl Sigma, Australia Triton X-100 Sigma, Australia Trizol Ambion, USA Trypan blue Life Technologies, Australia Tween 20 Sigma, Australia Urea Sigma, Australia Vectastain ABC-AP KIT Vector Laboratories, USA Western Lightning-enhanced Perkin-Elmer, USA chemiluminescence substrate Xylene Thermo Fisher Scientific, Australia Xylenol orange Sigma, Australia

346

Appendix II: Mouse primer sequences Gene Forward sequence (5′ -> 3′) Reverse sequence (5′ -> 3′) 1. HPRT AACAAAGTCTGGCCTGTATCCAA GCAGTACAGCCCCAAAATGG 2. β-actin AGTGTGACGTTGACATCCGTA GCCAGAGCAGTAATCTCCTTCT 3. GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 4. B2m TTCTGGTGCTTGTCTCACTGA CAGTATGTTCGGCTTCCCATTC 5. S100A4 TGAGCAACTTGGACAGCAACA TTCCGGGGTTCCTTATCTGGG 6. S100A8 AAATCACCATGCCCTCTACAAG CCCACTTTTATCACCATCGCAA 7. S100A9 GGAGCGCAGCATAACCACCATC GCCATCAGCATCATACACTCCTCA 8. IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT 9. IL-2 TGAGCAGGATGGAGAATTACAGG GTCCAAGTTCATCTTCTAGGCAC 10. IL-4 ACTTGAGAGAGATCATCGGCA AGCTCCATGAGAACACTAGAGTT 11. IL-5 CTCTGTTGACAAGCAATGAGACG TCTTCAGTATGTCTAGCCCCTG 12. IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 13. IL-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG 14. IL-12β AGACATGGAGTCATAGGCTCTG CCATTTTCCTTCTTGTGGAGCA 15. IL-13 GGATATTGCATGGCCTCTGTAAC AACAGTTGCTTTGTGTAGCTGA 16. IL-17β TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC 17. IL-18 CATGTACAAAGACAGTGAAGTAAG TTTCAGGTGGATCCATTTCC AGG 18. IL-23 AGCAACTTCACACCTCCCTAC ACTGCTGACTAGAACTCAGGC 19. CCL-2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT (MCP-1) 20. CCL-3 TTCTCTGTACCATGACACTCTGC CGTGGAATCTTCCGGCTGTAG (MIP-1α) 21. CCL-4 TTCCTGCTGTTTCTCTTACACCT CTGTCTGCCTCTTTTGGTCAG (MIP-1β) 22. CCL-5 GCTGCTTTGCCTACCTCTCC TCGAGTGACAAACACGACTGC (RANTES) 23. CCL-11 ATTCTGTGACCATCCCCTCAT TGTATGTGCCTCTGAACCCAC (Eotaxin) 24. CCL-13 GGCCACGGTATTCTCGAAGC GGGCGTAACTTGAATCCGATCTA 25. CXCL-1 CTGGGATTCACCTCAAGAACATC CAGGGTCAAGGCAAGCCTC (GRO) 26. CXCL-2 CCAACCACCAGGCTACAGG GCGTCACACTCAAGCTCTG 27. CXCL-5 TGCGTTGTGTTTGCTTAACCG CTTCCACCGTAGGGCACTG 28. CXCL-9 GGCACGATCCACTACAAATCC GGTTTGATCTCCGTTCTTCAGT (MIG) 29. CXCL-10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA (IP10) 30. CXCL-12 ACTCCAAACTGTGCCCTTC GTCTACTGGAAAGTCCTTTGGG 31. CXCR4 GACTGGCATAGTCGGCAATG AGAAGGGGAGTGTGATGACAAA 32. IFN-γ ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC 33. IFN-α4 TGATGAGCTACTACTGGTCAGC GATCTCTTAGCACAAGGATGGC 34. MMP-2 TTTGCTCGGGCCTTAAAAGTAT CCATCAAACGGGTATCCATCTC 35. MMP-3 ACATGGAGACTTTGTCCCTTTTG TTGGCTGAGTGGTAGAGTCCC 36. MMP-9 TGCCCATTTCGACGACGAC GTGCAGGCCGAATAGGAGC 37. MMP-10 GAGCCACTAGCCATCCTGG CTGAGCAAGATCCATGCTTGG 38. MMP-13 CTTCTTCTTGTTGAGCTGGACTC CTGTGGAGGTCACTGTAGACT 39. TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC 40. NF-кB CAGCTCTTCTCAAAGCAGCA TCCAGGTCATAGAGAGGCTCA

347

41. CSF-1 GGCTTGGCTTGGGATGATTCT GAGGGTCTGGCAGGTACTC (M-CSF) 42. CSF-2 TCGTCTCTAACGAGTTCTCCTT GCAGTATGTCTGGTAGTAGCTGG (GM-CSF) 43. CSF-3 ATGGCTCAACTTTCTGCCCAG CTGACAGTGACCAGGGGAAC (G-CSF) 44. VCAM-1 AGTTGGGGATTCGGTTGTTCT CCCCTCATTCCTTACCACCC 45. ICAM-1 GTGATGCTCAGGTATCCATCCA CACAGTTCTCAAAGCACAGCG 46. TGF-β1 CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG 47. MIF GCCAGAGGGGTTTCTGTCG GTTCGTGCCGCTAAAAGTCA 48. FGF-2 GCGACCCACACGTCAAACTA TCCATCTTCCTTCATAGCAAGGT 49. HIF-1α ACCTTCATCGGAAACTCCAAAG CTGTTAGGCTGGGAAAAGTTAGG 50. HIF-1β GACAGACCACAGGACAGTTCC AGCATGGACAGCATTTCTTGAA 51. HIF-2α CTGAGGAAGGAGAAATCCCGT TGTGTCCGAAGGAAGCTGATG 52. HIF-3α CATGCGCCTCACAATCAGCTA TCTTGGTCACAGGGATGGATAAA 53. VEGFα GCACATAGAGAGAATGAGCTTCC CTCCGCTCTGAACAAGGCT 54. HGF ATGTGGGGGACCAAACTTCTG GGATGGCGACATGAAGCAG 55. EGFR CTCCATGCTTTCGAGAACCTAG ATGATCACATCCCCATCACTG 56. iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC 57. Arg1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC 58. Arg2 TCCTCCACGGGCAAATTCC GCTGGACCATATTCCACTCCTA 59. NOX-2 TGAATGCCAGAGTCGGGATTT CCCCCTTCAGGGTTCTTGATTT 60. SOCS3 CAAGAACCTACGCATCCAGTG CCAGCTTGAGTACACAGTCGAA 61. Mt1 TCCAACGACTATAAAGAGGG CCCTCTTTATAGTCGTTGGA 62. Mt2 GCCTGCAAATGCAAACAATGC GCATTGTTTGCATTTGCAGGC 63. COX-2 TGAGCAACTATTCCAAACCAGC GCACGTAGTCTTCGATCACTATC 64. SAA3 CAGACAAATACTTCCATGCTC GAGCATGGAAGTATTTGTCTG 65. HO-1 GATAGAGCGCAACAAGCAGAA CAGTGAGGCCCATACCAGAA 66. ALOX-12 TATCTTCAAGCTCCTCGTTC GAACGAGGAGCTTGAAGATA 67. IDO ATTGGTGGAAATCGCAGCTTC ACAAAGTCACGCATCCTCTTAAA 68. PTGS2 TGCATTCTTTGCCCAGCACT AAGGCGCAGTTTACGCTGTCT 69. Cav1 GCGACCCCAAGCATCTCAA ATGCCGTCGAAACTGTGTGT 70. IGF1 GAGACTGGAGATGTACTGTGC CTCCTTTGCAGCTTCGTTTTC 71. GPX1 GGAGAATGGCAAGAATGAAG CTTCATTCTTGCCATTCTCC 72. CAT CTCCATCAGGTTTCTTTCTTG CAAGAAAGAAACCTGATGGAG 73. CAT2 TCTATGTTCCCCTTACCCCGA TCGGGGTAAGGGGAACATAGA 74. GSTM1 CTGACTTTGAGAAGCAGAAG CTTCTGCTTCTCAAAGTCAG 75. PRDX1 ATTATACGACTAGTCCAGGC GCCTGGACTAGTCGTATAAT 76. TXN1 TAAAAAGGGTCAAAAGGTGG CCACCTTTTGACCCTTTTTA 77. SOD1 GAGAAACAAGATGACTTGGG CCCAAGTCATCTTGTTTCTC 78. RAGE ACAGGCGAGGGAAGGAGGTC TTTGCCATCGGGAATCAGAAG 79. STAT3 TCCTGGCACCTTGGATTGAGA AGGAATCGGCTATATTGCTGGT 80. P53 GCGTAAACGCTTCGAGATGTT TTTTTATGGCGGGAAGTAGACTG 81. MKP1 GTTGTTGGATTGTCGCTCCTT TTGGGCACGATATGCTCCAG 82. MAPK1 CTACACCAACCTCTCGTACATC CTCTTAGGGTTCTTTGACAGTAGG 83. Kit CCCTGAAGACTCGGGCCTA CAATTACAAGCGAAATGAGAGCC 84. Muc1 GGCATTCGGGCTCCTTTCTT TGGAGTGGTAGTCGATGCTAAG 85. Krt5 TGAGATGAACCGAATGATCCAG GCTTGTTTCTGGCATCTTTGAG 86. Krt14 CAAAGACTACAGCCCCTACTTC TCTGCTCCGTCTCAAACTTG 87. Col10α1 TTCTGCTGCTAATGTTCTTGACC GGGATGAAGTATTGTGTCTTGGG 88. Col11α1 CCAGCGGGTCTTATGGGTC TGGTAACATCAGCATGGTTCC 89. Cadm1 ATAGTGGGAAAGGCTCATTCG CTCTTCACCTGCTCGAGAATC 90. IRF4 TCCGACAGTGGTTGATCGAC CCTCACGATTGTAGTCCTGCTT

348

91. Sky CTACCTGCTACGCCAGAGC GCCATTAAGTTCCCTCTCGATG 92. Smad4 ACACCAACAAGTAACGATGCC GCAAAGGTTTCACTTTCCCCA 93. Cdkn1α CTTGCACTCTGGTGTCTGAG GCACTTCAGGGTTTTCTCTTG 94. Timp2 TCAGAGCCAAAGCAGTGAGC GCCGTGTAGATAAACTCGATGTC 95. Cdh1 CAGGTCTCCTCATGGCTTTGC CTTCCGAAAAGAAGGCTGTCC 96. Cdh13 CTGTGGGGGTCATTGTCAACT GTTGGTCTGTGGGTTGGTGT 97. Anxa5 ATCCTGAACCTGTTGACATCCC AGTCGTGAGGGCTTCATCATA 98. Bcl2 ATGCCTTTGTGGAACTATATGGC GGTATGCACCCAGAGTGATGC 99. Ym1 AGAAGGGAGTTTCAAACCTGGT GTCTTGCTCATGTGTGTAAGTGA 100. Lck ATGGAGACTTGGGCTTTGAG CGAAGTTGAAGGGAATGAAGC 101. Mki67 ATCATTGACCGCTCCTTTAGGT GCTCGCCTTGATGGTTCCT 102. MST1 CTTCCACTACAACATGAGCAGC TGCAGGTCCGCACATAATCTT 103. SIRT1 TGATTGGCACCGATCCTCG CCACAGCGTCATATCATCCAG

349

Appendix III: Effects of S100A8 inhalation on expression of antioxidative genes in healthy lungs over a time course (unpublished data from our laboratory) Type Gene S100A8 (1 hr) S100A8 (4 hr) S100A8 (12 hr) Housekeeping genes HPRT 2.0 ± 0.5 -1.1 ± 0.2 1.4 ± 0.3 β-actin -1.4 ± 0.1 1.3 ± 0.4 -2.2 ± 0.1 GAPDH -1.4 ± 0.1 -1.3 ± 0.1 1.6 ± 0.1 Antioxidative genes SOD1 1.4 ± 0.3 1.7 ± 0.6 3.0 ± 0.6 Catalase -2.6 ± 0.3 -1.3 ± 0.4 -1.6 ± 0.4 TXN 2.7 ± 0.9 -1.5 ± 0.4 2.7 ± 1.0 PRDX1 -1.6 ± 0.2 -2.4 ± 0.2 7.4 ± 1.5 GPX1 1.3 ± 0.2 1.3 ± 0.2 7.1 ± 0.6 Mt1 3.0 ± 0.4 1.4 ± 0.7 6.7 ± 0.8 Mt2 -1.6 ± 0.2 -1.1 ± 0.5 -2.3 ± 0.4 HO-1 -2.0 ± 0.1 2.1 ± 0.3 -2.7 ± 0.3 Changes in mRNA expression 1, 4 and 12 hours after naïve Balb/c mice inhaled HBSS (control) or S100A8 (10 μg). Lungs were harvested for RT-qPCR analysis by Dr Yuka Hiroshima, and results presented as fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM. Red numbers indicate upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold, n ≥ 4/group. No statistically significant changes were detected.

350

Appendix IV: S100A8 expression was not detected in LLC tumour cells A) B)

C) D)

E) F)

Lungs from mice with orthotopic LLC tumours were harvested after A) 6 and B) 13 days (without intranasal treatments), C) 18 days (intranasal HBSS treatment), D) 20, E) 24 and F) 30 days (intranasal S100A8 treatment; 10 μg). Anti-S100A8 reactivity of lung sections from LLC-bearing mice shows S100A8 expression in tumour-infiltrating myeloid cells (red cells) but no obvious expression in tumour cells. Sections are representative of at least 3 mice/group; scale bar = 2.5 μm at 80X; T = tumours. S100A9 followed similar expression patterns to S100A8 (not shown).

351

Appendix V: Genes that influence tumour growth, metastasis, hypoxia and angiogenesis and immune function (not presented in main results) Gene Grouping Function S100A8+DPBS HBSS+LLC S100A8+LLC 3 days 10 days 3 days 10 days 3 days 10 days Sky Oncogene Oncogenic kinase receptor that facilitates 1.1 ± 0.1 -1.1 ± 0.2 1.5 ± 0.4 -1.6 ± 0.2 2.1 ± 0.3 -1.4 ± 0.2 transformation and tumour initiation [1006] HGF Oncogenic kinase ligand that promotes 1.1 ± 0.2 -2.7 ± 0.1 -1.1 ± 0.2 -1.4 ± 0.1 -1.7 ± 0.1 -1.5 ± 0.1 apoptosis evasion in lung cancer cells [1007] FGF-2 Oncogenic kinase ligand that promotes lung -2.3 ± 0.1 -1.1 ± 0.1 -2.0 ± 0.2 3.4 ± 0.6 -1.7 ± 0.1 1.6 ± 0.3 cancer cell proliferation and inhibits apoptosis [1008, 1009] MAPK1 Oncogenic kinase receptor that promotes -2.3 ± 0.1 -1.2 ± 0.1 -1.6 ± 0.1 1.3 ± 0.2 1.0 ± 0.1 -1.0 ± 0.2 transformation and lung tumour initiation [1010] Mki67 Modulates cell cycle [1011] and promotes -2.3 ± 0.1 -1.8 ± 0.3 1.1 ± 0.4 -1.3 ± 0.4 1.6 ± 0.5 -1.2 ± 0.4 lung cancer cell proliferation [1012] Bcl2 Inhibits DNA repair [1013] and apoptosis in -2.2 ± 0.1 -1.8 ± 0.1 -1.2 ± 0.2 2.1 ± 0.4 1.2 ± 0.2 1.4 ± 0.2 lung cancer cells [1014] Smad4 Tumour Suppresses lung cancer initiation, possibly -1.3 ± 0.1 -1.8 ± 0.1 1.0 ± 0.3 -1.5 ± 0.1 1.2 ± 0.2 -1.4 ± 0.2 suppressor facilitates DNA repair [1015] MST1 genes Promotes tumour cell apoptosis by inducing 1.2 ± 0.2 -1.3 ± 0.2 1.1 ± 0.4 1.0 ± 0.2 1.0 ± 0.2 -1.2 ± 0.2 death receptor [1016] Anxa5 Suppresses melanoma growth in vivo by -2.0 ± 0.1 -1.1 ± 0.2 -1.5 ± 0.1 1.5 ± 0.3 1.1 ± 0.1 -1.7 ± 0.1 inducing apoptosis; reduces angiogenesis [1017] MMP-2 Pro-metastatic Promotes metastasis by ECM degradation 1.9 ± 0.4 -1.4 ± 0.2 1.1 ± 0.4 -2.2 ± 0.2 1.4 ± 0.6 -1.1 ± 0.3 genes [632, 633] Muc1 Altered glycosylation of Muc1 promotes -1.9 ± 0.1 1.1 ± 0.3 -1.1 ± 0.2 -1.3 ± 0.2 1.0 ± 0.2 -1.9 ± 0.1 metastasis [1018] VCAM1 Promotes metastasis [1019] -2.0 ± 0.1 -2.1 ± 0.1 1.3 ± 0.3 1.3 ± 0.2 1.8 ± 0.2 -1.3 ± 0.1 Cdh13 Anti-metastatic Associates with less cancer metastasis -1.9 ± 0.1 -1.2 ± 0.2 -2.0 ± 0.1 -1.5 ± 0.2 1.1 ± 0.2 -2.4 ± 0.1 genes [1020]

352

CCL-2 Pro- Chemokines that increase angiogenesis -1.2 ± 0.1 -3.9 ± 0.1 1.3 ± 0.3 -4.5 ± 0.1 -1.2 ± 0.2 -2.9 ± 0.1 angiogenesis (Section 1.3.1) (*) (*) CCL-11 -1.0 ± 0.2 -3.5 ± 0.1 1.1 ± 0.4 -1.6 ± 0.2 1.3 ± 0.2 -1.7 ± 0.2 CXCL-5 -3.0 ± 0.0 -2.2 ± 0.2 -1.6 ± 0.1 -4.1 ± 0.1 -2.3 ± 0.1 -3.5 ± 0.1 (*) CXCL-9 Anti- Chemokines that suppress angiogenesis -2.2 ± 0.3 -2.2 ± 0.1 -1.2 ± 0.6 -1.1 ± 0.3 -1.1 ± 0.5 -2.0 ± 0.1 CXCL-10 angiogenesis (Section 1.3.1) and promote MDSC -1.9 ± 0.2 1.3 ± 0.3 -1.6 ± 0.4 1.2 ± 0.3 1.9 ± 0.9 -1.6 ± 0.1 recruitment IL-23 Immune MDSC expansion and activation -1.1 ± 0.5 -2.9 ± 0.2 2.5 ± 0.9 -2.8 ± 0.2 1.6 ± 0.8 -1.9 ± 0.3 TNF-α modulation -1.4 ± 0.2 -1.1 ± 0.2 1.0 ± 0.4 -2.5 ± 0.1 1.8 ± 0.5 -2.7 ± 0.1 CCL3 MDSC recruitment 1.4 ± 0.2 1.1 ± 0.3 -1.1 ± 0.2 -1.4 ± 0.2 1.8 ± 0.4 -1.7 ± 0.2 CCL4 2.4 ± 0.5 -1.1 ± 0.2 1.0 ± 0.2 -1.2 ± 0.2 2.5 ± 0.7 -1.4 ± 0.2 CCL5 1.3 ± 0.3 -1.4 ± 0.1 1.0 ± 0.3 -1.7 ± 0.1 1.8 ± 0.4 -1.8 ± 0.1 CXCL2 -2.2 ± 0.1 -1.0 ± 0.3 -1.1 ± 0.2 -1.6 ± 0.2 3.6 ± 1.3 -2.8 ± 0.1 MIF -2.7 ± 0.1 -1.1 ± 0.2 -1.4 ± 0.1 -1.2 ± 0.2 1.2 ± 0.2 -1.3 ± 0.2 IL-5 1.2 ± 0.3 -5.6 ± 0.1 -1.7 ± 0.2 -1.6 ± 0.7 -1.2 ± 0.3 -2.3 ± 0.1 STAT3 MDSC signalling [904] -2.6 ± 0.1 1.1 ± 0.2 -1.5 ± 0.1 -1.7 ± 0.1 1.0 ± 0.1 -1.9 ± 0.1 NF-ҡB -2.2 ± 0.1 -1.4 ± 0.1 -2.9 ± 0.1 -1.5 ± 0.1 -1.5 ± 0.1 -2.0 ± 0.1 Mice co-treated with HBSS or S100A8 (10 µg) 30 min prior to LLC or DPBS injection were harvested 3 days later, or treated 3, 6 and 9 days post LLC or DPBS injection and harvested on day 10, to determine changes in genes that influence tumour growth, metastasis, hypoxia and angiogenesis and immune function in lung lysates. Fold changes of mRNA compared to control (HBSS+DPBS) are means ± SEM (n ≥ 4/group). Red numbers indicate

upregulation ≥ 2.5-fold; blue indicates downregulation ≥ 2.5-fold. *p < 0.05 compared to control.

353