applyparastyle "fg//caption/p[1]" parastyle "FigCapt" applyparastyle "fg" parastyle "Figure"

Journal of Mammalogy, 100(5):1599–1630, 2019 DOI:10.1093/jmammal/gyz126 Version of Record, frst published online 06 September 2019, with fxed content and layout in compliance with Art. 8.1.3.2 ICZN.

Taxonomy of the Sylvilagus brasiliensis complex in Central and Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 South America (Lagomorpha: Leporidae)

Luis A. Ruedas,* Sofia Marques Silva, Johnnie H. French, Roy Nelson Platt II, Jorge Salazar-Bravo, José M. Mora, and Cody W. Thompson Department of Biology and Museum of Natural History, Portland State University, SRTC-246, 1719 SW 10th Avenue, P.O. Box 751, Portland, OR 97207-0751, USA (LAR) Museu Paraense Emilio Goeldi, Av. Perimetral 1901, CEP 66077 830, Belém, PA, Brasil (SMS) U.S. Fish and Wildlife Service, National Fish and Wildlife Forensics Laboratory, 1490 E Main Street, Ashland, OR 97520, USA (JHF) Department of Biological Sciences, Texas Tech University, Lubbock, TX 79409-3131, USA (RNP, JS-B) Instituto Internacional en Conservación y Manejo de Vida Silvestre (ICOMVIS), Universidad Nacional de Costa Rica, Avenida 1, Calle 9, 86-3000 Heredia, Costa Rica (JMM) Museum of Zoology and Department of Ecology and Evolutionary Biology, University of Michigan, 3600 Varsity Drive, Ann Arbor, MI 48108-2228, USA (CWT) * Correspondent: [email protected]

A taxonomic framework for South American cottontail rabbits (Lagomorpha: Leporidae: Sylvilagus) was recently published by Diersing and Wilson (2017). Although we agree with some of its taxonomic conclusions (e.g., species status for S. apollinaris and S. fulvescens), we disagree with others. We provide herein evidence supporting S. andinus as a valid species based on morphological characters and novel molecular data. We also provide details of the morphological characters of S. apollinaris and S. fulvescens that support separating these from S. brasiliensis. We adduce data suggestive to the effect that—absent any type material—S. deflippi is at best a nomen dubium. Finally, we provide evidence in support of recognizing additional Neotropical species of Sylvilagus.

Un esquema taxonómico para los conejos sudamericanos (Lagomorpha: Leporidae: Sylvilagus) fue recientemente publicado por Diersing y Wilson (2017). Aunque estamos de acuerdo con algunas de sus conclusiones (por ejemplo: estatus de especie válida para S. apollinaris y S. fulvescens), no estamos de acuerdo con las restantes conclusiones taxonómicas. Aportamos aquí pruebas convincentes sobre la característica naturaleza de los caracteres morfológicos y moleculares de S. andinus, pruebas que esgrimimos en apoyo de la hipótesis que esta última es una especie válida, así confrmando su escisión de S. brasiliensis. Proporcionamos detalles de los caracteres morfológicos de S. apollinaris y S. fulvescens que confrman la decisión taxonómica de asimismo separarlos de S. brasiliensis. Proporcionamos datos en aditamento que indican que a falta de cualquier material tipo para S. deflippi, este nombre es en el mejor de los casos un nomen dubium. Finalmente, ofrecemos datos y evidencia apoyando nuestras decisiones de reconocer un mayor número de especies Neotropicales de Sylvilagus que previamente se conocían.

Key words: Andes, biodiversity, Colombia, conservation, Ecuador, integrative taxonomy, Neotropics, Peru, Venezuela

Nomenclatural statement: A Life Science Identifer (LSID) number was obtained for this publication: urn:lsid:zoobank. org:pub:ED43AFA1-0A47-4706-BF9C-FA6D51C5A4FC

Our recent taxonomic framework (Ruedas et al. 2017) for and mensural characters, and molecular data, as direct lines of South American Sylvilagus Gray, 1867 was the result of thor- evidence, and ecological niche modeling and biogeography as ough analyses of independent lines of evidence: morphological an indirect line of evidence. Examination of geographically

© 2019 American Society of Mammalogists, www.mammalogy.org

1599 1600 JOURNAL OF MAMMALOGY restricted samples of Sylvilagus taxa by Diersing and Wilson (2017) put those hypotheses into question. Those authors made some specifc conclusions based on analysis of mensural data: where we considered S. andinus (Thomas, 1897) and S. brasiliensis (Linnaeus, 1758) to be evolutionarily distinct entities, Diersing and Wilson (2017) placed them back into syn- Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 onymy. They also considered S. sanctaemartae Hershkovitz, 1950, to be a subspecies of S. gabbi (Allen, 1877), rather than a subspecies of S. brasiliensis (sensu Hershkovitz 1950) or a valid species-level entity (Ruedas 2017). Below, we serially consider the taxonomic propositions of Diersing and Wilson (2017), and weigh the available evidence in support or opposi- tion of each hypothesis. Because we have carefully examined all the pertinent holotypes considered therein, as well as many of the same specimens, we are able to propose alternative tax- onomic hypotheses for some of these taxa, hypotheses that ex- plain the observed biogeographic distributions and variation in characters. Although we support two of the taxonomic hypoth- eses of Diersing and Wilson (2017), we fnd no supporting evi- dence for the remaining taxonomic recommendations.

Materials and Methods Fig. 1.—Standard nomenclature for dental features of Recent leporid Morphological data.—Terminology of cranial characters and lagomorphs’ third lower premolar (pm3, top) and second upper pre- molar (PM2, bottom), adapted from fgure 1 of Palacios and López features generally follows Wible (2007) and Ruedas (1998). Martínez (1980:62), and expanded from Ruedas et al. (2017) in Morphological characters used in this study were detailed and identifying all cusps by incorporating features from López Martínez illustrated in Ruedas (2017) and Ruedas et al. (2017). For dental (1974, 1977, 1980, 1989) and Angelone and Sesé (2009). The term characters, drawings of p3 were made by tracing from photo- “anterior loph,” preferred herein, was used interchangeably with graphs taken using a Canon EOS 30D digital camera mated to “trigonid” by Hibbard (1963). López-Martínez et al. (2007) con- a Canon MP-E 65 mm f/2.8 1-5X Macro Photo lens, or a Canon sidered only the caudal portion of the anterior loph to constitute the EOS 6D mated to the same lens or an AmScope CA-CAN-SLR- trigonid, with the rostral portion (anterior lobe) instead collectively III camera adapter for microscopes, shooting either through a constituting the anteroconids. camera tube on a binocular dissecting microscope or an ocular tube with the ocular removed, also on a binocular dissecting gene from S. andinus specimen UMMZ 77075 (collected by microscope. Among leporids, the p3 generally is acknowl- P. Hershkovitz, 18 April 1935); we used the same primer set edged to constitute the most informative dental element for described in Ruedas et al. (2017). Molecular analyses likewise taxonomic and systematic purposes (Hibbard 1963; Dalquest generally followed Ruedas et al. (2017), albeit focused on Cytb, 1979; Palacios and López Martínez 1980; White 1987, 1991; in contrast to the mitochondrial 12S ribosomal RNA gene. Here, Dalquest et al. 1989; White and Morgan 1995; Ruedas 1998; we complement the 12S data with additional Cytb sequences Winkler and Tomida 2011; Ruedas et al. 2017). Discrete char- from the neotype of S. brasiliensis (Universidade Federal de acters were deemed the most important; accordingly, resulting Pernambuco no. 1740; GenBank accession no. MH115201) fgures were oriented and scaled to the same size in linear di- and S. andinus (University of Michigan Museum of Zoology mensions to carry out size-independent comparisons of inter- no. 77075; GenBank no. MH460962). The sequence data specifc characters, although size was not ignored. Characters for UFPE 1740 were generated as described in Ruedas et al. considered (Fig. 1) follow the standard terminology of Palacios (2017). Data for UMMZ 77075 were generated using the same and López Martínez (1980; described in Appendix I of Ruedas procedures as in Ruedas et al. (2017) but using the following 1998), with modifcations from Ruedas et al. (2017) in that all primers (5′–3′): syl_0002F, TGACCAACATCCGTAAAACC; cusps were identifed by incorporating features from López syl_0129F, TTCAAATCCTAACCGGCCTA; syl_0398F, Martínez (1974, 1977, 1980, 1989), López-Martínez et al. CTCCCATGAGGCCAAATATC; syl_0520F, CACACTCA (2007), and Angelone and Sesé (2009). Additional dental and CCCGCTTCTTC; syl_0823F, TCTATTCGCCTACGCCATTC; morphological characters useful in distinguishing among lag- syl_0995F, CTTCTCACACTCACATGAATCG; syl_0148R, omorph species are from Palacios (1996), Palacios and López TAGGCCGGTTAGGATTTGAA; syl_0348R, CCAATATTT Martínez (1980), and Palacios et al. (2008). CAGGTTTCTAGGTAAGTG; syl_0538R, GAAGAAGCGGG Molecular data.—Molecular methods followed Ruedas et al. TGAGTGTG; syl_0777R, GCTGGGGTGTAGTTGTCTGG; (2017), with special emphasis on generating additional nucleo- syl_1017R, CCGATTCATGTGAGTGTGAGA; and syl_1149R, tide sequence data for the mitochondrial cytochrome b (Cytb) TACTGGGGCCTTCATTTGAG. The new sequences include RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1601

1,089 and 608 nucleotides for S. brasiliensis and S. andinus, and instead rely on subtle diagnostic character differences. respectively. Because of the limited number and length of Cytb Accordingly, we apply what Sangster (2014:210) called “meth- sequences available for Sylvilagus, phylogenetic analysis of odological introgression” of species concepts applied in an op- sequences was undertaken using PAUP* v. 4.0b10 for Unix erationally coherent manner to “discover, describe, and order (Swofford 2002) on a MacBook Pro laptop running 3.1 GHz into our classifcation system” (Mayden 1997:387) the individ-

Intel Core i7 with 16 GB 1867 MHz DDR3 memory. We used uals within, or constituting, the species category, independent Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 a heuristic search approach in maximum likelihood, with the of the properties of the species category. GTR+Γ+Ι model of evolution, determined the most appropriate Further, we used a comparative framework in assessing po- by jModeltest 2.1.10 v20160303 (Guindon and Gascuel 2003; tential species limits and undertaking species delimitation. Darriba et al. 2012) using the corrected AIC criterion. Model Morphological characters were assessed from holotypes frst, parameters were as follows: base frequencies: A, 0.2735; C, and only subsequently, whenever possible, on broader geo- 0.3350; G, 0.1203; T, 0.2711; rate matrix: [AC] = 1.0000, [AG] graphic samples in a comparative framework between non- = 23.1139, [AT] = 2.5621, [CG] = 1.0000, [CT] = 23.1139, [GT] controversial species of Sylvilagus. Morphological character = 1.0000; gamma shape parameter, 1.2820; proportion of invari- differences were then examined in the putative South American able sites, 0.5580. Calculation of genetic distances (uncorrected taxa in light of their interspecifc variation, to assess whether p-distances) among specimens was carried out in PAUP* v. variation was of an intra- or interspecifc nature. A similar ap- 4.0b10 for Unix (Swofford 2002). proach was employed in assessing molecular data, while also To the above two sequences, we added data from Ruedas et al. taking into consideration both topology (branching pattern (2017) and of South American species of Sylvilagus from Silva and phylogenetic relationships—de Queiroz and Gauthier et al. (2019) to construct a mitochondrial DNA supernetwork 1992) and genetic distance (Bradley and Baker 2001; Baker using 12S and Cytb data sets (Appendix I). We used SplitsTree and Bradley 2006) to inform our decision-making. Genetic dis- 4.14 (Huson et al. 2004; Huson and Bryant 2006) to separately tance alone was not used as a diagnostic property of species construct Neighbor Joining trees from both 12S and Cytb data, (Bickford et al. 2007; Siler et al. 2017), but rather integrated because each data set had a different number of terminal taxa. with remaining data. Morphological and molecular groups were The 12S and Cytb trees were then combined, also in SplitsTree, assessed for congruence with patterns of regional ecology, eco- using 1,000 runs to estimate the supernetwork. systems, and biomes. In this manner, although disagreements Species concepts and theoretical framework.—Our spe- about species delimitation may result from disagreements or cies concept as applied to the Sylvilagus taxa reviewed here differences concerning the reliability of particular methods (de extends from previous studies (Ruedas et al. 2017) and con- Queiroz 2007), consilience of evidence from independent data sideration of metapopulation lineage identifcation in our focal streams, systematized under the rubric of integrative taxonomy study system. Previously, we observed extensive discrete mor- (Padial et al. 2010; Schlick-Steiner et al. 2010) is anticipated to phological differences between the neotype of S. brasiliensis result in low levels of both Type I (underdescribing) and Type II and specimens of S. andinus, including both the holotype of (overdescribing) error rates. The resulting distinct species are: the latter as well as a series collected near the type locality 1) isolated genetically, ecologically, or geographically; 2) mor- by Philip Hershkovitz. We were led to the conclusion that a phologically or genetically distinct based on diagnostic, fxed hypothesis of conspecifcity of S. brasiliensis and S. andinus characters; and 3) have boundaries consistent with supernu- should be rejected because of the consistent morphological dis- merary data from ecology, behavior, biogeography, etc. (Brown tinctions, in combination with behavioral, ecological, biogeo- 2015; Brown et al. 2017, 2018; Siler et al. 2017). graphic, and genetic data. The conclusion is consistent across species concepts, including the biological (Mayr 1942), eco- Results logical (Van Valen 1976), evolutionary (G. G. Simpson 1961), phylogenetic (Eldredge and Cracraft 1980), and genetic spe- Sylvilagus andinus (Thomas, 1897) is not S. brasiliensis (Lin- cies concepts (Dobzhansky 1950; Baker and Bradley 2006). naeus, 1758) The species concepts detailed above share the characteristic Diersing and Wilson (2017) proposed that S. brasiliensis and signature of lineages that share commonality of descent, and S. andinus are conspecifc. Our previous character-based and distinct evolutionary lineage status as separately evolving genetic (primarily mitochondrial 12S gene) analyses do not ft ancestor-descendant segments of metapopulation lineages (de with that taxonomic hypothesis. At the 12S locus, the genetic Queiroz 1998, 2005, 2007). Ultimately, we agree that there is distance is 4.6%, approximately the same as that between S. a want of cohesion between the philosophical and operational aquaticus and S. palustris, which are well-recognized sister approaches to species (Mayden 1997; Sites and Marshall 2003, species (Ruedas et al. 2017:49; full data provided in Ruedas 2004; Sangster 2014). That is to say: issues of species concep- et al. 2017: Appendix 2, available at URL http://hdl.handle. tualization and delimitation of species are distinct (de Queiroz net/2027.42/136089). The additional sequence data presented 2007). However, these should not deter us from recognizing herein reinforce those conclusions: we obtained 1,063 nu- and delimiting species as cohesive lineage segments. This cleotides of Cytb sequence from S. brasiliensis UFPE 1740 may be challenging in instances where such lineages are not (GenBank no. MH115201) and 608 nucleotides from S. andinus easily distinguishable using traditional phenetic methodologies UMMZ 77075 (GenBank no. MH460962). We compared 1602 JOURNAL OF MAMMALOGY the new sequences with previously published sequences of Anthony (1923) and Hershkovitz (1938) similarly pointed Sylvilagus foridanus (AY292724), S. transitionalis (AF034256), out the stark alpine habitats (Andean Páramo) of S. andinus. S. obscurus (AY292725), S. audubonii (AY292722), S. Anthony (1923:9) noted that “the habitat of andinus, its sub- nuttallii (AY292723), S. palustris (AY292727), S. aquaticus species and related species, appears to be the elevated, grassy (AY292726), S. bachmani (KU759757), and S. mansuetus paramos”; to which Hershkovitz (1938:2), who spent 1933–

(KU759742), and used Brachylagus idahoensis (AY292721) as 1937 collecting in Ecuador, added that “rabbits of the andinus Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 the outgroup. The uncorrected (p) distance from S. andinus to S. group, […] inhabit most of the generally treeless portions of brasiliensis was 0.127. The mean uncorrected (p) distance in the the Ecuadorian Andes, including practically all summits of 55 ingroup comparisons was 0.113 (σ = 0.022, min = 0.004 [be- both the eastern and western cordilleras, most of their inner tween S. transitionalis and S. obscurus], max = 0.137 [between facing slopes, and the whole surface of the high interandean S. nuttallii and S. brasiliensis]). Of the 54 possible interspecifc plateau.” Ecological niche models support the low likelihood pairwise comparisons besides S. andinus to S. brasiliensis, 47 of animals such as S. brasiliensis, from the coastal plain of are closer (smaller p-distance) and only seven are larger, a sig- Pernambuco, Brazil (the Pernambuco Endemism Center of nifcant departure from evenness (P = 5.23 × 10−8). We proffer the Atlantic Forest Biome—Ruedas et al. 2017:13–14) being that the genetic distance exhibited between S. andinus and conspecifc with S. andinus from the Páramo regions of the S. brasiliensis for both 12S and Cytb within the comparative Andes in western South America. These ecological data, framework of Sylvilagus therefore constitutes strong evidence along with the existing and new molecular data, cranial and against conspecifcity (Bradley and Baker 2001). dental morphology, and behavioral characters that we exam- A phylogenetic tree resulting from the analysis of the ad- ined, fail to support the hypothesis that S. andinus is conspe- ditional Cytb sequences is shown in Fig. 2 (top). On the basis cifc with S. brasiliensis. That taxonomic decision was based of our previous molecular analyses (Ruedas et al. 2017), we on examination of specimens of “S. brasiliensis” from north- identifed instability at the base of the Sylvilagus radiations; we western South America (Diersing and Wilson 2017: Appendix inferred the instability because although the tips and the ma- I), none of which are congruent with the current defnition of jority of the more recent phylogenetic relationships remained S. brasiliensis (Ruedas et al. 2017). The name S. brasiliensis stable, basal relationships varied depending on the algorithm refers to a taxon whose type locality was restricted to employed to derive the phylogeny. Notwithstanding, S. andinus Pernambuco over 100 years ago (Thomas 1911), and the and S. brasiliensis were not recovered as sister taxa by any of range of which was further restricted to coastal Pernambuco the methods we employed. In an attempt to stabilize basal re- and surrounding ecological region (Ruedas et al. 2017). lationships, we used the phylogenetic split networks approach In summary, our data reject the hypothesis of conspecifcity of Huson and Bryant (2006). Those authors suggested that of S. brasiliensis and S. andinus. Instead, we propose to main- such “phylogenetic networks should be employed when retic- tain these as separate and distinct reciprocally monophyletic ulate events such as hybridization, horizontal gene transfer, re- species. combination, or gene duplication and loss are believed to be involved…” (Huson and Bryant 2006:254). We hypothesized On S. fulvescens J. A. Allen, 1912, and S. apollinaris Thomas, an explosive contemporaneous diversifcation for the basal ra- 1920 diation of Sylvilagus (Ruedas et al. 2017), during which such We agree with Diersing and Wilson (2017) that S. fulvescens and events could have come into play. The network diagram re- S. apollinaris are valid species independent of S. brasiliensis, sulting from our analysis (Fig. 2, bottom) confrms the large although we hypothesize that more than these two species may genetic distance between S. andinus and S. brasiliensis, and inhabit the Colombian Andes. In light of the fact that neither identifes the regions of instability responsible for our previous Allen (1912), nor Thomas (1920), nor Diersing and Wilson lack of resolution with respect to basal relationships in the (2017) suffciently described or illustrated these species in their genus: two networks are resolved at the base of the North and respective publications, we provide herein images of the holo- South American Sylvilagus radiations. The North American types (Fig. 3), and identify the morphological features that di- radiation of Sylvilagus also includes a secondary invasion of agnose these species, and how they differ from S. brasiliensis, South America, confrming our previous biogeographic ana- to facilitate their identifcation in the future. lyses, and identifes S. andinus as a member of the South In comparison with the neotype of S. brasiliensis American “foridanus” group. Because of the regions of in- (Universidade Federal de Pernambuco no. 1740; illustrated in stability identifed in this analysis, these relationships are not Ruedas et al. 2017), S. fulvescens differs in having a prima- likely to be the defnitive relationships among Sylvilagus spe- rily fat, featureless frontonasal suture largely oriented along cies. Nevertheless, it is clear from both our previous and the the axial plane. The medial portion, along the sagittal plane, present molecular data that S. andinus and S. brasiliensis are displays a narrow, short, sharp rostral infection. In contrast, S. defnitively not the same taxon, nor are they sister taxa. brasiliensis has a frontonasal suture that is broadly U-shaped, The ecology of S. andinus has long been recognized as dis- angling caudally from the corner of the nasal, premaxillary tinct. Cabrera (1913:6) viewed the andinus group as being (posterodorsal process), and frontal, to turn back rostrally in a animals of species from “great elevations” and characterized broadly open terminus along the sagittal plane. Sylvilagus apol- by their “stubby shape, hairy legs, and relatively long ears.” linaris differs from S. brasiliensis in that the frontonasal suture RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1603 Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 2.—Top: phylogenetic tree (maximum likelihood) based on Cytb, for Sylvilagus species, rooted using the pygmy rabbit, Brachylagus idahoensis (GenBank no. AY292721). Numbers above nodes show percent support based on 1,000 bootstrap replications. Where numbers are missing, support is < 50%. Approximately 16.2% of the bootstrap replications supported a relationship between S. andinus and S. brasiliensis, taxa that otherwise have a p-distance of 0.127, eighth largest of the 55 possible pairwise comparisons among the ingroup Sylvilagus taxa. Bottom: Split supernetwork constructed using SplitsTree 4.14 (Huson et al. 2004; Huson and Bryant 2006) by combining separate Neighbor Joining trees of Sylvilagus 12S and Cytb mitochondrial genes. These networks are better at identifying regions where reticulate events such as hybridization, horizontal gene transfer, recombination, or gene duplication and loss are hypothesized to cause unstable relationships. Based on this analysis, such events are hypothesized to have occurred at the base of the North American and South American radiations (the thin lines in the network) and show two invasion of South America by Sylvilagus: the primary invasion by the modern S. brasiliensis group taxa, and a second, the line identifed as “foridanus SA” (South America), which in this analysis includes S. andinus. tapers rostrally to a fne point in S. apollinaris, rather than being brasiliensis (Ruedas et al. 2017: fgure 7), the maxillary process broadly rounded, as previously described in S. brasiliensis. of the frontal is short and broad: coupled with the relatively Because of the rostral refection of the caudolateral margin broad posterodorsal process of the premaxilla, the maxillary of the nasal bone in S. fulvescens, and the also relatively long process of the frontal is almost nonexistent. In S. apollinaris, the posterodorsal process of the premaxilla, the maxillary process maxillary process of the frontal is quite prominent because of the of the frontal is somewhat marked and quite distinctive. In S. extremely long posterodorsal process of the premaxilla (which 1604 JOURNAL OF MAMMALOGY Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 3.—Holotype of (top row) Sylvilagus fulvescens J. A. Allen, 1912 (AMNH 32360), and (bottom row) S. apollinaris Thomas, 1920 (MNHUK 1919.10.15.2). Crania represented at the same size to highlight shape differences; dimensions are: greatest length of skull of S. fulvescens, 63.2 mm (not recorded in S. apollinaris due to incomplete nature of skull); zygomatic length of S. fulvescens, 26.4 mm, S. apollinaris, 28.6 mm. Left: dorsal perspective; center: ventral; right: lateral. Based on the lack of ossifcation of the cranial sutures, the holotype of S. fulvescens is not fully adult; notes made at time of physical examination indicate “immature.” extends almost to the orbit) coupled with a more marked rostral The junction of the frontal, parietal, and squamosal in refection of the caudolateral margin of the nasal bone than in S. S. brasiliensis is almost on the point of the tuberculum fulvescens. frontoparietale, to which is fused the retrorbital process. In RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1605 contrast, in both S. apollinaris and S. fulvescens, this three- way suture point is more caudally retracted. From this junc- tion, the parietal-squamosal suture extends, in S. brasiliensis, to the supraoccipital bone, forming a well-defned ridge with the suture line marked by strong interdigitation of the parietal and squamosal bones. In S. fulvescens, this ridge is absent, ex- Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 cept as a small protuberance ventral to the medial portion of the parietal-squamosal suture. The suture does not exhibit any interdigitation of frontal and parietal bones, although the hol- otype is an immature animal, and the degree of interdigitation may be associated with age. In S. apollinaris, there is some in- dication of a parietal ridge, but it is only evident for the rostral Fig. 4.—The pm3 of the holotypes of (left) Sylvilagus apollinaris portion of the parietal-squamosal suture, whereupon it becomes Thomas, 1920 (MNHUK 1919.10.15.2, sex unknown), and of (right) S. fulvescens J. A. Allen, 1912 (AMNH 32360, ). The area in gray indistinct. The parietal-squamosal suture of S. apollinaris dips ♀ shade surrounding the protofexid of S. fulvescens is somewhat ventrally at this point. indistinct. The postorbital processes are missing in S. fulvescens. We hypothesize that they are free of contact from the frontal: there is no evidence of any broken suture at the tuberculum (2017). Sylvilagus brasiliensis displays a shallow infection frontoparietale. Furthermore, the postorbital foramen is rel- of the enamel in the region of the parafexid; a shallow infec- atively open and broad, compared, for example, with S. tion likewise is present in S. apollinaris, as the last invagina- brasiliensis or S. tapetillus (fgures 26–27 of Ruedas et al. tion in the complex crenellation that forms the rostral surface of 2017). Only the right postorbital process is present in the hol- pm3, including the lingual anteroconid, anterofexid, and labial otype of S. apollinaris. It is completely free of the frontal, and anteroconid. A condition similar to S. apollinaris, contrasting displays a rounded caudal terminus, more common in South with S. brasiliensis, is present in S. fulvescens; the holotype of American cottontails (e.g., S. brasiliensis) in contrast to the the latter also has an isolated islet of enamel in the parafexid sharply pointed terminus of S. andinus. region, which may be an instance of individual- rather than From the ventral perspective, the most striking difference species-level variation. Sylvilagus brasiliensis have a simple an- among the three species is in the dimensions of the incisive terior surface to pm3, with a clearly defned anterofexid and a foramina. In S. fulvescens, they are relatively short and narrow, second indentation (referred specimen, UFPE 427) or invagina- barely extending caudally to the anterior of the alveolus of tion (neotype, UFPE 1740). In contrast, both S. apollinaris and PM2. In both S. apollinaris and S. brasiliensis, the incisive for- S. fulvescens have a markedly crenellated anterior surface, with amina extend caudally to about the midpoint of PM2. In terms no single well-defned anterofexid, but rather multiple invagin- of numbers, the incisive foramina of S. fulvescens are 12.4 mm ations. In this respect, the pm3 of S. apollinaris and S. fulvescens long and 5.4 mm wide; the corresponding measurements are in are more similar to, although not as complex as, the condition S. apollinaris, 17.9 mm and 5.2 mm, and in S. brasiliensis, 18.2 exhibited by S. andinus, rather than S. brasiliensis. The com- mm and 6.7 mm. plexity is such that there is no clearly defnable lingual or labial The basisphenoid of S. fulvescens differs from that of S. anteroconid in S. apollinaris, as there is in S. brasiliensis. In S. brasiliensis in being somewhat larger on the rostral end, which fulvescens, the most anterior labial cusp is more prominent than could be a variable phenomenon across populations, and in that the remaining anterior crenels, forming what could be construed S. fulvescens displays a second foramen, rostral to the clearly as a labial anteroconid. The protofexid has somewhat thickened defned craniopharyngeal canal; this second foramen is not enamel in S. apollinaris, in contrast to the thin enamel present in present in S. brasiliensis. Most of the basisphenoid is missing specimens of S. brasiliensis; this feature was not readily visible in the holotype of S. apollinaris, but the anterior neck is suff- when we examined the holotype of S. fulvescens. The rostral ciently evident that it also can be appreciated to be markedly aspect of the hypofexid is largely unremarkable. The caudal as- broader than that of S. brasiliensis. pect, in contrast, is markedly different between S. brasiliensis The alisphenoid canals of S. fulvescens are prominent and and S. apollinaris and S. fulvescens: whereas it is simple and broad, ca. 1.7 mm in greatest lateral extent; in S. brasiliensis, largely featureless in S. brasiliensis, it is quite complex in both this character is not as prominent, and is 1.3 mm wide. We were S. apollinaris and S. fulvescens. unable to examine this character in S. apollinaris due to the The foregoing data are, in light of the previously documented fragmentary condition of the skull. intra- and interspecifc variation in these characters (Ruedas As in many species of Sylvilagus, pm3 is diagnostically dis- 1998, 2017; Ruedas et al. 2017), and given the additional data tinct between S. brasiliensis, S. apollinaris, and S. fulvescens, presented by Diersing and Wilson (2017), compelling in re- although the differences between the latter two are more subtle jecting the hypothesis of conspecifcity among S. brasiliensis, (Fig. 4). The same tooth in S. brasiliensis was illustrated in de- S. apollinaris, and S. fulvescens. We note that the differences tail in fgure 10 of Ruedas et al. (2017), and in a broader com- between S. apollinaris and S. fulvescens on the one hand, and parative context with S. andinus in fgure 13 of Ruedas et al. S. brasiliensis on the other, are of a much smaller magnitude 1606 JOURNAL OF MAMMALOGY than those between S. andinus and S. brasiliensis, providing have examined at the Natural History Museum in London that additional support to our previously published hypothesis that is identifed, presumably by Thomas, as S. deflippi, none of the latter two also constitute independently evolving, reproduc- the specimens had feet with gray undersides (we examined tively and ecologically isolated, diagnosable species (Ruedas MNH nos.: 14.4.25.77, 27.1.1.148, 27.1.1.150, 27.1.1.151, et al. 2017). 27.1.1.153, 27.1.1.233; another two were juveniles hence not

considered by us: 27.1.1.232, 62.1881). It is therefore unclear Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 What is Sylvilagus defilippi? on the basis of what criteria, other than general geographic It was hypothesized by Diersing and Wilson (2017) that a provenance, Thomas might have identifed that material as S. subspecies-level taxon, S. b. deflippi (Cornalia 1849 [1850]), deflippi. occupies lowland tropical forests east of the Andes from Cabrera (1913, 1917) mentioned three specimens of S. northern Colombia to Eastern Peru. We favor rejection of this deflippi in the National Museum of Natural History, Madrid, hypothesis, frst because of the strong regionalization that we Spain (MNHN), that were collected “halfway between Quito have identifed in Sylvilagus from South America, and second, and the Napo River” (Cabrera 1913) or “on the road from Quito because of the lack of a holotype for S. b. deflippi and the con- to Baeza” (Cabrera 1917), which would have agreed in general sequent lack of any consistent taxonomic defnition for that pu- terms with the type locality as near as Cabrera (1913) could tative taxon. Below, we summarize our rationale for rejecting elucidate: “near the forests of Quijos, which is precisely the at present the name S. b. deflippi for any Sylvilagus in South type locality of S. Deflippii [sic].” Cabrera (1913) further in- America. dicated that the undersides of the feet of those specimens were “Lepus Deflippi” was described by Emilio Cornalia in a work “dirty brownish grey” hence similar to the Sylvilagus described by Gaetano Osculati dated 1849 in the fyleaf but published by Cornalia (1849 [1850]). We were able to fnd one of the in 1850. The description (Cornalia 1849 [1850]:309–310) was MNCN specimens listed by Cabrera (MNCN 11393) and inter- based on a single skin, and no illustration was provided. The pret the underside of the feet to be brown, rather than gray as holotype was deposited in the Museo Civico of Milan (now described by Cornalia. As with the MNH London specimens, Museo di Storia Naturale, Milan), but was lost in World War II we are unable therefore to ascertain with any certitude what (G. G. Bardelli, Sezione di Zoologia dei Vertebrati, Museo di criteria, besides geographic proximity, Cabrera may have used Storia Naturale, Milano, in litt., 6 March 2014). Thus, there has to identify that material as S. deflippi. not been a holotype or other type specimen for this taxon for Notwithstanding Hershkovitz’ establishment of Puerto Napo three quarters of a century. as the type locality (Hershkovitz 1950), we propose, based on Thomas (1897) suggested synonymy of S. deflippi with our examination of Osculati’s work (1849 [1850]) and of spe- S. brasiliensis (“…closely allied to, if not identical with…”) cimens putatively identifed as “deflippi,” that there are two based on the similarity in size of both taxa and the type locality equally likely possibilities for a type locality for deflippi, both of the former, which Thomas apparently felt was close enough in the Ecuadorian province of Napo. The frst is that specifed by to his concept of the type locality of S. brasiliensis at the time Cornalia (1849 [1850]) in his original description: he explicitly (Thomas [1911] later changed his concept of where the type stated the provenance of the holotype as “forests of Quixos.” locality of S. brasiliensis should actually be sited). Although it Based on Osculati (1849 [1850]), this would result in the cur- is unclear whether Thomas examined the actual holotype of S. rent Quijos Canton, either in the vicinity of the administrative deflippi in making his assessment, we feel that such a compar- seat of Baeza (ca. 0°27′45″S, 77°53′21″W, elevation ~1,900 m; ison is unlikely: Thomas cited as the primary source for the de- datum: WGS84), or near Cosanga (ca. 0°34′44″S, 77°52′02″W, scription of S. deflippi not Cornalia’s original publication, but ca. 1,900 m). The type locality designated by Hershkovitz rather the report (albeit verbatim) of Fairmaire in the December (1950) ignored Cornalia’s explicit statement of Quixos and is 1851 issue (published 1852) of the Revue et Magasin [sic] de instead nearly due south of Baeza in Tena Canton, in the vi- Zoologie Pure et Appliquée (wherein Fairmaire miscites the cinity of Puerto Napo, at an elevation of ca. 450 m. This locality date of Osculati’s work as 1830, and the geographic focus of is improbable based on the account of Osculati (1849 [1850]) Osculati’s work as Central America). Cornalia noted a few as well as Cornalia (1849 [1850]). The latter explicitly noted characters of external appearance, including a maximum length as a locality “Flumine Napo” (Napo River) for materials from of 11 inches. We have little idea of what that length would be the banks of the Napo, including capybaras (Hydrochoerus today (other than as an approximation), given that old Italian hydrochaeris) and various species of primates, squirrels, and measurement units varied extensively across locations in Italy bats, all in direct contrast to upland species from the forests of (Cardarelli 2003). The most signifcant character to him may Quijos, such as a spectacled bear (Tremarctos ornatus) and his have been “cauda brevissima quasi nulla” [extremely short, al- S. deflippi. Although Puerto Napo is only distant by some 60 most nonexistent, tail] in opposition to the fact that Linnaeus km linearly, the ecological distance between the localities is a (1758) described S. brasiliensis as having no tail (“cauda veritable chasm. Diersing and Wilson (2017:1647) suggested nulla”). However, S. brasiliensis do have a cauda brevissima that “Sylvilagus brasiliensis deflippi is found in the tropical quasi nulla (Ruedas et al. 2017). Orinoco and Amazon basins of Colombia, Ecuador, and Peru Cornalia (1849 [1850]) indicated that the feet were gray or […] a north–south distance of about 2,300 km.” We have pre- ash colored on their undersides. However, of the material we viously shown that the species-level taxa formerly subsumed RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1607 within S. brasiliensis are strongly regionalized and share little, Sylvilagus gabbi incitatus was described by Bangs in 1901, if any, range overlap (Ruedas 2017; Ruedas et al. 2017). Thus, as Lepus (Tapeti) incitatus. The only known specimen, an regardless of whether the type locality was on the Napo River adult female from Isla del Rey in the Gulf of Panama, was at 450 m, or near either Baeza or Cosanga at 1,900 m, it would catalogued with number 8441 into the Bangs Collection at be highly unlikely for a taxon in Sylvilagus to constitute a Harvard’s Museum of Comparative Zoology (nec MCZ 8441). singular cohesive whole across Colombia, the Quijos-Coca In describing “Lepus” incitatus as a species distinct from the Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 river system, as well as the Aguarico, San Miguel, Putumayo, previously described “L.” gabbi, Bangs (1901:633) noted Caquetá, Apaporis, Japurá, Vaupés, and Negro rivers, all suc- that “Compared with skulls of true L. gabbi from Panama cessively creating barriers to the Orinoco, as well as the vast and Chiriqui, the skull of L. incitatus is larger and heavier topographic relief separating the drainage basins of each of throughout; rostrum much wider and heavier, and more rounded these rivers. Thus, to consider S. deflippi, a taxon from the and arched; bony palate wider and longer; molar and incisor eastern foothills of the Andes of Ecuador, to be the same spe- teeth heavier.” cies as S. brasiliensis, a species demonstrably limited to a The species stood as valid for a few years only, being small area in the Atlantic coastal plain of Brazil in the states synonymized with S. gabbi by Nelson (1909). Nelson relied of Paraiba, Pernambuco, and Alagoas (Ruedas et al. 2017), a primarily on pelage characters in this decision (“scarcely dis- distance of over 4,800 linear km over terrain highly varied in tinguishable in color from specimens of gabbi in similar con- topography and ecology, would be strongly contrary to existing dition from the mainland” Nelson 1909:262), as he noted that, data and paradigms. For example, Naka and Brumfeld (2018) insofar as skull characters were concerned, incitatus “In general concluded that multiple river barriers in their area of study resembles gabbi, but with interorbital width and braincase nar- (Rio Branco and Rio Negro drainages) were involved in both rower and rostrum even heavier than average truei; supraor- the generation and the maintenance of avian species diversity bital process as in gabbi, but postorbital process even shorter and in multiple pulses of diversifcation spread between 0.24 and posteriorly touching a well-marked process on skull, thus and 8 MYA, a timeline consistent with the diversifcation of inclosing a very small oval foramen.” Hershkovitz (1950) Sylvilagus (Matthee et al. 2004; Ruedas et al. 2017). maintained the subspecifc integrity of incitatus but transferred As a result of the potential ambiguities described above the taxon to S. brasiliensis. Below, we detail characteristics of with respect to the type locality, as well as the loss of the holo- the morphology of these taxa that support the suggestion that type, there is a great deal of uncertainty surrounding the iden- Bangs (1901) was correct in his initial taxonomic assessment. tity of any specimens putatively identifed as S. deflippi (or S. Both S. gabbi and S. incitatus have broad, relatively smooth, b. deflippi) in museum collections. This uncertainty is com- V-shaped frontonasal sutures. In S. incitatus, there is an evi- pounded by the fact that neither Thomas (1897) nor Cabrera dently unpaired nasofrontal bone on the left side of the frontal (1913, 1917) appear to have undertaken direct comparisons and nasal sutures; S. gabbi has a caudal extension of the right with the holotype but instead used the somewhat unreliable nasal bone in the same location, likely corresponding with a original description by Cornalia (1849 [1850]), which was fused nasofrontal bone (e.g., Ruedas 2017). However, a closer based solely on demonstrably questionable external characters, examination of the cranial features frst outlined by Bangs or by (in the case of Thomas [1897]) secondhand accounts of (1901) confrms that there are indeed strong differences be- Cornalia’s description. Further, we do not know exactly where tween gabbi and incitatus (Fig. 5). The two taxa differ mark- Osculati (1849 [1850]) collected the now-lost specimen de- edly in the conformation of the posterodorsal process of the scribed by Cornalia. The ca. 1,500 m of elevation separating premaxilla and the maxillary process of the frontal: in S. the sites identifed above as conficting type localities are vastly incitatus, the posterodorsal process of the premaxilla ends even different ecologically, which presumptively could correspond with the caudalmost extension of the nasal bone; in S. gabbi, the to the presence of distinct species of Sylvilagus, depending posterodorsal process of the premaxilla extends well beyond on which site one were to select as the type locality. We sug- the nasal bone, almost to the orbital region of the cranium. The gest that a neotype with a defned type locality should be es- maxillary process of the frontal in S. incitatus is relatively short tablished to objectively defne S. deflippi per Art. 75.1 of the and broad, averaging 1.5 mm in breadth at the base (caudal tip International Code of Zoological Nomenclature (ICZN 1999, of posterodorsal process of premaxilla to caudal tip of nasal), in its current print iteration). and 2.9 mm from caudal base to rostral tip of maxillary process of frontal. In S. gabbi, the corresponding fgures are 0.8 and 6.9 On the contents of Sylvilagus gabbi (J. A. Allen 1877) mm. Put in perspective, the maxillary process of the frontal is On the basis of morphometric analyses, Diersing and Wilson ca. 10% of the greatest length of skull in S. gabbi, but less than (2017) synonymized all previously described S. gabbi subspe- 4% of the greatest length of skull in S. incitatus. cies into two subspecies: S. g. truei (J. A. Allen, 1890b) and S. As was noted by Nelson (1909), there are marked differences g. gabbi (J. A. Allen, 1877). Our intent here is not to revise S. in the postorbital process: that of S. gabbi is long (¯x ≈ 4.5 mm gabbi, but we do examine one of the subspecies synonymized depending on how and where it is measured) and thin (¯x ≈ 2.2 with S. g. gabbi by Diersing and Wilson (2017), S. g. incitatus mm), that of S. incitatus is shorter (¯x ≈ 3.3 mm) and broader (¯x (Bangs, 1901), to illustrate potential problems in using only ≈ 2.6 mm). The resulting postorbital foramina likewise differ, measurements to guide taxonomic decisions. averaging 3.9 mm long by 0.8 mm wide in S. gabbi, whereas in 1608 JOURNAL OF MAMMALOGY Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 5.—Crania of (top) the holotype of Sylvilagus incitatus (Bangs, 1901) (MCZ Bangs Collection, 8441) and (bottom) the lectotype of S. gabbi (J. A. Allen, 1877) (USNM 11371/37794). From left to right: dorsal, ventral, and lateral aspects. The lateral view shown for S. incitatus is the right aspect, inverted for consistency with S. gabbi; the left aspect is obscured by tags. Images scaled to the same size in order to emphasize shape differences. Representative dimensions are, greatest length of skull: 73.9 mm (S. incitatus), 70.9 mm (S. gabbi); zygomatic breadth at zygomatic spine: 35.2 mm, 32.6 mm; zygomatic length: 32.0 mm, 30.8 mm.

S. incitatus, the right postorbital foramen is almost completely gabbi, this suture is about medially located relative to the ossifed and the left is ca. 1.1 by 0.6 mm. In both taxa, the squamosal bar supporting the squamosal portion of the caudal terminus of the postorbital process is strongly fused to zygomatic arch, about 3–4 mm caudad of the tuberculum the tuberculum frontoparietale. frontoparietale. In S. incitatus, it is distinctly caudad of the The absolute and relative positions of the three-way su- squamosal bar supporting the squamosal portion of the zy- ture between frontal, parietal, and squamosal are prom- gomatic arch, and about 7–8 mm caudad of the tuberculum inently different between S. gabbi and S. incitatus. In S. frontoparietale. RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1609

Ventrally, there are no marked differences between the two expanded lacuna. The protofexid of S. gabbi is a simple invag- taxa except in the region of the auditory bulla. In S. gabbi, the ination, whereas that of S. incitatus is multiple. posteromedial aspect of the petrosal is prominent, and distinctly The metafexus of the P2 is deep and evident in S. gabbi separates the ectotympanic from the tympanic process of the but shallow and almost imperceptible in S. incitatus. The basioccipital; it is particularly large at the constriction of the anterolabial portion of the tooth, constituting the lagicone and latter. In S. incitatus, the posteromedial aspect of the petrosal postcone, is largely enveloped in thick enamel in S. gabbi, Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 forms in contrast a thin fange separating the ectotympanic whereas in S. incitatus, only the lagicone and a rostrally pro- from the tympanic process of the basioccipital. In addition, the jecting crenel intermediate between lagicone and postcone carotid canal is a prominent feature of the ectotympanic of S. have thick enamel. The parafexus is deeper in S. incitatus than gabbi, but is largely indistinct in S. incitatus. in S. gabbi, and its caudal surface (rostral facies) is smooth The dentition, particularly pm3, is diagnostically distinct be- and of a uniform thickness. In S. gabbi, the caudal surface of tween the two taxa (Fig. 6). Indeed, S. incitatus has a diagnostic the parafexus is complex in the caudal portion then becomes autapomorphy that we have seen in no other taxon of Sylvilagus smooth and of thin enamel in the rostral portion. There is a single or indeed Lagomorpha: in all lagomorphs, the caudal (rostral hypofexus separating distinct mesial and distal hypercones in facing) facies of the hypofexid of pm3 is a simple lamina of the lingual aspect of PM2 of S. gabbi. In contrast, S. incitatus enamel that may be smooth and featureless, or complex and has two invaginations in the lingual aspect of PM2, which is en- crenellated, or anywhere between those extremes, but always veloped by uniformly thick enamel, with the exception of one is singular. In the holotype of S. incitatus, there are two lam- of the invaginations. inae constituting the posterior facies of the hypofexid. This is The I1 of Sylvilagus generally is morphologically simple clearly evident in the right pm3 (Fig. 6) and present but not as with few if any distinguishing characters. In S. gabbi however, evident in the left pm3, which is somewhat more worn than the there is present a shallow, open rostral groove; this groove is right. The central angle of the hypofexid is multiple in S. gabbi more closed in S. incitatus, where the entire rostral surface of and singular in S. incitatus. The hypofexid itself is relatively the tooth has enamel of uniform thickness, whereas in S. gabbi short anteroposteriorly in S. incitatus, but relatively longer in there is a slight thinning in the deepest portion of the groove. S. gabbi; the lingual terminus of the hypofexid is simple in The most striking difference between the two taxa in this tooth S. incitatus, whereas in S. gabbi, it ends in a rostrocaudally is that S. gabbi has very thick enamel almost uniformly sur- rounding the crown surface of this tooth, and is particularly ev- ident in the caudal aspect of I1. We imaged the same tooth in S. incitatus for consistency, and there is no evidence of thick enamel on either the remainder of the caudal aspect of this tooth nor on the caudal aspect of the left I1. The characters outlined above, and the character differences displayed between the two taxa, have been previously shown to be of an interspecifc nature (Ruedas 1998, 2017; Ruedas et al. 2017). Therefore, a hypothesis of conspecifcity between S. gabbi and S. incitatus is not supported, ineluctably leading to the alternative hypothesis: S. incitatus (Bangs, 1901) is a valid species, likely restricted to the Archipiélago de Las Perlas.

Sylvilagus sanctaemartae Hershkovitz, 1950, is not Sylvilagus gabbi (J. A. Allen, 1877) Diersing and Wilson (2017:1646) stated that their “study shows clearly that rabbits from the lowlands of northern Colombia are indistinguishable from rabbits of the lowlands of Panama and Costa Rica, including topotypical specimens of S. gabbi. Accordingly, S. gabbi sanctaemartae is a synonym of S. g. gabbi.” Hershkovitz (1950:353) described “Sylvilagus brasiliensis sanctaemartae” as a subspecies of S. brasiliensis based almost exclusively on coloration, but also noted some interesting be- havioral differences distinguishing between the forest-dwelling Fig. 6.—Diagrammatic representations of the crown enamel pat- forms that he called S. b. sanctaemartae, “the frst tapitis to terns in (left column) the lectotype of Sylvilagus gabbi (J. A. Allen, be recorded from northern Colombia,” and the savanna- and 1877) (USNM 11371/37794) and (right column) the holotype of scrub-inhabiting “cottontail,” which he referred to S. foridanus S. incitatus (Bangs, 1901) (MCZ Bangs Collection, 8441). Top to subspecies. Ruedas (2017) in contrast hypothesized that bottom: pm3, PM2, I1. S. sanctaemartae constituted a species independent of S. 1610 JOURNAL OF MAMMALOGY brasiliensis. Some of the more salient morphological features are ca. 52° (left) and 47° (right); and from the junction of the distinguishing between S. brasiliensis and S. sanctaemartae are maxillary, frontal, and nasal bones, to the most posterolateral detailed and summarized below. point of the nasal, and thence to the most rostromedial point The two syntypes of S. gabbi listed by Allen (1877) are from of the frontonasal suture, 37° (left) and 40° (right). In con- Talamanca, Costa Rica, and Chiriquí, Panama. Subsequently, trast, in S. sanctaemartae, the lateral half of each frontonasal

Nelson (1909) designated USNM 11371/37794 as the lectotype, suture tends to be either parallel to the transverse plane or Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 fxing the type locality to Talamanca, Costa Rica. That lo- even caudomedially oriented (e.g., Ruedas 2017: fgures 6–7). cality was amended by Hershkovitz (1950:352) to “Talamanca Sylvilagus gabbi has a prominent long, slender process of the (=Sipurio, Río Sixaola, near the Caribbean coast), Costa Rica.” frontal bone intercalated between the posterodorsal process Ruedas and Salazar-Bravo (2007) georeferenced Hershkovitz’ of the maxilla and the caudolateral aspect of the nasal bone location as ca. 9°31′60″N, 82°55′0″W, ca. 195 m. An examina- (incorrectly identifed as the “maxillary process of frontal” in tion of that location and the geological features intervening be- Ruedas (2017), but is lateral to the posterodorsal process of the tween the type locality of S. gabbi and that of S. sanctaemartae premaxilla). Not a single specimen of S. sanctaemartae displays suggests that it would be exceedingly diffcult for a lowland this feature (Ruedas 2017: fgures 3, 6–7). The postorbital pro- species to have a continuous, panmictic population between cesses are characteristically different between S. gabbi and S. the ranges of the two named taxa, given the interruptions in sanctaemartae: as was noted above in reference to S. incitatus, lowland habitat by numerous mountain ranges between the they are thinner in S. gabbi; at their rostral base, they are ca. 2.2 two type localities. The geographical features that would inter- mm wide and ca. 4.9 mm long. The ample separation between rupt a lowland range include the southern reaches of the Sierra the thin postorbital processes and the frontal bones results in de Talamanca, which extend to the Caribbean in Panama, and a relatively long and open postorbital foramen: these average the Cordillera Occidental of the Andes, which likewise ex- 3.9 mm long by 0.8 mm wide in S. gabbi. In S. sanctaemartae tends to the Caribbean in western Colombia. Ecological niche the postorbital processes are much more massive, at a breadth modeling supports a low likelihood of interconnectedness of 3.1 and 3.4 mm and length of 5.8 and 6.2. The resulting between S. gabbi and S. sanctaemartae (Ruedas et al. 2017: postorbital foramina are consequently relatively minute in S. Appendix 1). We hypothesize that there are no populations of sanctaemartae: ca. 0.8 mm wide by 2.8 mm long, although the S. sanctaemartae that are adjacent to populations of S. gabbi; left postorbital foramen of the holotype is partially obstructed therefore, there is no comparison possible between adjacent by flaments of osseous material. The postorbital process of S. populations. sanctaemartae is much more tightly fused to the frontal bone Diersing and Wilson (2017:1646) concluded that S. gabbi along a greater part of its caudomedial surface, whereas only sanctaemartae is a synonym of S. g. gabbi based on the fact the caudal end is fused with the tuberculum frontoparietale that, that their fgure 1 “shows clearly that rabbits from the lowlands in the case of S. gabbi, is on the frontal and squamosal bones of northern Colombia are indistinguishable from rabbits of the only. The skull of the holotype of S. sanctaemartae is not com- lowlands of Panama and Costa Rica, including topotypical pletely cleaned, so not all details of the cranial anatomy from specimens of S. gabbi.” The causes of this lack of discrimina- a ventral perspective are clearly evident. A character that does tion are mysterious: Ruedas (2017: fgure 1) was able, using a stand out as apparently distinguishing between the two taxa is principal component analysis rather than a discriminant func- the relative length of the incisive foramina, which in S. gabbi tion analysis, but presumably on the same specimens used by do not reach to the alveoli of PM2, whereas in S. sanctaemartae Diersing and Wilson (2017), to distinguish between individuals almost invariably extend to about midway through PM2 (see of S. sanctaemartae collected on the eastern and western sides Ruedas 2017: fgure 6). of the Sierra Nevada de Santa Marta (i.e., among the holotype The dentition of S. gabbi is illustrated in Fig. 6 in reference and paratypes listed by Hershkovitz, 1950). to its comparison with S. incitatus. Here, we will draw com- Figure 7 shows perspectives of the crania of the holotypes parisons between the pm3 of S. gabbi as illustrated therein with of S. sanctaemartae and S. gabbi. Briefy, characters that the holotype and paratypes of S. sanctaemartae (Ruedas 2017: differ between the two taxa, and that have previously been de- fgure 5). In general terms, the anterior lobe of the two taxa scribed as indicative of species-level differences include the are indistinguishable, with numerous crenels, including a cen- following: from a dorsal perspective, the nasal bone, from its tral, more prominent invagination creating some distinction be- most posterolateral point in S. gabbi angles rostromedially to tween a relatively more prominent labial anteroconid and an what is presumably an unpaired nasofrontal bone that is fused indistinct lingual anteroconid. The majority of the specimens with the right nasal bone and extends backward along the me- of S. sanctaemartae have a poorly developed, even indistinct, dial suture line between the frontal bones. The angle formed by protofexid, which is in contrast well developed in S. gabbi; a line originating at the junction of the maxillary, frontal, and overall, this character is not consistent (e.g., Ruedas 2017: nasal bones, to the most posterolateral point of the nasal, thence fgure 5). The conformation of the hypofexid is, however, dis- to an infection point about halfway to the most rostromedial tinct between the two taxa: the rostral surface of the hypofexid point of the frontonasal suture (on the left side of the holotype in S. sanctaemartae is smooth and simple, with a single, gener- of S. gabbi) or to halfway to the most rostromedial point of the ally weakly developed central angle. In contrast, S. gabbi has a frontonasal suture (on the right side, with no such infection) series of complex folds in the area of the central angle, creating RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1611 Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 7.—Crania of (top) the lectotype of Sylvilagus gabbi (J. A. Allen, 1877) (USNM 11371/37794) and (bottom) the holotype of S. sanctaemartae (USNM 279993). From left to right: dorsal, ventral, and lateral aspects. The lateral view shown for S. gabbi is the left aspect, inverted for con- sistency with S. sanctaemartae. Images scaled to the same size in order to emphasize shape differences. Representative dimensions are, greatest length of skull: 77.0 mm (S. sanctaemartae), 70.9 mm (S. gabbi); zygomatic breadth at zygomatic spine: 33.0 mm, 32.6 mm; zygomatic length: 32.6 mm, 30.8 mm. essentially a multiple central angle (as discussed above in refer- gabbi, the rostral surface of the hypofexid is strongly refected ence to the comparison with S. incitatus). Lingual to the central rostrally lingual to the central angle, resulting in a relatively angle, the rostral surface of the hypofexid in specimens of S. large anteroposterior depth to the hypofexid. The caudal sur- sanctaemartae is oriented in a straight line to the lacuna at the face of the hypofexid of S. sanctaemartae is smooth and gen- lingual terminus of the hypofexid, the resulting anteroposterior erally featureless, although some individuals display shallow depth of the hypofexid is fairly homogeneous. In contrast, in S. folds (e.g., USNM 279981, 279982). The same feature in S. 1612 JOURNAL OF MAMMALOGY gabbi is more complex, particularly in the area across the cen- surdaster Thomas, 1901b, and Sylvilagus (Tapeti) salentus tral angle, where there are a number of deep invaginations. Allen, 1913, with S. g. gabbi (J. A. Allen, 1877). In light of the overwhelming character data presented above, Figure 8 shows crania of the holotypes of S. surdaster we propose that S. gabbi and S. sanctaemartae both are valid (MNHUK 1901.6.5.16) and S. salentus (AMNH 33050), as species-level taxa. well as a partial dorsal perspective of the lectotype of S. gabbi (USNM 11371/37794); a more complete series of perspectives Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 Sylvilagus gabbi (J. A. Allen, 1877) is unlikely to be present in of the latter is shown in Figs. 5 and 7. There are strong differences between S. g. gabbi and the two Pacific lowlands of Colombia and Ecuador purported conspecifcs in the conformation of the posterodorsal Diersing and Wilson (2017:1650) suggested that S. gabbi ex- process of the premaxilla, and its disposition vis-à-vis the nasal tends into western Colombia and Ecuador. They further indi- bone. The posterodorsal process of the premaxillary bone is ex- cated that the nominal subspecies from Costa Rica, S. g. gabbi, tremely long in S. gabbi, much longer than the nasal bone. In is to be found in those areas, and synonymized Sylvilagus S. surdaster it is just somewhat longer, and in S. salentus it is

Fig. 8.—Cranium of (top) the holotype of Sylvilagus surdaster Thomas, 1901 (NHMUK 1901.6.5.16), fragments (bottom left and center) of the holotype of S. salentus Allen, 1913 (AMNH 33050), and (bottom right) a partial perspective, for comparative purposes, of the holotype of S. gabbi (J. A. Allen, 1877) (USNM 11371/37794; full, uncut perspective in Fig. 6). Representative dimensions are, greatest length of skull: 72.7 mm; zygomatic breadth at spine: 37.0 mm; zygomatic length: 31.7 mm; length of nasals: 30.0 (S. surdaster), 27.6 (S. salentus), 28.0 (S. gabbi). RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1613 even with the nasal. The process of frontal bone that intercal- readily apparent character difference between S. gabbi and both ates between the dorsal processes of the premaxillaries and the S. surdaster and S. salentus is that the incisive foramina of S. nasal bones is relatively long in S. gabbi, reaching rostrally al- gabbi do not reach caudally to the rostral margin of the P2 alve- most to the midline suture between frontal and nasal bones. It olus, whereas in both S. surdaster and S. salentus, the incisive is much shorter in both S. salentus, where it is also thin, as in S. foramina reach to near the middle of PM2. gabbi, and S. surdaster, in which this feature is much broader at Finally, there is a postglenoid foramen present in S. Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 the base (along a transverse plane): 1.8 and 2.3 mm wide (left, surdaster, a character not otherwise present in species of right), and 3.8 and 4.5 mm long, to 0.7 and 0.6 mm wide and Sylvilagus that we have examined. This foramen is present in 6.1 and 7.4 mm long in S. gabbi. The shape of the frontonasal extinct eurymylids (e.g., Rhombomylus—Asher et al. 2005), suture likewise differs. Both S. surdaster and S. salentus have in Ochotona and Romerolagus (Wible 2007), and as well as nasal bones that angle in a posteromedial direction from the across other mammal taxa. Both Asher et al. (2005: character junction of the posterodorsal process of the premaxilla, nasal, 140) and Wible (2007: character 24) only considered the loca- and frontal bones. The angle formed at the caudal end of the tion of this character, rather than its possible absence. Because nasal is then approximately parallel with the transverse plane, of its broad distribution in extinct and extant mammal species, before turning back toward the most rostromedial point of the we hypothesize that its presence in S. surdaster is a primitive frontonasal suture in forming a tight U-shape, rather than the condition, whereas its absence (loss of postglenoid foramen) in open V-shape of S. gabbi. remaining Sylvilagus is a derived condition. As was the case with S. sanctaemartae (see above), there are The measurement that we provided for the length of nasal strong differences in the conformation of the postorbital pro- bones in S. salentus differs from that of Diersing and Wilson cesses (currently unknown in S. salentus). We described above (2017). They listed that dimension as 28.05 mm; we returned the conformation of these features in S. gabbi; in S. surdaster, dimensions for the left nasal bone of 27.5 mm and the right they are similar to those of S. sanctaemartae in being more of 27.8 mm. These are close, albeit not identical, to those of massive than those of S. gabbi: they average 2.7 mm in width at Diersing and Wilson (2017). Therefore, measurements across the rostral base, and 5.8 mm in length. The resulting postorbital both studies are not strictly comparable. In addition, Diersing foramina are smaller, 0.6 mm wide and ca. 2.5 mm long (to and Wilson (2017) listed for S. salentus a breadth across nasals 0.8 and 3.9 mm in S. gabbi). In addition, while the postorbital as 12.2 mm. Longitudinal cracks can be readily observed in processes of S. gabbi are largely confuent with the braincase, the nasal bones of the holotype of S. salentus (Fig. 8). These those of S. surdaster are somewhat more strongly angled lat- cracks suggest that the skull fragment has been subjected to erally. Finally, whereas in S. gabbi, only the caudal terminus dorsoventral fattening, which would lead to a distortion of the of the postorbital process is fused to the frontal and squamosal measurement of breadth across the nasal and casts doubt on portions of the braincase, in S. surdaster, the caudal half of the results of ensuing discriminant function analysis based on the medial aspect of the postorbital process is fused; Thomas the extremely limited number of measurements available on the (1901b:544) noted that the postorbital processes were “pressed holotype of S. salentus. against [the braincase] but not anchylosed with it.” In pm3, S. gabbi (Fig. 6) does not differ substantially from S. Thomas (1901b:544) pointed out that the auditory bullae surdaster (Fig. 9, left) in the anterior lobe: both taxa have some were “exceedingly small, far smaller than in any allied species, crenellation on the rostral facies of the anterior lobe, and a pre- so low that a line from the top of one to that of the other hardly sumed anterofexid demarcating labial anteroconid from a lingual clears the basioccipital.” In S. surdaster, the ventral surface of anteroconid region with additional crenellations (more numerous the bulla barely reaches the tip of the paraoccipital process, in S. gabbi). There also is some indication of the presence of a whereas in S. gabbi, it far exceeds this feature and reaches al- parafexid, as a small indentation is present in the lingual aspect most to the paracondylar process. Very little infation of the bullae is appreciated from the ventral perspective, and a large fange of the posteromedial aspect of the petrosal is prominent on the medial aspect of the bullae and separates these from the basioccipital and exoccipital bones, with a thin extension ex- tending around the wings of the basioccipital. In S. gabbi, the fange made up of the posteromedial aspect of the petrosal is broader throughout, rather than thinning around the wings of the basioccipital. There is scant evidence of an inferior petrosal sinus in S. gabbi, whereas these are present at the posterior base of the expansion of the basioccipital bone in S. surdaster; in contrast, the carotid canal of S. surdaster is minute and in- conspicuous, whereas S. gabbi displays the more characteristic Fig. 9.—Diagrammatic representations of the crown enamel patterns prominent carotid canal of remaining species of Sylvilagus. of pm3 in (left) the holotype of Sylvilagus surdaster Thomas, 1901 The shape of the basisphenoid differs between the two, as does (NHMUK 1901.6.5.16) and (right) the holotype of S. salentus Allen, the conformation of the secondary anterior foramen. A more 1913 (AMNH 33050). 1614 JOURNAL OF MAMMALOGY of the anterior loph of both taxa. However, the hypofexid differs to the hypofexid. The caudal surface of the hypofexid of S. markedly between the two: the rostral surface of the hypofexid surdaster is smooth and generally featureless. The same feature in S. surdaster is smooth and simple, with a single weakly devel- in S. gabbi is more complex, particularly in the area across the oped central angle. In contrast, S. gabbi has a series of complex central angle, where there are a number of deep invaginations. In folds in this area, resulting a multiple, complex central angle (as S. salentus, the rostral surface of the hypofexid is also relatively discussed above). Lingual to the central angle, the rostral sur- simple (in contrast with that of S. gabbi), but the caudal surface Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 face of the hypofexid in S. surdaster is oriented in a straight of the hypofexid is extremely complex, and has relatively thick line to the lacuna at the lingual terminus of the hypofexid, the enamel, in parts as thick or even thicker than the enamel layer resulting anteroposterior depth of the hypofexid is fairly homo- of the rostral surface of the hypofexid. In S. gabbi, this level of geneous. In S. gabbi, as we noted above, the rostral surface of complexity in the folding of the enamel is not approached, and the hypofexid is strongly refected rostrally lingual to the cen- the enamel is homogeneously thin throughout the caudal surface tral angle, resulting in a relatively large anteroposterior depth of the hypofexid.

Fig. 10.—Dorsal perspectives of the skins of the lectotype (in the case of Sylvilagus gabbi) and holotypes of (left to right): S. gabbi (USNM 11371/37794), S. salentus (AMNH 33050), and S. surdaster (MNH 1901.6.5.16). Scale bar = 50 cm. Note the stark differences in coloration, par- ticularly between S. surdaster and remaining taxa. All the taxa shown here were synonymized into the nominal subspecies S. g. gabbi by Diersing and Wilson (2017). RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1615

Both S. salentus and S. gabbi are distinctly different in S. brasiliensis, is that S. andinus has a completely smooth brain- pelage characters from S. surdaster (Fig. 10); the latter could case, without any evidence of pitting on its surface (Ruedas not be mistaken for any other species of Sylvilagus based on et al. 2017). Sylvilagus daulensis in contrast displays perhaps pelage characteristics alone. While pelage color is fundamen- the most pitted cranium within Sylvilagus. In addition, like S. tally agouti in all three species, S. surdaster has an overall much andinus, S. daulensis has postorbital processes that are unfused darker appearance than S. salentus and S. gabbi. In particular, to the parietal bones, they have blunt, rounded caudal termini, Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 S. surdaster differs most conspicuously from S. salentus and S. whereas all specimens of S. andinus that we have examined have gabbi in having extremely dark, almost black, external pinnae, thin, sharp termini (Ruedas et al. 2017: fgures 14–15, 18–19). in contrast to the more typically paler coloration of S. salentus Another character diagnostic of S. andinus is the presence of a and S. gabbi. The latter two also differ in details of their pinnae: premolar foramen (e.g., Ruedas et al. 2017: fgures 20–21). As these are almost devoid of pelage in S. gabbi versus furred al- is the case with S. brasiliensis, S. daulensis does not have a pre- most in their totality in S. salentus. The inside of the pinna is molar foramen. In the bullar area, the posteromedial aspect of likewise unfurred in S. gabbi, but is furred in S. salentus. The the petrosal in S. andinus intercalates between the bulla and the latter has a distinct black fringe on the anterior edge of the occipital. Essentially, the hypoglossal foramen of S. andinus pinna and an orange fringe of hairs on the distal edge, both of opens onto both the auditory bulla (most caudomedial aspect which are absent in S. gabbi. In addition, S. salentus is overall thereof) and the expanded posteromedial aspect of the petrosal, darker in appearance, with more gray on the haunches, a color whereas S. daulensis has the classic condition for Sylvilagus, in that appears to be absent from S. gabbi. There are additional, which the jugular foramen is adjacent to the occipital condyles. more subtle differences; we present the major distinctions The posteromedial aspect of the petrosal in S. daulensis extends only as a contrast to the suggestion of Diersing and Wilson between the bulla and the basioccipital almost to the alisphe- (2017:1650) who, in synonymizing S. surdaster and S. salentus noid, whereas in S. andinus, the posteromedial aspect of the with S. g. gabbi, indicated that “Sylvilagus g. gabbi exhibits no petrosal appears to end just anterior to the occipital condyles. observable pattern of geographic variation throughout its range The validity of the posteromedial aspect of the petrosal as a from east-central Guatemala to Colombia and northwestern diagnostic character requires validation in a broader sample. Ecuador.” Sylvilagus surdaster is unequivocally distinct and From the lateral perspective, two characters stand out as dis- warrants recognition as a distinct species. tinguishing between S. andinus and S. daulensis. The frst and The character data presented above are not consistent with more important is the relative position of the infraorbital fo- the hypothesis that S. surdaster and S. salentus are similar ramen. In S. daulensis, the infraorbital foramen is so low on the enough with the overall appearance of S. g. gabbi to warrant side of the rostrum that it is almost on the palatal aspect of the their inclusion into S. g. gabbi. In addition, there are ecolog- maxillary bone. In S. andinus, the infraorbital foramen is infe- ical data contradicting that hypothesis. The type locality of S. rior to but almost midway between ventral and dorsal aspects gabbi is approximately 20 m in elevation and, to the best of our of the rostrum. The nasals are heavily infated in S. daulensis, knowledge, S. gabbi is a lowland species, with no records from but fat and straight in S. andinus. This results in a distinct and elevations higher than ca. 400 m (Diersing and Wilson 2017). nonoverlapping depth of rostrum in S. daulensis (15.3 mm) The holotype of S. salentus is, however, from ca. 2,134 m. versus S. andinus (holotype: 12.2 mm; mean of six adults [hol- Diersing and Wilson (2017:1651) presented hypotheticals that otype, UMMZ 77072; 77075–76, 77080, 77082]: 13.1, σ: 0.55, may have resulted in the holotype of S. salentus having been range: 12.2–14.0; see Ruedas et al. 2017: fgure 19). collected at a lower elevation, closer to 550 m. They concluded The two taxa also differ strongly in dental characters (Fig. that “Although there is no evidence to support it, […], the hol- 12). In the third upper premolar, S. daulensis differs from S. otype may have been taken at a lower elevation […], where S. andinus (e.g., Ruedas et al. 2017: fgure 13) in having a rel- gabbi is more likely to occur. Accordingly, S. salentus is listed atively constricted anterior lobe versus a broad anterior lobe, as a synonym of S. gabbi.” We prefer to rely on our character similar in this respect to, for example, referred specimen of S. data, which are consistent with falsifcation of the hypothesis brasiliensis UFPE 427. In contrast, S. andinus has a broadly of conspecifcity between S. gabbi and both S. surdaster and S. square-shaped anterior lobe that extends almost the width of the salentus. We advocate instead the alternative hypothesis: that S. anterior loph; this is especially true of the holotype, MNHUK surdaster and S. salentus are reciprocally monophyletic species 1897.11.7.54, whose labial anteroconid extends labially as far that are also not conspecifc with S. gabbi. Therefore, S. gabbi as the protoconid. There is a distinct parafexid, absent in S. is confned to Mesoamerica and does not extend into lowlands andinus. Although the rostral facies of the anterior lobe of S. south or east of the Isthmus of Panama and south of the Darién daulensis is more complex than that of S. brasiliensis, it is not Gap. as complex as evident in even the simplest of the specimens of S. andinus we have examined. The protofexid of S. daulensis Sylvilagus daulensis J. A. Allen, 1914 is not S. andinus is similar to that of S. andinus and differs from S. brasiliensis (Thomas, 1897) in being deep and complex rather than shallow and relatively A cursory examination of the holotype of S. daulensis confrms smooth. The posterior surface (rostral facies) of the hypofexid that it is not conspecifc with S. andinus (Fig. 11). A key diag- is relatively smooth, much more so than in S. andinus. PM2 is nostic character of S. andinus, particularly in comparison with shown for completeness but does not appear to be diagnostic, 1616 JOURNAL OF MAMMALOGY Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 11.—Crania of (top) the holotype of Sylvilagus daulensis J. A. Allen, 1914 (AMNH 34671) and (bottom) the holotype of S. andinus (Thomas, 1897) (MNHUK 1897.11.7.54). From left to right: dorsal, ventral, and lateral aspects. The lateral view shown for S. andinus is the right aspect, in- verted for consistency with S. sanctaemartae. Images scaled to the same size in order to emphasize shape differences. Representative dimensions are, greatest length of skull: 69.2 mm (S. daulensis), 69.7 mm (S. andinus); zygomatic breadth at zygomatic spine: 30.3 mm, 32.2 mm; zygomatic length: 29.0 mm, 31.4 mm. other than having a marked hypofexus, which distinguishes S. parafexus display some relief, in contrast to the completely daulensis from S. brasiliensis. Similarly, both surfaces of the smooth parafexus of S. brasiliensis. RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1617

Hershkovitz (1950:355) suggested that based on Miller’s itin- erary, Belén should be “near or on the summit of the [Cordillera Occidental] range (10,340 feet) [3152 m] just north of Cerro Munchique.” Lawrence (1993:64) reiterated that opinion in indicating that the correct locality was “Colombia: Cauca;

Belen, west of Papayan, 10,000 ft (3050 m)” and that the alti- Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 tude of 6,000 ft on the label was incorrect. If Lawrence is cor- rect, then the georeferenced type locality after Lawrence would be in the vicinity of 2°31′N, 76°57′W, the only point with any such elevation west of Popayan. There are two localities in Cauca with the name Belén, neither close to that location: one is well west of Popayan at 71 m, and the other is in the Cordillera Central. Notwithstanding the uncertainty as to the exact loca- tion of the type locality, there is some degree of certainty, given Allen’s explicit statement, that it is in the Cordillera Occidental (Western Andes). The potentially synonymous taxon S. nicefori was described 9 years later by Thomas (1921), on the basis of materials collected December 1919 by Brother Nicéforo María in San Pedro, Medellín, Colombia (6°27′51″N, 75°33′22″W, ca. 2,480 m). The holotype, an adult male “received in exchange,” was catalogued as MNHUK no. 1921.7.1.26. Cranial features among specimens ascribed to the two taxa do bear a superfcial resemblance (Fig. 13). There is a marked dif- ference in the size of the holotypes of these two taxa, which are almost of the same relative age as assessed by degree of fusion of their occipital sutures (our examination notes of S. fulvescens indicate the holotype does not represent an adult): the greatest length of the skull of S. nicefori is 75.2 mm, whereas that of S. Fig. 12.—Diagrammatic representations of the crown enamel patterns of pm3 and PM2 of Sylvilagus daulensis J. A. Allen, 1914 (holotype, fulvescens is 63.2 mm (84%). The auditory bullae show similar AMNH 34671). differences: Thomas (1921) noted that the bullae of S. nicefori were small, presumably in comparison with those of other spe- There also are strong ecological differences between habi- cies of Sylvilagus. We measured their breadth from the carotid tats at the type localities of S. daulensis and S. andinus. The canal to the lateral surface, as that is a consistently repeatable type locality of S. andinus is in the Páramo and Subpáramo measurement. In S. nicefori, the breadth was 4.2 mm; in the ecosystem, at ca. 4,000 m on Volcán Cayambe, in the Cayambe smaller S. fulvescens, it was 5.1 mm. Relative to the greatest Canton of Ecuador’s Pichincha Province. The species has been length of skull in either taxon, that is 5.6% of the greatest recorded purportedly on Volcán Antisana as high as 5,000 m length of the skull in S. nicefori and 8.1% in S. fulvescens. The (S. a. nivicola Cabrera, 1913) and 5,486 m (“18,000 ft”: MNH general shape of the skull (lateral perspective) results in some- 54.625). Hershkovitz (1938), who extensively collected S. what distinct facial tilts (sensu Kraatz and Sherratt 2016) for andinus in the area between 1933 and 1937, hypothesized that either species: S. fulvescens: 46.5°; S. nicefori, 53.4°. The facial members of that species were restricted to the treeless zone of tilt of S. fulvescens places that taxon frmly within the middle the Andes, with a lower limit somewhere between 2,500 and quartiles of saltatorial species; that of S. nicefori is in contrast 3,500 m (see discussion in Ruedas et al. 2017). In contrast, the at the interface between saltatorial and generalist (Kraatz and type locality of S. daulensis is Ecuador: Guayas Prov.; Daule, Sherratt 2016: Supplementary Figure 6). However, those au- on Río Daule, coastal plain of W Ecuador, north of Guayaquil, thors documented extensive intraspecifc variation in this pa- elev. ca. 7 m (ca. 1°53′00″S, 80°0′W). rameter among the fve species that they sampled (Kraatz and In light of the data presented above, we conclude that S. Sherratt 2016: Supplementary Figure 5). daulensis is a valid species, separate from of S. andinus and S. Besides the obvious difference in size, there are numerous brasiliensis, and we fnd no support for the hypothesis of con- character differences between the crania of the two taxa (Fig. specifcity among S. daulensis, S. andinus, and S. brasiliensis. 14). The conformation of the occipital shield, formed by the projection of the superior nuchal line on the supraoccipital bone Sylvilagus nicefori Thomas, 1921 is not synonymous with S. and meeting caudally at the external occipital protuberance is fulvescens Allen 1912 one of the principal differences of the rear of the skull (Fig. 14). Sylvilagus fulvescens was described by Allen in 1912, from Sylvilagus fulvescens displays a roughly triangular occipital “Belen (alt. 6000 ft.), Western Andes,” on the basis of mate- shield, ending in a distinct external occipital protuberance that rial collected by Leo E. Miller on 28 July 1911. Subsequently, is continuous ventrally with a prominent external occipital crest 1618 JOURNAL OF MAMMALOGY Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 13.—Crania of (top) the holotype of Sylvilagus nicefori Thomas, 1921 (MNHUK 1921.7.1.26) and (bottom) the holotype of S. fulvescens Allen, 1912 (AMNH 32360). From left to right: dorsal, ventral, and lateral aspects. Images scaled to the same size to emphasize shape differences. Representative dimensions are: greatest length of skull = 75.2 mm (S. nicefori), 63.2 mm (S. fulvescens); zygomatic breadth at zygomatic spine = 36.1 mm, 30.1 mm; zygomatic length = 30.8 mm, 26.4 mm. running between the external occipital protuberance and the fo- spine and broadens in the jugal portion of the arch (30.1 ramen magnum (Fig. 14). In contrast, S. nicefori has a roughly versus 31.4 mm). The anterior portion of the zygomatic arch rectangular occipital shield without an overly distinct external in S. nicefori shows a distinct depression for the attachment occipital crest, as is the case in other species of Sylvilagus. of the lateral masseter: the zygomatic fossa. The zygomatic The zygomatic arch differs between the two in that the fossa is present in S. fulvescens, but not as well defned as in masseteric spine on the anterior of the zygoma is more ex- S. nicefori and shows no evidence of a foramen zygomatico- panded in S. nicefori: this is the broadest portion of the zy- orbitale, as present in S. nicefori. Finally, S. nicefori displays gomatic arch in this taxon (36.1 mm versus 35.5 across the a ventrad defection of the zygomatic arch from the masseteric jugal portion of the zygomatic arch) in contrast to that of S. spine, whereas the zygomatic arch of S. fulvescens trends fulvescens, which is narrowest anteriorly at the masseteric dorsocaudally from the same point. RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1619 Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019

Fig. 14.—Detail of some of the principal distinguishing characters displayed in the holotypes of Sylvilagus nicefori Thomas, 1921 (MNHUK 1921.7.1.26) and S. fulvescens Allen, 1912 (AMNH 32360). Top left pair: posterodorsal perspective (note that images of either holotype are taken at a different angle). Arrow shows the suture at the medial extremity of the mastoid exposure of the pretrosal. Note the sharp three-way suture in S. fulvescens (left) between the mastoid exposure of the petrosal, exoccipital, and supraoccipital, contrasting with the condition in S. nicefori (right), with a dorsoventrally oriented exposure of suture between the mastoid exposure of the pretrosal and exoccipital. These sutures become fused and inconspicuous in older adults. Lower left pair: dorsal aspect of the braincase region; arrow shows the tuberculum frontoparietale. Upper right pair: top, S. fulvescens; bottom, S. nicefori. Top arrow shows the ventrad defection of rostral aspect of the nasal bone in S. fulvescens; central arrow shows the retracted rostral aspect of the premaxillary bones encapsulating I1 and I2. Bottom arrow shows the relatively and absolutely contrasting upper diastema: S. fulvescens, 16.5 mm, S. nicefori, 21.4 mm. Bottom right pair: lateral aspect of the braincase and bullar region of S. fulvescens (left) and S. nicefori (right). The arrow on S. fulvescens shows the paraoccipital process of the petrosal, which is relatively short in S. fulvescens but almost completely covers the ectotympanic (auditory bulla) in S. nicefori. The arrow on S. nicefori shows the squamosal process of the squa- mosal bone, a squamosal intrusion of bone between the mastoid exposure of the petrosal and the supraoccipital; this feature is much longer in S. fulvescens, where it extends almost to the caudal extremity of the external auditory meatus, contrasting with the shortened condition in S. nicefori.

Additional osteological characters of the skull that differ S. nicefori does not exhibit this nasal bowing to the same extent. between the two taxa (Fig. 14) include the following: in the At the rostral extreme of the premaxillary, the portion of pre- occipital region, S. fulvescens displays a distinct triradiate su- maxillary encapsulating the incisors is caudally retracted in S. ture between the mastoid exposure of the petrosal, exoccipital, fulvescens relative to the more rostrally exposed S. nicefori. The and supraoccipital. This conformation contrasts with the con- resulting curvature of the incisors relative to the basal-incisive dition in S. nicefori, which has a dorsoventrally oriented expo- plane is strongly opisthodont in S. fulvescens, but orthodont sure of suture between the mastoid exposure of the pretrosal in S. nicefori (terminology of Hershkovitz 1962:103). The and exoccipital. These sutures become fused and inconspic- relative and absolute lengths of the upper diastema likewise uous in older adults. From a dorsal perspective, the tuberculum strongly contrast: 16.5 mm in S. fulvescens versus 21.4 mm frontoparietale of S. nicefori is distinct and sharply projecting in S. nicefori. For other taxa in the “brasiliensis” group, a size rostrad, whereas that of S. fulvescens is blunt and rounded. The comparable to that of S. fulvescens is somewhat small, whereas most salient features distinguishing the two taxa are in the ros- that of S. nicefori is comparatively large: S. daulensis (AMNH tral and auditory regions. The rostral extremities of the nasal 34671, female, holotype), 18.5 mm; S. kelloggi (AMNH bones of S. fulvescens are somewhat ventrally curved, resulting 60515, female, holotype), 18.6; S. capsalis (1900.3.15.29, fe- in a bowed profle above the premaxillary portion of the ros- male, holotype), 18.5; S. cumanicus (MNHUK 1894.9.25.18, trum. In our experience, leporid nasals bow in that manner as holotype, sex unknown), 21.6; S. andinus canarius (MNHUK, the individual matures; we would thus not expect this charac- 1899.9.9.123, male, holotype), 19.7; and others similarly. Mean teristic to decrease. However, the somewhat older individual of length of diastema in adult specimens of S. andinus is 17.5 mm, 1620 JOURNAL OF MAMMALOGY the holotype’s size for this dimension is 18.9 mm (Ruedas et rather than being of a continuous breadth with the hypofexid, al. 2017). Among the holotypes that we have examined, only as in S. nicefori. The characters of S. fulvescens as described S. gibsoni (1918.1.1.8, male, holotype) is in the range of S. are potentially representative of tooth wearing. Although the fulvescens at 15.8 mm. Like S. fulvescens, S. gibsoni has a small holotype of S. fulvescens is an individual younger than that of cranium (greatest length of skull = 61.3 mm); however, the hol- S. nicefori, the dentition is that of an adult. In S. fulvescens, otype is of an adult specimen. Even the Rio de Janeiro dwarf the width of anterior loph of pm3 is 2.4 mm (S. nicefori: 2.7); Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 cottontail, S. tapetillus has a diastema of 16.4 mm; Thomas anteroposterior length of anterior loph, 1.8 (2.0); width of pos- (1913) reported the greatest length of skull for this animal as terior loph, 3.2 (3.2), anteroposterior length of posterior loph, 61 mm; we did not measure this dimension because the skull is 0.9 (1.0). A larger sample would be required to discern whether broken, missing the supraoccipital, much of the basioccipital, differences in these dimensions are signifcant, but they cer- and portion of the right exoccipital. tainly are suggestive. In the bullar region, a marked difference can be observed Sylvilagus nicefori has been collected in the Cordillera in the paraoccipital process of the petrosal, which is rela- Central, east of the Cauca River, which fows at an elevation tively short in S. fulvescens, but almost completely covers the of ca. 460 m in those latitudes, between the Cordillera Central ectotympanic (auditory bulla) in S. nicefori. Just dorsal to the and the Cordillera Occidental. In contrast, the type locality of ectotympanic, the squamosal process of squamosal bone, a S. fulvescens is on the Pacifc slope of Cordillera Occidental. squamosal intrusion of bone between the mastoid exposure of Using global ecoregions as defned by Dinerstein et al. (2017), petrosal and the supraoccipital, is much longer in S. fulvescens, the type locality of S. nicefori is in Magdalena Valley montane where it extends almost to the caudal extremity of the external forest, whereas the type locality of S. fulvescens is in Northwest auditory meatus, contrasting with the shortened condition in S. Andean montane forest. The two type localities are separated nicefori, where the squamosal process barely extends caudal of by two ecoregions: Cauca Valley dry forests and Cauca Valley the rostral extremity of the external auditory meatus. montane forests, as well as isolated pockets of northern Andean The dentition of the two taxa under consideration is shown Páramo that are presumably occupied by S. andinus or related in Fig. 15. The general conformation of pm3 of S. fulvescens species. The Cauca Valley dry forests are in a different biome is more similar to that of S. nicefori than it is to that of S. (Tropical and Subtropical Dry Broadleaf forests) than either brasiliensis (see above for comparison of S. fulvescens with S. montane forests (Tropical and Subtropical Moist Broadleaf brasiliensis). The principal distinguishing features between the forests). Given the strong ecological differences between the two are that S. nicefori has more homogeneously thick enamel two type localities, application of the precautionary principle than has S. fulvescens. Both have the typical thickening on the (O’Riordan and Cameron 1994; Cooney 2004; Meffe et al. rostral facies of the hypofexid and labial and caudal surfaces 2006) would suggest that in the absence of scientifc certainty, of the hypoconid. However, the lingual face of the anterior loph a conservative approach to the taxonomy of the two taxa would is evenly thick in S. nicefori in contrast to the thin enamel of be preferable: that is, maintenance of both names as separate the same surface in S. fulvescens. This lingual face is where a entities. parafexid would manifest itself were it present: in S. nicefori Together with these ecological differences, the morpho- there is not even a trace of an infection (contrast with S. apol- logical character differences documented above, particularly linaris, Fig. 3). In S. fulvescens, there may be a parafexid, al- in the rostral region, the inclination of the incisors, and the though, as mentioned above (comparison of S. brasiliensis, S. differences in conformation of the bones in the occipital and apollinaris, and S. fulvescens), the parafexid may in fact be ectotympanic regions, in combination cast strong doubt on a particularly deep manifestation of the lingualmost crenel on a hypothesis of conspecifcity between S. fulvescens and S. the rostral face of the anterior lobe of pm3. In addition, the nicefori. Accordingly, we propose the alternative hypothesis, lacuna at the lingual terminus of the hypofexid is expanded, that S. fulvescens and S. nicefori are independent species- level taxa.

Discussion Lagomorph taxonomy and systematics have entered a new age of discovery (Donoghue and Alverson 2000) wherein there still remains “a blank space of delightful mystery” (Conrad 1899) in which reside the “rainbow colors around the outer edges of human knowledge and imagination” (Nietzsche 1878). The explosive, approximately contemporaneous diversifcations in Lepus and Sylvilagus (Silva et al. 2019; Upham et al., 2019) Fig. 15.—The pm3 of the holotypes of (left) Sylvilagus nicefori still largely shroud the basal patterns of diversifcation in Thomas, 1921 (MNHUK 1921.7.1.26, ♂), and of (right) S. fulvescens those genera. Although many questions remain regarding the J. A. Allen, 1912 (AMNH 32360, ♀). The area in gray shade sur- fne-scale relationships, the broad strokes are becoming illu- rounding the protofexid of S. fulvescens is somewhat indistinct. minated. Numerous species in a broad variety of higher taxa RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1621 have been demonstrated to display markedly elevated rates of same predicament, relying for all of South America on a ge- evolution, speciation, and endemism in the Andes (Patton and ographically restricted treatment (Hershkovitz 1950), and for Smith 1992; Chaves et al. 2011; Madriñan et al. 2013; Nürk North America on a more geographically comprehensive but et al. 2013; Despland 2014; Hazzi et al. 2018), a phenomenon equally old treatise (Hall 1951). In addition, convergent evolu- frst hypothesized for plants by B. B. Simpson (1975). In par- tion in lagomorph skull shape at the species and genus levels ticular, the Andes have been shown by Brumfeld and Edwards has obscured phylogenetic signals in their morphological evo- Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 (2007) to constitute a speciation accelerator in vertebrates such lution (Ge et al. 2015), increasing the diffculty of taxonomic as antshrikes, Thamnophilus Vieillot, 1816 (Passeriformes: identifcation in the Order, when morphological differentiation Thamnophilidae), with lowland species being derived from generally is accepted as evidence of reproductive isolation, highland species, as well as the converse. Therefore, it should hence species status (Corbet 1997). come as no surprise that high-elevation Andean species are dis- Here, we propose a character-based framework that re- tinct from low-elevation Atlantic Forest species, nor that there fects patterns of biological diversity and evolutionary his- are more species hypothesized to be present in the Andes, from tory (Bertrand and Härlin 2006; Padial and De la Riva 2006; montane forests to Páramos, than previously thought, particu- Wiley and Lieberman 2011), derived using principles of inte- larly as a result of continental insularity (Anthelme et al. 2014). grative taxonomy (Wheeler et al. 2004; Dayrat 2005; Padial The framework of the Andes as a center of high rates of di- et al. 2010) that bring together independent lines of evidence versifcation and endemism (Patterson et al. 2012; Luebert and from complementary disciplines (Schlick-Steiner et al. 2010; Weigend 2014; Mutke et al. 2014; Luebert and Muller 2015; Ndiaye et al. 2011) and coalesce them into an explicit, co- Hazzi et al. 2018) is key to understanding biological diversity herent, and defensible taxonomic schema, recognizing that and has important implications to the conservation of the spe- hidden from view in many taxa there may exist numerous cies contained therein. morphologically cryptic lineages that are evolving independ- Patterns of diversity, as revealed by careful examination of ently (Vieites et al. 2009; Barrowclough et al. 2016; Burgin a variety of distinct and independent data streams, support et al. 2018; Fišer et al. 2018). Lineages that are not obviously the phenomenon of high speciation and endemism in high differentiated and that may be diffcult in the extreme to di- Andean species as well as elsewhere in the tropics (Allen et al. agnose can nevertheless be valid species (de Queiroz (2005). 2002; Rolland et al. 2014), as is found in Neotropical species Sylvilagus, in the framework that we have described above, of Sylvilagus (Ruedas et al. 2017). Our previously published appears to be a textbook example of a genus containing nu- (Ruedas 2017; Ruedas et al. 2017) and present results indicate merous, poorly differentiated, but nevertheless diagnosable, that Sylvilagus is one of the most speciose genera among terres- species-level taxa. trial mammals in South America, after Ctenomys (ca. 69 spp.), Thomasomys (ca. 44), Cryptotis (ca. 43), and Akodon (ca. 39; Taxonomic Summary and Conclusions data extracted from Burgin et al. 2018). Adopting a more ex- pansive taxonomic hypothesis would result in a pattern of spe- 1. Sylvilagus andinus (Thomas, 1897) is not a synonym of S. cies richness for Sylvilagus with far greater diversity in North brasiliensis (Linnaeus 1758) but rather a valid species inde- America than in the otherwise (i.e., for other species of mam- pendent of the latter. Sylvilagus andinus is restricted to the mals) generally more speciose South American continent. Such Páramo and Subpáramo habitats of the Andes, with a dis- unrealized biodiversity obscures not just the pattern, but also tribution that remains unknown as to its full extent; the full the process of evolution (Struck et al. 2018), and has severe contents of S. andinus likewise remain to be illuminated. negative effects on conservation efforts (Thomson et al. 2018). Both morphological and molecular data strongly support Although the presence of ample morphologically cryptic di- this distinction. versity has been acknowledged for island taxa (Esselstyn et al. 2. We concur with Diersing and Wilson (2017) that S. 2013; Brown et al. 2014; Giarla and Esselstyn 2015; Heaney et fulvescens J. A. Allen, 1912 is not synonymous with S. al. 2016), such taxa are equally prevalent in island-continental brasiliensis (Linnaeus 1758). distributed faunas (Rhinolophus—Patrick et al. 2013), as well 3. We similarly agree with Diersing and Wilson (2017) that as continental faunas (Myotis—Ruedi et al. 2013; Mus—Bryja S. apollinaris Thomas, 1920 is not synonymous with S. et al. 2014; Rhinolophus—Soisook et al. 2008; Ith et al. brasiliensis (Linnaeus 1758). 2015; Volleth et al. 2015). Most pertinently, cryptic species 4. In the absence of a neotype, nothing can be construed as of mammals are not restricted to groups with small body size: representing S. deflippi (Cornalia, 1849 [1850]); cer- Gutierrez et al. (2017) found widespread incongruities between tainly nothing having a range hypothesized as extending identifcation and not just species, but also genus-level mis- throughout the tropical Amazon and Orinoco basins of identifcations among Central and South American Odocoileini Colombia, Ecuador, and Peru. Until a neotype is desig- (Cervidae), including a likely new genus previously recognized nated, described, diagnosed, and a type locality fxed, S. only as a subgenus. Gutierrez et al. (2017) further pointed out deflippi is at best a nomen dubium. that the uncritical reliance on early 20th-century taxonomies 5. Sylvilagus incitatus (Bangs, 1901) is not a synonym of S. not just perpetuated, but actually exacerbated the taxonomic g. gabbi (J. A. Allen, 1877), but rather a valid species inde- lapses the authors had identifed. Sylvilagus is in much the pendent of the latter. 1622 JOURNAL OF MAMMALOGY

6. Sylvilagus sanctaemartae Hershkovitz, 1950 is not a syn- Sylvilagus andinus: Stone 1914:15. Not Sylvilagus andinus onym of S. gabbi (J. A. Allen, 1877), but rather a valid spe- (Thomas, 1897). Stone acknowledged that these speci- cies independent of the latter. mens likely represented S. a. chimbanus. In the transcript 7. Sylvilagus surdaster Thomas, 1901b is not synonymous account from collector S. N. Rhoads (Stone 1914:15), with S. gabbi (J. A. Allen, 1877) nor with S. salentus J. there is evidence of ecological separation of two forms:

A. Allen, 1913. These all are species-level taxa. All lines one in the Páramo, one in the grasslands below the Páramo. Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 of evidence suggest that S. gabbi (J. A. Allen, 1877) is re- Sylvilagus kelloggi Anthony, 1923:9. Type locality Ecuador: stricted to Mesoamerica and does not extend into South Provincia de Loja, Guachanamá, headwaters of the Río America. Chira, 9,050 ft [2,758 m]. Est. ca. 4º25′42″S, 79º13′19″W, 8. Sylvilagus daulensis J. A. Allen, 1914 is not synonymous WGS84. Holotype, AMNH 60515. with S. andinus (Thomas 1897), which latter also is not Sylvilagus chillae Anthony, 1923:12. Type locality Ecuador: synonymous with S. brasiliensis (Linnaeus, 1758). Provincia del Oro, Cordillera de Chilla, trail from Salvias 9. Sylvilagus nicefori Thomas, 1921 is not synonymous with to Zaraguro, 6,600 ft [2,012 m]. Est. ca. 3º37′2″S, S. fulvescens Allen 1912. Both taxa are valid species de- 79º30′12″W (WGS84). Holotype, AMNH 60511. fned by numerous morphological differences, and inhabit Sylvilagus andinus carchensis Hershkovitz, 1938:5. Type lo- different ecoregions. cality Ecuador: Carchi Province; Montúfar, about 5 miles southwest of San Gabriel, foot of the Páramos of Boliche, elevation ca. 2,900 m. Est. ca. 0º33′56.8″N, 77º46′20.6″W (WGS84). Holotype, UMMZ 77062. Synonymies Sylvilagus andinus chotanus Hershkovitz, 1938:8. Type lo- Sylvilagus andinus (Thomas, 1897) cality Ecuador: Imbabura Prov.; Pimanpiro, slopes of the Chota Valley, elevation ca. 1,500 m. Est. ca. 0º25′13.6″N, Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758:58. Part. 77º56′09.6″W (WGS84). Holotype, UMMZ 77061. Not Sylvilagus brasiliensis: Ruedas et al. 2017. Type lo- Sylvilagus brasiliensis andinus: Hershkovitz, 1950:358. cality “America meridionali” [South America]. Name combination. Lepus [=Sylvilagus] andinus Thomas, 1897:551, by orig- inal designation. Type locality “W. slope of Cayambé Sylvilagus apollinaris Thomas, 1920 Mountain, [Province of Pichincha, Cantón Cayambe,] Eastern Cordillera of Ecuador, altitude 4000 metres” Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758. Part. Not [ca. 0º01′47.24″N, 78º01′26.89″W (datum: WGS84)]. Sylvilagus brasiliensis: Ruedas et al. 2017. Holotype, MNHUK 1897.11.7.54. Sylvilagus apollinaris Thomas, 1920:31. Type locality S. meridensis Thomas 1904:36. Type locality “Sierra de Colombia: Cundinamarca; “Choachi, near Bogota.” Merida, Venezuela.” Est. ca. 8º32′19″N, 71º5′52″W, Restricted by Hershkovitz (1950:357) to: “Choachi, WGS84, elevation 4,000 m. Holotype, MNHUK Cordillera Oriental, about 20 Km southeast of Bogotá; altitude 1904.5.14.1. of Choachi, 1966 m.” Est. ca. 4º31′29.5″N, 73º55′32.6″W Sylvilagus andinus Thomas, 1913:212. First use of current (WGS84). Holotype, MNHUK 1919.10.15.2. “Known only name combination. from the Bogotá region” (Hershkovitz 1950:357). Sylvilagus andinus chimbanus Thomas, 1913:212. Type Sylvilagus brasiliensis apollinaris: Hershkovitz, 1950:356. locality Ecuador: Bolivar Province; W slope of Mt. Name combination. Chimborazo, “Sinche, upper Río Chimbo, just north of Guabanda. Alt. 4000 m.” Est. ca. 1º28′30.3″S, 78º54′30″W, Sylvilagus brasiliensis (Linnaeus, 1758) WGS84. Holotype, MNHUK 1899.9.9.114. Sylvilagus andinus canarius Thomas, 1913:213. Type lo- Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758:58. Type lo- cality “Cañar, Andes of Ecuador. Alt. 2600 m.” Est. cality “America meridionali” [=South America]; restricted ca. 2º31′22″S, 78º58′0″W, WGS84. Holotype, MNH to Pernambuco by Thomas (1911), and further to Atlantic 1899.9.9.123. coastal Brazil (Pernambuco Endemism Center of the Sylvilagus capsalis Thomas, 1913:213. Type locality “San Atlantic Forest biome) by Ruedas et al. (2017). Based on Pablo, Cajamarca, Pacifc slope of N. Peru. Alt. 2000 “Tapeti Brasiliensibus” of Marcgraff 1648:223 (Fig. p. 224). m.” W. Slope Cordillera Occidental. Est. ca. 7º6′33″S, Neotype, Universidade Federal de Pernambuco 1740. 78º51′4″W, WGS84. Holotype, MNH 1900.3.15.29. Lepus [=Sylvilagus] brasiliensis: Erxleben 1777:336. Sylvilagus nivicola Cabrera, 1913:4. Type locality Ecuador: Provided an exhaustive contemporary synonymy; ex- Pichincha Province, Mount Antisana, Cordillera Oriental, panded range to include Mexico. near snow line, ca. 4,800 m. Est. ca. 0º28′26.5″S, Lepus [=Sylvilagus] Tapeti Pallas, 1778:30. Also based on 78º7′15″W, WGS84. Holotype lost in Spanish Civil War. Marcgraff, unavailable name combination (vernacular). S[ylvilagus]. andinus andinus: Cabrera, 1913:7. Name Lepus [=Sylvilagus] Tapeti: Schreber, 1792:902. Unavailable combination. name combination (vernacular). RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1623

Le tapeti Buffon 1799:342. Unavailable vernacular name. S. fulvescens to the holotype of S. andinus, “but it differs Locality: “on le trouve au Brésil et dans plusieurs autres from it widely” (Allen 1916:204). endroits de l’Amérique” [one fnds it in Brazil and in sev- Sylvilagus brasiliensis fulvescens: Hershkovitz 1950:355. eral other places of America]. Name combination. tapitý Azara, 1809:313. Unavailable vernacular name. Sylvilagus fulvescens: Diersing and Wilson 2017:1651.

Locality: South America north of 30º degrees latitude South. Included S. nicefori Thomas, 1921 (see below). Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 Lepus [=Sylvilagus] Brasilianus Lesson, 1842:99. Incorrect subsequent spelling, following Brisson (1756:141, una- Sylvilagus incitatus (Bangs, 1901) vailable on the basis of date), who in turn cited type lo- Lepus (Tapeti) incitatus Bangs, 1901:633. Type locality: cality as “Brésil” [=Brazil]. “San Miguel Island, the largest of the islands in the Bay of Le Tapéti Lesson, 1842:99. Alternate subsequent spelling Panama, known as the Archipelago de las Perlas.” of unavailable vernacular names from Buffon (1799:342) Sylvilagus gabbi incitatus: Nelson, 1909:261. Name and Azara (1809:313). combination. Lepus [=Sylvilagus] nigricaudatus: Lesson, 1842:100. Sylvilagus brasiliensis incitatus: Hershkovitz, 1950:352. Part (“Brésil” [=Brazil]) Part. Not Lepus nigricaudatus Name combination. Synonymized gabbi with brasiliensis Bennett, 1833. and maintained incitatus as a distinct subspecies. Tapeti brasiliensis: Gray, 1867:224. Name combination. Sylvilagus gabbi incitatus: Ruedas and Salazar–Bravo, Not Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758, as 2007:68. Returned incitatus into gabbi, which was defn- defned by Ruedas et al. (2017). Gray (1867) referred to itively recognized as a species separate from brasiliensis. animals from “Para [Brazil] and Bolivia.” Lepus [=Sylvilagus] brasiliensis: Thomas, 1901a:535. Based Sylvilagus nicefori Thomas, 1921 on a specimen “From Porto Real, near Rezende, Rio.” Not Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758. Part. Not Lepus [=Sylvilagus] brasiliensis, Linnaeus, 1758; later de- Sylvilagus brasiliensis: Ruedas et al. 2017. scribed as Sylvilagus tapetillus Thomas, 1913. Sylvilagus nicefori Thomas 1921:442. Type locality Lepus [=Sylvilagus] brasiliensis: Thomas, 1911:146. Colombia: Antioquia; Cordillera Central, “San Pedro,” Restricted Linnaeus’ type locality to “Pernambuco.” 24 km N Medellín, ca. 2,435 m. Est. ca. 6º27′50.6″N, L[epus]. brasiliensis: Thomas, 1913:209. Type locality re- 75º33′21.6″W (WGS84). Holotype, MNHUK 1921.7.1.26. iterated as “Pernambuco” but added that a series of speci- Sylvilagus brasiliensis nicefori: Hershkovitz 1950:356. mens reported in Thomas (1901a) collected by Alphonse Name combination. Robert from “Lamarão, Bahia” […] “not so very far from Sylvilagus fulvescens: Diersing and Wilson 2017:1651. Not Pernambuco […] may be treated as true L. brasiliensis.” S. fulvescens J. A. Allen, 1912. Lamarão restricted by Coimbra-Filho et al. (2006) to: “on the railway line midway between the towns of Água Fria Sylvilagus salentus J. A. Allen, 1913 (south) and Serrinha (north), 11º45′S, 38º53′W, northwest Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758. Part. Not of Salvador, about 140 km as the crow fies.” Sylvilagus brasiliensis: Ruedas et al. 2017. S[ylvilagus]. brasiliensis: Thomas, 1913:210. First use of Sylvilagus (Tapeti) salentus J. A. Allen, 1913:476. Type current name combination. locality Colombia: Caldas; “Salento, [at head of Río Sylvilagus brasiliensis brasiliensis: Hershkovitz, 1950:366. Quindio, W. Mt. Tolima,] West Quindio Andes (alt. Name combination. 7000 ft. [2134 m]).” Est. ca. 4º38′31.6″N, 75º33′30.6″W, Sylvilagus brasiliensis: Ruedas et al. 2017:1. Selected and WGS84. Holotype, AMNH 33050. described a neotype. Sylvilagus brasiliensis salentus: Hershkovitz 1950:355. Name combination. Sylvilagus fulvescens J. A. Allen, 1912 Sylvilagus gabbi gabbi: Diersing and Wilson 2017:1650. Not S. salentus J. A. Allen, 1913. Lepus [=Sylvilagus] brasiliensis Linnaeus, 1758. Part. Not Sylvilagus brasiliensis: Ruedas et al. 2017. Sylvilagus fulvescens J. A. Allen, 1912:73. Type locality Colombia: Cauca, Belén, W. Popayán, near summit of Cordillera Occidental, just N. Cerro Munchique. Est. ca. Acknowledgments 2º31′06″N, 76º57′22″W, WGS84, elevation ca. 3,152 m LAR and JS-B received funding for portions of this work from [Lawrence (1993) gave the elevation as 10,000 ft (3,050 NSF grant DEB-0616305. SMS was funded by CNPq Universal m), noting that the elevation of 6,000 ft noted on the label 447460/2014-5. JMM undertook portions of this work under the was incorrect]. Holotype, AMNH 32360. auspices of Project SIA-0286-16 from the Universidad Nacional Sylvilagus fuscescens J. A. Allen, 1916:204. “lapsus calami de Costa Rica. We are grateful to museum curators for having for fulvescens” (Hershkovitz 1950:355): incorrect sub- been granted permission to examine the holotypes under their sequent spelling. Allen noted here that he had compared care: A. L. Gardner (USNM; along with D. P. Lunde, J. J. Ososky, 1624 JOURNAL OF MAMMALOGY and S. C. Peurach), R. Portela Míguez (MNH-London, along Plata; l’histoire de la découverte et de la conquête de ces contrées; with L. Tomsett), and R. S. Voss (AMNH; along with E. Hoeger, des détails nombreux sur leur histoire naturelle, et sur les peuples B. O’Toole, and E. Westwig). Conversations with A. L. Gardner sauvages qui les habitent; le récit des moyens employés par les and R. S. Voss were particularly interesting and fruitful. J. R. Jésuites pour assujétir et civiliser les indigènes, etc. Publiés d’après Wible (Carnegie Museum of Natural History) kindly answered les manuscrits de l’auteur, avec une notice sur sa vie et ses écrits, par C. A. Walckenaer, enrichis de notes par G. Cuvier, secrétaire numerous questions relating to fne details of cranial osteology Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 perpétuel de la classe des sciences physiques de l’institut, etc. Suivis that helped vastly improve the interspecifc morphological com- de l’histoire naturelle de Oiseaux du Paraguay et de La Plata, par le parisons; we are particularly grateful for his monumental 2007 même auteur, traduite, d’après l’original espagnol, et augmentée d’un work on the osteology of the Lagomorpha. An interesting tan- grand nombre de notes, par M. Sonnini; accompagnés d’un atlas de gential conversation with E. G. Pringle (University of Nevada— vingt-cinq planches. V. 1. Dentu, Imprimeur-Libraire, Paris, France. Reno) resulted in the realization of a critical part of the puzzle. Baker, F. C. 1889 [published 1890]. Remarks upon the round-tailed M. Omura (Museum of Comparative Zoology, Harvard) kindly muskrat, Neofber alleni, True. Proceedings of the Academy of confrmed details of the cranial and particularly the bizarre Natural Sciences of Philadelphia 41:271–273. dental anatomy of the holotype of S. incitatus. R. M. Brown Baker, R. J., and R. D. Bradley. 2006. Speciation in mammals and generously discussed species concepts with us and greatly im- the genetic species concept. Journal of Mammalogy 87:643–662. proved those areas of this manuscript. D. A. Duffeld (Portland Bangs, O. 1901. The mammals collected in San Miguel Island, Panama, by W. W. Brown, Jr. American Naturalist 35:631–644. State University) provided critical and critically timed biblio- Barrowclough, G. F., J. Cracraft, J. Klicka, and R. M. Zink. graphic assistance. We thank two anonymous reviewers for their 2016. How many kinds of birds are there and why does it matter? invaluable comments, which greatly improved this paper. PLoS One 11:e0166307. Bennett, E. T. 1833. Characters of new species of Mammalia from California. Proceedings of the Zoological Society of London Part Literature Cited I:39–42. Allen, J. A. 1877. Leporidae. Pp. 263–578 in Monographs of North Bertrand, Y., and M. Härlin. 2006. Stability and universality in American Rodentia (E. Coues and J. A. Allen, eds.). United States the application of taxon names in phylogenetic nomenclature. Geological Survey of the Territories. Government Printing Offce, Systematic Biology 55:848–858. Washington, D.C. Bickford, D., et al. 2007. Cryptic species as a window on diversity Allen, J. A. 1890a. Descriptions of a new species and a new sub- and conservation. Trends in Ecology & Evolution 22:148–155. species of the genus Lepus. Bulletin of the American Museum of Bradley, R. D., and R. J. Baker. 2001. A test of the genetic spe- Natural History 3:159–160. cies concept: cytochrome-b sequences and mammals. Journal of Allen, J. A. 1890b. Notes on collections of mammals made in Central Mammalogy 82:960–973. America and Southern Mexico, by Dr. Audley C. Buller, with descrip- Brisson, M.-J. 1756. Le regne animal divisé en IX Classes, ou tions of new species of the genera Vespertilio, Sciurus, and Lepus. Méthode contenant la division generale des animaux en IX Classes, Bulletin of the American Museum of Natural History 3:175–194. & la division particuliere des deux premieres Classes, sçavoir de Allen, J. A. 1912. Mammals from western Colombia. Bulletin of the celle des Quadrupedes & celle des Cetacées, en Ordres, Sections, American Museum of Natural History 31:71–95. Genres, & Espéces. Aux quelles on a joint une courte description Allen, J. A. 1913. New mammals from Colombia and Ecuador. de chaque Espéces, avec les Citations des Auteurs qui en ont traité, Bulletin of the American Museum of Natural History 32:469–484. les Noms qu’ils leurs ont donnés, ceux que leurs ont donnés les Allen, J. A. 1914. Two new mammals from Ecuador. Bulletin of the différentes Nations, & les noms vulgaires [verbatim spelling of American Museum of Natural History 33:199–200. title]. Cl. Jean-Baptiste Bauche, Libraire, Paris, France. Allen, J. A. 1916. List of mammals collected in Colombia by the Brown, R. M. 2015. A new species of stream frog of the genus American Museum of Natural History Expeditions, 1910–1915. Hylarana from the mountains of Southern Mindanao Island, Bulletin of the American Museum of Natural History 35:191–238. Philippines. Herpetologica 71:223–233. Allen, A. P., J. H. Brown, and J. F. Gillooly. 2002. Global bio- Brown, R. M., et al. 2014. Conservation genetics of the Philippine diversity, biochemical kinetics, and the energetic-equivalence rule. tarsier: cryptic genetic variation restructures conservation priorities Science 297:1545–1548. for an island archipelago primate. PLoS One 9:e104340. Angelone, C., and C. Sesé. 2009. New characters for species dis- Brown, R. M., A. Prue, C. K. Onn, M. Gaulke, M. B. Sanguila, crimination within the genus Prolagus (Ochotonidae, Lagomorpha, and C. D. Siler. 2017. Taxonomic reappraisal of the Northeast Mammalia). Journal of Paleontology 83:80–88. Mindanao Stream Frog, Sanguirana albotuberculata (Inger Anthelme, F., et al. 2014. Biodiversity patterns and continental 1954), validation of Rana mearnsi, Stejneger 1905, and descrip- insularity in the tropical High Andes. Arctic, Antarctic, and Alpine tion of a new species from the Central Philippines. Herpetological Research 46:811–828. Monographs 31:182–203. Anthony, H. E. 1923. Preliminary report on Ecuadorean mammals. Brown, R. M., U. Smart, A. E. Leviton, and E. N. Smith. 2018. No. 3. American Museum Novitates 55:1–14. A new species of long-glanded coralsnake of the genus Calliophis Asher, R. J., et al. 2005. Stem Lagomorpha and the antiquity of (Squamata: Elapidae) from Dinagat Island, with notes on the bi- Glires. Science 307:1091–1094. ogeography and species diversity of Philippine Calliophis and Azara, F. 1809. Voyages dans l’Amérique Méridionale, par Don Félix Hemibungarus. Herpetologica 74:89–104. de Azara, Commissaire et commandant des limites espagnoles dans Brumfield, R. T., and S. V. Edwards. 2007. Evolution into and out le Paraguay depuis 1781 jusqu’en 1801; contenant la description of the Andes: a Bayesian analysis of historical diversifcation in géographique, politique, et civile du Paraguay et de la rivière de La Thamnophilus antshrikes. Evolution 61:346–367. RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1625

Bryja, J., et al. 2014. Pan-African phylogeny of Mus (subgenus De Queiroz, K., and J. Gauthier. 1992. Phylogenetic taxonomy. Nannomys) reveals one of the most successful mammal radiations Annual Review of Ecology and Systematics 23:449–480. in Africa. BMC Evolutionary Biology 14:256. Despland, E. 2014. Butterfies of the high-altitude Atacama Desert: Buffon, G. L. L. 1799. Histoire Naturelle, Quadrupèdes. Tome habitat use and conservation. Frontiers in Genetics 5:334. septième. P. Didot, L’Aîné, Paris, France. Diersing, V. E., and D. E. Wilson. 2017. Systematic status of the Burgin, C. J., J. P. Colella, P. L. Kahn, and N. S. Upham. 2018. How rabbits Sylvilagus brasiliensis and S. sanctaemartae from north- many species of mammals are there? Journal of Mammalogy 99:1–11. western South America with comparisons to Central American Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 Cabrera, Á. 1913. Dos mamíferos nuevos de la fauna Neotropical. populations. Journal of Mammalogy 98:1641–1656. Trabajos del Museo de Ciencias Naturales, Serie Zoológica 9:3–15 Dinerstein, E., et al. 2017. An ecoregion-based approach to pro- + 1 unnumbered Plate. tecting half the terrestrial realm. BioScience 67:534–545. Cabrera, Á. 1917. Mamíferos del viaje al Pacífco, verifcado de 1862 Dobzhansky, T. 1950. Mendelian populations and their evolution. a 1865 por una comisión de naturalistas enviada por el gobierno American Naturalist 74:312–321. español. Trabajos del Museo Nacional de Ciencias Naturales, Serie Donoghue, M. J., and W. S. Alverson. 2000. A new age of dis- Zoológica 31:3–62. covery. Annals of the Missouri Botanical Garden 87:110–126. Cardarelli, F. 2003. Encyclopaedia of scientifc units, weights and Eldredge, N., and J. Cracraft. 1980. Phylogenetic patterns and measures: their SI equivalencies and origins (Shields, M. J., trans). the evolutionary process: method and theory in comparative bi- Springer-Verlag, London, United Kingdom. ology. Columbia University Press, New York. Chaves, J. A., J. T. Weir, and T. B. Smith. 2011. Diversifcation Erxleben, J. C. P. 1777. Systema regni animalis per classes, ordines, in Adelomyia hummingbirds follows Andean uplift. Molecular genera, species, varietates cum synonymia et historia animalium. Ecology 20:4564–4576. Classis I. Mammalia. Weygand’s Press, Leipzig, Germany. Coimbra-Filho, A. F., R. A. Mittermeier, A. B. Rylands, S. L. Esselstyn, J. A., Maharadatunkamsi, A. S. Achmadi, C. D. Mendes, M. C. M. Kierulff, and L. P. de S. Pinto. 2006. The Siler, and B. J. Evans. 2013. Carving out turf in a biodiversity taxonomic status of Wied’s black-tufted-ear marmoset, Callithrix hotspot: multiple, previously unrecognized shrew species co-occur kuhlii (Callitrichidae, Primates). Primate Conservation 21:1–24. on Java Island, Indonesia. Molecular Ecology 22:4972–4987. Conrad, J. 1899. The heart of darkness. Blackwood’s Edinburgh Fairmaire, L. 1851 [1852]. Esplorazione, etc.—exploration des Magazine 165:193–220 (Pt. I); 165:479–502 (Pt. 2); 165:634–657 régions équatoriales le long du Napo et du feuve des Amazones; (Conclusion). par Gaetano Osculati. Milan, 1830 [sic.]. Revue et Magasin de Cooney, R. 2004. The precautionary principle in biodiversity con- Zoologie Pure et Appliquée, 2e Série 3:613–616. servation and natural resource management: an issues paper for Fišer, C., C. T. Robinson, and F. Malard. 2018. Cryptic species as policy-makers, researchers and practitioners. International Union a window into the paradigm shift of the species concept. Molecular for the Conservation of Nature—IUCN, Gland, Switzerland. Ecology 27:613–635. Corbet, G. B. 1997. The species in mammals. Pp. 341–356 in Ge, D., L. Yao, L. Xia, Z. Zhang, and Q. Yang. 2015. Geometric Species: the units of biodiversity (M. F. Claridge, H. A. Dawah, and morphometric analysis of skull morphology reveals loss of phylo- M. R. Wilson, eds.). Chapman & Hall, London, United Kingdom. genetic signal at the generic level in extant lagomorphs (Mammalia: Cornalia, Æ. 1849 [1850]. Vertebratorum synopsis in Museo Lagomorpha). Contributions to Zoology 84:267–284. Mediolanense extantium; quæ per Novam Orbem Cajetanus Giarla, T. C., and J. A. Esselstyn. 2015. The challenges of resolving Osculati collegit annis 1846-47-48 speciebus novis vel minus a rapid, recent radiation: empirical and simulated phylogenomics cognitis adjectis nec non descriptionibus atque iconibus illustrates. of Philippine shrews. Systematic Biology 64:727–740. Pp. 301–315 in Esplorazione delle regioni equatoriali lungo il Napo Goldman, E. A. 1912. New mammals from Eastern Panama. ed il fume delle Amazzoni: frammento di un viaggio fatto nelle Smithsonian Miscellaneous Collections 60:1–18. due Americhe negli anni 1846-1847-1848 da Gaetano Osculati (G. Gray, J. E. 1867. Notes on the skulls of hares (Leporidae) and Picas Osculati, ed.). Tip[ografa] Bernardoni, Milan, Italy. (Lagomyidae) in the British Museum. Annals and Magazine of Dalquest, W. W. 1979. Identifcation of genera of American rabbits Natural History, Series 3 20:219–225. of Blancan age. Southwestern Naturalist 24:275–278. Guindon, S., and O. Gascuel. 2003. A simple, fast and accurate Dalquest, W. W., F. B. Stangl, Jr., and J. V. Grimes. 1989. The method to estimate large phylogenies by maximum-likelihood. third lower premolar of the cottontail, genus Sylvilagus, and its Systematic Biology 52:696–704. value in the discrimination of three species. American Midland Gutierrez, E. E., et al. 2017. A gene-tree test of the traditional Naturalist 121:293–301. taxonomy of American deer: the importance of voucher specimens, Darriba, D., G. L. Taboada, R. Doallo, and D. Posada. 2012. geographic data, and dense sampling. ZooKeys 697:87–131. jModelTest 2: more models, new heuristics and parallel computing. Hall, E. R. 1951. A synopsis of the North American Lagomorpha. Nature Methods 9:772. University of Kansas Publications, Museum of Natural History Dayrat, B. 2005. Towards integrative taxonomy. Biological Journal 5:119–202. of the Linnean Society 85:407–415. Hazzi, N. A., J. S. Moreno, C. Ortiz-Movliav, and R. D. Palacio. De Queiroz, K. 1998. The general lineage concept of species, spe- 2018. Biogeographic regions and events of isolation and diversifcation cies criteria, and the process of speciation. Pp. 57–75 in Endless of the endemic biota of the tropical Andes. Proceedings of the National forms: species and speciation (D. J. Howard and S. H. Berlocher, Academy of Sciences of the United States of America 115:7985–7990. eds.). Oxford University Press, New York. Heaney, L. R., et al. 2016. Doubling diversity: a cautionary tale of De Queiroz, K. 2005. A unifed concept of species and its conse- previously unsuspected mammalian diversity on a tropical oceanic quences for the future of taxonomy. Proceedings of the California island. Frontiers of Biogeography 8:e29667. Academy of Sciences, Series 4 56:196–215. Hershkovitz, P. 1938. A review of the rabbits of the andinus group De Queiroz, K. 2007. Species concepts and species delimitation. and their distribution in Ecuador. Occasional Papers of the Museum Systematic Biology 56:879–886. of Zoology, University of Michigan 393:1–15. 1626 JOURNAL OF MAMMALOGY

Hershkovitz, P. 1950. Mammals of northern Colombia. Preliminary Luebert, F., and L. A. Muller. 2015. Effects of mountain for- report no. 6: rabbits (Leporidae), with notes on the classifcation mation and uplift on biological diversity. Frontiers in Genetics and distribution of the South American forms. Proceedings of the 6:54. United States National Museum 100:327–375. Luebert, F., and M. Weigend. 2014. Phylogenetic insights into Hershkovitz, P. 1962. Evolution of Neotropical cricetine rodents Andean plant diversifcation. Frontiers in Ecology and Evolution (Muridae) with special reference to the phyllotine group. Fieldiana: 2:27. Zoology 46:1–524. Madriñán, S., A. J. Cortés, and J. E. Richardson. 2013. Páramo Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 Hibbard, C. W. 1963. The origin of the P3 pattern of Sylvilagus, is the world’s fastest evolving and coolest biodiversity hotspot. Caprolagus, Oryctolagus, and Lepus. Journal of Mammalogy Frontiers in Genetics 4:192. 44:1–15. Marcgraff von Liebstadt, G. 1648. Historiæ rerum naturalium Huson, D. H., and D. Bryant. 2006. Application of phylogenetic Brasiliæ, libro octo: quorum tres priores agunt de Plantis. Quartus networks in evolutionary studies. Molecular Biology and Evolution de Piscibus. Quintus de Avibus. Sextus de Quadrupedibus & 23:254–267. serpentibus. Septimus de Insectis. Octavus de ipsa Regione & Huson, D. H., T. Dezulian, T. Klöpper, and M. A. Steel. 2004. illius Incolis. Cum appendice de tapuyis, et Chilensibus. Ioannes Phylogenetic super-networks from partial trees. IEEE/ACM de Laet, Antwerp, Belgium. Transactions on Computational Biology and Bioinformatics Matthee, C. A., B. J. van Vuuren, D. Bell, and T. J. Robinson. 1:151–158. 2004. A molecular supermatrix of the rabbits and hares (Leporidae) ICZN [International Commission on Zoological allows for the identifcation of fve intercontinental exchanges Nomenclature]. 1999. International code of zoological nomen- during the Miocene. Systematic Biology 53:433–447. clature. 4th ed. International Trust for Zoological Nomenclature, Mayden, R. L. 1997. A hierarchy of species concepts: the denoue- London, United Kingdom. ment in the saga of the species problem. Pp. 381–424 in Species: Ith, S., et al. 2015. Taxonomic implications of geographical vari- the units of biodiversity (M. F. Claridge, H. A. Dawah, and M. R. ation in Rhinolophus affnis (Chiroptera: Rhinolophidae) in main- Wilson, eds.). Chapman & Hall, London, United Kingdom. land Southeast Asia. Zoological Studies 54:31. Mayr, E. 1942. Systematics and the origin of species from the view- Kraatz, B., and E. Sherratt. 2016. Evolutionary morphology of point of a zoologist. Columbia University Press, New York. the rabbit skull. PeerJ 4:e2453. Meffe, G. K., C. R. Carroll, and M. J. Groom. 2006. What is con- Lawrence, M. A. 1993. Catalog of recent mammal types in the servation biology? Pp. 3–25 in Conservation biology (M. J. Groom, American Museum of Natural History. Bulletin of the American G. K. Meffe, and C. R. Carroll, eds.). 3rd ed. Sinauer Associates, Museum of Natural History 217:1–200. Sunderland, Massachusetts. Lesson, R.-P. 1842. Nouveau tableau du règne animal. Première classe. Mutke, J., R. Jacobs, K. Meyers, T. Henning, and M. Weigend. Mammifères. Arthus Bertrand, Libraire-éditeur, Paris, France. 2014. Diversity patterns of selected Andean plant groups corre- Linnaeus, C. 1758. Sistema naturæ per regna tria naturæ, secundum spond to topography and habitat dynamics, not orogeny. Frontiers classes, ordines, genera, species, cum characteribus, differentiis, in Genetics 5:351. synonymis, locis, Editio decima, reformata, v. 1: Regnum animale. Naka, L. N., and R. T. Brumfield. 2018. The dual role of Amazonian Laurentii Salvii, Stockholm, Sweden. rivers in the generation and maintenance of avian diversity. Science López Martínez, N. 1974. Évolution de la lignée Piezodus-Prolagus Advances 4:eaar8575. (Lagomorpha, Ochotonidae) dans le Cénozoïque d’Europe Ndiaye, A., et al. 2011. Evolutionary systematics and biogeography sud-occidentale. Ph.D. dissertation, Université des Sciences et of endemic gerbils (Rodentia, Muridae) from Morocco: an integra- Techniques du Languedoc, Montpellier, France. tive approach. Zoologica Scripta 4:11–28. López Martínez, N. 1977. Revisión sistemática y Nelson, E. W. 1909. The rabbits of North America. North American bioestratigráfica de los Lagomorpha (Mammalia) del Terciario y Fauna 29:1–314. Cuaternario Inferior de España. Ph.D. dissertation, Universidad Nietzsche, F. W. 1878. Menschliches, Allzumenschliches. Ein Complutense de Madrid, Facultad de Ciencias Geológicas, Buch für freie Geister. Verlag von Ernst Schmeltzner, Chemnitz, Madrid, Spain. Germany, 377 pp. López Martínez, N. 1980. Los micromamíferos (Rodentia, Nürk, N. M., C. Scheriau, and S. Madriñán. 2013. Explosive ra- Insectivora, Lagomorpha y Chiroptera) del Sitio de Ocupación diation in high Andean Hypericum—rates of diversifcation among Achelense de Áridos-1 (Arganda, Madrid). Pp. 161–202 in New World lineages. Frontiers in Genetics 4:175. Ocupaciones Achelenses en el Valle del Jarama; Geología, O’Riordan, T., and J. Cameron. 1994. The history and contem- paleontología, paleoecología y prehistoria. Vol. 1: Arqueología porary signifcance of the precautionary principle. Pp. 12–30 y Paleontología (M. Santonja, N. López Martínez, and A. Pérez- in Interpreting the precautionary principle (T. O’Riordan, ed.). González, eds.). Servicios de Extensión Cultural y Divulgación de Earthscan Publications, London, United Kingdom. la Diputación Provincial de Madrid, Madrid, Spain, 1:1–352. Osculati, G. 1849 [1850]. Esplorazione delle regioni equatoriali López Martínez, N. 1989. Revisión sistemática y bioestratigráfca lungo il Napo ed il fume delle Amazzoni: frammento di un viaggio de los Lagomorpha (Mammalia) del Terciario y Cuaternario fatto nelle due Americhe negli anni 1846-1847-1848. Tip[ografo] Inferior de España. Memorias del Museo de Paleontología de la Bernardoni, Milan, Italy. Universidad de Zaragoza 3:1–342. Padial, J. M., A. Miralles, I. De la Riva, and M. Vences. 2010. López-Martínez, N., A. Likius, H. T. Mackaye, P. Vignaud, The integrative future of taxonomy. Frontiers in Zoology 7:16. and M. Brunet. 2007. A new lagomorph from the Late Miocene Padial, J. M., and I. de la Riva. 2006. Taxonomic infation and the of Chad (Central Africa). Revista Española de Paleontología stability of species lists: the perils of ostrich’s behavior. Systematic 22:1–20. Biology 55:859–867. RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1627

Palacios, F. 1996. Systematics of the indigenous hares of Italy tra- Siler, C. D., et al. 2017. First record of the Pseudogekko brevipes ditionally identifed as Lepus europaeus Pallas, 1778 (Mammalia: complex from the Northern Philippines, with description of a new Leporidae). Bonner Zoologische Beiträge 46:59–91. species. Herpetologica 73:162–175. Palacios, F., C. Angelone, G. Alonso, and S. Reig. 2008. Silva, S. M., L. A. Ruedas, L. H. Santos, J. S. Silva, Jr., and A. Morphological evidence of species differentiation within Lepus Aleixo. 2019. Illuminating the obscured phylogenetic radiation of capensis Linnaeus, 1758 (Leporidae, Lagomorpha) in Cape South American Sylvilagus Gray, 1867 (Lagomorpha: Leporidae). Province, South Africa. Mammalian Biology 73:358–370. Journal of Mammalogy 100:31–44. Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 Palacios, F., and N. López Martínez. 1980. Morfología dentaria Simpson, B. B. 1975. Pleistocene changes in the fora of the High de las liebres europeas. Doñana, Acta Vertebrata 7:61–81. Andes. Paleobiology 1:273–294. Pallas, P. S. 1778. Novae species quadrupedum e gliririrum ordine Simpson, G. G. 1961. Principles of animal taxonomy. Columbia cum illustrationibus variis complurium ex hoc ordine animalium. University Press, New York. Wolfgang Walther, Erlangen, Germany. Sites, J. W., Jr., and J. C. Marshall. 2003. Delimiting species: a Patrick, L. E., E. S. McCulloch, and L. A. Ruedas. 2013. Renaissance issue in systematic biology. Trends in Ecology and Systematics and biogeography of the arcuate horseshoe bat spe- Evolution 18:462–70. cies complex (Chiroptera, Rhinolophidae). Zoologica Scripta Sites, J. W., Jr., and J. C. Marshall. 2004. Operational criteria 42:553–590. for delimiting species. Annual Review of Ecology and Systematics Patterson, B. D., S. Solari, and P. M. Velazco. 2012. The role of 35:199–227. the Andes in the diversifcation and biogeography of Neotropical Soisook, P., et al. 2008. A taxonomic review of Rhinolophus stheno mammals. Pp. 351–378 in Bones, clones, and biomes: the history and R. malayanus (Chiroptera: Rhinolophidae) from continental and geography of Recent Neotropical mammals (B. D. Patterson Southeast Asia: an evaluation of echolocation call frequency in and L. P. Costa, eds.). University of Chicago Press, Chicago, discriminating between cryptic species. Acta Chiropterologica Illinois. 10:221–242. Patton, J. L., and M. F. Smith. 1992. MtDNA phylogeny of Andean Stone, W. 1914. On a collection of mammals from Ecuador. mice: a test of diversifcation across ecological gradients. Evolution Proceedings of the Academy of Natural Sciences of Philadelphia 46:174–183. 66:9–19. Paynter, R. A., Jr. 1997. Ornithological gazetteer of Colombia. 2nd Struck, T. H., et al. 2018. Finding evolutionary processes hidden in ed. Bird Department, Museum of Comparative Zoology, Harvard cryptic species. Trends in Ecology & Evolution 33:153–163. University, Cambridge, Massachusetts, ix+537 pp., 2 maps. Swofford, D. L. 2002. PAUP*. Phylogenetic analysis using par- Rolland, J., F. L. Condamine, F. Jiguet, and H. Morlon. 2014. simony (*and other methods). Version 4. Sinauer Associates, Faster speciation and reduced extinction in the tropics contribute Sunderland, Massachusetts. to the Mammalian latitudinal diversity gradient. PLoS Biology Thomas, O. 1897. Descriptions of new bats and rodents from 12:e1001775. America. Annals and Magazine of Natural History, 6th Series Ruedas, L. A. 1998. Systematics of Sylvilagus Gray, 1867 20:544–553. (Lagomorpha: Leporidae) from southwestern North America. Thomas, O. 1901a. On mammals obtained by Mr. Alphonse Robert Journal of Mammalogy 79:1355–1378. on the Rio Jordão, S.W. Minas Geraes. Annals and Magazine Ruedas, L. A. 2017. A new species of cottontail rabbit (Lagomorpha: of Natural History, 7th Series 8:526–536. [N.B.: Sylvilagus Leporidae: Sylvilagus) from Suriname, with comments on the tax- minensis] onomy of allied taxa from northern South America. Journal of Thomas, O. 1901b. New Myotis, Artibeus, Sylvilagus, and Metachirus Mammalogy 98:1042–1059. from Central and South America. Annals and Magazine of Natural Ruedas, L. A., and J. Salazar-Bravo. 2007. Morphological and History, 7th Series 7:541–545. [N.B.: Sylvilagus surdaster] chromosomal taxonomic assessment of Sylvilagus brasiliensis Thomas, O. 1904. New Sciurus, Rhipidomys, Sylvilagus, and gabbi (Leporidae). Mammalia 71:63–69. Caluromys from Venezuela. Annals and Magazine of Natural Ruedas, L. A., et al. 2017. A prolegomenon to the systematics of History, 7th Series 14:33–37. the South American cottontail rabbits (Mammalia, Lagomorpha, Thomas, O. 1911. The mammals of the tenth edition of Linnæus, Leporidae: Sylvilagus): designation of a neotype for S. brasiliensis an attempt to fx the types of the genera and the exact bases and (Linnaeus, 1758), and restoration of S. andinus (Thomas, 1897) and localities if the species. Proceedings of the Zoological Society of S. tapetillus Thomas, 1913. Miscellaneous Publication, Museum of London 1911:120–158. Zoology, University of Michigan 205:i–iv+1–67 pp. Thomas, O. 1913. Notes on S. American Leporidae. Annals and Ruedi, M., et al. 2013. Molecular phylogenetic reconstructions iden- Magazine of Natural History, 8th Series 11:209–214. tify East Asia as the cradle for the evolution of the cosmopolitan Thomas, O. 1920. A new cotton-tail (Sylvilagus) from Colombia. genus Myotis (Mammalia, Chiroptera). Molecular Phylogenetics Annals and Magazine of Natural History, 9th Series 8:442–443. and Evolution 69:437–449. Thomas, O. 1921. Two new species of Sylvilagus from Colombia. Sangster, G. 2014. The application of species criteria in avian taxonomy Annals and Magazine of Natural History, 9th Series 5:31–33. and its implications for the debate over species concepts. Biological Thomson, S. A., et al. 2018. Taxonomy based on science is neces- Reviews of the Cambridge Philosophical Society 89:199–214. sary for global conservation. PLoS Biology 16:e2005075. Schlick-Steiner, B. C., F. M. Steiner, B. Seifert, C. Stauffer, Upham, N. S., J. A. Esselstyn, and W. Jetz. 2019. Ecological E. Christian, and R. H. Crozier. 2010. Integrative taxonomy: a causes of uneven diversification and richness in the mammal multisource approach to exploring biodiversity. Annual Review of tree of life. Proceedings of the Academy of Sciences of Entomology 55:421–438. the United States of America. bioRxiv:504803. https://doi. Schreber, J. C. D. 1792. Die Säugthiere in Abbildungen nach der org/10.1101/504803 Natur, mit Beschreibungen, v. 4. Wolfgang Walther, Erlangen, Van Valen, L. 1976. Ecological species, multispecies, and oaks. Germany. Taxon 25:233–239. 1628 JOURNAL OF MAMMALOGY

Vieillot, L. P. 1816. Analyse d’une nouvelle ornithologie élémentaire. White, J. A., and N. H. Morgan. 1995. The Leporidae Deterville Libraire, de l’imprimerie de A. Belin, Paris, France. (Mammalia, Lagomorpha) from the Blancan (Pliocene) Taunton Vieites, D. R., K. C. Wollenberg, F. Andreone, J. Köhler, local fauna of Washington. Journal of Vertebrate Paleontology F. Glaw, and M. Vences. 2009. Vast underestimation of 15:366–374. Madagascar’s biodiversity evidenced by an integrative amphibian Wible, J. R. 2007. On the cranial osteology of the Lagomorpha. inventory. Proceedings of the National Academy of Sciences of the Bulletin of the Carnegie Museum of Natural History United States of America 206:8267–8272. 39:213–234. Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 Volleth, M., J. Loidl, F. Mayer, H.-S. Yong, S. Muller, and Wiley, E. O., and B. S. Lieberman. 2011. Phylogenetics: theory K.-G. Heller. 2015. Surprising genetic diversity in Rhinolophus and practice of phylogenetic systematics. 2nd ed. Wiley-Blackwell, luctus (Chiroptera: Rhinolophidae) from Peninsular Malaysia: de- Hoboken, New Jersey. scription of a new species based on genetic and morphological Winkler, A. J., and Y. Tomida. 2011. The lower third premolar characters. Acta Chiropterologica 17:1–20. of Serengetilagus praecapensis (Mammalia: Lagomorpha: Wheeler, Q. D., P. H. Raven, and E. O. Wilson. 2004. Taxonomy: Leporidae) from Laetoli, Tanzania. Pp. 55–66 in Paleontology impediment or expedient? Science 303:285. and geology of Laetoli: human evolution in context. Volume White, J. A. 1987. The Archaeolaginae (Mammalia, Lagomorpha) of 2: fossil hominins and the associated fauna (T. Harrison, ed.). North America, excluding Archaeolagus and Panolax. Journal of Springer, New York. Vertebrate Paleontology 7:425–450. White, J. A. 1991. North American Leporinae (Mammalia: Submitted 25 June 2018. Accepted 26 June 2019. Lagomorpha) from the Late Miocene (Clarendonian) to Latest Pliocene (Blancan). Journal of Vertebrate Paleontology 11:67–89. Associate Editor was Duke Rogers.

Appendix I Sample vouchers, GenBank accession numbers, and references for the sequences used in the supernetwork analysis.

Voucher/isolate Speciesa Cytb 12S References UFPE1740 Sbr MH115201 KU057257 Ruedas et al. (2017); Silva et al. (2019) M1380 Smn MH115202 MH115190 Silva et al. (2019) M1770 Smn MH115203 MH115191 Silva et al. (2019) M1778 Smn MH115204 MH115192 Silva et al. (2019) LG479 Smn MH115205 MH115193 Silva et al. (2019) DPV53580 Smn MH115206 MH115194 Silva et al. (2019) SP01 Smn MH115207 MH115195 Silva et al. (2019) RS01 Spa MH115208 MH115196 Silva et al. (2019) M1796 Ssp MH115209 MH115197 Silva et al. (2019) TOC013 Ssp MH115210 MH115198 Silva et al. (2019) MPEG45455 Ssp MH115211 MH115199 Silva et al. (2019) MPEG45456 Ssp MH115212 MH115200 Silva et al. (2019) Saq AY292726 AY292700 Matthee et al. (2004) Sau AY292722 AY292696 Matthee et al. 2004) Sf AY292724 AY292698 Matthee et al. 2004) Snt AY292723 AY292697 Matthee et al. 2004) Sob AY292725 AY292699 Matthee et al. 2004) Spl AY292727 AY292701 Matthee et al. 2004) Str AF034256 Snyder and Husband QCAZ 10893 San KU057258 Ruedas et al. (2017); Silva et al. (2019) UMMZ 77075 San MH460962 KU057259 This study; Ruedas et al. 2017) AK 11178 Sau KU057237 Ruedas et al. (2017) MVZ 206386 Sbc KU057239 Ruedas et al. (2017) MSB 40683 Sbc KU057238 Ruedas et al. (2017) ROM 105515 Sbr KU057236 Ruedas et al. (2017) MVZ 153492 Sbr KU057243 Ruedas et al. (2017) MN 24041 Sbr KU057254 Ruedas et al. (2017) MSB 55948 Sbr KU057240 Ruedas et al. (2017) TK 61307 Sbr KU057242 Ruedas et al. (2017) TTU 79706 Sbr KU057241 Ruedas et al. (2017) EPN 954419 Sbr KU057228 Ruedas et al. (2017) CR1hsr Sbr KU057219 Ruedas et al. (2017) CRIV1 Sbr KU057222 Ruedas et al. (2017) CRIV2 Sbr KU057223 Ruedas et al. (2017) CRIV4 Sbr KU057224 Ruedas et al. (2017) CRIV5 Sbr KU057225 Ruedas et al. (2017) CRIV6 Sbr KU057226 Ruedas et al. (2017) RUEDAS ET AL.—TAXONOMY OF SYLVILAGUS IN SOUTH AMERICA 1629

Appendix I Continued

Voucher/isolate Speciesa Cytb 12S References EM1556 Sbr KU057227 Ruedas et al. (2017) TTU 114374 Sdc KU057256 Ruedas et al. (2017) TK 147518 Sdc KU057251 Ruedas et al. (2017)

AK 11511 Sf KU057246 Ruedas et al. (2017) Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 MVZ 154373 Sf KU057231 Ruedas et al. (2017) ASNHC 2330 Sf KU057218 Ruedas et al. (2017) CR26gpv Sf KU057220 Ruedas et al. (2017) MSB 89673 Sf KU057244 Ruedas et al. (2017) hidra008 Sf KU057229 Ruedas et al. (2017) IIBT 349 Sf KU057253 Ruedas et al. (2017) NP 310 Sf KU057235 Ruedas et al. (2017) MSB 158806 Sgb KU057232 Ruedas et al. (2017) MSB 158807 Sgb KU057233 Ruedas et al. (2017) PSU 4944 Snt KU057255 Ruedas et al. (2017) AK 11516 Sob KU057248 Ruedas et al. (2017) AK 11529 Sob KU057247 Ruedas et al. (2017) PSU 4960 Spl KU057249 Ruedas et al. (2017) AK 11525 Str KU057250 Ruedas et al. (2017) a Key to species: San, Sylvilagus andinus; Saq, S. aquaticus; Sau, S. audubonii; Sbc, S. bachmani; Sbr, S. brasiliensis; Sdc, S. dicei; Sf, S. foridanus; Sgb, S. gabbi; Smn, S. minensis; Snt, S. nuttallii; Sob, S. obscurus; Spa, S. paraguensis; Spl, S. palustris; Srb, S. robustus; Ssp, Sylvilagus sp.; Str, S.transitionalis.

Appendix II [3,962 m], same coordinates: MNHUK 54.628, ♀ Ecuador: Pichincha (Oriente); Cerro Puntas, elev. 1,600 m, MNHUK 54.630, ♀ elev. 1,800 Specimens Examined m, MNHUK 54.629, ♀ Ecuador: Pichincha Prov.; near Nono, ca. 2,750 m, est. ca. 0°04′01″S, 78°34′36″W (WGS84), MNHUK 1934.9.10.222, ♀ Ecuador; Sinche, just N of Guabanda [= Guaranda], Sylvilagus andinus: Ecuador: Pichincha Prov.; Eastern Cordillera, W upper Rio Chimbo, W slope of Mt. Chimborazo, ca. 4,000 m, slope of Mt. Cayambe, 4,000 m, est. coordinates: 0°1′47.24″N, 1°28′30″S, 78°54′30″W (WGS84); MNHUK 1899.9.9.114, ♀ (holo- 78°01′26.89″W (WGS84); The Museum of Natural History, London type of S. andinus chimbanus Thomas, 1913), MNHUK 1899.9.9.112, (MNHUK) 1897.11.7.54, ♀ (holotype), MNHUK 1897.11.7.53, ♂ ♀ Ecuador; “Cañar, Andes of Ecuador” Alt. 2,600 m [8,530 ft]. Est. (topotype contemporary with holotype, but not a paratype). Ecuador: coordinates: ca. 2°31′22″S, 78°58′0″W (WGS84); MNHUK Bolívar Prov.; Telagua, MNHUK 1899.9.9.121, ♂ 1899.9.9.122, ♀ 1899.9.9.123, ♂ (holotype of S. andinus canarius Thomas, 1913). Ecuador: Chimborazo Prov.; Riobamba, ca. 2,800 m, est. coordinates: Sylvilagus apollinaris: Colombia, Bogotá, Choachi. Est. coordinates: 1°38′47″S, 78°38′56″W (WGS84), MNHUK 1899.9.9.115, ♂ 4°31′29.51″N, 73°55′32.61″W (WGS84), elev. ca. 1,966 m; MNHUK Ecuador: Chimborazo Prov.; Páramos East of Riobamba, ca. 4,000 m, 1919.10.15.2, sex unknown (holotype of S. apollinaris Thomas, 1920). est. coordinates: 1°40′07″S, 78°28′43″W (WGS84), MNHUK Sylvilagus brasiliensis: Brazil: state of Pernambuco, Municipality of 1899.9.9.117, ♂ Ecuador: Pichincha Prov.; Cayambe, near Cangagua, Paudalho, Mata da Privativa, forest fragment in the Centro de Instrução est. coordinates: 0°04′33.88″N, 78°05′37.32″W (WGS84), elev. ca. Marechal Newton Cavalcanti, 7°50′38.4″S, 35°6′7.3″W, elevation: ca. 3,525 m; University of Michigan Museum of Zoology (UMMZ) 137 m; Universidade Federal de Pernambuco (UFPE) 1740 (neotype 77072, ♀ 77073, ♂ 77075, ♂ 77076, ♀ 77077, ♀ 77078, ♂ 77079, ♂ of Sylvilagus brasiliensis). Brazil: Pernambuco, Municipality of Rio 77080, ♂ 77082, ♀ Ecuador: Imbabura; Rio Chota Valley, below Formoso, Estação Experimental Florestal de Saltinho (as of 1983: Pimampiro, San Nicolás, est. coordinates: 0°33′56.8″N, 77°56′9.61″W Reserva Biológica de Saltinho), coll. A. G. de Miranda Coelho, 5 (WGS84), elev. ca. 2,000 m; UMMZ 77061, ♀ (holotype of S. September 1974, est. coordinates: 8°43′14.7″S, 35°10′44.6″W brasiliensis chotanus Hershkovitz, 1938). Ecuador: Carchi Prov.; foot (WGS84), elev. 104 m; UFPE 427. Sylvilagus daulensis: Ecuador: of the páramos of Boliche, ca. 5 mi SW San Gabriél, Montúfar, est. Guayas Prov.; Daule, on Río Daule, coastal plain of W Ecuador, north coordinates: 0°25′13.61″N, 77°46′20.6″W (WGS84), elev. ca. 2,900 of Guayaquil; ca. 7 m, coordinates est. 1°53′0″S, 79°59′50″W m; UMMZ 77062, ♀ (holotype of S. b. carchensis Hershkovitz, 1938). (WGS84), American Museum of Natural History (AMNH) 34671, ♀ Ecuador: Napo Prov.; Pico Antisana, ca. 4,800 m, est. coordinates: ca. (holotype of S. daulensis J. A. Allen, 1914). Sylvilagus deflippi: 0°27′59″S, 78°08′26″W (WGS84); Museo Nacional de Ciencias Ecuador, between Quito and Baeza, MNCN 11393, sex unknown, Naturales, Madrid, Spain (MNCN), 11392, ♂ (contemporary topotype coll.: Marcos Jiménez de la Espada (no. 845), February 1865 (possible of S. a. nivicola Cabrera, 1913) [N.B.: this specimen was listed by topotype; see results). MNHUK specimens identifed as S. deflippi by Cabrera (1913) as MNCN no. 749, and its identity verifed by nature Oldfeld Thomas: Ecuador: Gualaquiza, elev. 2,500 ft (762 m), coordi- of having the same collection data (Marcos Jiménez de la Espada, col- nates on skin tag read “3°31′S, 78°27′W,” MNHUK 1914.4.25.77, ♂ lector number 10; coll. date “January 1865”)]. Additional near Peru: San Martín; Yuracyacu, elev. 817 m, ca. 5°55′50″S, 77°13′35″W topotypes of S. a. nivicola from the same mountain (Volcán Antisana) (WGS84), MNHUK 1927.1.1.148, ♂ 1927.1.1.150, ♂ 1927.1.1.151, but elevation listed as 18,000 ft [5,486 m] and coordinates as “78°W, ♀ 1927.1.1.153, ♀ Peru: Huanuco; Tingo María, elev. ca. 650 m, ca. 0.5°S”: MNHUK 54.625, ♂ elevation 12,500 ft [3,810 m], same coor- 9°17′45″S, 75°59′52″W (WGS84), MNHUK 1927.11.1.233, ♂ dinates: MNHUK 54.626, ♀ MNHUK 54.627, ♀ elevation 13,000 ft Sylvilagus gabbi: Costa Rica: Talamanca; locality restricted by 1630 JOURNAL OF MAMMALOGY

Hershkovitz (1950:352) to Talamanca, Sipurio, Río Sixaola, near the Cantón Paltas]; Guachanamá (Lawrence 1993:65 added “east of Caribbean Coast [Limón Prov.]; coordinates defned by Ruedas and Alamor and northeast of Celica”), 9,050 ft (2,758 m), coordinates, ca. Salazar-Bravo (2007:68) as 9°32′N, 82°55′00″W, 195 m a.s.l.; USNM 4°02′10″S, 79°53′03″W (WGS84); AMNH 60515 ♂ (holotype of S. 11371/37794, ♂ lectotype (Nelson 1909) of S. gabbi (J. A. Allen, kelloggi, Anthony 1923). Sylvilagus nicefori: Colombia: Antioquía; 1877). Costa Rica: [Limón]; Estella Valley [= Estrella Valley], Pandora Cordillera Central, San Pedro, 24 km N Medellín, elev. ca. 2,435 m, (ca. 9°44′10″N, 82°57′50″W, elev. ca. 21 m); USNM 28643, 28645, est. coordinates: 6°27′51″N, 75°33′22″W (WGS84); MNHUK Downloaded from https://academic.oup.com/jmammal/article-abstract/100/5/1599/5561556 by University of Michigan user on 20 December 2019 both ♀ Costa Rica: Limón; Olivia (ca. 9°36′50″N, 82°47′59″W, elev. 1921.7.1.26, ♂ (holotype of S. nicefori Thomas, 1921). Sylvilagus ca. 45 m); USNM 335490, ♀ 335491, ♀ 335492, ♂ Sylvilagus “ gabbi” salentus: Colombia: Caldas; Salento, at head of Río Quindio, W Mt. truei: Mexico: Veracruz; Hacienda El Mirador (ca. 19°12′47″N, Tolima, W Quindio Andes, 7,000 ft (2,135 m), est. 4°38′32″N, 96°52′51″W, 1,065 m); USNM 6357/34878, sex unknown (holotype 75°33′31″W (WGS84); AMNH 33050, ♂ (holotype of S. salentus J. of S. truei J. A. Allen, 1890b). Mexico: Veracruz; Motzorongo, 800 ft A. Allen, 1913). Sylvilagus sanctaemartae: Colombia: Magdalena; (244 m; ca. 18°38′33″N, 96°43′49″W); USNM 63661, ♂ Mexico: Southern Slope Sierra de Santa Marta, Colonia Agrícola de Veracruz; Otatítlan (ca. 18°10′38″N, 96°02′03″W, elev. ca. 23 m); Caracolicito, Río Ariguaní, 335 m (est. coordinates, Datum WGS84: USNM 65396, ♂ Mexico: Veracruz; Buena Vista (ca. 18°52′35″N, 10°46′2.25″N, 74°2′58.83″W): USNM 279993, ♀ (holotype of S. b. 96°54′23″W, elev. ca. 762 m); USNM 112787, ♂ Sylvilagus “ gabbi” sanctaemartae Hershkovitz, 1950). Colombia: Magdalena; Southern messorius: Panama: Darién; Cana, mountains of eastern Panamá, Slope Sierra de Santa Marta, Colonia Agrícola de Caracolicito, 400 1,800 ft (549 m), USNM 179579, ♀ (holotype of S. g. messorius m, USNM 279975, ♂ 279989, ♂ 279990, ♀ 279991, ♂ 279992, ♂ Goldman, 1912). Sylvilagus foridanus foridanus: Florida: [Brevard 279994, ♀ (all paratypes). Colombia: Magdalena; Distrito County]; San Sebastian River [near Micco] (ca. 27°50′47″N, Valledupar, Río Guaimaral, 140 m, USNM 279976, ♀ 279979, ♂ 80°31′49″W, elev. ca. 6 m); AMNH 1890/1155 [holotype of S. 279980, ♂ 279981, ♀ 279982, ♀ 279983, ♀ localities mapped in foridanus (J. A. Allen, 1890a)]. Florida: Brevard Co.; Micco, Oak Hershkovitz (1950: fgure 43, as localities 1 and 2). Colombia: Lodge [C. F. Latham residence, east Peninsula Barrier Island, opposite Bolívar; San Juan Nepomuceno (estimated geographic coordinates: Micco; see Baker (1889 [1890]); ca. 27°52′36″N, 80°27′36″W, elev. environs of 9°57′4″N, 74°4′46″W, ca. 172 m): FMNH 68937 ♀ ca. 1 m]; USNM 70870 ♀ Florida: Brevard Co.; Micco (ca. 27°52′30″N, Colombia: Córdoba; Catival, upper Rio San Jorge (possibly ca. 80°30′18″W, elev. ca. 6 m); USNM 76711, 77113, 77115, all ♂ 77114, 8°17′2″N, 75°41′0″W, ca. 60 m, based on Paynter 1997, who listed ♀ Florida: Seminole or Volusia Co.; Lake Harney (center of lake: ca. elevation of this site as 120 m): FMNH 68947 ♀ 68948 ♀ 68949 ♂ 28°45′19″N, 81°03′31″W, elev. ca. 1 m); USNM 78754, 78755, both 68950 ♀ 68951 ♂ 68952 ♂ 68953 ♀ Colombia: Córdoba; Socorré, ♂ 78756, 78757, 80334, 80335, all ♀ Sylvilagus fulvescens: Colombia: upper Rio Sinú (estimated geographic coordinates: environs of Cauca; Belén, W Popayán, near summit of Cordillera Occidental, just 7°51′3″N, 76°16′56″W, ca. 155 m; also fde Paynter 1997, who, how- N Cerro Munchique, elev. ca. 3,152 m, est. coordinates: ca. 2°31′06″N, ever, listed the elevation as 110 m): FMNH 68938, ♀ 68939, ♀ 76°57′22″W (WGS84); AMNH 32360, ♀ (holotype of S. fulvescens J. 68940, ♂ 68941, ♂ 68942, ♂ 68943, ♂ 68944, ♀ 68945, ♀ 68946, ♀ A. Allen, 1912). Sylvilagus incitatus: Panama: Bay of Panama; San 68954, ♀ FMNH specimens were examined, but not measured, for Miguel Island [= Isla del Rey, Archipiélago de las Perlas], est. this study. Sylvilagus surdaster: Ecuador: Esmeraldas Prov.; 8°27′26″N, 78°56′13″W, sea level; Museum of Comparative Zoology, Carondelet, Río Bogotá, elev.: ca. 20 m, est. coordinates: 1°07′27″N, Harvard University, Bangs Collection no. 8441, ♀ [holotype of S. 78°45′46″W (WGS84); MNHUK 1901.6.5.16, ♀ (holotype of S. incitatus (Bangs, 1901)]. Sylvilagus kelloggi: Ecuador: [Loja Prov.; surdaster Thomas, 1901b).