Oncogene (1997) 14, 2033 ± 2039  1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00

Identi®cation of Gas6 as a ligand for Mer, a neural cell adhesion molecule related receptor tyrosine kinase implicated in cellular transformation

Jian Chen, Kendall Carey and Paul J Godowski

Department of Molecular Biology, Genentech Inc, South San Francisco, California 94080, USA

Mer/Nyk/Eyk is an orphan receptor tyrosine kinase The mRNAs for Axl and Mer and Rse exhibit expressed at high levels in monocytes and cells derived distinct but overlapping patterns of expression and are from epithelial and reproductive tissues. Overexpression widely expressed in cells of the hematopoietic system. of Mer has been associated with lymphoid malignancies. Mer mRNA is detected in peripheral blood mono- Here we identify Gas6, the product of a growth arrest nuclear cells, bone marrow mononuclear cells and speci®c gene, as a ligand for Mer. Gas6 has previously monocytes, but not in granulocytes. Despite the fact been shown to activate both Axl and Rse/Tyro3, two that Mer mRNA is expressed in neoplastic B and T cell other receptor tyrosine kinases in the same family as lines, it is not detected in normal B or T lymphocytes Mer. The apparent relative association and dissociation (Graham et al., 1994). Like Mer, Axl is expressed in rate constants of Gas6 for soluble Axl, Rse/Tyro3 and monocytes but not in granulocytes or mature B or T Mer were compared using surface plasmon resonance. lymphocytes (Neubauer et al., 1995). Rse mRNA was Gas6 was shown to induce rapid phosphorylation of Mer detected in a megakaryocytic cell line (Mark et al., expressed in several di€erent types of cells. We also 1994). In normal human tissues, Rse mRNA is observed a transient activation of p42 MAP kinase expressed preferentially in the adult brain and at following activation of Mer by Gas6. Thus, Gas6 exerts lower levels in kidney, ovary, and testis (Mark et al., its biological e€ects through multiple receptor tyrosine 1994). Axl and Mer are also widely expressed, but the kinases. highest levels of Axl mRNA are found in the heart and skeletal muscle (Neubaure et al., 1995) while Mer Keywords: Gas6; Mer; Rse/Tyro3; Axl mRNA is expressed at highest levels in ovary, prostate, lung and kidney (Graham et al., 1994). The extracellular domains of the Rse/Axl/Mer family of receptors contain 28 ± 36% amino acid Introduction identity and are composed of two immunoglobulin (Ig) repeats followed by two membrane proximal Mer, Rse and Axl comprise a family of tyrosine kinase ®bronectin type three (Fn-III) repeats. This combina- receptors whose disregulated expression is associated tion of structural motifs within the extracellular with cellular transformation. For example, Mer was domains of Rse, Axl and Mer is similar to that cloned from a neoplastic B cell line and is expressed in observed in neural cell adhesion molecules (Brummen- numerous transformed T acute lymphocytic leukemia dorf and Rathjen, 1993; Rutishauser, 1993). cell lines (Graham et al., 1994). It was independently We have shown that Gas6 is a ligand for human Rse isolated as a tyrosine kinase potentially involved in the (Godowski et al., 1995). Gas6 binds directly to Rse, development of glioblastomas, and called Nyk (for and rapidly stimulates phosphorylation of the receptor NCAM-related tyrosine kinase; Ling and Kung, 1995). in a dose responsive fashion (Godowski et al., 1995; The transforming gene of the avian retrovirus RPL30, Mark et al., 1996). This work has been independently v-eyk, was derived from the chicken homologue of con®rmed by Ohashi et al. (1995). Interestingly, Mer, c-eyk (Jia and Hanafusa, 1994). Axl was isolated Varnum et al. (1995) identi®ed Gas6 as a ligand for from DNA of patients with chronic myelogenous human Axl. This work was con®rmed independently leukemia (O'Bryan et al., 1991) and chronic myelopro- (Stitt et al., 1995; Mark et al., 1996). liferative disorder (Janssen et al., 1991) using a Gas6 was initially identi®ed as a product of a gene transfection/tumorogenicity assay. Rse (Mark et al., whose expression is increased in ®broblasts upon 1994, also known as brt, sky, tyro3, etk2 and tif, growth arrest (Man®oletti et al., 1993). Gas6 contains Fujimoto and Yamamoto, 1994; Ohashi et al., 1994; 46% amino acid identity and a similar domain Lai and Lemke, 1994; Biesecker et al., 1995; Dai et al., organization with Protein S, an abundant serum 1994) and Axl, when overexpressed in ®broblasts and protein and a negative regulator of the coagulation certain hematopoietic cells induce cellular transforma- cascade (Dahlback et al., 1986). Although human tion (Taylor et al., 1995; O'Bryan et al., 1991; Protein S has been reported to activate murine Rse McCloskey et al., 1994). Rse mRNA and protein are (Stitt et al., 1995), it does not activate human Rse also overexpressed in mammary tumors derived from (Godowski et al., 1995; Ohashi et al., 1995; Mark et transgenic animals that overexpress either the wnt-1 or al., 1996). The amino-terminal Gla domain of Gas6 is fgf-3 oncogenes (Taylor et al., 1995). rich in g-carboxyglutamic acid (Gla) residues. Gla domains commonly serve to mediate the Ca2+ dependent binding of proteins to negatively charged Correspondence: PJ Godowski The ®rst two authors contributed equally to this work phospholipids present in cell membranes. A loop Received 15 November 1996; revised 8 January 1997; accepted 15 region and four EGF-like repeats follow the Gla January 1997 domain. The loop region of Protein S contains Gas6 is a ligand for Mer JChenet al 2034 thrombin-sensitive cleavage sites, although these are We then compared the ability of Axl-, Rse- and not conserved in Gas6. The C-terminal portions of Mer-Fc to bind directly to Gas6 using a coprecipitation Gas6 and Protein S are similar to the steroid hormone assay. We also determined if these receptors bound binding globulin (SHBG) protein (Gershagen et al., Protein S, which contains 46% amino acid identity 1987; Hammond et al., 1987) and contain tandem with Gas6. To allow a more quantitative comparison `globular' or G domains. G domains were initially of their binding properties, we utilized versions of Gas6 characterized in laminin A chain and are also present and Protein S that contained epitope tags (Godowski in numerous proteins involved in cell growth and et al., 1995). Conditioned media from cells expressing di€erentiation (reviewed by Joseph and Baker, 1992; tagged Gas6 or Protein S was incubated with each of Patthy and Nikolics, 1993). The G domains of Gas6 the receptor fusion proteins. The Fc fusion proteins, are sucient to bind with high anity to Rse and to and proteins bound to them, were recovered with Axl and can activate receptor phosphorylation with a protein A and washed extensively. Tagged proteins that speci®c activity similar to that of the full length bound to the Fc-fusion proteins were revealed by molecule (Mark et al., 1996). Western blotting and detection with an antibody In this report we characterize the interaction of directed against the epitope tag. As observed Mer with Gas6 and Protein S. Our results suggest previously, both Axl-Fc and Rse-Fc bound tagged that a single protein serves as a ligand for all three Gas6 but not Protein S (Figure 2). An identical result identi®ed members of the Rse/Axl/Mer receptor was observed with Mer-Fc. The binding was speci®c in family. We provide evidence that Gas6 induced that neither Gas6 nor Protein S bound the control activation of Mer results in activation of the MAP CD4-Fc. kinase pathway. Surface plasmon resonance was used to further characterize interactions of Mer with potential ligands. Mer-Fc was covalently coupled through amino groups to dextran immobilized on the gold surface of a Results biosensor chip. Potential ligands were injected over the chip, and their association and dissociation with Mer Comparison of Gas6 and protein S binding to the was measured by recording the changes in the extracellular domains of Mer refraction of polarized light and the angle of the We constructed, expressed and puri®ed a soluble form absorption maximum by the plasmon electrons of the of the extracellular domain of Mer (termed Mer-Fc). gold ®lm. A representative sensorgram from an Similar fusion proteins derived from the extracellular experiment in which two di€erent concentrations of domains of Rse (Rse-Fc) or Axl (Axl-Fc) have been Gas6 were passed over the chip is shown in Figure 3a. shown to bind with high anity to Gas6 (Godowski et As Gas6 was injected over the chip, association with al., 1995; Mark et al., 1996). As an initial test to Mer was measured as a gradual increase in the RU ascertain whether Mer bound Gas6, we compared the (resonance units) over time; following the injection, the ability of Mer-Fc and Rse-Fc to neutralize the Gas6 resonance slowly decreased as Gas6 dissociated from induced phosphorylation of Rse in an ELISA based Mer. In contrast, injection of Protein S resulted in a KIRA assay. Activation of Rse by Gas6 was blocked sample bulk e€ect, a sudden apparent increase in RU by Rse-Fc and Mer-Fc, but not by control Fc protein, at the beginning of the injection. After injection, the in a dose-responsive fashion (Figure 1). These data RU dropped immediately back to the baseline level, suggest that Mer-Fc, like Rse-Fc, competitively inhibits indicating that Protein S did not bind with a activation of Rse by binding to Gas6. We note that Rse-Fc was somewhat more potent than Mer-Fc in neutralizing Gas6. This result is consistent with the

di€erences in anity of these proteins for Gas6 as c described. Input Axl-Fc Mer-FC Rse-Fc CD4-Fc mRse-F

G PS G PS G PS G PS G PS PS KDa

106 — 80 —

Figure 2 Expression and binding of proteins to the extracellular domains of Mer, Axl and Rse. Conditioned media from cells expressing epitope tagged Gas6 (G) or Protein S (PS) were incubated with Axl-Fc, Rse-Fc, Mer-Fc or CD4-Fc, as indicated. Complexes were captured with protein A-sepharose and fractionated by SDS ± PAGE. Following Western transfer, Figure 1 Neutralization of Gas6 induced phosphorylation of Rse proteins were detected using the anti-gD antibody. The lane by receptor-Fc fusion proteins measured in a KIRA assay. The labeled `input' represents 20% of the material used in the binding percentage of Rse phosphorylation observed in CHO Rse.gD cells assay. In contrast to PS, the Gas6 derivatives were bound by Rse- treated with puri®ed Gas6 in the presence of the indicated Fc, Axl-Fc and Mer-Fc. As observed previously, the human concentrations of receptor fusion protein relative to that observed Protein S binds murine Rse-Fc (mRse-FC) (Godowski et al., in cells treated with Gas6 alone is shown 1995) Gas6 is a ligand for Mer JChenet al 2035

Figure 3 Kinetic analysis of ligand binding to Mer-Fc. Mer-Fc was coupled to the carboxymethylated dextran layer on the surface TM of a BIAcore biosensor chip. Puri®ed Gas6 (a, b and c) or Protein S (d) at a concentration of either 100 nM (broken line) or 140 nM (solid line) was injected over the surface of the chip at 160 s. At 340 s, the injector loop was switched to bu€er to follow dissociation. The binding of Gas6 to Mer-Fc on the chip was blocked by preincubation with soluble Mer-Fc (b) but not CD4-Fc (c). No binding of Protein S to Mer-Fc was observed (d)

measurable anity to Mer (Figure 3d) The binding of Table 1 Gas6 to the Mer-coated chip was inhibited by Equilibrium preincubation of Gas6 with soluble Mer-Fc, but not Association Dissociation dissociation constant (ka) constant (kd) constant (Kd) with the control CD4-Fc fusion protein (Figure 3b and ±1 ±1 4 ±1 ±4 ±9 Receptor-Fc (s M 610 )(s610 )(M610 ) 3c). The kinetics of binding of Gas6 to the extracellular Axl 16.8+0.3 2.7+0.1 1.6+0.3 Rse 6.7+0.5 2.4+1.2 3.6+1.3 domains of Mer, Axl and Rse were compared by Mer 6.1+0.6 5.9+1.7 9.7+1.8 surface plasmon resonance. In each case we observed a On-rates and o€-rates were determined as detailed in Materials and single class of binding sites for Gas6 with the receptor. methods. Data was evaluated using BIAevaluation 2.1 software The association rate of Gas6 with soluble Axl was (Pharmacia Biosensor) more rapid compared to those observed with either Rse or Mer (Table 1). While the dissociation rates of Gas6 from Axl and Rse were similar, Gas6 dissociated more rapidly from Mer. Consequently, the equilibrium 293 cells treated with an agonistic a-Rse antibody; in dissociation constant (KD) of Gas6 with Mer was this case, a 140 kDa protein that migrates with the size higher than that observed for either Axl or Rse. expected for Rse was phosphorylated on tyrosine. These results suggest that Mer is expressed as a 200 kDa protein in 293 cells and that the tyrosine Mer is phosphorylated in response to Gas6 and agonistic kinase domain is functional. antibodies We next compared the abilities of puri®ed human We used a polyclonal antibody developed against the Gas6 and Protein S to act as activating ligands for extracellular domain of Mer and ¯uorescence activated Mer. Consistent with the binding studies, incubation of cell sorting to demonstrate that human embryonic cells with Gas6 but not Protein S results in the kidney 293 cells express Mer (data not shown). phosphorylation of a 200 kDa protein that is Activation of the intrinsic kinase activity of a receptor immunoprecipitated with a-Mer antibody (Figure 4a). can often be achieved by incubation of intact cells with Because our a-Mer antibody reacted poorly with anti-receptor antibodies that promote receptor oligo- Mer on Western blots, we performed an additional merization. We took advantage of this fact to experiment to establish unequivocally that the 200 kDa characterize Mer in 293 cells. Following treatment of protein is Mer. We constructed and expressed a version intact cells with a-Mer antibody, we observed rapid of Mer, termed gD.Mer, which contains an amino phosphorylation of a protein which migrated with a terminal epitope tag. As shown previously for a molecular weight of approximately 200 kDa (Figure similarly tagged version of Rse (gD.Rse; Mark et al., 4a). The size of this protein is consistent with the 1994), incubation of 293.gD.Mer cells with an antibody observation that Mer contains a number of sites for N- speci®c for the epitope tag results in phosphorylation linked glycosylation, and is glycosylated (unpublished of a 200 kDa protein that was precipitated with observations). As a control, we showed that the antibodies to the epitope tage (Figure 4b). As 200 kDa protein did not become phosphorylated in observed with untagged Mer, gD.Mer was activated Gas6 is a ligand for Mer JChenet al 2036

a a 293.gD.Mer 293 -Mer

– 1 5 10 30 60 α

– -gD -HGF -Mer -Rse – -gD -HGF -Mer -Rse Gas6 PS α α α α Gas6 PS α α α α 206 — 206 — IP: α-Mer Blot: α-pTyr 116 — 116 —

b 293.gD.Mer 293

– -gD -HGF -Mer -Rse – -gD -HGF -Mer -Rse Gas6 PS α α α α Gas6 PS α α α α b 206 — – IP: α-Mer 5 50 250 500 1000 Blot: α-pTyr 116 —

206 — Figure 4 Characterization and regulation of Mer phosphoryla- tion in 293 or 293.gD.Mer cells. Cells were either unstimulated (7) or treated with Gas6, Protein S (PS), a monoclonal antibody that recognizes the epitope gD tag on the extracellular domain of gD.Mer (a-gD), a control antibody 4.5.9 speci®c for hepatocyte growth factor (a-HGF), or polyclonal antibody raised against 116 — Mer-Fc (a-Mer) or Rse-Fc (a-Rse). After 5 min, lysates were prepared and immunoprecipitated with a-Mer (a)ora-gD (b) antibodies. Precipitates were resolved by PAGE gel electrophor- esis and detected with anti-phosphotyrosine antibodies as detailed Figure 5 Time course (a) and dose response (b) of activation of in Materials and methods. Sizes of the molecular weight Mer by Gas6 in human monocytic U937 cells. In a, serum starved standards are indicated on the left (in kilodaltons). Control experiments showed that antibodies which bound to receptors on cells were left unstimulated (7) or treated for the indicated times cells and acted as agonists during cell stimulation remained bound (in min) with 1 mg/ml Gas6. In b, cells were treated with the to receptors after cell lysis, resulting in their immunoprecipitation. indicated concentrations (in nM) of Gas6 for 5 min. Western blots For example, the a-Rse antibody used to activate Rse expressed in of immunoprecipitates prepared with a-Mer polyclonal antibody were detected with anti-phosphotyrosine antibodies as described 293 cells was sucient for immunoprecipitation of the 140 kDa in Figure 4 legend Rse receptor in a and b. Similarly, the a-Mer and a-gD antibodies, agonists for Mer and/or gD.Mer also immunopreci- pitated these receptors

activation of the mitogen activated protein (MAP) kinase pathway. Therefore, we examined if Gas6 by Gas6 and a-Mer antibodies, but not by Protein S or treatment of serum starved 293 cells resulted in a-Rse antibodies. Taken together, these results estab- phosphorylation of MAP kinase. Whole cell extracts lish that Mer is expressed as a 200 kDa protein in 293 were prepared from Gas6 activated 293 cells and cells and that Gas6 induces phosphorylation of Mer in immunoblots were probed with antibodies speci®cally these cells. against tyrosine-phosphorylated forms of MAP kinase. Mer is highly expressed in cells derived from the p42MAPK and p44MAPK were seen to become monocyte cell lineage and Mer mRNA is detected in phosphorylated as early as 2 min post Gas6 stimula- the monocytic cell line U937 (Graham et al., 1994). We tion (Figure 6). The kinetics of activation of MAP con®rmed that U937 cells express Mer protein at their kinase correlates well with the rapid induction of surface by FACS analysis (data not shown). We phosphorylation of Mer following Gas6 treatment in further characterized the properties of Gas6 as a these cells. ligand for Mer in these cells. A time course experiment Gas6 activates both Rse and Mer in 293 cells. demonstrated that Mer is rapidly activated in these Thus, the activation of MAPK in these cells in cells (Figure 5a), with maximal phosphorylation response to Gas6 could be mediated by either Rse observed within 1 ± 10 min following addition of or Mer or a combination of these receptors. As a ®rst ligand. In a dose response experiment, phosphoryla- step in discerning the contributions of Mer to tion of Mer was detected at concentrations of Gas6 of activation of downstream signaling events, we exam- *5 ± 10 nM (Figure 5b). ined if activation of Mer by the a-Mer agonistic antibody also resulted in subsequent phosphorylation of MAP kinase. We observed that both p42MAPK Phosphorylation of MAP kinase in 293 cells in response and p44MAPK became phosphorylated within 2 min to Gas6 and a-Mer agonistic antibody following stimulation of Mer with antibody. These We examined the cellular events induced by treatment results further support a model where activation of of 293 cells with Gas6. Activation of receptor tyrosine Mer in 293 cells leads to downstream activation of the kinases is often associated with phosphorylation and MAP kinase pathway. Gas6 is a ligand for Mer JChenet al 2037 a a Time 0 2 5 15 30 60 Time 0 2 5 15 30 60

(min) (min)

¨ ¨

¨ p44MAPK-P ¨ p44MAPK-P p42MAPK-P p42MAPK-P

b b Time 0 2 5 15 30 60 Time 0 2 5 15 30 60

(min) (min)

¨ ¨ p42MAPK p42MAPK Figure 6 Phosphorylation of MAP kinase in response to Gas6 Figure 7 Phosphorylation of MAP kinase in response to treatment of 293 cells. In a, serum starved 293 cells were treated activation of Mer with agonistic antibody. 293 cells were treated for the indicated times with Gas6 as described in Figure 5. with a-Mer antibody for the times indicated, and then Western blots of whole cell lysates were probed with an antibody phosphorylated (a) and unphosphorylated (b) MAP kinase was speci®c for the tyrosine phosphorylated (a) or unphosphorylated analysed as described in Figure 6 (b) forms of MAP kinase

Discussion

These observations show that Gas6 is a functional the anity of neuregulins for erbB-3 and erbB-4 is ligand for Mer. Previous studies have demonstrated increased 4100-fold by heterodimerization of these that Gas6 is also a ligand for two other members of receptors with erbB-2. While there is no direct evidence this receptor tyrosine kinase family, Rse (Godowski et that Rse, Axl or Mer form heterodimers, the receptors al., 1995; Ohashi et al., 1995; Mark et al., 1996) and do exhibit overlapping patterns of expression. We Axl (Varnum et al., 1995; Stitt et al., 1995). In each detect expression of Rse and Axl in primary human case, Gas6 has been shown to bind directly to the Schwann cells (Li et al., 1996), and Rse and Mer are extracellular domains of the receptor in vitro and both expressed in 293 cells and U937 cells (Figures 4 stimulate phosphorylation of the receptors in vivo. The and 5). Gas6 treatment of 293 or U937 cells results in biological rationale for Gas6 serving as a ligand for phosphorylation of both Mer and Rse. Since it is not Rse, Axl and Mer is not yet clear but precedents for known if these receptors can heterodimerize, we do not this phenomenon exist. Vascular endothelial growth know if the phosphorylation we observe is due to factor (VEGF) is a ligand for at least two receptor trans- or autophosphorylation. Gas6 has been reported tyrosine kinases, Flt-1 and Flk-1. Both receptors are to block apoptosis induced by growth arrest in rat expressed in endothelial cells. The phenotypes of mice vascular smooth muscle cells (Nakano et al., 1996). containing targeted mutations in Flt-1 or Flk-1 are However, it was not determined if this function of di€erent, suggesting that the roles of these receptors Gas6 is mediated by Rse, Axl or Mer (or combinations are not redundant (Fong et al., 1995; Shalaby et al., of these receptors) since the receptor status of these 1995). The Eph related receptors consist of a large cells was not examined. As noted above, the expression family of tyrosine kinases. At least seven ligands have of Rse, Axl and Mer is often overlapping. This may been identi®ed for Eph-related receptors. These ligands present a mechanism to modulate both quantitatively exhibit promiscuity in that di€erent ligands often bind and qualitatively the range of biological responses to multiple members of the Eph receptor family. A set mediated by Gas6. of closely related proteins known as neuregulins act as Since the ligand for Mer had not previously been ligands for the erB gene family which includes the EGF reported, earlier studies of the signaling pathways receptor, erbB-2, erbB-3 and erbB-4. The physiological regulated by Mer have relied on the use of chimeric response of a particular cell to the neuregulins is receptors. For example, an arti®cial construct contain- governed by the complex interactions of di€erent erbB ing the ligand binding domain of the colony- family members expressed in that cell. For example, stimulating factor 1 receptor (Fms) and the Mer neuregulin does not bind erbB-2, but does bind erbB-3 intracellular domain was shown to activate MAP and erbB-4. However, erbB-2 can be activated by kinase in a CSF-1 dependent manner (Ling and neuregulins because it forms heterodimers with erbB-3 Kung, 1995). Zong et al. (1996) showed that the and erbB-4 (Sliwkowski et al., 1994; Riese et al., 1995). intracellular domain of the avian homologue of Mer, The anity of Gas6 for the puri®ed extracellular c-Eyk, stimulates the JAK-STAT pathway but not the domain of Mer-Fc was lower than that observed for Ras-MAP kinase or JNK pathways. In this latter case, Gas6 with Rse-Fc or Axl-Fc. Moreover, the anities the kinase domain of c-eyk was constitutively activated we (Table 1 and reefs 15 and 16) and others (17 ± 19) by construction of chimeric CD-8/c-eyk fusion gene. have reported for Gas6 for the extracellular domains of While chimeric receptors have been widely used to these receptors (Kd=1 ± 9 nM) are not as high as those study intracellular signaling events, there are examples observed for many other growth factor-receptor when the signaling response of the kinase domain is combinations. The anities we determined in vitro dramatically altered by the extracellular domain. For may di€er from those of Gas6 for Rse, Axl and Mer example, Fridell et al. (1996) demonstrated that a expressed on cell surfaces. It is worth noting that the chimeric receptor containing the extracellular domain binding anity of the neuregulins for either erbB-3 or of the EGF receptor and the kinase domain of Axl erbB-4 homodimers is similar to what we have reported activated MAP kinase in a ligand dependent fashion in for Gas6 with the Axl/Rse/Mer family. Interestingly, 32D cells. However, authentic Axl did not activate Gas6 is a ligand for Mer JChenet al 2038 MAP kinase in these cells in response to its cognate Recombinant human Gas6 and Protein S were expressed as ligand Gas6. The molecular mechanisms involved in described (Godowski et al., 1995). Expression was veri®ed by the di€erential activation of intracellular signaling metabolic labeling of cultures with [35S]cysteine and pathways by chimeric and natural Axl is not under- [35S]methionine (Mark et al., 1992) and/or by Western blotting stood. As suggested by Fridell (1996), the downstream with a rabbit polyclonal a-Gas6 antiserum or rabbit a-Protein S antiserum (Sigma). N-terminal gD-tagged versions of Protein signaling events initiated by the activation of the Axl S or Gas6 have been described previously (Mark et al., 1996). kinase domain may be a€ected if Axl can hetero- dimerize with other receptors. We observed that MAP kinase becomes phosphorylated in 293 cells by Phosphorylation assays treatment with Gas6. Both Mer and Rse are activated CHO.Rse.gD cells and methods to detect Rse phosphoryla- by Gas6 in 293 cells, and therefore these results do not tion using the ELISA based KIRA assay and by Western address the relative contributions of Rse or Mer to analysis using anti-phosphotyrosine antibodies have been downstream signaling. As a ®rst step in addressing this described (Godowski et al., 1995; Mark et al., 1996). For complicated question, we demonstrated that an neutralization experiments, potential ligand sources were agonistic antibody to Mer leads to phosphorylation treated at room temperature for 30 min with the indicated Fc fusion protein prior to addition to cells. To analyse the of MAPK with a time course that is similar to that ability of potential ligands to induce phosphorylation of observed for Gas6. These studies are consistent with receptors in 293 cells, 100 000 cells were seeded on a 60 mm the view that activation of Mer can lead to MAPK dish in the presence of serum for 16 h. The cells were then phosphorylation. However, our studies do not prove washed twice in PBS and serum-starved for 6 h. Potential that activation of Mer is sucient for this response. ligands were added to the cells and receptors were For example, if Rse and Mer form heterodimers, it immunoprecipitated from lysates, analysed by SDS ± PAGE remains possible that Rse might also be activated by under reducing conditions and blotted with anti-phospho- a-Mer antibodies. tyrosine antibody (4G10; Upstate Biotechnology Company) The observation that Gas6 is a ligand for Mer as described (Mark et al., 1994). For experiments involving should facilitate studies aimed at elucidating the U937 cells were starved for serum for 16 h and 2 000 000 cells were treated with Gas6 or polyclonal a-Mer antibody as intracellular signaling mechanisms activated by this indicated in the ®gure legend. Cell lysates were prepared and receptor and perhaps provide clues to the mechanism treated as described above. by which Mer induces transformation. MAP kinase was detected on Western blots of whole cell lysates using antibodies speci®c for tyrosine phosphorylated and unphosphorylated forms of MAP Kinase from New England Biolabs, and detected with a goat anti-rabbit HRP Materials and methods conjugated antibody (Sigma).

Construction and expression of recombinant proteins Binding assays A cDNA encoding human Mer was obtained by screening For binding to Rse-Fc, Axl-Fc, and Mer-Fc, conditioned a human testis cDNA library prepared in lambda DR2 media containing 300 nM Gas6 or Protein S were (Clontech, Palo Alto CA) with oligonucleotide probes 5'- precleared with protein A-sepharose (Sigma) for 30 min GAAA TTACAGATCCGCAG CCC CGGGATGGGGCC - at room temperature, then incubated with 5 mg of receptor- GGCCCCGCTGCCGCTGC, 5'-CCTTGGATTCTAGCA- Fc fusion protein for 4 h at 48C. Fusion proteins were AGCA CGACT GAAGG AG CCCCATCAGTAGCACCT - immunoprecipitated with 20 ml of protein A-sepharose and TT and 5'-TCTTAAAATTAAGCTTCAGCTGCTCCT- the complexes were collected by centrifugation at 14 000 g TGATATTAACCTTTGTACAGAGT-3'). Positive phage for 1 min, and then washed three times with PBS were puri®ed and insert sizes were determined. Fragments containing 0.1% Triton X-100. Precipitates were analysed from three overlapping clones, hMer.cl4, hMer.cl25, and by SDS ± PAGE under reducing conditions. Western blots hMer.cl6 (corresponding to nucleotides 1 ± 561, 223 ± 2025, oftheSDS±PAGEgelswereprobedwithantibody5B6as and 1902 ± 3608, respectively, of the sequence published by described (4). Graham et al., 1994) were combined to make a cDNA Protein interaction analyses using BIAcoreTM instruments encoding the entire open reading frame of human Mer. were performed with receptor-Fc proteins coupled to Mer-Fc was constructed by fusing the sequence encoding BIAcore CM5 sensor chips using puri®ed Gas6 and Protein amino acids 1 ± 498 of human Mer to amino acids 216 ± 443 S as described (Mark et al., 1996). For neutralization of human IgG g1 through a Narl ± BstEll linker (5'- experiments, 5 mg of either Mer-Fc or CD4-Fc was mixed CGCCTGGCAACGCG-3',5'-GTGACCGCGTTGCCAG-3') with Gas6 for 30 min at room temperature prior to injection (adding amino acids valine and threonine). Human of the mixture over the chip. Sensorgrams were analysed with embryonic kidney (HEK) 293 cells expressing Mer-Fc were BIAevaluation 2.1 software from Pharmacia Biosensor AB. screened using a human Fc-speci®c ELISA. Mer-Fc was Apparent dissociation rate constants (k ) and association rate puri®ed on a protein A-sepharose column (Pharmacia). d constants (ka) were obtained by evaluating the sensorgram Epitope tagged gD.Mer was constructed by fusing the with A+B=AB type I ®tting. The equilibrium dissociation coding sequences for amino acids 1 ± 53 of herpes simplex constant K was calculated as kd/ka. virus type 1 (HSV I) glycoprotein D (gD) to the sequences d encoding amino acids 36 ± 999 of human Mer. This contains the HSV-1 gD signal sequence as well as an epitope for monoclonal antibody 5B6 (Paborsky et al., 1990). Oligos (5'- Acknowledgements CGAATTCCTCGAGCCGGGACC TTTT CCA GGG AGC - We are extremely grateful to Melanie Mark, Glenn 3', and 5'-CCAACTGTGTGTTTGAAGGCAAGAGGCGG- Hammonds and Helga Raab for production and purifica- 3') were used to add a Xhol site to the human Mer cDNA by tion of Gas6, Rse-Fc and Axl-Fc. We thank Mike Sadick PCR. The gD-Mer cDNA was inserted into a CMV-based and Marcel Reichert for running the KIRA assays, and expression vector and HEK 293 cells were transfected, Greg Bennett for production and puri®cation of the a-Mer selected and screened by Western blotting and ¯uorescent polyclonal antibody. We also thank the Genentech DNA activated cell sorting as described (Mark et al., 1994). Synthesis Group for oligonucleotides. Gas6 is a ligand for Mer JChenet al 2039 References

Biesecker LG, Giannola DM and Emerson SG. (1995). McCloskey P, Pierce J, Koski RA, Varnum B and Liu ET. Oncogene, 10, 2239 ± 2242. (1994). Cell Growth and Di€., 5, 1105 ± 1117. Brummendorf T and Rathjen FG. (1993). J. Neurochem., 61, Nakano T, Kawamoto K, Higashino K and Arita H. (1996). 1207 ± 1219. FEBS Lett., 387, 78 ± 80. Dahlback B, Lundwall A and Sten¯o J. (1986). Proc. Natl. Neubauer A, Fiebeler A, Graham DK, O'Bryan JP, Schmidt Acad. Sci. USA, 83, 4199 ± 4203. CA,BarckowP,SerkeS,SiegertW,SnodgrassHR,Huhn Dai W, Hassanain H, Gupta SL and Murphy MJ. (1994). D and Liu ET. (1995). Blood, 84, 1931 ± 1941. Oncogene, 9, 975 ± 979. O'Bryan JP, Frye RA, Cogswell PC, Neubauer A, Kitch B, Fong G-H, Rossant J, Gertsenstein M and Breitmen M. Prokop C, Espinosa R III, Le-Beau MM, Earp HS and Liu (1995). Nature, 376, 66 ± 70. ET. (1991). Mol. Cell. Biol., 11, 5016 ± 5031. Fridell Y-WC, Jin Y, Quilliam LA, Burchert A, McCloskey Ohashi K, Mizuno K, Kuma K, Miyata T and Nakamura T. P, Spizz G, Varnum B, Der C and Liu ET. (1996). Mol. (1994). Oncogene, 9, 669 ± 705. Cell. Biol., 16, 135 ± 145. Ohashi K, Nagata K, Toshima J, Nakano T, Arita H, Tsuda Fujimoto J and Yamamoto T. (1994). Oncogene, 9, 693 ± 698. H, Suzuki K and Mizuno K. (1995). J. Biol. Chem., 270, Gershagen SP, Fernlund P and Lundwall A. (1987). FEBS 22681 ± 22684. Let., 220, 129 ± 135. Paborsky LR, Fendly BM, Fisher KL, Lawn RM, Marks BJ, Godowski PJ, Mark MR, Chen J, Sadick MR, Raab H and McCray G, Tate KM, Vehar GA and Gorman CM. Hammonds RG. (1995). Cell, 82, 355 ± 358. (1990). Prot. Eng., 3, 547 ± 553. Graham DK, Dawson TL, Mullaney DL, Snodgrass HR and Patthy L and Nikolics K. (1993). TINS, 16, 76 ± 81. Earp HS. (1994). Cell Growth Di€er., 5, 647 ± 657. Riese DJ, van Raaij TM, Plowman GD, Andrews GC and Hammond GL, Underhill DA, Smith CL, Goping IS, Harley Stern DF. (1995). Mol. Cell. Bio., 15, 5770 ± 5776. MJ, Musto NA, Cheng CY and Bardin CW. (1987). FEBS Rutishauser U. (1993). Current Opin. Neurobiol., 3, 709 ± Let., 215, 100 ± 104. 715. Janssen JWG, Schulz AS, Steenvoorden ACM, Schmidber- Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu ger M, Strehl S, Ambros PF and Bartram CR. (1991). X-F, Breitman ML and Schuh AC. (1995). Nature, 376, Oncogene, 6, 2113 ± 2120. 62 ± 66. Jia R and Hanafusa H. (1994). J. Biol. Chem., 269, 1839 ± Sliwkowski MX, Schaefer G and Akita RW. (1994). J. Biol. 1844. Chem., 20, 14661 ± 14665. Joseph DR and Baker ME. (1992). FASEB J., 6, 2477 ± 2481. Stitt TN, Conn G, Gore M, Lai C, Bruno J, Radziejewski C, Lai C and Lemke G. (1994). Oncogene, 9, 2567 ± 2578. Mattsson K, Fisher J, Gies DR, Jones PF, Masiakowski P, Li R-H, Chen J, Hammonds G, Phillips H, Armanini M, Ryan TE, Tobkes NJ, Chen DH, DeStefano PS, Long GL, Wood P, Bunge R, Godowski PJ, Sliwkowski MX and Basilico C, Goldfarb MP, Lemke G and Yancopoulos Mather JP. (1996). J. Neuroscience, 16, 2012 ± 2019. GD. (1995). Cell, 80, 661 ± 670. Ling L and Kung H-J. (1995). Mol. Cell. Biol., 15, 6582 ± Taylor IC, Roy S, Yaswen P, Stampfer MR and Varmus HE. 6592. (1995). J. Biol. Chem., 270, 6872 ± 6880. Man®oletti G, Brancolini C, Avanzi G and Schneider C. Varnum BC, Young C, Elliot G, Garcia A, Bartley TD, (1993). Mol. Cell. Biol., 13, 4976 ± 4985. Fridell Y-W, Hunt RW, Trail G, Clogston C, Toso RJ, Mark MR, Chen J, Hammonds RG, Sadick M and Yanagihara D, Bennett L, Sylber M, Merewether LA, Godowski PJ. (1996). J. Biol. Chem., 271, 9785 ± 9789. Tseng A, Escobar E, Liu ET and Yamano HK. (1995). Mark MR, Lokker NA, Zioncheck TR, Luis EA and Nature, 373, 623 ± 626. Godowski PJ. (1992). J. Biol. Chem., 267, 26166 ± 26171. Zong C, Yan R, August A, Darnell Jr JE and Hanafusa H. MarkMR,ScaddenDT,WangZ,GuQ,GoddardAand (1996). EMBO J., 15, 4515 ± 4525. Godowski PJ. (1994). J. Biol. Chem., 269, 10720 ± 10728.