Thermococcus Litorali$, Vent DNA Polymerase During DNA Amplification in Vitro

Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Predominant Mutations Induced by the Thermococcus litorali$, Vent DNA Polymerase during DNA Amplification In Vitro

Phouthone Keohavong, 1 Lucy Ling, Cremilda Dias, and William G. Thilly

Center for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139; 1Department of Environmental and Occupational Health, Graduate School of Public Health, University of Pittsburgh, Pittsburgh, Pennsylvania 15238

We have analyzed the predominant this DNA template under the in vitro polymerases. Recently, we have shown mutations created during DNA am- reaction conditions studied. This pre- that the DNA polymerase of Thermococ- plification by PCR utilizing a DNA dominance of A/T to G/C transition is cus litoralis, Vent, had the useful advan- polymerase isolated from the Ther- also a characteristic of the Taq DNA tages of both thermostability and in- mococcus litorolis (Vent DNA poly- polymerase, although the positions creased fidelity relative to the more merase). Exon 3 of the human hypox- of most errors induced by both en- widely used Taq DNA polymerase de- anthine guanine phosphoribosyl zymes are not identical. rived from Thermus acquaticus. (z) transferase (HPRT) gene was ampli- In this paper we report and discuss fied using conditions optimized for the results of our comparative study of efficiency of DNA amplification. The the fidelity and the kinds of predomi- resulting PCR product was subjected The value of PCR r in the study of nant mutations between Vent DNA poly- to denaturing gradient gel electro- rare mutational events in cell population merase and a Vent deficient in the proof- phoresis (DGGE) to separate poly- or tissue is limited by the infidelity of reading 3' --~ 5' exonuclease activity. (1~ merase-induced mutant sequences DNA polymerases/4-7~ By separation of from correctly amplified sequences. the PCR products by denaturing gradient MATERIALS AND METHODS The nature of induced mutaUons was gel electrophoresis (DGGE), ~8) we have determined by isolating and sequenc- been able to characterize the fidelity of Materials ing the mutant sequences from the several DNA polymerases and associated Vent DNA polymerase isolated from gel. Eighteen predominant muta- reaction conditions during the amplifi- Thermococcus litoralis, designated Vent tions were found in the 104-bp low cation of the exon 3 of the human hy- (wt) in this study, and Vent deficient in temperature melting domain of exon poxanthine phosphoribosyl transferase 3'--~ 5' exonuclease activity, designated 3 and consisted of 16 A/T to G/C tran- (HPRT) gene. (9) This approach has the Vent (exo-), was from New England Bi- sitions, a G/C to T/A transversion and value of presenting varied local DNA olabs. Taq DNA polymerase was pur- a complex 4-bp deletion. Thus, the contexts yielding an estimate of fidelity chased from Perkin Elmer-Cetus (Nor- Vent exonuclease proofreading activ- averaged over the entire sequence inves- walk, Connecticut). ity seems to affect all misincorpora- tigated. Furthermore, DGGE allows iso- The 2'-deoxynucleoside-5'-triphos- tion events with apparently equal lation of individual "hotspot" mutants phates were purchased as 100-1XM solu- probability (i.e., by a factor of five). so that the specific kinds of errors and t-ions from Pharmacia (Piscataway, N]). The comparison of the error rates be- their local sequence contexts can be de- The oligonucleotides (Synthetic Genetic, tween analogues of Vent DNA poly- termined. This information allows users CA) used as primers for PCR were P1, 5'- merase proficient and deficient in of particular DNA polymerases in PCR to CATATATTAAATATACTCAC-3'; P2, 5'- the proofreading 3' -~ $' exonu- consider the probability that an isolated TCCTGATITI'ATTTCTGTAG-3'; P3, 5'- clease activity indicates that the lack mutant sequence could have arisen from GACTGACGTCTTGCTCGAG-3'. of proofreading resulting in an ap- the PCR process, rather than having proximate five-fold increase in in- been present in the sample studied. Such Procedures duced error rate. However, the simi- knowledge may also contribute to the larity of the patterns of the mutant understanding of the basic mechanisms To obtain radioactive DNA, PCR was car- sequences observed in DGGE sug- of the DNA polymerization process. In ried out with 5'-end-labeled primers gested that both enzymes created previous work, we reported the predom- (150 Ci/mmole) using [-r (7000 predominantly the same kinds of mu- inant errors for bacteriophage T4, mod- Ci/mmole), T4 polynucleotide kinase, tations and at the same positions in ified T7, Klenow fragment, and Taq DNA and the reagents in the 5'-end DNA ter-

288 PCR Methods and Applications 2:288-2929 by Cold Spring Harbor Laboratory ISSN 1054-9803/93 $3.00 Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

minus labeling system (Bethesda Re- DGGE Analysis and DNA Sequence tion conditions for the three DNA poly- search Laboratories, Gaithersburg, MD). Determination merases. After 10-, 10 4-, and 107-fold The DNA template used in this study amplification by each enzyme, the re- The conditions for DGGE analysis, for was a 224-bp fragment containing the sulting 204-bp DNA was purified from isolation and characterization of individ- wild-type 184-bp exon 3 of the human each reaction mixture, and an equal ual mutant sequences have already been HPRT gene surrounded at both ends by a amount of radioactivity from each sam- described. (0'13) In summary, the 204-bp 20-bp fragment from flanking intron se- ple was boiled and reannealed, and ana- radioactive DNA was PAGE-purified from quences. (9) The target fragment was pre- lyzed by DGGE. As shown in Figure 1, each reaction mixture, and the total pared by an initial PCR amplification each amplified DNA revealed a specific amount of radioactivity incorporated from genomic DNA isolated from hu- pattern of mutant/wild-type heterodu- was determined by scintillation count- man lymphoblastoid cells, line TK6 (1~) plexes separated in lower denaturant ing. DNA from each sample was boiled using primers P1 and P2, and Vent (wt) concentrations of the gel from the excess and reannealed so that each strand of DNA polymerase. The resulting 224-bp of wild-type homoduplex. These data the mutant homoduplexes hybridized fragment was boiled and reannealed and showed that for Vent (exo-) and Taq with the complementary strand from the migrated through a denaturing gradient DNA polymerases, the patterns of mu- correctly amplified DNA or wild type gel to separate the polymerase-induced tant sequences constantly remain iden- present in excess. The DNA was then sep- mutant sequences from the wild-type tical after an exponential 10-, 10 4-, and arated through a denaturing gradient gel homoduplex. The wild-type homodu- 107-fold amplification. For Vent (wt), in which the excess of wild-type homo- plex DNA was isolated from the gel, and however, an intense triplet appeared af- duplex focused as a single band while the number of molecules was deter- ter a 107-fold amplification in one of the the less stable mutant/wild-type hetero- mined by polyacrylamide gel electro- three experiments performed, indicative duplexes focused between the wild-type phoresis (PAGE) analysis against known of allelic preference in the amplification homoduplex and the top of the gel as amounts of markers and standard of this sequence. (~ patterns of discrete bands (see Fig. 1, be- DNA. (12) To analyze the fidelity of DNA The amount of radioactivity in the low). amplification, this wild-type 224-bp frag- heteroduplex region (between the wild To determine the kind of each muta- ment was used as a template for further type and the top of the gel) and that of tion, each visible mutant/wild-type het- amplification using 5'-end-labeled prim- wild-type homoduplex were recorded us- eroduplex band was isolated from the ers P1 + P3. The resulting 204 bp was gel ing a PhosphorImager. The background gel. The DNA was eluted from each gel purified from the reaction mixture and noise, due to nonspecific DNA binding portion, further amplified, and directly analyzed by DGGE under mutant/wild- in the gel, or depurination occurring analyzed by a second DGGE. If a band type heteroduplex conditions. (9) during DNA handling, was measured isolated from the first denaturing gradi- The conditions for DNA amplification from the control lanes loaded with only ent gel originally contained only one were optimized for fidelity as de- DGGE-purified wild-type DNA homodu- mutant/wild-type heteroduplex, then scribed. ~ In this study both the mix- plex sequences that had been subjected two major bands would be observed in ture and reaction conditions were iden- to the identical treatment of boiling, re- the second denaturing gradient gel cor- tical for Vent (wt), Vent (exo-), and Taq annealing, and ethanol precipitation responding to one mutant and one wild- DNA polymerases. Each 100-~1 reaction and run in the same gels as the experi- type homoduplex. If a band originally mixture contained 20 mM Tris (pH 8.5) at mental samples. The heteroduplex frac- contained two or more mutant/wild- 25~ 10 mM KCI, 10 mM (NH4)2SO4, tion (HeF), due to polymerase amplifica- type heteroduplexes, then two or more 0.1% Triton X-100, 7.5 mM MgSO4, 0.5 tion, was calculated as: HeF = (Total mutant homoduplex bands would be de- mM each dNTP, 10 i~g of BSA, 1 I~M each heteroduplex counts - background het- tected in addition to the wild-type ho- primer, and 4 units of each DNA poly- eroduplex counts)/total counts. The er- moduplex band. The mutant homodu- merase. Each cycle of the PCR reactions ror rates (f) can then be calculated using plexes were isolated from the gels and consisted of I min at 94~ for DNA tem- the following equation: f = HeF/b x d; sequenced to determine the kinds and plate denaturation, 2 min at 53~ for where b represents the 104 bases of the position of the mutations. (9'~3) template--primer hybridization, and 2 low temperature melting domain of The conditions for DNA sequencing min at 72~ for DNA polymerization. To exon 3, and d is the number of DNA dou- were improved from those described by analyze the PCR product by DGGE at 10- blings (d is 23 doublings for 107-fold am- Keohavong and Thilly(9) by omitting 10 4- and 107-fold amplification, each plification). NaC1 from both the 16-~1 reaction mix- DNA polymerase was allowed to carry The estimated mean error rate f, error ture and from each of the four termina- out the amplification from 101~, l0 s, per base doubling, was 5.3 x 10 -s for tion mixtures. and l0 s copies of the 244-bp fragment, Vent, 2.7 x 10 -4 for Vent (exo-) and respectively, to produce a total 1012 cop- 1.3 x 10 -4 for Taq DNA polymerases for ies of the 204-bp fragment. To achieve a RESULTS 107 -fold amplification. The error rate at 10-, 104-, and 10 7 -fold amplification, 23 doublings of amplification of Comparison of the Patterns of Vent (wt) and Taq, which had both an 5.3 x 10 -s for Vent (wt) is comparable Mutant/Wild-type Heteroduplexes efficiency of amplification of 77%, re- to the previously reported 5.5 x 10-s by among Vent (wt), Vent (exo-), and quired 4, 16, and 28 PCR cycles, respec- Ling et al., (12) and 2.2 x 10 -s by Cariello Taq DNA Polymerases tively, whereas Vent (exo-) with an effi- et al., C14) using the same approach and ciency of 85%, required 4, 15, and 26 DNA amplifications were carried out un- the same DNA template, and 3.0 x 10-s PCR cycles, respectively. der identical reaction mixture and reac- for this enzyme using the single round

PCR Methods and Applications 289 Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

previously for Taq within this same target sequence) 9~ In this study we determined the kinds and positions of hotspot mutations induced by Vent (wt) DNA polymerase. All discrete bands created by Vent (wt) (see Fig. 1) were ex- cised from the gel, the DNA was eluted from each gel slice, further amplified, and subsequently characterized by a second DGGE as described in Materials and Methods. After characterization, a total of 18 different hotspot mutant sequences were identified by DGGE for Vent DNA polymerase. Figure 2 shows for each of the 18 mutant alleles (mutants a-r) the positions of the mutant homoduplex (indicated by an arrow) and those of the two respective mutant/ wild-type heteroduplexes relative to the position of the wild-type homoduplex (wt). Sequencing analysis of the mutant homoduplexes revealed that they consisted of 16 AdT to G/C transitions, one G/C to T/A transversion, and one complex 4-bp deletion in which the last l0 bp at the 3' end of exon 3, 5'-GAGCTAT- TGT-3', was replaced by a 6-bp sequence, 5'-CGTCTT-3', resulting in a 4-bp deletion (see Fig. 3).

FIGURE 1 Analysis by DGGE of the PCR products after 10-, 104-, and 107-fold amplification using the DNA polymerases indicated. To compare the fidelity of DNA amplification, the DGGE- DISCUSSION purified 224-bp fragment containing wild-type exon 3 of the human HPRT gene (see Materials The thermostable Vent DNA polymerase and Methods) was used as template for PCR. Copies of this fragment (10 ~, l08, and 105) were induced predominantly A/T to G/C tran- amplified an additional 10-, 104-, and 107-fold (indicated at the top of each lane), respectively, using the same reaction mixture containing 32p-5'-end-labeled primers P1 + P3, the same reac- sitions in the low temperature melting tion conditions, the DNA polymerases indicated, and the numbers of PCR cycles indicated in domain of exon 3 of the human HPRT Materials and Methods. The amount of desired increase in DNA amplification was controlled by gene and under the reaction conditions polyacrylamide gel analyzing an aliquot of each reaction mixture against known amount of DNA given in Materials and Methods. The markers and by counting the amount of radioactivity incorporated in each sample. The resulting same kinds of predominant mutations radioactive 204-bp fragment was gel-purified from each mixture and 5 • 104 cpm aliquots were have also been found for Taq DNA poly- boiled and reannealed, and separated as heteroduplexes on a 12.5% polyacrylamide gel contain- merase within this same DNA se- ing 16% to 30% denaturant gradient (top to bottom). (Wt) The position of the wild-type homo- quence ~9~ and other templates) 2'1s) Fur- duplex. thermore, 5 of the 16 A,rF to G/C transitions induced by Vent DNA polymerase (mutations b, e, i, m, and p) were of DNA synthesis and the phage merases in Figure 1 showed that Vent identical to those found for Taq DNA M13mp2. ~1~ The difference may be at- (wt) and Vent (exo-) created identical polymerase in our previous study r con- tributed to the slight variations in the patterns of mutant sequences indicating sistent with the observation in Figure 1 composition of the reaction mixtures that they induced predominantly the that the two enzymes appeared to share used in each study. ~1~ same kinds of mutations at the same po- several common bands in their patterns sitions within the template used. Several of mutant/wild-type heteroduplexes. On of the mutant bands produced by Taq the basis of exact correspondence be- Analysis of Predominant Mutations DNA polymerase appeared to focus at tween the patterns of hotspot mutant For each enzyme, the patterns of mu- the same positions as those seen with bands (Fig. 1) we conclude that predom- tant/wild-type heteroduplexes observed Vent (wt) or Vent (exo-). This suggested inantly the same mutations were in- remained identical during the course of that the three enzymes created some duced by Vent (exo-) in this study. Hot- amplification from 10-, 104- , and 107- common mutations with regard to the spot mutant sequences induced by Vent fold, with one exception for Vent (wt), kinds and positions in the template stud- (exo-) were not determined by sequenc- which revealed an intense mutant band ied and under the reaction conditions ing. The origin or the mechanisms of after a 107-fold amplification (see Fig. 1). used. mutagenesis by these DNA polymerases Comparison among the three DNA poly- Hotspot mutations have determined leading to the predominant formation of

290 PCR Methods and Applications Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

abcde fghi j klmnopqr cation with an efficiency significantly higher than that of the wild type or those of other mutant alleles [See Fig. 1, lane labeled 107-fold amplification for Vent (wt)]. We have named this phenomenon "allelic preference" in DNA amplification.(9) In both cases, however, this phenomenon occurred in only one out of the three independent experiments performed and at a high number of amplification cycles. The occurrence Wt in one of the three trials suggests that the mutation itself arises at very low fre- quency. Our comparative study of Vent (wt) and Vent (exo-) shows that the deft- FIGURE 2 Analysis by DGGE of individual mutant sequences produced by Vent (wt) DNA poly- ciency of the proofreading 3'--* 5' exo- merase. Discrete mutant/wild-type heteroduplex bands in lane 107 -fold amplification with Vent nuclease activity in Vent (exo-) poly- (wt), as shown in Fig. 1, were isolated from the gel, further amplified, characterized by a second merase resulted in a five-fold decrease in DGGE, and the kinds and positions of the mutations identified as described in Materials and fidelity. This is in agreement with the Methods. From each of the 18 different mutant homoduplexes identified, 2 x 103 cpm equiva- error rate reported for this enzyme using lent were boiled and reannealed with wild-type DNA to partially generate mutant/wild-type heteroduplexes and analyzed by the same type of DGGE as in Fig. 1. Shown are the position of a single round DNA synthesis using the the wild-type homoduplex (Wt), those of each mutant homoduplex (indicated by an arrow), and phage M13mp2. (t~ Furthermore, the those of the two respective mutant/wild-type heteroduplexes distributed between the wild type identity of the mutational spectra pro- and the top of the gel. For mutant r, the two respective mutant/wild-type heteroduplexes were duced by both enzymes (see Fig. 1) ap- unseparated and focused at the same position of the gel. pears to indicate that the 3' ---> 5' exonuclease activity in Vent proofreads all misincorporation events with the same efficiency. These observations may be of base-pair substitutions and especially the by a guanine. Either -AG- or - GA- importance in considering the molecu- A/T to G/C transitions are unclear. It is was converted to - GG- in mutant alle- lar mechanisms of proofreading. How- unlikely to be the result of DNA damage les. This may indicate an important role ever, it is important to point out here during DNA denaturation at high tem- of neighboring base or template se- that all such observations may critically perature such as deamination of cy- quence in the induction of hotspot mu- depend on the reaction conditions and tosine to produce uracil or the spontane- tation by Vent (wt) DNA polymerase. the DNA template used. ous base hydrolysis leading to apurinic The 4-bp deletion (mutation r, Fig. 3) or apyrimidic sites, as these types of corresponded to the replacement of the damage would have led to a C/G to T/A 10-bp sequence S'-GAGCTATTGT-3' (po- ACKNOWLEDGMENTS transitions. (ls'16) Rather, this kind of sitions 394--403) immediately adjacent This work was supported by grants from mutation may have resulted from the ex- to the 3' end of primer P1 by a new 6-bp the U.S. National Institute of Environ- tension of base-mispairing T-G (or A-C) sequence 5'-CGTCTT-3'. This mutation mental Health Sciences (P42-ES04675, leading to the formation of A/T to G/C had also been found to be produced by PO1-ES00597, PS0-ES03926-05) and the transitions. (ts'17) Furthermore, our Klenow fragment of the DNA PolI after a Office of Health and Environmental Re- 108-fold amplification in our previous present results show (Fig. 3) that 12 of search, U.S. Department of Energy (DE- the 16 AfI" to G/C transitions occurred at study. ~9) In both cases, this mutation ap- FG02-86-ER60448). the level of an adenine flanked 3' or 5' peared to have resulted from an amplifi-

REFERENCES

G G C G ~-" G G 1. Mullis, K.B. and F.A. Faloona. 1987. Spe- ! i ! 1 I I ! cific synthesis of DNA in vitro via a poly- TTACATCAAAGCACTGAATAGAAATAGTGATAGATCCATTCCTATGACTGTA }A 7':'TTATCA 3ACTGAAGAGCTATTGT 3 ' merase-catalyzed chain reaction Methods ..... + ...... + ...... + ...... + ...... + ...... , ...... ~ ...... +___ Enzymol. 155: 335-350. AATGTAGTTTCGTGACTTATCTTTATCACTATCTAGGTAAGGATAC~T.~L~,CAI YIAAAA". A(]T<'T L~.('TT(~TC~GATAACA 5 ' 2. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, . C O . G ,f C O O and H.A. Erlich. 1988. Primer-directed en- zymatic amplification of DNA with a ther- ab c d ef g hi j k I m n up q r mostable DNA polymerase. Science 239: FIGURE 3 Summary of the kinds and positions of the mutations induced by Vent (wt) DNA 487-491. polymerase in the low temperature melting domain of exon 3. The 18 predominant mutations 3. Kleppe, K., E. Ohtsuka, R. Kleppe, I. Mo- found (designated a-r) were located between base-pair position 325 and 3' end of exon 3 at lineux, and H.G. Khorona. 1971. Studies position 403. The last 10-bp sequence at the 3' end of exon 3 involving the complex 4-bp deletion on polynucleotides. XCVI. Repair replica- that resulted in mutation r is underscored by a broken line. tions of short synthetic DNAs as cata-

PCR Methods and Applications 29! Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

lyzed by DNA polymerase. L Mol. Biol. chain reaction. PCR Methods Applic. 1:17- 56: 341-361. 24. 4. Muzyczka, N., R.L. Poland, and M.J. Bess- 17. Loeb, L.A. and B.P. Preston. 1986. Mu- man. 1972. Studies on the biochemical tagenesis by apurinic/apyrimidic sites. basis of spontaneous mutations. A com- Annu. Rev. Genet. 20: 201-230. parison of the deoxyribonucleic acid polymerases of mutator, antimutator, and wild type strains of bacteriophage T4 ]. Received November 19, 1992; accepted in Biol. Chem. 247: 7115-7142. revised form on January I 1, 1993. 5. Goodman, M.F., W.C. Gore, N. Muzyczka, and M.J. Bessman. 1974. Studies on the biochemical basis of spontaneous mutation. Rate model for DNA polymerase-ef- fected nucleotide misincorporation. ]. Mol. Biol. 88: 423-435. 6. Loeb, L.A. and T.A. Kunkel. 1982. Fidelity of DNA synthesis. Annu. Rev. Biochem. 52: 429-457. 7. Kunkel, T.A., L.A. Loeb, and M.F. Good- man. 1984. On the fidelity of DNA repli- cation, fi Biol. Chem. 259: 1539-1545. 8. Fischer, S.G. and L.S. Lerman. 1983. DNA fragments differing by single base-pair substitutions separated in denaturing gradient gel: correspondence with melting theory. Proc. Natl. Acad. Sci. 80: 1579- 1583. 9. Keohavong, P. and W.G. Thilly. 1989. Fi- delity of DNA polymerases in DNA amplification. Proc. Natl. Acad. Sci. 86: 9253- 9257. 10. Mattila, P., J. Ronka, T. Tenkanen, and K. Pitkanen. 1991. Fidelity of DNA synthesis by the thermococcus litoralis DNA polymerase, an extremely heat stable enzyme with proofreading activity. Nucleic Acids Res. 19: 4967-4976. 11. Skopek, T.R., H.L. Liber, P.W. Penman, and W.G. Thilly. 1978. Isolation of human lymphoblastoid line heterozygous at the thymidine kinase locus: Possibility for a rapid human cell mutation assay. Bio- chem. Biophys. Res. Commun. 84: 411-416. 12. Ling, L., P. Keohavong, C. Dias, and W.G. Thilly. 1991. Optimization of the polymerase chain reaction with regard to fidelity: Modified T7, Taq, and Vent DNA polymerase. PCR Methods Applic. l: 67-93. 13. Keohavong, P., V.F. Liu, and W.G. Thilly. 1991. Analysis of point mutations induced by ultraviolet light in human cells. Mut. Res. 249: 147-159. 14. Cariello, N.F., T.A. Swenberg, and T.R. Skopek. 1991. Fidelity of the Thermococ- cus litoralis DNA polymerase (Vent) in polymerase chain reaction determined by denaturing gradient gel electrophoresis. Nucleic Acids Res. 19: 4193-4198. 15. Eckert, K.A. and T.A. Kunkel. 1991a. The fidelity of DNA polymerases used in the PCR. In Polymerase chain reaction I: A prac- tical approach (ed. M.J. McPherson, P. Quirke, and G.R. Taylor). IRL Press, Ox- ford University Press, Oxford. 16. Eckert, K.A. and T.A. Kunkel. 1991b. DNA polymerase fidelity and the polymerase

292 PCR Methods and Applications Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Predominant mutations induced by the Thermococcus litoralis, vent DNA polymerase during DNA amplification in vitro.

P Keohavong, L Ling, C Dias, et al.

Genome Res. 1993 2: 288-292 Access the most recent version at doi:10.1101/gr.2.4.288

References This article cites 16 articles, 4 of which can be accessed free at: http://genome.cshlp.org/content/2/4/288.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions