The Effects of the Novel Reproductive Peptide Phoenixin-20 Amide on GnRH and Kisspeptin Hypothalamic Cell Models
by
Alice K. Treen
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Physiology University of Toronto
© Copyright by Alice Treen 2014
The Effects of the Novel Reproductive Peptide Phoenixin-20 Amide on GnRH and Kisspeptin Hypothalamic Cell Models
Alice K. Treen Master of Science Department of Physiology University of Toronto
2014
Abstract
Reproductive function is coordinated by the actions of specific neuropeptides and hormones, which converge on GnRH neurons in the hypothalamus. Phoenixin-20 amide
(PNX-20) is a recently described peptide that increases GnRH-stimulated LH secretion and upregulates GnRH receptor mRNA in the anterior pituitary. However, to date no studies have looked at the role of PNX-20 in the hypothalamus, where it is most highly expressed. Using cell lines representative of GnRH and kisspeptin neurons, the effects of
PNX-20 in the hypothalamic cells were explored. PNX-20 increases GnRH mRNA expression, protein levels and secretion in a GnRH cell model and Kiss-1 mRNA in anteroventral periventricular and arcuate nuclei kisspeptin cell models. PNX-20 also activates the adenylyl cyclase and MAPK pathways. Furthermore, we report that kisspeptin increases gene expression of the PNX precursor protein, SMIM20. These results indicate that PNX-20 may be involved in the regulation of reproduction at the level of the hypothalamus.
ii Acknowledgements
I would like to thank my supervisor Dr. Denise Belsham for welcoming me to her lab and providing continuous support and guidance over the past two years. She has been an excellent role model and taught me about the importance of hard work, critical thinking and organization in the research environment. Thank you for providing me with this fulfilling learning opportunity and helping me to grow as a scientist. I would like to thank the members of my advisory committee Dr. Ted Brown and Dr. Mark Palmert for their ongoing input and for always asking interesting and provocative questions. Your guidance in our meetings was essential to the development of my project. I also wish to acknowledge the tremendous support of all the Belsham lab who have become a second family to me. In particular I would like to acknowledge our lab technician Jennifer Chalmers for always providing helpful insight for my experiments, Dr. Leigh Wellhauser for providing tips on improving my research techniques and for writing this thesis, Dr. Joëlle Oosterman and Chloé Berland, the two spirited European exchange students, for always being supportive and encouraging, Dr. Prasad Dalvi for sharing his wisdom and stories in the lab and Dean Tran for providing his helpful suggestions with this thesis. It has been a real pleasure working with such kind, hardworking, intelligent, and inspirational colleagues. Outside of the lab I have had the wonderful support of my friends within the department, on GASP and friends outside of physiology. Thanks for making these years so memorable. In particular I must acknowledge the help of Blerta Meraj and Christian Somody. Last but not least, to my loving family for their kindness and encouragement. In particular, I would like to thank my Nana (herself a lab tech!) for inspiring me to pursue a scientific career and supporting me throughout my studies and my grandfather for passing on his curious and inquisitive nature. I must thank my two brothers Harold and Oliver for continuously providing IT support (and comedic relief) during my Master’s and my inspiring parents, Peter and Darlene, for fostering such a motivating, creative and caring environment at home; I am truly fortunate to have such a supportive family.
iii Table of Contents List of Tables and Figures…………………………………………………………… vii
List of Abbreviations…………………………………………………………………. ix
Chapter 1: Introduction…………………………………………………………...... 1
1.1 General Introduction………………………………………………...……………... 2
1.2 The Hypothalamic-Pituitary-Gonadal Axis……………………………………...... 3
1.3 Gonadotropin-releasing hormone (GnRH) neurons………………………………... 4 1.3.1 Discovery of GnRH……………………………………………………….. 4 1.3.2 Development and anatomy of GnRH neurons……………………………...4 1.3.3 Function of GnRH neurons in the HPG axis……………………………… 5 1.3.4 GnRH-R and GnRH signalling mechanisms……………………………… 6 1.3.5 GnRH gene………………………………………………………………... 6 1.3.6 Regulation of GnRH Neurons……………………………………………... 7 1.3.6.1 Gonadal Steroids………………………………………………… 7 1.3.6.1.1 Estrogens………………………………………………. 8 1.3.6.1.2 Androgens……………………………………………...10 1.3.6.1.3 Progesterone…………………………………………... 10 1.3.6.2 Stress and the HPG axis………………………………………… 11 1.3.6.3 Nutritional status and insulin………………………………….... 11
1.4 Kisspeptin neurons…………………………………………………………………..12 1.4.1 Discovery of Kisspeptin and Kiss-1R (GPR54)...... 12 1.4.2 Kisspeptin gene and protein...... 13 1.4.3 Kisspeptin and GPR54 anatomical expression...... 13 1.4.3.1 Arcuate kisspeptin neurons, KNDy neurons...... 15 1.4.3.2 RP3V(AVPV/PeN) kisspeptin neurons...... 15 1.4.4 Function of Kisspeptin neurons in the HPG axis...... 15 1.4.5 Function of Kisspeptin neurons in puberty...... 16 1.4.6 Gonadal steroidal feedback to kisspeptin neurons...... 17 1.4.6.1 Negative feedback of estrogen……………………...... 17 1.4.6.2 Positive feedback of estrogen……………………...... 18 1.4.7 Signalling pathways activated by kisspeptin...... 19
1.5 Phoenixin...... 19 1.5.1 Bioinformatic Discovery...... 20
iv 1.5.2 Isolation and Localization...... 20 1.5.3 Function of PNX in the HPG axis...... 21 1.5.4 PNX Structure, Processing and Cellular Localization...... 21 1.5.5 PNX Signalling Mechanisms……………………………………………... 23 1.5.6 PNX in the Spinal Cord for the Modulation of Pain...... 23
1.6 Hypothalamic cell models for the study of neuroendocrine function...... 24 1.6.1 Immortalized adult, non-clonal GnRH cell model (mHypoA-GnRH/GFP).25 1.6.2 Immortalized adult, non-clonal kisspeptin cell model (mHypoA-Kiss/GFP-3 and mHypoA-Kiss/GFP-4)...... 28 1.6.3 Immortalized adult clonal cell models (mHypoA-xx)...... 28
1.7 Study Hypotheses and Aims...... 29
Chapter 2: Materials and Methods...... 32
2.1 Cell Culture and Reagents...... 33 2.2 Phoenixin-20 Amide, Kisspeptin, Steroid and Insulin Treatments...... 34 2.3 cDNA synthesis and Quantitative RT-PCR (qRT-PCR)...... 34 2.4 Protein Isolation, SDS-PAGE and Western Blotting...... 35 2.5 GnRH Enzyme-Linked Immunoassay (EIA)...... 35 2.6 In Silico Analysis...... 37 2.7 Statistical Analysis...... 37
Chapter 3: Results...... 38
3.1 PNX-20 induces neuronal activation in the mHypoA-GnRH/GFP cell model...... 39
3.2 PNX-20 increases GnRH but not SMIM20 mRNA expression in mHypoA- GnRH/GFP cell model...... 39
3.3 PNX-20 increases GnRH secretion and protein synthesis in mHypoA-GnRH/GFP cell model...... 42
3.4 PNX-20 increases Kiss-1 mRNA expression in mHypoA-Kiss/GFP-3 and 4 cell models……………………………………………………………………………...... 44
3.5 PNX-20 increases phosphorylation of CREB and ERK1/2 in mHypoA-GnRH/GFP and CREB in mHypoA-Kiss/GFP-3 and 4 cells...... 47
3.6 In silico analysis of the SMIM20 promoter using Alibaba 2.1 and PROMO transcription factor binding analysis programs...... 47
v 3.7 Kisspeptin increases SMIM20 gene expression in the mHypoA-GnRH/GFP cell model...... 50
3.8 Neither insulin nor dexamethasone regulate SMIM20 gene expression in the mHypoA-GnRH/GFP cell line...... 53
3.9 17β-estradiol does not appear to regulate SMIM20 mRNA expression in the mHypoA-Kiss/GFP-4 or mHypoA-50 cell models at 4 and 24 hours...... 53
Chapter 4: Discussion...... 58 4.1 General discussion...... 59 4.2 Regulation of GnRH neuronal models by PNX-20...... 60 4.3 Regulation of kisspeptin neuronal models by PNX-20...... 66 4.4 Signal transduction pathways activated by PNX-20...... 71 4.5 Regulation of SMIM20 gene expression...... 78 4.6 Study limitations...... 81 4.7 Future directions...... 83 4.8 Conclusions...... 87
References...... 88
vi List of Tables and Figures
Table 1.1 Characterization of gene expression profiles for the mHypoA-GnRH/GFP, mHypoA-Kiss/GFP-3, mHypoA-Kiss/GFP-4, mHypoA-50 and mHypoA-55 cell lines. 27
Table 2.1 List of primers used for real time RT-PCR...... 36
Figure 1.1 Schematic illustrations of SMIM20 and the protein products PNX-20 and PNX-14...... 22
Figure 1.2 Schematic representation of the immortalization of cell lines from GnRH/GFP and Kiss/GFP mice...... 26
Figure 1.3 Schematic representation of the HPG axis and thesis general hypothesis..... 30
Figure 3.1 PNX-20 mediated regulation of c-Fos mRNA expression in the mHypoA- GnRH/ GFP neuronal cell line...... 40
Figure 3.2 PNX-20 mediated regulations of GnRH and SMIM20 mRNA expression in the mHypoA-GnRH/GFP neuronal cell line...... 41
Figure 3.3 PNX-20 mediated regulation of GnRH secretion in the mHypoA-GnRH/GFP neuronal cell model...... 43
Figure 3.4 PNX-20 mediated regulations of Kiss-1 mRNA expression in the (A) mHypoA-Kiss/GFP-3 and (B) mHypoA-Kiss/GFP-4 neuronal cell lines...... 45
Figure 3.5 PNX-20 mediated regulations of Kiss-1 mRNA expression in the (A) mHypoA-50 and (B) mHypoA-55 neuronal cell lines...... 46
Figure 3.6 PNX-20 increases phosphorylation of CREB and ERK1/2 in the mHypoA- GnRH/GFP neuronal cell line at 5 min...... 48
Figure 3.7 PNX-20 increases phosphorylation of CREB but not ERK1/2 in the mHypoA- Kiss/ GFP-3 and mHypoA-Kiss/GFP-4 neuronal cell lines at 5 min...... 49
Figure 3.8 In silico promoter analysis of the 5’ flanking region of the SMIM20 mus musculus gene...... 51
Figure 3.9 Kiss-10 mediated regulation of SMIM20 mRNA expression in the mHypoA- GnRH/GFP neuronal cell line...... 52
Figure 3.10 Insulin mediated regulation of SMIM20 mRNA expression in the mHypoA- GnRH/GFP neuronal cell line...... 54
vii Figure 3.11 Dexamethasone mediated regulation of SMIM20 mRNA expression in the mHypoA-GnRH/GFP neuronal cell line...... 55
Figure 3.12 17β-estradiol mediated regulation of Kiss-1 and SMIM20 mRNA expression in the mHypoA-Kiss/GFP-4 and mHypoA-50 neuronal cell lines...... 57
Figure 4.1 Representative model summarizing the regulation of the HPG axis by PNX...... 61
Figure 4.2 Schematic illustration of the positive feedback loop between kisspeptin and PNX to generate the GnRH/LH surge...... 68
Figure 4.3 Schematic illustration of the proposed role for PNX in the Arc GnRH pulse generator…………………………………………………………………………...... 69
Figure 4.4 Representative model summarizing the proposed pathways activated by PNX- 20…………………………………………………………………………………………73
Figure 4.5 Representative model summarizing the proposed mechanisms involved in the regulation of GnRH neuron activity by PNX-20 in mHypoA-GnRH/GFP cell model.... 74
Figure 4.6 Representative model summarizing the proposed mechanisms involved in the regulation of kisspeptin neuron activity by PNX-20 in mHypoA-Kiss/GFP-3 and -4 cell models...... 76
viii List of Abbreviations
AC adenylyl cyclase
Act D actinomycin D
ACTH adrenocorticotropic hormone
AMPK 5’ adenosine monophosphate-activated protein kinase
ANOVA analysis of variance
AP-1 activator protein 1
AR androgen receptor
Arc arcuate nucleus
AVPV anteroventral periventricular nucleus
BBB blood-brain barrier
BSA bovine serum albumin bp base pair cAMP cyclic adenosine monophosphate cGMP cyclic guanosine monophosphate
ChIP chromatin immunoprecipitation
CHX cyclohexamide
CNS central nervous system
CNTF ciliary neurotrophic factor
CRE cAMP response element
CREB cAMP response element-binding protein
CRH corticotropin-releasing hormone
Crt-1 CREB-1 regulated transcription co-activator-1
ix
DAG diacylglycerol
DHT dihydrotestosterone
DNA deoxyribonucleic acid
DRB 5,6-Dichlorobenzimidazole riboside
Dyn dynorphin A
E2 17β-estradiol
EIA enzyme immunoassay
EPac cAMP-guanadine exchange factor
ER endoplasmic reticulum
ERα estrogen receptor alpha
ERβ estrogen receptor beta
ERK1/2 extracellular signal-regulated kinase ½
FBS fetal bovine serum
FSH follicle-stimulating hormone
GABA γ-aminobutyric acid
GC glucocorticoid
GnRH gonadotropin-releasing hormone
GnRH-R gonadotropin-releasing hormone receptor
GFP green fluorescence protein
GPCR G-protein coupled receptor
GR glucocorticoid receptor
GT1 GnRH T-antigen
GTP guanosine 5’-triphosphate
x
HH hypogonadotropic hypogonadism
HPA hypothalamic-pituitary-adrenal axis
HPG hypothalamic-pituitary-gonadal axis
ICC immunocytochemistry
ICV intracerebroventricular
IP3 inositol (1,4,5)-triphosphate
JAK2 Janus kinase 2 kDa kilodaltons
Kir inwardly rectifying potassium channel
Kiss-1 kisspeptin gene
KNDy kisspeptin/neurokinin B/dynorphin A neuron
KO knockout
LH luteinizing hormone
MAPK mitogen-activated protein kinase
ME median eminence
MEK mitogen-activated protein kinase kinase miRNA microRNA mPOA medial preoptic area mRNA messenger RNA
NKB neurokinin B
NPY neuropeptide Y
Oct-1 Octamer binding transcription factor-1
Otx orthodenticle homeobox
xi
OVLT organum vasculosum of lamina terminalis
OVX ovarioectomized
P4 progesterone
PAM peptidyl-alpha-amidating monooxygenase
PBS phosphate buffer solution
PCR polymerase chain reaction
PeN periventricular nucleus
PIP2 phosphatidylinositol 4,5-bisphosphate
PKA protein kinase A
PKC protein kinase C
PLC phospholipase C
PNX phoenixin
PNX-14 phoenixin-14 amide
PNX-20 phoenixin-20 amide
POA preoptic area
PR progesterone receptor qRT-PCR quantitative reverse transcription polymerase chain reaction
RNA ribonucleic acid
RP3V rostral periventricular area of the third ventricle siRNA small interfering ribonucleic acid
SMART simple modular architecture research tool
SMIM20 small integral membrane protein 20
SNP sodium nitroprusside
xii
SV40 simian virus 40
T-Ag T Antigen
TBST Tris buffered saline + Tween-20
TF transcription factor
TH tyrosine hydroxylase
xiii
Chapter 1
Introduction
1 1.1 General Introduction Reproductive function is tightly regulated by a myriad of factors at the level of the hypothalamus. The hypothalamus is at the peak of the hypothalamic pituitary gonadal (HPG) axis where it secretes gonadotropin-releasing hormone (GnRH) to promote the transcription and secretion of luteinizing hormone (LH) and follicle stimulating hormone (FSH) [1]. LH and FSH are important hormones for the growth of the gonads, ovulation, production of steroid hormones and puberty. Determining how central and peripheral signals regulate these neuronal populations is critical for a full understanding of reproductive physiology. It is thought that there are peptides, yet to be identified, that play important roles in the regulation of the reproductive axis [2]. Using information from the Human Genome Project and a bioinformatic approach, a novel reproductive peptide named Phoenixin (PNX) was recently described [3]. PNX is highly conserved across species and was detected at highest levels in the hypothalamus. Expression was also found in the median eminence and pituitary, suggesting PNX may be released into the hypophyseal portal vessel and transported to the anterior pituitary to exert its effects. In rat primary pituitary cultures, PNX increased GnRH-stimulated LH release and increased GnRH receptor (GnRH-R) mRNA levels. Endogenously compromising PNX using small interfering RNA (siRNA) in female cycling rats delayed the onset of the next estrus cycle and caused a reduction in GnRH-R mRNA in the anterior pituitary. From these initial studies, it has been hypothesized that PNX is a pituitary-priming factor that helps stimulate reproductive function and may help initiate the GnRH/LH surge [3]. The abundance of PNX in multiple regions of the hypothalamus and in the periphery suggests that PNX has other unidentified functions beyond those in pituitary gonadotropes [3]. In particular, PNX may act at the level of the hypothalamus to control reproductive function. Neuropeptides that act on the anterior pituitary commonly have receptors in the hypothalamus. PNX may therefore have feedback loops within the hypothalamus to complement its stimulatory action on the gonadotropes. PNX is expressed in the arcuate (Arc) and anteroventral periventricular (AVPV) nuclei, regions containing kisspeptin neurons [4], which contact GnRH neurons in the medial preoptic area [5,6], raising the possibility that PNX may stimulate GnRH neurons. PNX could also
2 act upstream on kisspeptin neurons through autocrine mechanisms or connections with other PNX-expressing neurons of the hypothalamus. However, the roles of PNX in the hypothalamus, the molecular pathways that it activates and the regulatory mechanisms for its synthesis and secretion have yet to be explored. To address this, the central aim of this thesis was to determine a hypothalamic function of PNX, specifically on the GnRH and kisspeptin neuronal populations, and also to examine the molecular pathways PNX activates and other hormones or neuropeptides that may regulate PNX. As the hypothalamus is a highly heterogeneous region with a complex architecture, it is difficult to investigate these specific nuclei in vivo [7]. However, using several specific cell lines, representing GnRH, Arc kisspeptin and AVPV kisspeptin neurons, the effects of PNX on GnRH and kisspeptin neurons could be studied.
1.2 The Hypothalamic-Pituitary-Gonadal Axis Reproductive function is carefully orchestrated by interactions between the hypothalamus, pituitary and gonads, which comprise the reproductive axis. The hypothalamus is situated at the pinnacle of the HPG axis, where it integrates environmental cues to regulate reproductive function [7]. Hypothalamic neurons secrete the reproductive decapeptide, GnRH, in pulses from nerve terminals in the median eminence (ME) into the hypophyseal portal vessels for transport to the anterior pituitary. In pituitary gonadotropes, GnRH stimulates the synthesis and secretion of the gonadotropins LH and FSH [8]. LH pulsatile release is tightly correlated with GnRH secretion patterns [1]. The gonadotropins, LH and FSH, are both essential for normal reproductive function and regulate folliculogenesis and ovulation in females and spermatogenesis in males [9]. These hormones also trigger the production of estrogens, progesterins and androgens in the gonads [9]. These steroid hormones are required for gametogenesis and the feedback loops up the HPG axis for the dynamic regulation of GnRH and gonadotropins [10].
3 1.3 Gonadotropin-Releasing Hormone (GnRH) Neurons GnRH is considered to be the key regulator of reproductive function in the hypothalamus. It is the final output from the hypothalamic neuronal network that feeds down to regulate reproductive function. GnRH pulsatile release is determined by integration of multiple environmental and internal factors at the level of the GnRH neuron [11]. The GnRH neuron is a critical component of the HPG axis and therefore has been the focus of reproductive neuroendocrine research.
1.3.1 Discovery of GnRH The idea of a hypothalamic “exciter” of gonadotrophs was first proposed in 1950 [12]; however, as the hypothalamus contains such low amounts of the decapeptide, it was difficult to isolate [13]. It was not until over 20 years later, in 1970, that the two independent research groups of Andrew Schally and Roger Guillemin eventually isolated and characterized the master regulator of reproductive function, GnRH [14,15]. Originally, GnRH was thought to only be a hypophysiotropic factor important for the regulation of LH and FSH; however, in the four decades that have followed, our understanding of the GnRH system has grown substantially [16].
1.3.2 Development and Anatomy of GnRH Neurons As GnRH neurons are essential for reproductive viability in mammals, they undergo a precisely orchestrated developmental pattern that is unusual when compared to nearly all other neurons in the brain [8]. GnRH neurons emerge from the olfactory placode and migrate along the vomeronasal nerves across the nasal septum. These embryonic neurons then cross into the median forebrain and terminate in the preoptic area and medial septum of the hypothalamus [17,18]. The olfactory placode origins of GnRH neurons helped explain the phenotype of Kallmann’s syndrome, a genetic disease characterized by hypogonadotropic hypogonadism (HH) and anosmia [8,19]. In these patients, abnormal olfactory development disrupts GnRH neuronal migration, leading to HH [19,20]. This disease is due to mutations in genes encoding proteins for GnRH neural migration.
4 Once fully developed, GnRH neurons are found in a small heterogeneous population of 800–1000 neurons in the medial preoptic area (mPOA) of the hypothalamus. These neurons have dense projections to the ME [21,22,23], and studies with retrograde tracers reveal that about 70% of GnRH neurons terminate in the ME [24,25], leaving 30% with their axons projecting to alternative regions including the amygdala, hippocampus, striatum and other hypothalamic nuclei [26,27,28,29]. Studies have also demonstrated that GnRH neurons can terminate in the organum vasculosum of the lamina terminalis (OVLT) [30,31,32,33], a region with highly permeable fenestrated endothelial cells that make up a brain-peripheral interface, found outside the blood–brain barrier (BBB) [34,35]. Herde et al. demonstrated that, in the OVLT, GnRH dendrites, rather than axons, projected outside the BBB, where they sense peripheral signals to regulate GnRH neuronal activity [36]. These projections could serve as an interface between the central nervous system (CNS) and periphery to regulate reproductive function based on the homeostatic status of an individual [37].
1.3.3 Function of GnRH Neurons in the HPG Axis Reproductive capacity requires the pulsatile release of GnRH from the hypothalamus, a process initiated at puberty. Puberty is an extended developmental phase that culminates with the first ovulation in females and production of sperm in males [8]. Female rhesus monkeys given pulsatile GnRH infusions developed precocious puberty, providing the first evidence that GnRH stimulates puberty [38]. GnRH pulses are low in amplitude and frequency after birth until the onset of puberty [39,40,41]. They gradually increase in frequency and amplitude during the prepubertal phase until they peak and plateau at the time of adulthood [42,43,44,45,46]. This rise in GnRH is paralleled by a subsequent rise in LH and FSH release from the anterior pituitary to stimulate the gonads. Pulsatile GnRH infusions are administered to sexually mature children with delayed puberty [47] and are used to treat patients with hypogonadotropic hypogonadism [48]. This episodic nature of the GnRH neuron is necessary for reproductive function during adulthood [49]. The frequency of GnRH release ranges from every 30 to 120 minutes, depending on the species and, in females, the phase of the menstrual cycle [50,51]. Constant infusion of exogenous GnRH in rhesus monkeys with hypothalamic
5 lesions fails to reestablish gonadotropin secretion; however, administration once per hour restores normal function [52]. Interestingly, GT1-7 cells, an immortalized mouse clonal cell line representative of GnRH neurons, also have the intrinsic rhythmic release of GnRH in vitro and these neurons may be synchronized by cell-to-cell contacts [53]. In the female menstrual cycle, the rise in estrogen from the developing follicles during the follicular phase triggers a GnRH surge, comprised of a large release of the peptide [8]. In turn, this surge of GnRH stimulates the gonadotrophs to increase LH and FSH release, known as the pre-ovulatory LH surge [54,55,56].
1.3.4 GnRH-R and GnRH Signalling Mechanisms
GnRH signals through a Gq/11-type G protein–coupled receptor (GPCR), GnRH- R, that activates phospholipase C (PLC) and subsequently protein kinase C (PKC). This cellular response mobilizes calcium stores to increase LH and FSH secretion while increasing the activity of mitogen-activated protein kinase (MAPK) pathways to regulate the transcription of multiple genes, including gonadotrophin subunits [57,58,59]. The density of GnRH-R determines the sensitivity of the pituitary to GnRH and is regulated by GnRH itself, estrogen, progesterone (P4) , GnRH and other neuropeptides, such as the novel peptide PNX [60]. GnRH-R expression is highest during the GnRH surge to ensure the LH surge is elicited from the pituitary for normal ovulation [60]. Elevated estrogen levels increase the levels of GnRH-R on gonadotropes prior to the
GnRH/LH surge, while P4 reduces expression during the luteal phase [61]. However, the most potent stimulator of GnRH-R mRNA expression is GnRH itself [60]. Treatment of pituitary gonadotropes with GnRH antagonists or GnRH antiserum dramatically reduces the number of receptors [62,63]. Regular pulsatile secretion is required to maintain the full complement of GnRH-Rs on gonadotropes. Continuous release of GnRH desensitizes the pituitary and causes internalization of GnRH-Rs [64].
1.3.5 GnRH Gene As GnRH is critical for reproductive success and the evolutionary transfer of genes to the next generation, it is one of the most phylogenetically conserved peptides and present in all invertebrates and vertebrates [16]. For example, a paralogue of the
6 GnRH gene in yeast, functioning as a pheromone, shares 50% similarity with those in vertebrates [16,65]. All mammals, with the exception of the guinea pig, share an identical amino acid sequence for the GnRH peptide [8]. In mammals, two GnRH genes exist, GnRH-I and GnRH-II, each consisting of four exons encoding for the signal peptide, the mature GnRH peptide and gene (GnRH) associated peptide [66,67,68]. GnRH-I was the first to be discovered and is responsible for the regulation of the gonadotropes [16], while GnRH-II is more evolutionarily conserved than GnRH-I [69] and, in humans, is expressed in every structure of the brain stem and hypothalamus as well as in regions of the periphery [70]. Although a hypophysiotropic has not been demonstrated, in mammals, GnRH-II has been implicated in the regulation of reproductive behaviours [71,72]. In particular, GnRH-II stimulates reproductive function based on energy status and reduces food intake [71,73,74]. Interestingly, food restriction decreases the transcription and protein synthesis of GnRH- II [75], suggesting that GnRH-II may mediate a balance between energy status and reproduction [76] by stimulating reproductive function only if sufficient energy stores are available [77].
1.3.6 Regulation of GnRH Neurons GnRH neuronal circuits are regulated by a range of factors including steroid hormones, neurotransmitters and peptide hormones, all of which are crucial for the fine homeostatic regulation of reproductive function in the organism. Although this system may seem redundant, each input plays an important role for relaying information about the internal and external environment [8].
1.3.6.1 Gonadal Steroids The role of gonadal steroids in the positive and negative feedback regulation of the HPG axis is well established and a key regulatory mechanism. Pulsatile release of LH and FSH from the pituitary leads to steroidogenesis in the gonads [78]. There are three main classes of sex steroids that feedback from the gonads to directly or indirectly regulate GnRH neurons: estrogens, progesterones, and androgens.
7 1.3.6.1.1 Estrogens Estrogens are essential for the regulation of GnRH synthesis and secretion as well as for sexual differentiation of the mammalian brain. Three main estrogens are produced in the gonads: estrone, estradiol, which can be classified as 17β-estradiol or 17α- estradiol, and estriol [79]. Estrogens are synthesized by the aromatization of androgen precursors. The production of the precursor androstenedione from cholesterol first occurs in the theca cells of the ovaries. Androstenedione can then cross into neighbouring granulosa cells, which harbour the enzyme P450 aromatase, for the production of estrone. Estradiol can then be generated from estrone by the enzyme 17β-hydroxysteroid dehydrogenase [79]. 17β-estradiol (E2) is the most potent and predominant form of estrogen in the reproductive system and the most commonly used estrogen in research.
E2 has been established as a bimodal regulator of the hypothalamus, exerting both inhibitory and stimulatory effects on GnRH neurons [80]. Basal levels inhibit GnRH mRNA expression and secretion in vivo [81,82,83,84,85,86], and in vitro experiments have demonstrated inhibition of GnRH promoter activity with E2 treatment [87,88,89,90]. Reduction in GnRH mRNA levels was observed in both the GT1-7 cell line and another immortalized GnRH hypothalamic cell model, the GN11cell line [91,92]. In females, there is also a stimulatory effect that occurs before the GnRH and LH pre-ovulatory surge, in the late follicular phase, where the rise in E2 induces a surge of GnRH to induce ovulation [11,93,94,95,96]. Although there is consensus that E2 acts in a differential manner throughout the estrous cycle, the cellular and molecular mechanisms by which it regulates GnRH neurons is debated [80].
Classical estrogen signalling involves E2 binding and the dimerization of nuclear receptors, estrogen receptor α (ERα) and estrogen receptor β (ERβ) [97]. Both isoforms bind with similar affinity to consensus estrogen responsive elements (EREs) on the promoters of target genes to regulate their transcription [98,99,100]. ERα can also act in a non-classical way by tethering to other transcription factors such as activator protein-1 (AP-1) [101]. A membrane receptor, GPR30, is also activated by E2, causing rapid activation of adenylyl cyclase (AC) and MAPK pathways, which results in the mobilization of Ca2+ [102,103,104].
8 ERα is widely expressed throughout the HPG axis in the hypothalamus, pituitary, gonads and uterus. ERα knockout mice (ERαKO) are infertile and display high circulating levels of gonadotropins, suggesting that the negative feedback from the gonads is disrupted in these animals and that ERα is necessary for this process [105,106,107,108]. ERαKO were also unable to generate the pre-ovulatory surge, suggesting ERα is also critical for the positive feedback of estrogen [109]. Interestingly, ERβKO exhibited subfertility, although their gonadotropin levels were not affected. A double knockout mouse did have greater circulating gonadotropin levels than ERαKO alone, suggesting that ERβ may be moderately involved in the negative feedback [110,111,112]. There has been contention over whether GnRH neurons themselves express steroid receptors and can respond to steroids hormones, or whether steroidal regulation is via upstream neurons that synapse on GnRH cells [8]. The prevalent hypothesis is that E2 acts through presynaptic afferents that express ERs, although there is still evidence that
E2 could act directly on GnRH neurons. Multiple in vivo double-labelling immunohistochemical studies failed to detect ERα receptors in GnRH neurons [113,114,115,116], but the approach may not have been sufficiently sensitive to detect a small population of ERs, or the levels may have been hampered by castration [80]. In vitro, ERα and/or ERβ expression has been observed in various GnRH-expressing hypothalamic cell lines [91,117,118,119,120,121], and more recent immunocytochemical studies have revealed co-expression of ERβ with GnRH, including in human tissue samples [122,123,124]. In support of the hypothesis for a direct effect of estrogen on
GnRH neurons, in vitro studies have demonstrated that E2 directly represses GnRH mRNA expression through ERα-mediated mechanisms [91,125], activates the GnRH promoter through a functional ERE [89] and induces Ca2+ oscillations [126]. Together, this mounting evidence suggests that E2 likely signals through a combination of direct and indirect mechanisms to regulate GnRH neurons in the preoptic region. These processes have yet to be determined; however, E2 may act through ERβ or GPR30 to affect GnRH synthesis and secretion.
9 1.3.6.1.2 Androgens Proper androgen signalling is critical for sexual differentiation, spermatogenesis and gonadotropin function [127]. Testosterone and dihydrotestosterone (DHT) are the two main androgen steroid hormones synthesized in the Leydig cells of the testis, and, in females, small amounts of testosterone are produced in the ovaries [128]. 5α-reductase type 1 or 2 enzyme converts testosterone into the more potent androgen DHT, the form that is hypothesized to exert the majority of effects [129]. Androgens are involved in the negative feedback loops from the gonads and reduce GnRH mRNA expression and secretion from the hypothalamus and limit the release of gonadotropins from the pituitary in vivo [130,131,132,133]. In vitro studies corroborate these, demonstrating a repressive effect on GnRH gene transcription in the GT1-7 cell line and direct binding of androgen receptor (AR) to the 5’ promoter region of the GnRH gene via Oct-1 transcription factor binding sites [127,134,135]. Androgens signal through the AR superfamily of nuclear receptors, and, although they have not been localized to GnRH neurons in vivo [113], studies have found expression in GnRH-expressing cell lines [129,134]. The low expression of ARs, heterogeneity and scarcity of GnRH neurons in the hypothalamus in vivo [127] could explain why ARs have not been co-localized to date. From in vitro studies, androgens appear to regulate GnRH neurons directly; however, the molecular mechanisms involved remain to be elucidated.
1.3.6.1.3 Progesterone
P4 is the steroid hormone elevated during the luteal phase of the estrous cycle.
The rise in P4 reduces GnRH pulsatility and LH secretion frequency to prevent the onset of a second GnRH/LH surge by the fluctuating levels of estrogens
[136,137,138,139,140]. Experiments have demonstrated direct binding of P4 nuclear receptors (PR) to the GnRH promoter, resulting in a decrease in GnRH mRNA expression [130,141]. This reduction is dependent on prior estrogen exposure, which elevates PR expression [142,143]. As with the other gonadal steroids, the mechanisms of
P4 signalling in GnRH neurons are still under investigation. Experiments using the PR antagonist RU486 completely abolished P4-mediated suppression of GnRH secretion [140]. In contradiction, in vivo studies have been unable to locate PR in native GnRH
10 neurons [144], and PR knockout mice exhibit normal responses to P4 [145], suggesting another receptor may be responsible for the inhibitory effects of P4 in GnRH neurons.
Interestingly, GnRH neuronal explants responded to P4 through the P4-receptor 2+ membrane component 1 (PgRMC1). P4 reduced Ca oscillations and inhibited GnRH neuronal firing, independent of PRs and gamma-Aminobutyric acid (GABA) ergic or glutamatergic inputs [146]. It was hypothesized that PgRMC1 mediates the immediate effects on the GnRH pulse generator, while PR may be involved with the longer-term effects of P4, such as regulating GnRH gene transcription. In summary, there may be a combinatorial effect of both types of P4 receptors; however, more research will be required to elucidate these precise mechanisms [146].
1.3.6.2 Stress and the HPA Axis Stress, defined as any factor that disrupts homeostasis in an organism [147], inhibits reproductive function and the HPG axis [147]. Stress-related disorders and high levels of cortisol are associated with reduced GnRH and LH in females [148,149]. The stress response involves the activation of the hypothalamic-pituitary-adrenal (HPA) axis, which stimulates the release of corticotropin-releasing hormone (CRH) from the hypothalamus and, subsequently, adrenocorticotropic hormone (ACTH) from the pituitary. ACTH is released into circulation, where it acts on the adrenal glands to cause the release of glucocorticoids (GCs). GCs, along with CRH, feed back to the hypothalamus and pituitary to inhibit GnRH and gonadotropin biosynthesis and secretion [150,151,152,153,154,155,156,157], which reduces output to the gonads. GCs signal through glucocorticoid receptors (GRs), nuclear receptors that dimerize and translocate to the nucleus, where they exert effects on the promoters of target genes [158]. Both in vivo [159,160] and in vitro models [151] have confirmed the presence of GRs on GnRH- expressing cells and gonadotropes, suggesting that GCs may directly act to repress GnRH neuronal function.
1.3.6.3 Nutritional Status and Insulin Reproductive capacity is a costly biological process that is heavily dependent on the nutritional status of an organism. For instance, food restriction and insufficient energy
11 stores, in anorexia nervosa, can inhibit the reproductive axis, causing dysrhythmic GnRH release, amenorrhea and infertility [161,162]. The hypothalamus regulates both reproduction and energy-balance processes to ensure the survival of the organism and relies heavily on metabolic signals, like insulin, to regulate the two processes properly. Insulin is not only important for glucose homeostasis in the body, but also involved in satiety signalling to the hypothalamus, which, in turn, regulates reproductive function [163,164]. Women with insulin-dependent diabetes mellitus exhibit an impairment in GnRH secretion [165], and neuron-specific insulin receptor knockout mice show diminished fertility as well as a reduction in circulating LH [163], implicating a role for insulin in the central regulation of reproduction. Insulin stimulates GnRH biosynthesis and secretion in primary GnRH neuronal cultures [166] and activates GnRH promoter activity in both the GT1-7 and GN11 cell lines via a MAPK-dependent pathway [167]. However, recent studies have shown GnRH-specific insulin receptor knockout mice did not have compromised reproductive function [168], and the induction of the MAPK pathway upon insulin stimulation could not be reproduced in vivo [169]. These findings raise questions about the direct action of insulin on GnRH neurons. Instead, afferents that feed into GnRH neurons may be regulated by insulin [169] such as NPY or POMC neurons [170].
1.4 Kisspeptin Neurons In the past decade, kisspeptin has emerged as a critical player in the regulation of the reproductive axis, particularly of GnRH neurons. Kisspeptin is a 54–amino acid product encoded by the Kiss-1 gene [171,172,173]. Kisspeptin administration stimulates gonadotropin secretion [174] and, in GnRH neurons, increases c-fos expression and GnRH secretion via the Kiss1R [175,176,177,178].
1.4.1 Discovery of Kisspeptin and the Kiss-1R (GPR54) The discovery of the kisspeptin family of peptides and their connection with reproductive physiology was revolutionary for the field of reproductive endocrinology and helped build on our understanding of the pathophysiology of reproductive diseases. Kisspeptin was first identified in 1996 and originally named metastin for its anti-
12 metastatic properties in melanoma cell lines [179]. The gene was termed KiSS-1 as tribute to the city in which it was discovered, Hershey, Pennsylvania, the birthplace of Hershey’s Chocolate Kisses [179]. After the discovery, research was primarily focussed on the metastatic properties of metastin in cancer biology [180,181]. In 2001, four research groups independently identified GPR54 as the receptor for the metastin ligand. At this time, the metastin peptides were also given the alternative name kisspeptins [171,172,173,182]. In 2003, the kisspeptin-GPR54 system came to the attention of reproductive physiologists when two separate groups simultaneously reported that disabling mutations to the kisspeptin receptor were associated with hypogonadotropic hypogonadism and disrupted pubertal progression in their patients [183,184]. Targeted deletion of GPR54 in rodents produced the same phenotype as in humans [184,185], and thus the kisspeptin– GPR54 system emerged as a vital component of the HPG axis and has spurned a decade of intense research into its role in reproductive physiology.
1.4.2 Kisspeptin Gene and Protein The kisspeptin peptides are derived from the same 154-residue precursor protein product of the Kiss-1 gene and are highly conserved across species. The initial product cleaved is a 54–amino acid protein, kisspeptin-54 [186], thought to be produced by furin or prohormone convertases [171]. Shorter peptides can then be cleaved from kisspeptin- 54 (kisspeptin-10, -13 and -14). All four kisspeptins are part of the arginine phenylalanine-amide (RF-amide) related peptide family of proteins containing an arginine-phenylalanine-NH2 motif at their carboxy-terminus [187] and exhibit the same affinity for GPR54 [171].
1.4.3 Kisspeptin and GPR54 Anatomical Expression The distribution of kisspeptin neurons has been studied in a variety of species [188], and, in mammals, there are two distinct populations of kisspeptin neurons in the diencephalon. The largest population is in the Arc (infundibular nucleus, in humans), followed by a population in the rostral periventricular area of the third ventricle (RP3V), which encompasses the AVPV and periventricular nucleus (PeN) in rodents [188]. There
13 are also clusters of Kiss1-expressing cells outside of the hypothalamus, including a population in the medial nucleus of the amygdala and a few cell bodies in the bed nucleus of the stria terminalis [4]. Kisspeptin may mediate these structures’ involvement in the pheromonal control of sexual behavior and neuroendocrine function [188]. From multiple observations, it is now clear that kisspeptin directly stimulates GnRH neurons [189]. First, double-label in situ hybridization has shown that the majority of GnRH neurons co-express GPR54 [175,190,191,192], and IHC has shown that kisspeptin-positive cells form close appositions with GnRH cell bodies and dendrites [193,194,195,196,197]. Most recently, evidence from direct electron microscopy shows axo-dendritic and axo-somatic contacts between kisspeptin fibers and GnRH neurons in the preoptic area [198]. In addition to contacts with the GnRH cell bodies, kisspeptin fibers also form appositions with GnRH neuron axon terminals in the ME [199,200,201,202]. Kisspeptin may act via diffusion in this region to regulate GnRH release or through intermediary cells in the ME, such as glial cells [188]. Confocal studies have also confirmed that GnRH neurons have reciprocal afferent connections to kisspeptin cells [196,203]. These reciprocal inputs may serve as part of a large circuitry important for the synchronization of a coherent GnRH pulse [188] comprised of GnRH neurons in the POA and kisspeptin neurons in the Arc and RP3V. Although the anatomical distribution of kisspeptin is relatively similar between males and females, females possess a nearly 10-fold greater number of kisspeptin cell bodies in the RP3V [204]. These sex differences likely result from hormonal influences during development [205]. This larger population is necessary for stimulating the GnRH pre-ovulatory surge in females [206], where as it is not necessary in males [207]. There is also sexual dimorphism in the number of kisspeptin fibers that form appositions to GnRH neurons in the preoptic area. In 2006, Clarkson and Herbison observed that 40% of GnRH neurons were in contact with kisspeptin fibers in the female mouse, compared to only 10% in the male [193]. Kisspeptin neurons in both the Arc and RP3V play an important role in the steroid feedback control to GnRH neurons, and, therefore, both populations highly express nuclear receptors for gonadal sex steroids. The majority of Arc and RP3V cells express estrogen receptor-alpha (ERα), with co-expression in the Arc ranging from 70–90%,
14 compared to 50–99% in the RP3V [207,208,209,210,211,212]. The percentage of kisspeptin cells co-expressing estrogen receptor-beta (ERβ) is only 11–25% in the Arc and 21–31% in the RP3V in rodents [208,213]. Although both populations are highly regulated by estrogens, each region has distinct responses and unique characteristics.
1.4.3.1 Arc Kisspeptin Neurons, KNDy Neurons The majority of Arc kisspeptin neurons co-express the peptides Neurokinin B (NKB) and Dynorphin A (Dyn), giving them the name “KNDy neurons” [214]. Interestingly, both NKB and Dyn contribute to the control of GnRH secretion [215,216]. NKB mediates the positive steroid feedback [217,218,219], and Dyn mediates the negative P4 feedback to GnRH neurons [220,221]. KNDy neurons have high co- expression with the gonadal steroid hormone receptors ERα, PR and AR to facilitate these processes [214]. KNDy neurons form reciprocal KNDy–KNDy connections with each other [201,222]. They send stimulatory (NKB) and inhibitory (Dyn) projections to GnRH neurons in the POA [201,202,223]. KNDy Arc neurons may orchestrate GnRH pulses with this network of connections [214,224,225,226]. Consistent with this notion, the ablation of KNDy neurons prevents the serum rise in LH, which indicates their importance in the GnRH pulse generator [227].
1.4.3.2 RP3V (AVPV/PeN) Kisspeptin Neurons Rodent RP3V kisspeptin neurons do not express NKB or Dyn. However, a subset of rodent AVPV neurons express tyrosine hydroxylase (TH) [228], an enzyme involved in the biosynthesis of dopamine, suggesting these neurons may co-release dopamine. It is hypothesized that RP3V (AVPV/PeN) neurons are important for GnRH neuron activation during the pre-ovulatory surge and for puberty onset in females [229,230,231].
1.4.4 Function of Kisspeptin Neurons in the HPG axis Since the connection between kisspeptins and reproduction was made in 2003 [183,184], there has been an explosion in kisspeptin research to determine how
15 kisspeptins interact with the HPG axis and how loss of the kisspeptin–GPR54 system causes HH. These initial observations implicated the kisspeptins as essential components for the initiation of gonadotropin secretion at puberty and for supporting the reproductive axis in adulthood. Intraperitoneal or intracerebroventricular injections of kisspeptin-10 or kisspeptin- 54 stimulated LH and FSH secretion in mice, rats, sheep, monkeys and even humans [4,174,177,232,233,234,235]. GnRH antagonist acyline could block kisspeptin-induced gonadotropin secretion, demonstrating that it is dependent on the release of GnRH from the hypothalamus rather than kisspeptin action on the pituitary [4,174,190]. In addition, blockage of local kisspeptin action in the POA of ovariectomized rats (OVX) using an antimetastin antibody prevents the pre-ovulatory surge and inhibited estrus cyclicity [236]. In vitro, kisspeptins directly depolarize and increase the firing rate of GnRH neurons, which complements in vivo research [175,216,237]. In GT1-7 and GN11 cells, kisspeptin increases both GnRH secretion and GnRH mRNA transcription [238]. Kisspeptins play a central role in the regulation of GnRH pulsatility, which governs reproductive function, influencing both puberty and the estrus cycle.
1.4.5 Kisspeptin Neurons in Puberty Kisspeptin is able to activate GnRH neurons from their quiescent state and initiate pubertal development. Both rodents and humans with loss of function mutations in the kisspeptin receptor fail to enter puberty [183,184]. At the onset of puberty in many species, Kiss1 and Kiss1r gene expression increases [174,175,239,240,241,242,243]. In addition, the number of RP3V Kiss1 neurons increases dramatically between birth and puberty onset [243], and this increase depends on E2. Female aromatase KO mice, which cannot produce estrogen, do not express kisspeptin in the RP3V [243]. Furthermore, central kisspeptin administration to juvenile female rats increased LH secretion and advanced vaginal opening, resulting in precocious puberty [242]. Peripheral administration of kisspeptin to prepubertal rats also induced ovulation and increased gonadotropin secretion [177]. In rhesus monkeys, kisspeptin release increased in amplitude during pubertal development [244].
16 Terasawa et al. have proposed that kisspeptin neurons are critical for puberty onset because they control GnRH pulsatility, not because they innately control puberty timing [245]. The timing of puberty may be controlled by upstream neuronal signals that project afferents onto kisspeptin neurons to inhibit them before puberty. In primates, neuronal components responsible for central inhibition of GnRH pulsatility before puberty might include GABAergic inputs to kisspeptin neurons [246,247,248] or NPY afferents [249]. Future studies need to characterize the precise mechanisms and afferents that initiate puberty and how they might influence kisspeptin neurons [245].
1.4.6 Gonadal Steroidal Feedback to Kisspeptin Neurons Kisspeptin neurons are known to be important mediators of the steroidal feedback from the gonads to GnRH neurons [250,251]. They mediate both inhibitory and positive feedback because of their high expression of ERα, AR and PR [208,213], which are not highly expressed on GnRH neurons [114,115,144]. E2 plays a central role in the regulation of kisspeptins by inhibiting them in the Arc and stimulating their expression the RP3V. This dual regulation by E2 produces two outcomes: normal GnRH pulsatility (negative estrogen feedback) [194,213,252] and the generation of the GnRH/LH surge (positive estrogen feedback).
1.4.6.1 Negative Feedback of Estrogen Gonadal steroids are involved in the inhibition of kisspeptin neurons in the Arc of a variety of species to regulate GnRH pulsatility [253]. In males, following castration, there is a significant increase in Kiss1 mRNA, specifically in the Arc. This increase can be reversed by the sex steroids E2, testosterone or DHT [190,232,254,255]. The increase in Kiss1 mRNA coincides with a rise in GnRH and gonadotropin secretion, indicating the removal of negative feedback [255]. Kisspeptin antagonists can prevent secretion of GnRH, LH and FSH, demonstrating the importance of kisspeptin for normal pulsatile GnRH and gonadotropin secretion [256]. During the majority of the female estrus cycle, negative feedback of estrogen predominates, and GnRH secretion is kept under control through kisspeptin action. Kisspeptin levels fluctuate in the Arc during the estrus cycle, with levels at their lowest
17 when estrogen is highest [213], while ovariectomy induces Kiss1 mRNA expression [194,208,211,232,257,258,259]. This loss of kisspeptin can be overcome with estradiol treatment [194,208,211,213,232,257,258]. Deletions of GPR54 prevent the postovariectomy rise in gonadotropins, despite the rise in Kiss1 mRNA levels, demonstrating the requirement for kisspeptin signalling for normal GnRH pulsatility [258]. As mentioned previously, the neurons in the Arc are often referred to as KNDy neurons for their co-expression of NKB and Dyn [214]. It has been proposed that NKB and Dyn neurons coordinate the pulsatile release of kisspeptin from the Arc, with NKB stimulating and Dyn suppresing the release. KNDy are in close contact with other KNDy neurons, creating an interconnected neural network [201,222,223,224] that can both stimulate and repress kisspeptin release. Kisspeptin fibers form close contacts to the GnRH terminals in the ME and, therefore, act as output for the pulse generator.
Gonadal steroid feedback also regulates Dyn and NKB expression. P4 is a strong stimulator of Dyn and causes a reduction in frequency of action potentials from KNDy neurons [221,260,261]. Dyn signalling may be essential in determining the refractory period between bursts in KNDy neurons [261]. E2 reduces both kisspeptin [208,210,211,257] and NKB expression to dampen the amplitude of GnRH pulses
[219,262,263]. E2 may also reduce neuronal excitability and the frequency of GnRH pulses by altering cell membrane properties [264]. As NKB and Dyn appear to play central roles in the GnRH pulse generator, NKB agonists or Dyn antagonists hold promise as novel therapeutic targets for improving gonadal activity in reproductive disorders by stimulating GnRH pulsatility [261].
1.4.6.2 Positive Feedback of Estrogen The GnRH/LH surge during proestrus (in rodents) or in the late follicular phase
(in primates) is triggered by a rise in E2 and is necessary for stimulating ovulation. The
AVPV is positively regulated by E2 and mediates the positive feedback onto GnRH neurons [109,252,265]. Kisspeptin neurons in the rodent AVPV act directly on GnRH neurons to stimulate the GnRH/LH surge [109,266]. Lesions to the AVPV or infusions of kisspeptin antagonists to the AVPV blocked the GnRH/LH surge [210,236,267,268].
18 Targeted deletion of ERα specifically in kisspeptin cells also prevented the GnRH/LH surge in mice [269]. At the time of the GnRH/LH surge, Kiss1 mRNA expression in the rat AVPV is highest in the estrous cycle and the AVPV expresses Fos [210,213]. Mice lacking functional GPR54 were unable to produce a clear LH surge, and they did not exhibit Fos expression in GnRH neurons after E2 and P4 treatment [212]. Interestingly, the human female response to kisspeptin injections is stronger during the pre-ovulatory phase than during the early follicular or luteal phases [270,271,272]. Similarly, in rats and sheep, the strongest response to kisspeptin occurs just before ovulation [273,274]. High E2 levels during the pre-ovulatory surge enhance kisspeptin stimulation of GnRH neurons [238,275,276]. Together, these experiments provide compelling evidence that the positive feedback of E2 to AVPV kisspeptin neurons is critical for the generation of the pre-ovulatory surge [253].
1.4.7 Signalling Pathways Activated by Kisspeptin
The activation of GPR54, a Gq/11-type GPCR by kisspeptin results in the activation of phospholipase C (PLC) [171,172,277,278,279] and subsequent hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the secondary messengers inositol
(1,4,5)-triphosphate (IP3) and diaglycerol (DAG). IP3, in turn, triggers a massive release of intracellular Ca2+ from the endoplasmic reticulum (ER) into the cytosol to activate Ca2+-dependent pathways, while DAG activates protein kinase C (PKC) [277,279]. It is hypothesized that DAG and Ca2+ activate transient receptor potential canonical (TRPC)– like channels and inhibit inwardly rectifying potassium channels (Kir) to stimulate the secretion of GnRH [187,216]. PKC, in turn, phosphorylates the extracellular signal- regulated kinases 1 and 2 (ERK1/2) and the p38-mitogen-activated protein kinase (p38- MAPK) transcription factors, which are also required for proper GnRH secretion [172,173,280]. The signalling pathways activated by kisspeptins are dependent on the cell type being stimulated.
1.5 Phoenixin Although many neuropeptides responsible for reproductive function have been identified, it is thought that there are unidentified peptides that regulate the reproductive
19 axis [2,3]. In 2012, Yosten et al. identified a novel reproductive peptide known as phoenixin using a bioinformatic approach [3].
1.5.1 Bioinformatic Discovery
Phoenixin was discovered by a bioinformatic algorithm previously used to predict neuropeptides, including the novel peptide neuronostatin [281]. Using information from the Human Genome Project, the algorithm searches for previously unidentified, secreted peptides with high evolutionary conservation [3]. It uses several databases to narrow down potential peptides. The Simple Modular Architecture Research Tool (SMART) database [282,283] first excludes any potential peptides with a transmembrane domain, then the SignalP database [284,285] eliminates any peptides without a signal peptide. All sequences encoding known proteins are removed, and the BioRegEx database identifies remaining sequences with dibasic cleavage sites. The final step involves screening using NCBI BLAST to identify highly conserved peptide sequences.
1.5.2 Isolation and Localization The sequence for phoenixin was synthesized and antibodies were developed so that the endogeneous peptide could be detected and purified from rat tissue [3]. PNX immunoreactivity was detected in multiple tissues, including the heart, thymus, stomach and spleen; however, the highest expression was in the hypothalamus. Within the hypothalamus, PNX is most significantly expressed in the paraventricular and supraoptic nuclei; however, there is also immunoreactivity in the periventricular, Arc, perifornical and dorsomedial nuclei, and the ventromedial hypothalamus. Positive labelling was also found in the ME and pituitary, suggesting there may be PNX release into the hypophyseal portal vessel and transport to the anterior pituitary. Other brain regions expressing PNX included the substantia nigra reticulate, Edinger-Westphal nucleus and nucleus of the solitary tract/dorsal motor nucleus of the vagus. As the hypothalamus and heart were found to contain the highest expression, the endogeneous peptide was isolated from these tissues and peptide sizes determined using mass spectrometry. In the hypothalamus, the
20 major product was a 20–amino acid amidated peptide (2182 Da), while, in the heart, it was a 14–amino acid amidated peptide (1583.1 Da).
1.5.3 Function of PNX in the HPG Axis PNX localization in the ME suggested it might act on the anterior pituitary. PNX alone did not change the basal secretion of LH, ACTH, prolactin, growth hormone or thyroid-stimulating hormone in primary pituitary cells [3]. However, in female primary pituitary cultures, 24-hour PNX pre-treatment increased GnRH stimulated LH release. PNX alone increased GnRH-R mRNA concentrations in female pituitary cultures and the alpha T3-1 immortalized gonadotroph cell line [3]. This increased abundance of GnRH-R on pituitary cells likely sensitized the pituitary to GnRH and enhanced the amount of LH secreted from the cells. To test the physiological relevance of PNX in vivo, ICV injections of siRNA directed against PNX were given to female cycling rats [3]. The endogenous compromise of PNX delayed the onset of the next estrus cycle by 2.3 days. This coincided with a reduction in GnRH-R mRNA in the anterior pituitary, further demonstrating that PNX regulates GnRH-R mRNA expression in the pituitary [3]. These initial experiments have highlighted a role for PNX in the regulation of female pituitary gonadotrophs. PNX appears to be critical for normal ovarian cyclicity and may influence the cycle by sensitizing the pituitary to GnRH [3]. From these initial studies, it has been hypothesized that PNX is a pituitary priming factor that helps stimulate reproductive function and may help initiate the pre-ovulatory surge [3].
1.5.4 PNX Structure, Processing and Cellular Localization PNX may be cleaved from the precursor protein, small integral membrane protein 20 (SMIM20), into two major products of 14 and 20 amino acid residues in length. In rodents, SMIM20 contains 69 amino acids (Figure 1.1) while in humans there are two isoforms of 67 and 168 amino acids. The PNX sequence contains a C-terminal glycine residue for amidation by peptidyl-alpha-amidating monooxygenase (PAM), and SMIM20 has multiple dibasic residues for cleavage [3]. PNX is highly conserved across species and PNX-20 is 100% homologous between humans and rodents. The 20–amino acid
21
Figure 1.1 Schematic illustrations of the rodent SMIM20 homolog and the protein products PNX-20 and PNX-14. The initial protein from the SMIM20 gene is SMIM20, a 69–amino acid protein in rodents. It is predicted to be a type 2 transmembrane protein with the TM domain indicated in green. SMIM20 may be cleaved and then amidated at the C-terminus to produce PNX-20 and PNX-14, 20-amino acid and 14-amino acid products, respectively. There are multiple dibasic residues in SMIM20 that are potential cleavage sites.
22 product (PNX-20) was the most abundant SMIM20 product in the hypothalamus and, therefore, is the focus of this thesis. The online topology prediction program Phobius [286] detects a transmembrane domain in SMIM20 and predicts it is a type-2 transmembrane protein with the C-terminus in the extracellular domain. To date, no studies have explored the cellular localization of PNX. PNX may be cleaved from SMIM20 in the secretory pathway by prohormone convertase 2 and carboxypeptidase E enzymes and then stored in vesicles. However, as it is located on the extracellular domain of the SMIM20 transmembrane protein, PNX may alternatively be released from SMIM20 by a process known as ectodomain shedding. Ectodomain shedding consists of the proteolytic cleavage by metalloproteinase enzymes and release of the extracellular domain of a transmembrane protein. This process occurs at the cell membrane to regulate a diverse number of molecules [287].
1.5.5 PNX Signalling Mechanism Currently, the receptor and mechanisms involved in PNX signal transduction are unknown and remain to be elucidated. The patent data for PNX indicates that 100 nM PNX-14 or PNX-20 treatment increases cAMP levels from 2- to 3-fold in rat pituitary adenoma cells [288]. This suggests PNX activates the AC/cAMP pathway that is often stimulated through a Gs G-protein coupled receptor. Many reproductive neuropeptides, including GnRH, kisspeptin, gonadotropin-inhibitory hormone and neuropeptide Y (NPY), signal through GPCRs [64,171,289,290]. Therefore, it is likely that PNX operates in a similar nature. PNX may stimulate one of the 150 orphan GPCRs that are of unknown function [291].
1.5.6 PNX in the Spinal Cord and the Modulation of Pain Studies by Lyu et al. recently showed PNX, primarily PNX-14, is highly expressed in all spinal segments of the superficial dorsal horn of the spinal cord [292], in laminae I and II. They demonstrated that intrathecal administration of PNX-14 suppressed visceral pain and that this effect was blocked with PNX antiserum. Their observations matched two studies that showed partial deletion of SMIM20 gene in patients who had partial epilepsy with pericentral spikes, characterized by various seizure
23 types and epigastric pain [293,294]. However, nociception may not be the only sensory modality PNX modulates in the spinal cord, and future studies need to explore these further [292].
1.6 Hypothalamic Cell Models for the Study of Neuroendocrine Function
The hypothalamus is involved in the integration of peripheral signals to coordinate multiple biological processes, including energy homeostasis, sleep, growth, thermoregulation and reproduction. To execute these processes, the hypothalamus is organized into various nuclei, each containing populations of highly specialized neuronal cell types with distinct neuropeptide, neurotransmitter and receptor profiles [7,295]. The heterogeneity of the hypothalamus makes it complicated to dissect the specific molecular mechanisms involved in neuromodulation and neuropeptide synthesis in these nuclei [295]. Although in vivo methods offer valuable insights into the overall physiological system, they are not practical for exploring these cellular events. Using primary cell cultures and immortalized cell lines can circumvent these issues. In the past, hypothalamic cell models were difficult to generate due to the lack of CNS tumors and difficulty of immortalizing highly differentiated primary cells [295,296]. However, in 1990, Mellon et al. successfully established one of the first hypothalamic cell models, the GT1 cell line [297]. The GT1 cell model is a clonal, mature, GnRH neurosecretory cell line generated by targetted tumorigenesis with the simian virus 40 (SV40) T antigen (T-Ag) to the GnRH gene. GnRH-expressing hypothalamic tumors grew and these were isolated and subcloned to generate three separate clonal cell lines, GT1-1, GT1-3 and GT1-7 [297]. These cell lines, especially the GT1-7 model, have been indispensible in developing our understanding of the molecular mechanisms of GnRH synthesis and secretion [295]. Since the generation of the GT1 model, the SV40 T-Ag immortalization technique has been used in other embryonic or fetal dividing hypothalamic cell types, such as in suprachiasmatic nucleus and CRH-expressing cells [295,298,299,300,301,302] and in adult primary cells treated with ciliary neurotrophic factor (CNTF) [303]. The Belsham laboratory has generated over 200 hypothalamic cell lines, including embryonic and adult cell lines through the retroviral transfer of SV-40 T-
24 Ag into primary dividing cells. Adult cell proliferation was possible from the observation that CNTF could induce neurogenesis in adult mature neurons [303](Further discussed in Section 1.6.3). These cell lines each have distinct phenotypes and endogenously express neuropeptides, hormone receptors, neurosecretory machinery. These cell lines have become indispensible tools for the investigation of molecular and biochemical processes involved in hypothalamic regulation of neuropeptides [304].
1.6.1 Immortalized Adult, Non-Clonal GnRH Cell Model (mHypoA- GnRH/GFP)
The GnRH clonal models have been critical in developing our understanding of the cellular and molecular events involved in the synthesis and secretion of GnRH [16]. These models, however, do not account for the full array of GnRH neurons found in the hypothalamus, but rather represent one single GnRH cell type [305]. Recent in vivo work has shown that GnRH neurons exhibit differing morphologies, dendritic organization and membrane properties [36,306,307], leading to the hypothesis that there may be subpopulations of GnRH neurons within the hypothalamus [305]. To bridge this gap in GnRH cell lines and generate a model of multiple GnRH neurons, the Belsham lab generated the mHypoA-GnRH/GFP cell line [305]. A cell line representative of the NPY population [308] was previously generated, and, following a similar protocol, this was achieved with the GnRH population to produce the mHypoA-GnRH/GFP cell model. To summarize, the hypothalami from two-month-old female transgenic GnRH/GFP mice [generated by Dr. Suzanne Moenter (University of Michigan, Ann Arbor, ME, USA)] [309] were isolated for primary culture. Subsequently, the primary culture was treated with CNTF to induce cellular proliferation, and the SV-40 T-Ag and neomycin resistance gene were introduced to cause immortalization [305]. To isolate a population of only GnRH-expressing neurons, GFP-expressing cells were separated using fluorescence- activated cell sorting (FACS) (Figure 1.2). The mHypoA-GnRH/GFP cell model represents a heterogeneous GnRH neurosecretory line and expresses neuron-specific markers along with relevant reproductive neuropeptides and receptors [305] (Table 1A). The development of this unique cell model will allow for exploration of a heterogeneous complement of GnRH neurons.
25
Figure 1.2 Schematic representation of the immortalization of cell lines from GnRH/GFP and Kiss/GFP mice. In brief, the hypothalami of adult GnRH/GFP and Kiss/GFP mice were isolated and treated with CNTF to induce neuronal proliferation. Cells were then transfected with SV-40 T-Antigen to cause immortalization. The cells were subsequently FAC sorted to produce the mHypoA-GnRH/GFP, mHypoA- Kiss/GFP-3 and mHypoA-Kiss/GFP-4 cell models. mHypoA-Kiss/GFP-3 cells were isolated from the Arc and mHypoA-Kiss/GFP-4 cells from the AVPV.
26 A Gene mHypoA-GnRH/GFP GnRH + Kiss-R (GPR54) + ERα + ERβ + GPR30 + IR + GR + Kiss-1 -
SMIM20 +
Gene mHypoA-Kiss/GFP-3 (ARC) mHypoA-Kiss/GFP-4 (AVPV) B ERα + + ERβ + + GPR54 + + GPR30 + + KiSS1 + + NKB + - Dynorphin A ? ? Substance P + - SMIM20 + +
C Gene mHypoA-50 (AVPV) mHypoA-55 (Arc) Kiss-1 + + ER-α + + ER-β + + GPR30 + + NKB - + Dynorphin A - + Substance P - + TH + - SMIM20 + +
Table 1.1 Characterization of gene expression profiles for the (A) mHypoA- GnRH/GFP cell line (B) mHypoA-Kiss/GFP-3 and -4 cell lines and (C) mHypoA-50 and -55 cell lines. RT-PCR results of relevant reproductive neuropeptides and receptors in the cell lines indicated. (+) indicates the presence of the gene and (-) indicates the absence or weak expression of a gene. Screening courtesy of Jennifer Chalmers.
27 1.6.2 Immortalized Adult, Non-Clonal Kisspeptin Cell Models (mHypoA-Kiss/GFP-3 and mHypoA-Kiss/GFP-4)
As the generation of both the mHypoA-NPY/GFP [308] and mHypoA- GnRH/GFP [305] neuronal models was successful using the protocol described above, our laboratory generated similar models of kisspeptin neurons to further our understanding of kisspeptin populations. Using both female and male Kiss- GFP mice [225,310], the Arc and AVPV were micro-dissected from isolated hypothalamii, and cells were treated separately to generate two separate kisspeptin cell lines. The mHypoA- Kiss/GFP-1 (male) and mHypoA-Kiss/GFP-3 (female) represent the Arc neuronal populations, while the mHypoA-Kiss/GFP-2 (male) and mHypoA-Kiss/GFP-4 (female) represent AVPV neuronal populations. All four cell lines endogenously express neuron- specific markers and the appropriate reproductive neuropeptides and receptors. This thesis focuses on the female models, and Table 1B outlines their specific characterization.
1.6.3 Immortalized Adult Clonal Kisspeptin Cell Models (mHypoA-xx)
Although several hypothalamically-derived cell lines had been generated and became essential tools in neuroendocrine research, only a paucity of cell lines were available, representing only an infinitesimal proportion of cells in the hypothalamus [295]. There was also clear lack of adult-derived cell models as many hypothalamic models are of embryonic origin. This is because mature, differentiated cells do not proliferate and thus cannot be immortalized [303]. However, the demonstration that the hypothalamus is capable of exhibiting low levels of neurogenesis with CNTF allowed for the immortalization of mature hypothalamic neurons [311,312]. Using CNTF to induce proliferation, Belsham et al. developed over 50 immortalized, clonal, adult murine cell lines to offer a broader repertoire of cell lines available for the study of hypothalamic gene regulation [303]. Because these cell models were derived from adult mice, they are named mHypoA-
28 serially diluted until clonal cell populations were obtained [303]. These cell lines were found to express characteristic neuronal markers of mature neurons and were characterized based on their specific neuropeptide and receptor profiles. They offer new models by which to study the molecular mechanisms that govern neural activity, gene regulation and secretory events. In the presented thesis, two of these cell models have been used to explore the regulation of kisspeptin: the mHypoA-50 and mHypoA-55 cell lines. Both express Kiss-1 mRNA; however, only the mHypoA-55 line expresses NKB, Dyn and substance P, which are three neuropeptides co-expressed in Arc kisspeptin neurons [214]. Tyrosine hydroxylase (TH), a marker of the AVPV [228], was only expressed in the mHypoA-50 line, indicating that the mHypoA-50 model may originate from the AVPV (Table 1C).
1.7 Study Hypotheses and Aims
To date, it has been established that PNX is a reproductive peptide that up- regulates GnRH-R mRNA expression and GnRH-stimulated LH release in primary pituitary cultures [3]. Only the role of PNX at the level of the pituitary has been elucidated, although the expression in multiple regions of the hypothalamus suggests that it may also regulate reproductive hypothalamic neurons, such as those expressing kisspeptin or GnRH. The hypothalamus is an interconnected network of neurons that communicate among each other to regulate the activity in the pituitary [313]. PNX neurons may therefore connect with other reproductive neurons for the regulation of the HPG axis. Moreover, the knockdown of hypothalamic PNX delayed the onset of the next estrous cycle [3]. The estrous cycle is centrally regulated by kisspeptin and GnRH neurons [314], therefore, we hypothesize that PNX may directly regulate these two populations of neurons. Using adult mouse immortalized hypothalamic neurons representative of GnRH, AVPV kisspeptin and Arc kisspeptin neurons, I was able to test the general hypothesis that PNX-20 regulates the HPG axis at the level of GnRH and kisspeptin neurons (Figure 1.3). In order to test my general hypothesis, this thesis has been divided into three aims.
29
Figure 1.3 Schematic representation of the HPG axis and thesis general hypothesis. At the peak of the HPG axis, the hypothalamus contains kisspeptin and GnRH neurons, both of which are critical for reproductive function. Kisspeptin neurons regulate GnRH biosynthesis and secretion in GnRH neurons. GnRH neurons secrete GnRH in pulses down to the anterior pituitary to stimulate the production and secretion of LH and FSH. LH and FSH are released into the circulation and regulate steroidogenesis and gametogenesis in the gonads. The novel reproductive peptide PNX increases GnRH-R in the anterior pituitary. The goal of this thesis was to establish a role for PNX in GnRH and kisspeptin neurons.
30 Since PNX appears to positively regulate the HPG axis by increasing GnRH-R mRNA in the pituitary, I hypothesized PNX would also stimulate the HPG axis at the level of the hypothalamus. Aim 1 of this thesis was focused on testing the hypothesis that PNX-20 directly upregulates the expression of GnRH and PNX along with the secretion of GnRH in GnRH neurons. I also tested whether PNX upregulates Kiss-1 mRNA in kisspeptin neurons. Following PNX-20 treatment, GnRH and SMIM20 gene expression, GnRH protein expression and GnRH secretion were measured in the mHypoA- GnRH/GFP cell line. Kiss-1 gene expression was also measured following PNX treatment in the mHypoA-Kiss/GFP-3 and mHypoA-55 Arc kisspeptin cell models along with the mHypoA-Kiss/GFP-4 and mHypoA-50 AVPV kisspeptin cell models. Currently, the signalling mechanisms and receptor type involved in PNX signal transduction are unknown. As PNX is a probable ligand for an orphan GPCR [292] and previous data demonstrates PNX increases cAMP, I hypothesize that PNX-20 will activate one or both of the two primary GPCR signal transduction cascades: the cAMP/AC and PLC/MAPK pathways in the hypothalamus. Aim 2 of the thesis tests whether these pathways are activated by PNX in GnRH and kisspeptin neuronal models. Specifically, the phosphorylation of CREB (cAMP pathway) and ERK1/2 (PLC/MAPK pathways) were measured in the mHypoA-GnRH/GFP, mHypoA-Kiss/GFP-3, and mHypoA-Kiss/GFP-4 cell models, representative of GnRH, Arc kisspeptin and AVPV kisspeptin neurons respectively. Steroid hormones and other peripheral factors play a critical role in the regulation of the reproductive axis, in particular kisspeptin, insulin, glucocorticoids and E2 Because PNX is a novel stimulator of the HPG axis, I hypothesize that the PNX gene, SMIM20, will be upregulated by the stimulatory peptides kisspeptin and insulin, and downregulated by glucorcorticoids in GnRH neurons. I also hypothesize that E2 will increase SMIM20 mRNA in AVPV kisspeptin neurons, similarly to E2 regulation of Kiss-1 mRNA in the AVPV. Aim 3 first determined whether dexamethasone, insulin and kisspeptin regulate SMIM20 gene expression in the mHypoA-GnRH/GFP cell model. Next I explored whether E2 regulates SMIM20 gene expression in the mHypoA-Kiss/GFP-4 and mHypoA-50 AVPV kisspeptin cell models.
31 Chapter 2 Materials and Methods
32 2.1 Cell Culture and Reagents Five adult-derived hypothalamic cell lines were used to represent GnRH, Arc kisspeptin and AVPV kisspeptin neurons. The mHypoA-GnRH/GFP cell line originated from FAC-sorted immortalized hypothalamic neurons from a GnRH-GFP mouse [309](The Jackson Laboratory, Bar Harbor ME, U.S.A), while the mHypoA-Kiss/GFP-3 and mHypoA-Kiss/GFP-4 cell lines originated from Kiss-GFP mice [225,310](The Jackson Laboratory, Bar Harbor ME, U.S.A) by the same process. The mHypoA-50 and mHypoA-55 cell lines were generated by SV-40 T-Ag immortalization of primary hypothalamic culture from C57Bl/6 female adult mice. The mHypoA- Kiss/GFP-3 and mHypoA-55 cell lines were isolated from the Arc, while the mHypoA- Kiss/GFP-4 and mHypoA-50 cell lines were isolated from the AVPV. The immortalized cell lines were grown in a monolayer in Dulbecco’s Modified Eagle Medium (DMEM) (Sigma) 1 mg/ml glucose, supplemented with 5% fetal bovine serum (FBS) (Sigma-Aldrich, Oakville, Ontario, Canada) and 1% penicillin /streptomycin (Gibco, Burlington, Ontario, Canada). Cells were maintained at 37 °C and
5% CO2 as previously described [295,303]. Phoenixin-20 amide, Kisspeptin-10 and Lutenizing hormone-Releasing Hormone (LH-RH) EIA kit were purchased from Phoenix Pharmaceuticals (Burlingame, California, USA). Phoenixin-20 amide and Kisspeptin-10 were dissolved in Hypure water (Hyclone, Fisher Scientific, Whitby, ON, Canada) to 100 μM and 1000 μM (Phoenixin-20 amide only) stock concentrations and stored at −80 °C prior to use. Dexamethasone was purchased from Sigma-Aldrich, (Oakville, ON, Canada) and 17β- estradiol from Tocris Bioscience (R&D Systems Inc., Minneapolis, MN, U.S.A.). Both were dissolved in 100% ethanol to stock concentrations and stored at −20°C prior to mRNA studies. Biosynthetic human insulin was a gift from Novo-Nordisk Canada Inc. (Mississauga, Ontario, Canada) and diluted in phosphate buffered saline (PBS). G-protein β antibody was purchased from Santa Cruz Biotechnology (Dallas, TX, U.S.A). Phospho-CREB (#9191), phospho-p44/42 MAPK (ERK1/2) (#9101), CREB, and p44/42 MAPK (ERK1/2)(#4695) antibodies were purchased from Cell Signaling Technology (via New England Biolabs (Whitby, ON, Canada)). Phospho- CREB and CREB were diluted 1:750 and 1:1000 respectively in 5% bovine albumin
33 serum in Tris-buffered saline with 0.1% Tween-20 (1x TBST) (Sigma-Aldrich, (Oakville, ON, Canada). Phospho-p44/42 MAPK (ERK1/2), p44/42 MAPK (ERK1/2) and Gβ antibodies were diluted 1:1000 in 5% milk in 1x TBST.
2.2 Phoenixin-20, Kisspeptin, Steroid and Insulin Treatments For c-Fos mRNA studies and western blot experiments, cells were grown to 90– 95% confluency in 60 mm plates (Sarstedt, Montreal, QC, Canada), then serum starved in 2.5 mL low glucose media supplemented with 1% penicillin streptomycin (Gibco, Life Technologies, Burlington, ON, Canada) for 4 hours. Next, treatment was added in 0.5 mL serum-free media to give final concentrations of 10 and 100 nM PNX-20. The cells were then harvested at 0, 5, 15, 30 and 60 minutes. For 24-hour PNX-20, insulin and kisspeptin treatments, cells were grown to 75– 80% confluency in 1 mg/mL glucose DMEM supplemented with 5% FBS and 1% penicillin streptomycin. Media was replaced to 2.5 mL volume the evening before treatments. Treatments were added to each 60 mm plate in 0.5 mL serum-free DMEM to give final concentrations. For steroid treatments, cells were maintained in 4.5 mg/mL glucose phenol-red- free DMEM (Fisher Scientific, Whitby, ON, Canada) supplemented with 5% charcoal- stripped FBS (Gemini Bio-Products, Cedarlane, Burlington, ON, Canada) and 1% penicillin/ streptomycin (Gibco, Burlington, ON, Canada). Treatments were added in 0.5 mL serum-free media to 2.5 mL in the plates to give final concentrations.
2.3 cDNA Synthesis and Quantitative RT-PCR (qRT-PCR) Total RNA was isolated using the guanidium thiocyanate phenol chloroform extraction method [315]. RNA concentration and purity were measured using a Nanodrop 2000c spectrophotometer. Contaminating DNA was removed using Turbo DNase (Ambion, Austin, TX, USA) treatment for 30 min at 37 °C. 2 mg of RNA was reverse transcribed using a High Capacity cDNA reverse transcription Kit (Applied Biosystems, Streetsville, Ontario, Canada) according to the manufacturer’s protocol. Next, 50 ng of cDNA was amplified by real-time PCR with Platinum SYBR Green qPCR SuperMix- UDG with ROX (Life Technologies, Burlington, ON, Canada) and gene- specific primers
34 using an Applied Biosystems 7900 HT Real-Time PCR machine. The SYBR primers were designed using PrimerBLAST, an online primer design tool [316]. Primer sequences, annealing temperatures and amplicon sizes are listed in Table 2.1.
2.4 Protein Isolation, SDS-PAGE and Western Blotting First, plates were washed with cold 1x PBS then harvested in 1x lysis buffer supplemented with phosphatase inhibitor cocktail, protease inhibitor cocktail and PMSF (Sigma-Aldrich, Oakville, ON, Canada). The soluble fraction of the lysate was isolated after centrifugation (14000 rpm, 10 min, 4 °C). Total protein was quantified using the biocinchoninic acid (BCA) Protein Assay Kit according to the manufacturer’s protocol (Thermo Scientific, Rockford, IL, USA). Total protein (25–35 µg) was run on a 8% polyacrylamide gel and transferred onto 0.22 μm polyvinylidene difluoride membrane (Bio-Rad Laboratories, Mississauga, ON, Canada). Membranes were blocked with 5% milk in Tris buffered saline with 0.1% Tween-20 (1X TBST) for 1 hour and subsequently incubated in primary antibody overnight at 4 °C. Primary antibody was either diluted in 5% milk in 1x TBST or 5% bovine albumin serum (Sigma-Aldrich, Oakville, ON, Canada) in 1x TBST depending on the antibody (see reagents section). After 3 washes in 1x TBST, membranes were complexed with secondary horseradish peroxidase antibody for 1 hour and then washed 6 times in 1x TBST. Secondary antibody was diluted 1:7500 in either 5% milk in 1x TBST or 5% BSA in 1x TBST to match the dilution of the primary antibody. Fluorescence was visualized using the ECL select Western Blotting Detection reagent (GE Healthcare Life Sciences, Pittsburgh, PA, USA) and captured using a KODAK Image Station 2000R. Western blot experiments were normalized using the relative phosphorylated samples divided by total protein or Gβ for the specific protein analyzed.
2.5 GnRH Enzyme-Linked Immunoassay (EIA) mHypoA-GnRH/GFP cells were split into triplicates and grown to 90–95% confluency in 24-well plates (Sarstedt, Montreal, QC, Canada). Cells were maintained in
35
Table 2.1 List of primers used for quantitative RT-PCR
Gene Name Primer Sequence (5’ è 3’) Amplicon Annealing Size (bp) Temp (°C) Histone 3a F: CGC TTC CAG AGT GCA GCT ATT 72 57.5 R: ATC TTC AAA AAG GCC AAC CAG AT 55.1 c-Fos F: CAACGAGCCCTCCTCCGACT 68 60 R: TGCCTTCTCTGACTGCTCACA 60 Gonadotropin- F: CGT TCA CCC CTC AGG GAT CT 51 59.8 releasing R: CTC TTC AAT CAG ACT TTC CAG AGC 55.4 hormone (GnRH) Small integral F: AGCAGGCTGTAAATCGAGCTGGTA 146 60.1 membrane R: ACTGCGGAGTGCACAGGATAAAGA 60.3 protein 20 (SMIM20) Kisspeptin F: AAG GAA TCG CGG TAT GCA GA 191 56.6 (Kiss-1)- Set 1 R: CAG TTG TAG GTG GAC AGG TC 54.9 (mHypoA- Kiss/GFP-3 &-4) Kisspeptin F: AGC TGC TTC TCC TCT GT 127 60 (Kiss-1)- Set 2 R: GCA TAC CGC GAT TCC TTT T 60 (mHypoA-50 & -55) AgRP F: CGG AGG TGC TAG ATC CAC AGA 75 58.2 R: AGG ACT CGT GCA GCC TTA CAC 59.3
36 500 µL of 1 mg/mL glucose, 5% FBS, 1% P/S media. For the initial PNX-20 studies without pre-treatments, media was replaced with 300 µL treatment media (1 mg/mL glucose, 1% P/S) containing either vehicle, 10, 100, 1000 nM PNX-20 or 100 μM sodium nitroprusside (SNP, Sigma-Aldrich, Oakville, ON, Canada). In pre-treatment studies, media was replaced with 300 µL of vehicle or 1000 nM PNX-20 DMEM (1 mg/mL glucose, 5% FBS, 1% P/S) 24 hours before the 1 hour treatments described above. Cell supernatants were collected in triplicates after a 1 hour period and immediately dried and stored at −80°C. GnRH immunoreactivity was measured using a LH-RH EIA Kit (Phoenix Pharmaceuticals, Burlingame, California, U.S.A., assay range = 0–25 ng/mL) following the manufacturer’s protocol. Total protein was collected after cell supernatant, isolated and quantified as described in the section above. Secretion values were normalized to the total protein per treatment.
2.6 In Silico Analysis The web tool Alibaba 2.1 was used to predict transcription factor binding sites for 2500 basepairs upstream of the 5’ flanking regions of SMIM20 gene. Alibaba 2.1 is a program that predicts transcription factor binding sites using the TRANSFAC 4.0 transcription factor database (http://www.gene- regulation.com/pub/programs/alibaba2/index.html)
2.7 Statistical Analysis Data are presented as mean ± standard error of the mean (SEM) and were analyzed using GraphPad Prism Software 6.0 (GraphPad Software Inc., La Jolla, CA, USA). Statistical significance was determined using Student’s t test, or one-way or two- away ANOVAs where appropriate, followed by either a Bonferroni, Dunnett’s or Tukey’s post hoc test. Statistical significance was assumed when P < 0.05. All experiments were performed with 3–7 repeats.
37 Chapter 3 Results
38 3.1 PNX-20 Induces Neuronal Activation in the mHypoA- GnRH/GFP Cell Model
Since the receptor for PNX-20 is currently unknown, it is important to determine which neurons are sensitive to this peptide. C-Fos, a widely used marker of neuronal activation, was measured to determine whether PNX-20 could stimulate GnRH hypothalamic neurons [317]. After a 4 hour serum starve, the mHypoA-GnRH/GFP cell line was treated with 1, 10 and 100 nM of PNX-20 or vehicle (water) and samples were isolated after 30 minutes. C-Fos gene expression was assessed using quantitative reverse transcription PCR (qRT-PCR). C-Fos mRNA levels increased by 30% after 30 min of 10 nM PNX-20 exposure (n = 4, P < 0.05) (Figure 3.1). This finding indicates that the mHypoA-GnRH/GFP cell line is activated by PNX-20 and confirms it is representative of a PNX-responsive cell model.
3.2 PNX-20 Increases GnRH but not SMIM20 mRNA Expression in mHypoA-GnRH/GFP Cell Model
As the GnRH cell model was responsive to PNX-20, we investigated PNX-20 mediated changes to GnRH and SMIM20 mRNA levels to further characterize the role of PNX-20 in GnRH neurons. SMIM20 gene expression was assessed to determine if PNX- 20 could regulate its mRNA in the GnRH neuronal model. The mHypoA-GnRH/GFP cell line was treated for 1, 2, 4, 8 and 24 hours with 10 or 100 nM of PNX-20. Changes in GnRH and SMIM20 gene expression were assessed using qRT-PCR. 10 nM (n = 4–5, P < 0.05) and 100 nM (n = 4–5, P < 0.01) PNX-20 increased GnRH mRNA expression 2- fold at 2 hours (Figure 3.2A). There is also an increasing trend at 8 and 24 hours; however, it did not reach significance. In addition, over a 24-hour PNX-20 exposure, SMIM20 mRNA expression did not change (Figure 3.2B). These findings indicate that PNX-20 increases GnRH mRNA levels but does not affect SMIM20 expression over 24 hours in this GnRH cell model.
39
mHypoA-GnRH/GFP (30 min) 2.5 * 2.0
1.5
1.0
0.5
0.0
Relative c-Fos mRNA expression
Vehicle 1 nM PNX 10 nM PNX 100 nM PNX
Figure 3.1. PNX-20 mediated regulation of c-Fos mRNA expression in the mHypoA- GnRH/GFP neuronal cell line. Cells were serum starved for 4 hours then treated with vehicle (water), 1, 10 or 100 nM PNX-20 amide for 30 minutes. C-Fos mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 3–4), * P < 0.05. Statistical significance was determined by one-way ANOVA with Bonferroni’s post hoc test.
40
A mHypoA-GnRH/GFP
2.0 ** Vehicle * 10 nM PNX 1.5 100 nM PNX
1.0
0.5
0.0 1 2 4 8 24 Relative GnRH mRNA expression Time (Hours)
B mHypoA-GnRH/GFP Vehicle 10 nM PNX 1.5 100 nM PNX
1.0
0.5
0.0 1 2 4 8 24 Relative SMIM20 mRNA expression Time (Hours)
Figure 3.2. PNX-20 mediated regulation of (A) GnRH and (B) SMIM20 mRNA expression in the mHypoA-GnRH/GFP neuronal cell line. Cells were treated with vehicle (water), 10 or 100 nM PNX-20 amide over a 24 hour time course. GnRH and SMIM20 mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 4–5), * P < 0.05. Statistical significance was determined by two-way ANOVA with Bonferroni’s post hoc test.
41 3.3 PNX-20 Increases GnRH Secretion and Protein Synthesis in the mHypoA-GnRH/GFP Cell Model
Next, since PNX-20 increased GnRH mRNA, we explored whether PNX-20 could affect GnRH protein secretion. The mHypoA-GnRH/GFP cell model was treated with vehicle (water), 10 nM, 100 nM or 1000 nM PNX-20 for one hour before the media was collected and GnRH protein quantified using a GnRH-specific EIA kit. 10 and 100 nM PNX-20 did not increase GnRH secretion; however, 1000 nM PNX-20 increased GnRH secretion by 30% (Figure 3.3A). As PNX-20 increased both GnRH mRNA levels and secretion, we investigated whether it could also elevate intracellular GnRH protein levels. To induce protein synthesis, the mHypoA-GnRH/GFP cells were first pre-treated for 24 hours with 1000 nM PNX or vehicle (water). Subsequently, the cells were incubated for an hour in media containing 100 μM sodium nitroprusside (SNP) to induce the secretion of GnRH. SNP is a nitric oxide donor that potently induces GnRH secretion, effectively “unloading” GnRH from the cells. This has been previously demonstrated in both the mHypoA-GnRH/GFP [305] and the GT1-7 cell lines [318]. The neurons pre-treated with PNX-20 released a significantly greater amount of GnRH compared to those pre-treated with control media (n = 3, P < 0.05) (Figure 3.3B). This suggests that the pre-treated cells contained a higher content of GnRH protein then those without PNX-20 pre-treatment, indicating PNX-20 induces GnRH protein synthesis. Finally, we sought to determine whether a 24 hour PNX pre-treatment could further increase the amount of GnRH released when the cells are stimulated with 1000 nM PNX-20. mHypoA-GnRH/GFP neurons were pre-treated for 24 hours with 1000 nM PNX-20 or vehicle (water) and then GnRH secretion was measured following 1 hour of 1000 nM PNX-20 treatment. Interestingly, neurons pre-treated with PNX-20 did not change the amount of GnRH released with PNX-20 stimulation compared to controls (Figure 3.3C). This suggests that the 24 hour PNX-20 pre-exposure desensitized the cells to PNX-20. Therefore, re-exposure to 1000 nM PNX-20 for 1 hour did not increase GnRH secretion.
42
A B 100 μM SNP 1.5 * * 1.5
1.0 1.0
0.5 0.5
total protein (ug/mL) protein total total protein (ug/mL) protein total
GnRH secretion (ng/mL) / (ng/mL) secretion GnRH 0.0 0.0 GnRH secretion (ng/mL) / No 1000 nM PNX Pre-Treatment Pre-Treatment Vehicle 10 nM PNX 100 nM PNX 1000 nM PNX
1.5 C *
1.0
0.5
0.0 GnRH Secretion / total Secretion protein GnRH
Vehicle
1000nM PNX
Vehicle + Pre-Treatment
1000nM PNX + Pre-Treatment
Figure 3.3. PNX-20 mediated regulation of GnRH secretion in the mHypoA- GnRH/GFP neuronal cell model. A) Cells were treated with vehicle (water), 10 nM, 100 nM or 1000 nM PNX-20 for 1 hour. B) Cells were pre-treated with either vehicle (water) or 1000 nM PNX for 24 hours then treated for 1 hour with 100 μM sodium nitroprusside (SNP). C) Cells were pre-treated with vehicle or 1000 nM PNX-20 for 24 hours, and then treated for 1 hour with vehicle or 1000 nM PNX-20. Media and total protein was collected and GnRH levels were measured by a GnRH-specific EIA and normalized to total protein levels. Results are expressed as mean ± SEM (n = 3–5), * P < 0.05. Statistical significance was determined by one-way ANOVA with Dunnett’s post hoc test or Student’s t-test.
43 In summary, short-term (i.e. 1 hour) PNX-20 exposure increases GnRH secretion in mHypoA-GnRH/GFP neurons. Moreover, long-term exposure increased SNP-induced secretion, but not PNX-induced secretion. This suggests long-term PNX-20 incubation increases GnRH protein synthesis, but also desensitizes the cells to further stimulation.
3.4 PNX-20 Increases Kiss-1 mRNA Expression in mHypoA- Kiss/GFP-3 and -4 Cell Models
PNX-20 peptide is expressed in the hypothalamic Arc and PeN nuclei, which are regions that contain kisspeptin neurons [3]. Kisspeptin neurons play an essential role in the regulation of the HPG axis and therefore I sought to determine if PNX-20 regulates kisspeptin neurons. Specific kisspeptin cell lines generated in our laboratory were used to assess whether PNX-20 could affect the transcription of the Kiss-1 gene. The mHypoA- Kiss-GFP-3 and mHypoA-Kiss/GFP-4 are representative of the Arc and AVPV cells respectively. I also assessed the 24-hour time point in two other Arc and AVPV cell lines, the mHypoA-55 and mHypoA-50 respectively. Cell lines were treated with 100 nM PNX-20 and samples taken at 0, 4, 8 and 24 hours to measure the relative changes in Kiss-1 mRNA expression with the exception of the mHypoA-50 and -55 cell lines, which were only isolated at 24 hours. There was a significant 2-fold increase in Kiss-1 mRNA expression at 24 hours with 100 nM PNX in both the mHypoA-Kiss/GFP-3 (n = 3–8, P < 0.05) (Figure 3.4A) and 4 (n = 4–6, P < 0.05) (Figure 3.4B) cell lines. In the mHypoA- 50 cell line there was a 30% increase in Kiss-1 mRNA expression (n = 5, P < 0.01) (Figure 3.5A); however, there were no changes in the mHypoA-55 Arc kisspeptin cells (n = 5, P > 0.05) (Figure 3.5B). These results demonstrate that PNX-20 stimulates kisspeptin neurons in the AVPV and Arc to increase mRNA levels of the Kiss-1 gene. This effect may only be in certain neurons of the Arc as no changes in Kiss-1 expression were observed in the mHypoA-55 line.
44 A mHypoA-Kiss/GFP-3
2.0 * Vehicle 100 nM PNX 1.5
1.0
0.5
0.0 4 8 24 Relative Kiss-1 mRNA Expression Time (hours)
B mHypoA-Kiss/GFP-4
2.0 * Vehicle 100 nM PNX 1.5
1.0
0.5
0.0 4 8 24 Relative Kiss-1 mRNA Expression Time (hours)
Figure 3.4. PNX-20 mediated regulation of Kiss-1 mRNA expression in the (A) mHypoA-Kiss/GFP-3 and (B) mHypoA-Kiss/GFP-4 neuronal cell lines. Cells were treated with vehicle (water) or 100 nM PNX-20 amide over a 24 hour time course. Kiss-1 mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 3–7), * P < 0.05. Statistical significance was determined by two-way ANOVA with Bonferroni’s post hoc test.
45 mHypoA-55 A (24 hours) 1.5
1.0
0.5
0.0 Vehicle 100 nM PNX Relative Kiss-1 mRNA Expression N = 5
B mHypoA-50 (24 hours)
1.5 **
1.0
0.5
0.0 Vehicle 100 nM PNX
Relative Kiss-1 mRNA Expression N = 5
Figure 3.5. PNX-20 mediated regulation of Kiss-1 mRNA expression in the (A) mHypoA-55 and (B) mHypoA-50 neuronal cell lines after 24 hours. Cells were treated with vehicle (water) or 100 nM PNX-20 amide for 24 hours. Kiss-1 mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 5), **P < 0.01. Statistical significance was determined by Student’s t test.
46 3.5 PNX-20 Increases Phosphorylation of CREB and ERK 1/2 in mHypoA-GnRH/GFP and of CREB in mHypoA-Kiss/GFP-3 and -4 Cell Models
To elucidate the signal transduction pathways mediating PNX-induced mRNA and secretion changes, I measured the phosphorylation of key signalling molecules using Western blot. In particular, I measured changes to the phosphorylation of CREB and ERK1/2 that are involved in the AC and MAPK pathways respectively, following PNX-20 treatment. Neurons were serum starved for 4 hours and then treated with either 10 or 100 nM of PNX-20 and total protein was isolated after 0, 5, 15, 30 and 60 minutes for western blotting. In the mHypoA-GnRH/GFP cells, following 5 minutes of 10 nM PNX-20 treatment, levels of both pCREB (n=4-5, P <0.05) (Figure 3.6B) and pERK1/2 (n=4-5, P < 0.05) (Figure 3.6B) increased. However, 100 nM PNX-20 did not significantly increase either, although there was an increasing trend. In both mHypoA- Kiss/GFP-3 (n=3, P <0.05), and mHypoA-Kiss/GFP-4 (n=3, P <0.01) cells, 5 minutes of 100 nM PNX, but not 10 nM PNX, increased CREB phosphorylation (Figure 3.7A and Figure 3.7B). In these cells, PNX had no effect on ERK1/2 phosphorylation (Figure 3.7C and Figure 3.7D). These findings indicate the phosphorylation of CREB is increased in response to PNX-20 in both GnRH and kisspeptin models. However, PNX- 20 only induced the phosphorylation of ERK1/2 in the GnRH cell model, suggesting signaling can be cell type dependent. This result also indicates that there could be a convergence of the AC and MAPK signaling cascades in the GnRH cell line resulting in the phosphorylation of both CREB and ERK1/2.
3.6 In Silico Analysis of the SMIM20 Promoter Using Alibaba 2.1 and PROMO Transcription Factor Binding Analysis Programs
The final aim was to determine potential regulators of PNX by assessing mRNA changes in the PNX precursor protein SMIM20. To predict prospective regulators of
47
A mHypoA-GnRH/GFP (5 min) B mHypoA-GnRH/GFP (5 min) 2.0 * 2.5 * 2.0 1.5
1.5 1.0 1.0 0.5 0.5
0.0 0.0 Relative CREB phosphorylation Relative ERK1/2 phosphorylation n = 4 Vehicle Vehicle n = 4-5 10 nM PNX 10 nM PNX 100 nM PNX 100 nM PNX
pERK 1/2 pCREB
Gβ Gβ
Figure 3.6. PNX-20 increases phosphorylation of A) CREB and B) ERK1/2 in the mHypoA- GnRH/GFP neuronal cell line at 5 min. Cells were serum starved for 4 hours, then treated with either vehicle (water), 10 or 100 nM PNX-20 for 5 minutes. Protein was isolated and relative pCREB and pERK1/2 expression was determined using western blot. All results shown are normalized to Gβ. Results are expressed as mean ± SEM (n=4–5), *P < 0.05. Statistical significance was determined by one-way ANOVA with Dunnett’s post hoc test.
48 A mHypoA-Kiss/GFP-3 (5 min) B mHypoA- Kiss/GFP-4 (5 min)
1.5 * 2.0 ** 1.5 1.0
1.0
0.5 0.5
0.0 0.0 Relative CREB phosphorylation Relative CREB phosphorylation Vehicle Vehicle 10 nM PNX 10 nM PNX 100 nM PNX 100 nM PNX
pCREB pCREB
Total Total CREB CREB
C D
mHypoA-Kiss/GFP-3 Vehicle mHypoA- Kiss/GFP-4 10 nM PNX Vehicle 1.5 100 nM PNX 2.0 10 nM PNX 100 nM PNX 1.5 1.0
1.0
0.5 0.5
0.0 0.0 5 15 30 60 5 15 30 60 Relative pERK1/2 phosphorylation Relative pERK1/2 phosphorylation pERK1/2 pERK1/2
total ERK total ERK
Figure 3.7. PNX-20 increases phosphorylation of CREB but not ERK1/2 in the mHypoA- Kiss/GFP-3 and mHypoA-Kiss/GFP-4 neuronal cell lines at 5 min. Cells were serum starved for 4 hours, then treated with either vehicle (water), 10 or 100 nM PNX-20 over a 1 hour time course. Protein was isolated and relative pCREB and pERK1/2 expression was determined using western blot. All results shown are normalized to total protein. Results are expressed as mean ± SEM (n = 3–4), *P < 0.05, **P< 0.01. Statistical significance was determined by a one-way ANOVA with Dunnett’s post hoc test or two-way ANOVA with Bonferroni’s post hoc test.
49 SMIM20 gene transcription, in silico analysis of the SMIM20 promoter region was performed using two online web tools, Alibaba 2.1 (www.generegulation.com) and PROMO [319,320]. Alibaba 2.1 was used to identify putative estrogen response elements (ERE) and glucocorticoid response elements (GRE) sites in the 5’ flanking region (2000 base pairs upstream) of the Mus musculus SMIM20 gene. PROMO was used to identify other notable transcription factor binding sites. Alibaba 2.1 identified 1 ERE and two ERE half-sites, indicating there could be potential regulation of the SMIM20 gene by ER α or ERβ. Three full GRE sites and 1 half GRE site were identified in the SMIM20 promoter region, suggesting glucocorticoids may also play a role in the transcriptional regulation of the SMIM20 gene (Figure 3.8). Analysis using PROMO revealed multiple AR, PR, cAMP responsive element modulator (CREM), CCAAT/enhancer binding protein alpha (C/EBPα), specificity protein 1 (SP1) and activator protein 1 (AP-1) sites in the 5’flanking region of the Mus musculus SMIM20 gene. This indicates there may be potential regulation of the SMIM20 gene by androgens, progesterone, CREB, c-Fos and c-Jun.
3.7 Kisspeptin increases SMIM20 gene expression in the mHypoA- GnRH/GFP cell models
Kisspeptin exerts potent effects on GnRH neurons [321] and therefore it prompted investigation into kisspeptin mediated changes to SMIM20 gene expression. mHypoA- GnRH/GFP cells were treated with 10 nM kisspeptin-10 (KiSS-10) and RNA was isolated after 24 hours of treatment. qRT-PCR was used to determine SMIM20 gene expression. KiSS-10 treatment caused a 35% increase in SMIM20 mRNA compared to vehicle control after 24 hours (n = 7, P < 0.05) (Figure 3.9). These results suggest that kisspeptin increases SMIM20 gene expression in GnRH neurons. This rise in SMIM20 mRNA levels might augment the amount of SMIM20 protein translated and lead to higher levels of PNX in the hypothalamus, specifically in GnRH neurons. This could then feedback to increase the levels of Kiss-1 mRNA in kisspeptin neurons, forming a positive feedback loop or be important for action on the gonadotropes.
50
Figure 3.8 In silico promoter analysis of the 5’ flanking region of the Mus musculus SMIM20 gene. The sequence for the 5’ flanking region of the SMIM20 Mus musculus gene was obtained through Ensembl (2000 bp) then subsequently analyzed by the gene regulation program Alibaba 2.1 (www.generegulation.com) for the presence of estrogen responsive elements (EREs) or glucocorticoid responsive elements (GREs).
51
mHypoA-GnRH/GFP (24 hours)
1.5 *
1.0
0.5
0.0 Vehicle 10 nM Kisspeptin
Relative SMIM20 mRNA expression
Figure 3.9. Kiss-10 mediated regulation of SMIM20 mRNA expression in the mHypoA-GnRH/GFP neuronal cell line. Cells were treated with vehicle (water) or 10 nM Kiss-10 for 24 hours. SMIM20 mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 7), * P < 0.05. Statistical significance was determined by Student’s t-test.
52 3.8 Neither insulin nor dexamethasone regulate SMIM20 gene expression in the mHypoA-GnRH/GFP cell model
Because both insulin and glucocorticoids are central regulators of the reproductive axis [322,323], we tested if either could regulate SMIM20 mRNA expression in GnRH neurons. Also the presence of GREs in the SMIM20 promoter indicated glucocorticoids may regulate SMIM20 transcription. The mHypoA-GnRH/GFP cell line was treated with 10 nM insulin or 20 nM dexamethasone, a potent glucocorticoid receptor agonist, over 24 hours and RNA was isolated at 0, 1, 2, 4, 8, and 24 hours. I also treated the mHypoA- NPY/GFP cell line with 10 nM insulin to ensure it suppressed AgRP gene expression, indicating that the insulin was working effectively [324]. There was a 30% reduction at 4 hours in AgRP mRNA expression in the mHypoA-NPY/GFP cell line treated with 10 nM insulin (n = 5, P < 0.05) (Figure 3.10B) that indicated the insulin was functioning properly. However, there were no significant changes in SMIM20 mRNA expression with 10 nM insulin the mHypoA-GnRH/GFP cell line (Figure 3.10A), suggesting that insulin may not regulate SMIM20 in GnRH neurons at this concentration. Glucocorticoids are known to suppress GnRH mRNA [157] and therefore GnRH mRNA levels were measured alongside SMIM20 mRNA levels as a positive control. 20 nM dexamethasone suppressed GnRH mRNA expression at 2 hours by 50% (n = 3–4, P < 0.05) in the mHypoA-GnRH/GFP cell line (Figure 3.11B), demonstrating that the dexamethasone was functioning in our cell model. However, there were no significant changes in SMIM20 mRNA expression with 20 nM dexamethasone (Figure 3.11A), suggesting dexamethasone may not regulate SMIM20 expression at this concentration in GnRH neurons.
3.9 17β-estradiol does not appear to regulate SMIM20 mRNA expression in the mHypoA-Kiss/GFP-4 or mHypoA-50 cell models at 4 and 24 hours
As 17β-estradiol (E2) is a critical regulator of kisspeptin neurons, the effects of E2 on Kiss-1 and SMIM20 mRNA expression were examined in the AVPV mHypoA-
Kiss/GFP-4 and mHypoA-50 cell models. E2 stimulates the synthesis of Kiss-1 mRNA in
53 A mHypoA-GnRH/GFP 1.5 Vehicle 10 nM insulin
1.0
0.5
0.0 1 2 4 8 24 Relative SMIM20 mRNA expression Time (Hours)
mHypoA-NPY/GFP (4 hours) B
1.5
*
1.0
0.5
0.0
Relative AgRP mRNA expression Vehicle 10 nM insulin
Figure 3.10. Insulin mediated regulation of SMIM20 mRNA expression in the mHypoA-GnRH/GFP neuronal cell line. Cells were treated with vehicle (PBS) or 10 nM insulin for 24 hours. To confirm that insulin was working effectively, the (B) mHypoA-NPY/GFP cell line was also treated with insulin alongside the (A) mHypoA- GnRH/GFP. (A) SMIM20 and (B) AgRP mRNA expression was determined using qRT- PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 3–5), * P < 0.05. Statistical significance was determined by a two-way ANOVA with Bonferroni’s post hoc test or a Student’s t-test.
54 A mHypoA-GnRH/GFP
1.5 Vehicle 20 nM Dexamethasone
1.0
0.5
0.0 0 1 2 4 8 24 Relative SMIM20 mRNA expression Time (Hours)
B mHypoA-GnRH/GFP (2 hours)
1.5 *
1.0
0.5
0.0 Vehicle 20 nM Dexamethasone Relative GnRH mRNA expression
Figure 3.11. Dexamethasone mediated regulation of SMIM20 mRNA expression in the mHypoA-GnRH/GFP neuronal cell line. Cells were treated with vehicle (EtOH/ water) or 20 nM dexamethasone for 24 hours. (A) SMIM20 (n = 6-7) and (B) GnRH (n=3-4) mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM, * P < 0.05. Statistical significance was determined by a two-way ANOVA with Bonferroni’s post hoc test or a Student’s t-test.
55 the AVPV [208,255] and EREs in the SMIM20 promoter region suggest it may also be regulated by E2 [3]. The mHypoA-Kiss/GFP-4 and mHypoA-50 cells were treated with
10 and 100 nM E2 and RNA was isolated at 0, 4 and 24 hours after treatment. Kiss-1 and SMIM20 mRNA expression were measured using qRT-PCR. In the mHypoA-Kiss/GFP-4 cell lines there was a 1.5 fold increase in Kiss-1 mRNA expression at 4 hours with 100 nM E2 (n=5-6, P <0.05) (Figure 3.12C). 10 and 100 nM E2 increased Kiss-1 mRNA expression at 24 hours 1.8 and 2 fold respectively in the mHypoA-50 cell line (Figure 3.12D). However, there were no significant changes in SMIM20 gene expression in either the mHypoA-Kiss/GFP-4 (Figure 3.12A) or mHypoA-50 (Figure 3.12B) cell lines. This indicates that SMIM20 gene expression is not regulated at the times and concentrations tested in these AVPV cell models.
56
A B
mHypoA-Kiss/GFP-4 Vehicle mHypoA-50 Vehicle 10 nM E 1.5 2 1.5 10 nM E2 100 nM E 2 100 nM E2
1.0 1.0
0.5 0.5
0.0 0.0 4 24 4 24 Relative SMIM20 mRNA expression Relative SMIM20 mRNA expression Time (Hours) Time (Hours)
D C
mHypoA-Kiss/GFP-4 (4 hours) mHypoA-50 (24 hours)
2.0 * 1.5 * * 1.5 1.0
1.0 0.5 0.5
0.0 0.0 Vehicle 10 nM E 100 nM E Vehicle 10 nM E 100 nM E Relative Kiss-1 mRNA Expression Relative Kiss-1 mRNA Expression 2 2 2 2
Figure 3.12. 17β-estradiol mediated regulation of SMIM20 and Kiss-1 mRNA expression in the mHypoA-Kiss/GFP-4 and mHypoA-50 neuronal cell lines. Cells were treated with vehicle (EtOH/water), 10, or 100 nM 17β-estradiol (E2) for 24 hours. Kiss-1 mRNA expression was determined using qRT-PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM, (n = 5–6),* P < 0.05. Statistical significance was determined by a one-way or a two-way ANOVA with Bonferroni’s post hoc test.
57
Chapter 4
Discussion
58 4.1 General Discussion PNX is a novel reproductive peptide proposed to be involved in the regulation of the HPG axis, where it may sensitize the anterior pituitary to GnRH, particularly before the pre-ovulatory surge in females [3]. However, PNX may have other roles in the regulation of reproductive function that have yet to be defined, specifically in the hypothalamus. siRNA knockdown of PNX by ICV injection interrupted estrus cyclicity in female rats [3], a process that is centrally regulated by the hypothalamus. This disruption in the estrous cycle could have been the result of dysregulated PNX signalling to hypothalamic GnRH and kisspeptin populations and the anterior pituitary. PNX may be involved in the regulation of GnRH and kisspeptin populations, which control reproductive function. Therefore, I was interested in determining the role of the SMIM20 cleavage product PNX-20 in GnRH and kisspeptin neuronal populations of the hypothalamus. Due to the heterogeneous nature of the hypothalamus, it is difficult to study the direct effects of PNX-20 on various neural populations in vivo, so I took an in vitro approach using immortalized cell lines developed by our laboratory. To study the role of PNX-20 in reproductive hypothalamic neurons, the mHypoA-GnRH/GFP cell line was used as a model for GnRH neurons, and the mHypoA-Kiss/GFP-3, mHypoA-Kiss/GFP- 4, mHypoA-50, and mHypoA-55 cell lines were used as models for the two known kisspeptin populations [4]. Through the use of these cell models, it was possible to examine the transcriptional, secretion, and signalling events evoked by PNX-20 in both GnRH and kisspeptin neurons. Previous screening of the cell lines in our laboratory has demonstrated the presence of GnRH, GPR54 and SMIM20 mRNA expression in the mHypoA-GnRH/GFP cell lines, making them suitable to study the regulation of GnRH and SMIM20 mRNA by PNX-20. The mHypoA-Kiss/GFP-3 and -4 cell lines express both Kiss-1 and SMIM20 mRNA therefore could be used to study Kiss-1 mRNA regulation. The expression of SMIM20 in these cell lines suggests that PNX-20 is synthesized by both kisspeptin and GnRH neurons. In GnRH neurons, GnRH feeds back to auto-regulate both GnRH peptide secretion and mRNA synthesis [325,326]. PNX-20 may also auto-regulate the hypothalamic neurons in which it is expressed or feedback to regulate other hypothalamic
59 neuropeptides via autocrine mechanisms. Immunohistochemistry revealed high expression of PNX in the periventricular and arcuate nuclei, both regions important for kisspeptin synthesis [3]. PNX may be involved with the autocrine regulation of kisspeptin neurons or signal through paracrine mechanisms to other neurons in the local region, including GnRH neurons. The current studies establish a role for PNX-20 in the regulation of both GnRH and kisspeptin neurons. In GnRH cell models, PNX-20 regulated GnRH mRNA and protein expression and GnRH secretion. While in kisspeptin cell models, PNX-20 increased Kiss-1 mRNA expression. PNX is a stimulatory neuropeptide in the anterior pituitary and also appears to be in both GnRH and kisspeptin neurons (Figure 4.1). These neurons are central regulators in the HPG axis and delineating the mechanisms for their regulation is crucial for reproductive physiology. These studies also identify pCREB and pERK1/2 as downstream targets for PNX, implicating the AC/cAMP and PLC/MAPK pathways as potential mediators of PNX signalling. Interestingly, kisspeptin was found to be a regulator of GnRH neuronal SMIM20 mRNA expression. There may be reciprocal interactions between kisspeptin and PNX neurons so they positively stimulate each other. Together, these studies suggest PNX may be involved in the positive regulation of the HPG axis at the level of both kisspeptin and GnRH hypothalamic neurons. These findings suggest that PNX could potentially play a role in the tonic regulation of GnRH neurons, the generation of the GnRH/LH surge, and the initiation of puberty and therefore have implications for reproductive disorders.
4.2 Regulation of GnRH Neuronal Models by PNX-20 These are the first studies implicating a direct stimulatory role for PNX-20 on GnRH neurons. It is widely recognized that GnRH neurons are the convergence point for a wide array of neuropeptides and hormones [8]. The summation of effects on GnRH neurons ultimately determines the output to the gonadotropes. Alongside kisspeptin, E2, GCs, nutrients, and neurotransmitters, PNX-20 appears to be an additional player in the
60
Figure 4.1 Representative model summarizing the regulation of the HPG axis by PNX. Previous studies have demonstrated that PNX increases GnRH-R mRNA at the level of the anterior pituitary. We have established that PNX can also act upstream in GnRH and Kisspeptin neurons. In GnRH neurons PNX increases GnRH mRNA and protein levels and GnRH secretion. In kisspeptin neurons, PNX increases Kiss-1 mRNA expression. Kisspeptin was also found to increase SMIM20, the PNX precursor, mRNA expression in GnRH neurons.
61 complex regulation of the GnRH neuron [78]. Immunohistochemistry in the hypothalamus revealed PNX expression in multiple regions, including in the Arc and PeN which are both regions that classically express kisspeptin [4]. It is well established that many kisspeptin immunoreactive fibers form close appositions with GnRH neurons in the preoptic area and ME [193,194,195,236] to regulate both the expression [238] and secretion of GnRH and to increase neuronal firing of GnRH neurons [175,216]. Mounting evidence suggests kisspeptin also signals through intermediary neurons, such as GABA- or NPY-expressing cells, to exert effects on GnRH neurons [327,328,329]. PNX could be released from the same synaptic terminals as kisspeptin onto GnRH neurons or interneurons to help stimulate GnRH transcription, translation, and secretion. Further characterization of PNX-20 co-localization with kisspeptin in vivo will need to be carried out to determine how these two peptides may be interacting. 10 nM PNX-20 induced c-Fos gene expression in the mHypoA-GnRH/GFP cell line, indicating that PNX-20 activated GnRH cells [317,330] and these neurons are PNX- 20-responsive. Second messenger systems activate c-Fos, including Ca2+ influx after depolarization through voltage-dependent Ca2+ channels [331]. This suggests PNX may depolarize the cells. Interestingly, although there was an increasing trend, 100 nM PNX- 20 did not significantly increase c-Fos mRNA expression. PNX-20 may have concentration dependent effects, whereby higher doses of the peptide do not activate the neurons. This type of biphasic dose-dependent effect is observed with other neuropeptidergic systems, for example with the endocannabinoid system and the GPCR cannabinoid 1 receptor CB1. Low doses of receptor agonists activate a Gs mechanism on
CB1 to enhance PKA and neuronal activity, while high doses activate a Gi on CB1 to reduce PKA activity and close voltage-gated channels [332]. The PNX receptor, similarly to CB1, may have the potential to activate both Gs and Gi proteins to potentiate dose- dependent effects. PNX-20 also increased GnRH mRNA expression, which could be a result of transcriptional or mRNA stability changes. If this increase is a result of transcriptional changes, GnRH mRNA may have been induced by the activation of the c-Fos signalling cascade or by one of the many TFs induced by c-Fos. The GnRH promoter region contains AP-1 sites for the binding of c-Fos and c-Jun transcription factors, which could
62 activate GnRH mRNA transcription [78]. However, since PNX-20 increased GnRH mRNA levels with both 10 and 100 nM PNX-20, but c-Fos with only 10 nM PNX-20, c- Fos may not be the only mediator of PNX-induced changes to GnRH mRNA levels. The GnRH 5’ flanking region has been previously characterized and is highly conserved between species [78]. Several transcription factors are critical for the regulation of GnRH transcription and these may be regulated by PNX-20 to increase GnRH mRNA transcripts. Octamer binding transcription factor-1 (Oct-1) binding motifs have been identified in the rGnRH-I promoter and enhancer regions and mutations to these motifs caused a 95% reduction in transcriptional activity [333]. Two GATA factor- binding sites were also identified in the GnRH-I enhancer region, mutation experiments demonstrated that both are necessary for full enhancer activity [334,335]. In the proximal promoter region, there is a conserved orthodenticle homeobox (Otx) motif that binds Otx2 transcription factors [336], and overexpression of Otx2 in GT1-7 and GN11 cells induced GnRH-I promoter and transcriptional activity [78]. Otx2 has been co-localized to GnRH neurons in mice [337], and its deletion results in significant reproductive abnormalities [338]. Interestingly, Novaira et al. demonstrated that kisspeptin regulated GnRH mRNA by increasing Otx2 binding to the enhancer region of the mGnRH-I gene [339]. These experiments indicate that Otx2 is important for GnRH mRNA expression and reproductive competence and, therefore, may mediate the PNX induced effects on GnRH mRNA expression along with Oct-1, GATA and other transcription factors. Further characterization of the transcription factors activated by PNX-20 will be required to elucidate these mechanisms. PNX may also have increased GnRH mRNA expression by improving mRNA stability in the mHypoA-GnRH/GFP neurons. Micro RNAs (miRNAs) have recently become recognized as important for the regulation of mRNA stability, mRNA translation and for protein secretion. miRNAs are 21-nucleotide gene products that hybridize with the complementary 3’ untranslated region (UTR) of mRNA to sequester them into protein complexes that degrade or inhibit the translation of the mRNA [340]. Several miRNAs that regulate the HPG axis have been characterized, including miR-361-3P, an X-linked miRNA that inhibits FSH secretion from gonadotropes [341], and miR-132 and miR-122 that are upregulated by GnRH in the LβT2 gonadotrope cell line [342]. To stimulate
63 GnRH expression and secretion, PNX may inhibit the expression of particular miRNAs that repress GnRH biosynthesis. To determine if PNX-20 directly increases the transcription of GnRH mRNA, or whether it improves the stability of mRNA transcripts, transcriptional inhibitor experiments should be performed (See Section 4.7 Future Directions). PNX-20 did not affect SMIM20 mRNA expression in the mHypoA-GnRH/GFP cell model. This indicates that it is not involved regulating its own expression in GnRH neurons at the times and concentrations studied. However, PNX-20 may regulate SMIM20 at other time points or through post-transcriptional or post-translational processes. This might include the regulation of the cleavage of PNX-20 from the SMIM20 protein or regulation of SMIM20/PNX vesicular transport. PNX-20 may also regulate SMIM20 in other hypothalamic nuclei. Intriguingly, PNX-20 also induced GnRH secretion and measured GnRH protein levels, along with increasing GnRH mRNA levels. Kisspeptin also stimulates all three processes in GnRH cell models [238]. The molecular mechanisms for PNX-induced GnRH secretion have yet to be determined. Drawing from kisspeptin signaling cascades, the PLC/MAPK pathway could be activated. This pathway increases intracellular Ca2+ and stimulates GnRH neuronal depolarization and action potential firing rate [10]. These events occur through the closure of inwardly rectifying potassium channels (Kir) and activation of non-selective cation channels [278,327]. As will be discussed in Section 4.4, PNX-20 increased ERK1/2 phosphorylation in the mHypoA-GnRH/GFP cell model, suggesting there may be activation of the PLC/MAPK pathways. This suggests the PLC/MAPK pathways could be involved in the regulation of GnRH biosynthesis and secretion by PNX-20. GnRH secretion can also be induced by cAMP, through the activation of cAMP-gated cation channels [343,344], suggesting PNX-20 may have also activated the AC/cAMP pathway (Further discussed in Section 4.4). SNP, a nitric oxide (NO) donor, is a potent stimulant for GnRH secretion as demonstrated in in vitro experiments in the GT1-7 and mHypoA-GnRH/GFP cell models [305,318]. SNP releases NO allowing it to bind to guanylyl cyclase to increase the production of cyclic guanosine monophosphate (cGMP). cGMP activates cGMP-gated ion channels causing depolarization of GnRH neurons and subsequent GnRH protein
64 secretion [318]. SNP was used to stimulate GnRH peptide release from the mHypoA- GnRH/GFP neurons after a PNX 24 hour pre-treatment to determine if intracellular stores of GnRH were increased. Since the 24 hour PNX-20 pre-treatment stimulated GnRH protein production, the intracellular stores of GnRH increased, and higher levels of GnRH were released upon stimulation with SNP. GnRH protein biosynthesis induced by PNX-20 could be a result of increased GnRH mRNA levels, which was observed, or from post-transcriptional regulatory mechanisms. Mechanisms regulating protein turnover rates, including regulation by miRNAs, could account for the changes in GnRH protein levels. The induction of GnRH secretion by PNX was only observed with 1000 nM PNX, a 10 x higher concentration than was required to increase GnRH mRNA. Depending on the concentrations of PNX-20 found in the hypothalamus, GnRH secretion might only be induced when PNX-20 levels are elevated. Kisspeptin expression changes across the estrous cycle and peaks before ovulation [213]. Perhaps PNX-20 levels also fluctuate during the estrous cycle and are highest before the GnRH/LH surge. Increased levels of PNX-20 in proestrous would stimulate GnRH secretion in GnRH neurons to help induce the surge. In the original paper describing PNX, GnRH stimulated LH release was only increased with 1000 nM PNX and not 100 nM PNX [3]. It was hypothesized that if PNX sensitizes the pituitary to GnRH by increasing GnRH-R, higher levels of LH will be released from the pituitary and therefore PNX may be helping produce the LH surge [3]. As both GnRH secretion and GnRH-R mRNA levels increased with 1000 nM PNX-20 treatment, this higher concentration of PNX may be critical for inducing the GnRH/LH surge. The dose-dependent effects of PNX-20 might be mediated through a biphasic receptor or by differences in the number of receptors on the cell surface. PNX receptor levels may fluctuate during the estrous cycle to cause changes in the cellular responsiveness to PNX. PNX may also be the ligand for more than one receptor. These receptor subtypes could have different affinities for PNX and mediate the activation of separate downstream signalling cascades, such as seen with NPY [345]. Future studies will need to elaborate on the mechanisms through which PNX regulates GnRH mRNA, protein, and secretion; however, elucidating a role for PNX in the GnRH neuron has important implications for reproductive physiology. PNX may be
65 involved in the initiation of puberty, generation of GnRH pulsatility and regulation of GnRH throughout the female menstrual cycle. As GnRH is the target for extensive reproductive therapies in hormone-dependent diseases and for in vitro fertilization, it is conceivable that PNX or PNX antagonists could be used as an alternative therapy to stimulate or suppress GnRH signalling.
4.3 Regulation of Kisspeptin Neuronal Models by PNX-20 Interestingly, PNX-20 also has a role in the regulation of kisspeptin neurons. Two cell lines micro-dissected from Kiss-GFP mice, representing the Arc and AVPV kiss cell populations, were used to examine the effects of PNX-20 on Kiss-1 gene expression. The mHypoA-Kiss/GFP-3 cell line was isolated from the female Arc nucleus, while the mHypoA-Kiss/GFP-4 cell line was isolated from the female AVPV. After 24 hours of PNX-20 treatment, Kiss-1 mRNA increased 2-fold in both cell lines, suggesting a non- specific effect on Kiss-1 mRNA, regardless of the hypothalamic kisspeptin population. Two adult clonal kisspeptin cell models, the mHypoA-50 (AVPV) and mHypoA-55 (Arc), were used to confirm the effects on Kiss-1 mRNA expression. Surprisingly, only the AVPV clonal cell showed increased Kiss-1 mRNA expression after PNX treatment. As the clonal lines are representative of only one neuron from the region, it is plausible that only certain subpopulations in the Arc express the PNX receptor and respond to PNX treatment. The mHypoA-55 cell model may represent a neuron that does not express high levels of the PNX receptor while other Arc neurons may have high expression of the PNX receptor, just as only 11–25% of Arc neurons express ERβ [188]. In the mHypoA- 50 model, there was only a 30% increase in Kiss-1 mRNA, compared to the 2-fold increase observed in the GFP cell models. As in the Arc, there is heterogeneity between AVPV neurons, with only 21–31% expressing ERβ and 51–68% expressing TH [188]. This heterogeneity could explain why the mHypoA-Kiss/GFP-4 cell line was more responsive to PNX-20 then the mHypoA-50 cell line, even though both lines originate from the AVPV. Utilizing a cell model representative of a heterogeneous cell population, instead of a clonal cell model, gives a more accurate representation of the overall activity in this region. Clearly, Arc kisspeptin neurons have a response to PNX; however, this may not be evident with the use of only the mHypoA-55 cell model. These studies also
66 highlight the differences between neurons in each population and indicate that we need to further develop our understanding of these subpopulations. Hormonal regulation of kisspeptin neurons is necessary for the control of GnRH neurons [346], and, therefore, PNX-20 may indirectly regulate GnRH neurons by regulating Kiss-1 mRNA. Kisspeptin is involved in generating the pre-ovulatory surge in GnRH neurons and for the tonic regulation of GnRH secretion. PNX-20 may stimulate these processes by increasing Kiss-1 mRNA expression and likely a concomitant increase in kisspeptin. Since the hypothalamic knockdown of PNX with siRNA prolonged the estrous cycle of female cycling rats [3], it could be hypothesized that Kiss-1 or GnRH mRNA levels were disrupted. The upregulation of GnRH-R mRNA was also specific to female rats [3] and therefore PNX may be primarily involved in the regulation of the female rather than the male reproductive system. A potential role could be in the initiation of the pre-ovulatory surge in female AVPV neurons, as mentioned previously in
Section 4.2. The AVPV relays the positive feedback of E2 to GnRH neurons to generate the LH/GnRH surge [213,258]. The AVPV is a sexually dimorphic region that is larger among female rodents [193,204,210] and Kiss-1 mRNA expression is highest right before the surge [210]. By increasing Kiss-1 mRNA in the AVPV, PNX-20 may be involved in generating the rise in kisspeptin that induces the GnRH/LH surge (Figure 4.2, detailed explanation in Section 4.4). We can speculate that PNX-20 could also be involved in the GnRH pulse generator. In the Arc, kisspeptin is important for the pulsatile release of GnRH [10]. Reciprocal connections between Arc KNDy neurons and their output to GnRH neurons stimulate pulsatile GnRH release. NKB stimulates reciprocal KNDy neurons while Dyn inhibits them, ultimately influencing the release of kisspeptin to GnRH neurons [261]. PNX-20 may be part of signalling between KNDy neurons, alongside NKB and Dyn, and influence the system by increasing Kiss-1 mRNA in reciprocal neurons. Kisspeptin produced by PNX-20 would then stimulate the release of GnRH in the mPOA (Figure 4.3). Future studies should explore how PNX-20 interacts with other Arc kisspeptin neuropeptides, including NKB and Dyn, both which are necessary for the GnRH pulse generator [10].
67
Figure 4.2 Schematic illustration of the positive feedback loop between kisspeptin and PNX to generate the GnRH/LH surge. In this hypothetical model, increasing levels of E2 during proestrous (late follicular phase in primates) increases kisspeptin in the AVPV. Kisspeptin then stimulates the production of GnRH synthesis and secretion in GnRH neurons. This generates the GnRH surge which increases LH in the anterior pituitary. PNX also stimulates the production and secretion of GnRH in GnRH neurons and increases kisspeptin in the AVPV. Kisspeptin feeds back to PNX neurons and increases the biosynthesis of PNX. Ultimately, this cycle induces the GnRH surge, which stimulates the LH surge in the anterior pituitary. E2 may also influence PNX, however this still needs further characterization.
68
Figure 4.3. Schematic illustration of the proposed role for PNX in the GnRH pulse generator. In this hypothetical model, PNX is released from Arc KNDy axon terminals to other Arc KNDy neurons alongside NKB (stimulatory peptide) and Dyn (inhibitory peptide). PNX stimulates the biosynthesis of kisspeptin and perhaps secretion of kisspeptin from these neurons. The stimulatory and inhibitory actions of this network cause the pulsatile release of kisspeptin onto GnRH neurons in the POA to stimulate pulsatile GnRH secretion. PNX may also be released onto GnRH neurons to help stimulate GnRH secretion.
69 The stimulation of kisspeptin by PNX-20 may also be important for initiation of puberty. Kisspeptin neurons are critical for the onset of puberty, as both humans and rodents with GPR54 mutations fail to reach reproductive maturity [183,184]. PNX-20 could induce the distinctive rise in Kiss1 expression before puberty. Currently, the mechanisms initiating pubertal onset are undefined, but as hypothesized by Terasawa et al., the timing of puberty relies more heavily on upstream afferents rather than kisspeptin neurons themselves [245]. These might include NPY or GABA inputs. PNX afferents, in concert with NPY and GABAergic inputs, may help initiate puberty by increasing Kiss-1 mRNA expression and kisspeptin release [246,249]. PNX may also be synthesized in kisspeptin neurons, but, similarly to NKB and Dyn [188], may be secreted onto other kisspeptin neurons to increase Kiss-1 mRNA expression. Characterization of PNX inputs to kisspeptin neurons will be required to elaborate on this mechanism. PNX-20 increased Kiss-1 mRNA after 24 hours but induced GnRH mRNA after only 2 hours, indicating multiple downstream effectors are activated upon the stimulation with PNX-20. It could be that multiple transcription factors are stimulated by PNX-20, causing changes to gene expression at different times. As mentioned in Section 4.2, PNX-20 may activate GnRH mRNA transcription directly or by increasing mRNA stability. Epigenetic modifications also regulate gene expression. These are modifications to the chromatin structure not attributable to the nucleotide sequence alone [347]. Tomikawa et al. recently characterized histone modifications in the Arc and AVPV in response to E2. E2 increased histone acetylation of the Kiss-1 promoter in AVPV/PeN while reducing it in the Arc, identifying a possible mechanism behind the dual response of kisspeptin neurons to E2 [348]. PNX might induce histone acetylation or reduce histone or DNA methylation in kisspeptin neurons to improve the accessibility of the chromatin to TFs, ultimately for increased transcription of Kiss-1 [347]. Alternatively, PNX-20 might act directly on TFs to promote Kiss-1 promoter activity. To date, the promoter for the Kiss-1 gene is not well characterized [347] and further studies must be conducted to identify the TFs and binding sites necessary for the induction of gene expression. Identifying a role for PNX-20 in kisspeptin neurons has significant implications for reproductive physiology. Kisspeptin neurons are important for the regulation of the
70 GnRH neuron and necessary for GnRH pulsatility, the GnRH/LH surge and puberty. PNX-20 may be involved in the regulation of these three processes by increasing Kiss-1 mRNA. PNX may work in concert or alongside kisspeptin to stimulate GnRH synthesis and secretion. Kisspeptin antagonists are being considered as alternatives to GnRH agonists and antagonists for therapeutics [349]. GnRH agonist and antagonist treatments reduce gonadotropin secretion; however, there is a consequent suppression of gonadal steroids. This reduction in gonadal steroids can have severe side effects including bone loss and hot flushes [349]. Using kisspeptin antagonists, LH pulsatility can be reduced and sex steroids lowered without the complete abrogation of gonadal steroid production [349]. This is beneficial for disorders such as endometriosis and uterine fibroids, where partial reduction of sex steroids can improve the condition of the patient without consequent side effects [349]. As PNX appears to work in concert with kisspeptin, PNX antagonists also hold a similar promise for lowering LH pulsatility, without the negative side-effects. PNX antagonists would also reduce kisspeptin expression ultimately supressing GnRH and LH secretion. Once the role for PNX in GnRH and kisspeptin neurons is more thoroughly characterized, PNX may have potential to improve the outcomes of reproductive disorders.
4.4 Signal Transduction Pathways Activated by PNX-20 Currently the receptor for PNX is unknown; however, because it stimulated an increase in cAMP in pituitary adenoma cells and many reproductive neuropeptides act through GPCRs, it has been suggested that PNX may also bind to either a Gαs, Gαi, Gα q/11 or Gα12/13 coupled receptor [3,292]. Interestingly, pre-treating the mHypoA- GnRH/GFP neurons with PNX-20 for 24 hours abrogated the PNX-20 induced increase in GnRH secretion. Desensitization of GPCRs is an important physiological feedback mechanism that prevents chronic receptor stimulation. It involves the receptor uncoupling from the G protein by phosphorylation, internalization of the receptor, and eventual downregulation of the total cellular concentration of receptors [350]. The PNX-20 pre- treatment may have desensitized the neurons to further PNX-20 treatment and caused internalization of the receptors, suggesting the receptor could be a GPCR. Further studies should be performed to elucidate the orphan receptor for PNX. Determining the receptor
71 for PNX will help to identify other hypothalamic regions it may stimulate, elucidate further functions for this novel peptide and develop our understanding of its signalling cascades and potential desensitization mechanisms. We measured the phosphorylation of key signalling molecules after PNX-20 treatment to help elucidate the mechanism through which PNX-20 may increase GnRH- R, GnRH, and Kiss-1 mRNA expression and GnRH protein secretion. PNX-20 increased the relative levels of pCREB and pERK1/2 in the mHypoA-GnRH/GFP cells and pCREB in the mHypoA-Kiss/GFP-3 and 4 cell lines after 5 minutes. This suggests there is likely activation of a Gαs coupled GPCR leading to the phosphorylation of CREB through the activation of the AC pathway. Cross talk from this pathway may activate the MAPK pathway leading to the phosphorylation of ERK1/2 in GnRH cells. There could also be activation of a Gαq/11 in the GnRH cell line leading to the activation of the PLC pathway (Figure 4.4). CREB is a TF, expressed in most hypothalamic neurons and is phosphorylated after PNX-20 treatment. It signals by binding to specific Ca2+-cAMP responsive elements (CRE) in the promoter region of target genes and activates cellular events that alter the intracellular levels of cAMP or Ca2+ [351]. The GnRH gene has regions that bind CREB to regulate its transcription [78]. pCREB is elevated by E2 in GnRH neurons to mediate the negative feedback from the gonads [352]. Interestingly, mice with GnRH neuron specific CREB deletion have disrupted estrous cycles, with particularly long diestrous periods and shortened estrous phases [353]. A similar dysfunction in estrous cyclicity was observed in PNX siRNA KO rats, who also had prolonged diestrous periods [3]. If PNX signal transduction relies on the phosphorylation of CREB, CREB KO animals and PNX KO animals may display similar phenotypes. In a theoretical PNX KO model, GnRH gene expression, protein levels and secretion from GnRH neurons would be reduced, which could prevent the GnRH/LH surge and prolong the diestrous phase. Together, these studies suggest PNX-20 may signal through pCREB to increase the activity in GnRH neurons (Figure 4.5). Similarly in kisspeptin cells, CREB may be important for PNX signal transduction. A CREB binding site was located on the Kiss-1 gene for CREB and CREB- 1 regulated transcription co-activator-1 (Crtc1) TFs [354]. Knockdown of Crtc1, a TF
72
Figure 4.4. Representative model summarizing the proposed pathways activated by
PNX-20. The activation of an orphan GPCR by PNX-20 likely activates a Gαs type GPCR leading to the activation of the adenylate cyclase/cAMP pathway which results in the phosphorylation of CREB. There could also be the activation of a Gαq/11 coupled GPCR in the GnRH cell model leading to the activation of the PLC/MAPK pathways and resulting in the phosphorylation of ERK1/2. ERK1/2 may also be phosphorylated by crosstalk from the AC pathway.
73
Figure 4.5 Representative model summarizing the proposed mechanisms involved in the regulation of GnRH neuron activity by PNX-20 in mHypoA-GnRH/GFP cell model. The receptor for PNX is hypothesized to be an orphan GPCR. We report that PNX-20 increases the phosphorylation of CREB and ERK1/2, c-Fos and GnRH mRNA expression, intracellular levels of GnRH, and GnRH secretion.We propose that either the AC or PLC/MAPK pathways are activated by stimulation of the PNX receptor and induce changes in GnRH mRNA levels, GnRH protein levels, and GnRH secretion. The orphan GPCR probably activates the AC pathway via a Gαs and there is crosstalk to activate the MAPK pathway leading to the phosphorylation of ERK1/2. Dotted line (to be elucidated).
74 that binds with CREB to induce or repress gene expression, caused a significant reduction in Kiss-1 mRNA expression in mice [354]. In human embryonic kidney HEK cells, expression of a dominant negative CREB inhibitor blocked the forskolin and A23187 induction of a KiSS-1 reporter gene [354]. Chromatin immunoprecipitation assays (ChIPs) confirmed the binding of CREB and Crct1 to the Kiss-1 promoter in GT1-7 cells. The phosphorylation of CREB in both the mHypoA-Kiss/GFP-3 and 4 cell models in response to PNX could directly induce the transcription of the Kiss-1 gene through CREB binding elements (Figure 4.6). The increased phosphorylation of CREB in the mHypoA-GnRH/GFP, mHypoA- Kiss/GFP-3 and mHypoA-Kiss/GFP-4 cells by PNX-20 suggests that PNX-20 may stimulate a Gαs-type GPCR and activate the AC/cAMP pathway. Gαs GPCRs activate AC to stimulate the production of cAMP. cAMP activates protein kinase A (PKA) and leads to the phosphorylation of CREB. These studies corroborate previous data demonstrating PNX increased cAMP levels in rat pituitary adenoma cells [288]. Many neuropeptides, including CRH, signal through Gαs-type GPCRs to regulate the transcription, translation and secretion of peptides. For example, to induce exocytosis of
ACTH, CRH stimulates a Gαs GPCR which increases cAMP, activates PKA and opens L-type Ca2+ channels to cause an influx of Ca2+ and the subsequent release of vesicles [355]. A similar mechanism may be responsible for inducing PNX-20 mediated GnRH secretion. Interestingly, a coupling between elevated cAMP and increased GnRH vesicle release has been established in GT1 neurons [344]. This has been demonstrated with dopamine, noradrenaline and forskalin treatments, all which stimulate the AC pathway [356,357,358]. The rise in intracellular cAMP opens cAMP-gated cation channels to stimulate GnRH vesicle release [343,344]. As PNX has previously been shown to increase cAMP and the current studies suggest the activation of the AC pathway, PNX may also increase GnRH secretion through this same pathway. Interestingly, only 10 nM PNX-20 activated CREB in the GnRH neurons while 100 nM PNX-20 activated CREB in kisspeptin neurons. This suggests GnRH neurons might be more sensitive to PNX; perhaps they have more PNX receptors than kisspeptin neurons, or a second type of receptor with a higher affinity for PNX. However, 100 nM
75
Figure 4.6 Representative model summarizing the proposed mechanisms involved in the regulation of kisspeptin neuron activity by PNX-20 in mHypoA-Kiss/GFP-3 and -4 cell models. The receptor for PNX is hypothesized to be an orphan GPCR. We report that PNX-20 increases the phosphorylation of CREB and increases Kiss-1 mRNA expression. We propose that the AC pathway is activated by stimulation of the PNX receptor. This pathway may induce changes to Kiss-1 mRNA expression. Future studies should explore whether PNX-20 increases the secretion of kisspeptin. Dotted line (to be elucidated).
76 PNX-20 increased GnRH mRNA levels in GnRH neurons and 1000 nM PNX-20 increased GnRH secretion, even though no activation of CREB was observed at 100 nM PNX-20 (1000 nM was not tested). Although CREB may be involved in the regulation of GnRH gene transcription, as described above, other intracellular signalling molecules that have not yet been explored are likely also important for GnRH gene expression and secretion. These might include p38, a transcription factor activated by kisspeptin [329], or pSTAT3, a transcription factor regulated by the metabolite GnRH (1-5) and other neuropeptides [359]. Perhaps the AC pathway is activated by higher concentrations of PNX-20; however, CREB is not phosphorylated. This would increase cAMP for the induction of GnRH secretion as was observed with 1000 nM PNX-20 and perhaps activate alternative pathways to increase GnRH mRNA levels. Using pharmacological inhibitors to the AC pathway could help to confirm the involvement of this pathway in PNX-20 signal transduction (See Section 4.7 Future Directions). Further research will need to characterize the precise mechanisms mediating the PNX-20 induced activation of CREB. The phosphorylation of ERK1/2 was specific to GnRH neurons and could represent crosstalk with cAMP from the AC pathway to the MAPK pathway. cAMP is able to stimulate the MAPK pathway by binding to the cAMP-guanadine exchange factor I or II (Epac I and Epac II), which serves as a guanosine 5’-triphosphate (GTP) exchange factor to activate Rap1 [360]. The small GTPase, Rap1, subsequently activates the serine/threonine kinase, B-Raf, which phosphorylates mitogen-activated protein kinase kinase (MEK) [360,361,362,363]. This mechanism is activated in corticotrophs where in corticotropin-releasing hormone (CRH) stimulates a Gαs GPCR to increase the production of cAMP. cAMP then activates the MAPK pathway to increase the transcription of proopiomelanocortin [364]. Alternatively, if PNX has more than one target receptor, phosphorylation may also be caused by the induction of a Gq/11 G-protein coupled receptor that activates the PLC/MAPK pathway. This type of cell-specific activation has been seen with other neuropeptides, including kisspeptin, which was shown to activate both ERK1/2 and p38 in certain NPY neurons, while only activating ERK1/2 in other NPY neurons [329].
77 Similar to pCREB, ERK1/2 is implicated in the regulation of the GnRH gene and for the stimulation of GnRH secretion through MAPK pathways [238,278]. Kisspeptin binds to GPR54, a Gq/11 GPCR, causing the downstream activation of PLC and PKC enzymes. PKC phosphorylates ERK1/2 leading to GnRH mRNA transcription [238] and the activation of Kir and non-selection cation channels to depolarize and subsequently release GnRH vesicles [278]. Since PNX also induces the phosphorylation of ERK1/2, it is plausible that it increases GnRH mRNA levels and secretion through a similar pathway as kisspeptin. Future studies using pharmacological inhibitors to the MAPK pathways will have to confirm their involvement with PNX signal transduction. PNX responsive regions of the GnRH promoter should also be determined to identify important binding motifs and TFs involved in signal transduction (See Section 4.7 Future Directions). Together, these are the first experiments to explore PNX signalling cascades in GnRH and kisspeptin neurons. From these observations, we can conclude that different pathways are activated depending on the cell type and pCREB and pERK1/2 may both be important for PNX stimulation of GnRH and Kiss-1 mRNA expression, GnRH protein synthesis and GnRH secretion. Further characterization will need to be performed to elaborate on the precise mechanisms involved with PNX signalling.
4.5 Regulation of SMIM20 Gene Expression As PNX has emerged as an important player regulating the HPG axis, determining how other neuropeptides affect PNX expression is critical for a complete understanding of the PNX neuropeptidergic system. Exploring how other systems are involved with PNX may potentially reveal additional functions for PNX and the interplay of these physiological networks. Therefore, I sought to determine how particular hormones regulate the gene for PNX, SMIM20. First a screening of the Mus musculus SMIM20 5’ flanking promoter region was conducted using the transcription factor binding site prediction tool Alibaba 2.1 and PROMO to determine potential regulators of the SMIM20 gene. Multiple steroid binding sites were identified for ERs, GRs, ARs, and PRs. This suggests that steroid hormones may transcriptionally regulate SMIM20. Steroid hormones can also signal through non- classical binding sites, including AP-1 or c/EBPalpha sites using c-Fos and c-Jun or other
78 co-activators [365]. CREM sites were also identified, indicating CREB may also be involved in the regulation of SMIM20. These programs only identify sequence motifs ideal for TF binding but TFs can also interact with imperfect binding sites or motifs that have yet to be identified. Thus, further experiments using ChIP are needed to determine what factors bind to the SMIM20 gene. GnRH neurons are regulated by a myriad of factors, including metabolic regulators (insulin), stress factors (glucocorticoids), and reproductive peptides (kisspeptin) [78]. Insulin and kisspeptin both increased GnRH levels and secretion in GT1-7 cell models [166,167,238], while glucocorticoids repressed the expression and secretion of GnRH in vitro [150,151,152]. Therefore, as GnRH neurons express SMIM20 mRNA, we explored whether these reproductive regulators could govern the expression of the novel reproductive peptide PNX. Although both insulin and dexamethasone stimulated gene expression changes in the GFP cell models, neither had significant effects on SMIM20 mRNA expression indicating they do not directly regulate SMIM20 mRNA levels in this GnRH cell model. However, both insulin and glucocorticoids could be important for post-translational modifications or even for the regulation of PNX cleavage from SMIM20. Alternatively, although no effects were observed in the GnRH cell model, these hormones may initiate transcriptional or post-transcriptional changes in other PNX-expressing hypothalamic or pituitary cells, such as kisspeptin neurons. Kisspeptin, unlike insulin or dexamethasone, increased SMIM20 mRNA expression in the mHypoA-GnRH/GFP neurons suggesting there may be a reciprocal stimulatory interaction between PNX and kisspeptin. PNX increases Kiss-1 mRNA levels in kisspeptin neurons and this may feedback to increase SMIM20 transcription, ultimately leading to an increase in PNX protein. This cycle could be used to help drive the increase in Kiss-1 mRNA expression seen around the time of puberty in the AVPV and Arc neurons [232] or during proestrus, before the GnRH/LH surge, in the AVPV [213]. E2 may also be involved in this cycle between kisspeptin and PNX. E2 could trigger a rise in kisspeptin levels in the AVPV (important for inducing the LH surge) and kisspeptin could feed onto GnRH neurons to increase SMIM20 mRNA expression, subsequently increasing PNX protein levels. PNX can then stimulate GnRH synthesis and secretion
79 from GnRH neurons and also positively feedback to kisspeptin neurons to potentiate this cycle. Hypothetically, this cycle could stimulate the GnRH/LH surge (Figure 4.2). Since kisspeptin neurons are important for the steroidal feedback to hypothalamic neurons, the regulation of SMIM20 by E2 was explored in the kisspeptin cell models. Both populations of kisspeptin neurons readily express ERα, ERβ and GPR30 estrogen receptors [188]; however, they respond in a differential manner to E2 exposure.
AVPV/PeN neurons increase Kiss-1 mRNA expression in response to E2 and Arc neurons repress gene expression [10]. The regulation of SMIM20 by E2 was explored in the AVPV cell models to determine if SMIM20 was similarly regulated as the Kiss-1 gene.
The Arc models did not respond to E2 at the times and concentrations tested, and, therefore, were not used for further characterization of SMIM20 regulatory mechanisms.
The mHypoA-Kiss/GFP-4 and mHypoA-50 models responded to E2 treatment by increasing Kiss-1 gene expression as expected; however, there were no significant changes to SMIM20 mRNA expression. This was surprising as there were multiple putative EREs detected in the promoter region of the mouse SMIM20 gene. However, these may be non-functional or as with insulin and dexamethasone, although no changes to mRNA were observed, E2 may still regulate PNX expression. E2 may regulate post- transcriptional events or cleavage enzymes governing PNX release from SMIM20. E2 may also regulate SMIM20 mRNA expression at different time points or concentrations then were studied. PNX may also be important in other hypothalamic nuclei, such as
NPY neurons, which also regulate GnRH [366,367]. Therefore, E2 may regulate SMIM20 in a different hypothalamic subpopulation than was explored in the current experiments. These preliminary experiments implicate kisspeptin as a regulator of the PNX gene SMIM20 in a GnRH neuronal model. This regulation could be involved with the generation of the GnRH/LH surge. Greater characterization of SMIM20 gene regulation needs to be performed in upstream kisspeptin neurons and even other neuronal populations, such as NPY neurons. Also, the steroidal regulation by other sex steroids including androgens and progesterones should be analyzed in both GnRH and kisspeptin models to improve our understanding of the overall PNX neuropeptidergic system.
80 4.6 Study Limitations Since PNX was only recently isolated and identified, the current studies were limited by the amount of information available on PNX. To begin, without knowing the receptor that PNX activates, cell models could not be screened in advance to detect the expression of the receptor and indicate that PNX may interact with the particular cell type. Next, with only one published manuscript related to the function of PNX in the HPG axis [3], and another on the function related to visceral pain in the spinal cord [292], our ability to draw on previous experiments to hypothesize how PNX may influence the hypothalamus was limited. Similarly, for the regulation of the SMIM20 gene, although the SMIM20 promoter region was screened for putative TF binding sites, the hormones that were assessed were selected based on our understanding of their interactions with the HPG axis, not because of a known interaction with PNX. Assessing PNX gene expression is also complicated because of its likely cleavage from the precursor protein SMIM20. Using qRT-PCR, the gene expression of SMIM20 was measured rather than PNX directly, which may not translate to changes in PNX protein expression. Although no changes to SMIM20 gene expression were observed with E2, dexamethasone or insulin, it could be that these hormones regulate PNX post-translationally. However, as the mechanisms for PNX processing are not defined, it was not possible to assess whether these regulatory hormones affected cleavage enzyme expression or other post- translational modifications. Despite the limitations of studying a novel peptide, there are also many opportunities for discovery.
GnRH and kisspeptin neurons of the hypothalamus are essential in the regulation of the HPG axis; however, despite their importance, the regulatory mechanisms governing their expression and function have not been fully elucidated. This is partially due to the heterogeneous nature and intricate architecture of the hypothalamus that makes the study of specific nuclei and cell populations challenging [304]. Cell models have emerged as an invaluable tool that allow for the study of the molecular mechanisms mediating endocrine neuropeptide expression and signal transduction in specific neuronal populations in a controlled environment [304]. These types of studies are not possible in vivo due to the multitude of afferent inputs and external confounding factors from other
81 hypothalamic nuclei. Therefore, cell models are indispensible for the investigation of genetic, epigenetic and cellular pathways and these mechanisms can be translated to in vivo settings to help in the development of therapeutic agents. However, like all experimental models, consideration needs to be taken for the limitations and the conclusions that can be drawn from these cell models. First off, although causal relationships can be demonstrated between neuromodulators and gene expression or secretion using cell models, these may not be physiologically relevant. As the cell has been dissected from the complex environment of the hypothalamus, all neuronal inputs have been removed and therefore the cell may shift its activity from that observed in vivo, including cellular expression of particular proteins and structures. An inherent property of all cultured cells is they adjust their enzymatic activity based on the nutrients and temperatures in novel environments [304]. The immortalization process also modifies the metabolism of the cells due to excessive growth and proliferation [368]. Furthermore, over long periods of passaging, the cellular characteristics may change from those in lower cell passages. In performing our experiments, we strove to keep passaging to a minimum; however, we cannot conclude for certain that the phenotype remained unchanged. Together, the artificial environment of cell cultures may transform the cellular phenotype from that observed in the natural environment of the hypothalamus and this must be considered when interpreting data. With respect to the heterogeneous cell cultures, they provide a novel model to research multiple cellular phenotypes found in a particular neuronal population, an advantage over the clonal cell models [305]. However, studies in population biology have demonstrated that when two different cell types are placed in one environment and competing for resources, one population will dominate and eventually displace the slower growing cells [368]. In the case of the mHypoA-GnRH/GFP and mHypoA-Kiss/GFP-3 and -4 cell models, it is conceivable that, over multiple passages, certain cell types could predominate while others could become extinguished. Therefore, although multiple cell types were evident in culture, it may not represent a wide array of GnRH or kisspeptin cells as postulated. The final limitation of these cell models is that the insertion of the foreign gene, the SV-40 T-Ag oncogene, may alter the biological properties of the cell. Using short
82 hairpin RNA knockdown of SV-40 T-Ag, our laboratory demonstrated that SV-40 T-Ag increases the basal activity of certain signalling kinases, including pAKT, 5’ adenosine monophosphate-activated protein kinase (AMPK) and Janus kinase 2 (JAK2) and oxytocin gene expression (Belsham et al., unpublished data). In order to reduce any interference during western experiments, the cells were serum starved and low-glucose media was used to lower basal activity. Despite the limitations with cell models, they are indispensible tools for the advancement of reproductive physiology and have provided valuable insight into the cellular mechanisms governing particular neuronal populations in the hypothalamus. Historically, they have also proven to be reflective of the natural physiology found in vivo and conclusions can be translated back to whole animal models [304].
4.7 Future Directions Since PNX has only recently emerged as a neuropeptide involved in the regulation of the reproductive axis, our understanding of the central roles of the PNX neuropeptidergic system in the HPG axis and the mechanisms for its regulation remain largely unknown. There are a multitude of factors that still need to be explored to improve our knowledge of this novel peptide.
In the first aim of this thesis, the central mechanisms involved in the regulation of the GnRH neuronal population by PNX-20 were explored. GnRH mRNA expression, protein and secretion were increased by PNX-20; however, the precise molecular mechanisms mediating these effects are unknown. GnRH mRNA expression rose rapidly and transiently at 2 hours. Using the transcriptional inhibitors, actinomycin D (Act D) and 5,6-dichlorobenzimidazole riboside (DRB) [369], we could evaluate whether the increase in mRNA expression is owing to improved mRNA stability or transcriptional mechanisms. These experiments would build on our understanding of the cellular processes PNX utilizes to affect the neuroendocrine system. To follow up on whether PNX increases GnRH protein synthesis within GnRH neurons, an intracellular GnRH specific EIA should be performed after 24 hour PNX-20 pre-treatment. Although an increase in GnRH secretion was observed with SNP-induced
83 secretion after PNX-20 pre-treatment, that was an indirect measurement of the amount of GnRH protein in the neurons. Directly assessing GnRH protein levels in GnRH neurons would provide greater credence for this effect. Furthermore, incubation of the GnRH cell model with the protein synthesis inhibitor, cycloheximide (CHX), with PNX-20 pre- treatment, could determine if this effect is abolished, indicating de novo protein synthesis. Kisspeptin is one of the most potent activators of GnRH secretion [10] and PNX- 20 is also a stimulator for GnRH secretion, at higher concentrations. Co-treatment with PNX and kisspeptin in the GnRH cell model could determine if these two peptides work synergistically to increase GnRH secretion, as necessary for the GnRH surge. PNX-20 robustly upregulated Kiss-1 mRNA transcription in both Arc and AVPV cell models; however, the regulation of kisspeptin protein expression and secretion were not explored. Using similar techniques as in the GnRH neuronal model, the protein expression of kisspeptin should be assessed using a kisspeptin specific EIA to test whether PNX-20 augments secretion. Importantly, the co-expression of kisspeptin with PNX should be evaluated in these cell models and in vivo using double-labelling immunocytochemistry and immunohistochemistry, respectively. This will determine if PNX is co-localized with kisspeptin in the hypothalamus and determine if NKB, Dyn and TH also co-localize with the same neuronal populations. The stimulation of kisspeptin expression was only tested in female cell models, yet our laboratory has generated two male kisspeptin models, the mHypoA-Kiss/GFP-1 and mHypoA-Kiss/GFP-2, representative of kisspeptin neurons from the Arc and AVPV, respectively. Although it has been hypothesized that PNX may be involved in generating the GnRH/LH surge, a female-specific process, it would be interesting to explore the role it could play in male kisspeptin neurons. If PNX does not exert any effect on the male lines, that would support the involvement of PNX in the GnRH/LH surge and would also correlate with the initial experiments on PNX in male rats, where PNX did not have any effect [3]. However, as PNX increased Kiss-1 gene expression in the Arc, it may also be involved in the GnRH pulse generator, a process that is present in both sexes [261].
The molecular mechanisms mediated by PNX have begun to be explored using our hypothalamic cell models. However, only CREB and ERK1/2 phosphorylation were
84 measured, while other signalling molecules may be necessary for PNX action including pSTAT3 and p38. As PNX likely signals through a Gαs GPCR, a cAMP assay after PNX treatment could provide greater credence for this mechanism. To confirm the necessity of these signalling pathways for the transcriptional changes observed, pharmacological inhibitors to the AC and MAPK pathways, including SQ22536 (AC inhibitor), H-89 (PKA inhibitor), PD035901 (MEK inhibitor) and U0126 (MEK inhibitor), can then be used with PNX treatments. The abolishment of PNX-mediated increases in GnRH or Kiss-1 mRNA expression would suggest that these pathways are critical for the PNX- induced effects. These inhibitors could also determine whether the MAPK or the AC pathway is mediating the transcriptional and secretion effects in the GnRH cell model. Tests may indicate that either can compensate when the other is inhibited, or one pathway may dominate. Identifying the receptor for PNX is essential to help elaborate on its role in the HPG axis. The cognate receptor for the novel neuropeptide, neuronostatin, involved in raising mean arterial blood pressure, was recently identified by the use of a bioinformatic approach that identified orphan GPCRs with sequence homology to other GPCRs that bind small peptides [370,371]. This approach narrowed down the pool of orphan GPCRs. Next PCR was performed to identify receptors expressed in neuronostatin-responsive cell models. These candidate GPCRs were then knocked down using siRNA and since GPR107 knockdown abolished neuronostatin responsiveness, this receptor was identified as the likely neuronostatin receptor [370]. Using a similar approach, orphan GPCRs bearing sequence homology to those binding small peptides could identify candidate receptors for PNX. Using PCR, the GPCR receptors expressed in all three of the cell models (mHypoA-GnRH/GFP, mHypoA-Kiss/GFP-3 and mHypoA-Kiss/GFP-4) could be knocked down using siRNA or antisense oligonucleotides. Upon knockdown, models that lost responsiveness to PNX could be identified as the candidate receptor or as part of the downstream signalling cascade for PNX. Furthermore, recovery of function experiments and receptor binding assays will have to be employed to confirm the cognate receptor for PNX [370]. The receptor can be transfected into cells that do not express the receptor and using Gα15 or Gα16 promiscuous G-proteins or chimeric G-proteins, constitutive activity can be measured upon PNX stimulation [291]. Identification of the
85 receptor for PNX will allow for further investigation into the physiological function of PNX in other regions of the body including the heart, thymus, stomach, and spleen. Previous research performed on the identified cognate receptor could also discern functions or pathways in which PNX may be involved, just as the discovery of GPR54 lead to the association with reproductive physiology [183,184].
The regulation for the PNX precursor protein SMIM20 was explored in the final section of experiments and the kisspeptin peptide increased SMIM20 mRNA expression after 24 hours. To confirm these findings, the mHypoA-GnRH/GFP cell model could be incubated with the kisspeptin antagonist p234 [256] prior to kisspeptin-10 treatment. P234 treatment should abolish the kisspeptin-induced increase in SMIM20. Subsequently, reporter gene plasmids for SMIM20 with sequential deletions in the mSMIM20 promoter should be transfected into GnRH cell models to map regions of the 5’ flanking region that are required and sufficient for kisspeptin mediated transcriptional changes in SMIM20. Future regulatory experiments should also assess whether GCs such as dexamethasone or
CRH and P4 affect the levels of SMIM20 mRNA in kisspeptin cell models. Kisspeptin neurons are important mediators for steroidal feedback to GnRH neurons. The majority of kisspeptin neurons express both PR and CRH-R and the AVPV/PeN regions contain high levels of GRs [211,372]. This suggests that P4, CRH and GCs may be involved in the regulation of SMIM20 in kisspeptin neurons. P4 inhibits Kiss1 mRNA expression in the Arc [373], while stressors such as restraint challenges and CRH or corticosterone administration reduce expression in AVPV/PeN and Arc nuclei [372]. As PNX appears to be a stimulator of Kiss-1 mRNA expression, P4 or stress hormone reductions in Kiss-1 mRNA expression could be mediated indirectly through PNX down-regulation.
To expand on our overall understanding of PNX and the precursor protein SMIM20, several biochemical experiments need to be performed. First, the sub-cellular localization for SMIM20 and PNX should be determined by dual-labelling ICC with antibodies that are specific both SMIM20 and PNX. This will help to determine if PNX is cleaved from SMIM20 in the secretory pathway and stored in vesicles, or whether it remains as part of SMIM20 and is cleaved from the cellular membrane by ectodomain
86 shedding. Next, cleavage enzymes for PNX should be characterized so that the regulatory mechanisms governing PNX synthesis can be determined. It would also be useful to establish the half-life of PNX so that the mechanisms for its signalling can be further characterized. It would also be useful to generate a PNX hypothalamic KO mouse to determine whether PNX is necessary for reproductive function. The KO phenotype could be characterized and help to determine if PNX is involved in the initiation of puberty, the generation of the GnRH/LH surge and other non-reproductive physiological processes. Overall, our understanding of PNX is still in its infancy and there is still a lot to be determined regarding its physiological roles in the hypothalamus, the signalling cascades it activates and the mechanisms governing its regulation. PNX could also be an important component of other physiological systems, but these functions still need to be elucidated. As the role for PNX in the HPG axis is further characterized, more opportunities for therapeutic applications using PNX signalling will become available to improve the outcomes with reproductive disorders.
4.8 Conclusions In summary, we have demonstrated a role for PNX in the stimulation of both GnRH and kisspeptin neurons of the hypothalamus. PNX increases mRNA expression, protein levels and secretion of GnRH in a GnRH neuronal cell model, while stimulating Kiss-1 gene expression in kisspeptin neuronal cell models. These are also the first studies to look at signalling mechanisms of PNX. Phosphorylation of CREB and ERK1/2 both appear to be induced by PNX, suggesting PNX signals through the AC and PLC/MAPK pathways by activating a GPCR. PNX was only recently discovered and there are many questions that need to be addressed regarding its synthesis, regulation and signalling mechanisms. Developing our understanding of PNX and its mechanisms of action could have promising implications for reproductive medicine. As GnRH agonist medications are used in specific disorders, and kisspeptin is now being considered as a therapeutic [374], it is conceivable that a PNX agonist or antagonist could eventually be used to regulate GnRH or kisspeptin neurons.
87 References
1. Clarke IJ, Cummins JT (1982) The temporal relationship between gonadotropin releasing hormone (GnRH) and luteinizing hormone (LH) secretion in ovariectomized ewes. Endocrinology 111: 1737-1739. 2. McCann SM, Lumpkin MD, Mizunuma H, Khorram O, Samson WK (1984) Recent studies on the role of brain peptides in control of anterior pituitary hormone secretion. Peptides 5 Suppl 1: 3-7. 3. Yosten GLC, Lyu R-M, Hsueh AJW, Avsian-Kretchmer O, Chang J-K, et al. (2013) A novel reproductive peptide, phoenixin. J Neuroendocrinol 25: 206-215. 4. Gottsch ML, Cunningham MJ, Smith JT, Popa SM, Acohido BV, et al. (2004) A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology 145: 4073-4077. 5. Canteras NS, Simerly RB, Swanson LW (1994) Organization of projections from the ventromedial nucleus of the hypothalamus: a Phaseolus vulgaris-leucoagglutinin study in the rat. J Comp Neurol 348: 41-79. 6. Simonian SX, Spratt DP, Herbison AE (1999) Identification and characterization of estrogen receptor alpha-containing neurons projecting to the vicinity of the gonadotropin-releasing hormone perikarya in the rostral preoptic area of the rat. J Comp Neurol 411: 346-358. 7. Everitt BJ, Hokfelt T (1990) Neuroendocrine anatomy of the hypothalamus. Acta Neurochir Suppl (Wien) 47: 1-15. 8. Gore AC (2002) GnRH, the master molecule of reproduction. Norwell, Massachusetts: Kluwer Academic Publishers Group. 9. Fink G (2000) Neuroendocrine regulation of pituitary function. In: Conn PM, Freeman ME, editors. Neuroendocrinology in physiology and medicine. New York: Humana Press Inc. . pp. 107-133. 10. d'Anglemont de Tassigny X, Colledge WH (2010) The role of kisspeptin signaling in reproduction. Physiology (Bethesda) 25: 207-217. 11. Herbison AE (1998) Multimodal influence of estrogen upon gonadotropin-releasing hormone neurons. Endocr Rev 19: 302-330. 12. Harris GW (1950) Oestrous rhythm. Pseudopregnancy and the pituitary stalk in the rat. J Physiol 111: 347-360. 13. Fernald RD, White RB (1999) Gonadotropin-releasing hormone genes: phylogeny, structure, and functions. Front Neuroendocrinol 20: 224-240. 14. Matsuo H, Baba Y, Nair RM, Arimura A, Schally AV (1971) Structure of the porcine LH- and FSH-releasing hormone. I. The proposed amino acid sequence. Biochem Biophys Res Commun 43: 1334-1339. 15. Burgus R, Butcher M, Amoss M, Ling N, Monahan M, et al. (1972) Primary structure of the ovine hypothalamic luteinizing hormone-releasing factor (LRF) (LH- hypothalamus-LRF-gas chromatography-mass spectrometry-decapeptide-Edman degradation). Proc Natl Acad Sci U S A 69: 278-282. 16. Belsham DD, Lovejoy DA (2005) Gonadotropin-releasing hormone: gene evolution, expression, and regulation. Vitam Horm 71: 59-94. 17. Schwanzel-Fukuda M, Pfaff DW (1989) Origin of luteinizing hormone-releasing hormone neurons. Nature 338: 161-164.
88 18. Wray S, Grant P, Gainer H (1989) Evidence that cells expressing luteinizing hormone-releasing hormone mRNA in the mouse are derived from progenitor cells in the olfactory placode. Proc Natl Acad Sci U S A 86: 8132-8136. 19. Quinton R, Hasan W, Grant W, Thrasivoulou C, Quiney RE, et al. (1997) Gonadotropin-releasing hormone immunoreactivity in the nasal epithelia of adults with Kallmann's syndrome and isolated hypogonadotropic hypogonadism and in the early midtrimester human fetus. J Clin Endocrinol Metab 82: 309-314. 20. Schwanzel-Fukuda M, Bick D, Pfaff DW (1989) Luteinizing hormone-releasing hormone (LHRH)-expressing cells do not migrate normally in an inherited hypogonadal (Kallmann) syndrome. Brain Res Mol Brain Res 6: 311-326. 21. Ibata Y, Tani N, Obata HL, Tanaka M, Kubo S, et al. (1981) Correlative ontogenetic development of catecholamine- and LHRH-containing nerve endings in the median eminence of the rat. Cell Tissue Res 216: 31-38. 22. Silverman AJ, Desnoyers P (1976) Ultrastructural immunocytochemical localization of luteinizing hormone-releasing hormone (LH-RH) in the median eminence of the guinea pig. Cell Tissue Res 169: 157-166. 23. Setalo G, Vigh S, Schally AV, Arimura A, Flerko B (1975) LH-RH-containing neural elements in the rat hypothalamus. Endocrinology 96: 135-142. 24. Silverman RC, Silverman AJ, Gibson MJ (1989) Identification of gonadotropin releasing hormone (GnRH) neurons projecting to the median eminence from third ventricular preoptic area grafts in hypogonadal mice. Brain Res 501: 260-268. 25. Merchenthaler I, Setalo G, Csontos C, Petrusz P, Flerko B, et al. (1989) Combined retrograde tracing and immunocytochemical identification of luteinizing hormone-releasing hormone- and somatostatin-containing neurons projecting to the median eminence of the rat. Endocrinology 125: 2812-2821. 26. Merchenthaler I, Gorcs T, Setalo G, Petrusz P, Flerko B (1984) Gonadotropin- releasing hormone (GnRH) neurons and pathways in the rat brain. Cell Tissue Res 237: 15-29. 27. Witkin JW, Paden CM, Silverman AJ (1982) The luteinizing hormone-releasing hormone (LHRH) systems in the rat brain. Neuroendocrinology 35: 429-438. 28. Silverman AJ, Antunes JL, Abrams GM, Nilaver G, Thau R, et al. (1982) The luteinizing hormone-releasing hormone pathways in rhesus (Macaca mulatta) and pigtailed (Macaca nemestrina) monkeys: new observations on thick, unembedded sections. J Comp Neurol 211: 309-317. 29. Jennes L (1987) Sites of origin of gonadotropin releasing hormone containing projections to the amygdala and the interpeduncular nucleus. Brain Res 404: 339- 344. 30. Barry J, Dubois MP, Poulain P (1973) LRF producing cells of the mammalian hypothalamus. A fluorescent antibody study. Z Zellforsch Mikrosk Anat 146: 351-366. 31. Gross DS (1976) Distribution of gonadotropin-releasing hormone in the mouse brain as revealed by immunohistochemistry. Endocrinology 98: 1408-1417. 32. Broadwell RD, Brightman MW (1976) Entry of peroxidase into neurons of the central and peripheral nervous systems from extracerebral and cerebral blood. J Comp Neurol 166: 257-283.
89 33. Rotsztejn WH, Charli JL, Pattou E, Kordon C (1977) Stimulation by dopamine of luteinizing hormone-releasing hormone (LHRH) release from the mediobasal hypothalamus in male rats. Endocrinology 101: 1475-1483. 34. Ciofi P, Garret M, Lapirot O, Lafon P, Loyens A, et al. (2009) Brain-endocrine interactions: a microvascular route in the mediobasal hypothalamus. Endocrinology 150: 5509-5519. 35. Mullier A, Bouret SG, Prevot V, Dehouck Bnd (2010) Differential distribution of tight junction proteins suggests a role for tanycytes in blood-hypothalamus barrier regulation in the adult mouse brain. J Comp Neurol 518: 943-962. 36. Herde MK, Geist K, Campbell RE, Herbison AE (2011) Gonadotropin-releasing hormone neurons extend complex highly branched dendritic trees outside the blood-brain barrier. Endocrinology 152: 3832-3841. 37. Prevot V (2011) GnRH neurons directly listen to the periphery. Endocrinology 152: 3589-3591. 38. Wildt L, Marshall G, Knobil E (1980) Experimental induction of puberty in the infantile female rhesus monkey. Science 207: 1373-1375. 39. Donovan BT, ter Haar MB, Lockhart AN, MacKinnon PC, Mattock JM, et al. (1975) Changes in the concentration of luteinizing hormone in plasma during development in the guinea-pig. J Endocrinol 64: 511-520. 40. Monroe SE, Yamamoto M, Jaffe RB (1983) Changes in gonadotrope responsivity to gonadotropin releasing hormone during development of the rhesus monkey. Biol Reprod 29: 422-431. 41. Ramaley JA (1979) Development of Gonadotropin regulation in the prepubertal mammal. Biol Reprod 20: 1-31. 42. Watanabe G, Terasawa E (1989) In vivo release of luteinizing hormone releasing hormone increases with puberty in the female rhesus monkey. Endocrinology 125: 92-99. 43. Gore AC, Mitsushima D, Terasawa E (1993) A possible role of neuropeptide Y in the control of the onset of puberty in female rhesus monkeys. Neuroendocrinology 58: 23-34. 44. Sisk CL, Richardson HN, Chappell PE, Levine JE (2001) In vivo gonadotropin- releasing hormone secretion in female rats during peripubertal development and on proestrus. Endocrinology 142: 2929-2936. 45. Rodriguez RE, Wise ME (1989) Ontogeny of pulsatile secretion of gonadotropin- releasing hormone in the bull calf during infantile and pubertal development. Endocrinology 124: 248-256. 46. Yarney TA, Sanford LM (1989) Pubertal changes in the secretion of gonadotropic hormones, testicular gonadotropic receptors and testicular function in the ram. Domest Anim Endocrinol 6: 219-229. 47. Wagner TO, Brabant G, Warsch F, Hesch RD, von zur Muhlen A (1986) Pulsatile gonadotropin-releasing hormone treatment in idiopathic delayed puberty. J Clin Endocrinol Metab 62: 95-101. 48. Spratt DI, Crowley WF (1988) Pituitary and gonadal responsiveness is enhanced during GnRH-induced puberty. Am J Physiol 254: E652-657. 49. Knobil E (1980) The neuroendocrine control of the menstrual cycle. Recent Prog Horm Res 36: 53-88.
90 50. Santoro N, Filicori M, Spratt D, Crowley WF (1986) Gonadotropin-releasing hormone (GnRH) physiology in men and women. Acta Med Hung 43: 201-221. 51. Ferris HA, Shupnik MA (2006) Mechanisms for pulsatile regulation of the gonadotropin subunit genes by GNRH1. Biol Reprod 74: 993-998. 52. Belchetz PE, Plant TM, Nakai Y, Keogh EJ, Knobil E (1978) Hypophysial responses to continuous and intermittent delivery of hypopthalamic gonadotropin-releasing hormone. Science 202: 631-633. 53. Martinez de la Escalera G, Choi AL, Weiner RI (1992) Generation and synchronization of gonadotropin-releasing hormone (GnRH) pulses: intrinsic properties of the GT1-1 GnRH neuronal cell line. Proc Natl Acad Sci U S A 89: 1852-1855. 54. Gay VL, Midgley AR, Niswender GD (1970) Patterns of gonadotrophin secretion associated with ovulation. Fed Proc 29: 1880-1887. 55. Thorneycroft IH, Mishell DR, Stone SC, Kharma KM, Nakamura RM (1971) The relation of serum 17-hydroxyprogesterone and estradiol-17-beta levels during the human menstrual cycle. Am J Obstet Gynecol 111: 947-951. 56. Wuttke W (1976) Neuroendocrine mechanisms in reproductive physiology. Rev Physiol Biochem Pharmacol 76: 59-101. 57. Burger LL, Haisenleder DJ, Dalkin AC, Marshall JC (2004) Regulation of gonadotropin subunit gene transcription. J Mol Endocrinol 33: 559-584. 58. Millar RP, Lu Z-L, Pawson AJ, Flanagan CA, Morgan K, et al. (2004) Gonadotropin- releasing hormone receptors. Endocr Rev 25: 235-275. 59. Naor Z (2009) Signaling by G-protein-coupled receptor (GPCR): studies on the GnRH receptor. Front Neuroendocrinol 30: 10-29. 60. Rispoli LA, Nett TM (2005) Pituitary gonadotropin-releasing hormone (GnRH) receptor: structure, distribution and regulation of expression. Anim Reprod Sci 88: 57-74. 61. Turzillo AM, Clapper JA, Moss GE, Nett TM (1998) Regulation of ovine GnRH receptor gene expression by progesterone and oestradiol. J Reprod Fertil 113: 251-256. 62. Sakurai H, Adams BM, Adams TE (1997) Concentration of gonadotropin-releasing hormone receptor messenger ribonucleic acid in pituitary tissue of orchidectomized sheep: effect of passive immunization against gonadotropin- releasing hormone. J Anim Sci 75: 189-194. 63. Brooks J, McNeilly AS (1994) Regulation of gonadotrophin-releasing hormone receptor mRNA expression in the sheep. J Endocrinol 143: 175-182. 64. Nett TM, Crowder ME, Moss GE, Duello TM (1981) GnRH-receptor interaction. V. Down-regulation of pituitary receptors for GnRH in ovariectomized ewes by infusion of homologous hormone. Biol Reprod 24: 1145-1155. 65. Loumaye E, Thorner J, Catt KJ (1982) Yeast mating pheromone activates mammalian gonadotrophs: evolutionary conservation of a reproductive hormone? Science 218: 1323-1325. 66. Adelman JP, Mason AJ, Hayflick JS, Seeburg PH (1986) Isolation of the gene and hypothalamic cDNA for the common precursor of gonadotropin-releasing hormone and prolactin release-inhibiting factor in human and rat. Proc Natl Acad Sci U S A 83: 179-183.
91 67. Hayflick JS, Adelman JP, Seeburg PH (1989) The complete nucleotide sequence of the human gonadotropin-releasing hormone gene. Nucleic Acids Res 17: 6403- 6404. 68. Seeburg PH, Adelman JP (1984) Characterization of cDNA for precursor of human luteinizing hormone releasing hormone. Nature 311: 666-668. 69. Lovejoy DA, Fischer WH, Ngamvongchon S, Craig AG, Nahorniak CS, et al. (1992) Distinct sequence of gonadotropin-releasing hormone (GnRH) in dogfish brain provides insight into GnRH evolution. Proc Natl Acad Sci U S A 89: 6373-6377. 70. Chen A, Yahalom D, Ben-Aroya N, Kaganovsky E, Okon E, et al. (1998) A second isoform of gonadotropin-releasing hormone is present in the brain of human and rodents. FEBS Lett 435: 199-203. 71. Kauffman AS, Rissman EF (2004) A critical role for the evolutionarily conserved gonadotropin-releasing hormone II: mediation of energy status and female sexual behavior. Endocrinology 145: 3639-3646. 72. Barnett DK, Bunnell TM, Millar RP, Abbott DH (2006) Gonadotropin-releasing hormone II stimulates female sexual behavior in marmoset monkeys. Endocrinology 147: 615-623. 73. Temple JL, Millar RP, Rissman EF (2003) An evolutionarily conserved form of gonadotropin-releasing hormone coordinates energy and reproductive behavior. Endocrinology 144: 13-19. 74. Kauffman AS, Rissman EF (2004) The evolutionarily conserved gonadotropin- releasing hormone II modifies food intake. Endocrinology 145: 686-691. 75. Kauffman AS, Bojkowska K, Wills A, Rissman EF (2006) Gonadotropin-releasing hormone-II messenger ribonucleic acid and protein content in the mammalian brain are modulated by food intake. Endocrinology 147: 5069-5077. 76. Chen CC, Fernald RD (2008) GnRH and GnRH receptors: distribution, function and evolution. Journal of Fish Biology 73: 1099-1120. 77. Schneider JS, Rissman EF (2008) Gonadotropin-releasing hormone II: a multi- purpose neuropeptide. Integr Comp Biol 48: 588-595. 78. Lee VHY, Lee LTO, Chow BKC (2008) Gonadotropin-releasing hormone: regulation of the GnRH gene. FEBS J 275: 5458-5478. 79. Ryan KJ (1982) Biochemistry of aromatase: significance to female reproductive physiology. Cancer Res 42: 3342s-3344s. 80. Radovick S, Levine JE, Wolfe A (2012) Estrogenic regulation of the GnRH neuron. Front Endocrinol (Lausanne) 3: 52. 81. Zoeller RT, Seeburg PH, Young WS (1988) In situ hybridization histochemistry for messenger ribonucleic acid (mRNA) encoding gonadotropin-releasing hormone (GnRH): effect of estrogen on cellular levels of GnRH mRNA in female rat brain. Endocrinology 122: 2570-2577. 82. Petersen SL, McCrone S, Keller M, Shores S (1995) Effects of estrogen and progesterone on luteinizing hormone-releasing hormone messenger ribonucleic acid levels: consideration of temporal and neuroanatomical variables. Endocrinology 136: 3604-3610. 83. Caraty A, Locatelli A, Martin GB (1989) Biphasic response in the secretion of gonadotrophin-releasing hormone in ovariectomized ewes injected with oestradiol. J Endocrinol 123: 375-382.
92 84. Chongthammakun S, Terasawa E (1993) Negative feedback effects of estrogen on luteinizing hormone-releasing hormone release occur in pubertal, but not prepubertal, ovariectomized female rhesus monkeys. Endocrinology 132: 735- 743. 85. Sarkar DK, Fink G (1980) Luteinizing hormone releasing factor in pituitary stalk plasma from long-term ovariectomized rats: effects of steroids. J Endocrinol 86: 511-524. 86. Spratt DP, Herbison AE (1997) Regulation of preoptic area gonadotrophin-releasing hormone (GnRH) mRNA expression by gonadal steroids in the long-term gonadectomized male rat. Brain Res Mol Brain Res 47: 125-133. 87. Wierman ME, Kepa JK, Sun W, Gordon DF, Wood WM (1992) Estrogen negatively regulates rat gonadotropin releasing hormone (rGnRH) promoter activity in transfected placental cells. Mol Cell Endocrinol 86: 1-10. 88. Kepa JK, Wang C, Neeley CI, Raynolds MV, Gordon DF, et al. (1992) Structure of the rat gonadotropin releasing hormone (rGnRH) gene promoter and functional analysis in hypothalamic cells. Nucleic Acids Res 20: 1393-1399. 89. Radovick S, Ticknor CM, Nakayama Y, Notides AC, Rahman A, et al. (1991) Evidence for direct estrogen regulation of the human gonadotropin-releasing hormone gene. J Clin Invest 88: 1649-1655. 90. Dong KW, Chen ZG, Cheng KW, Yu KL (1996) Evidence for estrogen receptor- mediated regulation of human gonadotropin-releasing hormone promoter activity in human placental cells. Mol Cell Endocrinol 117: 241-246. 91. Roy D, Angelini NL, Belsham DD (1999) Estrogen directly respresses gonadotropin- releasing hormone (GnRH) gene expression in estrogen receptor-alpha (ERalpha)- and ERbeta-expressing GT1-7 GnRH neurons. Endocrinology 140: 5045-5053. 92. Ng Y, Wolfe A, Novaira HJ, Radovick S (2009) Estrogen regulation of gene expression in GnRH neurons. Mol Cell Endocrinol 303: 25-33. 93. Sarkar DK, Chiappa SA, Fink G, Sherwood NM (1976) Gonadotropin-releasing hormone surge in pro-oestrous rats. Nature 264: 461-463. 94. Karsch FJ, Bowen JM, Caraty A, Evans NP, Moenter SM (1997) Gonadotropin- releasing hormone requirements for ovulation. Biol Reprod 56: 303-309. 95. Levine JE (1997) New concepts of the neuroendocrine regulation of gonadotropin surges in rats. Biol Reprod 56: 293-302. 96. Simerly RB (2002) Wired for reproduction: organization and development of sexually dimorphic circuits in the mammalian forebrain. Annu Rev Neurosci 25: 507-536. 97. Wang H, Peters GA, Zeng X, Tang M, Ip W, et al. (1995) Yeast two-hybrid system demonstrates that estrogen receptor dimerization is ligand-dependent in vivo. J Biol Chem 270: 23322-23329. 98. Beato M, Herrlich P, Schutz G (1995) Steroid hormone receptors: many actors in search of a plot. Cell 83: 851-857. 99. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, et al. (1997) Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol Endocrinol 11: 353-365. 100. O'Malley BW, Tsai MJ (1992) Molecular pathways of steroid receptor action. Biol Reprod 46: 163-167.
93 101. Stein B, Yang MX (1995) Repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-kappa B and C/EBP beta. Mol Cell Biol 15: 4971- 4979. 102. Filardo EJ (2002) Epidermal growth factor receptor (EGFR) transactivation by estrogen via the G-protein-coupled receptor, GPR30: a novel signaling pathway with potential significance for breast cancer. J Steroid Biochem Mol Biol 80: 231- 238. 103. Filardo EJ, Quinn JA, Bland KI, Frackelton AR (2000) Estrogen-induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via trans-activation of the epidermal growth factor receptor through release of HB-EGF. Mol Endocrinol 14: 1649-1660. 104. Filardo EJ, Quinn JA, Frackelton AR, Bland KI (2002) Estrogen action via the G protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP- mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Mol Endocrinol 16: 70-84. 105. Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, et al. (1999) Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science 286: 2328-2331. 106. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, et al. (1993) Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci U S A 90: 11162-11166. 107. Schomberg DW, Couse JF, Mukherjee A, Lubahn DB, Sar M, et al. (1999) Targeted disruption of the estrogen receptor-alpha gene in female mice: characterization of ovarian responses and phenotype in the adult. Endocrinology 140: 2733-2744. 108. Wersinger SR, Haisenleder DJ, Lubahn DB, Rissman EF (1999) Steroid feedback on gonadotropin release and pituitary gonadotropin subunit mRNA in mice lacking a functional estrogen receptor alpha. Endocrine 11: 137-143. 109. Wintermantel TM, Campbell RE, Porteous R, Bock D, Gröne H-J, et al. (2006) Definition of estrogen receptor pathway critical for estrogen positive feedback to gonadotropin-releasing hormone neurons and fertility. Neuron 52: 271-280. 110. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, et al. (1998) Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc Natl Acad Sci U S A 95: 15677-15682. 111. Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, et al. (2000) Effect of single and compound knockouts of estrogen receptors alpha (ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development 127: 4277-4291. 112. Antal MC, Krust Ae, Chambon P, Mark M (2008) Sterility and absence of histopathological defects in nonreproductive organs of a mouse ERbeta-null mutant. Proc Natl Acad Sci U S A 105: 2433-2438. 113. Huang X, Harlan RE (1993) Absence of androgen receptors in LHRH immunoreactive neurons. Brain Res 624: 309-311. 114. Herbison AE, Theodosis DT (1992) Localization of oestrogen receptors in preoptic neurons containing neurotensin but not tyrosine hydroxylase, cholecystokinin or luteinizing hormone-releasing hormone in the male and female rat. Neuroscience 50: 283-298.
94 115. Shivers BD, Harlan RE, Morrell JI, Pfaff DW (1983) Absence of oestradiol concentration in cell nuclei of LHRH-immunoreactive neurones. Nature 304: 345- 347. 116. Watson RE, Langub MC, Landis JW (1992) Further Evidence that Most Luteinizing Hormone-Releasing Hormone Neurons are not Directly Estrogen-Responsive: Simultaneous Localization of Luteinizing Hormone-Releasing Hormone and Estrogen Receptor Immunoreactivity in the Guinea-Pig Brain. J Neuroendocrinol 4: 311-317. 117. Shen ES, Meade EH, Pérez MC, Deecher DC, Negro-Vilar A, et al. (1998) Expression of functional estrogen receptors and galanin messenger ribonucleic acid in immortalized luteinizing hormone-releasing hormone neurons: estrogenic control of galanin gene expression. Endocrinology 139: 939-948. 118. Butler JA, Sjoberg M, Coen CW (1999) Evidence for oestrogen receptor alpha- immunoreactivity in gonadotrophin-releasing hormone-expressing neurones. J Neuroendocrinol 11: 331-335. 119. Hrabovszky E, Shughrue PJ, Merchenthaler I, Hajszan T, Carpenter CD, et al. (2000) Detection of estrogen receptor-beta messenger ribonucleic acid and 125I- estrogen binding sites in luteinizing hormone-releasing hormone neurons of the rat brain. Endocrinology 141: 3506-3509. 120. Kallo I, Butler JA, Barkovics-Kallo M, Goubillon ML, Coen CW (2001) Oestrogen receptor beta-immunoreactivity in gonadotropin releasing hormone-expressing neurones: regulation by oestrogen. J Neuroendocrinol 13: 741-748. 121. Martinez-Morales JR, Morales A, Marin R, Hernandez-Jimenez JG, Acevedo A, et al. (2001) Estrogen modulates norepinephrine-induced accumulation of adenosine cyclic monophosphate in a subpopulation of immortalized luteinizing hormone- releasing hormone secreting neurons from the mouse hypothalamus. Neurosci Lett 298: 61-64. 122. Fekete CS, Strutton PH, Cagampang FR, Hrabovszky E, Kallo I, et al. (1999) Estrogen receptor immunoreactivity is present in the majority of central histaminergic neurons: evidence for a new neuroendocrine pathway associated with luteinizing hormone-releasing hormone-synthesizing neurons in rats and humans. Endocrinology 140: 4335-4341. 123. Hrabovszky E, Steinhauser A, Barabas K, Shughrue PJ, Petersen SL, et al. (2001) Estrogen receptor-beta immunoreactivity in luteinizing hormone-releasing hormone neurons of the rat brain. Endocrinology 142: 3261-3264. 124. Hrabovszky E, Kallo I, Szlavik N, Keller E, Merchenthaler I, et al. (2007) Gonadotropin-releasing hormone neurons express estrogen receptor-beta. J Clin Endocrinol Metab 92: 2827-2830. 125. Christian CA, Glidewell-Kenney C, Jameson JL, Moenter SM (2008) Classical estrogen receptor alpha signaling mediates negative and positive feedback on gonadotropin-releasing hormone neuron firing. Endocrinology 149: 5328-5334. 126. Temple JL, Laing E, Sunder A, Wray S (2004) Direct action of estradiol on gonadotropin-releasing hormone-1 neuronal activity via a transcription-dependent mechanism. J Neurosci 24: 6326-6333. 127. Brayman MJ, Pepa PA, Berdy SE, Mellon PL (2012) Androgen receptor repression of GnRH gene transcription. Mol Endocrinol 26: 2-13.
95 128. Burger HG (2002) Androgen production in women. Fertil Steril 77 Suppl 4: S3-5. 129. Poletti A, Rampoldi A, Piccioni F, Volpi S, Simeoni S, et al. (2001) 5Alpha- reductase type 2 and androgen receptor expression in gonadotropin releasing hormone GT1-1 cells. J Neuroendocrinol 13: 353-357. 130. Toranzo D, Dupont E, Simard J, Labrie C, Couet J, et al. (1989) Regulation of pro- gonadotropin-releasing hormone gene expression by sex steroids in the brain of male and female rats. Mol Endocrinol 3: 1748-1756. 131. Roselli CE, Kelly MJ, Ronnekleiv OK (1990) Testosterone regulates progonadotropin-releasing hormone levels in the preoptic area and basal hypothalamus of the male rat. Endocrinology 126: 1080-1086. 132. Gross DS (1980) Effect of castration and steroid replacement on immunoreactive gonadotropin-releasing hormone in hypothalamus and preoptic area. Endocrinology 106: 1442-1450. 133. Selmanoff M, Shu C, Petersen SL, Barraclough CA, Zoeller RT (1991) Single cell levels of hypothalamic messenger ribonucleic acid encoding luteinizing hormone- releasing hormone in intact, castrated, and hyperprolactinemic male rats. Endocrinology 128: 459-466. 134. Belsham DD, Evangelou A, Roy D, Duc VL, Brown TJ (1998) Regulation of gonadotropin-releasing hormone (GnRH) gene expression by 5alpha- dihydrotestosterone in GnRH-secreting GT1-7 hypothalamic neurons. Endocrinology 139: 1108-1114. 135. Shakil T, Hoque ANE, Husain M, Belsham DD (2002) Differential regulation of gonadotropin-releasing hormone secretion and gene expression by androgen: membrane versus nuclear receptor activation. Mol Endocrinol 16: 2592-2602. 136. Goodman RL, Karsch FJ (1980) Pulsatile secretion of luteinizing hormone: differential suppression by ovarian steroids. Endocrinology 107: 1286-1290. 137. Goodman RL, Bittman EL, Foster DL, Karsch FJ (1981) The endocrine basis of the synergistic suppression of luteinizing hormone by estradiol and progesterone. Endocrinology 109: 1414-1417. 138. O'Byrne KT, Thalabard JC, Grosser PM, Wilson RC, Williams CL, et al. (1991) Radiotelemetric monitoring of hypothalamic gonadotropin-releasing hormone pulse generator activity throughout the menstrual cycle of the rhesus monkey. Endocrinology 129: 1207-1214. 139. Karsch FJ, Cummins JT, Thomas GB, Clarke IJ (1987) Steroid feedback inhibition of pulsatile secretion of gonadotropin-releasing hormone in the ewe. Biol Reprod 36: 1207-1218. 140. Skinner DC, Evans NP, Delaleu B, Goodman RL, Bouchard P, et al. (1998) The negative feedback actions of progesterone on gonadotropin-releasing hormone secretion are transduced by the classical progesterone receptor. Proc Natl Acad Sci U S A 95: 10978-10983. 141. Kepa JK, Jacobsen BM, Boen EA, Prendergast P, Edwards DP, et al. (1996) Direct binding of progesterone receptor to nonconsensus DNA sequences represses rat GnRH. Mol Cell Endocrinol 117: 27-39. 142. Bayliss DA, Seroogy KB, Millhorn DE (1991) Distribution and regulation by estrogen of progesterone receptor in the hypothalamus of the cat. Endocrinology 128: 2610-2617.
96 143. Bayliss DA, Millhorn DE (1991) Chronic estrogen exposure maintains elevated levels of progesterone receptor mRNA in guinea pig hypothalamus. Brain Res Mol Brain Res 10: 167-172. 144. Skinner DC, Caraty A, Allingham R (2001) Unmasking the progesterone receptor in the preoptic area and hypothalamus of the ewe: no colocalization with gonadotropin-releasing neurons. Endocrinology 142: 573-579. 145. Sleiter N, Pang Y, Park C, Horton TH, Dong J, et al. (2009) Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release. Endocrinology 150: 3833-3844. 146. Bashour NM, Wray S (2012) Progesterone directly and rapidly inhibits GnRH neuronal activity via progesterone receptor membrane component 1. Endocrinology 153: 4457-4469. 147. Chand D, Lovejoy DA (2011) Stress and reproduction: controversies and challenges. Gen Comp Endocrinol 171: 253-257. 148. Suh BY, Liu JH, Berga SL, Quigley ME, Laughlin GA, et al. (1988) Hypercortisolism in patients with functional hypothalamic-amenorrhea. J Clin Endocrinol Metab 66: 733-739. 149. Berga SL, Mortola JF, Girton L, Suh B, Laughlin G, et al. (1989) Neuroendocrine aberrations in women with functional hypothalamic amenorrhea. J Clin Endocrinol Metab 68: 301-308. 150. Attardi B, Tsujii T, Friedman R, Zeng Z, Roberts JL, et al. (1997) Glucocorticoid repression of gonadotropin-releasing hormone gene expression and secretion in morphologically distinct subpopulations of GT1-7 cells. Mol Cell Endocrinol 131: 241-255. 151. Chandran UR, Attardi B, Friedman R, Dong KW, Roberts JL, et al. (1994) Glucocorticoid receptor-mediated repression of gonadotropin-releasing hormone promoter activity in GT1 hypothalamic cell lines. Endocrinology 134: 1467-1474. 152. DeFranco DB, Attardi B, Chandran UR (1994) Glucocorticoid receptor-mediated repression of GnRH gene expression in a hypothalamic GnRH-secreting neuronal cell line. Ann N Y Acad Sci 746: 473-475. 153. Chandran UR, Attardi B, Friedman R, Zheng Zw, Roberts JL, et al. (1996) Glucocorticoid repression of the mouse gonadotropin-releasing hormone gene is mediated by promoter elements that are recognized by heteromeric complexes containing glucocorticoid receptor. J Biol Chem 271: 20412-20420. 154. Tellam DJ, Perone MJ, Dunn IC, Radovick S, Brennand J, et al. (1998) Direct regulation of GnRH transcription by CRF-like peptides in an immortalized neuronal cell line. Neuroreport 9: 3135-3140. 155. Nikolarakis KE, Almeida OF, Herz A (1986) Corticotropin-releasing factor (CRF) inhibits gonadotropin-releasing hormone (GnRH) release from superfused rat hypothalami in vitro. Brain Res 377: 388-390. 156. Tache Y, Du Ruisseau P, Ducharme JR, Collu R (1978) Pattern of adenohypophyseal hormone changes in male rats following chronic stress. Neuroendocrinology 26: 208-219. 157. Gore AC, Attardi B, DeFranco DB (2006) Glucocorticoid repression of the reproductive axis: effects on GnRH and gonadotropin subunit mRNA levels. Mol Cell Endocrinol 256: 40-48.
97 158. Evans RM (1988) The steroid and thyroid hormone receptor superfamily. Science 240: 889-895. 159. Ahima RS, Harlan RE (1992) Glucocorticoid receptors in LHRH neurons. Neuroendocrinology 56: 845-850. 160. Kononen J, Honkaniemi J, Gustafsson JA, Pelto-Huikko M (1993) Glucocorticoid receptor colocalization with pituitary hormones in the rat pituitary gland. Mol Cell Endocrinol 93: 97-103. 161. Cameron JL, Nosbisch C (1991) Suppression of pulsatile luteinizing hormone and testosterone secretion during short term food restriction in the adult male rhesus monkey (Macaca mulatta). Endocrinology 128: 1532-1540. 162. Stoving RK, Hangaard J, Hansen-Nord M, Hagen C (1999) A review of endocrine changes in anorexia nervosa. J Psychiatr Res 33: 139-152. 163. Bruning JC, Gautam D, Burks DJ, Gillette J, Schubert M, et al. (2000) Role of brain insulin receptor in control of body weight and reproduction. Science 289: 2122- 2125. 164. Obici S, Feng Z, Karkanias G, Baskin DG, Rossetti L (2002) Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats. Nat Neurosci 5: 566-572. 165. South SA, Asplin CM, Carlsen EC, Booth RA, Weltman JY, et al. (1993) Alterations in luteinizing hormone secretory activity in women with insulin- dependent diabetes mellitus and secondary amenorrhea. J Clin Endocrinol Metab 76: 1048-1053. 166. Burcelin R, Thorens B, Glauser M, Gaillard RC, Pralong FP (2003) Gonadotropin- releasing hormone secretion from hypothalamic neurons: stimulation by insulin and potentiation by leptin. Endocrinology 144: 4484-4491. 167. Kim HH, DiVall SA, Deneau RM, Wolfe A (2005) Insulin regulation of GnRH gene expression through MAP kinase signaling pathways. Mol Cell Endocrinol 242: 42-49. 168. Divall SA, Williams TR, Carver SE, Koch L, Bruning JC, et al. (2010) Divergent roles of growth factors in the GnRH regulation of puberty in mice. J Clin Invest 120: 2900-2909. 169. Evans MC, Rizwan M, Mayer C, Boehm U, Anderson GM (2014) Evidence that insulin signalling in gonadotrophin-releasing hormone and kisspeptin neurones does not play an essential role in metabolic regulation of fertility in mice. J Neuroendocrinol 26: 468-479. 170. Roa J (2013) Role of GnRH Neurons and Their Neuronal Afferents as Key Integrators between Food Intake Regulatory Signals and the Control of Reproduction. Int J Endocrinol 2013: 518046. 171. Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, et al. (2001) The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J Biol Chem 276: 34631-34636. 172. Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, et al. (2001) AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J Biol Chem 276: 28969-28975.
98 173. Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, et al. (2001) Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature 411: 613-617. 174. Shahab M, Mastronardi C, Seminara SB, Crowley WF, Ojeda SR, et al. (2005) Increased hypothalamic GPR54 signaling: a potential mechanism for initiation of puberty in primates. Proc Natl Acad Sci U S A 102: 2129-2134. 175. Han S-K, Gottsch ML, Lee KJ, Popa SM, Smith JT, et al. (2005) Activation of gonadotropin-releasing hormone neurons by kisspeptin as a neuroendocrine switch for the onset of puberty. J Neurosci 25: 11349-11356. 176. Thompson EL, Patterson M, Murphy KG, Smith KL, Dhillo WS, et al. (2004) Central and peripheral administration of kisspeptin-10 stimulates the hypothalamic-pituitary-gonadal axis. J Neuroendocrinol 16: 850-858. 177. Matsui H, Takatsu Y, Kumano S, Matsumoto H, Ohtaki T (2004) Peripheral administration of metastin induces marked gonadotropin release and ovulation in the rat. Biochem Biophys Res Commun 320: 383-388. 178. Tovar S, Vazquez MJ, Navarro VM, Fernandez-Fernandez R, Castellano JM, et al. (2006) Effects of single or repeated intravenous administration of kisspeptin upon dynamic LH secretion in conscious male rats. Endocrinology 147: 2696-2704. 179. Lee JH, Miele ME, Hicks DJ, Phillips KK, Trent JM, et al. (1996) KiSS-1, a novel human malignant melanoma metastasis-suppressor gene. J Natl Cancer Inst 88: 1731-1737. 180. Lee JH, Welch DR (1997) Suppression of metastasis in human breast carcinoma MDA-MB-435 cells after transfection with the metastasis suppressor gene, KiSS- 1. Cancer Res 57: 2384-2387. 181. Lee JH, Welch DR (1997) Identification of highly expressed genes in metastasis- suppressed chromosome 6/human malignant melanoma hybrid cells using subtractive hybridization and differential display. Int J Cancer 71: 1035-1044. 182. Clements MK, McDonald TP, Wang R, Xie G, O'Dowd BF, et al. (2001) FMRFamide-related neuropeptides are agonists of the orphan G-protein-coupled receptor GPR54. Biochem Biophys Res Commun 284: 1189-1193. 183. de Roux N, Genin E, Carel J-C, Matsuda F, Chaussain J-L, et al. (2003) Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc Natl Acad Sci U S A 100: 10972-10976. 184. Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS, et al. (2003) The GPR54 gene as a regulator of puberty. N Engl J Med 349: 1614-1627. 185. Funes S, Hedrick JA, Vassileva G, Markowitz L, Abbondanzo S, et al. (2003) The KiSS-1 receptor GPR54 is essential for the development of the murine reproductive system. Biochem Biophys Res Commun 312: 1357-1363. 186. West A, Vojta PJ, Welch DR, Weissman BE (1998) Chromosome localization and genomic structure of the KiSS-1 metastasis suppressor gene (KISS1). Genomics 54: 145-148. 187. Oakley AE, Clifton DK, Steiner RA (2009) Kisspeptin signaling in the brain. Endocr Rev 30: 713-743. 188. Lehman MN, Hileman SM, Goodman RL (2013) Neuroanatomy of the kisspeptin signaling system in mammals: comparative and developmental aspects. Adv Exp Med Biol 784: 27-62.
99 189. Colledge WH (2009) Kisspeptins and GnRH neuronal signalling. Trends Endocrinol Metab 20: 115-121. 190. Irwig MS, Fraley GS, Smith JT, Acohido BV, Popa SM, et al. (2004) Kisspeptin activation of gonadotropin releasing hormone neurons and regulation of KiSS-1 mRNA in the male rat. Neuroendocrinology 80: 264-272. 191. Messager S, Chatzidaki EE, Ma D, Hendrick AG, Zahn D, et al. (2005) Kisspeptin directly stimulates gonadotropin-releasing hormone release via G protein-coupled receptor 54. Proc Natl Acad Sci U S A 102: 1761-1766. 192. Herbison AE, de Tassigny XdA, Doran J, Colledge WH (2010) Distribution and postnatal development of Gpr54 gene expression in mouse brain and gonadotropin-releasing hormone neurons. Endocrinology 151: 312-321. 193. Clarkson J, Herbison AE (2006) Postnatal development of kisspeptin neurons in mouse hypothalamus; sexual dimorphism and projections to gonadotropin- releasing hormone neurons. Endocrinology 147: 5817-5825. 194. Smith JT, Coolen LM, Kriegsfeld LJ, Sari IP, Jaafarzadehshirazi MR, et al. (2008) Variation in kisspeptin and RFamide-related peptide (RFRP) expression and terminal connections to gonadotropin-releasing hormone neurons in the brain: a novel medium for seasonal breeding in the sheep. Endocrinology 149: 5770-5782. 195. Decourt C, Tillet Y, Caraty A, Franceschini I, Briant C (2008) Kisspeptin immunoreactive neurons in the equine hypothalamus Interactions with GnRH neuronal system. J Chem Neuroanat 36: 131-137. 196. Ramaswamy S, Guerriero KA, Gibbs RB, Plant TM (2008) Structural interactions between kisspeptin and GnRH neurons in the mediobasal hypothalamus of the male rhesus monkey (Macaca mulatta) as revealed by double immunofluorescence and confocal microscopy. Endocrinology 149: 4387-4395. 197. Hrabovszky E, Ciofi P, Vida B, Horvath MC, Keller E, et al. (2010) The kisspeptin system of the human hypothalamus: sexual dimorphism and relationship with gonadotropin-releasing hormone and neurokinin B neurons. Eur J Neurosci 31: 1984-1998. 198. Kallo I, Vida B, Deli L, Molnar CS, Hrabovszky E, et al. (2012) Co-localisation of kisspeptin with galanin or neurokinin B in afferents to mouse GnRH neurones. J Neuroendocrinol 24: 464-476. 199. Uenoyama Y, Inoue N, Pheng V, Homma T, Takase K, et al. (2011) Ultrastructural evidence of kisspeptin-gonadotrophin-releasing hormone (GnRH) interaction in the median eminence of female rats: implication of axo-axonal regulation of GnRH release. J Neuroendocrinol 23: 863-870. 200. Matsuyama S, Ohkura S, Mogi K, Wakabayashi Y, Mori Y, et al. (2011) Morphological evidence for direct interaction between kisspeptin and gonadotropin-releasing hormone neurons at the median eminence of the male goat: an immunoelectron microscopic study. Neuroendocrinology 94: 323-332. 201. Burke MC, Letts PA, Krajewski SJ, Rance NE (2006) Coexpression of dynorphin and neurokinin B immunoreactivity in the rat hypothalamus: Morphologic evidence of interrelated function within the arcuate nucleus. J Comp Neurol 498: 712-726.
100 202. Foradori CD, Amstalden M, Goodman RL, Lehman MN (2006) Colocalisation of dynorphin a and neurokinin B immunoreactivity in the arcuate nucleus and median eminence of the sheep. J Neuroendocrinol 18: 534-541. 203. Ramaswamy S, Seminara SB, Ali B, Ciofi P, Amin NA, et al. (2010) Neurokinin B stimulates GnRH release in the male monkey (Macaca mulatta) and is colocalized with kisspeptin in the arcuate nucleus. Endocrinology 151: 4494-4503. 204. Kauffman AS, Gottsch ML, Roa J, Byquist AC, Crown A, et al. (2007) Sexual differentiation of Kiss1 gene expression in the brain of the rat. Endocrinology 148: 1774-1783. 205. Kauffman AS (2009) Sexual differentiation and the Kiss1 system: hormonal and developmental considerations. Peptides 30: 83-93. 206. Wiegand SJ, Terasawa E, Bridson WE, Goy RW (1980) Effects of discrete lesions of preoptic and suprachiasmatic structures in the female rat. Alterations in the feedback regulation of gonadotropin secretion. Neuroendocrinology 31: 147-157. 207. Lehman MN, Merkley CM, Coolen LM, Goodman RL (2010) Anatomy of the kisspeptin neural network in mammals. Brain Res 1364: 90-102. 208. Smith JT, Cunningham MJ, Rissman EF, Clifton DK, Steiner RA (2005) Regulation of Kiss1 gene expression in the brain of the female mouse. Endocrinology 146: 3686-3692. 209. Franceschini I, Lomet D, Cateau M, Delsol G, Tillet Y, et al. (2006) Kisspeptin immunoreactive cells of the ovine preoptic area and arcuate nucleus co-express estrogen receptor alpha. Neurosci Lett 401: 225-230. 210. Adachi S, Yamada S, Takatsu Y, Matsui H, Kinoshita M, et al. (2007) Involvement of anteroventral periventricular metastin/kisspeptin neurons in estrogen positive feedback action on luteinizing hormone release in female rats. J Reprod Dev 53: 367-378. 211. Smith JT, Clay CM, Caraty A, Clarke IJ (2007) KiSS-1 messenger ribonucleic acid expression in the hypothalamus of the ewe is regulated by sex steroids and season. Endocrinology 148: 1150-1157. 212. Clarkson J, d'Anglemont de Tassigny X, Moreno AS, Colledge WH, Herbison AE (2008) Kisspeptin-GPR54 signaling is essential for preovulatory gonadotropin- releasing hormone neuron activation and the luteinizing hormone surge. J Neurosci 28: 8691-8697. 213. Smith JT, Popa SM, Clifton DK, Hoffman GE, Steiner RA (2006) Kiss1 neurons in the forebrain as central processors for generating the preovulatory luteinizing hormone surge. J Neurosci 26: 6687-6694. 214. Lehman MN, Coolen LM, Goodman RL (2010) Minireview: kisspeptin/neurokinin B/dynorphin (KNDy) cells of the arcuate nucleus: a central node in the control of gonadotropin-releasing hormone secretion. Endocrinology 151: 3479-3489. 215. Pielecka-Fortuna J, DeFazio RA, Moenter SM (2011) Voltage-gated potassium currents are targets of diurnal changes in estradiol feedback regulation and kisspeptin action on gonadotropin-releasing hormone neurons in mice. Biol Reprod 85: 987-995. 216. Zhang C, Roepke TA, Kelly MJ, Ronnekleiv OK (2008) Kisspeptin depolarizes gonadotropin-releasing hormone neurons through activation of TRPC-like cationic channels. J Neurosci 28: 4423-4434.
101 217. Rance NE, Young WS (1991) Hypertrophy and increased gene expression of neurons containing neurokinin-B and substance-P messenger ribonucleic acids in the hypothalami of postmenopausal women. Endocrinology 128: 2239-2247. 218. Sahu A, Kalra SP (1992) Effects of tachykinins on luteinizing hormone release in female rats: potent inhibitory action of neuropeptide K. Endocrinology 130: 1571- 1577. 219. Rance NE, Bruce TR (1994) Neurokinin B gene expression is increased in the arcuate nucleus of ovariectomized rats. Neuroendocrinology 60: 337-345. 220. Goodman RL, Coolen LM, Anderson GM, Hardy SL, Valent M, et al. (2004) Evidence that dynorphin plays a major role in mediating progesterone negative feedback on gonadotropin-releasing hormone neurons in sheep. Endocrinology 145: 2959-2967. 221. Foradori CD, Goodman RL, Adams VL, Valent M, Lehman MN (2005) Progesterone increases dynorphin a concentrations in cerebrospinal fluid and preprodynorphin messenger ribonucleic Acid levels in a subset of dynorphin neurons in the sheep. Endocrinology 146: 1835-1842. 222. Foradori CD, Coolen LM, Fitzgerald ME, Skinner DC, Goodman RL, et al. (2002) Colocalization of progesterone receptors in parvicellular dynorphin neurons of the ovine preoptic area and hypothalamus. Endocrinology 143: 4366-4374. 223. Krajewski SJ, Burke MC, Anderson MJ, McMullen NT, Rance NE (2010) Forebrain projections of arcuate neurokinin B neurons demonstrated by anterograde tract- tracing and monosodium glutamate lesions in the rat. Neuroscience 166: 680-697. 224. Wakabayashi Y, Nakada T, Murata K, Ohkura S, Mogi K, et al. (2010) Neurokinin B and dynorphin A in kisspeptin neurons of the arcuate nucleus participate in generation of periodic oscillation of neural activity driving pulsatile gonadotropin-releasing hormone secretion in the goat. J Neurosci 30: 3124-3132. 225. Navarro VM, Gottsch ML, Wu M, Garcia-Galiano D, Hobbs SJ, et al. (2011) Regulation of NKB pathways and their roles in the control of Kiss1 neurons in the arcuate nucleus of the male mouse. Endocrinology 152: 4265-4275. 226. Rance NE, Krajewski SJ, Smith MA, Cholanian M, Dacks PA (2010) Neurokinin B and the hypothalamic regulation of reproduction. Brain Res 1364: 116-128. 227. Mittelman-Smith MA, Williams H, Krajewski-Hall SJ, Lai J, Ciofi P, et al. (2012) Arcuate kisspeptin/neurokinin B/dynorphin (KNDy) neurons mediate the estrogen suppression of gonadotropin secretion and body weight. Endocrinology 153: 2800-2812. 228. Clarkson J, Herbison AE (2011) Dual phenotype kisspeptin-dopamine neurones of the rostral periventricular area of the third ventricle project to gonadotrophin- releasing hormone neurones. J Neuroendocrinol 23: 293-301. 229. Clarkson J, Herbison AE (2009) Oestrogen, kisspeptin, GPR54 and the pre- ovulatory luteinising hormone surge. J Neuroendocrinol 21: 305-311. 230. Clarkson J, Han S-K, Liu X, Lee K, Herbison AE (2010) Neurobiological mechanisms underlying kisspeptin activation of gonadotropin-releasing hormone (GnRH) neurons at puberty. Mol Cell Endocrinol 324: 45-50. 231. Popa SM, Clifton DK, Steiner RA (2008) The role of kisspeptins and GPR54 in the neuroendocrine regulation of reproduction. Annu Rev Physiol 70: 213-238.
102 232. Navarro VM, Castellano JM, Fernandez-Fernandez R, Barreiro ML, Roa J, et al. (2004) Developmental and hormonally regulated messenger ribonucleic acid expression of KiSS-1 and its putative receptor, GPR54, in rat hypothalamus and potent luteinizing hormone-releasing activity of KiSS-1 peptide. Endocrinology 145: 4565-4574. 233. Navarro VM, Castellano JM, Fernandez-Fernandez R, Tovar S, Roa J, et al. (2005) Effects of KiSS-1 peptide, the natural ligand of GPR54, on follicle-stimulating hormone secretion in the rat. Endocrinology 146: 1689-1697. 234. Plant TM, Ramaswamy S, Dipietro MJ (2006) Repetitive activation of hypothalamic G protein-coupled receptor 54 with intravenous pulses of kisspeptin in the juvenile monkey (Macaca mulatta) elicits a sustained train of gonadotropin- releasing hormone discharges. Endocrinology 147: 1007-1013. 235. Dhillo WS, Chaudhri OB, Patterson M, Thompson EL, Murphy KG, et al. (2005) Kisspeptin-54 stimulates the hypothalamic-pituitary gonadal axis in human males. J Clin Endocrinol Metab 90: 6609-6615. 236. Kinoshita M, Tsukamura H, Adachi S, Matsui H, Uenoyama Y, et al. (2005) Involvement of central metastin in the regulation of preovulatory luteinizing hormone surge and estrous cyclicity in female rats. Endocrinology 146: 4431- 4436. 237. Liu X, Herbison AE (2008) Small-conductance calcium-activated potassium channels control excitability and firing dynamics in gonadotropin-releasing hormone (GnRH) neurons. Endocrinology 149: 3598-3604. 238. Novaira HJ, Ng Y, Wolfe A, Radovick S (2009) Kisspeptin increases GnRH mRNA expression and secretion in GnRH secreting neuronal cell lines. Mol Cell Endocrinol 311: 126-134. 239. Martinez-Chavez CC, Minghetti M, Migaud H (2008) GPR54 and rGnRH I gene expression during the onset of puberty in Nile tilapia. Gen Comp Endocrinol 156: 224-233. 240. Filby AL, van Aerle R, Duitman J, Tyler CR (2008) The kisspeptin/gonadotropin- releasing hormone pathway and molecular signaling of puberty in fish. Biol Reprod 78: 278-289. 241. Li S, Ren J, Yang G, Guo Y, Huang L (2008) Characterization of the porcine Kisspeptins receptor gene and evaluation as candidate for timing of puberty in sows. J Anim Breed Genet 125: 219-227. 242. Navarro VM, Fernandez-Fernandez R, Castellano JM, Roa J, Mayen A, et al. (2004) Advanced vaginal opening and precocious activation of the reproductive axis by KiSS-1 peptide, the endogenous ligand of GPR54. J Physiol 561: 379-386. 243. Clarkson J, Boon WC, Simpson ER, Herbison AE (2009) Postnatal development of an estradiol-kisspeptin positive feedback mechanism implicated in puberty onset. Endocrinology 150: 3214-3220. 244. Keen KL, Wegner FH, Bloom SR, Ghatei MA, Terasawa E (2008) An increase in kisspeptin-54 release occurs with the pubertal increase in luteinizing hormone- releasing hormone-1 release in the stalk-median eminence of female rhesus monkeys in vivo. Endocrinology 149: 4151-4157. 245. Terasawa E, Guerriero KA, Plant TM (2013) Kisspeptin and puberty in mammals. Adv Exp Med Biol 784: 253-273.
103 246. Terasawa E, Fernandez DL (2001) Neurobiological mechanisms of the onset of puberty in primates. Endocr Rev 22: 111-151. 247. Mitsushima D, Hei DL, Terasawa E (1994) gamma-Aminobutyric acid is an inhibitory neurotransmitter restricting the release of luteinizing hormone-releasing hormone before the onset of puberty. Proc Natl Acad Sci U S A 91: 395-399. 248. Keen KL, Burich AJ, Mitsushima D, Kasuya E, Terasawa E (1999) Effects of pulsatile infusion of the GABA(A) receptor blocker bicuculline on the onset of puberty in female rhesus monkeys. Endocrinology 140: 5257-5266. 249. El Majdoubi M, Sahu A, Ramaswamy S, Plant TM (2000) Neuropeptide Y: A hypothalamic brake restraining the onset of puberty in primates. Proc Natl Acad Sci U S A 97: 6179-6184. 250. Smith JT (2008) Kisspeptin signalling in the brain: steroid regulation in the rodent and ewe. Brain Res Rev 57: 288-298. 251. Smith JT (2009) Sex steroid control of hypothalamic Kiss1 expression in sheep and rodents: comparative aspects. Peptides 30: 94-102. 252. Herbison AE (2008) Estrogen positive feedback to gonadotropin-releasing hormone (GnRH) neurons in the rodent: the case for the rostral periventricular area of the third ventricle (RP3V). Brain Res Rev 57: 277-287. 253. Smith JT (2013) Sex steroid regulation of kisspeptin circuits. Adv Exp Med Biol 784: 275-295. 254. Revel F, Saboureau M, Masson-Pevet M, Pevet P, Mikkelsen J, et al. (2006) Kisspeptin mediates the photoperiodic control of reproduction in hamsters. Curr Biol 16: 1730-1735. 255. Smith JT, Dungan HM, Stoll EA, Gottsch ML, Braun RE, et al. (2005) Differential regulation of KiSS-1 mRNA expression by sex steroids in the brain of the male mouse. Endocrinology 146: 2976-2984. 256. Roseweir AK, Kauffman AS, Smith JT, Guerriero KA, Morgan K, et al. (2009) Discovery of potent kisspeptin antagonists delineate physiological mechanisms of gonadotropin regulation. J Neurosci 29: 3920-3929. 257. Rometo AM, Krajewski SJ, Voytko ML, Rance NE (2007) Hypertrophy and increased kisspeptin gene expression in the hypothalamic infundibular nucleus of postmenopausal women and ovariectomized monkeys. J Clin Endocrinol Metab 92: 2744-2750. 258. Dungan HM, Gottsch ML, Zeng H, Gragerov A, Bergmann JE, et al. (2007) The role of kisspeptin-GPR54 signaling in the tonic regulation and surge release of gonadotropin-releasing hormone/luteinizing hormone. J Neurosci 27: 12088- 12095. 259. Kim W, Jessen HM, Auger AP, Terasawa E (2009) Postmenopausal increase in KiSS-1, GPR54, and luteinizing hormone releasing hormone (LHRH-1) mRNA in the basal hypothalamus of female rhesus monkeys. Peptides 30: 103-110. 260. Gallo RV (1990) Kappa-opioid receptor involvement in the regulation of pulsatile luteinizing hormone release during early pregnancy in the rat. J Neuroendocrinol 2: 685-691. 261. Okamura H, Tsukamura H, Ohkura S, Uenoyama Y, Wakabayashi Y, et al. (2013) Kisspeptin and GnRH pulse generation. Adv Exp Med Biol 784: 297-323.
104 262. Navarro VM, Gottsch ML, Chavkin C, Okamura H, Clifton DK, et al. (2009) Regulation of gonadotropin-releasing hormone secretion by kisspeptin/dynorphin/neurokinin B neurons in the arcuate nucleus of the mouse. J Neurosci 29: 11859-11866. 263. Pillon D, Caraty A, Fabre-Nys C, Bruneau G (2003) Short-term effect of oestradiol on neurokinin B mRNA expression in the infundibular nucleus of ewes. J Neuroendocrinol 15: 749-753. 264. Sun J, Chu Z, Moenter SM (2010) Diurnal in vivo and rapid in vitro effects of estradiol on voltage-gated calcium channels in gonadotropin-releasing hormone neurons. J Neurosci 30: 3912-3923. 265. Gu GB, Simerly RB (1997) Projections of the sexually dimorphic anteroventral periventricular nucleus in the female rat. J Comp Neurol 384: 142-164. 266. Terasawa E, Wiegand SJ, Bridson WE (1980) A role for medial preoptic nucleus on afternoon of proestrus in female rats. Am J Physiol 238: E533-539. 267. Wiegand SJ, Terasawa E, Bridson WE (1978) Persistent estrus and blockade of progesterone-induced LH release follows lesions which do not damage the suprachiasmatic nucleus. Endocrinology 102: 1645-1648. 268. Pineda R, Garcia-Galiano D, Roseweir A, Romero M, Sanchez-Garrido MA, et al. (2010) Critical roles of kisspeptins in female puberty and preovulatory gonadotropin surges as revealed by a novel antagonist. Endocrinology 151: 722- 730. 269. Mayer C, Acosta-Martinez M, Dubois SL, Wolfe A, Radovick S, et al. (2010) Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc Natl Acad Sci U S A 107: 22693- 22698. 270. Dhillo WS, Chaudhri OB, Thompson EL, Murphy KG, Patterson M, et al. (2007) Kisspeptin-54 stimulates gonadotropin release most potently during the preovulatory phase of the menstrual cycle in women. J Clin Endocrinol Metab 92: 3958-3966. 271. Jayasena CN, Nijher GMK, Comninos AN, Abbara A, Januszewki A, et al. (2011) The effects of kisspeptin-10 on reproductive hormone release show sexual dimorphism in humans. J Clin Endocrinol Metab 96: E1963-1972. 272. Chan Y-M, Butler JP, Sidhoum VF, Pinnell NE, Seminara SB (2012) Kisspeptin administration to women: a window into endogenous kisspeptin secretion and GnRH responsiveness across the menstrual cycle. J Clin Endocrinol Metab 97: E1458-1467. 273. Roa J, Vigo E, Castellano JM, Navarro VM, Fernandez-Fernandez R, et al. (2006) Hypothalamic expression of KiSS-1 system and gonadotropin-releasing effects of kisspeptin in different reproductive states of the female Rat. Endocrinology 147: 2864-2878. 274. Smith JT, Saleh SNH, Clarke IJ (2009) Seasonal and cyclical change in the luteinizing hormone response to kisspeptin in the ewe. Neuroendocrinology 90: 283-291. 275. Guerriero KA, Keen KL, Millar RP, Terasawa E (2012) Developmental changes in GnRH release in response to kisspeptin agonist and antagonist in female rhesus
105 monkeys (Macaca mulatta): implication for the mechanism of puberty. Endocrinology 153: 825-836. 276. Tonsfeldt KJ, Goodall CP, Latham KL, Chappell PE (2011) Oestrogen induces rhythmic expression of the Kisspeptin-1 receptor GPR54 in hypothalamic gonadotrophin-releasing hormone-secreting GT1-7 cells. J Neuroendocrinol 23: 823-830. 277. Stafford LJ, Xia C, Ma W, Cai Y, Liu M (2002) Identification and characterization of mouse metastasis-suppressor KiSS1 and its G-protein-coupled receptor. Cancer Res 62: 5399-5404. 278. Liu X, Lee K, Herbison AE (2008) Kisspeptin excites gonadotropin-releasing hormone neurons through a phospholipase C/calcium-dependent pathway regulating multiple ion channels. Endocrinology 149: 4605-4614. 279. Constantin S, Caligioni CS, Stojilkovic S, Wray S (2009) Kisspeptin-10 facilitates a plasma membrane-driven calcium oscillator in gonadotropin-releasing hormone-1 neurons. Endocrinology 150: 1400-1412. 280. Castellano JM, Navarro VM, Fernandez-Fernandez R, Castalo JP, Malagan MM, et al. (2006) Ontogeny and mechanisms of action for the stimulatory effect of kisspeptin on gonadotropin-releasing hormone system of the rat. Mol Cell Endocrinol 257-258: 75-83. 281. Samson WK, Zhang JV, Avsian-Kretchmer O, Cui K, Yosten GLC, et al. (2008) Neuronostatin encoded by the somatostatin gene regulates neuronal, cardiovascular, and metabolic functions. J Biol Chem 283: 31949-31959. 282. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 95: 5857-5864. 283. Letunic I, Doerks T, Bork P (2012) SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res 40: D302-305. 284. Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10: 1-6. 285. Bendtsen JDv, Nielsen H, von Heijne G, Brunak Sr (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340: 783-795. 286. Käll L, Krogh A, Sonnhammer ELL (2004) A combined transmembrane topology and signal peptide prediction method. J Mol Biol 338: 1027-1036. 287. Hayashida K, Bartlett AH, Chen Y, Park PW (2010) Molecular and cellular mechanisms of ectodomain shedding. Anat Rec (Hoboken) 293: 925-937. 288. Lyu R-M, Chang J-K (2012) Phoenixin Peptides. In: Organization WIP, editor. USA. pp. 61. 289. Larhammar D, Blomqvist AG, Yee F, Jazin E, Yoo H, et al. (1992) Cloning and functional expression of a human neuropeptide Y/peptide YY receptor of the Y1 type. J Biol Chem 267: 10935-10938. 290. Hinuma S, Shintani Y, Fukusumi S, Iijima N, Matsumoto Y, et al. (2000) New neuropeptides containing carboxy-terminal RFamide and their receptor in mammals. Nat Cell Biol 2: 703-708. 291. Wise A, Jupe SC, Rees S (2004) The identification of ligands at orphan G-protein coupled receptors. Annu Rev Pharmacol Toxicol 44: 43-66.
106 292. Lyu R-M, Huang X-F, Zhang Y, Dun SL, Luo JJ, et al. (2013) Phoenixin: a novel peptide in rodent sensory ganglia. Neuroscience 250: 622-631. 293. Kinton L, Johnson MR, Smith SJM, Farrell F, Stevens J, et al. (2002) Partial epilepsy with pericentral spikes: a new familial epilepsy syndrome with evidence for linkage to chromosome 4p15. Ann Neurol 51: 740-749. 294. Limviphuvadh V, Chua LL, Eisenhaber F, Adhikari S, Maurer-Stroh S (2010) Is LGI2 the candidate gene for partial epilepsy with pericentral spikes? J Bioinform Comput Biol 8: 117-127. 295. Belsham DD, Cai F, Cui H, Smukler SR, Salapatek AMF, et al. (2004) Generation of a phenotypic array of hypothalamic neuronal cell models to study complex neuroendocrine disorders. Endocrinology 145: 393-400. 296. Cepko CL (1989) Immortalization of neural cells via retrovirus-mediated oncogene transduction. Annu Rev Neurosci 12: 47-65. 297. Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, et al. (1990) Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5: 1-10. 298. Kasckow J, Mulchahey JJ, Aguilera G, Pisarska M, Nikodemova M, et al. (2003) Corticotropin-releasing hormone (CRH) expression and protein kinase A mediated CRH receptor signalling in an immortalized hypothalamic cell line. J Neuroendocrinol 15: 521-529. 299. Kawaguchi S, Shinozaki A, Obinata M, Saigo K, Sakaki Y, et al. (2007) Establishment of cell lines derived from the rat suprachiasmatic nucleus. Biochem Biophys Res Commun 355: 555-561. 300. Radovick S, Wray S, Lee E, Nicols DK, Nakayama Y, et al. (1991) Migratory arrest of gonadotropin-releasing hormone neurons in transgenic mice. Proc Natl Acad Sci U S A 88: 3402-3406. 301. Gingerich S, Wang X, Lee PKP, Dhillon SS, Chalmers JA, et al. (2009) The generation of an array of clonal, immortalized cell models from the rat hypothalamus: analysis of melatonin effects on kisspeptin and gonadotropin- inhibitory hormone neurons. Neuroscience 162: 1134-1140. 302. Earnest DJ, Liang FQ, DiGiorgio S, Gallagher M, Harvey B, et al. (1999) Establishment and characterization of adenoviral E1A immortalized cell lines derived from the rat suprachiasmatic nucleus. J Neurobiol 39: 1-13. 303. Belsham DD, Fick LJ, Dalvi PS, Centeno M-L, Chalmers JA, et al. (2009) Ciliary neurotrophic factor recruitment of glucagon-like peptide-1 mediates neurogenesis, allowing immortalization of adult murine hypothalamic neurons. FASEB J 23: 4256-4265. 304. Dalvi PS, Nazarians-Armavil A, Tung S, Belsham DD (2011) Immortalized neurons for the study of hypothalamic function. Am J Physiol Regul Integr Comp Physiol 300: R1030-1052. 305. McFadden SA, Menchella JA, Chalmers JA, Centeno M-L, Belsham DD (2013) Glucose responsiveness in a novel adult-derived GnRH cell line, mHypoA- GnRH/GFP: involvement of AMP-activated protein kinase. Mol Cell Endocrinol 377: 65-74.
107 306. Sim JA, Skynner MJ, Herbison AE (2001) Heterogeneity in the basic membrane properties of postnatal gonadotropin-releasing hormone neurons in the mouse. J Neurosci 21: 1067-1075. 307. Campbell RE, Han S-K, Herbison AE (2005) Biocytin filling of adult gonadotropin- releasing hormone neurons in situ reveals extensive, spiny, dendritic processes. Endocrinology 146: 1163-1169. 308. Dhillon SS, McFadden SA, Chalmers JA, Centeno M-L, Kim GL, et al. (2011) Cellular leptin resistance impairs the leptin-mediated suppression of neuropeptide Y secretion in hypothalamic neurons. Endocrinology 152: 4138-4147. 309. Suter KJ, Song WJ, Sampson TL, Wuarin JP, Saunders JT, et al. (2000) Genetic targeting of green fluorescent protein to gonadotropin-releasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology. Endocrinology 141: 412-419. 310. Gottsch ML, Popa SM, Lawhorn JK, Qiu J, Tonsfeldt KJ, et al. (2011) Molecular properties of Kiss1 neurons in the arcuate nucleus of the mouse. Endocrinology 152: 4298-4309. 311. Kokoeva MV, Yin H, Flier JS (2005) Neurogenesis in the hypothalamus of adult mice: potential role in energy balance. Science 310: 679-683. 312. Kokoeva MV, Yin H, Flier JS (2007) Evidence for constitutive neural cell proliferation in the adult murine hypothalamus. J Comp Neurol 505: 209-220. 313. Nieuwenhuys R, Voogd J, van Huijzen C (2008) The human central nervous system. Berlin: Springer Berlin Heidelberg. 314. Maeda K-I, Adachi S, Inoue K, Ohkura S, Tsukamura H (2007) Metastin/kisspeptin and control of estrous cycle in rats. Rev Endocr Metab Disord 8: 21-29. 315. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156- 159. 316. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, et al. (2012) Primer- BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13: 134. 317. Kovacs KJ (2008) Measurement of immediate-early gene activation- c-fos and beyond. J Neuroendocrinol 20: 665-672. 318. Mahachoklertwattana P, Black SM, Kaplan SL, Bristow JD, Grumbach MM (1994) Nitric oxide synthesized by gonadotropin-releasing hormone neurons is a mediator of N-methyl-D-aspartate (NMDA)-induced GnRH secretion. Endocrinology 135: 1709-1712. 319. Messeguer X, Escudero R, Farre D, Nunez O, Martinez J, et al. (2002) PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18: 333-334. 320. Farre D, Roset R, Huerta M, Adsuara JE, Rosello L, et al. (2003) Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res 31: 3651-3653. 321. Tena-Sempere M (2006) GPR54 and kisspeptin in reproduction. Hum Reprod Update 12: 631-639.
108 322. Wolfe A, Divall S, Wu S (2014) The regulation of reproductive neuroendocrine function by insulin and insulin-like growth factor-1 (IGF-1). Front Neuroendocrinol. 323. Toufexis D, Rivarola MA, Lara H, Viau V (2014) Stress and the Reproductive Axis. J Neuroendocrinol. 324. Mayer CM, Belsham DD (2009) Insulin directly regulates NPY and AgRP gene expression via the MAPK MEK/ERK signal transduction pathway in mHypoE-46 hypothalamic neurons. Mol Cell Endocrinol 307: 99-108. 325. Krsmanovic LZ, Stojilkovic SS, Mertz LM, Tomic M, Catt KJ (1993) Expression of gonadotropin-releasing hormone receptors and autocrine regulation of neuropeptide release in immortalized hypothalamic neurons. Proc Natl Acad Sci U S A 90: 3908-3912. 326. Padmanabhan V, Evans NP, Dahl GE, McFadden KL, Mauger DT, et al. (1995) Evidence for short or ultrashort loop negative feedback of gonadotropin-releasing hormone secretion. Neuroendocrinology 62: 248-258. 327. Pielecka-Fortuna J, Chu Z, Moenter SM (2008) Kisspeptin acts directly and indirectly to increase gonadotropin-releasing hormone neuron activity and its effects are modulated by estradiol. Endocrinology 149: 1979-1986. 328. Zhang C, Bosch MA, Ronnekleiv OK, Kelly MJ (2009) Gamma-aminobutyric acid B receptor mediated inhibition of gonadotropin-releasing hormone neurons is suppressed by kisspeptin-G protein-coupled receptor 54 signaling. Endocrinology 150: 2388-2394. 329. Kim GL, Dhillon SS, Belsham DD (2010) Kisspeptin directly regulates neuropeptide Y synthesis and secretion via the ERK1/2 and p38 mitogen- activated protein kinase signaling pathways in NPY-secreting hypothalamic neurons. Endocrinology 151: 5038-5047. 330. Hoffman GE, Smith MS, Verbalis JG (1993) c-Fos and related immediate early gene products as markers of activity in neuroendocrine systems. Front Neuroendocrinol 14: 173-213. 331. Sheng M, McFadden G, Greenberg ME (1990) Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron 4: 571-582. 332. Fan S-F, Yazulla S (2003) Biphasic modulation of voltage-dependent currents of retinal cones by cannabinoid CB1 receptor agonist WIN 55212-2. Vis Neurosci 20: 177-188. 333. Clark ME, Mellon PL (1995) The POU homeodomain transcription factor Oct-1 is essential for activity of the gonadotropin-releasing hormone neuron-specific enhancer. Mol Cell Biol 15: 6169-6177. 334. Lawson MA, Whyte DB, Mellon PL (1996) GATA factors are essential for activity of the neuron-specific enhancer of the gonadotropin-releasing hormone gene. Mol Cell Biol 16: 3596-3605. 335. Lawson MA, Buhain AR, Jovenal JC, Mellon PL (1998) Multiple factors interacting at the GATA sites of the gonadotropin-releasing hormone neuron-specific enhancer regulate gene expression. Mol Endocrinol 12: 364-377.
109 336. Kelley CG, Lavorgna G, Clark ME, Boncinelli E, Mellon PL (2000) The Otx2 homeoprotein regulates expression from the gonadotropin-releasing hormone proximal promoter. Mol Endocrinol 14: 1246-1256. 337. Mallamaci A, Di Blas E, Briata P, Boncinelli E, Corte G (1996) OTX2 homeoprotein in the developing central nervous system and migratory cells of the olfactory area. Mech Dev 58: 165-178. 338. Diaczok D, DiVall S, Matsuo I, Wondisford FE, Wolfe AM, et al. (2011) Deletion of Otx2 in GnRH neurons results in a mouse model of hypogonadotropic hypogonadism. Mol Endocrinol 25: 833-846. 339. Novaira HJ, Fadoju D, Diaczok D, Radovick S (2012) Genetic mechanisms mediating kisspeptin regulation of GnRH gene expression. J Neurosci 32: 17391- 17400. 340. Williams AE (2008) Functional aspects of animal microRNAs. Cell Mol Life Sci 65: 545-562. 341. Ye R-S, Xi Q-Y, Qi Q, Cheng X, Chen T, et al. (2013) Differentially expressed miRNAs after GnRH treatment and their potential roles in FSH regulation in porcine anterior pituitary cell. PLoS One 8: e57156. 342. Yuen T, Ruf F, Chu T, Sealfon SC (2009) Microtranscriptome regulation by gonadotropin-releasing hormone. Mol Cell Endocrinol 302: 12-17. 343. Charles A, Weiner R, Costantin J (2001) cAMP modulates the excitability of immortalized H=hypothalamic (GT1) neurons via a cyclic nucleotide gated channel. Mol Endocrinol 15: 997-1009. 344. Vitalis EA, Costantin JL, Tsai PS, Sakakibara H, Paruthiyil S, et al. (2000) Role of the cAMP signaling pathway in the regulation of gonadotropin-releasing hormone secretion in GT1 cells. Proc Natl Acad Sci U S A 97: 1861-1866. 345. Michel MC (1991) Receptors for neuropeptide Y: multiple subtypes and multiple second messengers. Trends Pharmacol Sci 12: 389-394. 346. Parhar I, Ogawa S, Kitahashi T (2012) RFamide peptides as mediators in environmental control of GnRH neurons. Prog Neurobiol 98: 176-196. 347. Semaan SJ, Kauffman AS (2013) Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int J Dev Neurosci 31: 452-462. 348. Tomikawa J, Uenoyama Y, Ozawa M, Fukanuma T, Takase K, et al. (2012) Epigenetic regulation of Kiss1 gene expression mediating estrogen-positive feedback action in the mouse brain. Proc Natl Acad Sci U S A 109: E1294-1301. 349. Roseweir AK, Millar RP (2013) Kisspeptin antagonists. Adv Exp Med Biol 784: 159-186. 350. Ferguson SS (2001) Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacol Rev 53: 1-24. 351. Gu G, Rojo AA, Zee MC, Yu J, Simerly RB (1996) Hormonal regulation of CREB phosphorylation in the anteroventral periventricular nucleus. J Neurosci 16: 3035- 3044. 352. Abraham IM, Han S-K, Todman MG, Korach KS, Herbison AE (2003) Estrogen receptor beta mediates rapid estrogen actions on gonadotropin-releasing hormone neurons in vivo. J Neurosci 23: 5771-5777.
110 353. Kwakowsky A, Herbison AE, Abraham IM (2012) The role of cAMP response element-binding protein in estrogen negative feedback control of gonadotropin- releasing hormone neurons. J Neurosci 32: 11309-11317. 354. Altarejos JY, Goebel N, Conkright MD, Inoue H, Xie J, et al. (2008) The Creb1 coactivator Crtc1 is required for energy balance and fertility. Nat Med 14: 1112- 1117. 355. Hockings GI, Grice JE, Walters MM, Jackson RV (1991) L-type calcium channels and CRH-mediated ACTH and cortisol release in humans. Clin Exp Pharmacol Physiol 18: 303-307. 356. Martinez de la Escalera G, Choi AL, Weiner RI (1992) Beta 1-adrenergic regulation of the GT1 gonadotropin-releasing hormone (GnRH) neuronal cell lines: stimulation of GnRH release via receptors positively coupled to adenylate cyclase. Endocrinology 131: 1397-1402. 357. Martinez de la Escalera G, Gallo F, Choi AL, Weiner RI (1992) Dopaminergic regulation of the GT1 gonadotropin-releasing hormone (GnRH) neuronal cell lines: stimulation of GnRH release via D1-receptors positively coupled to adenylate cyclase. Endocrinology 131: 2965-2971. 358. Martinez de la Escalera G, Choi AL, Weiner RI (1995) Signaling pathways involved in GnRH secretion in GT1 cells. Neuroendocrinology 61: 310-317. 359. Larco DO, Cho-Clark M, Mani SK, Wu TJ (2013) The metabolite GnRH-(1-5) inhibits the migration of immortalized GnRH neurons. Endocrinology 154: 783- 795. 360. Vossler MR, Yao H, York RD, Pan MG, Rim CS, et al. (1997) cAMP activates MAP kinase and Elk-1 through a B-Raf- and Rap1-dependent pathway. Cell 89: 73-82. 361. Dugan LL, Kim JS, Zhang Y, Bart RD, Sun Y, et al. (1999) Differential effects of cAMP in neurons and astrocytes. Role of B-raf. J Biol Chem 274: 25842-25848. 362. Yao H, York RD, Misra-Press A, Carr DW, Stork PJ (1998) The cyclic adenosine monophosphate-dependent protein kinase (PKA) is required for the sustained activation of mitogen-activated kinases and gene expression by nerve growth factor. J Biol Chem 273: 8240-8247. 363. Bos JL (2006) Epac proteins: multi-purpose cAMP targets. Trends Biochem Sci 31: 680-686. 364. Kovalovsky D, Refojo D, Liberman AC, Hochbaum D, Pereda MP, et al. (2002) Activation and induction of NUR77/NURR1 in corticotrophs by CRH/cAMP: involvement of calcium, protein kinase A, and MAPK pathways. Mol Endocrinol 16: 1638-1651. 365. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, et al. (2000) Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74: 311-317. 366. Advis JP, Klein J, Kuljis RO, Sarkar DK, McDonald JM, et al. (2003) Regulation of gonadotropin releasing hormone release by neuropeptide Y at the median eminence during the preovulatory period in ewes. Neuroendocrinology 77: 246- 257. 367. Besecke LM, Wolfe AM, Pierce ME, Takahashi JS, Levine JE (1994) Neuropeptide Y stimulates luteinizing hormone-releasing hormone release from superfused hypothalamic GT1-7 cells. Endocrinology 135: 1621-1627.
111 368. Masters JR (2002) False cell lines: The problem and a solution. Cytotechnology 39: 69-74. 369. Ross J (1995) mRNA stability in mammalian cells. Microbiol Rev 59: 423-450. 370. Yosten GLC, Redlinger LJ, Samson WK (2012) Evidence for an interaction of neuronostatin with the orphan G protein-coupled receptor, GPR107. Am J Physiol Regul Integr Comp Physiol 303: R941-949. 371. Ben-Shlomo I, Rauch R, Avsian-Kretchmer O, Hsueh AJW (2007) Matching receptome genes with their ligands for surveying paracrine/autocrine signaling systems. Mol Endocrinol 21: 2009-2014. 372. Takumi K, Iijima N, Higo S, Ozawa H (2012) Immunohistochemical analysis of the colocalization of corticotropin-releasing hormone receptor and glucocorticoid receptor in kisspeptin neurons in the hypothalamus of female rats. Neurosci Lett 531: 40-45. 373. Alcin E, Sahu A, Ramaswamy S, Hutz ED, Keen KL, et al. (2013) Ovarian regulation of kisspeptin neurones in the arcuate nucleus of the rhesus monkey (macaca mulatta). J Neuroendocrinol 25: 488-496. 374. Jayasena CN, Dhillo WS (2009) Kisspeptin offers a novel therapeutic target in reproduction. Curr Opin Investig Drugs 10: 311-318.
112