of ACCase Ile of ACCase report first the is This P-ethyl-resistance of A.aequalis. resistance mechanisms were both present in fenoxaprop- suggesting thattarget-site resistanceandnon-target-site cytochrome P450, mutation, resistance. cytochrome P450,mutation,resistance. Key words: Acetolactate synthase,acetyl-CoA carboxylase, aequalis. in aPro acetolactate synthase (ALS)geneoftheRplants,resulting single nucleotide change of CCCto CGC waspresent in an Ile (ACCase) gene of theresistant (R) , resulting in of ATT to AAT waspresentinacetyl-CoA carboxylase Sequencing resultsshowedthat a singlenucleotide change site andnon-target-site based resistance mechanisms. the purified subpopulation and explore the potential target- study aimed to establish the cross-resistance pattern using to fenoxaprop-P-ethylandmesosulfuron-methyl. This from Anhui ProvinceChina,wassuspectedtoberesistant One fields. China which hasbecomeincreasinglytroublesometocontrolin aequalisSobol.isacommongrassweed, ABSTRACT growth reduction (GR pretreatment of piperonyl butoxide reduced the 50% to tralkoxydim, sethoxydim, and isoproturon. The flucarbazonc- and pyroxsulam sodium, lowlyresistant to pinoxaden, and susceptible to resistant moderately population was highlyresistanttoclodinafop-propargyl, methyl. Cross resistance patterns showed that the R level resistance to fenoxaprop-P-ethyl and mesosulfuron- susceptible (S)population,Rpopulationdisplayedhigh in whole- bioassays. Compared with the resistant plants were isolated and the seeds were used doi:10.4067/S0718-58392016000200005 Accepted: 22March2016. Received: 10December2015. Taian, 271000,China. 2 271018, China. 1 Wenlei Guo resistant short-awnfoxtail ( cross resistance ofamultiple Weitang Liu aequalis Taian Academy of Agricultural Sciences of ShandongProvince, Shandong Agricultural University, College of Plant Protection, Taian, CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL 2041 197 Asn amino acidsubstitution.Besides,another Asn Arg aminoacidsubstitution. The homozygous * Corresponding author([email protected]). 2041 1 1 , Lingling Lv , andJinxinWang Asn and ALS Pro Sobol.)populationinwheatfield 50 A. aequalispopulation,collected ) valueoffenoxaprop-P-ethyl, CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL 1 , Lele Zhang 197 1* Arg mutation in A. 1 , QiLi 1 - , Cuixia Wu JUNE 2016 with was reportedthatwheatyieldreduced24.2%and51.9%infested which guaranteesitscompetitiveness againstwheatseedlings.It ground, the to flutter easily seeds the and capacity reproductive the Yangtze River (Zhang,2003).Alopecurusaequalishasastrong some regionsofChina,especially inthelower-middle reachesof grass weedinfesting wheat (Triticum aestivum L.)production in Short-awn foxtail (Alopecurus aequalis Sobol.)isa winter-annual INTRODUCTION and sulfonylaminocarbonyltriazolinones (SCTs) (Dugglebyet triazolopyrimidines (TPs), pyrimidinylthiobenzoates (PTBs), four more dissimilar chemical classes: imidazolinones (IMIs), 4.1.3.18). Besidesthe SUs, ALS-inhibiting herbicides also include inhibiting the activity of enzyme acetolactate synthase (ALS,EC targets thebiosynthetic pathway ofbranched chainaminoacidsby other ACCase inhibitorsinChina(Heap,2015). aequalis, have evolved resistance to fenoxaprop-P-ethyl and/or fenoxaprop-P-ethyl andatleast eightweedspecies, including a result, the control effect on grassweedsdeclined gradually by people applieditastheuniquemethodforgrassweedcontrol. As grass weeds in wheat fields since 1990s. Moreover, in some areas, ethyl has been extensively used to control al., 2003). InChina, postemergence application of fenoxaprop-P- ACCase isthetarget for ACCase-inhibiting herbicides (Zhang et carboxyl transferase (CT)domain ofthemultidomain chloroplastic 1997; Hoferetal.,2006).Previousstudieshaveprovedthatthe the phenylpyrazoline herbicide pinoxaden (DEN)(Herbertetal., herbicides, namely the APPs, the cyclohexanediones (CHDs) and chloroplastic multidomain ACCase ingrassspeciesissensitivetothreedistinct classes of the contrary, the On 1994). Sasaki, ACCase inthecytosolareinsensitivetoherbicides(Konishiand 2004). Interestingly, the multisubunit ACCase andmultidomain multidomain in thePoaceae (grasses) family (Sasaki andNagano, Hall, 1997). However, both cytosolic and chloroplastic ACCase are chloroplastic ACCase isamultisubunit enzyme (Incledon and species, thecytosolic ACCase isamultidomain enzyme andthe in thecytosolrespectively (Konishi et al., 1996).Inmostplant and chloroplast the in identified are forms Inplants, ACCase different two acid biosynthesis. of fatty step first the catalyzes that CoA carboxylase (ACCase;EC6.4.1.2),whichisakeyenzyme (APP) herbicide class and it can inhibit the activity of acetyl- Fenoxaprop-P-ethyl belongs to the aryloxyphenoxypropionate respectively (Zhuand Tu, 1997). 2 Mesosulfuron-methyl is a sulfonylurea (SU) compound that , Xingtao Lu Alopecurus Alopecurus A. aequalisat540to675and1197 to1560plantsm - JUNE 2016 2 , A. aequalis and other A. -2 ,

163 RESEARCHRESEARCH weed species,including herbicides is nowrecognized to be widespread in several various crossresistancepatterns(Yu andPowles,2014a). or thesamesubstitutionindifferent weedspeciesmayconfer with thesameactionsite.Nonetheless,different substitutions listed above,usuallyconferscrossresistancetoherbicides based mechanism,suchas ACCase and ALS genemutations Pro Ser, Trp 2010; Beckieand Tardif, 2012; Tranel etal.,2015): Ala been foundineightpositionsof ALS gene(Powlesand Yu, the enzymebeinsensitiveto ALS-inhibiting herbicideshave AJ310767). Similarly, 26target-site substitutionsthatmake to theA.myosuroides ACCase sequence,GenBankaccession 2010; Kaundun,2014):Ile result in ACCase herbicidesresistance(Powlesand Yu, points intheCT domainof ACCase, havebeenprovedto Up to now, 13 amino acid substitutions, locatingatseven enzyme prohibiting herbicides from effective binding. caused bysingleaminoacidsubstitutioninthetarget resistance (Powlesand Yu, 2010).Generally, TSR ismainly (NTSR) arethemainmechanismsresultinginherbicide beginning toemerge insomeregionsofChina. 2006). Inrecent years, mesosulfuron-methyl resistance is can be selected with fewer than ten treatments (Beckie, however, weedresistance to herbicides with thisaction site weed species.Similar to theresistance to ACCase herbicides, in wheat fields, especially for the control of ACCase resistant has become a popular product for grassweedsmanagement Since itsregistration in China2004,mesosulfuron-methyl spectrum of grassweeds andseveral broad-leaved weeds. methyl has a high herbicidal activity towards a wide al., Gly (3), andGly of substitutions at specific position; amino acid residue residue sequence, GenBank accession NM acid amino position; numbering isaccordingtotheArabidopsisthalianaALS specific at substitutions of other herbicides using the purified homozygous resistant homozygous population. purified the using herbicides other aequalis; and(3)evaluate the cross-resistance patternsto P450 monooxygenase in multiple herbicide-resistant conduct preliminary studies on the role of cytochrome mutation(s) in ACCase and ALS gene respectively; (2) ethyl andmesosulfuron-methylisstillamystery. role in multiple resistance of whether ornotcytochrome P450 monooxygenaseplaysa resistance pattern (Yu andPowles,2014b).Nevertheless, metabolic resistance usuallyconfersanunpredictable cross- ingredient of herbicide reaching target site.Unlike TSR, to detoxify herbicides, which reduces the amount of active in NTSR,anditcanenhance metabolic capacity of theplant (Han etal.,2016).Metabolic resistance is aleading member and 2012), al., et Bromus rigidus(Owen CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL Non-target-site resistance to ACCase- and ALS-inhibiting Target-site resistance(TSR)andnon-target-site resistance In thisarticle, we aimedto(1)identifytarget-site 197 2096 2008). an As ALS-inhibiting herbicide, mesosulfuron- (12), Ala Ala/Ser (amino acid residue numbering is according Ala/Ser (aminoacidresiduenumberingisaccording 2027 Cys, Ile 654 (2) (bracketed number represents the amount (2)(bracketednumberrepresentstheamount 205 (1), Asp 2041 Asn/Val, Asp A. 376 myosuroides (Délyeetal.,2010), 1781 (1), Arg A. aequalis to fenoxaprop-P- Leu/Val/Thr, Trp 2078 — 377 114714.2). Target-site Gly, Cys (1), Trp Lolium rigidum 574 1999 2088 - (3),Ser JUNE 2016 Cys/Leu/ Arg, and 122 (3), (3), 653 A.

ieoy btxd (B; 5-[2-(2-butoxyethoxy) (PBO; purchased from Aladdin (Shanghai,China). butoxide ethoxymethyl]-6-propyl-1,3-benzodioxole, 97%) was Piperonyl 1,1-dimethylurea; 50% WP, Bianjing,Suzhou,China). photosystem IIinhibitor isoproturon (3-(4-isopropylphenyl)- 3-sulfonamide; 7.5% WDG, Dow AgroSciences); and pyrimidin-2-yl)-2-methoxy-4-(trifluoromethyl)pyridine- pyroxsulam (N-(5,7-dimethoxy[1,2,4]triazolo[1,5- azanide; 70% WDG, Arysta LifeScience, Shanghai, China); 1-yl)carbonyl]{[2-(trifluoromethoxy)phenyl]sulfonyl} [(4,5-dihydro-3-methoxy-4-methyl-5-oxo-1H of theRpopulation, respectively. The remaining 10 plants mesosulfuron-methyl at 9gai ha 1,3-benzoxazol-2-yloxy)phenoxy]propionate; 69 gL inhibitors: fenoxaprop-P-ethyl(ethyl(R)-2-[4-(6-chloro- at 4°Cuntilused. Seed sampleswereair-dried andstoredinsealedpaperbags N; 119°22’7.7” E),wasusedasthecontrolinthisstudy. uncultivated landinRizhao,Shandongprovince(35°16’5.7” many years. A susceptible(S)populationcollectedfroman and mesosulfuron-methylhadbeencontinuouslyusedfor Shou China, wherefenoxaprop-P in field wheat a county, Anhui province(32°05’11.4” N;116°53’28.8” E), from collected were population Seeds oftheputativeresistant(R)Alopecurusaequalis Plant material, herbicides,andchemicals MATERIALS ANDMETHODS Three weeks after, fenoxaprop-P-ethyl at 62.1 gai ha conditions were the same as described in Guo et al. (2015). The pots were placed in an artificial chamber and the culture transferred to50pots(12-cmdiameter) with loamsoils. germinated, 50 seedswereselected and separately et al.(2015). and germinatedasdescribedinGuo After Prior toplanting, seedsoftheRpopulationwerepretreated ALS mutations population homozygous for ACCase and Acquisition ofpurifiedresistant toluate; 30 gL 2-ylcarbamoyl)sulfamoyl]-α-(methanesulfonamido)-p mesosulfuron-methyl (methyl 2-[(4,6-dimethoxypyrimidin- 2,2-dimethylpropionate; 5% EC,Syngenta); ALS inhibitors: 7-oxo-7H pinoxaden (8-(2,6-diethyl- WDG, Jiangsu Agrochem Laboratory, Changzhou, China); propyl]-3-hydroxy-5-mesitylcyclohex-2-en-1-one; 40% Tianjin, China); tralkoxydim ((RS)-2-[(EZ)-1-(ethoxyimino) propyl]-3-hydroxycyclohex-2-en-1-one; 12.5% EC,Soda, 2-[(EZ)-1-(ethoxyimino)butyl]-5-[(2RS)-2-(ethylthio) propionate; 15% WP, Syngenta); sethoxydim ((5RS)- ynyl (R)-2-[4-(5-chloro-3-fluoro-2-pyridyloxy)phenoxy] Bayer, Hangzhou,China);clodinafop-propargyl (prop-2- The herbicides usedinthisstudywere ACCase -pyrazolo[1,2-d -1 OF, Bayer); flucarbazone-sodium (sodium flucarbazone-sodium Bayer); OF, -ethyl, clodinafop-propargyl ][1,4,5]oxadiazepin-9-yl p-tolyl)-1,2,4,5-tetrahydro- -1 weretreated to 20plants -1,2,4-triazol- -1 -1 EW, and a] -

164 Photosystem IIinhibitor ALS inhibitors ACCase inhibitors response experiments. The recommended fieldratesare showninbold. Table 2.Herbicide dosesappliedtotheresistant (R)populationandthesusceptible(S)ofAlopecurusaequalis indose- AL-F3 AL-F2 AL-R1 RTCCTGCCATCACCWTCCA AL-F1 AC-R1 TCCCTGGAGTCTTGCTTTCA AC-F1 Table 1.Primersusedinthisstudy. were alignedandcomparedrespectively. translated amino acid sequences of ACCase and ALS gene corresponding primers (Table 1). The DNA fragment and (TransGen Biotech, Beijing, China) and sequenced using the Kit Extraction Gel Quick EasyPure the using purified were followed by a final step of 8 min at 72 °C. The PCR products of 94°Cfor30s,X40and72~120 following reaction program: 94°Cfor5min,then35cycles using T100 Thermal cycler (Bio-Rad, America), with the except that the total volume was 50 μL. PCR was conducted (PCR) systemwasthesameasdescribedinGuoetal.(2015), study wasshowedin Table 1. The polymerase chain reaction respectively. The detailed information of primersusedinthis all theknownmutation sites in ACCase and gene, AHAS A. aequalis by CTAB method. Two pairs of primers were usedto amplify (about 80mg,2-to3-leafstage)ofindividual R andSplants Genomic DNA wasextracted from youngleafmaterial ACCase andALS genesequencing then usedinherbicidedose-responseexperiments. and harvested were population resistant purified this from to ensure no other pollen was introduced. When they were ripe, seeds chamber artificial an in cultured and segregated codon position. These homozygousresistantplantswere homozygous resistant both at ACCase 2041andat ALS 197 Sequencing results (n=48)showedthat 16 plantswere was sampled for both ACCase and ALS gene sequencing. as control were treated with water. Each surviving plant ACCase: Acetyl-coenzyme A carboxylase;PBO:piperonylbutoxide; ALS: acetolactatesynthase. PCR: Polymerasechainreaction; ACCase: acetyl-coenzyme A carboxylase; ALS: acetolactatesynthase. CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL Primers Herbicide Isoproturon Flucarbazone-sodium Pyroxsulam Mesosulfuron-methyl Pinoxaden Sethoxydim Tralkoxydim Clodinafop-propargyl Fenoxaprop-P-ethyl +PBO Fenoxaprop-P-ethyl ACCase and ALS gene fragments containing TCATTGCCACTGGTGTTGGGC ATTGCCCGCCTTCCTAAGCC CGTCGCCTTACCCAAACCTAC TTTCCCAGCGGCAGACAGAT Sequence (5’-3’) 0, 28,56,112, 225,450,900 0, 0.5,2.0,7.9,31.5,126,504 0, 0.13,0.4,1.2,3.5,10.6,31.7 0, 3,9,27,81,243,729 0, 1.4,2.8,5.6,11.3, 22.5,45,90 0, 1.9,5.6,16.7,50,150,450 0, 4.8,14.4,43.3,130,390,1170 0, 15,45,135,405,1215,3645 0, 20.7,62.1,186.3,558.9,1676.7,5030.1 0, 20.7,62.1,186.3,558.9,1676.7,5030.1

Resistant population(R) - JUNE 2016 temperature (°C) Annealing 59.6 55

and withoutPBOpretreatment applied twotimes,eachwith2100gaiha plus fenoxaprop-P fenoxaprop-P PBO, with treated were Plants populations weregerminatedandculturedasdescribedabove. Fenoxaprop- (TeeJet nozzle fan flat 9503EVS Technologies, delivering 450LWheaton, Illinois,USA) ha one with equipped were sprayedusingamovingnozzle cabinet sprayer herbicide. were totally dead within 7dundertreatment of each S population. As expected, all plantsfromtheSpopulation field rate (Table 2) to confirm herbicide susceptibilities of the 4- leafstage)weretreated with eachherbicide at thesingle were R populations (2015). Before dose-response experiment, 20 plants (3- to purified the and germinated, sowed andcultured asdescribed in Guoetal. S the from Seeds Cross resistance to herbicides Alopecurus aequalis to give a total rate of 4200gai ha twice andeachtreatmenthadthreereplicates. at 21daftertreatment. The wholeexperiment was conducted weight of the above-ground part of the plants was recorded application, all pots werereturned to the greenhouse. Dry and Spopulations were listedin Table 2. Thirty minutesafter at pressure of280kPa. The herbicide doses applied to the R When theseedlingsgrewto3-4-leafstage,herbicides Application doses ALS sequencing ALS sequencing PCR and ALS sequencing PCR and ACCase sequencing g aiha -1 Usage P -ethyl at the 3- to 4-leaf stage. PBO was was PBO stage. 4-leaf to 3- the at -ethyl -ethyl doseresponse with seeds from 0, 28,56,112, 225,450,900 0, 0.12,0.5,2.0,7.9,31.5,126 0, 0.04,0.13,0.4,1.2,3.5,10.6 0, 0.1,0.3,1,3,9,27 0, 0.7,1.4,2.8,5.6,11.2, 22.5,45 0, 1.9,5.6,16.7,50,150,450 0, 4.8,14.4,43.3,130,390,1170 0, 0.6,1.7,5,15,45,135 0, 0.8,2.3,6.9,20.7,62.1,186.3 0, 0.8,2.3,6.9,20.7,62.1,186.3 Susceptible population(S) h S n prfe R purified and S the -1 in 194 L water ha -1 Guo etal.,2015 in 97 L in97 ha Bi etal.,2016 This article This article -ethyl, and PBO PBO and -ethyl, Reference -1 water, -1 -1

165 above-ground partwereassessed. plants were harvested after 21 d, when dry weights of the in showed were ethyl TablePBO. without or with 2, Treated and hydrocarbon solvent mixture. The doses offenoxaprop- P- emulsifier the of solution aqueous with sprayed were herbicide application (Preston etal.,1996).Controlplants homozygous forthis ACCase mutation. What’s more,all the48individuals of theRpopulation were P197R mutationin ALS geneofRpopulation. (a) I2041Nmutationin ACCase gene of Rpopulation;(b) Alopecurus aequalispopulations. The boxedcodonsindicate: ACCase and ALS genefrom resistant (R)andsusceptible (S) Figure 1. of plastid Alignment ofpartialaminoacidsequences of Tween-80 mixture (1 mL L a in formulated was PBO 2013). al., et (Wang to AAT, resulting in an Ile amino acidsubstitution: a singlenucleotide change of ATT the sequencesbetween R andSsamplesrevealed only an 10 individual plants of theSpopulation. Comparison of and 10 control plants) of the R population, as well as from treatment, 18 survivedmesosulfuron-methyl treatment, was amplified from 48individuals (20 survived fenoxaprop-P-ethyl sites mutation verified seven the covering Agene 1437bpPCRfragment of theA.aequalisACCase ACCase andALS genesequencing RESULTS reduction (GR in responses difference of the control. The herbicide doses causing 50% growth nonsignificant had experiments the control. Data were pooled because the two repeated The dryweightdatawereconvertedtoapercentageof Data analyses (RI) was indicated by the ratio of GR slope ofthecurveviaGR where y=C+(D﹣C)/{1exp[b(logxlogGR California, USA): 1995) (SigmaPlot 12.5 software; Systat Software, San Jose, by using a four-parameter log-logistic model (Seefeldt et al., population. ACCase: Acetyl-coenzyme A carboxylase; ALS: acetolactate synthase. acetolactate ACCase: Acetyl-coenzyme carboxylase; AALS: CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL C isthe lower limit, 50 ) inthe R andSpopulations were calculated -1 ) and acetone and applied 1 hprior to 2041 D isthe upper limit and b 50 Asn substitution (Figure 1a). value. The resistance index 50 between the 50 )]} - JUNE 2016 R and [1] is the S ethyl both for ACCase Ile mutation. Accordingly, intotal, 16plantswerehomozygous remaining six plantsdidnothaveanydocumented ALS gene Pro a singlenucleotide changeofCCCtoCGC,leadinga the S population. Comparison of the sequence data showed from theabove48plantsofRpopulationand10 amplified was domains conserved highly five the including shown). 70% and 63% growthreduction respectively (data not sodium treatment at the recommended field rate, with nearly flucarbazone- and pyroxsulam survived plants of 53% and plants oftheSpopulation. mutations, and no documented mutation was detected in plants possessed homozygousIle R purified the all expected, As R and respectively. population, S purified the from sequenced and chosen randomly R population. purified the produce to bulked were they and mutation, (Table 3), thoughtheGR had evolvedlowlevel (3.4-fold) resistance to pinoxaden It was particularly noteworthy that the purified R population less than2whencompared with theSpopulation (Table 3). CHD herbicides: sethoxydim andtralkoxydim. The RIswere the to sensitive were population R purified the of plants the fenoxaprop-P-ethyl andclodinafop-propargyl. Inthisstudy, population, R population was 86.1-and29.8-foldresistantto of fenoxaprop-P-ethyland clodinafop-propargyl (datanotshown).ComparedwiththeS rates field the 27-fold at even rates (Table 2)ofthetwoherbicides.Someplantssurvived propargyl, respectively, which were much more than the field inhibiting herbicides Sensitivity to ACCase-inhibiting andALS- sensitive tothe photosystem IIinhibitorisoproturon (Table 3). very still is population R purified the that showed result The PBO ondose-response to fenoxaprop- Sensitivity to isoproturon andimpact of propargyl (Table 3). The GR level resistance to APP herbicides,fenoxaprop-P-ethylandclodinafop- high displayed R population purified The 229.5 ±31.9gaiha 26 plantswereheterozygous for thePro the 48plantssequenced, 16 plantswerehomozygousand respectively (Table 3). The GR sodium andpyroxsulam, with the RI 32.6,6.0,and9.6, flucarbazone- to resistant moderately mesosulfuron-methyl, still lessthanitsfieldrate(45gaiha six times as many as the field rate (9 g ai ha ai g (9 rate field the as many as times six was R population purified the for mesosulfuron-methyl of Similarly, an1859bpPCRfragment of the ALS gene To verifythepurityofpopulation,20plantswere The purified R population was highly resistant to resistant was highly R population purified The 197 Arg mutation in the R population (Figure 1b). Among -1 2041 offenoxaprop-P-ethyl and clodinafop- Asn mutation and for ALS Pro 50 value(14.2±3.8gai ha 50 values were 757.3 ± 30.2 and 50 value (55.5 ± 3.8 gai ha 2041 -1 ). 197 Asn andPro Arg mutation. The Arg -1 ). About 46% ). About P -1 197 197 ) was - Arg Arg -1 )

166 22% for the purified R population, from 757.3 ± 30.2to ± 757.3 588.9 ±24.5gaiha from R population, purified the for 22% the percentage oftheuntreated control. ai ha with arangeoffenoxaprop-P-ethyl dosesplusor minus4200g susceptible (S) (R) and Figure 2. Dose-response curves for dryweightoftheresistant ha ai g (900 rate field isoproturon the of limit lower the At Table 3. Parameters of the four-parameter log-logistic equation* usedtocalculate the 50% growth reduction (GR g ai ha (4200 pretreatment PBO Withshown). not (data population no apparent effect on survival or biomassofeither the S orR plants fromtheRandSpopulationsweretotallydead. to 8.3±0.4gaiha decreased less than6%fortheSpopulation, from 8.8±0.5 purified resistant (R)andsusceptible(S)populationsof PBO: Piperonylbutoxide. values oftheRandSpopulations. Means with different letters are significantly different according to Tukey’s HSD test (α = 0.05). Resistance index (RI) was calculated as the ratio of GR of ratio the as calculated was (RI) index Resistance 0.05). = (α test HSD Tukey’s to according different significantly are letters different with Means *y =C+(D﹣C)/{1exp[b(logxlogGR through GR CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL Herbicides Fenoxaprop-P-ethyl +PBO(4200gaiha Fenoxaprop-P-ethyl Isoproturon Flucarbazone-sodium Pyroxsulam Mesosulfuron-methyl Pinoxaden Sethoxydim Tralkoxydim Clodinafop-propargyl When PBO was applied alone at 4200 g ai ha -1 piperonyl butoxide (PBO). The valuesare expressed as -1 ), the GR 50 . 50 -1 value of fenoxaprop-P-ethyl decreased (Table 3,Figure2). -1 (Table 3, Figure2).Incomparison, it populations treatedAlopecurus aequalispopulations 50 )]}, whereyisthepercentage of thecontrol,CandDarelowerupperasymptotic limits, bistheslopeofcurve -1 ) Populations S R S R S R S R S R S R S R S R S R S R -1 22.7 (6.6) 22.7 (3.4) 19.6 (1.3) 18.6 (1.3) 19.1 (1.5) 13.2 (9.1) 18.5 (1.6) 18.4 (4.5) 15.5 (4.5) 22.4 (3.6) 20.9 (0.8) 25.1 (2.2) 17.3 (3.5) 25.5 (1.0) 21.5 (5.8) 12.9 (1.2) 24.6 - , therewas JUNE 2016 9.2 (16.7) 9.2 (28.2) 8.9 (13.6) 8.5 (11.0) C Alopecurus aequalis.Standarderrors are inparentheses. -1 ), all ), all 100.7 (7.8) 100.7 (17.9) 107.6 (3.5) 101.9 (14.7) 108.9 99.3 (6.3) 97.9 (1.9) 94.8 (24.7) 80.9 (1.5) 93.6 (8.1) 91.2 (2.3) 98.4 (10.0) 97.3 (16.4) 91.0 (7.7) 97.0 (2.4) 89.8 (2.4) 96.9 (3.6) 87.2 (1.3) 77.6 (3.0) 98.6 (1.6) 91.4 (4.4) Regression parameters resistance evolution(Pro ALS-inhibiting herbicidemesosulfuron-methylwasusedand appeared intheRpopulationanditwasinheritedthough population, Ile repeated useforseveralyears.InindividualplantoftheR fenoxaprop-P from ShouCountyhasevolvedhighlevelresistanceto Powles, the actionsiteofherbicide(Beckieand Tardif, 2012; Yu and Both ACCase and ALS arepronetoresistanceevolutionas serious threatforwheatproductioninChina(Bietal.,2016). inhibiting herbicidesinsomegrassweedshasbecomea In recentyears,multipleresistanceto ACCase and ALS- DISCUSSION population will haveahomozygous ALS mutation, together R the in plants the of most that likely very is it 1980), Oka, aequalis for 7 preserved inspiteoftheinterruption of ACCase applications reported inL.rigidumthatthe ACCase resistancetraitswere homozygous ALS Pro homozygous ALS and onlyone-thirdoftheplants(16out48)possessed 48) possessedthehomozygous ACCase Ile was inaccordancewiththeresultthatallindividualplant(n = was apossibilitythatthe ACCase Ile methyl’s commercializationinthisarea. Therefore, there of fenoxaprop-P mesosulfuron-methyl inthisarea.Inaddition,thecontroleffect fenoxaprop-P simultaneously.detected field, the of owner the to According D yr (Collavo et al., 2013). Considering the fact that is diploid and partly cross-pollinated (Morishma and is diploidandpartlycross-pollinated (Morishmaand 2014a). In this study, the R population collected -ethyl and mesosulfuron-methyl (Table 3) after -ethyl was applied 7 ~ 8 yr earlier than that of -ethyl wasapplied7~8yrearlierthanthatof -1.55 (0.5) -4.23 (1.4) -0.83 (0.1) -0.50 (0.2) -1.57 (0.2) -0.63 (0.5) -1.44 (0.1) -0.88 (0.3) -1.57 (0.2) -0.92 (0.3) -0.90 (0.3) -0.65 (0.1) -0.72 (0.2) -0.95 (0.1) -1.83 (0.3) -0.96 (0.2) -1.73 (0.1) -0.95 (0.2) -1.41 (0.1) -0.81 (0.2) 2041 -ethyl haddecreasedbeforemesosulfuron- Asn mutationandPro b 197 Arg mutation. Similarresulthasbeen 197 Arg mutation). This deduction 0.9940 0.9908 0.9997 0.9949 0.9989 0.9845 0.9991 0.9933 0.9988 0.9941 0.9948 0.9987 0.9984 0.9998 0.9976 0.9983 0.9974 0.9974 0.9993 0.9974 R 2 2041 GR 197 143.2 (23.6) 143.2 (31.9) 229.5 (24.5)b 588.9 (30.2)a 757.3 90.2 (9.5) 14.4 (7.8) 55.5 (3.8) 14.2 (3.8) 16.8 (4.5) 18.7 (8.3) 27.9 (2.1) 50 Arg mutationwere Asn mutation first first mutation Asn 2.4 (0.2) 0.2 (0.02) 2.3 (1.8) 1.7 (0.1) 4.2 (0.3) 8.7 (4.1) 7.7 (0.7) 8.3 (0.4)c 8.8 (0.5)c (gaiha 2041 50 ) values of the Asn mutation Asn mutation -1 ) 0.6 6.0 9.6 32.6 3.4 1.9 1.5 29.8 71.0 86.1 R1 A. A. 50

167 study, the Ile and Powles, 2006),Phalarisparadoxa(Hochberg etal.,2009), A. myosuroides (Délye in and DEN sensitive ormoderately resistant toCHDs APPs, Yu, 2010).Generally, thismutation is highlyresistantto documented in many weed species (reviewed in Powlesand endowing ACCase herbicide resistance and has been weeds inthefields. could effectively control some ACCase and ALS resistant 360 SC, Bayer CropScience, Monheim am Rhein, Germany) Forte (Bacara diflufenican flurtamonec, flufenacet, mixture resistance evolution. ordelay Our unpublished results revealed that prevent the herbicide to diflufenican) + isoproturon isoproturon incombination with otherherbicides (such as many yearsinChina.Nonetheless,peoplehadbetter apply ALS resistant weeds though it has been commercialized for may performausefulroleinmanaging ACCase and/or isoproturon on bothpopulationsofA.aequalis.Therefore, R populationof two herbicides were nolongerapplicable for controlling the weed species (Yu and andPowles,2014a).Italso indicated us thatthese herbicides specific on also but acid) amino and site (mutation mutation specific the on only not dependent aequalis. This demonstrates that cross-resistance pattern is (flucarbazone-sodium) and TP (pyroxsulam) herbicides in found thismutation conferring moderate resistance toSCT A. aequaliswith our results, on tralkoxydim can stillbeusedtocontroltheRpopulation of Based field. wheat in weeds grass control CHDs. Tralkoxydim is a CHD herbicide and can selectively low level resistance APPs, to pinoxaden,butnoresistance to time in is relatively low compared with other Pro Pro at identified substitution in A.aequalis. Among 12amino acid substitutions single useof ALS herbicide. an idealchoicetomanage ACCase-resistant A.aequalisby Therefore, becauseoftheriskmultipleresistance,itisnot with thehomozygous ACCase mutation,inthenearfuture. using the purified population homozygous for Pro TP andPTBherbicides (Beckie and Tardif, 2012).However, confers highlevel resistance to SUbutlowlevel resistance to before itscommercialization(Petitetal.,2010). researches that the weedsevolved pinoxaden resistance had neverbeenapplied. This wasinaccordance with former study wasslightresistant to pinoxaden(Table 3) thoughit introduced intoChinain2010. The Rpopulationinthis et al., 2015). Pinoxaden was the latest ACCase herbicide CHDs resistance have been reported in A.aequalis(Guo not recommended, let alone the ACCase mutations endowing rotation with herbicides having thesamemodeofaction is from thesustainable management point of view, anherbicide Pro CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL In thisstudy, isoproturonstillhadanideal control effect The Ile This study reports for the first time the Pro the time first the for reports study This 197 Avena fatua(Cruz-Hipolitoetal., Arg hasbeen reported in onlyfourweedspecies and A. aequalis, wasinvolved in high level resistance to 2041 2041 Asn mutation is awell-knownmutation 197 A. aequalis Asn mutant ACCase, reported for the first the for reported ACCase, mutant Asn Ile of ALS gene, the frequency of Pro 2041 et al., Asn mutation (TableAsn 3).However, in wheatfield. 2003), L. rigidum(Zhangand 2011). Inthepresent 197 substitutions. - 197 JUNE 2016 Arg, we 197 197 Arg Arg A. with PBO decreased the GR the decreased PBO with L. (Wang et al., 2013). In the current study, pretreatment (Fisher et al., 2000), fenoxaprop-P-ethyl Poa in annua in Sinapis arvensis L. (Veldhuis rigidum (Prestonetal.,1996),ethametsulfuron-methyl in weed species,including: chlorotuluron andsimazine in L. P450 inhibitor, could synergize some herbicides in several to investigatetheNTSRin the complexity of NTSR, furtherresearchesneedtobedone (Ahmad-Hamdani etal., exists inpopulationscontaining target-site basedresistance toACCase herbicides (Délye et al., 2011). mechanism Additionally, NTSR often resistance major the as identified population. Non-target-site resistance is nowincreasingly also playaroleinfenoxaprop-P-ethyl resistance of theR mediated by cytochrome P450 monooxygenase may S population,suggestingthatanenhancedmetabolism the in 6% only while population R purified the in 22% by Pro herbicides ofA.aequalis. monooxygenase maybothplay a role in resistance to CONCLUSIONS Collavo, A., H.Strek,R.Beffa, andM.Sattin.2013.Management of Bi, Y.L., W.T. Liu, W.L. Guo, L.X.Li,G.H. Yuan, L.Du,etal. Beckie, H.J., andF.J. Tardif. 2012.Herbicide cross resistance in Beckie, H.J. 2006.Herbicide-resistant weeds: management tactics S.F. Cawthray, G.R. Han, H. Yu, Q. M.S., Ahmad-Hamdani, REFERENCES Agroscientific ResearchinthePublicInterest(201303031). Foundation of China (31471787) and the Special Fund for This researchwasfundedbytheNational Natural Science ACKNOWLEDGEMENTS In conclusion, the R population of mutations (Ile cross resistancelevelstootherherbicides. Target-site and mesosulfuron-methyl,showeddifferent evolved high-levelresistancetofenoxaprop-P 69:200-208. over a 7 year field-scale investigation. Pest Management Science on theuseof ALS inhibitors: weed population evolution observed an ACCase-inhibitor-resistant pestbp.2015.07.002. Pesticide Biochemistry andPhysiology126:22-27.doi:10.1016/j. ALS-inhibiting herbicidesinAlopecurusjaponicusfromChina. 2016. Molecular basis ofmultiple resistance to ACCase- and weeds. CropProtection35:15-28. practices. Weedand Technology20:793-814. Weed Science61:55-62. enhanced rates ofherbicide metabolism in wildoat(Avena spp.). Wang, andS.B.Powles.2012.Herbicide resistanceendowedby Previous studies have proved that PBO, as a cytochrome a as PBO, that proved have studies Previous Echinochloa phyllopogon 197 Arg inacetolactatesynthase)andcytochromeP450 2041 Asn inacetyl-CoA carboxylaseand 2012; Kaundunetal.,2013).Given A. aequalis 50 et al., Lolium rigidumpopulationbased (Stapf)StapfexKossenko valueoffenoxaprop-P-ethyl 2000), bispytibac-sodium Alopecurus aequalis . -ethyl

168 Konishi, T., K.Shinohara, K. Yamada, and Y. Sasaki. 1996. Konishi, T., and Y. Sasaki.1994.Compartmentalization of Kaundun, S.S.,G.C.Bailly, R.P. Dale, S.J. Hutchings, and E. Kaundun, S.S.2014.Resistance to acetyl-CoA carboxylase- Incledon, B.J., and C.J. Hall. 1997. Acetyl-coenzyme A carboxylase: Hofer, U.,M.Muehlebach, S. Hole,and A. Zoschke.2006. of response The 2009. Rubin. B. and Sibony, M. O., Hochberg, Herbert, D., K.A. Walker, L.J.Price, D.J. Cole, K.E. Pallett, S.M. Heap, I.M.2015.Internationalsurveyofherbicideresistantweeds. Powles. S.B. and Cawthray, G.R. Owen, M.J. Yu, Q. H., Han, Guo, W., W. Liu,L.Li,G. Yuan, L.Du,andJ. Wang. 2015. Fisher,C.M. K.O. Bayer,Carriere, and Yim.D.E. M.D. Ateh, A.J., Duggleby,McCourt, andL.W.J.A. R.G., Guddat.2008.Structure Powles. S.B. and Michel, S. Chalopin, C. Zhang, X.Q. C., Délye, Délye, C.,S.Michel, A. Bérard,B.Chauvel,D.Brunel,J.P. Délye, C., J.A.C. Gardin, K. Boucansaud, B. Chauvel, and C. N. Dominguez-Valenzuela, J.A. Osuna, M.D. H., Cruz-Hipolito, CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 76(2)APRIL this enzyme.Plant andCellPhysiology37:117-122. Gramineae have boththeprokaryoticandeukaryotic forms of Acetyl-CoA carboxylase in higher plants: most plants other than America 91:3598-3601. the National Academy ofSciences oftheUnitedStates origin oftheirtolerancetoward herbicides.Proceedingsof two formsofacetyl-CoA carboxylaseinplants andthe population. PLoSONE8:e58012. multiflorum Lolium herbicides to varyingdegreesinaUK site resistanceimpact on Acetyl-CoA carboxylaseinhibiting Mclndoe. 2013. A novel W1999S mutation and non-target inhibiting herbicides.PestManagementScience70:1405-1417. Pesticide BiochemistryandPhysiology57:255-271. quaternary structure and inhibition by graminicidal herbicides. crops. JournalofPlantDiseasesandProtection113:989-995. Pinoxaden–for broad spectrum grass weed management in cereal different target sitemutations. Weed Research49:37-46. ACCase-resistant site. PesticideScience50:67-71. Ridley, etal.1997. Acetyl-CoA carboxylase: a graminicide target Available at http://www.weedscience.org (accessed October 2015). Pest ManagementScience72:255-263.doi:10.1002/ps.3995. herbicide resistance mechanismsinLoliumrigidumpopulations. 2016. Widespread occurrence of both metabolic and target-site (Alopecurus aequalis Molecular basis forresistance to fenoxapropinshortawnfoxtail Physiology 28:156-165. Echinochloa phyllopogon of resistancetobispyribac-sodiuminan 2000. Mechanisms Plant PhysiologyandBiochemistry46:309-324. and mechanism ofinhibition of plantacetohydroxyacid synthase. 132:1716-1723. but nottocyclohexanedione inhibitors. PlantPhysiology major determinant of sensitivitytoaryloxyphenoxypropionate domain of multidomain acetyl-coenzyme A carboxylase is a 2003. An isoleucine residue withinthecarboxyl-transferase New Phytologist186:1005-1017. range of the arable weed acetyl-coenzyme A carboxylase-inhibiting herbicides across the Guillemin, et al. 2010. Geographical variation in resistance to myosuroides asanillustration. Weed Research51:433-437. centre ofattention for herbicideresistanceresearch:Alopecurus Petit. 2011. Non-target-site-based resistance should bethe America. Journalof Agricultural andFoodChemistry59:7261-7267. ACCase-inhibiting herbicidesinwildoat(Avena fatua)fromLatin Espinoza, andR.dePrado.2011. Mechanismofresistanceto Phalaris paradoxapopulationsinvolvestwo ) fromChina. Weed Science63:416-424. Alopecurus myosuroides (black-grass). accession. Pesticide Biochemistry and - JUNE 2016 Zhu, W.D., andS.X. Tu. 1997.Studyondamage from Alopecurus Zhang, H., Z. Yang, Y. Shen,and L. Tong. 2003Crystal structure substitutions acid amino Six 2006. Powles. S.B. and X.Q., Zhang, Zhang, Z.P. 2003.Development of chemical weed control herbicide Metabolism-based 2014b. Powles. S.B. and Q., Yu, inhibitor AHAS to Resistance 2014a. Powles. S.B. and Q., Yu, Wang, H.,J.Li,B.Lv, Y. Lou,andL.Dong.2013. The roleof Veldhuis,J.T.Hall, L.M. L.J., O’Donovan, W. Hall. Dyer,J.C. and Tranel, P.J., T.R. Wright, andI.M.Heap.2015.Mutationsin Seefeldt, S.S., J.E.Jensen,andE.P. Fuerst.1995.Log-logistic Sasaki, Y., and Y. Nagano.2004.Plantacetyl-CoA carboxylase: Preston, C.,F.J. Tardif, J.T. Christopher, andS.B.Powles.1996. S.B., andQ. Powles, Yu. 2010.Evolutioninaction: plants resistant Petit, C., G. Bay, F. Pernin, and C. Délye. 2010. Prevalence of cross- Non-target-site- 2012. Powles. S.B. and Goggin, D. M.J., Owen, copper of impact The 1980. Oka. H.I. and H., Morishma, 3:268-271 [InChinese] Hubei province. Journal ofHuazhong Agricultural University of fields wheat in threshold economical its and Sobol. aequalis carboxylase. Science299:2064-2067. of thecarboxyltransferase domain ofacetyl-coenzyme A Lolium rigidumpopulation.NewPhytologist172:636-645. carboxylase gene are linked with resistance to herbicides in a in thecarboxyl-transferasedomainofplastidic acetyl-CoA Management 3:197-203. and integrated weed management in China. Weed Biology 166:1106-1118. sustainability and global crop production. Plant Physiology resistance andcross-resistanceincropweeds:athreattoherbicide 70:1340-1350. herbicides: current understanding.PestManagement Science Biochemistry andPhysiology107:334-342. short awnedfoxtail (Alopecurus aequalis Sobol.)Pesticide to fenoxaprop-P-ethyl in annual bluegrass (Poa annua L.) and cytochrome P450 monooxygenase in thedifferent responses Agricultural andFoodChemistry48:2986-2990. arvensis L.)biotype to ethametsulfuron-methyl. Journal of 2000. Metabolism-based resistance ofa wild mustard (Sinapis www.weedscience.com (accessedOctober2015). herbicide-resistant weeds to ALS inhibitors. Available at http:// Technology 9:218-227. analysis ofherbicidedose-responserelationships. Weed 68:1175-1184. plant breeding.Bioscience Biotechnology andBiochemistry structure, biosynthesis, regulation, and gene manipulation for Physiology 54:123-134. herbicide degradingenzymes.PesticideBiochemistryand biotype ofLoliumrigidumduetoenhancedactivity of several Multiple resistance to dissimilar herbicide chemistries in a to herbicides. Annual ReviewofPlantBiology61:317-347. Science 66:168-177. (Alopecurus myosuroides Huds.)inFrance. Pest Management inhibitors fenoxaprop, clodinafop and pinoxaden in black-grass or multiple resistancetotheacetyl-coenzyme A carboxylase fields. Pest ManagementScience68:1077-1082. cropping Australian Western from populations rigidus based resistance to ALS-inhibiting herbicides in six Bromus Agro-Ecosystem 6:33-49. populations andwinterweedcommunitiesinricefields. pollution onwaterfoxtail(AlopecurusaequalisSobol.) .

169