Two FGFRL-Wnt Circuits Organize the Planarian Anteroposterior Axis 2 3 M

1 Two FGFRL-Wnt circuits organize the planarian anteroposterior axis 2 3 M. Lucila Scimone*, Lauren E. Cote*, Travis Rogers, and Peter W. Reddien† 4 5 Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA. Department

6 of Biology, Massachusetts Institute of Technology (MIT), Cambridge, MA 02139, USA.

7 Howard Hughes Medical Institute, MIT, Cambridge, MA 02139, USA.

8 *These authors contributed equally to this work. †Corresponding author. E-mail: 9 [email protected] 10 11

12 Competing Interests

13 The authors declare no competing interests.

14 Abstract

15 How positional information instructs adult tissue maintenance is poorly understood.

16 Planarians undergo whole-body regeneration and tissue turnover, providing a model for

17 adult positional information studies. Genes encoding secreted and transmembrane

18 components of multiple developmental pathways are predominantly expressed in

19 planarian muscle cells. Several of these genes regulate regional identity, consistent with

20 muscle harboring positional information. Here, single-cell RNA-sequencing of 115

21 muscle cells from distinct anterior-posterior regions identified 44 regionally expressed

22 genes, including multiple Wnt and ndk/FGF receptor-like (ndl/FGFRL) genes. Two

23 distinct FGFRL-Wnt circuits, involving juxtaposed anterior FGFRL and posterior Wnt

24 expression domains, controlled planarian head and trunk patterning. ndl-3 and wntP-2

25 inhibition expanded the trunk, forming ectopic mouths and secondary pharynges, which

26 independently extended and ingested food. fz5/8-4 inhibition, like that of ndk and wntA,

27 caused posterior brain expansion and ectopic eye formation. Our results suggest that

28 FGFRL-Wnt circuits operate within a body-wide coordinate system to control adult axial

29 positioning.

31 Introduction

32 Adult animals replace cells during tissue turnover and, in many cases, regeneration. How

33 animals specify and maintain regional tissue identity during these processes is poorly

34 understood. Planarians can regenerate any missing body part and replace aged tissues

35 during homeostasis, presenting a powerful system for identifying adult positional

36 information mechanisms (Reddien and Sánchez Alvarado 2004; Reddien 2011).

37 Planarian regeneration requires an abundant population of dividing cells called

38 neoblasts that includes pluripotent stem cells (Wagner et al. 2011; Rink 2013; Reddien

39 2013). Accordingly, many genes required for regeneration are required for neoblast

40 biology. However, some phenotypes associated with gene inhibition do not impact the

41 capacity of animals to regenerate, but instead affect the outcome of regeneration,

42 suggestive of a role for such genes in positional information. For example, inhibition of

43 components of the Wnt signaling pathway causes regeneration of heads in place of tails,

44 generating two-headed animals with heads facing opposing directions (Petersen and

45 Reddien 2008; Gurley et al. 2008; Iglesias et al. 2008). Neoblasts are also constantly

46 utilized for the replacement of differentiated cells during natural tissue turnover. Several

47 striking planarian phenotypes associated with altered regional tissue identity during tissue

48 turnover have also been identified, including hypercephalized (Wnt-signaling inhibition)

49 (Petersen and Reddien 2008; Gurley et al. 2008; Iglesias et al. 2008) and ventralized

50 (BMP-signaling inhibition) (Reddien et al. 2007; Molina et al. 2007; Orii and Watanabe

51 2007) planarians. Reminiscent of the roles of Wnt and Bmp in planarian regeneration and

52 tissue turnover, Wnt regulates anterior-posterior (AP) axis development (Petersen and

53 Reddien 2009b; Niehrs 2010) and Bmp regulates dorsal-ventral (DV) axis development

54 (De Robertis and Sasai 1996) in many animal phyla.

55 Many receptors, ligands, and secreted inhibitors belonging to key pathways that

56 regulate development in many organisms, such as BMP and Wnt pathways are

57 constitutively expressed in a regionalized manner across adult planarian body axes

58 (Reddien 2011). Interestingly, these genes are predominantly expressed together in the

59 same planarian tissue, the body-wall muscle (Witchley et al. 2013). Expression patterns

60 of these genes can change dynamically following injury (Petersen and Reddien 2008;

61 Petersen and Reddien 2009a; Gurley et al. 2010; Witchley et al. 2013), and some of these

62 changes can occur in existing muscle cells in the absence of neoblasts (Witchley et al.

63 2013). Body-wall muscle is distributed peripherally around the entire planarian body, and

64 the known expression domains of candidate patterning molecules in muscle broadly span

65 the AP, DV, and medial-lateral (ML) body axes, raising the possibility that muscle

66 provides a body-wide coordinate system of positional information that controls regional

67 tissue identity in tissue turnover and regeneration (Witchley et al. 2013). However, the

68 roles for many of these genes with regionally restricted expression in muscle are poorly

69 understood, and it is likely that many genes with regionally restricted expression in

70 muscle and roles in positional information await identification.

71 Identification of muscle as a major site of expression of genes controlling

72 regeneration and tissue turnover in adult planarians presented the opportunity for

73 systematic characterization of positional information in an adult metazoan. To this end,

74 we performed systematic single-cell RNA sequencing on muscle cells isolated from 10

75 discrete regions along the planarian anteroposterior (AP) axis and found 44 genes for

76 which expression within planarian muscle was restricted to specific AP domains. An

77 RNA interference (RNAi) screen of many of these genes revealed two similar circuits

78 each containing FGFRL-Wnt components that are required for the normal patterning of

79 two distinct regions of the planarian body: the head and trunk.

81 Results

82 Single muscle cell sequencing reveals 44 genes expressed in restricted domains along

83 the AP axis

84 The prior identification of a single, body-wide cell type (body-wall muscle) expressing

85 genes implicated in patterning in restricted domains (Witchley et al. 2013) raised the

86 possibility that RNA sequencing of muscle cells could systematically identify

87 components of this candidate adult positional information system. We sought such genes

88 with regional expression in muscle utilizing single-cell RNA sequencing of muscle cells

89 isolated from different regions along the AP axis. Non-dividing single cells from 10

90 consecutive regions along the AP axis (Figure 1A) were isolated by fluorescence

91 activated cell sorting (FACS), and the resulting single-cell cDNA libraries were screened

92 by qRT-PCR for expression of planarian muscle markers before sequencing (Methods,

93 Figure 1–figure supplement 1A-C, Supplementary file 1A). Cells expressed an average of

94 3,253 transcripts, within the range reported for planarian single-cell libraries (Wurtzel et

95 al. 2015). Principal component analysis (PCA) on the 177 single cells sequenced was

96 performed using highly variable transcripts. Two significant principal components that

97 separated cells by expression of muscle markers (PC1<0) and expression of neoblast

98 markers (PC2<0) were identified (details in Methods, Figure 1–figure supplement 1D-F,

99 Supplementary file 1B). PCA and troponin expression confirmed the identity of 115

100 muscle cells, and these 115 cells were used in all subsequent analyses (Figure 1–figure

101 supplement 1D, Supplementary file 1A).

102 Single-cell differential expression (SCDE, (Kharchenko et al. 2014)) analysis of

103 the data was used to identify regionally expressed genes in the muscle single cell

104 sequencing data, because of its ability to identify transcripts of genes with known anterior

105 and posterior expression patterns (details in Methods, Figure 1–figure supplement 1G).

106 SCDE analyses of three different anterior-versus-posterior region comparisons (Methods,

107 Figure 1A, Figure 1–figure supplement 1H, Supplementary file 1C-E) identified

108 transcripts of 99 genes as differentially expressed at p<0.005. To further validate the

109 regional expression of these candidate genes, RNA probes were generated for all

110 statistically significant transcripts (88/99 successfully amplified) and whole-mount in situ

111 hybridization (ISH) was performed (Figure 1B). 18 genes with regional expression in

112 muscle have been previously identified (Figure 1–figure supplement 2, (Witchley et al.

113 2013; Vogg et al. 2014; Reuter et al. 2015)). Although these three SCDE analyses

114 correctly identified 13 of these 18 genes, those expressed in rare muscle cells (wnt1,

115 foxD, zic-1), in shallow gradients (sFRP-2), or broadly (wntA), were below statistical

116 significance (Methods, Figure 1–figure supplement 1H, figure supplement 2B).

117 Therefore, an additional 168 genes, for which transcripts showed non-significant

118 differential expression in the SCDE analysis, were tested by ISH. ISH reveals expression

119 in all tissue types, which might obscure detection of regional expression within muscle

120 cells for some genes by this method. Nonetheless, ISH analysis verified 44 of these genes

121 as regionally expressed (35/44 with p<0.005 in any of anterior-versus-posterior SCDE

122 analyses) from the total 256 genes tested, including 26 previously not reported to be

123 regionally expressed in muscle (Figure 1B, Figure 1–figure supplement 2, Supplementary

124 file 1F). All newly identified regionally expressed genes tested were expressed at least in

125 part in cells expressing the planarian muscle marker collagen (Figure 1C).

126 The term position control gene (PCG) has been used for genes with both regional

127 adult expression, and patterning abnormal RNAi phenotypes or prediction by sequence to

128 be in a pathway regulating planarian patterning (Witchley et al. 2013). The function for

129 many such PCGs awaits elucidation. Many of the genes identified here have as yet no

130 known function and cannot be linked to known signaling pathways by sequence; we will

131 therefore use in this manuscript the broadly inclusive term muscle regionally expressed

132 gene (mRG). Hierarchical clustering of the average expression per region of the 44 mRGs

133 identified recapitulates the AP order of the regions (Figure 1D). Interestingly, the 44

134 identified mRGs identified here were comprised mainly of genes encoding Wnt-signaling

135 components, Hox-family transcription factors, and FGF receptor-like (FGFRL) proteins

136 (Figure 1), suggesting that these gene families have prominent roles in providing

137 positional information for maintaining and regenerating the planarian primary body axis.

138

139 Regionally expressed genes in muscle, including FGFRL and Wnt-pathway genes,

140 constitute an axial expression map in adult muscle

141 Combinatorial expression analysis using fluorescence ISH (FISH) of previously known

142 mRGs and those newly described here generated a map depicting multiple, overlapping

143 expression domains in planarian muscle along the planarian AP axis (Figure 2A, Figure

144 2–figure supplement 1A). Few genes, like sFRP-2 and ptk7 (Gurley et al. 2010; Reuter et

145 al. 2015), were expressed broadly in the trunk. The posterior involves multiple

146 overlapping expression domains of genes encoding Wnt, Hox and novel proteins

147 (Petersen and Reddien 2008; Adell et al. 2009; Iglesias et al. 2008; Reuter et al. 2015;

148 Currie et al. 2016). The anterior region involves overlapping expression domains of

149 several components of the Wnt pathway and genes of the FGFRL family (Petersen and

150 Reddien 2008; Rink et al. 2009), some of which extended from the anterior head tip to

151 varying posterior extents of the head and some were expressed in the pre-pharyngeal

152 region (Figure 2–figure supplement 2).

153 FGFRL-family proteins, which lack the intracellular kinase domain present in

154 FGFRs, have been little studied but are broadly conserved (Figure 2–figure supplement 2,

155 (Cebrià et al. 2002; Bertrand et al. 2009)). The molecular mechanism of action of FGFRL

156 proteins is not well understood. Planarians have six FGFRL-encoding genes, named nou

157 darake (ndk), the defining member of the FGFRL family (Cebrià et al. 2002), and nou

158 darake-like (ndl)-1 through ndl-5 (Figure 2–figure supplement 2). All of these FGFRL

159 genes were identified in the SCDE analyses as AP mRGs (Figure 1D). At least three of

160 the five FGFRL genes with expression at the anterior-most region of the animal (ndk,

161 ndl-1, ndl-2, ndl-4, ndl-5) were co-expressed in all 11 muscle cells isolated and

162 sequenced from the anterior head tip (region 1); 10/11 of these cells also co-expressed

163 ndk and frizzled5/8-4 (fz5/8-4) (Figure 2B). In the single muscle cells sequenced from the

164 pre-pharyngeal region (region 4), 3/6 cells expressing ndl-3 also expressed wntP-2. FISH

165 also demonstrated co-expression of FGFRL and Wnt-pathway genes together in the same

166 cells in regions where their expression domains overlapped (Figure 2C). Similarly,

167 extensive co-expression of multiple mRGs in single muscle cells was observed in

168 different regions along the entire AP axis (Figure 2-figure supplement 1B).

169 Wnt signaling is also required for maintenance of the AP axis, with β-catenin-1

170 RNAi animals developing ectopic heads around the entire body during tissue turnover

171 (Petersen and Reddien 2008; Gurley et al. 2008; Iglesias et al. 2008). At early timepoints

172 following RNAi (7-9 days after first RNAi feeding), β-catenin-1 RNAi animals showed

173 subtle posterior expansions of ndl-5 and ndl-2 expression domains (Figure 2- figure

174 supplement 3). Later, ectopic expression of ndl-5 in posterior and lateral locations

175 occurred and preceded ectopic expression of ndl-2 (9 days after first RNAi feeding) even

176 before the appearance of ectopic eyes. Fully formed ectopic heads (21 days after first

177 RNAi feeding) showed clear ectopic expression of the pre-pharyngeal mRG ndl-3 (Figure

178 2- figure supplement 3). Gross anatomical changes in the AP axis are therefore

179 accompanied by corresponding changes in FGFRL expression domains.

180 The axial expression map of genes in planarian adult muscle is reminiscent of

181 regionalized gene expression patterns found during embryonic development in other

182 species (Pankratz and Jäckle 1993; De Robertis et al. 2000; Jaeger et al. 2012) and

183 provides a tool to dissect adult positional identity maintenance and regeneration.

184

185 Functional analysis of AP mRGs from major gene families

186 The regional expression of mRGs raises the possibility that many of these genes will have

187 a role in controlling regional tissue identity. Therefore, we sought to determine with

188 functional assays the roles of particular mRGs in the maintenance and/or regeneration of

189 regional tissue identity. The prominence of a few gene families in the dataset of mRGs

190 suggests that FGFRL/Wnt/Hox genes are major patterning determinants of the planarian

191 AP axis. We, therefore, performed extensive single and multi-gene RNAi to identify the

192 roles of these genes in adult positional identity (Supplementary file 1G). Inhibition of

193 single or combinations of Hox genes and a subset of FGFRL genes (ndl-1, ndl-2, ndl-4,

194 and ndl-5) did not result in animals with a robust abnormal phenotype (Supplementary

195 File 1). Additionally, expression of other members of the FGFRL family was not affected

196 under these RNAi conditions at the time-point analyzed (Figure 2-figure supplement 4).

197 However, we found striking AP patterning phenotypes when inhibiting a subset of Wnt

198 pathway components and FGFRL genes as described below.

199

200 ndl-3 and wntP-2 restrict the number of mouths and pharynges in the planarian

201 trunk

202 The ndl-3 gene is expressed from below the eyes to the esophagus at the anterior end of

203 the pharynx (Rink et al. 2009) (Figure 1B), which is located centrally in the animal trunk

204 (Figure 3A). ndl-3 RNAi resulted in a striking phenotype: the formation of two or more

205 mouths and two pharynges (Figure 3A-C, Figure 3–figure supplement 1A-D). The

206 ectopic mouths and pharynges of ndl-3 RNAi animals appeared within the trunk,

207 posterior to the original mouth/pharynx location. This phenotype emerged both during

208 tissue turnover in uninjured animals (Figure 3–figure supplement 1C) and following

209 regeneration (Figure 3A, Figure 3–figure supplement 1A). In the case of regeneration,

210 animals initially regenerated a single mouth/pharynx, but as regenerating animals grew

211 following feeding, ectopic mouths and pharynges emerged. Inhibition of the posterior

212 mRG wntP-2/wnt11-5 also caused ectopic mouth and pharynx formation (Figure 3A-C,

213 Figure 3–figure supplement 1A-D), in agreement with a recent report (Sureda-Gómez et

214 al. 2015). Double RNAi of ndl-3 and wntP-2 was synergistic (Figure 3A, Fisher’s exact

215 test p<0.0001 for ndl-3, p=0.0153 for wntP-2, Figure 3–figure supplement 1C). Inhibition

216 of ndl-3 and wntP-2 also resulted in pharyngeal cavity expansion (Figure 3B,C, Figure 3–

217 figure supplement 1B), and in increased numbers of para-pharyngeal cells (Figure 3B),

218 which express the matrix metalloproteinase mmp1 (Newmark et al. 2003). In summary,

219 when either ndl-3 or wntP-2 was inhibited, ectopic trunk structures were added

220 sequentially as the animal grew and replaced tissues.

221 The planarian pharynx is a long muscular organ that can extend through the

222 mouth to ingest food (Reddien and Sánchez Alvarado 2004) and connects to the intestine

223 through the esophagus at the medial anterior end of the pharyngeal cavity. In ndl-3 and

224 wntP-2 RNAi animals, ectopic esophagi (NB.22.1e+) formed in variable locations,

225 including from the side of the pharyngeal cavity wall and from a gut branch crossing the

226 pharyngeal cavity (Figure 3C). Despite variable positioning, ectopic pharynges always

227 integrated through an esophagus into the intestine, demonstrating remarkable plasticity in

228 the mechanisms underlying tissue organization. Ectopic pharynges in ndl-3; wntP-2

229 RNAi or wntP-2 RNAi animals were also functional – animals simultaneously projected

230 both pharynges and each pharynx displayed independent food searching behavior, such as

231 on opposite sides of the animal or in different directions (Figure 3D, Movie 1).

232

233 Inhibition of ndl-3 and wntP-2 affects the expression domains of trunk mRGs

234 Next, we examined whether trunk expansion in ndl-3 and wntP-2 RNAi animals with

235 ectopic pharynges and mouths affected the mRG axial expression map described above.

236 Anterior-most mRG expression domains (sFRP-1 and ndl-5) were present and showed no

237 overt changes following ndl-3 and wntP-2 RNAi (Figure 4A-C, Figure 4–figure

238 supplement 1A). By contrast, the ndl-3 expression domain was expanded to the ectopic

239 posterior esophagus in wntP-2 RNAi animals (Figure 4A,D). In both wntP-2 and ndl-3;

240 wntP-2 RNAi animals, the expression domain of sFRP-2 (Figure 4–figure supplement

241 1D) was also extended towards the animal posterior. By contrast, expression of the pre-

242 pharyngeal mRGs wnt2 and ndl-2 was changed only slightly or not at all (Figure 4-figure

243 supplement 1B,C). Conversely, the broad posterior expression domain of wntP-2 was

244 significantly reduced in ndl-3 RNAi animals (Figure 4B,E). Expression of other posterior

245 mRGs such as fz4-1 and dd_13065 was still present in ndl-3, wntP-2, and ndl3; wntP-2

246 RNAi animals (Figure 4-figure supplement 1E,F). Thus, both ndl-3 and wntP-2 are

247 required for maintaining normal trunk tissue pattern including associated mRG

248 expression domains, but not head or tail patterns of mRG expression. Altogether, these

249 data suggest that the trunk patterning defects of ndl-3 and wntP-2 RNAi animals only

250 affect local mRG expression within the axial map.

251

252 ndk, fz5/8-4, and wntA control head patterning in planarians

253 In addition to trunk patterning phenotypes, we found that fz5/8-4 RNAi caused ectopic

254 eye formation and expansion of the brain posteriorly in both uninjured and regenerating

255 animals (Figure 5A,B, Figure 5–figure supplement 1A,C). fz5/8-4 showed graded anterior

256 expression, strongest at the head tip, and brain expression (Figure 1B). The fz5/8-4 RNAi

257 phenotype was similar to that previously described for ndk and wntA RNAi (Figure 5–

258 figure supplement 1B, (Cebrià et al. 2002; Kobayashi et al. 2007; Adell et al. 2009; Hill

259 and Petersen 2015)). ndk is expressed in head muscle and the brain (Figure 1B, (Cebrià et

260 al. 2002; Witchley et al. 2013)) and restricts brain tissues to the animal head (Cebrià et al.

261 2002). wntA is expressed broadly, with strong expression at the posterior base of the brain

262 (Figure 1–figure supplement 2B, (Kobayashi et al. 2007; Adell et al. 2009; Hill and

263 Petersen 2015)). wntA; ndk double RNAi animals showed a stronger phenotype in

264 homeostasis (Figure 5A,B) and regeneration (Kobayashi et al. 2007), than did single gene

265 RNAi animals. Double RNAi of fz5/8-4 and either ndk or wntA also showed a synergistic

266 effect during tissue turnover (Figure 5A,B, Figure 5–figure supplement 1B, Fisher’s exact

267 test p<0.0001 for both ndk and wntA). Additionally, RNAi of four out of five other ndl

268 (FGFRL)-family members further enhanced the fz5/8-4; ndk double RNAi phenotype

269 (Figure 5–figure supplement 1D, Supplementary file 1G), suggesting that multiple

270 FGFRL genes synergize to control head pattern with ndk.

271 The ndk RNAi phenotype is poorly understood. For instance, are mRG expression

272 domains expanded along with the brain in ndk RNAi animals, and what diversity of cell

273 types expands posteriorly? Following eight RNAi feedings, fz5/8-4; ndk, wntA; ndk, and

274 fz5/8-4; wntA double RNAi intact animals showed posterior expansion of multiple neuron

275 classes from different head regions suggesting that the entire head-restricted nervous

276 system expanded posteriorly (Figure 5B,C, Figure 5–figure supplement 1E,F). After eight

277 RNAi feedings, a time point at which brain expansion was visible, non-neural mag-1+

278 adhesive gland cells (Zayas et al. 2010) showed normal distribution (Figure 6–figure

279 supplement 1A). By 12 RNAi feedings, however, mag-1+ cells were disorganized (Figure

280 6A, Figure 6–figure supplement 1D), indicating that non-neural head cell types were

281 eventually affected, but not visibly posteriorized, by these RNAi conditions.

282 We next examined whether the axial mRG map changed in RNAi animals with

283 posterior ectopic eyes. Anterior-most (sFRP-1 and ndl-4) and posterior (wntP-2, wnt11-1,

284 and wnt11-2) mRG expression domains did not visibly change in fz5/8-4; ndk RNAi or

285 wntA; ndk double RNAi animals, even under strong RNAi conditions (12 RNAi feedings,

286 multiple ectopic eyes) (Figure 6B,C, Figure 6–figure supplement 1B-D). By contrast, ndl-

287 2 expression, which is normally restricted to a domain immediately posterior to the eyes,

288 was expanded into the pre-pharyngeal region after eight RNAi feedings (Figure 6B,E),

289 and showed a more severe posterior expansion after 12 RNAi feedings (Figure 6–figure

290 supplement 1B). Similarly, ndl-5, ndk, and wnt2 expression domains extended posteriorly

291 into the pre-pharyngeal region in RNAi animals with strong phenotypes (Figure 6A,D,

292 Figure 6-figure supplement 1C,E). By contrast, the anterior end of the pre-pharyngeal

293 ndl-3 expression domain was significantly posterior-shifted (Figure 6C,F). Our results

294 indicate that ndk, wntA, and fz5/8-4 are required to restrict anterior tissues and associated

295 expression domains of mRGs to the head region, while leaving the anterior tip, trunk, and

296 tail mRG domains unaffected.

297

298 Discussion

299 Single-cell sequencing has recently been used to identify transcriptomes for multiple

300 planarian cell types (Wurtzel et al. 2015). We utilized single-cell sequencing to map axial

301 gene expression within the planarian muscle. Planarian muscle was previously found to

302 express several genes with known roles in adult tissue patterning in planarians, raising the

303 possibility that muscle functions to produce a body-wide coordinate system of positional

304 information (Witchley et al. 2013). Traditional RNA sequencing approaches to

305 identifying candidate adult positional information in planarians is limited by the diversity

306 of gene expression in heterogeneous tissue. The identification of a particular cell type

307 expressing genes associated with regional tissue identity allowed application of regional

308 single-cell sequencing to surmount this challenge. We applied this approach to the AP

309 axis, and identified mRGs that constitute an expression map of muscle cells of the

310 planarian primary axis (Figure 7A). Coordinate systems of positional information, such

311 as those proposed to control embryonic development (De Robertis et al. 2000; Petersen

312 and Reddien 2009b; Niehrs 2010), might exist within adult tissues of many animals,

313 including humans (Rinn et al. 2006), however there is little functional data regarding

314 positional information and maintenance of the adult body plan. Here, we described

315 several mRGs that work together to pattern and maintain two distinct body regions, the

316 head and the trunk.

317 Constitutive regional expression of planarian orthologs to genes with key

318 developmental roles in metazoans has been hypothesized to be important for multiple

319 aspects of planarian body plan maintenance (Reddien 2011). Here we show that both the

320 planarian head and trunk require an FGFRL-Wnt circuit to maintain adult regional tissue

321 identity. Different FGFRL and Wnt genes are used in the two body locations; however, in

322 both cases, an FGFRL expression domain is juxtaposed by a posterior Wnt expression

323 domain. Strikingly, inhibition of either gene (FGFRL or Wnt) caused posterior expansion

324 and sequential duplications of structures normally found within the head and trunk

325 regions, resulting in expanded brain and ectopic eyes in one case, and ectopic pharynges

326 and mouths in the other (Figure 7B).

327 Following inhibition of any of the components of these FGFRL-Wnt circuits, the

328 axial expression map shows local shifts in expression domains coincident with the

329 expansion of specific regionally restricted tissues such as brain and pharynx (Figure 7B).

330 These results suggest that muscle, a tissue found uniformly throughout the animal, marks

331 different AP regions through combinatorial expression of mRGs. This implies that

332 communication exists between muscle cells and the underlying region-specific tissues.

333 Understanding the coordination between muscle cells and tissues within AP regions is

334 necessary for determining how planarians are able to robustly maintain and regenerate

335 their entire body plan. Positional information must be integrated into the decision to

336 generate and pattern new tissue during planarian growth and regeneration. mRGs might

337 therefore influence the regional behavior of neoblasts and/or their division progeny.

338 The two FGFRL-Wnt circuits described in this work are striking examples of

339 body plan plasticity during homeostatic tissue turnover. In both cases, inhibition by RNAi

340 of FGFRL genes (i.e., reduction or absence of the FGFRL expression domain) and

341 inhibition of Wnt pathway components (i.e., expansion of the FGFRL expression domain)

342 are coincident with the same phenotype of expanded regional identity. Future

343 characterization of the biochemical properties of FGFRLs and elucidation of the

344 mechanisms of interaction between Wnt/Fz pathways and FGFRLs might help in

345 understanding this property. We propose that FGFRL proteins confine the regions where

346 specific tissues in both the head and trunk can normally form and that the Wnt gene of

347 each circuit acts by restricting tissues at the anterior end of its expression domain (Figure

348 7B,C). Given the similarities of the distinct FGFRL-Wnt circuits for patterning two

349 different body regions, FGFRL-Wnt circuits might be broadly utilized, but presently

350 underappreciated, patterning modules of animal body plans.

351

352 Materials and methods

353 Animals

354 Asexual Schmidtea mediterranea strain (CIW4) animals starved 7-14 days prior

355 experiments were used.

356

357 Muscle single cell isolation and library construction

358 Animals were dissected into 10 adjacent regions along the AP axis, and only the midline

359 region (i.e., in between the ventral nerve cords) of each segment was utilized, to

360 minimize heterogeneity caused by gradients expressed along the medio-lateral axes. 10

361 regions were chosen to balance consistency of amputation and AP resolution. The

362 pharynx was dissected out and discarded for the regions 5 and 6. Fragments were

363 dissociated into single cells. Single cell suspensions for each region were stained labeled

364 with Hoechst, and non-dividing single cells were sorted by flow cytometry into 96 well

365 plates containing 5 ul of total cell lysis buffer (Qiagen) with 1% β-mercaptoethanol.

366 Subsequently, amplified cDNA libraries were made from each single cell using the

367 SmartSeq2 method (Picelli et al. 2013; Picelli et al. 2014; Wurtzel et al. 2015), and tested

368 by qRT-PCR for the expression of the muscle markers collagen and troponin (collagen

369 Fw: GGTGTACTTGGAGACGTTGGTTTA, collagen Rv:

370 GGTCTACCTTCTCTTCCTGGAAC; troponin Fw:

371 ACAGGGCCTTGCAACTATTTTCATC, troponin Rv:

372 GAAGCTCGACGTCGACAGGA). Cells expressing either or both of these muscle-

373 specific genes (~5 in 96 cells) were used to make libraries using the Nextera XT kit

374 (Illumina, Inc). Libraries were sequenced (Illumina Hi-seq) and fastq files generated by

375 Illumina 1.5 and examined by fastqc.

376

377 Identification of muscle cell expression profiles

378 Sequencing data is submitted to GEO database as GSE74360. Each cell was sequenced

379 twice, once with 80 bp reads and once with 40 bp reads, and reads from both sequencing

380 runs were concatenated. Reads were trimmed using cutadapt to remove Nextera

381 transposon sequences CTGTCTCTTATA and TATAAGAGACAG (overlap 11bp) and

382 low quality 3′ base pairs (quality score less than 30) before mapping to the dd_Smed_v4

383 assembly (http://planmine.mpi-cbg.de; (Liu et al. 2013)) using bowtie 1 (Langmead et al.

384 2009) with -best alignment parameter. Bowtie 1 was used because of its better sensitivity

385 mapping <50bp reads. Read counts from prominent mitochondrial and ribosomal RNAs

386 (dd_smedV4_0_0_1, dd_Smed_v4_7_0_1, and dd_Smed_v4_4_1_1) were discarded.

387 Reads from the same isotig were summed to generate raw read counts for each transcript

388 (Wurtzel et al. 2015). Libraries with fewer than 1,000 expressed (> 2 reads) transcripts

389 were discarded, leaving 177 cells, expressing an average of 3,253 unique transcripts with

390 an average of 430,114 reads mapped (Supplementary file 1A, Figure 1–figure supplement

391 1E). Counts per million reads (cpm) were log transformed after addition of a pseudocount

392 and used as expression values for violin plots and heatmap in Figure 2B. Principal

393 component (PC) analysis on a set of highly expressed transcripts (4 < mean expression <

394 8) with high variance (dispersion > 1.2) was extended to the entire set of transcripts to

395 identify two significant PCs (Seurat (Satija et al. 2015), Supplementary file 1B). The

396 transcripts defining PC1<0 are all found within the top 45 of the published set of muscle-

397 enriched transcripts (Wurtzel et al. 2015). Two clear populations were separated by PC

398 analysis, one of which included 115 cells that expressed troponin (>4 cpm) (Figure 1–

399 figure supplement 1D,F). These 115 muscle cells were used for all subsequent analysis

400 (Supplementary file 1A). Average expression per region (Seurat) for each transcript

401 (Figure 1D) or expression per cell (Figure 2–figure supplement 1B) was centered and

402 scaled to generate expression z-scores used for heatmap visualization. Dendrograms

403 show complete hierarchical clustering using Euclidean distance (Figure 1D, Figure 2–

404 figure supplement 1B).

405

406 Single cell differential analysis

407 Rv3.2.2 was used for all subsequent data analysis and visualization, relying on the

408 following packages: Seurat (Satija et al. 2015), SCDE (Kharchenko et al. 2014),

409 matrixStats, ROCR (Sing et al. 2005), ggplot2, RColorBrewer (http://colorbrewer2.org).

410 To determine the best differential expression analysis method to identify putative mRGs,

411 we tested three statistical methods: SCDE (Kharchenko et al. 2014), bimod (McDavid et

412 al. 2013), t-test (Students t-test) for their ability to identify known mRGs. For each of the

413 statistical tests, we compared cells from the head tip (region 1) versus those from the tail

414 tip (region 10) and determined the rank and statistical significance of 10 canonical mRGs

415 (Figure 1–figure supplement 1G). Based on its ability to identify mRGs present only in a

416 subset of cells within a region (e.g., wnt11-1, sFRP-1, notum), we chose SCDE for all

417 further differential expression analysis. Note that SCDE explicitly accounts for drop-out

418 rates due to single-cell sequencing by calculating a probability distribution for each

419 transcript in each cell before calculating differential expression between groups. To

420 identify putative mRGs, we performed three differential expression analyses: anterior

421 (regions 1, 2, 3; n=23 cells) versus posterior (regions 8, 9, 10; n=38 cells); head (region

422 1; 11 cells) versus post-pharyngeal (regions 7, 8, 9; n=35 cells); pre-pharyngeal (regions

423 2, 3, 4; n=22 cells) versus tail (region 10; n=12 cells) (Figure 1A). All transcripts with a

424 |Z| score greater than 2.58 (p<0.005) in any of the SCDE analyses were screened by ISH

425 (Supplementary file 1C-E). Z-scores corrected for multiple hypothesis testing are

426 reported in Supplementary file 1C-E, however we used uncorrected Z-scores due to their

427 ability to rank many more transcripts. In addition, 168 genes below our statistical cutoff

428 were successfully amplified from cDNA and screened by ISH (Supplementary file 1C-E).

429 To determine if our method correctly classified transcripts as mRGs, we used a

430 combined score from all three SCDE analyses (Figure 1–figure supplement 1H, (Wan

431 and Sun 2012)). If there is no differential expression of a gene along the AP axis, then the

432 minimum p-value from any of the analyses, p[1] = min(p1, …, pk) where pi is the p-value

433 from ith analysis, is expected to follow a beta distribution with parameters 1 and k

434 (Tippett 1931). A differential expression score was calculated based on beta distribution,

435 Smin= -log( P(beta(1,k) < p[1]) ), and used to rank all transcripts. Note that this scoring

436 system only ranks transcripts, and that statistical significance of differential expression is

437 only interpretable within the analysis performed. We then quantified how well our

438 analyses, as scored by Smin, classified transcripts as mRGs, as determined by ISH

439 validation. The receiver-operator curve plots the false positive rate versus the true

440 positive rate for each value of Smin based on ISH validation. The area under the curve

441 (0.88, perfect classification = 1, random classification = 0.5) indicates that Smin and

442 therefore our SCDE analyses are able to correctly classify transcripts as mRGs visible by

443 ISH.

444

445 Gene cloning and whole-mount in situ hybridizations

446 Primers used to PCR amplify all planarian transcripts are listed in Supplementary file 1C-

447 E. 44 mRGs were cloned from cDNA into the pGEM vector (Promega). RNA probes

448 were synthesized and nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate

449 (NBT/BCIP) colorimetric whole-mount in situ hybridizations (ISH) were performed as

450 described (Pearson et al. 2009). Fluorescence in situ hybridizations (FISH) were

451 performed as described (King and Newmark 2013) with minor modifications. Briefly,

452 animals were killed in 5% NAC and treated with proteinase K (2ug/ml). Following

453 overnight hybridizations, samples were washed twice in pre-hyb buffer, 1:1 pre-hyb-2X

454 SSC, 2X SSC, 0.2X SSC, PBST. Subsequently, blocking was performed in 5% casein

455 (10X solution, Sigma) and 5% inactivated horse serum PBST solution when anti-DIG or

456 anti-DNP antibodies were used, and in 10% casein PBST solution when an anti-FITC

457 antibody was used. Post-antibody binding washes and tyramide development were

458 performed as described (King and Newmark 2013). Peroxidase inactivation with 1%

459 sodium azide was done for 90 minutes at RT. Live animal images were taken with a Zeiss

460 Discovery Microscope. Fluorescent images were taken with a Zeiss LSM700 Confocal

461 Microscope. Co-localization analysis of FISH signals was performed using Fiji/ImageJ.

462 For each channel, histograms of fluorescence intensity were used to determine the cut-off

463 between signal and background. All FISH images shown are maximal intensity

464 projections. A median filter was applied using the ImageJ Despeckle function. Images are

465 representative of results seen in >5 animals per panel.

466

467 RNAi

468 dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-

469 generated templates with flanking T7 promoters, followed by ethanol precipitation, and

470 annealed after resuspension in water. dsRNA was then mixed with planarian food (liver)

471 (Rouhana et al. 2013) and 2 ul per animal of the liver containing dsRNA was used in

472 feedings. For the RNAi screen (Supplementary file 1G), the following feeding protocol

473 was used: animals were fed six times in three weeks, cut in four pieces (head, pre-

474 pharyngeal, trunk and tail pieces), allowed to regenerate for 10 days, fed all together six

475 times in another three weeks, and cut again into the four pieces described above. Seven

476 days following amputation (7 dpa), trunk pieces were scored (Supplementary file 1G,

477 Figure 3A right panels, Figure 3–figure supplement 1A, and Figure 5–figure supplement

478 1A), and fixed at day 20 following amputation for further analysis (Figure 3 and Figure

479 4). Five to 10 trunk pieces were kept after the first regeneration cycle, and were fed once

480 a week for another 12 weeks and were scored after that period (homeostasis,

481 Supplementary file 1G). Animals for homeostasis RNAi experiments for trunk patterning

482 studies (Figure 3–figure supplement 1C) were fed eight times in four weeks and scored a

483 week after the last feeding. In RNAi experiments for head patterning analysis, animals

484 were fed eight times in four weeks, scored after the first six feedings (Figure 5A, Figure

485 5–figure supplement 1B,D), and fixed seven days after the last feeding (without

486 amputation). For longer time point experiments, animals were fed twelve times in six

487 weeks and fixed seven days after the last feeding. For all RNAi conditions tested, the

488 total amount of dsRNA per feeding per animal was kept constant. Therefore, for example,

489 when RNAi of two or more genes was performed, dsRNA for each gene was diluted in

490 half. For combinations of dsRNAs, synergistic effects of double RNAi were calculated

491 using Fisher’s exact test (Figure 3A, 5A, Figure 3–figure supplement 1C). Minimum

492 sample sizes were estimated using difference of proportion power calculation with h=0.4

493 (ectopic mouths) or h=0.8 (ectopic eyes), sig.level=0.05, and power=0.8 (n=98.1 or

494 n=24.5). RNAi animals with ectopic pharynges/mouths were treated with 0.2%

495 chlorotone, which results in muscle relaxation and pharynx protrusion through the mouth

496 (Figure 3A, left panels). For RNAi enhancement experiments of ndl-3; wntP-2 RNAi

497 with β-catenin-1, animals were fed five times with a combination of ndl-3 and wntP-2,

498 and starting in the sixth feeding, β-catenin-1 or control dsRNA was added to the mix of

499 ndl-3 and wntP-2 for another three, four, or five feedings (being a total of eight, nine or

500 10 feedings, Figure 3-figure supplement 1E). For the β-catenin-1 RNAi experiment

501 shown in Figure 2-figure supplement 3, animals were fed once, twice, or four times with

502 β-catenin-1 or control dsRNA. Animals were fixed at different days after the first RNAi

503 feeding.

504

505 Quantitative reverse-transcriptase PCR

506 Samples were processed and analyzed as described (Owen et al. 2015). Briefly, total

507 RNA was isolated from fragments from individual intact worms or from individual

508 regenerated fragments, as indicated by cartoons in figures, in 0.75mL Trizol (Life

509 Technologies) following manufacturer's instructions. Samples were homogenized for 30s

510 using TissueLyser II (Qiagen). Following RNA purification and resuspension in dH20,

511 concentrations for each sample were measured by Qubit using RNA HS Assay Kit (Life

512 Technologies). 5 ng of RNA were treated with 1U amplification-grade DNAse I (Life

513 Technologies) for 15 min at room temperature before DNAse heat-inactivation for 10

514 min at 65°C in the presence of 2.5 mM EDTA. Multiplex reverse-transcription and 15

515 cycles of PCR amplification were performed on DNAse-treated RNA using pooled outer

516 primers at 50 nM each and Superscript III/Platinum Taq enzyme mix (Supplementary file

517 1H). Following outer primer digestion with ExoI (15U, New England Biolabs), samples

518 were diluted to 500pg/ul and checked for presence of g6pd by qRT-PCR (7500 Fast PCR

519 System, Applied Biosystems). Samples and inner primers were loaded onto a 96.96

520 Dynamic Array Fast IFC chip (Fluidigm BioMark) and analyzed as described

521 (Supplementary file 1H, (Owen et al. 2015)). Ct values from two technical replicates

522 were averaged and normalized by the average Ct value of three housekeeping genes

523 (g6pd, clathrin, and ubiquilin, (van Wolfswinkel et al. 2014)) to generate ΔCt values.

524 Log2 fold-changes were determined by the ΔΔCt method by calculating the difference

525 from the average ΔCt value of control RNAi replicates. Heatmap of average ΔΔCt values

526 was generated by pheatmap in R. Bar graphs show mean ΔΔCt +/- standard deviation

527 with individual ΔΔCt values. Statistical tests (unpaired student’s t-test or one-way

528 ANOVA followed by Dunnett’s multiple comparisons test) were performed between

529 individual ΔΔCt values.

530

531 Expression domain quantification

532 FISH of the mRG of interest was performed in control RNAi animals and RNAi animals

533 showing phenotypes (ectopic pharynx or ectopic eyes) in at least three independent

534 experiments, and images taken with same intensity settings within an experiment. The

535 extent of an mRG expression domain was measured in ImageJ as depicted in cartoons by

536 blind scoring maximal intensity projections. For ndl-2, the extent of the domain with

537 strong expression and not total expression was measured. The length of the mRG

538 expression domain was normalized by the length of the animal. Statistical analysis of

539 expression domain shifts were determined by one-way ANOVA followed by Dunnett’s

540 multiple comparisons test.

541

542 Immunostainings

543 Animals were fixed as for in situ hybridizations and then treated as described (Newmark

544 and Sánchez Alvarado 2000). A mouse anti-ARRESTIN antibody (kindly provided by

545 Kiyokazu Agata) was used in a 1:5000 dilution, and an anti-mouse-Alexa conjugated

546 antibody was used in a 1:500 dilution.

547

548 Cell quantification and statistical analysis

549 Numbers of cintillo+ and gd+ cells were counted and normalized by the length between

550 the anterior tip of the animal and the esophagus in control, fz5/8-4; ndk, and wntA; ndk

551 RNAi animals after eight RNAi feedings (Figure 5C, Figure 5–figure supplement 1E).

552 One-way ANOVA and Dunnet’s post-test were used to determine significant differences

553 between the different conditions and the control. Similarly, cells expressing the

554 metalloproteinase mmp1 were counted in control, wntP-2, ndl-3, and ndl-3; wntP-2 RNAi

555 trunk pieces after 12 RNAi feedings and two rounds of regeneration (20 dpa, screen

556 RNAi protocol, Figure 3B). One-way ANOVA and Dunnet post-test were used to

557 determine significant differences between the different conditions and the control.

558 Minimum sample-size estimations were calculated using balanced one-way analysis of

559 variance power calculation with k=4 (mmp1) or k=3 (cintillo and gd), f=0.8,

560 sig.level=0.05, and power=0.8 (n=5.3 or n=6.1).

561

562 Phylogenetic analysis: accession numbers

563 Genbank: Homo sapiens: NP_068742.2 (FGFRL1). Mus musculus: NP_473412.1

564 (FGFRL1). Xenopus tropicalis NP_001011189.1 (FGFRL1). Strongylocentrotus

565 purpuratus NP_001165523.1 (FGFRL1). Dj, Dugesia japonica: BAC20953.1 (Ndk),

566 BAP15931.1 (Ndl-2), BAQ21471.1 (Ndl-3), BAQ21471.1 (Ndl-1). Nematostella

567 vectensis XP_001635234.1 (FGFRL-1). Uniprot: Ciona intestinalis F7BEX9 (FGFRL1).

568 Genomic database: Capitella sp. I: CAPC1_170033 (FGFRL1). Lottia gigantean:

569 LOTGI_167118 (FGFRL1). Schistosoma mansoni: Smp_052290 (Ndk), Smp_036020

570 (Ndl-5) Planmine/Genbank: Schmidtea mediterranea: dd_11285/ADD84674.1(Ndk),

571 dd_12674/ADD84675.1 (Ndl-4), dd_5102/AFJ24803.1(Ndl-5), dd_6604/ADD84676.1

572 (Ndl-3), dd_8310 (Ndl-1), dd_8340 (Ndl-2).Dendrocoelum lacteum:

573 Dlac_193209/JAA92597.1 (Ndk), Dlac_194186/JAA92596.1 (Ndl-4), Dlac_184398

574 (Ndl-5), Dlac_178408 (Ndl-3-2), Dlac_182339 (Ndl-3-1), Dlac_189993 (Ndl-1),

575 Dlac_170672 (Ndl-2-1), Dlac_181923/JAA92595.1 (Ndl-2-2). Planaria torva:

576 Ptor_24279 (Ndk-1), Ptor_18635 (Ndk-2), Ptor_24521(Ndl-4-1), Ptor_34251 (Ndl-4-2),

577 Ptor_36400 (Ndl-5-1), Ptor_68870 (Ndl-5-2), Ptor_24828 (Ndl-3-1), Ptor_27132 (Ndl-3-

578 2), Ptor_29905 (Ndl-1), Ptor_23702 (Ndl-2). Polycelis tenuis: Pten_63627 (Ndk-1),

579 Pten_14428 (Ndk-2), Pten_6171 (Ndl-4), Pten_43037 (Ndl-5), Pten_46975 (Ndl-3),

580 Pten_39799 (Ndl-1-1), Pten_47685 (Ndl-1-2), Pten_41107 (Ndl-2). Polycelis nigra:

581 Pnig_15421 (Ndk-1), Pnig_6593 (Ndk-2), Pnig_29523 (Ndl-4-2), Pnig_3947 (Ndl-4-1),

582 Pnig_25001 (Ndl-5), Pnig_3933 (Ndl-3), Pnig_25308 (Ndl-1), Pnig_22111 (Ndl-2).

583

584 Acknowledgements

585 We thank Inma Barrasa for help with RNA-seq analysis and Dayan Li for designing

586 collagen and cadherin primers. We are grateful to the work of Aneesha Tewari and

587 Jennifer Cloutier in designing and verifying qPCR primers.

588

589 References

590 Adell, T., E. Saló, M. Boutros, and K. Bartscherer. 2009. Smed-Evi/Wntless is required

591 for beta-catenin-dependent and -independent processes during planarian

592 regeneration. Development 136 (6):905-10. doi: 10.1242/dev.033761

593 Bertrand, S., I. Somorjai, J. García-Fernández, T. Lamonerie, and H. Escriva. 2009.

594 FGFRL1 is a neglected putative actor of the FGF signalling pathway present in all

595 major metazoan phyla. BMC Evol Biol 9:226. doi: 10.1186/1471-2148-9-226

596 Cebrià, F., C. Kobayashi, Y. Umesono, M. Nakazawa, K. Mineta, K. Ikeo, T. Gojobori,

597 M. Itoh, M. Taira, A. Sánchez Alvarado, and K. Agata. 2002. FGFR-related gene

598 nou-darake restricts brain tissues to the head region of planarians. Nature 419

599 (6907):620-4. doi: 10.1038/nature01042

600 Currie, K. W., D. D. R. Brown, S. Zhu, C. Xu, V. Voisin, G. D. Bader, and B. J. Pearson.

601 2016. HOX gene complement and expression in the planarian Schmidtea

602 mediterranea. EvoDevo 7 (7). doi: 10.1186/s13227-016-0044-8

603 De Robertis, E. M., J. Larrain, M. Oelgeschlager, and O. Wessely. 2000. The

604 establishment of Spemann's organizer and patterning of the vertebrate embryo.

605 Nat Rev Genet 1 (3):171-81. doi: 10.1038/35042039

606 De Robertis, E.M. and Y. Sasai. 1996. A common plan for dorsoventral patterning in

607 Bilateria. Nature 380(6569):37–40. doi:10.1038/380037a0

608 Gurley, K. A., S. A. Elliott, O. Simakov, H. A. Schmidt, T. W. Holstein, and A. Sánchez

609 Alvarado. 2010. Expression of secreted Wnt pathway components reveals

610 unexpected complexity of the planarian amputation response. Dev Biol 347

611 (1):24-39. doi: 10.1016/j.ydbio.2010.08.007

612 Gurley, K. A., J. C. Rink, and A. Sánchez Alvarado. 2008. Beta-catenin defines head

613 versus tail identity during planarian regeneration and homeostasis. Science 319

614 (5861):323-7. doi: 10.1126/science.1150029

615 Hill E. M. and C. P. Petersen. 2015. Wnt/Notum spatial feedback inhibition controls

616 neoblast differentiation to regulate reversible growth of the planarian brain.

617 Development 142 (24):4217-29. doi: 10.1242/dev.123612

618 Iglesias, M., J. L. Gomez-Skarmeta, E. Saló, and T. Adell. 2008. Silencing of Smed-

619 betacatenin1 generates radial-like hypercephalized planarians. Development 135

620 (7):1215-21. doi: 10.1242/dev.020289

621 Jaeger, J., Manu, and J. Reinitz. 2012. Drosophila blastoderm patterning. Curr Opin

622 Genet Dev 22 (6):533-41. doi: 10.1016/j.gde.2012.10.005

623 Kharchenko, P. V., L. Silberstein, and D. T. Scadden. 2014. Bayesian approach to single-

624 cell differential expression analysis. Nat Methods 11 (7):740-2. doi:

625 10.1038/nmeth.2967

626 King, R. S., and P. A. Newmark. 2013. In situ hybridization protocol for enhanced

627 detection of gene expression in the planarian Schmidtea mediterranea. BMC

628 developmental biology 13:8. doi: 10.1186/1471-213X-13-8

629 Kobayashi, C., Y. Saito, K. Ogawa, and K. Agata. 2007. Wnt signaling is required for

630 antero-posterior patterning of the planarian brain. Developmental biology 306

631 (2):714-24. doi: 10.1016/j.ydbio.2007.04.010

632 Langmead, B., C. Trapnell, M. Pop, and S. L. Salzberg. 2009. Ultrafast and memory-

633 efficient alignment of short DNA sequences to the human genome. Genome Biol

634 10 (3):R25. doi: 10.1186/gb-2009-10-3-r25

635 Liu, S. Y., C. Selck, B. Friedrich, R. Lutz, M. Vila-Farre, A. Dahl, H. Brandl, N.

636 Lakshmanaperumal, I. Henry, and J. C. Rink. 2013. Reactivating head regrowth in

637 a regeneration-deficient planarian species. Nature 500 (7460):81-4. doi:

638 10.1038/nature12414

639 McDavid, A., G. Finak, P. K. Chattopadyay, M. Dominguez, L. Lamoreaux, S. S. Ma, M.

640 Roederer, and R. Gottardo. 2013. Data exploration, quality control and testing in

641 single-cell qPCR-based gene expression experiments. Bioinformatics 29 (4):461-

642 7. doi: 10.1093/bioinformatics/bts714

643 Molina, M. D., E. Saló, and F. Cebrià. 2007. The BMP pathway is essential for re-

644 specification and maintenance of the dorsoventral axis in regenerating and intact

645 planarians. Dev Biol 311 (1):79-94. doi: 10.1016/j.ydbio.2007.08.019

646 Newmark, P. A., P. W. Reddien, F. Cebrià, and A. Alvarado. 2003. Ingestion of

647 bacterially expressed double-stranded RNA inhibits gene expression in

648 planarians. Proc Natl Acad Sci U S A 100 Suppl 1:11861-5. doi:

649 10.1073/pnas.1834205100.

650 Newmark, P. A., and A. Sánchez Alvarado. 2000. Bromodeoxyuridine specifically labels

651 the regenerative stem cells of planarians. Dev Biol 220 (2):142-53. doi:

652 10.1006/dbio.2000.9645

653 Niehrs, C. 2010. On growth and form: a Cartesian coordinate system of Wnt and BMP

654 signaling specifies bilaterian body axes. Development 137 (6):845-57. doi:

655 10.1242/dev.039651

656 Orii, H. and K. Watanabe. 2007. Bone morphogenetic protein is required for dorso-

657 ventral patterning in the planarian Dugesia japonica. Dev Growth Differ 49(4): 345–

658 349. doi: 10.1111/j.1440-169X.2007.00931.x

659 Owen, J.H., D. E. Wagner, C.- C. Chen, C. P. Petersen, and P. W. Reddien. 2015. teashirt

660 is required for head-versus-tail regeneration polarity in planarians. Dev

661 142(6):1062–1072. doi: 10.1242/dev.119685

662 Pankratz, M. J. and H. Jäckle. 1993. The Development of the Drosophila melanogaster.

663 Chapter 9. Blastorderm Segmentation. New York: Cold Spring Harbor

664 Laboratories Press.

665 Pearson, B. J., G. T. Eisenhoffer, K. A. Gurley, J. C. Rink, D. E. Miller, and A. Sánchez

666 Alvarado. 2009. Formaldehyde-based whole-mount in situ hybridization method

667 for planarians. Dev Dyn 238 (2):443-50. doi: 10.1002/dvdy.21849

668 Petersen, C. P., and P. W. Reddien. 2008. Smed-betacatenin-1 is required for

669 anteroposterior blastema polarity in planarian regeneration. Science 319

670 (5861):327-30. doi: 10.1126/science.1149943

671 Petersen, C. P., and P. W. Reddien. 2009a. A wound-induced Wnt expression program

672 controls planarian regeneration polarity. Proc Natl Acad Sci U S A 106

673 (40):17061-6. doi: 10.1073/pnas.0906823106

674 Petersen, C. P. and P. W. Reddien. 2009b. Wnt signaling and the polarity of the primary

675 body axis. Cell 139(6):1056–1068. doi: 10.1016/j.cell.2009.11.035

676 Picelli, S., A. K. Bjorklund, O. R. Faridani, S. Sagasser, G. Winberg, and R. Sandberg.

677 2013. Smart-seq2 for sensitive full-length transcriptome profiling in single cells.

678 Nat Methods 10 (11):1096-8. doi: 10.1038/nmeth.2639

679 Picelli, S., O. R. Faridani, A. K. Bjorklund, G. Winberg, S. Sagasser, and R. Sandberg.

680 2014. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9

681 (1):171-81. doi: 10.1038/nprot.2014.006

682 Reddien, P. W. 2011. Constitutive gene expression and the specification of tissue identity

683 in adult planarian biology. Trends Genet 27 (7):277-85. doi:

684 10.1016/j.tig.2011.04.004

685 Reddien, P. W. 2013. Specialized progenitors and regeneration. Development. 140

686 (5):951–957. doi: 10.1242/dev.080499

687 Reddien, P. W., A. L. Bermange, A. M. Kicza, and A. Sánchez Alvarado. 2007. BMP

688 signaling regulates the dorsal planarian midline and is needed for asymmetric

689 regeneration. Development 134 (22):4043-51. doi: 10.1242/dev.007138

690 Reddien, P. W., and A. Sánchez Alvarado. 2004. Fundamentals of planarian regeneration.

691 Annu Rev Cell Dev Biol 20:725-57. doi:

692 10.1146/annurev.cellbio.20.010403.095114

693 Reuter, H., M. März, M. C. Vogg, D. Eccles, L. Grifol-Boldú, D. Wehner, S. Owlarn, T.

694 Adell, G. Weidinger and K. Bartscherer. 2015. Βeta-catenin-dependent control of

695 positional information along the AP body axis in planarians involves a teashirt

696 family member. Cell Rep 10(2):253–65. doi: 10.1016/j.celrep.2014.12.018

697 Rink, J. C., K. A. Gurley, S. A. Elliott, and A. Sánchez Alvarado. 2009. Planarian Hh

698 signaling regulates regeneration polarity and links Hh pathway evolution to cilia.

699 Science 326 (5958):1406-10. doi: 10.1126/science.1178712

700 Rink, J. 2013. Stem cell systems and regeneration in planaria. Dev Genes Evol 223 (1-

701 2):67–84. doi: 10.1007/s00427-012-0426-4

702 Rinn, J. L., C. Bondre, H. B. Gladstone, P. O. Brown, and H. Y. Chang. 2006. Anatomic

703 demarcation by positional variation in fibroblast gene expression programs. PLoS

704 Genet 2 (7):e119. doi: 10.1371/journal.,pgen.0020119

705 Rouhana, L., J. A. Weiss, D. J. Forsthoefel, H. Lee, R. S. King, T. Inoue, N. Shibata, K.

706 Agata, and P. A. Newmark. 2013. RNA interference by feeding in vitro-

707 synthesized double-stranded RNA to planarians: methodology and dynamics.

708 Developmental dynamics : an official publication of the American Association of

709 Anatomists 242 (6):718-30. doi: 10.1002/dvdy.23950

710 Satija, R., J. A. Farrell, D. Gennert, A. F. Schier, and A. Regev. 2015. Spatial

711 reconstruction of single-cell gene expression data. Nat Biotechnol 33 (5):495-

712 502. doi: 10.1038/nbt.3192

713 Sing, T., O. Sander, N. Beerenwinkel, and T. Lengauer. 2005. ROCR: visualizing

714 classifier performance in R. Bioinformatics 21 (20):3940-1. doi:

715 10.1093/bioinformatics/bti623

716 Sureda-Gómez, M., E. Pascual-Carreras, and T. Adell. 2015. Posterior Wnts Have

717 Distinct Roles in Specification and Patterning of the Planarian Posterior Region. Int

718 J Mol Sci 16(11):26543–26554. doi: 10.3390/ijms161125970

719 Tippett, Leonard Henry Caleb. 1931. The methods of statistics: London, Williams and

720 Norgate ltd.

721 Vogg, M.C., Y. A. Pérez Rico, J. Xie, Y. Suzuki, L. Gentile, W. Wu, and K. Bartscherer.

722 2014. Stem cell-dependent formation of a functional anterior regeneration pole in

723 planarians requires Zic and Forkhead transcription factors. Dev Biol 390(2):136-

724 48. doi:10.1016/j.ydbio.2014.03.016

725 Wagner, D. E., I. E. Wang, and P. W. Reddien. 2011. Clonogenic neoblasts are

726 pluripotent adult stem cells that underlie planarian regeneration. Science

727 332(6031):811–6. doi: 10.1126/science.1203983

728 Wan L. and F. Sun. 2012. CEDER: Accurate detection of differentially expressed genes

729 by combining significance of exons using RNA-Seq. IEEE/ACM transactions on

730 computational biology and bioinformatics / IEEE, ACM 9 (5):1281-1292.

731 doi:10.1109/TCBB.2012.83

732 Witchley, J. N., M. Mayer, D. E. Wagner, J. H. Owen, and P. W. Reddien. 2013. Muscle

733 cells provide instructions for planarian regeneration. Cell reports 4 (4):633-41.

734 doi: 10.1016/j.celrep.2013.07.022

735 van Wolfswinkel, J. C., D. E. Wagner, and P. W. Reddien. 2014. Single-Cell Analysis

736 Reveals Functionally Distinct Classes within the Planarian Stem Cell Compartment.

737 Cell stem cell 15(3):326-39. doi: 10.1016/j.stem.2014.06.007

738 Wurtzel, O., L. E. Cote, A. Poirier, R. Satija, A. Regev, and P. W. Reddien. 2015. A

739 Generic and Cell-Type-Specific Wound Response Precedes Regeneration in

740 Planarians. Dev Cell, 35(5):632–45. doi: 10.1016/j.devcel.2015.11.004

741 Zayas, R. M., F. Cebrià, T. Guo, J. Feng, and P. A. Newmark. 2010. The use of lectins as

742 markers for differentiated secretory cells in planarians. Dev Dyn 239 (11):2888-

743 97. doi: 10.1002/dvdy.22427

744

745 Figure titles and legends

746 Figure 1. Single-muscle-cell RNA sequencing identifies regionally expressed genes

747 on the planarian AP axis.

748 (A) Single cells from each colored AP region were isolated by FACS and resultant cDNA

749 was screened by qRT-PCR for muscle marker expression. Positive cells were sequenced

750 and analyzed for differential expression. (B) Whole-mount in situ hybridization (ISH)

751 (n=2 experiments) shows expression of a subset of new and previously known (#) muscle

752 regionally expressed genes (mRGs). Images are representative of n>10 animals for new

753 mRGs. Anterior, up. Scale bar, 100 μm. Right, violin plots show the expression

754 distribution in muscle cells (black dots) within the 10 dissected regions. cpm, counts per

755 million. (C) Double fluorescence ISH (FISH) show co-localization of several newly

756 identified mRGs (magenta) and the muscle marker collagen (green). DAPI was used to

757 label nuclei DNA (gray). Yellow arrows point to cells co-expressing both genes. Scale

758 bar, 10 μm. (D) Heat map shows hierarchical clustering of the average expression per

759 region of the 44 identified mRGs. Top color bar indicates dissected region. (*) marks

760 genes that are named by best human BLASTx hits. (E) Pie chart shows the percentage,

761 within the 44 genes shown in D, of Wnt-signaling genes, FGFRL, and Hox homologs.

762

763 Figure 2. Co-expression of mRGs along the AP axis.

764 (A) FISH using mRGs map discrete domains of mRG expression onto the planarian AP

765 axis. Bars on left indicate the approximate extent of the expression domain for each of the

766 genes analyzed. Images are representative of n=5 animals. Anterior, up. Scale bar, 100

767 μm. (B) Heatmap shows co-expression of anterior FGFRL and Wnt pathway mRGs in the

768 four anterior regions indicated in the cartoon (1-4). Each column shows expression within

769 a single cell with color bars above indicating the dissected region of origin for the cell.

770 cpm, counts per million (C) FISH using different FGFRL/ndl probes and Wnt pathway

771 mRGs show co-expression in the four regions depicted in the cartoon. Black boxes (1-4)

772 in the cartoon in B show the region imaged for the FISH, as denoted by the number and

773 colored rectangle next to the merged image. Scale bar, 10 μm. Images are representative

774 of n=5 animals.

775

776 Figure 3. ndl-3 and wntP-2 restrict trunk positional identity.

777 (A) Live, ventral images of ectopic pharynges and mouths in 20-30 day post-amputation

778 (dpa) RNAi animals. Right top, cartoon depicts esophagus, pharynx, and mouth. Left,

779 pharynges (yellow arrows) and ectopic mouths without a protruding pharynx (white

780 arrows). Scale bar, 500 μm. Right bottom, mouths (white arrows) in 7 dpa RNAi animals.

781 Anterior, left. Total number of animals were pooled from at least 2 independent RNAi

782 experiments. (B) Increased numbers of para-pharyngeal mmp1+ cells in RNAi animals.

783 NB.22.1e labels mouths. Graph below shows mean ± SD (n>8 animals/condition, 2

784 pooled experiments, One-way ANOVA). (C) Esophagus-gut connection in 20 dpa trunk

785 fragments, region in dotted rectangle is shown at higher magnification below. FISH: mat

786 (gut), mhc-1 (pharynx), and NB.22.1e (esophagus). Bracket, pharyngeal cavity length.

787 (D) Time-lapse images of an ndl-3; wntP-2 RNAi animal eating liver through both

788 pharynges (yellow arrows), see Movie 1.

789

790 Figure 4. Trunk mRG gradients are shifted in ndl-3 and wntP-2 RNAi animals with

791 ectopic pharynges/mouths.

792 mRG expression analyses by FISH: (A) expanded expression of trunk mRG ndl-3, (B)

793 reduction of the lateral expression of the posterior mRG wntP-2. Left panel, ventral view.

794 Right panel, dorsal view. Red arrows point to the mRG expression domain boundary

795 shifted. White arrows point to mouths. Yellow arrows indicate esophagus. Anterior, up.

796 Scale bar, 100 μm. All FISH images are representative of n>8 animals per condition, and

797 at least 2 independent RNAi experiments have been performed. (C-E) Graphs show

798 quantification of the shifts in expression domains for the mRGs shown in the FISH

799 experiments (mean ± SD, at least 3 independent experiments were pooled. One-way

800 ANOVA for sFRP-1, unpaired Student-t-tests for ndl-3 and wntP-2). Cartoons on the left

801 depicts the expression domain in the wild-type animal and the distance that was measured

802 in each case. Length of expression domain measured was normalized by total length of

803 the animal. All measurements were scored blind.

804

805 Figure 5. fz5/8-4, wntA, and ndk restrict head positional identity.

806 (A) Posterior ectopic eyes seen in uninjured RNAi animals. Black arrows, ectopic eyes.

807 Total number of animals have been pooled from 3 independent RNAi experiments.

808 Cartoon on left shows area imaged. Graph below shows the percentage of intact animals

809 with ectopic posterior eyes in each RNAi condition. (B,C) Posterior expansion of

810 neuronal markers (B) ChAT and notum and eyes (anti-ARRESTIN/VC-1 antibody,

811 images representative of n>5) and (C) glutamic acid decarboxylase (gd, red arrows mark

812 posterior-most cell) and photoreceptor marker opsin. Cartoon on left shows area imaged.

813 Below, graph shows increased gd+ cell numbers, mean ± SD (n>5 animals/condition, 2

814 independent RNAi experiments, One-way ANOVA) normalized by the length from head

815 tip to the esophagus.

816

817 Figure 6. Anterior and prepharyngeal mRG gradients are shifted in fz5/8-4, ndk,

818 and wntA RNAi animals with expanded brain tissue and ectopic eyes.

819 (A,B) Expansion of mRG expression domains towards the animal posterior. White

820 bracket marks distance between mRG posterior boundary and esophagus; red arrows

821 mark expression domain shifts. White dotted lines outline pharynx. (A) ndl-5, and (B)

822 ndl-2. (A) Disorganization of mag-1 expression (yellow arrows). White arrows and opsin

823 expression mark eyes. (C) Retraction of the pre-pharyngeal mRG ndl-3. Red arrows

824 points to the shift towards the posterior of the anterior gradient boundary. White bracket

825 indicates distance from the tip of the head to the anterior edge of the ndl-3 gradient. In all

826 panels, anterior is up. Scale bar, 100 μm. All FISH images are representative of n>10

827 animals and at least 2 independent RNAi experiments were performed. (D-F) Graphs

828 show quantification of the expression domain shifts for the mRGs shown in the FISH

829 experiments (mean ± SD, at least 3 independent experiments were pooled, One-way

830 ANOVA). Cartoons on the left depict the expression domain in the wild-type animal and

831 the distance (normalized to total length) that was measured in each case. All

832 measurements were scored blind.

833

834 Figure 7. Two FGFRL-Wnt circuits control AP patterning in planarians. (A)

835 Expression domains of all identified mRGs along the planarian AP axis. Wnt pathway

836 (purple), FGFRL (orange), and Hox genes (green). In bold, genes shown here to be

837 involved in maintaining regional identity. (B) Cartoons summarize the characterized

838 RNAi phenotypes. ndl-3 and wntP-2 restrict the number of pharynges and mouths in the

839 trunk region. wntP-2 RNAi animals with ectopic pharynges/mouths have an expanded

840 ndl-3 domain whereas ndl-3 RNAi animals with ectopic pharynges/mouths have a

841 reduced wntP-2 expression domain. fz5/8-4, ndk, and wntA restrict the brain tissue to the

842 head. Inhibition of these genes results in ectopic posterior eyes, brain expansion, and

843 expanded domains of head mRGs. (C) Expression domains of the two FGFRL-Wnt

844 circuits are shown. Black brackets indicate the region controlled by the FGFRL-Wnt

845 circuits.

846

847 Figure supplements

848 Figure 1—figure supplement 1. Single-muscle-cell sequencing and analysis.

849 (A) Schematic of the 10 regions dissected and macerated to isolate single cells. (B)

850 Representative FACS plot of Hoechst-stained cells from a single region indicating the

851 gate used to isolate non-dividing cells. (C) Representative qRT-PCR plot for the muscle

852 marker troponin used to screen single-cell cDNA libraries. The libraries from cells

853 circled in red were sequenced. (D) Principal component (PC) analysis and troponin

854 expression identified 115 muscle cells. Cells separated along two significant principal

855 components: PC1 (29.9% of variance explained, p=1.4E-120) separated muscle from

856 epidermal lineage and PC2 (8.3% of variance explained, p=4.4E-44) separated neoblasts

857 from differentiated cells (Supplementary file 1B). Cells to the left of the dashed line that

858 expressed troponin were retained for further analysis as muscle cells. (E) Distribution of

859 contigs with two or more reads in the 177 single-cell libraries used for PC analysis.

860 Nearly all cells with high number of expressed contigs that could signal a doublet event

861 from FACS were categorized as non-muscle cells and excluded from differential

862 expression analysis. (F) Muscle cells from all regions were evenly distributed throughout

863 PC-space indicating that AP region of origin did not explain a significant proportion of

864 the variance. Inset includes number of muscle cells analyzed per region. (G) Different

865 differential expression analysis methods were tested for the ability to identify known 866 mRGs. The rank order by p-value is shown on the y-axis in log10 scale for several

867 canonical mRGs. Arrows mark the rank separating significant (filled circle) and not

868 significant (n.s., unfilled circle) genes at p<0.01 for each method. (H) Three differential

869 expression analyses (left) using SCDE were performed between the indicated regions.

870 Ranking of genes by a differential expression score was used to generate a receiver-

871 operator curve (right) to evaluate whether the SCDE analysis correctly classified genes as

872 mRGs compared to ISH validation (Methods).

873

874 Figure 1—figure supplement 2. 44 mRGs are distributed along the AP axis.

875 Colorimetric ISH of mRGs (blue) identified in SCDE analyses. Violin plots show the

876 distribution of cells that express that gene in each of the 10 dissected regions; cpm,

877 counts per million. #, previously known mRGs. (A) Genes with p<0.005 in any analysis;

878 (B) Genes with p>0.005. Anterior, up. Scale bar, 100 μm. Each image is representative of

879 n>5 animals. At least 2 independent ISH experiments were performed for each new

880 mRG.

881

882 Figure 2—figure supplement 1. Axial mRG map and co-expression of multiple

883 FGFRL genes and mRGs in the same muscle cell.

884 (A) FISH using a combination of known and new mRG RNA probes show distributions

885 of gradients along the AP axis. Anterior, left. Scale bar, 100 μm. Each image is

886 representative of n>5 animals. (B) Heatmap shows hierarchical clustering of the

887 identified 44 mRGs in each of the 115 muscle cells analyzed. Cartoon on top depicts the

888 10 regions dissected. Top color bar indicates region of origin for that cell. Expression

889 values for each gene are scaled across each row as z-scores. (*) marks transcripts that are

890 best human BLASTx hits.

891

892 Figure 2—figure supplement 2. Phylogenetic analysis of SMED-FGFRL proteins.

893 Top right: Domain diagram of FGFR and FGFRL proteins. IG, immunoglobulin domain;

894 TM, transmembrane domain; TyrKc, Tyrosine kinase. Tree showing 54 FGFRL proteins

895 from diverse organisms, which were aligned using MUSCLE with default settings and

896 trimmed with Gblocks. Maximum likelihood analyses were run using PhyML with 100

897 bootstrap replicates, the WAG model of amino acid substitution, 4 substitution rate

898 categories and the proportion of invariable sites estimated from the dataset. All ML

899 bootstrap values are shown above or below respective branch. Hs, Homo sapiens; Mm,

900 Mus musculus; Xt, Xenopus tropicalis; Sp, Strongylocentrotus purpuratus; Cs, Capitella

901 sp. I; Lg, Lottia gigantean; Ci, Ciona intestinalis; Sm, Schistosoma mansoni; Smed,

902 Schmidtea mediterranea; Dj, Dugesia japonica; Dl, Dendrocoelum lacteum; Ptor,

903 Planaria torva; Pt, Polycelis tenuis; Pn, Polycelis nigra; Nv, Nematostella vectensis.

904 Right, ISH of the 6 Schmidtea mediterranea FGFRL genes shown in tree. Images are

905 representative of n>10 animals. Anterior, left.

906

907 Figure 2—figure supplement 3. Pattern of FGFRL/ndl family expression in β-

908 catenin-1 RNAi animals.

909 FISH shows expression of ndl-5, ndl-2, ndl-3, and sFRP-1 in control and -catenin-1

910 RNAi animals after one, two or four RNAi feedings (1F, 2F, 4F). Animals were fixed at

911 different timepoints after initiation of RNAi, shown in brackets at the top. Yellow arrows

912 show ectopic expression of anterior mRGs in posterior regions of the animal before

913 ectopic eyes are visible. Red arrow indicates ectopic expression of the prepharyngeal

914 mRG ndl-3. opsin (green) marks eyes. Anterior, up. Scale bar, 100 μm.

915

916 Figure 2—figure supplement 4. Inhibition of FGFRL genes does not significantly

917 change expression of other members of the FGFRL family.

918 (A) Heatmap shows efficiency of RNAi inhibition in each condition, and no significant 919 effects in the expression level of other genes. Color scale represents mean log2 fold

920 change in expression of each gene (rows) in the RNAi conditions (columns) compared to

921 control RNAi in 6 dpa head fragments (cartoon on left, screen RNAi feeding protocol

922 was used, see Methods). At least three head fragments were analyzed by qRT-PCR in

923 each condition. One-way ANOVA, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

924 (B) FISH shows normal expression of ndk and wntP-2 in ndl-1; ndl-2; ndl-4; ndl-5 RNAi

925 animals in prepharyngeal fragments 6 dpa (cartoon on left, same RNAi feeding protocol

926 as A). Anterior, up. Scale bar, 100 μm.

927

928 Figure 3—figure supplement 1. ndl-3 and wntP-2 restrict the number of mouths and

929 pharynges in the trunk region.

930 (A) Ectopic posterior mouths are observed in regenerating trunk pieces of ndl-3, wntP-2,

931 and ndl-3; wntP-2 RNAi animals 7 dpa. Number of animals showing ectopic mouths are

932 described in Figure 3A. Yellow arrows point to mouths. Anterior, left; ventral, up. Scale

933 bar, 100 μm. (B) DAPI stainings of RNAi animals show pharynges in the different RNAi

934 conditions. Bracket indicates pharyngeal cavity length. Anterior, up; Scale bar, 100 μm.

935 Images are representative of n>10 animals per condition. (C) Graph shows the percentage

936 of intact RNAi animals with a total of two or more mouths after 8 RNAi feedings. p-

937 values, Fisher’s exact test. 3 independent RNAi experiments are pooled in this analysis.

938 Number of animals with ectopic mouths out of total animals (n) are indicated. (D) FISH

939 using RNA probes for ndl-3 and wntP-2 show a decrease in the expression of those genes

940 following their RNAi demonstrating the efficiency of the inhibition (total of 8 RNAi

941 feedings). Graphs below (mean ± SD) show quantification of the mRNA levels by qRT-

942 PCR. Student-t-test, * p<0.05, ** p<0.01. Cartoons show the region from where the

943 mRNA was extracted. (E) Graph shows the percentage of intact RNAi animals with a

944 total of two or more mouths after different number of RNAi feedings. First five RNAi

945 feedings were performed with only ndl-3; wntP-2 dsRNA. -catenin-1 or control dsRNA

946 was added in addition to ndl-3; wntP-2 starting on feeding six.

947

948 Figure 4—figure supplement 1. ndl-3 and wntP-2 restrict trunk but not head or tail

949 mRG expression domains in animals with ectopic pharynges/mouths.

950 (A-D, F) FISH using RNA probes for different mRGs and the esophagus and mouth

951 marker NB.22.1e (yellow or green). White arrows indicate mouths. (A-D) Red arrows

952 point to the posterior edge of the mRG expression gradient. (A) ndl-5 (magenta) and (B)

953 wnt2 (magenta) expression domains do not obviously expand. (C) ndl-2 (magenta) and

954 (D) sFRP-2 (magenta) expression domain slightly expands in some RNAi conditions.

955 Graph on right (mean ± SD) shows quantification of gradient shifts. One-way ANOVA *

956 p<0.05, ** p<0.01. Cartoons on the left depicts the gradient in the wild-type animal and

957 the distance that was measured in each case. All measurements were scored blindly. (E)

958 Colorimetric whole-mount ISH using the RNA probe for the posterior mRG fz4-1. Black

959 arrows point to fz4-1 expression. (F) Expression of the posterior mRG dd_13065

960 (magenta) is still present. FISH images are representative of n>8 animals, ventral view.

961 All FISH and ISH experiments have been repeated at least twice from independent RNAi

962 experiments. All animals were fixed 20 dpa. The screen RNAi feeding protocol was used

963 (see Methods). Anterior, up; scale bar, 100 μm.

964

965 Figure 5—figure supplement 1. fz5/8-4, wntA, and ndk restrict the brain tissue to the

966 head region.

967 (A) Ectopic eyes are shown in 7 dpa trunk fragments of fz5/8-4 RNAi animals. Black

968 arrows point to ectopic eyes. Total numbers of RNAi animals are indicated. (B) Ectopic

969 eyes (black arrows) are shown in an intact wntA RNAi and in a fz5/8-4; wntA double

970 RNAi intact animal after 6 RNAi feedings. RNAi experiments were performed three

971 times. Total numbers of RNAi animals are indicated. (C) FISH using the RNA probe

972 fz5/8-4 shows decreased expression of this gene following its RNAi demonstrating the

973 efficiency of the inhibition (6 RNAi feedings). Graph below (mean ± SD) shows

974 quantification of the mRNA levels by qRT-PCR in different RNAi conditions. mRNA

975 was extracted from 6 dpa head fragments. One-way ANOVA, **** p<0.0001. (D)

976 Synergistic RNAi effect of several members of the FGFRL family on the fz5/8-4; ndk

977 RNAi phenotype. RNAi experiments have been performed twice. Total number of RNAi

978 animals is indicated. Black arrows point to ectopic eyes. (E,F) FISH using the neuronal

979 markers: (E) cintillo, and (F) notum and the photoreceptor marker opsin (E). Graph

980 shows the percentage of cintillo+ cells (mean ± SD) in intact RNAi animals normalized

981 by the length of the animal (from the tip of the head to the esophagus), (n>8 animals per

982 RNAi condition, two independent RNAi experiments, One-way ANOVA). Yellow dotted

983 line shows the esophagus location, * shows pharynx. White arrows show the most

984 posterior cell expressing the neuronal marker analyzed. Anterior, up; dorsal view unless

985 indicated. Scale bar, 100 μm.

986

987 Figure 6—figure supplement 1. fz5/8-4, wntA, and ndk locally restrict mRG

988 expression in animals with expanded brain tissue and ectopic eyes.

989 FISH and ISH in intact RNAi animals after 8 or 12 RNAi feedings. (A,D) FISH

990 experiments show normal (A, after only 8 RNAi feedings) and abnormal (D, after 12

991 RNAi feedings) organization in the expression of the secretory cell marker mag-1

992 (green). (B,C) FISH experiments show expression domain shifts of prepharyngeal mRGs

993 ndl-2 (magenta, B) and wnt2 (C). (B-D) Posterior mRG expression domains (wntP-2,

994 wnt11-1, wnt11-2, both wnt11 genes pooled in C) did not change. opsin (green or

995 magenta) and NB.22.1e (yellow). For all FISH images, red arrows point to the posterior

996 edge of the mRG expression domain. White arrows point to eyes. Anterior, up. Scale bar,

997 100 μm. FISH images are representative of n>8, FISH experiments. DAPI shows ectopic

998 eyes in the fz5/8-4; ndk RNAi animal imaged (yellow arrows) in B. FISH have been

999 performed twice from independent RNAi experiments. (E) ISH using ndk RNA probe

1000 shows posterior expansion of the ndk expression domain in a fz5/8-4; wntA RNAi animal

1001 after 8 RNAi feedings. Images are representative of n>5 animals per condition. Anterior,

1002 left. Right graph shows quantification of increased ndk expression by qRT-PCR.

1003 Cartoons on top indicate the region from which mRNA was extracted.

1004

1005

1006 Supplementary files

1007 Supplementary File 1A. Single-cell library information

1008 Supplementary File 1B. Top 12 significant genes defining principal components (PC) 1

1009 and 2

1010 Supplementary File 1C. Anterior (regions 1-3) versus Posterior (regions 8-10) SCDE

1011 analysis and ISH results

1012 Supplementary File 1D. Head (region 1) versus post-pharyngeal (regions 7-9) SCDE

1013 analysis and ISH results

1014 Supplementary File 1E. Pre-pharyngeal (regions 2-4) versus post-pharyngeal (region 10)

1015 SCDE analysis and ISH results

1016 Supplementary File 1F. List of 44 mRGs

1017 Supplementary File 1G. RNAi summary

1018 Supplementary File 1H. qRT-PCR primers

1019

1020 Rich media file

1021 Movie 1: Control, wntP-2, and ndl-3; wntP-2 RNAi animals eating from one or two

1022 pharynges.

A i. Regional single-cell ii. Muscle marker iii. Single-muscle-cell differential D isolation screening expression analysis 1 12345678910 2 notum 3 ndl-4 fz5/8-3 4 ndl-1 &60' 5 foxD 6 ()5 prep 7 fz5/8-4 8 sFRP-1 zic-1 9 ndk 10 '1$-% ndl-2 B log cpm log cpm log cpm log cpm fz4-4 wnt2 ndl-5 zic-2 ndl-3

# sFRP-2

# fz4-3 ptk7 25)OLNH ndk

fz5/8-3 fz5/8-4 wntA sFRP-1 ,*)$/6 fz4-1 lox5a hox4b dd_13735 axin2 dd_4427 dd_13065 &711% Post-2c # # dd_15686 VS wnt11-1 ptk7 ndl-2 ndl-5 ndl-3 fz4-2 wntP-2 )$0$ Post-2d wntless wnt1 wnt11-2 Expression (z-score) # # E -2 -1 0 1 2 FGFRL wntP-2 Post-2c dd_4427 Wnt- Hox dd_13065 VLJQDOLQJ RWKHU C DAPI collagen fz5/8-3 fz5/8-4 ndl-5 ndl-2 dd_13065 Post-2c )LJXUH6LQJOHPXVFOHFHOO51$VHTXHQFLQJLGHQWLÀHVUHJLRQDOO\H[SUHVVHGJHQHVRQWKHSODQDULDQ $3D[LV (A) Single cells from each colored AP region were isolated by FACS and resultant cDNA was screened by qRT-PCR for muscle marker expression. Positive cells were sequenced and analyzed for differential expression. (B) Whole-mount in situ hybridization (ISH) (n=2 experiments) shows expression of a subset of new and previously known (#) muscle regionally expressed genes (mRGs). Images are UHSUHVHQWDWLYHRIQ!DQLPDOVIRUQHZP5*V$QWHULRUXS6FDOHEDUѥP5LJKWYLROLQSORWVVKRZWKH expression distribution in muscle cells (black dots) within the 10 dissected regions. cpm, counts per million. (C 'RXEOHÁXRUHVFHQFH,6+ ),6+ VKRZFRORFDOL]DWLRQRIVHYHUDOQHZO\LGHQWLÀHGP5*V PDJHQWD DQG the muscle marker collagen (green). DAPI was used to label nuclei DNA (gray). Yellow arrows point to cells FRH[SUHVVLQJERWKJHQHV6FDOHEDUѥP D) Heat map shows hierarchical clustering of the average H[SUHVVLRQSHUUHJLRQRIWKHLGHQWLÀHGP5*V7RSFRORUEDULQGLFDWHVGLVVHFWHGUHJLRQ PDUNVJHQHVWKDW are named by best human BLASTx hits. (E) Pie chart shows the percentage, within the 44 genes shown in D, of Wnt-signaling genes, FGFRL, and Hox homologs. A ndl-4 ndl-4 ndl-4 fz5/8-3 sFRP-1 fz5/8-4 sFRP-1 ndk ndl-5 ndl-2 sFRP-2 ndl-5 sFRP-2 ndl-3 ndl-3 ndl-3 ndl-3 ndl-3

dd_13065 wntP-2 Post-2c wntP-2 wntP-2 wnt11-1 B fz5/8-3 merge ndl-2 ndk ndl-4 1 sFRP-1 1 notum 2 ndl-1 3 ndl-5 4 ndl-4 ndl-2 ndk fz5/8-4 wntA fz4-4 wnt2 1 merge ndl-5 ndk ndl-4 fz4-3 sFRP-2 log cpm ndl-3 wntP-2 02468 11

C r01_515 r01_370 r01_430 r01_410 r01_463 r01_400 r01_514 r01_440 r01_390 r01_380 r01_420 r02_447 r02_396 r02_427 r02_426 r02_437 r02_386 r03_407 r03_487 r03_377 r03_397 r03_507 r03_417 r04_402 r04_401 r04_422 r04_392 r04_442 r04_381 r04_371 r04_412 r04_432 r04_4 merge ndl-5 ndk ndl-3 1 merge ndl-1 ndl-4 2

merge ndl-2 ndk ndl-3 1 merge fz5/8-4 ndk 2

merge ndl-2 ndk 4 merge wntP-2 ndl-3 3 ndl-3

Figure 2. Co-expression of mRGs along the AP axis. (A) FISH using mRGs map discrete domains of mRG expression onto the planarian AP axis. Bars on left indicate the approximate extent of the expression domain for each of the genes analyzed. Images are representative of n=5 animals. Anterior, up. Scale bar, ѥP B) Heatmap shows co-expression of anterior FGFRL and Wnt pathway mRGs in the four anterior regions indicated in the cartoon (1-4). Each column shows expression within a single cell with color bars above indicating the dissected region of origin for the cell. cpm, counts per million (C) FISH using different FGFRL/ndl probes and Wnt pathway mRGs show co-expression in the four regions depicted in the cartoon. Black boxes (1-4) in the cartoon in B show the region imaged for the FISH, as denoted by the number and FRORUHGUHFWDQJOHQH[WWRWKHPHUJHGLPDJH6FDOHEDUѥP,PDJHVDUHUHSUHVHQWDWLYHRIQ DQLPDOV A HVRSKDJXV SKDU\Q[ PRXWK YHQWUDOYLHZ YHQWUDOYLHZ FRQWURO ndl-3 RNAi FRQWURO ndl-3 RNAi 100% (138/138) 20% (30/154) wntP-2 RNAi ndl-3; wntP-2 RNAi

wntP-2 RNAi ndl-3; wntP-2 RNAi 39% (68/176) 51% (52/102) B mmp1 NB.22.1e C mhc-1 mat NB.22.1e

ndl-3; wntP-2 ndl-3 wntP-2 ndl-3; wntP-2 FRQWURO ndl-3 RNAi wntP-2 RNAi RNAi FRQWURO RNAi RNAi RNAi p<0.0001

p=0.0027 800 p=0.0002 D

+ cells 600 IRRG

mmp1 400

200 number of 0 ndl-3; wntP-2 RNAi control ndl-3 RNAi time wntP-2 RNAi

ndl-3; wntP-2 RNAi Figure 3. ndl-3DQGwntP-2UHVWULFWWUXQNSRVLWLRQDOLGHQWLW\(A) Live, ventral images of ectopic pharynges and mouths in 20-30 day post-amputation (dpa) RNAi animals. Right top, cartoon depicts esophagus, pharynx, and mouth. Left, pharynges (yellow arrows) and ectopic mouths without a protruding SKDU\Q[ ZKLWHDUURZV 6FDOHEDUѥP5LJKWERWWRPPRXWKV ZKLWHDUURZV LQGSD51$LDQLPDOV Anterior, left. Total number of animals were pooled from at least 2 independent RNAi experiments. (B) Increased numbers of para-pharyngeal mmp1+ cells in RNAi animals. NB.22.1e labels mouths. Graph below shows mean ± SD (n>8 animals/condition, 2 pooled experiments, One-way ANOVA). (C) Esophagus-gut FRQQHFWLRQLQGSDWUXQNIUDJPHQWVUHJLRQLQGRWWHGUHFWDQJOHLVVKRZQDWKLJKHUPDJQLÀFDWLRQEHORZ FISH: mat (gut), mhc-1 (pharynx), and NB.22.1e (esophagus). Bracket, pharyngeal cavity length. (D) Time- lapse images of an ndl-3; wntP-2 RNAi animal eating liver through both pharynges (yellow arrows), see Movie 1. A YHQWUDOYLHZ GRUVDOYLHZB YHQWUDOYLHZ GRUVDOYLHZ sFRP-1

sFRP-1

ndl-3 NB.22.1e wntP-2 NB.22.1e ndl-3 wntP-2 NB.22.1e NB.22.1e

FRQWURO wntP-2 RNAi FRQWURO wntP-2 RNAi FRQWURO ndl-3 RNAi FRQWURO ndl-3 RNAi C D E

ns ns 0.6 0.8 midline 0.15 * *** lateral 0.6 0.4 0.10 0.4

0.2 length/total length 0.05 0.2 midline length/total length gradient length/total length wntP-2 0.0 0.0 0.00 ndl-3

sFRP-1 RNAi RNAi RNAi RNAi RNAi RNAi ndl-3 ndl-3 control RNAi control RNAi ndl-3 control RNAi wntP-2 control RNAi wntP-2

ndl-3; wntP-2 )LJXUH7UXQNP5*JUDGLHQWVDUHVKLIWHGLQndl-3DQGwntP-251$LDQLPDOVZLWKHFWRSLFSKDU\QJHV PRXWKV mRG expression analyses by FISH: (A) expanded expression of trunk mRG ndl-3, (B) reduction of the lateral expression of the posterior mRG wntP-2. Left panel, ventral view. Right panel, dorsal view. Red arrows point to the mRG expression domain boundary shifted. White arrows point to mouths. Yellow arrows LQGLFDWHHVRSKDJXV$QWHULRUXS6FDOHEDUѥP$OO),6+LPDJHVDUHUHSUHVHQWDWLYHRIQ!DQLPDOV per condition, and at least 2 independent RNAi experiments have been performed. (C-E) Graphs show TXDQWLÀFDWLRQRIWKHVKLIWVLQH[SUHVVLRQGRPDLQVIRUWKHP5*VVKRZQLQWKH),6+H[SHULPHQWV PHDQ SD, at least 3 independent experiments were pooled. One-way ANOVA for sFRP-1, unpaired Student-t-tests for ndl-3 and wntP-2). Cartoons on the left depicts the expression domain in the wild-type animal and the distance that was measured in each case. Length of expression domain measured was normalized by total length of the animal. All measurements were scored blind. A 51$LIHHGLQJV B C FRQWURO fz5/8-4 RNAi 51$LIHHGLQJV notum VC-1 ChAT 51$LIHHGLQJV gd opsin FRQWURO fz5/8-4; ndk RNAi

99/99 6/83 fz5/8-4; ndk RNAi wntA; ndk RNAi

FRQWURO fz5/8-4 RNAi p=0.0002 wntA; ndk RNAi

p=0.0042 120 60/81 68/79 80 + cells/mm

control 0 gd fz5/8-4 RNAi 40 ndk RNAi number of 0 fz5/8-4; ndk RNAi fz5/8-4; ndk RNAi wntA; ndk RNAi wntA RNAi control wntA; ndk RNAi wntA; ndk RNAi fz5/8-4; wntA RNAi fz5/8-4; ndk RNAi 0 25 50 75 100 % of intact animals with ectopic eyes Figure 5. fz5/8-4, wntADQGndkUHVWULFWKHDGSRVLWLRQDOLGHQWLW\(A) Posterior ectopic eyes seen in uninjured RNAi animals. Black arrows, ectopic eyes. Total number of animals have been pooled from 3 independent RNAi experiments. Cartoon on left shows area imaged. Graph below shows the percentage of intact animals with ectopic posterior eyes in each RNAi condition. (B,C) Posterior expansion of neuronal markers (B) ChAT and notum and eyes (anti-ARRESTIN/VC-1 antibody, images representative of n>5) and (C) glutamic acid decarboxylase (gd, red arrows mark posterior-most cell) and photoreceptor marker opsin. Cartoon on left shows area imaged. Below, graph shows increased gd+ cell numbers, mean ± SD (n>5 animals/condition, 2 independent RNAi experiments, One-way ANOVA) normalized by the length from head tip to the esophagus. D A ndl-2. DQLPDOVZLWKH[SDQGHGEUDLQWLVVXHDQGHFWRSLFH\HV )LJXUH$QWHULRUDQGSUHSKDU\QJHDOP5*JUDGLHQWVDUHVKLIWHG eyes. ( esophagus; redarrowsmarkexpressiondomainshifts.Whitedottedlinesoutlinepharynx.( towards theanimalposterior. WhitebracketmarksdistancebetweenmRGposteriorboundaryand All measurementswerescoredblind. domain inthewild-typeanimalanddistance(normalizedtototallength)thatwasmeasured eachcase. least 3independentexperimentswerepooled,One-way ANOVA). Cartoonsontheleftdepictexpression TXDQWLÀFDWLRQRIWKHH[SUHVVLRQGRPDLQVKLIWVIRUWKHP5*VVKRZ of n>10animalsandatleast2independentRNAiexperimentswereperformed.( of the the anteriorgradientboundary. White bracketindicatesdistancefromthetipofheadtoanterioredge

mag-1 ndl-5 opsin ( ndl-3 FRQWURO C A ) Retractionofthepre-pharyngealmRG ) Disorganizationof ndl-5 gradient length/ JUDGLHQW,QDOOSDQHOVDQWHULRULVXS6FDOHEDUѥP$O total length 51$LIHHGLQJV

control RNAi 0.0 0.1 0.2 0.3 0.4

fz5/8-4; ndk RNAi fz5/8-4; ndk *

RNAi

ndk; wntA **

mag-1 RNAi B E expression(yellowarrows).Whitearrowsand NB.22.1e ndl-2 opsin sFRP-1 FRQWURO

ndl-2 gradient length/ total length 51$LIHHGLQJV 0.0 0.1 0.2 0.3 0.4 ndl-3. control RNAi RNAi fz5/8-4; ndk

fz5/8-4; ndk Red arrowspointstotheshifttowardsposteriorof *

( RNAi A,B *

ndk; wntA RNAi wntA; ndk ) ExpansionofmRGexpressiondomains

QLQWKH),6+H[SHULPHQWV PHDQ6'DW RNAi LQ O),6+LPDJHVDUHUHSUHVHQWDWLYH fz5/8-4 F C ndl-3 sFRP-1 FRQWURO , ndk

D-F distance to anterior ndl-3 edge/

opsin total length

control RNAi 0.0 0.1 0.2 0.3 DQG ) Graphsshow

fz5/8-4; ndk YHQWUDOYLHZ expressionmark ** wntA A fz5/8-4; wntA RNAi RNAi fz5/8-4; ndk *** ) ndl-5 RNAi ****

RNAi

, and( ndk; wntA

RNAi B ) ABC ndk ndl-1 ndl-5 ndl-4 zic-1/2, foxD CSMD, EFR3, DNAJB13 RNAi: ndl-3, ndk, wntA, control notum ndl-2 fz5/8-3 fz5/8-4 wntP-2 fz5/8-4 sFRP-1 ndk ndl-3 fz4-3/4 Head fz5/8-4 wnt2 wntA

prep wntA FAM160A1, dd_13065, ORF2 sp5, dd_13735, CTNN1B sFRP-2 ndl-3 IGFBP, dd_4427 Trunk ptk7 wntP-2 Post-2d wntP-2 hox4b, Post-2c dd_15686 lox5a axin 2, wntless, wnt11-1 fzd-4-1/2 wnt1, wnt11-2

Figure 7. Two FGFRL-Wnt circuits control AP patterning in planarians. (A) Expression domains of all identified mRGs along the planarian AP axis. Wnt pathway (purple), FGFRL (orange), and Hox genes (green). In bold, genes shown here to be involved in maintaining regional identity. (B) Cartoons summarize the characterized RNAi phenotypes. ndl-3 and wntP-2 restrict the number of pharynges and mouths in the trunk region. wntP-2 RNAi animals with ectopic pharynges/mouths have an expanded ndl-3 domain whereas ndl-3 RNAi animals with ectopic pharynges/mouths have a reduced wntP-2 expression domain. fz5/8-4, ndk, and wntA restrict the brain tissue to the head. Inhibition of these genes results in ectopic posterior eyes, brain expansion, and expanded domains of head mRGs. (C) Expression domains of the two FGFRL-Wnt circuits are shown. Black brackets indicate the region controlled by the FGFRL-Wnt circuits.