USOO7662929B2
(12) United States Patent (10) Patent No.: US 7,662.929 B2 BrOWn et al. (45) Date of Patent: Feb. 16, 2010
(54) ANTIBODY THAT SPECIFICALLY BINDS Owens et al. (Journal of Immunological Methods, 1994, 168:149 HYALURONAN SYNTHASE 165).* Bullard et al., “Hyaluronan Synthase-3 Is Upregulated in Metastatic (75) Inventors: Tracey J. Brown, Flemington (AU); Colon Carcinoma Cells and Manipulation of Expression Alters Gary R. Brownlee, East Burwood (AU) Matrix Retention and Cellular Growth.” Int. J. Cancer, 107(5):739 746, 2003. (73) Assignee: Alchemia. Oncology Pty Limited, Eight Hakanson et al., “Inhibition of hyaluronidase by serum in human Mile Plains (AU) cancer.” Chemical Abstracts Accession No. 43:15662 & J. Natl. Cancer Inst., 9:129-132, 1948. (Abstract Only). (*) Notice: Subject to any disclaimer, the term of this Nishida et al., “Antisense Inhibition of Hyaluronan Synthase-2 in patent is extended or adjusted under 35 Human Articular Chondrocytes Inhibits Proteoglycan Retention and Matrix Assembly.” J. Biological Chem., 274(31):21893-21899, Jul. U.S.C. 154(b) by 43 days. 1999. Simpson et al., “Manipulation of Hyaluronan Synthase Expression in (21) Appl. No.: 10/574,903 Prostate Adenocarcinoma Cells Alters Pericellular Matrix Retention and Adhesion to Bone Marrow Endothelial Cells,” J. Biological (22) PCT Filed: Oct. 11, 2004 Chem., 277 (12): 10050-10057, Mar. 2002. Simpson et al., “Inhibition of Prostate Tumor Cell Hyaluronan Syn (86). PCT No.: PCT/AU2OO4/OO1383 thesis Impairs Subcutaneous Growth and Vascularization in Immunocompromised Mice.” Am. J. Pathol. 161(3):849-857, Sep. S371 (c)(1), 2002. (2), (4) Date: Feb. 28, 2007 Ueki et al., “Inhibition of hyaluronan synthesis by vesnarinone in cultured human myofibroblasts.” Biochimica et Biophysica Acta, (87) PCT Pub. No.: WO2005/035548 1495(2):160-167, 2000. Zhang et al., “Glucocorticoids induce a near-total Suppression of PCT Pub. Date: Apr. 21, 2005 hyaluronan synthase mRNA in dermal fibroblasts and in osteoblasts: a molecular mechanism contributing to organ atrophy.” Biochemical (65) Prior Publication Data J., 349(Part 1):91-97, 2000. US 2007/0286856A1 Dec. 13, 2007 Chao, H. et al. (Jul. 29, 2005). “Natural Antisense mRNAS to Hyaluronan Synthase 2 Inhibit Hyaluronan Biosynthesis and Cell (30) Foreign Application Priority Data Proliferation.” Journal Biological Chemistry 280(30):27513-27522. International Search Report mailed May 30, 2007, for PCT Applica Oct. 10, 2003 (AU) ...... 2003905551 tion No. PCT/AU2007/000359, filed Mar. 23, 2007, three pages. Dec. 1, 2003 (AU) ...... 20039.06658 Udabage, L. et al. (2005). “The Over-Expression of HAS2, Hyal-2 and CD44 is Implicated in the Invasiveness of Breast Cancer.” (51) Int. Cl. Experimental Cell Research 310:205-217. C07K 6/00 (2006.01) Udabage, L. et al. (Jul. 15, 2005). "Antisense-Mediated Suppresion C07K 6/40 (2006.01) of Hyaluronan Synthase 2 Inhibits the Tumorigenesis and Progres A 6LX 39/395 (2006.01) sion of Breast Cancer.” Cancer Research 65(14):6139-6150. (52) U.S. Cl...... 530/388.26; 530/387.1; 530/387.9; 424/130.1; 424/139.1; 424/146.1 * cited by examiner (58) Field of Classification Search ...... None Primary Examiner Phillip Gambel See application file for complete search history. Assistant Examiner Sharon Wen (56) References Cited (74) Attorney, Agent, or Firm Morrison & Foerster LLP U.S. PATENT DOCUMENTS (57) ABSTRACT 5,994,100 A 11/1999 Zhu et al. 6,682,904 B1 1/2004 Frost 2002fO151026 A1* 10, 2002 Briskin ...... 435/200 Modulation of Hyaluronan (HA) synthesis and degradation is 2009.0068.186 A1 3/2009 Friedman et al. disclosed by compounds and compositions that are capable of reducing the level of hyaluronan synthase (HAS) or hyalu FOREIGN PATENT DOCUMENTS ronidase (HYAL) or the function or activity of HAS or HYAL. EP O 881 294 A2 12, 1998 The compounds and compositions can also inhibit the expres EP O881294 A2 12, 1998 sion of genetic material encoding these enzymes. The com JP 2002293740 A 10, 2002 pounds and compositions comprise nucleic acid molecules WO 974O174 A1 10, 1997 and interactive molecules Such as antibodies, Small molecule WO 98OO551 A2 1, 1998 inhibitors and substrate analogs of HAS and HYAL. The WO 98.00553 A1 1, 1998 compounds and compositions are useful in the prophylaxis WO 2004.003158 A2 1, 2004 and/or treatment of inflammatory disorders including hyper WO WO-2005/035548 A1 4/2005 proliferative conditions, such as but not limited to, cancer and WO WO-2007 112475 A1 10, 2007 psoriasis. OTHER PUBLICATIONS Falkenberget al. (J. Clin. Chem. Clin. Biochem. 1984, 22:867-882).* 5 Claims, 18 Drawing Sheets U.S. Patent Feb. 16, 2010 Sheet 1 of 18 US 7,662.929 B2
FIGURE 1
12
1 O ZZ HAS O HAS3
6
2 U.S. Patent Feb. 16, 2010 Sheet 2 of 18 US 7,662.929 B2
FIGURE 2
40 Panel A O 30 -A ASHAS2 -H Parental ? L 100 kDa 3. 20 r 2 10 O 3000 kDa SS O Yayyyyyy A. -0.2
PANEL B 18O
(M)- 160 S. 140 52 ge: 120 C 100 8 C 5. 80 a 60 o
S4. Ap 40 S 20 O Parental Mock ASHAS2 U.S. Patent Feb. 16, 2010 Sheet 3 of 18 US 7,662.929 B2
FIGURE 3
18 16 O parental 14 -V- mock 12 IC ASHAS2
10
n 2 U.S. Patent Feb. 16, 2010 Sheet 4 of 18 US 7,662.929 B2
FIGURE 4
500000
3OOOOO
2OOOOO
1OOOOO • *O mock um ASHAS2
O 24 48 72 96 120 144 Time (h) U.S. Patent Feb. 16, 2010 Sheet 5 of 18 US 7,662.929 B2
FIGURE 5
PANEL. A
Time (h)
40
-A - Control PANELB 20 -O- MOCK In ASHAS2 O
O 4 8 12 16 20 24 28 32 36 Time (h)
O2O30 O PANELC O 4, 8 12 16 2D 24, 28 32 36 Time (h) U.S. Patent Feb. 16, 2010 Sheet 6 of 18 US 7,662.929 B2
FIGURE 6
Parental Mock ASHAS2 U.S. Patent Feb. 16, 2010 Sheet 7 of 18 US 7,662.929 B2 FIGURE 7
1400 1200 --- Parental -A- Mock 1 O O O -One ASHAS2 800 600 400 200
1 OO
60
40
20
SE E.iss .. , BRAN KIDNEY LIVER LUNG Parental Mock ASHAS2 U.S. Patent Feb. 16, 2010 Sheet 8 of 18 US 7,662.929 B2 FIGURE 8
40
30 U.S. Patent Feb. 16, 2010 Sheet 9 of 18 US 7,662.929 B2 FIGURE 9
120
20
120
Breast cancer cell lines U.S. Patent Feb. 16, 2010 Sheet 10 of 18 US 7,662.929 B2
FIGURE 10
140
120
80
60
40
20
Parental Mock ASHAS2
U.S. Patent Feb. 16, 2010 Sheet 11 of 18 US 7,662.929 B2
FIGURE 11
18O 1111
O Parental Mock ASHAS2 U.S. Patent Feb. 16, 2010 Sheet 12 of 18 US 7,662.929 B2 FIGURE 12
U.S. Patent Feb. 16, 2010 Sheet 13 of 18 US 7,662.929 B2
FIGURE 13
2 O 24 48 72 96 120 144 Time (hours) U.S. Patent Feb. 16, 2010 Sheet 14 of 18 US 7,662.929 B2
FIGURE 14
10000 kDa
100 kDa
800 kDa | 0.2 0.4 0.6 0.8 1.O 1.2 Kav U.S. Patent Feb. 16, 2010 Sheet 15 of 18 US 7,662.929 B2
FIGURE 15
500000 A
400000 E E 300000 200000 g ( 100000
O 24, 48 72 96 120 144 Time (h) 24.68OOOO O
O 4, 8 12 16 20 24 28 32 36 Time (h)
100
O O
O 4 8 12 16 20 24 28 32 36 me
40 D 30
20
10
O
o 4 is 12 16 20 24 28 32 36 Time (h) U.S. Patent Feb. 16, 2010 Sheet 16 of 18 US 7,662.929 B2
FIGURE 16
120
G 100 () ) gg9 80 60
Eas Ea 40
5.C N 20
O Parental Mock ASHAS2 U.S. Patent Feb. 16, 2010 Sheet 17 of 18 US 7,662.929 B2 FIGURE 17
1400 A 1200 S 1000 MN 800 O 600 O-O-R 2 400 -(Af s MTN 200 O A O a-a-a-o.
O 2 4. 6 8 10 12 Weeks
100 af 2 10 B
E 1
SS 0.1
ss O.O1 s o s OOO1 Threshold O 0.00001 s 1.0x 109 U.S. Patent Feb. 16, 2010 Sheet 18 of 18 US 7,662.929 B2
FIGURE 18
100 10 1 0.1 0.01 O.001 Threshold O.OOO1 0.00001 O.OOOOO1 1.0x10-07
125 B
100
75
50
25
O O 50 100 150 200 Days elapsed following intracardiac US 7,662.929 B2 1. 2 ANTIBODY THAT SPECIFICALLY BINDS another with respect to temporal and differential expression HYALURONANSYNTHASE during different physiological processes and disease states. In work leading up to the present invention, it was observed CROSS-REFERENCE TO RELATED that HAS and HYAL are differentially expressed under vari APPLICATIONS ous physiological conditions. In particular, they were up This application is a National Phase application under 35 regulated during disease conditions such as an inflammatory U.S.C. S371 of International Application No. PCT/AU04/ condition or cancer. HAS, and in particular, HAS1, 2 and/or 3 0.1383, filed Oct. 11, 2004 and claims the benefit of Australian and HYAL1, 2 and/or 3 represent useful drug targets. Application Nos. 2003905551, filed Oct. 10, 2003 and 10 2003906658, filed Dec. 1, 2003. SUMMARY OF THE INVENTION BACKGROUND OF THE INVENTION Throughout the specification, unless the context requires otherwise, the word “comprise', or variations such as “com 1. Field of the Invention 15 prises' or “comprising, will be understood to imply the The present invention relates generally to the modulation inclusion of a stated element or integer or group of elements of hyaluronan (HA) synthesis and degradation. More particu or integers but not to the exclusion of any other element or larly, the present invention provides compositions and meth integer or group of elements or integers. ods for modulating the expression of genetic material encod ing HA synthase (HAS) and other enzymes or receptors Nucleotide and amino acid sequences are referred to by a primarily involved in hyaluronan metabolism; or modulating sequence identifier number (SEQID NO:). The SEQIDNOs: the proteins that synthesis or degrade hyaluronan including correspond numerically to the sequence identifiers <400>1 (SEQID NO:1), <400>2 (SEQID NO:2), etc. A summary of HAS function or activity. The compositions include or com the sequence identifier numbers is provided in Table 1. A prise nucleic acid molecules and interactive molecules Such sequence listing is provided after the claims. as antibodies and small molecule inhibitors and HAS sub 25 strate analogs. The present invention further contemplates The present invention is directed to compounds, such as modulation of cellular proliferation, useful in the prophylaxis nucleic acid and nucleic acid-like oligomer compounds or and/or treatment of inflammatory disorders including hyper complexes comprising same, which are targeted to a nucleic proliferative conditions, such as but not limited to, cancer and acid encoding HAS and/or HYAL a nucleic acid molecule psoriasis 30 required for or which facilitates expression of HAS and/or 2. Description of the Prior Art HYAL-encoding material as well as compounds such as inter Bibliographic details of the publications referred to in this active molecules including antibodies or recombinant or chi specification are also collected at the end of the description. meric or derivative forms thereof or small molecules which Reference to any prior art in this specification is not, and are specific for HAS and/or HYAL and which antagonize should not be taken as, an acknowledgment or any form of 35 HAS and/or HYAL function or activity. The nucleic acid and Suggestion that this prior art forms part of the general knowl nucleic acid-like oligomers or complexes comprising same, edge in any country. conveniently target to a nucleic acid encoding an isoform of Inflammatory conditions representa major causative factor HAS such as HAS1, HAS2 and/or HAS3. The nucleic acid in numerous medically significant disorders. Inflammation and nucleic acid-like oligomers or complexes comprising can result from a range of stimuli from outside or within the 40 same, conveniently target to a nucleic acid encoding an iso body. However, these stimuli trigger cells and physiological form of HYAL such as HYAL1, HYAL2, HYAL3 and/or processes within a host environment. Whilst a substantial PH-20. Preferred interactive molecules are antibodies such as amount of research has been undertaken to investigate the monoclonal or polyclonal antibodies. Pharmaceutical and cellular and cytokine nature of inflammatory processes, less other compositions comprising the compounds of the Subject is known about other possible participants in inflammation. 45 invention are also provided. Methods of screening for modu One such class of participants is transmembrane proteins. lators of HAS and HYAL gene expression in cells, tissues or Transmembrane proteins are involved in a range of signalling animals are also contemplated. Methods of treating an ani activities and many have enzymic activity. mal, particularly a human, Suspected of having or being prone Hyaluronan (HA) metabolism is an intricate balance to a disease or condition associated with HA levels or HAS between the rate of HA synthesis and degradation where 50 gene and HYAL gene expression are also set forth herein. depending upon the physiological role being played by the Such methods comprise administering a therapeutically or HA, the simultaneous synthesis and degradation is carefully prophylactically effective amount of one or more of the com controlled. Hyaluronan is synthesised by a family of distinct pounds or compositions of the present invention to the Subject yet related transmembrane proteins termed hyaluronan Syn of need of treatment or Suspected of needing prophylactic treatment. thase (HAS) isoforms HAS1, 2 and 3, which can be distin 55 guished from one another with respect to temporal and dif The present invention provides, therefore, in one embodi ferential expression during mouse embryogenesis and in ment, anti-sense, sense, siRNA, RNAi ribozymes and mature tissues, respectively and also in the molecular weight DNAZymes which selectively reduce directly or indirectly, of the HA produced. The extracellular matrix polysaccharide HAS and HYALgene expression. In another embodiment, the HA or its acidic form, hyaluronic acid, is a linear, high 60 present invention provides antibodies or Fab, chimeric molecular weight polymer comprised of repeating disaccha recombinant or derivative forms thereof. ride units of (B1-3) D-glucuronate-(B1-4)N-acetyl-D-glu Accordingly, one aspect of the present invention is directed cosamine (Weissman & Meyer, J. Am. Chem. Soc. 76: 1753, to an isolated compound capable of reducing the level of 1954). Hyaluronan is degraded by a family of enzymes hyaluronan synthase (HAS) or function or activity of HAS. known as hyaluronidases which are currently termed 65 Accordingly, one aspect of the present invention is directed to HYAL1, HYAL2, HYAL3 and PH-20, where like the an isolated compound capable of reducing the level of hyalu enzymes which produce HA are also distinguished from one ronidases (HYAL) or function or activity of HYAL. US 7,662.929 B2 3 4 transfected MDA-MB 231 (Panel F). Note the complete lack TABLE 1. of staining in the antisense transfected cells. FIG. 2 is a graphical representation of the characterization Summary of sequence identifiers of the molecular weigh of HA synthesised and differential SEQUENCE ID NO: DESCRIPTION expression of the hyaluronidase genes by parental, mock and HAS2 antisense transfected MDA-MB 231. A: Cells were 1 Sense primer for human HAS2 2 Antisense primer for human HAS2 seeded at 7.5x10 cells in 75 cm culture flasks and grown for 3 Primer for PCINeo 24 h in complete medium supplemented with 5 uCi of 4 Sense primer for GSP2 D-6-H-glucosamine hydrochloride. To determine the MW 5 Sense primer for GSP4 10 of H-HA in the medium, samples were subjected to size 6 Sense primer for HAS1 7 Antisense primer for HAS1 exclusion chromatography on a Sephacryl(R) 5-1000 SF 8 Sense primer for HAS2 eluted in 0.15M NaCl/phosphate pH 7.25 at 13.6 ml/h. This 9 Sense primer for HAS2 figure demonstrates the differences in molecular weight syn 10 Antisense primer for HAS2 thesized by parental MDA-MD 231 and their transfected 11 Sense primer for HAS2 15 12 Sense primer for HAS3 counterparts harbouring antisense mRNA to HAS2. B: Total 13 Antisense primer for HAS3 RNA extracted from parental, mock and ASHAS2 transfected 14 Sense primer for HAS3 MDA-MD 231 was analysed by RT-PCR to detect the levels 15 Sense primer for GAPDH of the hyaluronidase genes, notable HYAL-1, 2 and 3. PCR 16 Antisense primer for GAPDH products were resolved by agarose gel electrophoresis con 17 Sense primer for GAPDH 18 Sense primer for HYAL1 taining ethidium bromide. Stained gels were then subjected to 19 Antisense primer for HYAL1 densitometric analysis to allow comparison of levels for each 2O Sense primer HYAL2 HYAL gene between parental, mock and ASHAS2 trans 21 Antisense primer HYAL2 22 Sense primer HYAL3 fected cells. Note, both parental and mock-transfected MDA 23 Antisense primer HYAL3 MD 231 cells express comparable levels of both HYAL-1 and 24 Immunising peptide HAS418 25 2 but do not express HYAL-2. In contrast ASHAS2 trans 25 Immunising peptide HAS419 fected cells, HYAL-2 is not expressed whereas HYAL-3 was 26 Immunising peptide HAS421 detected and HYAL-1 was moderately increased in expres 27 Sense primer for HAS1 28 Sense primer for HAS2 S1O. 29 Sense primer for HAS3 FIG. 3 is a graphical representation of the quantification 30 Sense primer for GAPDH 30 and comparison HAS in parental, mock and ASHAS2 trans 31 Sense primer for HYAL1 fected MDA-MB 231. Cells were seeded at 2.5x10/cells in 32 Sense primer for HYAL2 33 Sense primer for HYAL3 25 cm culture flasks and incubated at 37°C. for 24h, 48 h, 72 34 Antisense primer for HAS1 h, 96 h, 120 h and 144 h. At each time points cells were 35 Antisense primer for HAS2 trypsinized and counted using an automated coulter counter. 36 Antisense primer for HAS3 35 HA concentration in the harvested culture medium was deter 37 Antisense primer for GAPDH 38 Antisense primer for HYAL1 mined using a hyaluronic acid binding protein (HABP) assay, 39 Antisense primer for HYAL2 with the standards and reaction buffer provided Corgenix Inc 40 Antisense primer for HYAL3 (Colorado, USA). HA synthesis by parental and mock trans 41 Hybridisation probe for HAS1 42 Hybridisation probe for HAS2 fected MDA-MB 231 was comparable over the duration of 43 Hybridisation probe for HAS3 40 the experiment. In contrast, HA synthesis was significantly 44 Hybridisation probe for GAPDH increased in ASHAS2 transfectants, where approximately 2 45 Sense primer for HAS2 to 7-fold more HA was liberated into the culture medium. 46 Antisense primter for HAS2 FIG. 4 is a graphical representation showing characterisa 47 Primer for pCL-neo 48 GSP2 sense primer tion of cell proliferation in parental, mock and ASHAS2 49 GSP4 sense primer 45 transfected MDA MB 231. Parental, mock and ASHAS2 50 Alu sense primer transfectants were harvested at approximately 80% conflu 51 Alu antisense primer ency and seeded in to 24-well plates at a cell density of 5x10 cells/well. The rate of cell growth was then followed for 24, 48,72, and 96 hours after plating. All cell counts were deter BRIEF DESCRIPTION OF THE FIGURES 50 mined using an automated Coulter counter. Whereas both parental and mock transfected MDA-MB 231 displayed FIG. 1 is a graphical and photographical representation of exponential cell growth until 72 hours where cells became Real time RT-PCR quantitation of mRNA expression of the confluent, the ASHAS2 transfected cells grew at a much HAS family and immunodetection of HAS2 in parental slower rate with an approximate lag period in cell doubling MDA-MB231 and antisense transfectants. A: Expression and 55 of 24 hours. quantification of mRNA for HAS2 in parental MDA-MB 231, FIG. 5 is a graphical representation of the effect of anti mock (pCIneo vector only) and stable clones of MDA sense inhibition of HAS2 on cell cycle. The transfected and MB-231 expressing antisense mRNA to HAS2 (ASHAS2). control cells were seeded at 2x10 cells/25 cm flask in the B: Expression and quantification of HAS1 and HAS3 in presence of 2 mM thymidine and grown until 50% confluent. parental, mock and ASHAS2 transfectants. C: Immunodetec 60 Cells were washed then returned to normal culture medium tion of HAS2 protein on parental MDA-MB 231 and, D: on and harvested, by trypsinisation, at the following time points; stable clones expressing antisense mRNA to HAS2. Photo Oh, 4 h, 8 h, 12 h, 16 h, 20h, 24 h, 28 h, 32 h, and 36 h then graphs of parental and ASHAS2 transfectants at 400x mag fixed in 95% w/v ethanol for 2 hat 4°C. Cells were pretreated nification. In parental cells note the periphery of the cell stains with 100 ug/mL RNAase (Sigma) and 50 lug/ml propidium positively for the HAS2 epitope (arrows) that is absent in the 65 iodide (Sigma) for 30 minutes at 37° C. before determining antisense transfected, Panel D, E and F: Immunoreactivity of the cell cycle stage in a FACS-CaliburTM analytical instru parental MDA MB 231 to CD44 (panel E) and antisense ment (Becton Dickinson, San Jose, Calif.). Panel A: popula US 7,662.929 B2 5 6 tion of cells in Go/G1; Panel B: in S phase, and PANELC: in were quantified by densitometry analysis using ProXpressTM G2/M phase. Note the delay of 24 hours of entry into S Imager and the data analysed using PhoretixTM 1D software. PHASE in the ASHAS2 MDA MB 231 transfectants. FIG. 10 are graphical and photographical representations FIG. 6 is the graphical representation of the effect of HAS2 of mRNA expression of the hyaluronan synthase family and inhibition on the migratory behaviour of the highly metastatic immunodetection of HAS2 in parental MDA-MB 231 and MDAMD 231 cell line. The migration rate of parental, mock antisense transfectants, respectfully. A: Total RNA was and antisense transfected cells was examined using the Boy extracted from exponentially dividing cultures of parental den chamber chemoinvasion assay as described in materials MDA-MB 231, mock transfectants and stable clones express and methods. Whereas parental and mock transfectants dis ing ASHAS2 mRNA. The level of mRNA for HAS2 was played 100% migration, cells harbouring antisense to HAS2 10 quantitated by real time RT-PCR. B: Immunodetection of HAS2 protein on stable clones expressing antisense mRNA to were inhibited in migration by 93%. HAS2 parental MDA-MB 231 and, C: on the parental MDA FIG. 7 is the graphical representation of the effect of anti MB 231 cell line. (Scale bar 20 um). sense HAS2 inhibition on the tumorgenicity and metastasis of FIG. 11 is a graphical representation comparing hyalu MDAMB231. A: Parental, mock and ASHAS2 transfectants 15 ronidase gene expression by parental, mock and HAS2 anti were inoculated into the mammary fat pad of nude mice. sense transfected MDA-MB 231. Total RNA extracted from Primary tumor growth was followed over a 12 week period parental, mock and ASHAS2 transfected MDA-MB 231 was following implantation after which the extent of metastasis to analysed by RT-PCR to detect the presence of the hyalu other organs detected using Alu PCR. Mice inoculated with ronidase genes, HYAL-1, 2 and 3. PCR products were parental or mock transfected MDA MB 231 readily estab resolved by agarose gel electrophoresis containing ethidium lished primary tumors which were comparable in growth over bromide. Band volume in stained gels was then subjected to the duration of the 12 week experiment. Mice inoculated with densitometric analysis to allow comparison of levels for each parental or mock transfected MDA MB 231 readily estab HYAL gene expression between parental, mock and lished primary tumors which were comparable in growth over ASHAS2 transfected cells. Closed bar: HYAL1; open bar. the duration of the 12 week experiment. In contrast, however, 25 HYAL2; diagonal hatched bar: HYAL3. Note: percentage mice inoculated with ASHAS2 transfectants did not establish variance between triplicate determinations <2%. primary tumors. B: Soft organ metastasis in mice inoculated FIG. 12 is a photographical representation showing Immu with parental, mock and antisense transfected MDAMD 231. nohistochemical reactivity of parental MDA-MB 231 and As assessed by Alu PCR, metastasis was most prevalent in antisense transfectants to CD44. Sub-confluent stable trans brain, and lung but was also detected in kidneys and the liver 30 fectants of MDA-MB 231 expressing antisense mRNA to in samples prepared from mice injected with either parental HAS2 (A), and (B) parental MDA-MB231 were reacted with or mock transfectant MDA-MD 231 cells. No metastasis an anti-human CD44. (Scale bar 20 um). could be found in the aforementioned organs in mice that FIG. 13 is a graphical representation of the quantification were injected with ASHAS2 transfectants. and comparison of hyaluronan synthesis in parental, mock FIG. 8 is a diagrammatic representation demonstrating 35 and ASHAS2 transfected MDA-MB 231. Cells were seeded HAS 2 and HAS3 liberate high molecular weight HA which at 2.5x10/cells in 25 cm culture flasks and incubated at 37° is rapidly depolymerised. MDA-MB 231 cells were seeded at C. for 24, 48, 72.96, 120 and 144 h. At each time point cells 7.5x10 cells/75 cm culture flaskand were grown for 24h in were trypsinized and quantitated using an automated coulter growth media containing +400 ug/ml DS and 250 uCi counter. HA concentration in the harvested culture medium D-6-Hlglucosamine. At the conclusion of the incubation, 40 was determined using a hyaluronic acid binding protein the media and cell-associated HA was removed and dialysed (HABP) assay. HA synthesis by parental and mock trans (M, exclusion of 5 kDa). After substantiation that the non fected MDA-MB 231 was expressed as HA synthesised (pg/ dialysable Dpm was HA (as determined by Streptomyces cell). Data represent the average of triplicate determinations hyaluronidase digestion) it was Subjected to size exclusion at each time point-tSD. A-A: parental MDA-MB 231; O-O: chromatography in a Sephacryl S-1000 gel eluted in 0.15M 45 mock transfectants; -: ASHAS2 transfectants. NaCl/phosphate buffer, pH 7.25 at 13.6 ml/h. Differences in FIG. 14 is a graphical representation of the characterisation the M of liberated (FIGS. 1A, C, E & G) and cell-associated of the molecular weight of HA synthesised by parental and HA (FIGS. 1B, D, F & G) was determined in the following MDA-MB 231 stable transfectants harbouring ASHAS2. cell line: (FIGS. 1A, B) MDA-MB 453 cell line, (FIGS. 1C, Cells were seeded at 7.5x10 cells in 75 cm culture flasks and D) MDA-MB 231, (FIGS. 1E, F) BT-549 and (FIGS. 1G, H) 50 grown for 24h in complete medium supplemented with 250 Hs578T. To qualitate the HA produced by the cell lines cul uCi of D-6-H-glucosamine hydrochloride. To determine tures were treated with 400 ug/ml dextran sulphate (O-O) and the MW of H-HA in the medium, samples were subjected to for the identification of HA degradation products the cultures size exclusion chromatography on a Sephacryl S-1000 SF did not contain dextran Sulphate (o-o). eluted in 0.15M NaCl/phosphate pH 7.25 at 13.6 ml/h. This FIG. 9 is a diagrammatic representation demonstrating 55 figure demonstrates the differences in molecular weight syn comparison of the invasive potential of human breast cancer thesised by parental MDA-MB 231 and their transfected cell lines and HA receptors. The invasive potential of the counterparts harbouring antisense mRNA to HAS2. Eluted breast cell lines (*-*) were examined using the Boyden cham fractions were proven to be HA as determined by Streptomy ber chemoinvasion assay as described in Materials and Meth ces hyaluronidase digestion. (O-O: parental cell line; O-O: ods. The cells that had traversed the matrigel and spread on 60 ASHAS2 MDA-MBA 231 stable transfectants) the lower surface of the filter were expressed as a percentage FIG. 15 is a graphical representation showing the effect of of the cell count determined for the HS578T cell line. The data antisense inhibition of HAS2 on cell proliferation and cell presented represents the mean SD average of triplicate cycle in parental, mock and ASHAS2 transfected MDA-MB experiments performed on two separate days. Note: percent 231. A: Parental, mock and ASHAS2 transfectants were har age variance between triplicate determinations <2%. Quan 65 vested at approximately 80% confluency and seeded in to titation of HA receptors (A) CD44 and (B) RHAMM was 24-well plates at a cell density of 5x10 cells/well (2.5 cm). determined by immunoblotting where immunoreactive bands The rate of cell growth was then followed for 24, 48, 72, and US 7,662.929 B2 7 8 96 h after plating. All cell counts were determined using an any molecule with the same function. In a preferred aspect, automated Coulter counter. Data represents the average of reference to “HAS’, includes reference to the isoforms triplicate determinations at each time point-SD. : ASHAS2 HAS1, HAS2 or HAS3. In a particularly preferred embodi stable transfectants; A: parental cell line; O: mock transfec ment, the HAS is HAS2 or HAS3. The present invention also tants. Note: percentage variance between triplicate determi employs compounds, preferably nucleotides and similar spe nations <2%. B: The transfected and control cells were cies for use in modulating the function of HYAL or the seeded at 2x10 cells/25 cm flask in the presence of 2 mM expression of nucleic acid molecules encoding HYAL and, in thymidine and grown until 50% confluent. Cells were har a particular embodiment, HYAL1, HYAL2, HYAL3 and/or Vested and the proportion of cells in a particular cell cycle PH-20 of a nucleic acid molecule required for or which facili stage was then determined in a FACS-CaliburTM analytical 10 tate expression of HYAL genetic material (e.g. a promoter instrument. B: population of cells in Go/G1:C: in S phase, and region). As used herein, reference to HYAL includes any D: in G/M phase. Note: the delay in 24 hours of entry into S molecule with the same function. In a preferred aspect, ref phase in the ASHAS2 MDA-MB 231 transfectants. : erence to “HYAL', includes reference to the isoforms ASHAS2 stable transfectants; A: parental cell line; O: mock HYAL1, HYAL2, HYAL3 and/or PH-20. In a particularly transfectants. 15 preferred embodiment, the HYAL is HYAL1, HYAL2 or FIG.16 is graphical representation showing inhibition of in HYAL3. vitro invasiveness of MDA-MB 231 expressing antisense Accordingly, one aspect of the present invention provides mRNA to HAS2. The invasive potential of parental MDA an isolated compound capable of reducing the level of hyalu MB 231, mock (vector only) and antisense HAS2 transfected roman synthase (HAS) and/or hyaluronidase or the function or cells were examined using the Boyden chamber chemoinva activity of HAS and or HYAL. sion assay. The cells that had traversed the matrigel and In one embodiment, the compounds of the present inven spread on the lower surface of the filter were expressed as a tion down regulate expression of HAS and HYAL genetic percentage of the cell count determined for the parental material. This is accomplished by providing oligonucleotides MDA-MB 231 cell line. The data presented represent the which specifically hybridize or otherwise interact with one or average of triplicate experiments performed on two separate 25 more nucleic acid molecules encoding HAS and/or HYAL or days tSD. Note: percentage variance between triplicate a nucleic acid molecule required for or which facilitates HAS determinations <2%. and/or HYAL gene expression. As used herein, the terms FIG. 17 is a graphical representation showing the effect of “nucleic acid' and “nucleic acid molecule encoding HAS or HAS2 antisense inhibition on the tumorgenicity and metasta HYAL have been used for convenience to encompass DNA sis in MDA-MB 231. A: Parental, mock and ASHAS2 trans 30 encoding HAS, RNA (including pre-mRNA and mRNA or fectants were inoculated into the mammary fat pad of nude portions thereof) transcribed from such DNA, and also cDNA mice. Primary tumor growth was followed over a 12-week derived from such RNA. The hybridization or interaction of a period with tumour progression recorded twice weekly. The compound of the present invention with a target nucleic acid results graphed represent the average tumor volume (mm) may encompass antisense or sense targeting. The latter is +SEM, where n=9-13. B: Alu PCR was utilised to determine 35 referred to herein as sense Suppression. Consequently, the the extent of Soft organ metastasis from brain, kidney, liver present invention provides for antisense or sense inhibition. and lung. Results are expressed as the percentage of human Such antisense or sense inhibition is typically based upon tumour DNA in mouse soft organs, n=8 per group. hydrogen bonding-based hybridization of oligonucleotide FIG. 18 is a graphical representation showing the effect of Strands or segments such that at least one strand or segment is HAS2 antisense inhibition on the metastasis and in animal 40 cleaved, degraded, or otherwise rendered inoperable. Alter survival. A: Alu PCR was utilised to determine the extent of natively, post-transcriptional gene silencing (PTGS) may be Soft organ metastasis after intracardiac inoculation of nude achieved using sense Suppression (formally known as co mice from brain, kidney, liver, lung and bone. Results are Suppression). In yet another alternative, complexes compris expressed as the percentage of human tumour DNA in mouse ing nucleic acid molecules and proteins (e.g. ribonucleases) Soft organs, n=9 per group. No metastasis to these organs 45 such as RNAi ribozymes and DNAZymes may be employed. could be detected where animals had been inoculated with The target nucleic acid molecules include the HAS and MDA-MB 231 ASHAS2 transfected cells. B: Survival rate of HYAL coding sequences, a promoter region, a 3' regulatory the parental, mock and ASHAS2 transfectants mice were region or a nucleotide sequence, the expression of which, plotted using Prism stats program (Kaplan-Meier Survival) facilitates or inhibits HAS or HYAL gene expression (e.g. a with the days elapsed following intracardiac inoculations. 50 regulatory gene, activator gene or reporter gene). There were no different in the animal survival rate (P=0.0840) The functions of the nucleic acid molecule to be down between the parental and mock transfected mice. Survival regulated include replication, transcription and/or transla curve for ASHAS2 was significantly different (P<0.0001) tion. Where the nucleic acid molecule is RNA, the com from the both control groups. MDA-MB 231 ASHAS2 trans pounds may target translocation of the RNA to a site of fectants (Solid); parental cell line (short dash); mock trans 55 protein translation, translocation of the RNA to sites within fectants (long dash). the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to DETAILED DESCRIPTION OF THE PREFERRED yield one or more RNA species, and catalytic activity or EMBODIMENTS complex formation involving the RNA which may be 60 engaged in or facilitated by the RNA. One preferred result of The present invention employs compounds, preferably Such interference with target nucleic acid function is reduc nucleotides and similar species for use in modulating the tion in the level of expression of HAS and/or HYAL genetic function of HAS or the expression of nucleic acid molecules material and, hence, levels of HAS and/or HYAL. Inhibition encoding HAS and, in a particular embodiment, HAS1, is the preferred form of modulation of expression and mRNA HAS2 and/or HAS3 or of a nucleic acid molecule required for 65 is the preferred target nucleic acid. or which facilitate expression of HAS genetic material (e.g. a In the context of this invention, “hybridization” means the promoter region). As used herein, reference to HAS includes pairing of complementary strands of nucleic acids. In the US 7,662.929 B2 10 present invention, the preferred mechanism of pairing with complementary nucleotides and need not be contiguous involves hydrogen bonding, which may be Watson-Crick, to each other or to complementary nucleotides. As such, an Hoogsteen or reversed Hoogsteen hydrogen bonding, antisense or sense compound which is 18 nucleotides in between complementary nucleoside or nucleotide bases length having 4 (four) noncomplementary nucleotides which (nucleotides) of the strands of oligomeric compounds. For are flanked by two regions of complete complementarity with example, adenine and thymine are complementary nucle the target nucleic acid would have 77.8% overall complemen otides which pair through the formation of hydrogen bonds. tarity with the target nucleic acid and would thus fall within Hybridization can occur under varying circumstances. the scope of the present invention. Percent complementarity An antisense or sense compound is specifically hybridiz of an antisense or sense compound with a region of a target able when binding of the compound to the target nucleic acid 10 nucleic acid can be determined routinely using BLAST pro interferes with the normal function of the target nucleic acid grams (basic local alignment search tools) and PowerBLAST to cause a loss of activity, and there is a Sufficient degree of programs known in the art (Altschulet al., J. Mol. Biol. 215: complementarity to avoid non-specific binding of the anti 403-410, 1990; Zhang and Madden, Genome Res. 7: 649-656, sense or sense compound to non-target nucleic acid 1997). sequences under conditions in which specific binding is 15 According to the present invention, compounds include desired, i.e., under physiological conditions in the case of in antisense or sense nucleic acids, antisense or sense oligo Vivo assays or therapeutic treatment, and under conditions in meric compounds, antisense or sense oligonucleotides, which assays are performed in the case of in vitro assays. ribozymes, sense oligonucleotides, full-length sense mol A sense compound includes RNAi or other complex which ecules, external guide sequence (EGS) oligonucleotides, includes PTGS. alternate splicers, primers, probes, and other oligomeric com In the present invention the phrase “stringent hybridization pounds which hybridize to at least a portion of the target conditions” or “stringent conditions' refers to conditions nucleic acid. As such, these compounds may be introduced in under which a compound of the invention will hybridize to its the form of single-stranded, double-stranded, circular or hair target sequence, but to a minimal number of other sequences. pin oligomeric compounds and may contain structural ele Stringent conditions are sequence-dependent and will be dif 25 ments such as internal or terminal bulges or loops. Once ferent in different circumstances and in the context of this introduced to a system, the compounds of the invention may invention, “stringent conditions’ under which oligomeric elicit the action of one or more enzymes or structural proteins compounds hybridize to a target sequence are determined by to effect modification of the target nucleic acid. the nature and composition of the oligomeric compounds and As used herein, an “antisense' or “sense' molecule the assays in which they are being investigated. 30 includes an RNA molecule which, by binding to a comple “Complementary,” as used herein, refers to the capacity for mentary sequence in either RNA or DNA, inhibits the func precise pairing between two nucleotides of an oligomeric tion and/or completion of synthesis of the latter molecule. It is compound. For example, if a nucleotide at a certain position involved in various regulatory systems in vivo. Artificial anti of an oligonucleotide (an oligomeric compound), is capable sense or sense RNAs have been used to inhibit translation of of hydrogen bonding with a nucleotide at a certain position of 35 specific mRNA molecules both in living cells (eukaryotic and a target nucleic acid, said target nucleic acid being a DNA, bacterial) and in cell-free systems. RNA, or oligonucleotide molecule, then the position of One non-limiting example of such an enzyme is RNASe H. hydrogen bonding between the oligonucleotide and the target a cellular endonuclease which cleaves the RNA strand of an nucleic acid is considered to be a complementary position. RNA:DNA duplex. It is known in the art that single-stranded The oligonucleotide and the further DNA, RNA, or oligo 40 antisense or sense compounds which are “DNA-like' elicit nucleotide molecule are complementary to each other when a RNAse H. Activation of RNase H, therefore, results in cleav Sufficient number of complementary positions in each mol age of the RNA target, thereby greatly enhancing the effi ecule are occupied by nucleotides which can hydrogen bond ciency of oligonucleotide-mediated inhibition of gene with each other. Thus, “specifically hybridizable' and expression. Similar roles have been postulated for other ribo “complementary are terms which are used to indicate a 45 nucleases such as those in the RNase III and ribonuclease L Sufficient degree of precise pairing or complementarity overa family of enzymes. sufficient number of nucleotides such that stable and specific binding occurs between the oligonucleotide and a target While the preferred form of antisense or sense compounds nucleic acid. are single-stranded oligonucleotides, in many species the It is understood in the art that the sequence of an antisense 50 introduction of double-stranded structures, such as double or sense compound need not be 100% complementary to that stranded RNA (dsRNA) molecules, miRNAs, short-interfer of its target nucleic acid to be specifically hybridizable. More ing RNA molecules (siRNA) and full-length dsRNAs. over, an oligonucleotide may hybridize over one or more Small interfering RNAs (siRNAs) have an integral role in segments such that intervening or adjacent segments are not the phenomenon of RNA interference (RNAi). In RNAi dsR involved in the hybridization event (e.g., a loop structure or 55 NAS introduced into certain organisms or cells are degraded hairpin structure). It is preferred that the antisense or sense into approximately 22 nucleotide fragments. These 22 nucle compounds of the present invention comprise at least 70% otide siRNA molecules then bind to the complementary por sequence complementarity to a target region within the target tion of their target mRNA and tag it for degradation. nucleic acid, such as 71, 72,73, 74, 75,76, 77,78, 79,80, 81, A second class of regulatory small RNAs contemplated by 82, 83, 84,85, 86, 87, 88, 89,90,91, 92,93,94, 95, 96, 97,98, 60 the present invention are referred to as small temporal RNAs. 99 or 100% complementarity to the nucleic acid sequence to Approximately 22 nucleotide lin-4 and let-7 RNAs are which they are targeted. For example, an antisense or sense example of this group. These RNA molecules have a role in compound in which 18 out of 20 nucleotides of the antisense temporal regulation of C. elegans development. These are or sense compound are complementary to a target region, and initially processed from an approximate 70 nucleotide would therefore specifically hybridize, would represent 90 65 ssRNA transcript folded into a stem loop structure. After percent complementarity. In this example, the remaining non processing, these stRNAS are thought to prevent translation of complementary nucleotides may be clustered or interspersed their target mRNAS by binding to the targets complementary US 7,662.929 B2 11 12 3' untranslated regions (UTRs). Dicer, RNAase enzyme pro that comprise at least the 10 consecutive nucleotides from the cesses both the types of RNAs (Grishok et al. Science 287 3'-terminus of one of the illustrative preferred antisense or (562):2494-2497, 2000). sense compounds (the remaining nucleotides being a con In the context of this invention, the term "oligomeric com secutive stretch of the same oligonucleotide beginning imme pound” refers to a polymer or oligomer comprising a plurality diately downstream of the 3'-terminus of the antisense or of monomeric units. In the context of this invention, the term sense compound which is specifically hybridizable to the "oligonucleotide' refers to an oligomer or polymer of ribo target nucleic acid and continuing until the oligonucleotide nucleic acid (RNA) or deoxyribonucleic acid (DNA) or contains about 10 to about 2000 nucleotides). One having mimetics, chimeras, analogs and homologs thereof. This term skill in the art armed with the preferred antisense or sense includes oligonucleotides composed of naturally occurring 10 compounds illustrated herein will be able, without undue nucleotides, Sugars and covalent internucleoside (backbone) experimentation, to identify further preferred antisense or linkages as well as oligonucleotides having non-naturally sense compounds. occurring portions which function similarly. Such modified Candidate compounds are also referred to herein as “lead or substituted oligonucleotides are often preferred overnative compounds. In the present invention, the target nucleic acid forms because of desirable properties such as, for example, 15 encodes HAS or HYAL or is a gene required for HAS or enhanced cellular uptake, enhanced affinity for a target HYAL gene expression. As indicated above, the term “HAS’ nucleic acid and increased Stability in the presence of includes isoforms HAS1, HAS2 and HAS3. HAS2 and HAS3 nucleases. are particularly preferred. As indicated above, the term While oligonucleotides are a preferred form of the com “HYAL includes isoforms HYAL1, HYAL2, HYAL3 and pounds of this invention, the present invention comprehends PH-20. HYAL1, HYAL2 and HYAL3 are particularly pre other families of compounds as well, including but not lim ferred. ited to oligonucleotide analogs and mimetics Such as those The targeting process usually also includes determination herein described. of at least one target region, segment, or site within the target The compounds in accordance with this invention prefer nucleic acid for the antisense or sense interaction to occur ably comprise from about 10 to about 2000 nucleotides (i.e. 25 Such that the desired effect, e.g., to reduce expression, will from about 10 to about 2000 linked nucleosides). One of result. Within the context of the present invention, the term ordinary skill in the art will appreciate that the invention “region' is defined as a portion of the target nucleic acid embodies compounds of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. having at least one identifiable structure, function, or charac 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, teristic. Within regions of target nucleic acids are segments. 37,38,39, 40, 41, 42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53, 30 'Segments' are defined as Smaller or Sub-portions of regions 54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65,66, 67,68, 69,70, within a target nucleic acid. “Sites, as used in the present 71, 72,73, 74, 75, 76, 77,78, 79,80, 90, 100, 110, 120, 130, invention, are defined as positions within a target nucleic acid. 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, Since, as is known in the art, the translation initiation codon 260, 270, 280,290, 300, 310,320, 330, 340,350, 360, 370, is typically 5'-AUG (in transcribed mRNA molecules: 380,390, 400, 410, 420, 430,440, 450, 460, 470, 480, 490, 35 5'-ATG in the corresponding DNA molecule), the translation 500,510,520, 530, 540, 550,560,570, 580,590, 600, 610, initiation codon is also referred to as the AUG codon, the 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, “start codon’ or the AUG start codon’. A minority of genes 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, have a translation initiation codon having the RNA sequence 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1080, 40 5'-CUG have been shown to function in vivo. Thus, the terms 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, “translation initiation codon’ and “start codon’ can encom 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, pass many codon sequences, even though the initiator amino 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, acid in each instance is typically methionine (in eukaryotes). 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, It is also known in the art that eukaryotic genes may have two 1490, 1500, 1510, 1520, 1530, 1540, 1550, 1560, 1570, 1580, 45 or more alternative start codons, any one of which may be 1590, 1600, 1610, 1620, 1630, 1640, 1650, 1660, 1670, 1680, preferentially utilized for translation initiation in a particular 1690, 1700, 1710, 1720, 1730, 1740, 1750, 1760, 1770, 1780, cell type or tissue, or under a particular set of conditions. In 1790, 1800, 1810, 1820, 1830, 1840, 1850, 1860, 1870, 1880, the context of the invention, “start codon and “translation 1890, 1900, 1910, 1920, 1930, 1940, 1950, 1960, 1970, 1980, initiation codon” refer to the codon or codons that are used in 1990 or 2000 nucleotides in length. 50 vivo to initiate translation of an mRNA transcribed from a Antisense or sense compounds 10-2000 nucleotides in gene encoding HAS, regardless of the sequence(s) of Such length comprising a stretch of at least ten (10) Such as 10, 11, codons. It is also known in the art that a translation termina 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, tion codon (or 'stop codon) of a gene may have one of three 29 or 30 consecutive nucleotides selected from within the sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corre illustrative antisense or sense compounds are considered to be 55 sponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, Suitable antisense or sense compounds as well. respectively). Exemplary preferred antisense or sense compounds The terms “start codon region' and “translation initiation include oligonucleotide sequences that comprise at least the codon region” refer to a portion of such an mRNA or gene that 10 consecutive nucleotides from the 5'-terminus of one of the encompasses from about 25 to about 50 contiguous nucle illustrative preferred antisense or sense compounds (the 60 otides in either direction (i.e., 5' or 3') from a translation remaining nucleotides being a consecutive stretch of the same initiation codon. Similarly, the terms "stop codon region' and oligonucleotide beginning immediately upstream of the “translation termination codon region” refer to a portion of 5'-terminus of the antisense or sense compound which is Such an mRNA or gene that encompasses from about 25 to specifically hybridizable to the target nucleic acid and con about 50 contiguous nucleotides in either direction (i.e., 5' or tinuing until the oligonucleotide contains about 10 to about 65 3') from a translation termination codon. Consequently, the 2000 nucleotides). Similarly preferred antisense or sense “start codon region’ (or “translation initiation codon region') compounds are represented by oligonucleotide sequences and the 'stop codon region’ (or “translation termination US 7,662.929 B2 13 14 codon region') are all regions which may be targeted effec are known as “alternative stop variants” of that pre-mRNA or tively with the antisense or sense compounds of the present mRNA. One specific type of alternative stop variant is the invention. "polyA variant” in which the multiple transcripts produced The open reading frame (ORF) or “coding region.” which result from the alternative selection of one of the “polyA stop is known in the art to refer to the region between the transla signals' by the transcription machinery, thereby producing tion initiation codon and the translation termination codon, is transcripts that terminate at unique polyA sites. Within the also a region which may be targeted effectively. Within the context of the invention, the types of variants described herein context of the present invention, a preferred region is the are also preferred target nucleic acids. intragenic region encompassing the translation initiation or The locations on the target nucleic acid to which the pre termination codon of the open reading frame (ORF) of a gene. 10 ferred antisense or sense compounds hybridize are hereinbe Other target regions include the 5' untranslated region low referred to as “preferred target segments.” As used herein (5' UTR), known in the art to refer to the portion of an mRNA the term “preferred target segment' is defined as at least a in the 5' direction from the translation initiation codon, and 10-nucleotide portion of a target region to which an active thus including nucleotides between the 5' cap site and the antisense or sense compound is targeted. While not wishingto translation initiation codon of an mRNA (or corresponding 15 be bound by theory, it is presently believed that these target nucleotides on the gene), and the 3' untranslated region segments represent portions of the target nucleic acid which (3'UTR), known in the art to refer to the portion of an mRNA are accessible for hybridization. in the 3' direction from the translation termination codon, and While the specific sequences of certain preferred target thus including nucleotides between the translation termina segments are set forth herein, one of skill in the art will tion codon and 3' end of an mRNA (or corresponding nucle recognize that these serve to illustrate and describe particular otides on the gene). The 5' cap site of a mRNA comprises an embodiments within the scope of the present invention. Addi N7-methylated guanosine residue joined to the 5'-most resi tional preferred target segments may be identified by one due of the mRNA via a 5'-5' triphosphate linkage. The 5' cap having ordinary skill. region of an mRNA is considered to include the 5' cap struc Target segments 10-2000 nucleotides in length comprising ture itself as well as the first 50 nucleotides adjacent to the cap 25 a stretch of at least ten (10) consecutive nucleotides selected site. It is also preferred to target the 5' cap region. from within the illustrative preferred target segments are con Although some eukaryotic mRNA transcripts are directly sidered to be suitable for targeting as well. translated, many contain one or more regions, known as Target segments can include DNA or RNA sequences that “introns, which are excised from a transcript before it is comprise at least the 8 consecutive nucleotides from the translated. The remaining (and therefore translated) regions 30 5'-terminus of one of the illustrative preferred target segments are known as “exons' and are spliced together to form a (the remaining nucleotides being a consecutive stretch of the continuous mRNA sequence. Targeting splice sites, i.e., same DNA or RNA beginning immediately upstream of the intron-exonjunctions or exon-intronjunctions, may also be 5'-terminus of the target segment and continuing until the particularly useful in situations where aberrant splicing is DNA or RNA contains about 10 to about 2000 nucleotides). implicated in disease, or where an overproduction of a par 35 Similarly preferred target segments are represented by DNA ticular splice product is implicated in disease. Aberrant fusion or RNA sequences that comprise at least the 10 consecutive junctions due to rearrangements or deletions are also pre nucleotides from the 3'-terminus of one of the illustrative ferred target sites. mRNA transcripts produced via the pro preferred target segments (the remaining nucleotides being a cess of splicing of two (or more) mRNAs from different gene consecutive stretch of the same DNA or RNA beginning Sources are known as “fusion transcripts”. It is also known 40 immediately downstream of the 3'-terminus of the target seg that introns can be effectively targeted using antisense or ment and continuing until the DNA or RNA contains about 10 sense compounds targeted to, for example, DNA or pre to about 2000 nucleotides). One having skill in the art armed mRNA. with the preferred target segments illustrated herein will be It is also known in the art that alternative RNA transcripts able, without undue experimentation, to identify further pre can be produced from the same genomic region of DNA. 45 ferred target segments. These alternative transcripts are generally known as “vari Once one or more target regions, segments or sites have ants. More specifically, “pre-mRNA variants’ are transcripts been identified, antisense or sense compounds are chosen produced from the same genomic DNA that differ from other which are sufficiently complementary to the target, i.e., transcripts produced from the same genomic DNA in either hybridize sufficiently well and with sufficient specificity, to their start or stop position and contain both intronic and 50 give the desired effect, i.e. to reduce HAS and/or HYALgene exonic sequence. expression or levels of HAS and/or HYAL. Upon excision of one or more exon or intron regions, or In a further embodiment, the “preferred target segments' portions thereofduring splicing, pre-mRNA variants produce identified herein may be employed in a screen for additional smaller “mRNA variants”. Consequently, mRNA variants are compounds that modulate the expression of the HAS and/or processed pre-mRNA variants and each unique pre-mRNA 55 HYAL gene. “Modulators' are those compounds that variant must always produce a unique mRNA variant as a decrease or increase the expression of a nucleic acid molecule result of splicing. These mRNA variants are also known as encoding HAS and/or HYAL and which comprise at least a “alternative splice variants”. If no splicing of the pre-mRNA 10-nucleotide portion which is complementary to a preferred variant occurs then the pre-mRNA variant is identical to the target segment. The screening method comprises the steps of mRNA variant. 60 contacting a preferred target segment of a nucleic acid mol It is also known in the art that variants can be produced ecule encoding HAS and/or HYAL with one or more candi through the use of alternative signals to start or stop transcrip date modulators, and selecting for one or more candidate tion and that pre-mRNAs and mRNAs can possess more that modulators which decrease or increase the expression of a one start codon or stop codon. Variants that originate from a nucleic acid molecule encoding HAS and/or HYAL. Once it pre-mRNA or mRNA that use alternative start codons are 65 is shown that the candidate modulator or modulators are known as “alternative start variants” of that pre-mRNA or capable of modulating (e.g. either decreasing or increasing) mRNA. Those transcripts that use an alternative stop codon the expression of a nucleic acid molecule encoding HAS US 7,662.929 B2 15 16 and/or HYAL the modulator may then be employed in further Reference to an “antibody” or “antibodies' includes refer investigative studies of the function of HAS and/or HYAL, or ence to all the various forms of antibodies, including but not for use as a research, diagnostic, ortherapeutic agent in accor limited to: full antibodies (e.g. having an intact Fc region), dance with the present invention. including, for example, monoclonal antibodies; antigen The preferred target segments of the present invention may binding antibody fragments, including, for example, Fv, Fab, be also be combined with their respective complementary Fab' and F(ab')2 fragments; humanized antibodies; human antisense or sense compounds of the present invention to antibodies (e.g., produced in transgenic animals or through form stabilized double-stranded (duplexed) oligonucleotides. phage display); and immunoglobulin-derived polypeptides Such double stranded oligonucleotide moieties have been produced through genetic engineering techniques. Unless shown in the art to modulate target expression and regulate 10 otherwise specified, the terms “antibody' or “antibodies' and translation as well as RNA processsing via an antisense or as used herein encompasses both full antibodies and antigen sense mechanism. Moreover, the double-stranded moieties binding fragments thereof. may be subject to chemical modifications (Fire et al., Nature Unless Stated otherwise, specificity in respect of an anti 391: 806-811, 1998; Timmons and Fire, Nature 395: 854, body of the present invention is intended to mean that the 1998; Timmons et al., Gene 263: 103-112, 2001; Tabara et al., 15 antibody binds Substantially only to its target antigen with no Science 282: 430-431, 1998; Montgomery et al., 1998, supra; appreciable binding to unrelated proteins. However, it is pos Tuschlet al., Genes Dev. 13:3191-3197, 1999: Elbashiret al., sible that an antibody will be designed or selected to bind to Nature, 411: 494-498, 2001: Elbashir et al., Genes Dev. 15: two or more related proteins. A related protein includes dif 188-200, 2001). For example, such double-stranded moieties ferent splice variants or fragments of the same protein or have been shown to inhibit the target by the classical hybrid homologous proteins from different species. Such antibodies ization of antisense or sense strand of the duplex to the target, are still considered to have specificity for those proteins and thereby triggering enzymatic degradation of the target (Tijs are encompassed by the present invention. The term 'substan terman et al., 2002, Supra). tially” means in this context that there is no detectable binding As indicated above, the present invention further contem to a non-target antigen above basal, i.e. non-specific, levels. plates interactive molecules specific for a HAS, including one 25 The antibodies of the present invention may be prepared by or more of HAS1, 2 and/or 3 and which modify HAS function well known procedures. See, for example, Monoclonal Anti or activity. As indicated above, the present invention further bodies, Hybridomas: A New Dimension in Biological Analy contemplates interactive molecules specific for a HYAL, ses, Kennet et al. (eds.), Plenum Press, New York (1980); and including one or more of HYAL1, HYAL2, HYAL3 and/or Antibodies: A Laboratory Manual, Harlow and Lane (eds.), PH-20 and which modify HYAL function or activity. 30 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, The present invention provides, therefore, antagonists of N.Y., (1988). HAS and/or HYAL function or activity. Such antagonists are One method for producing an antibody of the present useful in reducing the effects of HAS and/or HYAL and hence invention comprises immunizing a non-human animal. Such reducing or elevating levels of HA. as a mouse or a transgenic mouse, with HAS and/or HYAL The term “antagonist' includes a modified HAS and/or 35 molecule or immunogenic parts thereof whereby antibodies HYAL molecule or HAS and/or HYAL substrate as well as directed against the HAS and/or HYAL molecule or immu their homologs or chemical equivalent or analogs. In a pre nogenic parts are generated in said animal. Various means of ferred embodiment, it encompasses interactive molecules increasing the antigenicity of a particular immunogen, Such Such as antibodies and Small molecule inhibitors. as administering adjuvants or conjugated antigens, compris 40 ing the antigen against which an antibody response is desired The present invention provides, therefore, interactive mol and another component, are well known to those in the art and ecules Such as but not limited to antibodies and other immu may be utilized. Immunizations typically involve an initial noglobulins including fragments, derivatives, antigen bind immunization followed by a series of booster immunizations. ing portions, recombinant forms, chimeric forms as well as Animals may be bled and the serumassayed for antibody titer. deimmunized including humanized forms thereof directed to 45 Animals may be boosted until the titer plateaus. Conjugates the subject modulators and small molecule inhibitors. may be made in recombinant cell culture as protein fusions. Accordingly, in a preferred aspect the present invention Also, aggregating agents such as alum are suitably used to provides antibodies that bind, interact or otherwise associate enhance the immune response. with HAS and/or HYAL and which reduce HAS and/or Both polyclonal and monoclonal antibodies can be pro HYAL function or activity. 50 duced by this method. The methods for obtaining both types The antibodies maybe monoclonal or polyclonal antibod of antibodies are well known in the art. Polyclonal antibodies ies, although, monoclonal antibodies are preferred. Gener are less preferred but are relatively easily prepared by injec ally, the antibodies are in isolated, homogenous or fully or tion of a suitable laboratory animal with an effective amount partially purified form. of a modified LIF molecule, or immunogenic parts thereof, The antibodies may also be humanized or chimeric or are 55 collecting serum from the animal and isolating modified LIF human antibodies Suitable for administration to humans. molecule specific antibodies by any of the known immuno These include humanized antibodies prepared, for example, absorbent techniques. Antibodies produced by this technique from murine monoclonal antibodies, and human monoclonal are generally less favoured, because of the potential for het antibodies which may be prepared, for example, using trans erogeneity of the product. genic mice as described below, or by phage display. A 60 The use of monoclonal antibodies is particularly preferred “humanized' antibody includes a deimmunized antibody. because of the ability to produce them in large quantities and Preferably, antibodies are raised against a HAS such as the homogeneity of the product. Monoclonal antibodies may HAS1, 2 or 3 or immunogenic parts thereof or immunologi be produced by conventional procedures. cally homologous molecules. Preferably, antibodies are The term “monoclonal antibody” as used herein refers to raised against a HYAL such as HYAL1, 2 or 3 or immuno 65 an antibody obtained from a population of Substantially genic parts thereof or immunologically homologous mol homogeneous antibodies, i.e., the individual antibodies com ecules. prising the population are identical except for possible natu US 7,662.929 B2 17 18 rally occurring mutations that may be present in minor an antibody of interest are expressed in any suitable recom amounts. Monoclonal antibodies are highly specific, being binant expression system, and the expressed polypeptides are directed against a single antigenic site. Furthermore, in con allowed to assemble to form antibody molecules. trast to conventional (polyclonal) antibody preparations Single chain antibodies may be formed by linking heavy which typically include different antibodies directed against and light chain variable region (FV region) fragments via an different determinants (epitopes), each monoclonal antibody amino acid bridge (short peptide linker), resulting in a single is directed against a single determinant on the antigen. The polypeptide chain. Such single-chain Fvs (sclvs) have been modifier "monoclonal indicates the character of the anti prepared by fusing DNA encoding a peptide linker between body as being obtained from a Substantially homogeneous DNAs encoding the two variable region polypeptides (VL population of antibodies, and is not to be construed as requir 10 and VH). The resulting antibody fragments can form dimers ing production of the antibody by any particular method. For or trimers, depending on the length of a flexible linker example, the monoclonal antibodies to be used in accordance between the two variable domains (Kortt et al., Protein Engi with the present invention may be made by the hybridoma neering 10: 423, 1997). Techniques developed for the pro method first described by Kohler et al., Nature 256:495 duction of single chain antibodies include those described in (1975), or may be made by recombinant DNA methods (see, 15 U.S. Pat. No. 4,946,778; Bird (Science 242: 423, 1988), Hus e.g., U.S. Pat. No. 4,816,567). The “monoclonal antibodies' ton et al. (Proc. Natl. Acad. Sci. USA 85: 5879, 1988) and may also be isolated from phage antibody libraries using for Ward et al. (Nature 334: 544, 1989). Single chain antibodies example, the techniques described in Clackson et al., Nature derived from antibodies provided herein are encompassed by 352:624–628, 1991 and Marks et al., J. Mol. Biol. 222:581 the present invention. 597, 1991. In one embodiment, the present invention provides anti The present invention contemplates a method for produc body fragments or chimeric, recombinant or synthetic forms ing a hybridoma cell line which comprises immunizing a of the antibodies of the present invention that bind to a HAS non-human animal. Such as a mouse or a transgenic mouse, such as HAS1, 2 and/or 3. with a HAS or immunogenic parts thereof harvesting spleen Techniques are known for deriving an antibody of a differ cells from the immunized animal; fusing the harvested spleen 25 ent Subclass or isotype from an antibody of interest, i.e., cells to a myeloma cell line to generate hybridoma cells; and Subclass Switching. Thus, IgG1 or IgG4 monoclonal antibod identifying a hybridoma cell line that produces a monoclonal ies may be derived from an IgM monoclonal antibody, for antibody that binds to a HAS or HYAL. example, and Vice versa. Such techniques allow the prepara Such hybridoma cell lines and the HAS or HYAL mono tion of new antibodies that possess the antigen-binding prop clonal antibodies produced by them are encompassed by the 30 erties of a given antibody (the parent antibody), but also present invention. Monoclonal antibodies secreted by the exhibit biological properties associated with an antibody iso hybridoma cell lines are purified by conventional techniques. type or subclass different from that of the parent antibody. Hybridomas or the monoclonal antibodies produced by them Recombinant DNA techniques may be employed. Cloned may be screened further to identify monoclonal antibodies DNA encoding particular antibody polypeptides may be with particularly desirable properties. 35 employed in Such procedures, e.g. DNA encoding the con The HAS and/or HYAL molecule or immunogenic part stant region of an antibody of the desired isotype. thereof that may be used to immunize animals in the initial The monoclonal production process described above may stages of the production of the antibodies of the present inven be used in animals, for example mice, to produce monoclonal tion may be from any mammalian source. antibodies. Conventional antibodies derived from such ani Antigen-binding fragments of antibodies of the present 40 mals, for example murine antibodies, are known to be gener invention may be produced by conventional techniques. ally unsuitable for administration to humans as they may Examples of Such fragments include, but are not limited to, cause an immune response. Therefore, such antibodies may Fab, Fab'. F(ab') and Fv fragments, including single chain Fv need to be modified in order to provide antibodies suitable for fragments (termed SFv or scFV). Antibody fragments and administration to humans. Processes for preparing chimeric derivatives produced by genetic engineering techniques. Such 45 and/or humanized antibodies are well known in the art and are as disulphide stabilized FV fragments (dsEv), single chain described in further detail below. variable region domain (Abs) molecules, minibodies and dia The monoclonal antibodies herein specifically include bodies are also contemplated for use in accordance with the "chimeric' antibodies in which the variable domain of the present invention. heavy and/or light chain is identical with or homologous to Such fragments and derivatives of monoclonal antibodies 50 corresponding sequences in antibodies derived from a non directed against HAS and/or HYAL molecules may be pre human species (e.g., murine), while the remainder of the pared and Screened for desired properties, by known tech chain(s) is identical with or homologous to corresponding niques, including the assays described herein. Certain of the sequences in antibodies derived from humans, as well as techniques involve isolating DNA encoding a polypeptide fragments of Such antibodies, so long as they exhibit the chain (or a portion thereof) of a mAb of interest, and manipu 55 desired biological activity (U.S. Pat. No. 4,816,567; and Mor lating the DNA through recombinant DNA technology. The rison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855, 1984). DNA may be fused to another DNA of interest, or altered (e.g. “Humanized forms of non-human (e.g., murine) antibod by mutagenesis or other conventional techniques) to add, ies are chimeric antibodies which contain minimal sequence delete, or Substitute one or more amino acid residues, for derived from the non-human immunoglobulin. For the most example. 60 part, humanized antibodies are human immunoglobulins (re DNA encoding antibody polypeptides (e.g. heavy or light cipient antibody) in which the complementarity determining chain, variable region only or full length) may be isolated regions (CDRs) of the recipient are replaced by the corre from B-cells of mice that have been immunized with modified sponding CDRS from a non-human species (donor antibody) LIF molecules. The DNA may be isolated using conventional Such as mouse, rat, rabbit or nonhuman primate having the procedures. Phage display is another example of a known 65 desired properties, for example specificity, and affinity. In technique whereby derivatives of antibodies may be pre Some instances, framework region residues of the human pared. In one approach, polypeptides that are components of immunoglobulin are replaced by corresponding non-human US 7,662.929 B2 19 20 residues. Furthermore, humanized antibodies may comprise of the present invention include any animal who may benefit residues which are not found in the recipient antibody or in from such treatment. These include, without limitation, the donor antibody. humans, marmosets, orangutans and gorillas, livestock ani These modifications are made to further refine antibody mals (e.g. cows, sheep, pigs, horses, donkeys), laboratory test performance. In general, the humanized antibody will com animals (e.g. mice, rats, guinea pigs, hamsters, rabbits), com prise Substantially all of at least one, and typically two, Vari panion animals (e.g. cats, dogs) and captured wild animals able domains, in which all or substantially all of the comple (e.g. rodents, foxes, deer, kangaroos. A particularly preferred mentarity determining regions correspond to those of a non host is a human, primate or livestock animal. human immunoglobulin and all or Substantially all of the The compounds of the present invention can be utilized for framework region residues are those of a human immunoglo 10 diagnostics, therapeutics, prophylaxis and as research bulin sequence. The humanized antibody optionally also will reagents and kits. Furthermore, antisense or sense oligonucle comprise at least a portion of an immunoglobulin constant otides or antibodies to HAS and/or HYAL which are able to region (Fc), typically that of a human immunoglobulin. For inhibit gene expression or HAS and/or HYAL activity with further details, see Jones et al., Nature 321:522-525, 1986: exquisite specificity, are often used by those of ordinary skill Reichmann et al., Nature 332:323-329, 1988: Presta, Curr: 15 to elucidate the function of particular genes or gene products Op. Struct. Biol. 2:593-596, 1992; Liu et al., Proc. Natl. Acad. or to distinguish between functions of various members of a Sci. USA 84: 3439, 1987: Larricket al., Bio/Technology 7: biological pathway. 934, 1989; and Winter and Harris, TIPS 14: 139, 1993. For use in kits and diagnostics, the compounds of the The complementarity determining regions (CDRS) of a present invention, either alone or in combination with other given antibody may be readily identified, for example using compounds or therapeutics, can be used as tools in differen the system described by Kabat et al. in Sequences of Proteins tial and/or combinatorial analyses to elucidate expression of Immunological Interest, 5th Ed., US Dept. of Health and patterns of a portion or the entire complement of genes Human Services, PHS, NIH, NIH Publication No. 91-3242, expressed within cells and tissues. 1991). As one non-limiting example, expression patterns within Procedures for generating human antibodies in non-human 25 cells or tissues treated with one or more antisense or sense animals have been developed and are well known to those compounds are compared to control cells or tissues not skilled in the art. For example, transgenic mice into which treated with antisense or sense compounds and the patterns genetic material encoding one or more human immunoglo produced are analyzed for differential levels of gene expres bulin chains has been introduced may be used to produce the sion as they pertain, for example, to disease association, sig antibodies of the present invention. Antibodies produced in 30 nalling pathway, cellular localization, expression level, size, the animals incorporate human immunoglobulin polypeptide structure or function of the genes examined. In another chains encoded by the human genetic material introduced example, similar experiments are conducted with antibodies into the animal. Examples of techniques for production and to HAS. These analyses can be performed on stimulated or use of such transgenic animals are described in U.S. Pat. Nos. unstimulated cells and in the presence or absence of other 5,814,318, 5,569,825, and 5,545,806, which are incorporated 35 compounds which affect expression patterns. by reference herein. Examples of methods of gene expression analysis known Another method for generating human antibodies is phage in the art include DNA arrays or microarrays (Brazma and display. Phage display techniques for generating human anti Vilo, FEBS Lett. 480: 17-24, 2000; Celis et al., FEBS Lett. bodies are well known to those skilled in the art, and include 480: 2-16, 2000), SAGE (serial analysis of gene expression) the methods used by companies Such as Cambridge Antibody 40 (Madden et al., Drug Discov. Today 5: 415-425, 2000), Technology and MorphoSys and which are described in Inter READS (restriction enzyme amplification of digested national Patent Publication Nos. WO 92/01047, WO cDNAs) (Prashar and Weissman, Methods Enzymol. 303: 92/20791, WO 93/06213 and WO 93/11236. 258-272, 1999), TOGA (total gene expression analysis) (Sut The compounds of the present invention can also be cliffeet al., Proc. Natl. Acad. Sci. USA 97: 1976-1981, 2000), applied in the areas of drug discovery and target validation. 45 protein arrays and proteomics (Celis et al. 2000, Supra; Jung The present invention comprehends the use of the compounds blut et al., Electrophoresis 20: 2100-2110, 1999), expressed and preferred target segments identified herein in drug dis sequence tag (EST) sequencing (Celis et al., 2000, Supra; covery efforts to elucidate relationships that exist between Larsson et al., J. Biotechnol. 80: 143-157, 2000), subtractive HA, HAS or HA/HAS and HA, HYAL or HA/HYAL inter RNA fingerprinting (SuRF) (Fuchs et al., Anal. Biochem. action and a disease state, phenotype, or condition. These 50 286: 91-98, 2000; Larson et al., Cytometry 41: 203-208, methods include detecting or modulating HAS and/or HYAL 2000), subtractive cloning, differential display (DD) (Jurecic comprising contacting a sample, tissue, cell, or organism with and Belmont, Curr. Opin. Microbiol. 3:316-321, 2000), com the compounds of the present invention, measuring the parative genomic hybridization (Carulli et al., J. Cell Bio nucleic acid or protein level of HAS and/or HYAL and/or a chem. Suppl. 31: 286-296, 1998), FISH (fluorescent in situ related phenotypic or chemical endpoint at Some time after 55 hybridization) techniques (Going and Gusterson, Eur: J. Can treatment, and optionally comparing the measured value to a cer, 35: 1895-1904, 1999) and mass spectrometry methods non-treated Sample or sample treated with a further com (To, Comb. Chem. High Throughput Screen, 3: 235-241, pound of the invention. These methods can also be performed 2000). in parallel or in combination with other experiments to deter The compounds of the invention are useful for research and mine the function of unknown genes for the process of target 60 diagnostics, because these compounds hybridize to nucleic validation or to determine the validity of a particular gene acids encoding HAS or HYAL or bind to HAS or HYAL itself. product as a target for treatment or prevention of a particular For example, oligonucleotides that are shown to hybridize disease, condition, or phenotype. with Such efficiency and under Such conditions as disclosed The present invention contemplates the use of the com herein as to be effective HAS or HYAL inhibitors of HAS or pounds described herein as therapeutic agents to treat Sub 65 HYAL gene expression inhibitors will also be effective prim jects suffering from diseases and disorders associated with ers or probes under conditions favoring gene amplification or HA. Subjects treated using the compositions and compounds detection, respectively. These primers and probes are useful US 7,662.929 B2 21 22 in methods requiring the specific detection of nucleic acid inhibitors of gene expression, or, alternatively, may potentiate molecules encoding HAS or HYAL and in the amplification HAS and/or HYAL inhibition. of said nucleic acid molecules for detection or for use in Another technique for drug screening provides high further studies of HAS or its gene. Hybridization of the anti throughput screening for compounds having Suitable binding sense or sense oligonucleotides, particularly the primers and 5 affinity to a target and is described in detail in Geysen (Inter probes, of the invention with a nucleic acid encoding HAS or national Patent Publication No. WO 84/03564). Briefly HYAL can be detected by means known in the art. Such stated, large numbers of different Small peptide test com means may include conjugation of an enzyme to the oligo pounds are synthesized on a Solid Substrate. Such as plastic nucleotide, radiolabelling of the oligonucleotide or any other pins or some other Surface. The peptide test compounds are suitable detection means. Similarly, antibodies may be 10 reacted with HAS and/or HYAL and washed. Bound HAS labeled with reporter molecules including enzymes and and/or HYAL molecules are then detected by methods well radiolabels for imaging purposes, diagnostic purposes or known in the art. This method may be adapted for screening quantitative purposes. Kits using Such detection means for for non-peptide, chemical entities. This aspect, therefore, detecting the level of HAS or HYAL in a sample may also be extends to combinatorial approaches to screening for HAS prepared. 15 and/or HYAL antagonists or agonists. The specificity and sensitivity of antisense or sense com Purified HAS and/or HYAL can be coated directly onto pounds orantibodies are also harnessed by those of skill in the plates for use in the aforementioned drug screening tech art for therapeutic uses. Such compounds have been niques. However, non-neutralizing antibodies to the target employed as therapeutic moieties in the treatment of disease may also be used to immobilize the target on the Solid phase. states in animals, including humans. Another useful group of compounds is a mimetic. A For therapeutics, an animal, preferably a human, Suspected mimetic in this context refers to a Substance which has some of having a disease or disorder which can be treated by modu chemical similarity to the substrate of HAS and/or HYAL but lating the expression of the HAS and/or HYAL gene is treated which antagonises HAS and/or HYAL activity. A mimetic by administering antisense or sense compounds in accor may be a carbohydrate or peptide or chemical molecule that dance with this invention. Alternatively, antibodies may be 25 mimics elements of secondary structure (Johnson et al., “Pep used to inhibit HAS and/or HYAL activity. For example, in tide Turn Mimetics’ in Biotechnology and Pharmacy, Pez one non-limiting embodiment, the methods comprise the step Zuto et al., Eds. Chapman and Hall, New York, 1993). The of administering to the animal in need of treatment, a thera underlying rationale behind the use of mimetics is that the peutically effective amount of a HAS and/or HYAL gene backbone of the substrate of HAS and/or HYAL exists chiefly expression inhibitor. The HAS or HYAL gene expression 30 to orient the Substrate in Such a way as to facilitate molecular inhibitors of the present invention effectively inhibit the activ interactions with HAS and HYAL. A mimetic is designed to ity of the HAS and/or HYAL protein or inhibit the expression permit molecular interactions similar to the natural molecule. of the HAS and/or HYAL gene. In one embodiment, the Peptide or non-peptide mimetics may be useful, for example, activity or expression of HAS or its gene in an animal is to inhibit the activity of HAS and/or HYAL. inhibited by about 10%. Preferably, the activity or expression 35 The designing of mimetics to a pharmaceutically active of HAS and/or HYAL or its gene in an animal is inhibited by compound is a known approach to the development of phar about 30%. More preferably, the activity or expression of maceuticals based on a “lead compound. This might be HAS and/or HYAL or its gene in an animal is inhibited by desirable where the active compound is difficult or expensive 50% or more. to synthesize or where it is unsuitable for a particular method For example, the reduction of the expression of the HAS 40 of administration. Mimetic design, synthesis and testing are and/or HYAL gene may be measured in serum, adipose tissue, generally used to avoid randomly screening large numbers of skin cells, liver or any other body fluid, tissue or organ of the molecules for a desired property. animal. Preferably, the cells contained within said fluids, There are several steps commonly taken in the design of a tissues or organs being analyzed contain a nucleic acid mol mimetic from a compound having a given desired property. ecule encoding a HAS and/or HYAL protein. 45 First, the particular parts of the compound that are critical The present invention contemplates, therefore, methods of and/or important in determining the desired property are screening for compounds comprising, for example, contact determined. In the case of a peptide, this can be done by ing a candidate compound with genetic material encoding systematically varying the amino acid residues in the peptide, HAS and/or HYAL including mRna or HAS or HYAL itself. e.g. by Substituting each residue in turn. Alanine scans of The screening procedure includes assaying (i) for the pres 50 peptides are commonly used to refine such peptide motifs. ence of a complex between the drug and HAS and/or HYAL These parts or residues constituting the active region of the or genetic material encoding same or (ii) for an alteration in compound are known as its “pharmacophore'. the expression levels of nucleic acid molecules encoding the Once the pharmacophore has been found, its structure is HAS and/or HYAL. Whole cells may also be screened for modeled according to its physical properties, e.g. Stere interaction between the cell and the drug. 55 ochemistry, bonding, size and/or charge, using data from a One form of assay involves competitive binding assays. In range of sources, e.g. spectroscopic techniques, X-ray diffrac Such competitive binding assays, the candidate compound or tion data and NMR. Computational analysis, similarity map HAS and/or HYAL is typically labeled. Free HAS and/or ping (which models the charge and/or Volume of a pharma HYAL is separated from any putative complex and the cophore, rather than the bonding between atoms) and other amount of free (i.e. uncomplexed) label is a measure of the 60 techniques can be used in this modeling process. binding of the agent being tested to target molecule. One may In a variant of this approach, the three-dimensional struc also measure the amount of bound, rather than free, HAS ture of the ligand and its binding partner are modeled. This and/or HYAL. It is also possible to label the compound rather can be especially useful where the ligand and/or binding than HAS or HYAL and to measure the amount of compound partner change conformation on binding, allowing the model binding HAS or HYAL in the presence and in the absence of 65 to take account of this in the design of the mimetic. Modeling the compound being tested. Such compounds may inhibit can be used to generate inhibitors which interact with the HAS and/or HYAL which is useful, for example, in finding linear sequence or a three-dimensional configuration. US 7,662.929 B2 23 24 A template molecule is then selected onto which chemical as the reporter gene, co-expression of the fusion proteins will groups which mimic the pharmacophore can be grafted. The produce a blue color. Small molecules or other candidate template molecule and the chemical groups grafted onto it compounds which interact with a target will result in loss of can conveniently be selected so that the mimetic is easy to color of the cells. Reference may be made to the yeast two synthesize, is likely to be pharmacologically acceptable, and hybrid systems as disclosed by Munder et al. (Appl. Micro does not degrade in vivo, while retaining the biological activ biol. Biotechnol. 52(3): 311-320, 1999) and Young et al., Nat. ity of the lead compound. Alternatively, where the mimetic is Biotechnol. 16(10): 946-950, 1998). Molecules thus identi peptide-based, further stability can beachieved by cyclizing fied by this system are then re-tested in animal cells. the peptide, increasing its rigidity. The mimetic or mimetics As indicated above, the present invention also extends to found by this approach can then be screened to see whether 10 small molecule inhibitors identified as described above and they have the target property, or to what extent they exhibit it. which bind and inhibit the activity of HAS and/or HYAL. Further optimization or modification can then be carried out It is to be understood that unless otherwise indicated, the to arrive atone or more final mimetics for in vivo or clinical subject invention is not limited to specific formulations of testing. components, manufacturing methods, dosage regiments, The goal of rational drug design is to produce structural 15 treatment protocols or the like, as Such may vary. It is also to analogs of biologically active polypeptides of interest or of be understood that the terminology used herein is for the Small molecules with which they interact (e.g. agonists, purpose of describing particular embodiments only and is not antagonists, inhibitors or enhancers) in order to fashion drugs intended to be limiting. which are, for example, more active or stable forms of the It must be noted that, as used in the Subject specification, polypeptide, or which, e.g. enhance or interfere with the the singular forms “a”, “an and “the include plural aspects function of a polypeptide in vivo. See, e.g. Hodgson (Bio/ unless the context clearly dictates otherwise. Thus, for Technology 9: 19-21, 1991). In one approach, the three-di example, reference to “a compound includes a single com mensional structure of HAS and/or HYAL interest is deter pound, as well as two or more compounds; reference to “an mined by X-ray crystallography, by computer modeling or antibody' includes a single antibody, as well as two or more most typically, by a combination of approaches. Useful infor 25 antibodies; and so forth. mation regarding the structure of a polypeptide may also be The terms "compound”, “active agent”, “pharmacologi gained by modeling based on the structure of homologous cally active agent”, “medicament”, “active' and "drug” are proteins. An example of rational drug design is the develop used interchangeably herein to refer to an antagonist of HAS ment of HIV protease inhibitors (Erickson et al., Science 249: and/or HYAL function or activity or of expression of genetic 527-533, 1990). In addition, target molecules may be ana 30 material encoding same which induces a desired pharmaco lyzed by an alanine scan (Wells, Methods Enzymol. 202: logical and/or physiological effect such as but not limited to 2699-2705, 1991). In this technique, an amino acid residue is controlling inflammation and reducing cancer growth. The replaced by Ala and its effect on the peptide's activity is terms also encompass pharmaceutically acceptable and phar determined. Each of the amino acid residues of the peptide is macologically active ingredients of those active agents spe analyzed in this manner to determine the important regions of 35 cifically mentioned herein including but not limited to salts, the peptide. esters, amides, prodrugs, active metabolites, analogs and the It is also possible to isolate a HAS and/or HYAL-specific like. When the terms “compound”, “active agent”, “pharma antibody, selected by a functional assay and then to solve its cologically active agent”, “medicament”, “active' and “drug’ crystal structure. In principle, this approach yields a pharma are used, then it is to be understood that this includes the core upon which Subsequent drug design can be based. It is 40 active agent per se as well as pharmaceutically acceptable, possible to bypass protein crystallography altogether by gen pharmacologically active salts, esters, amides, prodrugs, erating anti-idiotypic antibodies (anti-ids) to a functional, metabolites, analogs, etc. The term "compound is not to be pharmacologically active antibody. As a mirror image of a construed as a chemical compound only but extends to RNA mirror image, the binding site of the anti-ids would be and DNA encoding a modified LIF molecule. expected to be an analog of the original receptor. The anti-id 45 The terms “effective amount” and “therapeutically effec could then be used to identify and isolate peptides from banks tive amount of the compound as used herein mean a suffi of chemically or biologically produced banks of peptides. cient amount of the agent to provide the desired therapeutic or Selected peptides would then act as the pharmacore. physiological effect such as inhibiting inflammation or reduc Two-hybrid screening is also useful in identifying other ing the growth or spread of cancer cells. Undesirable effects, members of a biochemical or genetic pathway associated 50 e.g. side effects, are sometimes manifested along with the with a target. Two-hybrid Screening conveniently uses Sac desired therapeutic effect; hence, a practitioner balances the charomyces cerevisiae and Saccharomyces pombe. Target potential benefits against the potential risks in determining interactions and screens for inhibitors can be carried out using what is an appropriate “effective amount. The exact amount the yeast two-hybrid system, which takes advantage of tran required will vary from Subject to Subject, depending on the Scriptional factors that are composed of two physically sepa 55 species, age and general condition of the Subject, mode of rable, functional domains. The most commonly used is the administration and the like. Thus, it may not be possible to yeast GAL.4 transcriptional activator consisting of a DNA specify an exact “effective amount'. However, an appropriate binding domain and a transcriptional activation domain. Two “effective amount” in any individual case may be determined different cloning vectors are used to generate separate fusions by one of ordinary skill in the art using only routine experi of the GAL4 domains to genes encoding potential binding 60 mentation. The present invention extends to a method of proteins. The fusion proteins are co-expressed, targeted to the treatment or prophylaxis. nucleus and if interactions occur, activation of a reporter gene By “pharmaceutically acceptable' carrier, excipient or (e.g. lacZ) produces a detectable phenotype. In the present diluent is meant a pharmaceutical vehicle comprised of a case, for example, S. cerevisiae is co-transformed with a material that is not biologically or otherwise undesirable, i.e. library or vector expressing a cDNAGAL4 activation domain 65 the material may be administered to a Subject along with the fusion, and a vector expressing a target gene Such as, for selected active agent without causing any or a substantial example, HAS or HYAL gene fused to GAL4. If lacz is used adverse reaction. Carriers may include excipients and other US 7,662.929 B2 25 26 additives such as diluents, detergents, coloring agents, wet Schinzel Type, AcrocephaloSyndactyly, Acrocephalosyndac ting or emulsifying agents, pH buffering agents, preserva tyly Type I, Acrocephalosyndactyly Type I Subtype I, Acro tives, and the like. cephalopolysyndactyly Type II. Acrocephalopolysyndactyly Similarly, a “pharmacologically acceptable' salt, ester, Type III, Acrocephalopolysyndactyly Type IV. Acrocephalo amide, prodrug or derivative of a compound as provided syndactyly V (ACS5 or ACSV) Subtype I, Acrocephaly Skull herein is a salt, ester, amide, prodrug orderivative that this not Asymmetry and Mild Syndactyly, Acrocephaly, Acrochon biologically or otherwise undesirable. drohyperplasia, Acrodermatitis Enteropathica, Acrodysosto The terms “treating and “treatment” as used herein refer to sis, Acrodystrophic Neuropathy, Acrodystrophic Neuropa reduction in severity and/or frequency of symptoms of dis thy, Acrofacial Dysostosis Nager Type, Acrofacial Dysostosis eases or disorders or physiological conditions elimination of 10 Nager Type, Acrofacial Dysostosis Postaxial Type, Acrofa symptoms and/or underlying cause, prevention of the occur cial Dysostosis Type Genee-Wiedep, Acrogeria Familial, rence of symptoms of disease and/or their underlying cause Acromegaly, Acromelalgia Hereditary, Acromesomelic Dys and improvement or remediation of conditions associated plasia, Acromesomelic Dwarfism, Acromicric Skeletal Dys with cytokine activity. plasia, Acromicric Dysplasia, Acroosteolysis with “Treating a patient may involve prevention of the disorder 15 Osteoporosis and Changes in Skull and Mandible, Acroost or disease condition or physiological event in a susceptible eolysis, Acroparesthesia, ACSI, ACS Type II, ACS Type III, individual as well as treatment of a clinically symptomatic ACS, ACS3, ACTH Deficiency, Action Myoclonus, Acute individual by inhibiting a disease or disorder. Brachial Neuritis Syndrome, Acute Brachial Radiculitis Syn Accordingly, another aspect of the present invention is drome, Acute Cerebral Gaucher Disease, Acute Cholangitis, directed towards therapeutic or prophylactic composition Acute Disseminated Encephalomyeloradiculopathy, Acute comprising a compound capable of reducing the levels or Disseminated Histiocytosis-X, Acute Hemorrhagic Polioen activity of HAS and/or HYAL and hence reducing levels of cephalitis, Acute Idiopathic Polyneuritis, Acute Immune-Me HA. diation Polyneuritis, Acute Infantile Pelizaeus-Merzbacher The compositions and compounds of the present invention Brain Sclerosis, Acute Intermittant Porphyria, Acute Porphy can be used in the treatment or prevention of diseases asso 25 rias, Acute Sarcoidosis, Acute Shoulder Neuritis, Acute Toxic ciated with HA. The present invention contemplates treat Epidermolysis, Acyl-CoA Dehydrogenase Deficiency Long ment of diseases and disorders such as A-Beta-Lipoproteine Chain, Acyl-CoA Dehydrogenase Deficiency Short-Chain, mia, A-V. A Beta-2-Microglobulin Amyloidosis, A-T, A1 AD, Acyl-CoA Dihydroxyacetone Acyltransferase, Acyl-coen A1AT, Aagenaes, Aarskog syndrome, Aarskog-Scott Syn Zyme A Oxidase Deficiency, ADA, ADA Deficiency, Adam drome, Aase-Smith syndrome, Aase Syndrome. AAT, Abder 30 Complex, Adamantiades-Behcet’s Syndrome, Adamanti halden-Kaufmann-Lignac Syndrome, Abdominal Muscle noma, Adams Oliver Syndrome, Adaptive Colitis, ADD com Deficiency Syndrome, Abdominal Wall Defect, Abdominal bined type, ADD, Addison Disease with Cerebral Sclerosis, Epilepsy, Abdominal Migraine, Abductor Spasmodic Dys Addison's Anemia, Addison's Anemia, Addison's Disease, phonia, Abductor Spastic Dysphonia, Abercrombie Syn Addison's Disease, Addison's Disease, Addison-Biermer drome, blepharon-Macrostomia Syndrome, ABS, Absence of 35 Anemia, Addison-Biermer Anemia, Addison-Schilder Dis HPRT, Absence of Corpus Callosum Schinzel Typ, Absence ease. Addisonian Pernicious Anemia, Addisonian Pernicious Defect of Limbs Scalp and Skull, Absence of Menstruation Anemia, Adducted Thumbs-Mental Retardation, Adductor Primar, Absence of HGPRT, Absorptive Hyperoxaluriaor Spasmodic Dysphonia, Adductor Spastic Dysphonia, Enteric, Abt-Letterer-Siwe Disease, ACADL, ACADM Defi Adenoma Associated Virilism of Older Women, Adenomato ciency, ACADM, ACADS, Acanthocytosis-Neurologic Dis 40 sis of the Colon and Rectum, Adenomatous polyposis of the order, Acanthocytosis, Acantholysis Bullosa, Acanthosis Colon, Adenomatous Polyposis Familial, Adenosine Deami Nigricans, Acanthosis Bullosa, Acanthosis Nigricans With nase Deficiency, Adenosine Deaminase Deficiency, Adeny Insulin Resistance Type A, Acanthosis Nigricans With Insulin losuccinase deficiency, ADHD predominantly hyperactive Resistance Type B. Acanthotic Nevus, Acatalasemia, Acata impulsive type, ADHD predominantly inattentive type, lasia, ACC. Accessory Atrioventricular Pathways, Accessory 45 ADHD, Adhesive Arachnoiditis, Adie Syndrome, Adie's Atrioventricular Pathways, Acephaly, ACF with Cardiac Syndrome, Adie's Tonic Pupil, Adie's Pupil, Adipogenital Defects, Achalasia, Achard-Thiers Syndrome, ACHARD Retinitis Pigmentosa Polydactyly, Adipogenital-Retinitis (Marfan variant), Achard's syndrome, Acholuric Jaundice, Pigmentosa Syndrome, Adiposa Dolorosa, Adiposis Dolo Achondrogenesis, Achondrogenesis Type IV. Achondrogen rosa, Adiposogenital Dystrophy, Adolescent Cystinosis, esis Type III, Achondroplasia, Achondroplasia Tarda, Achon 50 ADPKD, Adrenal Cortex Adenoma, Adrenal Disease, Adre droplastic Dwarfism, Achoo Syndrome, Achromat, Achro nal Hyperfunction resulting from Pituitary ACTH Excess, matope, Achromatopic, Achromatopsia, Achromic Nevi, Adrenal Hypoplasia, Adrenal Insufficiency, Adrenal Neo Acid Ceramidase Deficiency, Acid Maltase Deficiency, Acid plasm, Adrenal Virilism, Adrenal Virilism, Adreno-Retinitis Maltase Deficiency, Acid Beta-glucosidase Deficiency, Aci Pigmentosa-Polydactyly Syndrome, Adrenocortical Insuffi demia Methylmalonic, Acidemia Propionic, Acidemia with 55 ciency, Adrenocortical Hypofunction, Adrenocorticotropic Episodic Ataxia and Weakness, Acidosis, Aclasis Tarsoepi Hormone Deficiency Isolated, Adrenogenital Syndrome, physeal, ACM, Acoustic Neurilemoma, Acoustic Neuroma, Adrenogenital Syndrome, Adrenoleukodystrophy, Adreno ACPS with Leg Hypoplasia, ACPS II, ACPS IV, ACPS III, myeloneuropathy, Adreno-Retinitis Pigmentosa-Polydactyly Acquired Aphasia with Convulsive Disorder, Acquired Syndrome, Adult Cystinosis, Adult Dermatomyositis, Adult Brown Syndrome, Acquired Epileptic Aphasia, Acquired 60 Hypophosphatasia, Adult Macula Lutea Retinae Degenera Factor XIII Deficiency, Acquired Form of ACC (caused by tion, Adult Onset ALD, Adult-Onset Ceroidosis, Adult Onset infection while still in womb), Acquired Hyperoxaluria, Medullary Cystic Disease, Adult Onset Pernicious Anemia, Acquired Hypogammaglobulinemia, Acquired Immunodefi Adult Onset Pernicious Anemia, Adult Onset Schindler Dis ciency Syndrome (AIDS), Acquired Iron Overload, Acquired ease. Adult-Onset Subacute Necrotizing Encephalomyelopa Lipodystrophy, Acquired Partial Lipodystrophy, Acquired 65 thy, Adult Onset Pernicious Anemia, Adult Polycystic Kidney Wandering Spleen, ACR, Acral Dysostosis with Facial and Disease, Adult Onset Medullary Cystic Disease, Adynlosuc Genital Abnormalities, Acro Renal, Acrocallosal Syndrome cinate Lyase Deficiency, AE, AEC Syndrome, AFD, AFD. A US 7,662.929 B2 27 28 fibrinogenemia, African Siderosis, AGA, Aganglionic Mega loidosis, Analphalipoproteinemia, Analrectal, Analrectal, colon, Age Related Macular Degeneration, Agenesis of Com Analrectal, Anaplastic Astrocytoma, Andersen Disease, missura Magna Cerebri, Agenesis of Corpus Callosum, Anderson-Fabry Disease, Andersen Glycogenosis, Ander Agenesis of Corpus Callosum-Infantile Spasms-Ocular son-Warburg Syndrome, Andre Syndrome, Andre Syndrome Anomalies, Agenesis of Corpus Callosum and Chorioretinal 5 Type II, Androgen Insensitivity, Androgen Insensitivity Syn Abnormality, Agenesis of Corpus Callosum-Chorioretinitis drome Partial, Androgen Insensitivity Syndrome, Androgen Abnormality, Aggressive mastocytosis, Agnosis Primary, Insensitivity Syndrome Partial, Androgenic Steroids, Anemia AGRTriad, AGU, Agyria, Agyria-pachygria-band spectrum, Autoimmune Hemolytic, Anemia Blackfan Diamond, Ane AHC, AHD, AHDS, AHF Deficiency, AHG Deficiency, mia, Congenital, Triphalangeal Thumb Syndrome, Anemia AHO, Ahumada Del Castillo, Aicardi Syndrome, Aicardi 10 Hemolytic Cold Antibody, Anemia Hemolytic Cold Anti Syndrome, AIED, AIMP, AIP. AIS, AIS, Akinetic Seizure, body, Anemia Hemolytic with PGK Deficiency, Anemia Per ALA-D Porphyria, Alactasia, Alactasia, Alagile Syndrome, nicious, Anencephaly, Angelman Syndrome, Angio-Osteo Aland Island Eye Disease (X-Linked), Alaninuria, Albers hypertrophy Syndrome, Angiofollicular Lymph Node Schonberg Disease, Albinism, Albinism, Albinismus, Albi Hyperplasia, Angiohemophilia, Angiokeratoma Corporis, noidism, Albright Hereditary Osteodystrophy, Alcaptonuria, 15 Angiokeratoma Corporis Diffusum, Angiokeratoma Diffuse, Alcaptonuria, Alcohol-Related Birth Defects, Alcoholic Angiomatosis Retina, Angiomatous Lymphoid, Angion Embryopathy, Ald, ALD, ALD, Aldosterone, Aldosteronism eurotic Edema Hereditary, Anhidrotic Ectodermal Dysplasia, With Normal Blood Pressure, Aldrich Syndrome, Alex Anhidrotic X-Linked Ectodermal Dysplasias, Aniridia, ander's Disease, Alexanders Disease, Algodystrophy, Algo Aniridia-Ambiguous Genitalia-Mental Retardation, Aniridia neurodystrophy, Alkaptonuria, Alkaptonuric Ochronosis, Associated with Mental Retardation, Aniridia-Cerebellar Alkyl DHAP synthase deficiency, Allan-Herndon-Dudley Ataxia-Mental Deficiency, Aniridia Partial-Cerebellar Syndrome, Allan-Herndon Syndrome, Allan-Herndon-Dud Ataxia-Mental Retardation, Aniridia Partial-Cerebellar ley Mental Retardation, Allergic Granulomatous Antitis, Ataxia-Oligophrenia, Aniridia Type I, Aniridia Type II, Aniri Allergic Granulomatous Angiitis of Cronkhite-Canada, Alo dia-Wilms Tumor Association, Aniridia-Wilms Tumor-Go bar Holoprosencephaly, Alopecia Areata, Alopecia Areata, 25 nadoblastoma, Ankyloblepharon-Ectodermal Defects-Cleft Alopecia Celsi, Alopecia Cicatrisata, Alopecia Circum Lip/Palate, Ankylosing Spondylitis, Ankylosing Spondylitis, scripta, Alopecia-Poliosis-Uveitis-Vitiligo-Deafness-Cuta Annular groves, Anodontia, Anodontia, Anodontia Vera, neous-Uveo-O. Alopecia Seminuniversalis, Alopecia Totalis, Anomalous Trichromasy, Anomalous Dysplasia of Dentin, Alopecia Universalis, Alpers Disease, Alpers Disease, Alpers Coronal Dentin Dysplasia, Anomic Aphasia, Anophthalmia, Diffuse Degeneration of Cerebral Gray Matter with Hepatic 30 Anorectal. Anorectal Malformations, Anosmia, Anterior Cirrhosis, Alpers Progressive Infantile Poliodystrophy, Bowing of the Legs with Dwarfism, Anterior Membrane Cor Alpha-1-Antitrypsin Deficiency, Alpha-1 4 Glucosidase neal Dystrophy, Anti-Convulsant Syndrome, Anti-Epstein Deficiency, Alpha-1 4 Glucosidase Deficiency, Alpha-Galac Barr Virus Nuclear Antigen (EBNA) Antibody Deficiency, tosidase A Deficiency, Alpha-Galactosidase B Deficiency, Antibody Deficiency, Antibody Deficiency with near normal Alpha-1 4 Glucosidase Deficiency, Alpha High-Density 35 Immunoglobulins, Antihemophilic Factor Deficiency, Anti Lipoprotein Deficiency, Alpha-L-Fucosidase Deficiency hemophilic Globulin Deficiency, Antiphospholipid Syn Fucosidosis Type 3, Alpha-GalNAc Deficiency Schindler drome, Antiphospholipid Syndrome, Antiphospholipid Anti Type, Alpha-1 4 Glucosidase Deficiency, Alpha-L-Fucosi body Syndrome, Antithrombin III Deficiency, Antithrombin dase Deficiency Fucosidosis Type 3. Alphalipoproteinemia, III Deficiency Classical (Type I), Antitrypsin Deficiency, Ant Alpha Mannosidosis, Alpha-N-Acetylgalactosaminidase 40 ley-Bixler Syndrome, Antoni’s Palsy, Anxietas Tibialis, Deficiency Schindler Type, Alpha-NAGA Deficiency Schin Aorta Arch Syndrome, Aortic and Mitral Atresia with Hypo dler Type, Alpha-Neuraminidase Deficiency, Alpha-Thalas plasic Left Heart Syndrome, Aortic Stenosis, Aortic Stenosis, semia/mental retardation syndrome non-deletion type, Aparoschisis, APC, APECED Syndrome, Apert Syndrome, Alphalipoproteinemia, Alport Syndrome, ALS, Alstroems Aperts, Aphasia, Aplasia AXialis Extracorticales Congenital, Syndrome, Alstroem, Alstrom Syndrome. Alternating 45 Aplasia Cutis Congenita, Aplasia Cutis Congenita with Ter Hemiplegia Syndrome. Alternating Hemiplegia of Child minal Transverse Limb Defects, Aplastic Anemia, Aplastic hood, Alzheimer's Disease, Amaurotic Familial Idiocy, Anemia with Congenital Anomalies, APLS, Apnea, Appala Amaurotic Familial Idiocy, Amaurotic Familial Idiocy Adult, chian Type Amyloidosis, Apple Peel Syndrome, Apraxia, Amaurotic Familial Infantile Idiocy, Amaurotic Familial Apraxia, Apraxia Buccofacial, Apraxia Constructional, Infantile Idiocy, Ambiguous Genitalia, AMC, AMD, Amelo 50 Apraxia Ideational, Apraxia Ideokinetic, Apraxia Ideomotor, blastoma, Amelogenesis Imperfecta, Amenorrhea-Galactor Apraxia Motor, Apraxia Oculomotor, APS, Arachnitis, rhea Nonpuerperal, Amenorrhea-Galactorrhea-FSH Arachnodactyly Contractural Beals Type, Arachnodactyly, Decrease Syndrome, Amenorrhea, Amino Acid Disorders, Arachnoid Cysts, Arachnoiditis Ossificans, Arachnoiditis, Aminoaciduria-Osteomalacia-Hyperphosphaturia Syn Aran-Duchenne, Aran-Duchenne Muscular Atrophy, drome, AMN, AMN, Amniocentesis, Amniocentesis, Amni 55 Aregenerative Anemia, Arginase Deficiency, Argininemia, otic Bands, Amniotic Band Syndrome, Amniotic Band Dis Arginino Succinase Deficiency, Argininosuccinase Defi ruption Complex, Amniotic Band Sequence, Amniotic ciency, Argininosuccinate Lyase Deficiency, Argininosuc Rupture Sequence, Amputation Congenital, AMS, Amster cinic Acid Lyase-ASL, Argininosuccinic Acid Synthetase dam Dwarf Syndrome de Lange, Amylo-1 6-Glucosidase Deficiency, Argininosuccinic Aciduria, Argonz-Del Castillo Deficiency, Amyloid Arthropathy of Chronic Hemodialysis, 60 Syndrome, Arhinencephaly, Armenian Syndrome, Arnold Amyloid Corneal Dystrophy, Amyloid Polyneuropathy, Chiari Malformation, Arnold-Chiari Syndrome, ARPKD, Amyloidosis, Amyloidosis of Familial Mediterranean Fever, Arrhythmic Myoclonus, Arrhythmogenic Right Ventricular Amylopectinosis, Amyoplasia Congenita, Amyotrophic Lat Dysplasia, Arteriohepatic Dysplasia, Arteriovenous Malfor eral Sclerosis, Amyotrophic Lateral Sclerosis, Amyotrophic mation, Arteriovenous Malformation, Arteriovenous Malfor Lateral Sclerosis-Polyglucosan Bodies, AN, AN 1, AN 2, 65 mation of the Brain, Arteritis Giant Cell, Arthritis, Arthritis Anal Atresia, Anal Membrane, Anal Rectal Malformations, Urethritica, Arthro-Dento-Osteodysplasia, Arthro-Opthalm Anal Rectal Malformations, Anal Stenosis, Analine 60 Amy opathy, Arthrochalasis Multiplex Congenita, Arthrogryposis US 7,662.929 B2 29 30 Multiplex Congenita, Arthrogryposis Multiplex Congenita, BE, Beals Syndrome, Beals Syndrome, Beals-Hecht Syn Distal, Type IIA, ARVD. Arylsulfatase-B Deficiency, AS, AS, drome, Bean Syndrome, BEB, BEB, Bechterew Syndrome, AS, AS, ASA Deficiency, Ascending Paralysis, ASD, Atri Becker Disease, Becker Muscular Dystrophy, Becker Mus oseptal Defects, ASH, Ashermans Syndrome, Ashkenazi cular Dystrophy, Becker Nevus, Beckwith Wiedemann Syn Type Amyloidosis, ASL Deficiency, Aspartylglu drome, Beckwith-Syndrome, Begnez-Cesar's Syndrome, cosaminuria, Aspartylglycosaminuria, Asperger's Syn Behcet’s syndrome, Behcet’s Disease, Behcet’s Disease, drome, Asperger's TypeAutism, Asphyxiating Thoracic Dys Behr 1, Behr 2, Bell's Palsy, Benign Acanthosis Nigricans, plasia, Asplenia Syndrome, ASS Deficiency, Asthma, Benign Astrocytoma, Benign Cranial Nerve Tumors, Benign Astrocytoma Grade I (Benign), Astrocytoma Grade II (Be Cystinosis, Benign Essential Blepharospasm, Benign Essen nign), Asymmetric Crying Facies with Cardiac Defects, 10 tial Tremor, Benign Familial Hematuria, Benign Focal Asymmetrical septal hypertrophy, Asymptomatic Callosal Amyotrophy, Benign Focal Amyotrophy of ALS, Benign Agenesis, AT, AT III Deficiency, AT III Variant IA, AT III Hydrocephalus, Benign Hypermobility Syndrome, Benign Variant Ib, AT 3, Ataxia, Ataxia Telangiectasia, Ataxia Keratosis Nigricans, Benign Paroxysmal Peritonitis, Benign Telangiectasia, Ataxia with Lactic Acidosis Type II, Ataxia Recurrent Hematuria, Benign Recurrent Intrahepatic Cerebral Palsy, Ataxiadynamia, Ataxiophemia, ATD, Athe 15 Cholestasis, Benign Spinal Muscular Atrophy with Hypertro toid Cerebral Palsy, Atopic Eczema, Atresia of Esophagus phy of the Calves, Benign Symmetrical Lipomatosis, Benign with or without Tracheoesophageal Fistula, Atrial Septal Tumors of the Central Nervous System, Berardinelli-Seip Defects, Atrial Septal Defect Primum, Atrial and Septal and Syndrome, Berger's Disease, Beriberi, Berman Syndrome, Small Ventricular Septal Defect, Atrial Flutter, Atrial Fibril Bernard-Horner Syndrome, Bernard-Soulier Syndrome, lation, Atriodigital Dysplasia, Atrioseptal Defects, Atrioven Besnier Prurigo, Best Disease, Beta-Alanine-Pyruvate Ami tricular Block, Atrioventricular Canal Defect, Atrioventricu notransferase, Beta-Galactosidase Deficiency Morquio Syn lar Septal Defect, Atrioventricular Septal Defect, Atrophia drome, Beta-Glucuronidase Deficiency, Beta Oxidation Bulborum Hereditaria, Atrophic Beriberi, Atrophy Olivopon Defects, Beta-oxidation Defects, Beta Thalassemia Major, tocerebellar, Attention Deficit Disorder, Attention Deficit Beta Thalassemia Minor, Betalipoprotein Deficiency, Beth Hyperactivity Disorder, Attentuated Adenomatous Polyposis 25 lem myopathy, Beuren Syndrome, BH4. Deficiency, BH4 Coli, Atypical Amyloidosis, Atypical Hyperphenylalanine Deficiency, Biber-Haab-Dimmer Corneal Dystrophy, Bicus mia, Atypical Hyperphenylalaninemia, Auditory Canal Atre pid Aortic Valve, Bicuspid Aortic Valve, Biedl-Bardet, Bifid sia, Auriculotemporal Syndrome, Autism, Autism Asperger's Cranium, Bifunctional Enzyme Deficiency, Bilateral Acous Type, Autism Dementia Ataxia and Loss of Purposeful Hand tic Neurofibromatosis, Bilateral Acoustic Neuroma, Bilateral Use, Autism Infantile Autism, Autoimmune Addison's Dis 30 Right-Sidedness Sequence, Bilateral Renal Agenesis, Bilat ease, Autoimmune Hemolytic Anemia, Autoimmune eral Temporal Lobe Disorder, Bilious Attacks, Bilirubin Glu Hemolytic Anemia, Autoimmune Hemolytic Anemia, curonosyltransferase Deficiency Type I, Binder Syndrome, Autoimmune Hemolytic Anemia, Autoimmune Hepatitis, Binswanger's Disease, Binswanger's Encephalopathy, Bio Autoimmune-Polyendocrinopathy-Candidias, Autoimmune tinidase deficiency, Bird-Headed Dwarfism Seckel Type, Polyglandular Disease Type I, Autosomal Dominant Albi 35 Birth Defects, Birthmark, Bitemporal Forceps Marks Syn nism, Autosomal Dominant Compelling Helioophthalmic drome, Biventricular Fibrosis, Bjornstad Syndrome, B-K Outburst Syndrome, Autosomal Dominant Desmin Distal Mole Syndrome, Black Locks-Albinism-Deafness of Senso myopathy with Late Onset, Autosomal Dominant EDS,Auto neural Type (BADS), Blackfan-Diamond Anemia, Blennor somal Dominant Emery-Dreifuss Muscular Dystrophy, Auto rheal Idiopathic Arthritis, Blepharophimosis, Ptosis, Epican Somal Dominant Keratoconus, Autosomal Dominant Peliza 40 thus Inversus Syndrome, Blepharospasm, Blepharospasm, eus-Merzbacher Brain Sclerosis, Autosomal Dominant Blepharospasm Benign Essential, Blepharospasm Oroman Polycystic Kidney Disease, Autosomal Dominant Spinocer dibular Dystonia, Blessig Cysts, BLFS, Blindness, Bloch ebellar Degeneration, Autosomal Recessive Agammaglobu Siemens Incontinentia Pigmenti Melanoblastosis Cutis Lin linemia, Autosomal Recessive Centronuclear myopathy, earis, Bloch-Siemens-Sulzberger Syndrome, Bloch Autosomal Recessive Conradi-Hunermann Syndrome, Auto 45 Sulzberger Syndrome, Blood types, Blood type A, Blood type somal Recessive EDS,Autosomal Recessive Emery-Dreifuss B, Blood type AB, Blood type O, Bloom Syndrome, Bloom Muscular Dystrophy, Autosomal Recessive Forms of Ocular Torre-Mackacek Syndrome, Blue Rubber Bleb Nevus, Blue Albinism, Autosomal Recessive Inheritance Agenesis of Cor Baby, Blue Diaper Syndrome, BMD, BOD, BOFS, Bone pus Callosum, Autosomal Recessive Keratoconus, Autoso Tumor-Epidermoid Cyst-Polyposis, Bonnet-Dechaume mal Recessive Polycystic Kidney Disease, Autosomal Reces 50 Blanc Syndrome, Bonnevie-Ulrich Syndrome, Book Syn sive Severe Combined Immunodeficiency, AV, AV, AVM, drome, BOR Syndrome. BORJ, Borjeson Syndrome, Borje AVSD, AWTA, Axilla Abscess. Axonal Neuropathy Giant, son-Forssman-Lehmann Syndrome, Bowen Syndrome, Azorean Neurologic Disease, B-K Mole Syndrome, Babin Bowen-Conradi Syndrome, Bowen-Conradi Hutterite, ski-Froelich Syndrome. BADS, Baillarger's Syndrome, Bal Bowen-Conradi Type Hutterite Syndrome, Bowman's Layer, kan Disease, Baller-Gerold Syndrome, Ballooning Mitral 55 BPEI, BPES, Brachial Neuritis, Brachial Neuritis Syndrome, Valve, Balo Disease Concentric Sclerosis, Baltic Myoclonus Brachial Plexus Neuritis, Brachial-Plexus-Neuropathy, Bra Epilepsy, Bannayan-Zonana syndrome (BZS), Bannayan-Ri chiocephalic Ischemia, Brachmann-de Lange Syndrome, ley-Ruvalcaba syndrome, Banti’s Disease, Bardet-Biedl Syn Brachycephaly, Brachycephaly, Brachymorphic Type Con drome, Bare Lymphocyte Syndrome, Barlow's syndrome, genital, Bradycardia, Brain Tumors, Brain Tumors Benign, Barraquer-Simons Disease, Barrett Esophagus, Barrett Ulcer, 60 Brain Tumors Malignant, Branched Chain Alpha-Ketoacid Barth Syndrome, Barth syndrome, Bartter's Syndrome, Basal Dehydrogenase Deficiency, Branched Chain Ketonuria I, Cell Nevus Syndrome, Basedow Disease, Bassen-Kornzweig Brancher Deficiency, Branchio-Oculo-Facial Syndrome, Syndrome, Batten Disease, Batten-Mayou Syndrome, Bat Branchio-Oto-Renal Dysplasia, Branchio-Oto-Renal Syn ten-Spielmeyer-Vogt's Disease, Batten. Turner Syndrome, drome, Branchiooculofacial Syndrome, Branchiootic Syn Batten Turner Type Congenital myopathy, Batten-Vogt Syn 65 drome, Brandt Syndrome, Brandywine Type Dentinogenesis drome, BBB Syndrome, BBB Syndrome (Opitz), BBBSyn Imperfecta, Brandywine type Dentinogenesis Imperfecta, drome, BBBG Syndrome, BCKD Deficiency, BD, BDLS, Breast Cancer, BRIC Syndrome, Brittle Bone Disease, Broad US 7,662.929 B2 31 32 Beta Disease, Broad Thumb Syndrome, Broad Thumbs and Hemangioma, Cavernous Lymphangioma, Cavernous Mal Great Toes Characteristic Facies and Mental Retardation, formations, Cayler Syndrome, Cazenave's Vitiligo, CBGD, Broad Thumb-Hallux, Broca's Aphasia, Brocq-Duhring Dis CBGD, CBPS, CBPS, CCA, CCD, CCD, CCHS, CCM Syn ease, Bronze Diabetes, Bronze Schilder's Disease, Brown drome, CCMS, CCO, CD, CDG 1a, CDG1A, CDGSType Ia, Albinism, Brown Enamel Hereditary, Brown-Sequard Syn CDGS Type Ia, CDGS, CDI, CdLS, Celiac Disease, Celiac drome, Brown Syndrome, BRRS, Brueghel Syndrome, Bru sprue, Celiac Sprue-Dermatitis, Cellelar Immunodeficiency ton's Agammaglobulinemia Common, BS, BSS, Buchanan’s with Purine Nucleoside Phosphorylase Deficiency, Celsus' Syndrome, Budd’s Syndrome, Budd-Chiari Syndrome, Vitiligo, Central Apnea, Central Core Disease, Central Core Buerger-Gruetz Syndrome, Bulbospinal Muscular Atrophy Disease, Central Diabetes Insipidus, Central Form Neurofi X-linked, Bulldog Syndrome, Bullosa Hereditaria, Bullous 10 bromatosis, Central HypoVentilation, Central Sleep Apnea, CIE, Bullous CIE, Bullous Congenital Ichthyosiform Eryth Centrifugal Lipodystrophy, Centronuclear myopathy, CEP. roderma, Bullous Ichthyosis, Bullous Pemphigoid, Burkitt's Cephalocele, Cephalothoracic Lipodystrophy, Ceramide Tri Lymphoma, Burkitt's Lymphoma African type, Burkitt's hexosidase Deficiency, Cerebellar Agenesis, Cerebellar Lymphoma Non-african type, BWS, Byler's Disease, C Syn Aplasia, Cerebellar Hemiagenesis, Cerebellar Hypoplasia, drome, C1 Esterase Inhibitor Dysfunction Type II 15 Cerebellar Vermis Aplasia, Cerebellar Vermis Agenesis-Hy Angioedema, C1-INH, C1 Esterase Inhibitor Deficiency pernea-Episodic Eye Moves-Ataxia-Retardation, Cerebellar Type I Angioedema, C1 NH, Cacchi-Ricci Disease, CAD, Syndrome, Cerebellarparenchymal Disorder IV. Cerebellom CADASIL, CAH, CAH, Calcaneal Valgus, Calcaneovalgus, edullary Malformation Syndrome, Cerebellomedullary Mal Calcium Pyrophosphate Dihydrate Deposits, Callosal Agen formation Syndrome, Cerebello-Oculocutaneous Telang esis and Ocular Abnormalities, Calves-Hypertrophy of Spi iectasia, Cerebelloparenchymal Disorder IV Familial, nal Muscular Atrophy, Campomelic Dysplasia, Campomelic Cerebellopontine Angle Tumor, Cerebral Arachnoiditis, Dwarfism, Campomelic Syndrome, Camptodactyly-Cleft Cerebral Autosomal Dominant Arteriopathy with Subcortical Palate-Clubfoot, Camptodactyly-Limited Jaw Excursion, Infarcts and Leukodystrophy, Cerebral Beriberi, Cerebral Camptomelic Dwarfism, Camptomelic Syndrome, Camp Diplegia, Cerebral Gigantism, Cerebral Malformations Vas tomelic Syndrome Long-Limb Type, Camurati-Engelmann 25 cular, Cerebral Palsy, Cerebro-Oculorenal Dystrophy, Cere Disease, Camurati-Engelmann Disease, Canada-Cronkhite bro-Oculo-Facio-Skeletal Syndrome, Cerebrocostomandibu Disease, Canavan disease, Canavan's Disease Included, lar syndrome, Cerebrohepatorenal Syndrome, Canavan's Leukodystrophy, Cancer, Cancer Family Syn Cerebromacular Degeneration, Cerebromacular Degenera drome Lynch Type, Cantrell Syndrome, Cantrel-Haller-Rav tion, Cerebromuscular Dystrophy Fukuyama Type, Cere ich Syndrome, Cantrell Pentalogy, Carbamyl Phosphate Syn 30 broocular Dysgenesis, Cerebroocular Dysplasia-Muscular thetase Deficiency, Carbohydrate Deficient Glycoprotein Dystrophy Syndrome, Cerebrooculofacioskeletal Syndrome, Syndrome, Carbohydrate-Deficient Glycoprotein Syndrome Cerebroretinal Arteriovenous Aneurysm, Cerebroside Lipi Type Ia, Carbohydrate-Induced Hyperlipemia, Carbohydrate dosis, Cerebrosidosis, Cerebrotendinous Xanthomatosis, Intolerance of Glucose Galactose, Carbon Dioxide Acidosis, Cerebrovascular Ferrocalcinosis, Ceroid-Lipofuscinosis Carboxylase Deficiency Multiple, Cardiac-Limb Syndrome, 35 Adult form, Cervical Dystonia, Cervical Dystonia, Cervico Cardio-auditory Syndrome, Cardioauditory Syndrome of Oculo-Acoustic Syndrome, Cervical Spinal Stenosis, Cervi Jervell and Lange-Nielsen, Cardiocutaneous Syndrome, Car cal Vertebral Fusion, CES, CF, CFC syndrome, CFIDS, dio-facial-cutaneous syndrome, Cardiofacial Syndrome Cay CFND, CGD, CGF, CGF, Chalasodermia Generalized, Cha ler Type, Cardiomegalia Glycogenica Diffusa, Cardiomega narin Dorfman Disease, Chanarin Dorfman Syndrome, Cha lia Glycogenica Diffusa, Cardiomyopathic Lentiginosis, 40 narin Dorfman Ichthyosis Syndrome, Chandler's Syndrome, Cardiomyopathy, Cardiomyopathy, Cardiomyopathy Asso Charcot's Disease, Charcot-Marie-Tooth, Charcot-Marie ciated with Desmin Storage myopathy, Cardiomyopathy Due Tooth Disease, Charcot-Marie-Tooth Disease Variant, Char to Desmin Defect, Cardiomyopathy-Neutropenia Syndrome, cot-Marie-Tooth-Roussy-Levy Disease, CHARGE Associa Cardiomyopathy-Neutropenia Syndrome, Cardiomyopathy tion, Charge Syndrome, CHARGE Syndrome, Chaunds Neutropenia Syndrome Lethal Infantile Cardio myopathy, 45 Ectodermal Dysplasias, Chediak-Higashi Syndrome, Che Cardiopathic Amyloidosis, Cardiospasm, Cardocardiac Syn diak-Higashi Syndrome, Chediak-Steinbrinck-Higashi Syn drome, Carnitine-Acylcarnitine Translocase Deficiency, Car drome, Cheilitis Granulomatosa, Cheiloschisis, Chemke nitine Deficiency and Disorders, Carnitine Deficiency Pri Syndrome, Cheney Syndrome, Cherry Red Spot and Myo mary, Carnitine Deficiency Secondary, Carnitine Deficiency clonus Syndrome, CHF, CHH, CHH, Chiari's Disease, Chiari Secondary to MCAD Deficiency, Carnitine Deficiency Syn 50 Malformation 1, Chiari Malformation, Chiari Type I (Chiari drome, Carnitine Palmitoyl Transferase I & II (CPT I & II). Malformation I), Chiari Type II (Chiari Malformation II), Carnitine Palmitoyltransferase Deficiency, Carnitine Palmi Chiari I Syndrome, Chiari-Budd Syndrome, Chiari-Frommel toyltransferase Deficiency Type 1, Carnitine Palmitoyltrans Syndrome, Chiari Malformation II, CHILD Syndrome, ferase Deficiency Type 2 benign classical muscular form CHILD Ichthyosis Syndrome, CHILD Syndrome Ichthyosis, included severe infantile form included, Carnitine Transport 55 Childhood Adrenoleukodystrophy, Childhood Dermatomyo Defect (Primary Carnitine Deficiency), Carnosinase Defi sitis, Childhood-onset Dystonia, Childhood Cyclic Vomiting, ciency, Carnosinemia, Caroli Disease, Carpenter syndrome, Childhood Giant Axonal Neuropathy, Childhood Hypophas Carpenters, Cartilage-Hair Hypoplasia, Cartilage-Hair phatasia, Childhood Muscular Dystrophy, CHN, Cholestasis, Hypoplasia, Castleman's Disease, Castleman's Disease Hya Cholestasis Hereditary Norwegian Type, Cholestasis Intrahe line Vascular Type, Castleman's Disease Plasma Cell Type, 60 patic, Cholestasis Neonatal, Cholestasis of Oral Contracep Castleman Tumor, Cat Eye Syndrome, Cat's Cry Syndrome, tive Users, Cholestasis with Peripheral Pulmonary Stenosis, Catalayse deficiency, Cataract-Dental Syndrome, Cataract Cholestasis of Pregnancy, Cholesterol Desmolase Defi X-Linked with Hutchinsonian Teeth, Catecholamine hor ciency, Cholesterol Desmolase Deficiency, Chondrodyspla mones, Catel-Manzke Syndrome, Catel-Manzke Type Pala sia Punctata, Chondrodystrophia Calcificans Congenita, todigital Syndrome, Caudal Dysplasia, Caudal Dysplasia 65 Chondrodystrophia Fetalis, Chondrodystrophic Myotonia, Sequence, Caudal Regression Syndrome, Causalgia Syn Chondrodystrophy, Chondrodystrophy with Clubfeet, Chon drome Major, Cavernomas, Cavernous Angioma, Cavernous drodystrophy Epiphyseal, Chondrodystrophy Hyperplastic US 7,662.929 B2 33 34 Form, Chondroectodermal Dysplasias, Chondrogenesis mosome 18 Monosomy 18Q, Chromosome 18 Ring, Chro Imperfecta, Chondrohystrophia, Chondroosteodystrophy, mosome 18 Tetrasomy 18p, Chromosome 18q-Syndrome, Choreoacanthocytosis, Chorionic Villi Sampling, Chorioreti Chromosome 21 Mosaic 21 Syndrome, Chromosome 21 nal Anomalies, Chorioretinal Anomalies with ACC, Chor Ring, Chromosome 21 Translocation 21 Syndrome, Chromo ireninal Coloboma-Joubert Syndrome, Choroidal Sclerosis, some 22 Inverted Duplication (22pter-22q11), Chromosome Choroideremia, Chotzen Syndrome, Chotzen Syndrome, 22 Partial Trisomy (22pter-22d 11), Chromosome 22 Ring, Christ-Siemens-Touraine Syndrome, Christ-Siemans-Tou Chromosome 22 Trisomy Mosaic, Chromosome 48 XXYY. raine Syndrome, Christmas Disease, Christmas Tree Syn Chromosome 48 XXXY. Chromosome r15, Chromosomal drome, Chromosome 3 Deletion of Distal 3p, Chromosome 3 Triplication, Chromosome Triplication, Chromosome Trip Distal 3p Monosomy, Chromosome 3-Distal 3q2 Duplica 10 loidy Syndrome, Chromosome X, Chromosome XXY. tion, Chromosome 3-Distal 3q2 Trisomy, Chromosome 3 Chronic Acholuric Jaundice, Chronic Adhesive Arachnoidi Monosomy 3p2, Chromosome 3q Partial Duplication Syn tis, Chronic Adrenocortical Insufficiency, Chronic Cavern drome, Chromosome 3q, Partial Trisomy Syndrome, Chro ositis, Chronic Congenital Aregenerative Anemia, Chronic mosome 3-Trisomy 3q2, Chromosome 4 Deletion 4q31-qter Dysphagocytosis, Chronic Familial Granulomatosis, Syndrome, Chromosome 4 Deletion 4q32-qter Syndrome, 15 Chronic Familial Icterus, Chronic Fatigue Immune Dysfunc Chromosome 4 Deletion 4q33-qter Syndrome, Chromosome tion Syndrome (CFIDS), Chronic Granulomatous Disease, 4 Long Arm Deletion, Chromosome 4 Long Arm Deletion, Chronic Guillain-Barre Syndrome, Chronic Idiopathic Jaun Chromosome 4 Monosomy 4q, Chromosome 4-Monosomy dice, Chronic Idiopathic Polyneuritis (CIP), Chronic Inflam 4q, Chromosome 4 Monosomy Distal 4q, Chromosome 4 matory Demyelinating Polyneuropathy, Chronic Inflamma Partial Deletion 4p, Chromosome 4, Partial Deletion of the tory Demyelinating Polyradiculoneuropathy, Chronic Motor Short Arm, Chromosome 4 Partial Monosomy of Distal 4q, Tic, Chronic Mucocutaneous Candidiasis, Chronic Multiple Chromosome 4 Partial Monosomy 4p, Chromosome 4 Partial Tics, Chronic Non-Specific Ulcerative Colitis, Chronic Non Trisomy 4 (q25-qter), Chromosome 4 Partial Trisomy 4 (q26 Specific Ulcerative Colitis, Chronic Obliterative Cholangitis, or q27-qter), Chromosome 4 Partial Trisomy 4 (q31 or Chronic Peptic Ulcer and Esophagitis Syndrome, Chronic 32-qter), Chromosome 4 Partial Trisomy 4p, Chromosome 4 25 Progressive Chorea, Chronic Progressive External Opthal Partial Trisomies 4q2 and 4q3, Chromosome 4 Partial Tri moplegia Syndrome, Chronic Progressive External Opthal Somy Distal 4, Chromosome 4 Ring, Chromosome 4 4q Ter moplegia and myopathy, Chronic Progressive External minal Deletion Syndrome, Chromosome 4q-Syndrome, Opthalmoplegia with Ragged Red Fibers, Chronic Relapsing Chromosome 4q-Syndrome, Chromosome 4 Trisomy 4, Polyneuropathy, Chronic Sarcoidosis, Chronic Spasmodic Chromosome 4 Trisomy 4p, Chromosome 4 XY/47 XXY 30 Dysphonia, Chronic Vomiting in Childhood, CHS, Churg (Mosiac), Chromosome 5 Monosomy 5p, Chromosome 5, Strauss Syndrome, Cicatricial Pemphigoid, CIP, Cirrhosis Partial Deletion of the Short Arm Syndrome, Chromosome 5 Congenital Pigmentary, Cirrhosis, Cistinuria, Citrullinemia, Trisomy 5p, Chromosome 5 Trisomy 5p Complete (5p11 CJD. Classic Schindler Disease, Classic Type Pfeiffer Syn pter), Chromosome 5 Trisomy 5p Partial (5p13 or 14-pter), drome, Classical Maple Syrup Urine Disease, Classical Chromosome 5p-Syndrome, Chromosome 6 Partial Trisomy 35 Hemophilia, Classical Form Cockayne Syndrome Type I 6q, Chromosome 6 Ring, Chromosome 6 Trisomy 6q2, Chro (Type A), Classical Leigh's Disease, Classical Phenylketo mosome 7 Monosomy 7p2, Chromosome 7 Partial Deletion nuria, Classical X-Linked Pelizaeus-Merzbacher Brain Scle of Short Arm (7p2-), Chromosome 7 Terminal 7p Deletion rosis, CLE, Cleft Lip/Palate Mucous Cysts Lower Lip PP del (7) (p21-p22), Chromosome 8 Monosomy 8p2, Chro Digital and Genital Anomalies, Cleft Lip-Palate Blepharo mosome 8 Monosomy 8p21-pter, Chromosome 8 Partial 40 phimosis Lagopthalmos and Hypertelorism, Cleft Lip/Palate Deletion (short arm), Chromosome 8 Partial Monosomy 8p2. with Abnormal Thumbs and Microcephaly, Cleft palate-joint Chromosome 9 Complete Trisomy 9P, Chromosome 9 Partial contractures-dandy walker malformations, Cleft Palate and Deletion of Short Arm, Chromosome 9 Partial Monosomy 9p, Cleft Lip, Cleidocranial Dysplasia w/Micrognathia, Absent Chromosome 9 Partial Monosomy 9p22, Chromosome 9 Par Thumbs, & Distal Aphalangia, Cleidocranial Dysostosis, tial Monosomy 9p22-pter, Chromosome 9 Partial Trisomy 9P 45 Cleidocranial Dysplasia, Click murmur syndrome, CLN1, Included, Chromosome 9 Ring, Chromosome 9 Tetrasomy Clonic Spasmodic, Cloustons Syndrome, Clubfoot, CMDI, 9p, Chromosome 9 Tetrasomy 9p Mosaicism, Chromosome 9 CMM, CMT, CMTC, CMTX, COA Syndrome, Coarctation Trisomy 9p (Multiple Variants), Chromosome 9 Trisomy 9 of the aorta, Coarctation of the aorta, Coats Disease, Cobble (pter-p21 to q32) Included, Chromosome 9 Trisomy Mosaic, stone dysplasia, Cochin Jewish Disorder, Cockayne Syn Chromosome 9 Trisomy Mosaic, Chromosome 10 Distal Tri 50 drome, COD-MD Syndrome, COD, Coffin Lowry Syn somy 10q, Chromosome 10 Monosomy, Chromosome 10 drome, Coffin Syndrome, Coffin Siris Syndrome, COFS Monosomy 10p, Chromosome 10, Partial Deletion (short Syndrome, Cogan Corneal Dystrophy, Cogan Reese Syn arm), Chromosome 10, 10p-Partial, Chromosome 10 Partial drome, Cohen Syndrome, Cold Agglutinin Disease, Cold Trisomy 10q24-qter, Chromosome 10 Trisomy 10q2, Partial Antibody Disease, Cold Antibody Disease, Cold Antibody Monosomy of Long Arm of Chromosome 11, Chromosome 55 Hemolytic Anemia, Cold Agglutinin Disease, Cold Aggluti 11 Partial Monosomy 11q, Chromosome 11 Partial Trisomy, nin Disease, Colitis Ulcerative, Colitis Gravis, Colitis Gravis, Chromosome 11 Partial Trisomy 11q13-qter, Chromosome Colitis Ulcerative Chronic Non-Specific Ulcerative Colitis, 11 Partial Trisomy 11q21-qter, Chromosome 11 Partial Tri Collodion Baby, Coloboma Heart Defects Atresia of the Somy 11q23-qter, Chromosome 11q, Partial Trisomy, Chro Choanae Retardation of Growth and Development Genital mosome 12 Isochromosome 12p Mosaic, Chromosome 13 60 and Urinary Anomalies and Ear Anomalies, Coloboma, Partial Monosomy 13q, Chromosome 13, Partial Monosomy Coloboma, Colonic Neurosis, Color blindness, Color blind of the Long Arm, Chromosome 14 Ring, Chromosome 14 ness, Colour blindness, Colour blindness, Colpocephaly, Trisomy, Chromosome 15 Distal Trisomy 15q, Chromosome Columnar-Like Esophagus, Combined Cone-Rod Degenera r15, Chromosome 15 Ring, Chromosome 15 Trisomy 15q2. tion, Combined Immunodeficiency with Immunoglobulins, Chromosome 15q Partial Duplication Syndrome, Chromo 65 Combined Mesoectodermal Dysplasia, Common Variable some 17 Interstitial Deletion 17p, Chromosome 18 Long Arm Hypogammaglobulinemia, Common Variable Immunodefi Deletion Syndrome, Chromosome 18 Monosomy 18p, Chro ciency, Common Ventricle, Communicating Hydrocephalus, US 7,662.929 B2 35 36 Complete Absense of Hypoxanthine-Guanine Phosphoribo tal Rubella Syndrome, Congenital Scalp Defects with Distal syltransferase, Complete Atrioventricular Septal Defect, Limb Reduction Anomalies, Congenital Sensory Neuropa Complement Component 1 Inhibitor Deficiency, Comple thy, Congenital SMA with arthrogryposis, Congenital ment Component C1 Regulatory Component Deficiency, Spherocytic Anemia, Congenital Spondyloepiphyseal Dys Complete Heart Block, Complex Carbohydrate Intolerance, plasia, Congenital Tethered Cervical Spinal Cord Syndrome, Complex Regional Pain Syndrome, Complex V ATP Syn Congenital Tyrosinosis, Congenital Varicella Syndrome, thase Deficiency, Complex I, Complex I NADH dehydroge Congenital Vascular Cavernous Malformations, Congenital nase deficiency, Complex II, Complex II Succinate dehydro Vascular Veils in the Retina, Congenital Word Blindness, genase deficiency, Complex III, Complex III Ubiquinone Congenital Wandering Spleen (Pediatric), Congestive Cardio cytochrome c oxidoreductase deficiency, Complex IV, 10 myopathy, Conical Cornea, Conjugated Hyperbilirubinemia, Complex IV Cytochrome c oxidase deficiency, Complex IV Conjunctivitis, Conjunctivitis Ligneous, Conjunctivo-Ure Deficiency, Complex V, Cone-Rod Degeneration, Cone-Rod thro-Synovial Syndrome, Conn's Syndrome, Connective Tis Degeneration Progressive, Cone Dystrophy, Cone-Rod Dys Sue Disease, Conradi Disease, Conradi Hunermann Syn trophy, Confluent Reticular Papillomatosis, Congenital with drome, Constitutional Aplastic Anemia, Constitutional low PK Kinetics, Congenital Absence of Abdominal 15 Erythroid Hypoplasia, Constitutional Eczema, Constitutional Muscles, Congenital Absence of the Thymus and Parathy Liver Dysfunction, Constitutional Thrombopathy, Constrict roids, Congenital Achromia, Congenital Addison's Disease, ing Bands Congenital, Constrictive Pericarditis with Dwarf Congenital Adrenal Hyperplasia, Congenital Adreneal ism, Continuous Muscle Fiber Activity Syndrome, Contrac Hyperplasia, Congenital Afibrinogenemia, Congenital tural Arachnodactyly, Contractural Arachnodactyly, Alveolar Hypoventilation, Congenital Anemia of Newborn, Contractures of Feet Muscle Atrophy and Oculomotor Congenital Bilateral Persylvian Syndrome, Congenital Apraxia, Convulsions, Cooley's anemia, Copper Transport Brown Syndrome, Congenital Cardiovascular Defects, Con Disease, Coproporphyria Porphyria Hepatica, Cor Triatria genital Central HypoVentilation Syndrome, Congenital Cere tum, Cor Triatriatum Sinistrum, Cor Triloculare Biatriatum, bral Palsy, Congenital Cervical Synostosis, Congenital Cor Biloculare, Cori Disease, Cornea Dystrophy, Corneal Clasped Thumb with Mental Retardation, Congenital Con 25 Amyloidosis, Corneal Clouding-Cutis Laxa-Mental Retarda tractural Arachnodactyly, Congenital Contractures Multiple tion, Corneal Dystrophy, Cornelia de Lange Syndrome, Coro with Arachnodactyly, Congenital Cyanosis, Congenital nal Dentine Dysplasia, Coronary Artery Disease, Coronary Defect of the Skull and Scalp, Congenital Dilatation of Intra Heart Disease, Corpus Callosum Agenesis, Cortical-Basal hepatic Bile Duct, Congenital Dysmyelinating Neuropathy, Ganglionic Degeneration, Corticalis Deformaris, Cortico Congenital Dysphagocytosis, Congenital Dysplastic Ang 30 Basal Ganglionic Degeneration (CBGD), Corticobasal iectasia, Congenital Erythropoietic Porphyria, Congenital Degeneration, Corticosterone Methloxidase Deficiency Type Erythropoietic Porphyria, Congenital Factor XIII Deficiency, I, Corticosterone Methyloxidase DeficiencyType II, Cortisol, Congenital Failure of Autonomic Control of Respiration, Costello Syndrome, Cot Death, COVESDEM Syndrome, Congenital Familial Nonhemolytic Jaundice Type I, Con COX, COX Deficiency, COX Deficiency French-Canadian genital Familial Protracted Diarrhea, Congenital Form Cock 35 Type, COX Deficiency Infantile Mitochondrial myopathy de ayne Syndrome Type II (Type B), Congenital Generalized Toni-Fanconi-Debre included, COX Deficiency Type Benign Fibromatosis, Congenital German Measles, Congenital Giant Infantile Mitochondrial Mypoathy, CP, CPEO, CPEO with Axonal Neuropathy, Congenital Heart Block, Congenital myopathy, CPEO with Ragged-Red Fibers, CPPD Familial Heart Defects, Congenital Hemidysplasia with Ichthyosis Form, CPT Deficiency, CPTD, Cranial Arteritis, Cranial Erythroderma and Limb Defects, Congenital Hemolytic 40 Meningoencephalocele, Cranio-Oro-Digital Syndrome, Jaundice, Congenital Hemolytic Anemia, Congenital Hepatic Craniocarpotarsal dystrophy, Craniocele, Craniodigital Syn Fibrosis, Congenital Hereditary Corneal Dystrophy, Con drome-Mental Retardation Scott Type, Craniofacial Dysos genital Hereditary Lymphedema, Congenital Hyperchondro tosis, Craniofacial Dysostosis-PD Arteriosus-Hypertricho plasia, Congenital Hypomyelinating Polyneuropathy, Con sis-Hypoplasia of Labia, Craniofrontonasal Dysplasia, genital Hypomyelination Neuropathy, Congenital 45 Craniometaphyseal Dysplasia, Cranioorodigital Syndrome, Hypomyelination, Congenital Hypomyelination Neuropathy, Cranioorodigital Syndrome Type II, Craniostenosis Crouzon Congenital Hypomyelination (Onion Bulb) Polyneuropathy, Type, Craniostenosis, Craniostenosis, Craniosynostosis Congenital Ichthyosiform Erythroderma, Congenital Kerato Choanal Atresia-Radial Humeral Synostosis, Craniosynosto conus, Congenital Lactic Acidosis, Congenital Lactose Intol sis-Hypertrichosis-Facial and Other Anomalies, Cranio erance, Congenital Lipodystrophy, Congenital Liver Cirrho 50 synostosis Midfacial Hypoplasia and Foot Abnormalities, sis, Congenital Lobar Emphysema, Congenital Localized Craniosynostosis Primary, Craniosynostosis-Radial Aplasia Emphysema, Congenital Macroglossia, Congenital Medul Syndrome, Craniosynostosis with Radial Defects, Cranium lary Stenosis, Congenital Megacolon, Congenital Melano Bifidum, CREST Syndrome, CREST Syndrome, Creutzfeldt cytic Nevus, Congenital Mesodermal Dysmorphodystrophy, Jakob Disease, Cri du Chat Syndrome, Crib Death, Crigler Congenital Mesodermal Dystrophy, Congenital MicroVillus 55 Najjar Syndrome Type I, Crohn's Disease, Crohn's Disease, Atrophy, Congenital Multiple Arthrogryposis, Congenital Cronkhite-Canada Syndrome, Cross Syndrome, Cross Syn Myotonic Dystrophy, Congenital Neuropathy caused by drome, Cross-McKusick-Breen Syndrome, Crouzon, Crou Hypomyelination, Congenital Pancytopenia, Congenital Per Zon Syndrome, Crouzon Craniofacial Dysostosis, Cryoglo nicious Anemia, Congenital Pernicious Anemia due to Defect bulinemia Essential Mixed, Cryptopthalmos-Syndactyly of Intrinsic Factor, Congenital Pernicious Anemia due to 60 Syndrome, Cryptorchidism-Dwarfism-Subnormal Mentality, Defect of Intrinsic Factor, Congenital Pigmentary Cirrhosis, Crystalline Corneal Dystrophy of Schnyder, CS, CSD, CSID, Congenital Porphyria, Congenital Proximal myopathy Asso CSO, CST Syndrome, Curly Hair-Ankyloblephanon-Nail ciated with Desmin Storage myopathy, Congenital Pulmo Dysplasia, Curschmann-Batten-Steinert Syndrome, Curth nary Emphysema, Congenital Pure Red Cell Anemia, Con Macklin Type Ichthyosis Hystric, Curth-Macklin Type, genital Pure Red Cell Aplasia, Congenital Retinal Blindness, 65 Cushings, Cushing Syndrome, Cushings III, Cutaneous Congenital Retinal Cyst, Congenital Retinitis Pigmentosa, Malignant Melanoma Hereditary, Cutaneous Porphyrias, Congenital Retinoschisis, Congenital Rod Disease, Congeni Cutis Laxa, Cutis Laxa, Cutis Laxa-Growth Deficiency Syn US 7,662.929 B2 37 38 drome, Cutis Marmorata Telangiectatica Congenita, CVI. Disease Myxedema, Diabetic Acidosis, Diabetic Bearded CVID, CVS, CVS, Cyclic vomiting syndrome, Cystic Dis Woman Syndrome, Diamond-Blackfan Anemia, Diaphrag ease of the Renal Medulla, Cystic Disease of the Renal matic Apnea, Diaphyseal Aclasis, Diastrophic Dwarfism, Medulla, Cystic Hygroma, Cystic Fibrosis, Cystic Lymphan Diastrophic Dysplasia, Diastrophic Nanism Syndrome, gioma, Cystine-Lysine-Arginine-Ornithinuria, Cystine Stor Dicarboxylic Aminoaciduria, Dicarboxylicaciduria Caused age Disease, Cystinosis, Cystinuria, Cystinuria with Dibasic by Defect in Beta-Oxidation of Fatty Acids, Dicarboxylicaci Aminoaciduria, Cystinuria Type I, Cystinuria Type II, Cysti duria due to Defect in Beta-Oxidation of Fatty Acids, Dicar nuria Type III, Cysts of the Renal Medulla Congenital, Cysts boxylicaciduria due to MCADH Deficiency, Dichromasy, of the Renal Medulla Congenital, Cytochrome COxidase Dicker-Opitz, DIDMOAD. Diencephalic Syndrome, Dien Deficiency, D.C., Dacryosialoadenopathy, Dacryosiaload 10 cephalic Syndrome of Childhood, Diencephalic Syndrome of enopathia, Dalpro, Dalton, Daltonism, Danbolt-Cross Syn Emaciation, Dienoyl-CoA Reductase Deficiency. Diffuse drome, Dancing Eyes-Dancing Feet Syndrome, Dandy Cerebral Degeneration in Infancy, Diffuse Degenerative Walker Syndrome, Dandy-Walker Cyst, Dandy-Walker Cerebral Disease. Diffuse Idiopathic Skeletal Hyperostosis, Deformity, Dandy Walker Malformation, Danish Cardiac Diffusum-Glycopeptiduria, DiGeorge Syndrome, DiGeorge Type Amyloidosis (Type III), Darier Disease, Davidson's 15 Syndrome, Digital-Oro-Cranio Syndrome, Digito-Oto-Pala Disease, Davies’ Disease, DBA, DBS, DC, DD, De Barsy tal Syndrome, Digito-Oto-Palatal Syndrome Type I, Digito Syndrome, De Barsy-Moens-Diercks Syndrome, de Lange Oto-Palatal Syndrome Type II, Dihydrobiopterin Synthetase Syndrome, De Morsier Syndrome, DeSantis Cacchione Syn Deficiency, Dihydrobiopterin Synthetase Deficiency, Dihy drome, de Toni-Fanconi Syndrome, Deafness Congenital and dropteridine Reductase Deficiency, Dihydropteridine Reduc Functional Heart Disease, Deafness-Dwarfism-Retinal Atro tase Deficiency, Dihydroxyacetonephosphate synthase, phy, Deafness-Functional Heart Disease, Deafness Onychod Dilated (Congestive) Cardio myopathy, Dimitri Disease, ystrophy Osteodystrophy and Mental Retardation, Deafness Diplegia of Cerebral Palsy, Diplo-Y Syndrome, Disacchari and Pili Torti Bjornstad Type, Deafness Sensorineural with dase Deficiency, Disaccharide Intolerance I, Discoid Lupus, Imperforate Anus and Hypoplastic Thumbs, Debrancher Discoid Lupus Erythematosus, DISH, Disorder of Cornifica Deficiency, Deciduous Skin, Defect of Enterocyte Intrinsic 25 tion, Disorder of Cornification Type I, Disorder of Cornifica Factor Receptor, Defect of Enterocyte Intrinsic Factor Recep tion 4, Disorder of Cornification 6, Disorder of Cornification tor, Defect in Natural Killer Lymphocytes, Defect of Renal 8, Disorder of Cornification 9 Netherton's Type, Disorder of Reabsorption of Carnitine, Deficiency of Glycoprotein Cornification 11 Phytanic Acid Type, Disorder of Cornifica Neuraminidase, Deficiency of Mitochondrial Respiratory tion 12 (Neutral Lipid Storage Type), Disorder of Cornifica Chain Complex IV. Deficiency of Platelet Glycoprotein Ib. 30 tion 13, Disorder of Cornification 14, Disorder of Cornifica Deficiency of Von Willebrand Factor Receptor, Deficiency of tion 14 Trichothiodystrophy Type, Disorder of Cornification Short-Chain Acyl-CoA Dehydrogenase (ACADS, Deformity 15 (Keratitis Deafness Type), Disorder of Cornification 16, with Mesomelic Dwarfism, Degenerative Chorea, Degenera Disorder of Cornification 18 Erythrokeratodermia Variabilis tive Lumbar Spinal Stenosis, Degos Disease, Degos Type, Disorder of Cornification 19, Disorder of Cornification Kohlmeier Disease, Degos Syndrome, DEH. Dejerine 35 20, Disorder of Cornification 24, Displaced Spleen, Dissemi Roussy Syndrome, Dejerine Sottas Disease, Deletion 9p nated Lupus Erythematosus, Disseminated Neurodermatitis, Syndrome Partial, Deletion 11q Syndrome Partial, Deletion Disseminated Sclerosis, Distal 11q Monosomy, Distal 11q 13q Syndrome Partial, Delleman-Oorthuys Syndrome, Syndrome, Distal Arthrogryposis Multiplex Congenita Type Delleman Syndrome, Dementia with Lobar Atrophy and IIA, Distal Arthrogryposis Multiplex Congenita Type IIA, Neuronal Cytoplasmic Inclusions, Demyelinating Disease, 40 Distal Arthrogryposis Type IIA, Distal Arthrogryposis Type DeMyer Syndrome, Dentin Dysplasia Coronal, Dentin Dys 2A, Distal Duplication 6q Distal Duplication 10q, Dup (10q) plasia Radicular, Dentin Dysplasia Type I, Dentin Dysplasia Syndrome, Distal Duplication 15q Distal Monosomy 9p, Type II, Dentinogenesis Imperfecta Brandywine type, Den Distal Trisomy 6q Distal Trisomy 10q Syndrome, Distal tinogenesis Imperfecta Shields Type, Dentinogenesis Imper Trisomy 11q, Divalproex, DJS, DKC, DLE, DLPIII, DM, fecta Shields Type, Dentinogenesis Imperfecta Type III, Den 45 DMC Syndrome, DMC Disease, DMD, DNS Hereditary, tinogenesis Imperfecta Type III, Dento-Oculo-Osseous DOC I, DOC2, DOC 4, DOC 6 (Harlequin Type), DOC 8 Dysplasia, Dento-Oculo-Osseous Dysplasia, Dentooculocu Curth-Macklin Type, DOC 11 Phytanic Acid Type, DOC 12 taneous Syndrome, Denys-Drash Syndrome, Depakene, (Neutral Lipid Storage Type), DOC 13, DOC 14, DOC 14 DepakeneTM exposure, Depakote, Depakote Sprinkle, Depig Trichothiodystrophy Type, DOC 15 (Keratitis Deafness mentation-Gingival Fibromatosis-Microphthalmia, Dercum 50 Type), DOC 16, DOC 16 Unilateral Hemidysplasia Type, Disease, Dercum Disease, Dermatitis Atopic, Dermatitis DOC 18, DOC 19, DOC 20, DOC 24, Dohle's Bodies-My Exfoliativa, Dermatitis Herpetiformis, Dermatitis Multifor elopathy, Dolichospondylic Dysplasia, Dolichostenomelia, mis, Dermatochalasia Generalized, Dermatolysis General Dolichostenomelia Syndrome, Dominant Type Kenny-Caffe ized, Dermatomegaly, Dermatomyositis sine myositis, Der Syndrome, Dominant Type Myotonia Congenita, Donahue matomyositis, Dermatosparaxis, Dermatostomatitis Stevens 55 Syndrome, Donath-Landsteiner Hemolytic Anemia, Donath Johnson Type, Desbuquois Syndrome, Desmin Storage Landsteiner Syndrome, DOOR Syndrome, DOORS Syn myopathy, Desquamation of Newborn, Deuteranomaly, Deu drome, Dopa-responsive Dystonia (DRD), Dorfman Cha teranomaly, Developmental Reading Disorder, Developmen narin Syndrome, Dowling-Meara Syndrome, Down tal Gerstmann Syndrome, Devergie Disease, Devic Disease, Syndrome, DR Syndrome, Drash Syndrome, DRD, Dreifuss Devic Syndrome, Dextrocardia-Bronchiectasis and Sinusitis, 60 Emery Type Muscular Dystrophy with Contractures, Dressler Dextrocardia with Situs Inversus, DGS, DGSX Golabi-Rosen Syndrome, Drifting Spleen, Drug-induced Acanthosis Nigri Syndrome Included, DH. DHAP alkyl transferase deficiency, cans, Drug-induced Lupus Erythematosus, Drug-related DHBS Deficiency, DHBS Deficiency, DHOF, DHPR Defi Adrenal Insufficiency, Drummond's Syndrome, Dry Beri ciency, DHPR Deficiency, Diabetes Insipidus, Diabetes beri, Dry Eye, DTD, Duane's Retraction Syndrome, Duane Insipidus Diabetes Mellitus Optic Atrophy and Deafness, 65 Syndrome, Duane Syndrome Type IA 1B and 1C, Duane Diabetes Insipidus Neurohypophyseal, Diabetes Insulin Syndrome Type 2A2B and 2C, Duane Syndrome Type 3A3B Dependent, Diabetes Mellitus, Diabetes Mellitus Addison's and 3C, Dubin Johnson Syndrome, Dubowitz Syndrome, US 7,662.929 B2 39 40 Duchenne, Duchenne Muscular Dystrophy, Duchenne's Congenita Angiomatosa, Hemangiectatic Hypertrophy, Elfin Paralysis, Duhring's Disease, Duncan Disease, Duncan's Facies with Hypercalcemia, Ellis-van Creveld Syndrome, Disease, Duodenal Atresia, Duodenal Stenosis, Duodenitis, Ellis Van Creveld Syndrome, Embryoma Kidney, Embryonal Duplication 4p Syndrome, Duplication 6q Partial, Dupuy's Adenomyosarcoma Kidney, Embryonal Carcinosarcoma Syndrome, Dupuytren’s Contracture, Dutch-Kennedy Syn Kidney, Embryonal Mixed Tumor Kidney, EMC, Emery drome, Dwarfism, Dwarfism Campomelic, Dwarfism Corti Dreyfus Muscular Dystrophy, Emery-Dreifuss Muscular cal Thickening of the Tubular Bones & Transient Hypocalce Dystrophy, Emery-Dreifuss Syndrome, EMF, EMG Syn mia, Dwarfism Levi’s Type, Dwarfism Metatropic, drome, Empty Sella Syndrome, Encephalitis Periaxialis Dif Dwarfism-Onychodysplasia, Dwarfism-Pericarditis, Dwarf fusa, Encephalitis Periaxialis Concentrica, Encephalocele, ism with Renal Atrophy and Deafness, Dwarfism with Rick 10 Encephalofacial Angiomatosis, Encephalopathy, Encephal ets, DWM. Dyggve Melchior Clausen Syndrome, Dysauto otrigeminal Angiomatosis, Enchondromatosis with Multiple nomia Familial, Dysbetalipoproteinemia Familial, Cavernous Hemangiomas, Endemic Polyneuritis, Endocar Dyschondrodysplasia with Hemangiomas, Dyschondrosteo dial Cushion Defect, Endocardial Cushion Defect, Endocar sis, Dyschromatosis Universalis Hereditaria, Dysencephalia dial Cushion Defects, Endocardial Dysplasia, Endocardial Splanchinocystica, Dyskeratosis Congenita, Dyskeratosis 15 Fibroelastosis (EFE), Endogenous Hypertriglyceridemia, Congenita Autosomal Recessive, Dyskeratosis Congenita Endolymphatic Hydrops, Endometrial Growths, Scoggins Type, Dyskeratosis Congenita Syndrome, Dyskera Endometriosis, Endomyocardial Fibrosis, Endothelial Cor tosis Follicularis Vegetans, Dyslexia, Dysmyelogenic Leu neal Dystrophy Congenital, Endothelial Epithelial Corneal kodystrophy, Dysmyelogenic Leukodystrophy-Megalobare, Dystrophy, Endothelium, Engelmann Disease, Enlarged Dysphonia Spastica, Dysplasia Epiphysialis Punctata, Dys Tongue, Enterocolitis, Enterocyte Cobalamin Malabsorption, plasia Epiphyseal Hemimelica, Dysplasia of Nails With Hyp Eosinophia Syndrome, Eosinophilic Cellulitis, Eosinophilic odontia, Dysplasia Cleidocranial, Dysplasia Fibrous, Dyspla Fasciitis, Eosinophilic Granuloma, Eosinophilic Syndrome, sia Gigantism Syndromex-Linked, Dysplasia Osteodental, Epidermal Nevus Syndrome, Epidermolysis bullosa, Epider Dysplastic Nevus Syndrome, Dysplastic Nevus Syndrome, molysis Bullosa, Epidermolysis Bullosa Acquisita, Epider Dysplastic Nevus Type, Dyssynergia Cerebellaris Myo 25 molysis Bullosa Hereditaria, Epidermolysis Bullosa Letalias, clonica, Dyssynergia Esophagus, Dystonia, Dystonia, Dys Epidermolysis Hereditaria Tarda, Epidermolytic Hyperkera topia Canthorum, Dystopia Canthorum, Dystrophia Adi tosis, Epidermolytic Hyperkeratosis (Bullous CIE), Epilepsia posogenitalis, Dystrophia Endothelialis Cornea, Dystrophia Procursiva, Epilepsy, Epinephrine, Epiphyseal Changes and Mesodermalis, Dystrophic Epidermolysis Bullosa, Dystro High Myopia, Epiphyseal Osteochondroma Benign, Epiphy phic Epidermolysis Bullosa, Dystrophy, Asphyxiating Tho 30 sealis Hemimelica Dysplasia, Episodic-Abnormal Eye racic, Dystrophy Myotonic, E-D Syndrome, Eagle-Barrett Movement, Epithelial Basement Membrane Corneal Dystro Syndrome, Eales Retinopathy, Eales Disease, Ear Anoma phy, Epithelial Corneal Dystrophy of Meesmann Juvenile, lies-Contractures-Dysplasia of Bone with Kyphoscoliosis, Epitheliomatosis Multiplex with Nevus, Epithelium, Epival, Ear Patella Short Stature Syndrome, Early Constraint EPS, Epstein-Barr Virus-Induced Lymphoproliferative Dis Defects, Early Hypercalcemia Syndrome with Elfin Facie, 35 ease in Males, Erb-Goldflam syndrome, Erdheim Chester Early-onset Dystonia, Eaton Lambert Syndrome, EB. Disease, Erythema Multiforme Exudativum, Erythema Poly Ebstein's anomaly, EBV Susceptibility (EBVS), EBVS, morphe Stevens Johnson Type, Erythroblastophthisis, Eryth ECD, ECPSG, Ectodermal Dysplasias, Ectodermal Dyspla roblastosis Fetalis, Erythroblastosis Neonatorum, Erythro sia Anhidrotic with Cleft Lip and Cleft Palate, Ectodermal blastotic Anemia of Childhood, Erythrocyte Dysplasia-Exocrine Pancreatic Insufficiency, Ectodermal 40 Phosphoglycerate Kinase Deficiency, Erythrogenesis Imper Dysplasia Rapp-Hodgkin type, Ectodermal and Mesodermal fecta, Erythrokeratodermia Progressiva Symmetrica, Eryth Dysplasia Congenital, Ectodermal and Mesodermal Dyspla rokeratodermia Progressiva Symmetrica Ichthyosis, Erythro sia with Osseous Involvement, Ectodermosis Erosiva Pluri keratodermia Variabilis, Erythrokeratodermia Variabilis, orificialis, Ectopia Lentis, Ectopia Vesicae, Ectopic ACTH Erythrokeratodermia Variabilis Type, Erythrokeratolysis Syndrome, Ectopic Adrenocorticotropic Hormone Syn 45 Hiemalis, Erythrokeratolysis Hiemalis, Erythrokeratolysis drome, Ectopic Anus, Ectrodactilia of the Hand, Ectrodac Hiemalis, Erythropoietic Porphyrias, Erythropoietic Porphy tyly, Ectrodactyly-Ectodermal Dysplasia-Clefting Syn ria, Escobar Syndrome, Esophageal Atresia, Esophageal drome, Ectrodactyly Ectodermal Dysplasias Clefting Aperistalsis, Esophagitis-Peptic Ulcer, Esophagus Atresia Syndrome, Ectrodactyly Ectodermal Dysplasia Cleft Lip/ and/or Tracheoesophageal Fistula, Essential Familial Hyper Cleft Palate, Eczema, Eczema-Thrombocytopenia-Immuno 50 lipemia, Essential Fructosuria, Essential Hematuria, Essen deficiency Syndrome, EDA, EDMD, EDS, EDS Arterial tial Hemorrhagic Thrombocythemia, Essential Hemorrhagic Ecchymotic Type, EDS Arthrochalasia, EDS Classic Severe Thrombocythemia, Essential Mixed Cryoglobulinemia, Form, EDS Dysfibronectinemic, EDS Gravis Type, EDS Essential Moschowitz Disease, Essential Thrombocythemia, Hypermobility, EDS Kyphoscoliotic, EDS Kyphoscoliosis, Essential Thrombocythemia, Essential Thrombocytopenia, EDS Mitis Type, EDSOcular-Scoliotic, EDS Progeroid, EDS 55 Essential Thrombocytosis, Essential Thrombocytosis, Essen Periodontosis, EDS Vascular, EEC Syndrome, EFE, EHBA, tial Tremor, Esterase Inhibitor Deficiency, Estren-Dameshek EHK, Ehlers Danlos Syndrome, Ehlers-Danlos syndrome, variant of Fanconi. Anemia, Estrogen-related Cholestasis, Ehlers Danlos IX, Eisenmenger Complex, Eisenmenger's ET, ET, ETF, Ethylmalonic Adipicaciduria, Eulenburg Dis complex, Eisenmenger Disease, Eisenmenger Reaction, ease, pc, EVCS, Exaggerated Startle Reaction, EXencephaly, Eisenmenger Syndrome, Eisenmenger Syndrome, Ekbom 60 Exogenous Hypertriglyceridemia, Exomphalos-Macroglos Syndrome, Ekman-Lobstein Disease, Ektrodactyly of the sia-Gigantism Syndrom, Exophthalmic Goiter, Expanded Hand, Ektrodactyly of the Hand, EKV, Elastin fiber disorders, Rubella Syndrome, Exstrophy of the Bladder, EXT, External Elastorrhexis Generalized, Elastosis Dystrophica Syndrome, Chondromatosis Syndrome, Extrahepatic Biliary Atresia, Elective Mutism (obsolete), Elective Mutism, Electrocardio Extramedullary Plasmacytoma, Exudative Retinitis, Eye gram (ECG or EKG), Electron Transfer Flavoprotein (ETF) 65 Retraction Syndrome, FA1, FAA, Fabry Disease, FAC, Dehydrogenase Deficiency: (GAII & MADD), Electrophysi FACEB, FACD, FACE, FACF, FACG, FACH, Facial Nerve ologic study (EPS), Elephant Nails From Birth, Elephantiasis Palsy, Facial Paralysis, Facial Ectodermal Dysplasias, Facial US 7,662.929 B2 41 42 Ectodermal Dysplasia, Facio-Scapulo-Humeral Dystrophy, drome, FFDD Type II, FG Syndrome, FGDY, FHS, Fibrin Facio-Auriculo-Vertebral Spectrum, Facio-cardio-cutaneous Stabilizing Factor Deficiency, Fibrinase Deficiency, Fibrin syndrome, Facio-Fronto-Nasal Dysplasia, Faciocutaneoskel oid Degeneration of Astrocytes, Fibrinoid Leukodystrophy, etal Syndrome, Faciodigitogenital syndrome, Faciogenital Fibrinoligase Deficiency, Fibroblastoma Perineural, Fibro dysplasia, Faciogenitopopliteal Syndrome, Faciopala cystic Disease of Pancreas, Fibrodysplasia Ossificans Pro toosseous Syndrome, Faciopalatoosseous Syndrome Type II, gressiva, Fibroelastic Endocarditis, Fibromyalgia, Fibromy Facioscapulohumeral muscular dystrophy, Factitious algia-Fibromyositis, Fibromyositis, Fibrosing Cholangitis, Hypoglycemia, Factor VIII Deficiency, Factor IX Deficiency, Fibrositis, Fibrous Ankylosis of Multiple Joints, Fibrous Cav Factor IX Deficiency, Factor XI Deficiency, Factor XII defi ernositis, Fibrous Dysplasia, Fibrous Plaques of the Penis, ciency, Factor XIII Deficiency, Fahr Disease, Fahr's Disease, 10 Fibrous Sclerosis of the Penis, Fickler-Winkler Type, Fiedler Failure of Secretion Gastric Intrinsic Factor, Fairbank Dis Disease, Fifth Digit Syndrome, Filippi Syndrome, Finnish ease, Fallots Tetralogy, Familial Acrogeria, Familial Acrog Type Amyloidosis (Type V), First Degree Congenital Heart eria, Familial Acromicria, Familial Acromicria, Familial Block, First and Second Branchial Arch Syndrome, Fischer's Adenomatous Colon Polyposis, Familial Adenomatous Poly Syndrome, Fish Odor Syndrome, Fissured Tongue, Flat posis with Extraintestinal Manifestations, Familial Alobar 15 Adenoma Syndrome, Flatau-Schilder Disease, Flavin Con Holoprosencephaly, Familial Alpha-Lipoprotein Deficiency, taining Monooxygenase 2, Floating Beta Disease, Floating Familial Amyotrophic Chorea with Acanthocytosis, Familial Harbor Syndrome, Floating Spleen, Floppy Infant Syndrome, Arrhythmic Myoclonus, Familial Articular Chondrocalcino Floppy Valve Syndrome, Fluent aphasia, FMD, FMF, FMO sis, Familial Atypical Mole-Malignant Melanoma Syndrome, Adult Liver Form, FMO2, FND, Focal Dermal Dysplasia Familial Broad Beta Disease, Familial Calcium Gout, Famil Syndrome, Focal Dermal Hypoplasia, Focal Dermato-Pha ial Calcium Pyrophosphate Arthropathy, Familial Chronic langeal Dysplasia, Focal Dystonia, Focal Epilepsy, Focal Obstructive Lung Disease, Familial Continuous Skin Peel Facial Dermal Dysplasia Type II, Focal Neuromyotonia, ing, Familial Cutaneous Amyloidosis, Familial Dysproteine FODH, Folling Syndrome, Fong Disease, FOP, Forbes Dis mia, Familial Emphysema, Familial Enteropathy Microvil ease. Forbes-Albright Syndrome. Forestier's Disease. For lus, Familial Foveal Retinoschisis, Familial Hibernation 25 sius-Eriksson Syndrome (X-Linked), Fothergill Disease, Syndrome, Familial High Cholesterol, Familial Hemochro Fountain Syndrome, Foveal Dystrophy Progressive, FPO matosis, Familial High Blood Cholesterol, Familial High Syndrome Type II, FPO, Fraccaro Type Achondrogenesis Density Lipoprotein Deficiency, Familial High Serum Cho (Type IB), Fragile X syndrome, Franceschetti-Zwalen-Klein lesterol, Familial Hyperlipidema, Familial Hypoproteinemia Syndrome, Francois Dyscephaly Syndrome, Francois with Lymphangietatic Enteropathy, Familial Jaundice, 30 Neetens Speckled Dystrophy, Flecked Corneal Dystrophy, Familial Juvenile Nephronophtisis-Associated Ocular Fraser Syndrome, FRAXA, FRDA, Fredrickson Type I Anomaly, Familial Lichen Amyloidosis (Type IX), Familial Hyperlipoproteinemia, Freeman-Sheldon Syndrome, Freire Lumbar Stenosis, Familial Lymphedema Praecox, Familial Maia Syndrome, Frey's Syndrome, Friedreich's Ataxia, Frie Mediterranean Fever, Familial Multiple Polyposis, Familial dreich's Ataxia, Friedreich's Disease, Friedreich's Tabes, Nuchal Bleb, Familial Paroxysmal Polyserositis, Familial 35 FRNS, Froelich's Syndrome. Frommel-Chiari Syndrome, Polyposis Coli, Familial Primary Pulmonary Hypertension, Frommel-Chiari Syndrome Lactation-Uterus Atrophy, Fron Familial Renal Glycosuria, Familial Splenic Anemia, Famil todigital Syndrome. Frontofacionasal Dysostosis, Frontofa ial Startle Disease, Familial Visceral Amyloidosis (Type cionasal Dysplasia, Frontonasal Dysplasia, Frontonasal Dys VIII), FAMMM, FANCA, FANCB, FANCC, FANCD, plasia with Coronal Craniosynostosis, Fructose-1-Phosphate FANCE, Fanconi Panmyelopathy, Fanconi Pancytopenia, 40 Aldolase Deficiency, Fructosemia, Fructosuria, Fryns Syn Fanconi II, Fanconi's Anemia, Fanconi's Anemia Type I. drome, FSH, FSHD, FSS, Fuchs Dystrophy, Fucosidosis Fanconi's Anemia Complementation Group, Fanconi's Ane Type 1, Fucosidosis Type 2, Fucosidosis Type 3, Fukuhara mia Complementation Group A, Fanconi's Anemia Comple Syndrome, Fukuyama Disease, Fukuyama Type Muscular mentation Group B, Fanconi's Anemia Complementation Dystrophy, Fukuyama Type Muscular Dystrophy, Fumary Group C, Fanconi's Anemia Complementation Group D, 45 lacetoacetase deficiency, Furrowed Tongue, G Syndrome, Fanconi's Anemia Complementation Group E, Fanconi's G6PD Deficiency, G6PD, GA I, GA IIB, GA IIA, GA II, Anemia Complementation Group G, Fanconi's Anemia GAII & MADD, Galactorrhea-Amenorrhea Syndrome Non Complementation Group H, Fanconi's Anemia Estren puerperal, Galactorrhea-Amenorrhea without Pregnancy, Dameshek Variant, FANF, FANG, FANH, FAP, FAPG, Far Galactosamine-6-Sulfatase Deficiency, Galactose-1-Phos ber's Disease, Farber's Lipogranulomatosis, FAS, Fasting 50 phate Uridyl Transferase Deficiency, Galactosemia, GALB Hypoglycemia, Fat-Induced Hyperlipemia, Fatal Granulo Deficiency, Galloway-Mowat Syndrome, Galloway Syn matous Disease of Childhood, Fatty Oxidation Disorders, drome, GALT Deficiency, Gammaglobulin Deficiency, Fatty Liver with Encephalopathy, FAV, FCH, FCMD, FCS GAN, Ganglioside Neuraminidase Deficiency, Ganglioside Syndrome, FD, FDH, Febrile Mucocutaneous Syndrome Sialidase. Deficiency, Gangliosidosis GM1 Type 1, Gangli Stevens Johnson Type, Febrile Neutrophilic Dermatosis 55 osidosis GM2 Type 2, Gangliosidosis Beta Hexosaminidase Acute, Febrile Seizures, Feinberg's syndrome, Feissinger B Deficiency, Gardner Syndrome, Gardner Syndrome, Gar Leroy-Reiter Syndrome, Female Pseudo-Turner Syndrome, goylism, Garies-Mason Syndrome, Gasser Syndrome, Gas Femoral Dysgenesis Bilateral-Robin Anomaly, Femoral Dys tric Intrinsic Factor Failure of Secretion, Enterocyte Cobal genesis Bilateral, Femoral Facial Syndrome, Femoral Hypo amin, Gastrinoma, Gastritis, Gastroesophageal Laceration plasia-Unusual Facies Syndrome, Fetal Alcohol Syndrome, 60 Hemorrhage, Gastrointestinal Polyposis and Ectodermal Fetal Anti-Convulsant Syndrome, Fetal Cystic Hygroma, Changes, Gastroschisis, Gaucher Disease, Gaucher Fetal Effects of Alcohol, Fetal Effects of Chickenpox, Fetal Schlagenhaufer, Gayet-Wernicke Syndrome, GBS, GCA, Effects of Thalidomide, Fetal Effects of Varicella Zoster GCM Syndrome, GCPS, Gee-Herter Disease, Gee-Thaysen Virus, Fetal Endomyocardial Fibrosis, Fetal Face Syndrome, Disease, Gehrig's Disease, Gelineau's Syndrome, Genee Fetal Iritis Syndrome, Fetal Transfusion Syndrome, Fetal 65 Wiedemann Syndrome, Generalized Dystonia, Generalized Valproate Syndrome, Fetal Valproic Acid Exposure Syn Familial Neuromyotonia, Generalized Fibromatosis, Gener drome, Fetal Varicella Infection, Fetal Varicella Zoster Syn alized Flexion Epilepsy, Generalized Glycogenosis, Gener US 7,662.929 B2 43 44 alized Glycogenosis, Generalized Hyperhidrosis, General Gottron’s Syndrome, H. Gottron’s Syndrome, Habit Spasms, ized Lipofuscinosis, Generalized Myasthenia Gravis, HAE, Hageman Factor Deficiency, Hageman factor, Haim Generalized Myotonia, Generalized Sporadic Neuromytonia, Munk Syndrome, Hajdu-Cheney Syndrome, Hajdu Cheney, Genetic Disorders, Genital Defects, Genital and Urinary HAL Deficiency, Hall-Pallister Syndrome, Hallermann-Stre Tract Defects, Genital and Urinary Tract Defects, Gerstmann 5 iff-Francois syndrome, Hallermann-Streiff Syndrome, Hall Syndrome, Gerstmann Tetrad, GHBP, GHD, GHR, Giant ervorden-Spatz Disease, Hallervorden-Spatz Syndrome, Hal AXonal Disease, Giant AXonal Neuropathy, Giant Benign lopeau-Siemens Disease, Hallux Duplication Postaxial Lymphoma, Giant Cell Glioblastoma Astrocytoma, Giant Polydactyly and Absence of Corpus Callosum, Halushi-Be Cell Arteritis, Giant Cell Disease of the Liver, Giant Cell hcet’s Syndrome, Hamartoma of the Lymphatics, Hand Hepatitis, Giant Cell of Newborns Cirrhosis, Giant Cyst of 10 Schueller-Christian Syndrome, HANE, Hanhart Syndrome, the Retina, Giant Lymph Node Hyperplasia, Giant Platelet Happy Puppet Syndrome, Harada Syndrome, HARD +/-E Syndrome Hereditary, Giant Tongue, gic Macular Dystrophy, Syndrome, HARD Syndrome, Hare Lip, Harlequin Fetus, Gilbert's Disease, Gilbert Syndrome, Gilbert-Dreyfus Syn Harlequin Type DOC 6, Harlequin Type Ichthyosis, Harle drome, Gilbert-Dreyfus Syndrome, Gilbert-Lereboullet Syn quin Type Ichthyosis, Harley Syndrome, Harrington Syn drome, Gilford Syndrome, Gilles de la Tourette's syndrome, 15 drome, Hart Syndrome, Hartnup Disease, Hartnup Disorder, Gillespie Syndrome, Gingival Fibromatosis-Abnormal Fin Hartnup Syndrome, Hashimoto's Disease, Hashimoto-Pritz gers Nails Nose Ear Splenomegaly, GLA Deficiency, GLA, ker Syndrome, Hashimoto's Syndrome, Hashimoto's Thy GLB1, Glioma Retina, Global aphasia, Globoid Leukodys roiditis, Hashimoto's Thyroiditis, Hashimoto-Pritzker Syn trophy, Glossoptosis Micrognathia and Cleft Palate, Gluco drome, Hay Wells Syndrome, Hay-Wells Syndrome of cerebrosidase deficiency, Glucocerebrosidosis, Glucose-6- Ectodermal Dysplasia, HCMM, HCP, HCTD, HD, Heart Phosphate Dehydrogenase Deficiency, Glucose-6-Phosphate Hand Syndrome (Holt-Oram Type), Heart Disease, Hecht Tranport Defect, Glucose-6-Phosphate Translocase Defi Syndrome, HED, Heerferdt-Waldenstrom and Lofgren's ciency, Glucose-G-Phosphatase Deficiency, Glucose-Galac Syndromes, Hegglin's Disease, Heinrichsbauer Syndrome, tose Malabsorption, Glucose-Galactose Malabsorption, Glu Hemangiomas, Hemangioma Familial, Hemangioma cosyl Ceramide Lipidosis, Glutaric Aciduria I, Glutaric 25 Thrombocytopenia Syndrome, Hemangiomatosis Chondro Acidemia I, Glutaric Acidemia II, Glutaric Aciduria II, Glu dystrophica, Hemangiomatous Branchial Clefts-Lip taric Aciduria Type II, Glutaric Aciduria Type III, Glutaricaci Pseudocleft Syndrome, Hemifacial Microsomia, Hemimega demia I, Glutaricacidemia II, Glutaricaciduria I, Glutaricaci lencephaly, Hemiparesis of Cerebral Palsy, Hemiplegia of duria II, Glutaricaciduria Type IIA, Glutaricaciduria Type Cerebral Palsy, Hemisection of the Spinal Cord, Hemochro IIB, Glutaryl-CoA Dehydrogenase Deficiency, Glutaurate 30 matosis, Hemochromatosis Syndrome, Hemodialysis-Re Aspartate Transport Defect, Gluten-Sensitive Enteropathy, lated Amyloidosis, Hemoglobin Lepore Syndromes, Glycogen Disease of Muscle Type VII, Glycogen Storage Hemolytic Anemia of Newborn, Hemolytic Cold Antibody Disease I, Glycogen Storage Disease III, Glycogen Storage Anemia, Hemolytic Disease of Newborn, Hemolytic-Uremic Disease IV. Glycogen Storage Disease Type V. Glycogen Syndrome, Hemolytic-Uremic Syndrome, Hemophilia, Storage Disease VI, Glycogen Storage Disease VII, Glycogen 35 Hemophilia A, Hemophilia B, Hemophilia B Factor IX, Storage Disease VIII, Glycogen Storage Disease Type II, Hemophilia C, Hemorrhagic Dystrophic Thrombocytopenia, Glycogen Storage Disease-Type II, Glycogenosis, Glyco Hemorrhagica Aleukia, Hemosiderosis, Hepatic Fructoki genosis Type I, Glycogenosis Type IA, Glycogenosis Type nase Deficiency, Hepatic Phosphorylase Kinase Deficiency, IB, Glycogenosis Type II, Glycogenosis Type II. Glycogeno Hepatic Porphyria, Hepatic Porphyrias, Hepatic Porphyrias, sis Type III, Glycogenosis Type IV, Glycogenosis Type V. 40 Hepatic Veno-Occlusive Disease, Hepato-Renal Syndrome, Glycogenosis Type VI. Glycogenosis Type VII, Glycogenosis Hepatolenticular Degeneration, Hepatophosphorylase Defi Type VIII, Glycolic Aciduria, Glycolic Aciduria, Glycolipid ciency, Hepatorenal Glycogenosis, Hepatorenal Syndrome, Lipidosis, GM2 Gangliosidosis Type 1, GM2 Gangliosidosis Hepatorenal Tyrosinemia, Hereditary Acromelalgia, Heredi Type 1, GNPTA, Goitrous Autoimmune Thyroiditis, Golden tary Alkaptonuria, Hereditary Amyloidosis, Hereditary har Syndrome, Goldenhar-Gorlin Syndrome, Goldscheider's 45 Angioedema, Hereditary Areflexic Dystasia, Heredopathia Disease, Goltz Syndrome, Goltz-Gorlin Syndrome, Gonadal Atactica Polyneuritiformis, Hereditary Ataxia, Hereditary Dysgenesis 45 X, Gonadal Dysgenesis XO, Goniodysgen Ataxia, Hereditary Ataxia Friedrich's Type, Hereditary esis-Hypodontia, Goodman Syndrome, Goodman, Goodpas Benign Acanthosis Nigricans, Hereditary Cerebellar Ataxia, ture Syndrome, Gordon Syndrome, Gorlin’s Syndrome, Gor Hereditary Chorea, Hereditary Chronic Progressive Chorea, lin-Chaudhry-Moss Syndrome, Gottron 50 Hereditary Connective Tissue Disorders, Hereditary Copro Erythrokeratodermia Congenitalis Progressiva Symmetrica, porphyria, Hereditary Coproporphyria Porphyria, Hereditary Gottron’s Syndrome, Gougerot-Carteaud Syndrome, Grand Cutaneous Malignant Melanoma, Hereditary Deafness-Re Mal Epilepsy, Granular Type Corneal Dystrophy, Granulo tinitis Pigmentosa, Heritable Disorder of Zinc Deficiency, matous Arteritis, Granulomatous Colitis, Granulomatous Hereditary DNS, Hereditary Dystopic Lipidosis, Hereditary Dermatitis with Eosinophilia, Granulomatous Ileitis, Graves 55 Emphysema, Hereditary Fructose Intolerance, Hereditary Disease, Graves Hyperthyroidism, Graves Disease, Greig Hemorrhagic Telangiectasia, Hereditary Hemorrhagic Cephalopolysyndactyly Syndrome, Groenouw Type I Cor Telangiectasia Type I, Hereditary Hemorrhagic Telangiecta neal Dystrophy, Groenouw Type II Corneal Dystrophy, Gron sia Type II, Hereditary Hemorrhagic Telangiectasia Type III, blad-Strandberg Syndrome, Grotton Syndrome, Growth Hor Hereditary Hyperuricemia and Choreoathetosis Syndrome, mone Receptor Deficiency, Growth Hormone Binding 60 Hereditary Leptocytosis Major, Hereditary Leptocytosis Protein Deficiency, Growth Hormone Deficiency, Growth Minor, Hereditary Lymphedema, Hereditary Lymphedema Mental Deficiency Syndrome of Myhre. Growth Retardation Tarda, Hereditary Lymphedema Type I, Hereditary Lymphe Rieger Anomaly, GRS, Gruber Syndrome, GS, GSD6, GSD8, dema Type II, Hereditary Motor Sensory Neuropathy, GTS, Guanosine Triphosphate-Cyclohydrolase Deficiency, Hereditary Motor Sensory Neuropathy I, Hereditary Motor Guanosine Triphosphate-Cyclohydrolase Deficiency, Guen 65 Sensory Neuropathy Type III, Hereditary Nephritis, Heredi ther Porphyria, Guerin-Stem Syndrome, Guillain-Barré, tary Nephritis and Nerve Deafness, Hereditary Nephropathic Guillain-Barre Syndrome, Gunther Disease, H Disease, H. Amyloidosis, Hereditary Nephropathy and Deafness, US 7,662.929 B2 45 46 Hereditary Nonpolyposis Colorectal Cancer, Hereditary Hypercalcemia Familial with Nephrocalcinosis and Indica Nonpolyposis Colorectal Carcinoma, Hereditary Nonsphero nuria, Hypercalcemia-Supravalvar Aortic Stenosis, Hyper cytic Hemolytic Anemia, Hereditary Onychoosteodysplasia, calciuric Rickets, Hypercapnic acidosis, Hypercatabolic Pro Hereditary Optic Neuroretinopathy, Hereditary Polyposis tein-Losing Enteropathy, Hyperchloremic acidosis, Coli, Hereditary Sensory and Autonomic Neuropathy Type I, Hypercholesterolemia, Hypercholesterolemia Type IV. Hereditary Sensory and Autonomic Neuropathy Type II, Hyperchylomicronemia, Hypercystinuria, Hyperekplexia, Hereditary Sensory and Autonomic Neuropathy Type III, Hyperextensible joints, Hyperglobulinemic Purpura, Hyper Hereditary Sensory Motor Neuropathy, Hereditary Sensory glycinemia with Ketoacidosis and Lactic Acidosis Propionic Neuropathy type I, Hereditary Sensory Neuropathy Type I, Type, Hyperglycinemia Nonketotic, Hypergonadotropic Hereditary Sensory Neuropathy Type II, Hereditary Sensory 10 Hypogonadism, Hyperimmunoglobulin E Syndrome, Hyper Neuropathy Type III, Hereditary Sensory Radicular Neuropa immunoglobulin E-Recurrent Infection Syndrome, Hyperim thy Type I, Hereditary Sensory Radicular Neuropathy Type I, munoglobulinemia E-Staphylococcal, Hyperkalemia, Hereditary Sensory Radicular Neuropathy Type II, Heredi Hyperkinetic Syndrome, Hyperlipemic Retinitis, Hyperlipi tary Site Specific Cancer, Hereditary Spherocytic Hemolytic demia I, Hyperlipidemia IV. Hyperlipoproteinemia Type I, Anemia, Hereditary Spherocytosis, Hereditary Tyrosinemia 15 Hyperlipoproteinemia Type III, Hyperlipoproteinemia Type Type 1, Heritable Connective Tissue Disorders, Herlitz Syn IV. Hyperoxaluria, Hyperphalangy-Clinodactyly of Index drome, Hermans-Herzberg Phakomatosis, Hermansky-Pud Finger with Pierre Robin. Syndrome, Hyperphenylalanemia, lak Syndrome, Hermansky-Pudlak Syndrome, Hermaphro Hyperplastic Epidermolysis Bullosa, Hyperpnea, Hyperpo ditism, Herpes Zoster, Herpes Iris Stevens-Johnson Type, tassemia, Hyperprebeta-Lipoproteinemia, Hyperprolinemia Hers Disease, Heterozygous Beta Thalassemia, Hexoamini Type I, Hyperprolinemia Type II, Hypersplenism, Hyperte dase Alpha-Subunit Deficiency (Variant B), Hexoaminidase lorism with Esophageal Abnormalities and Hypospadias, Alpha-Subunit Deficiency (Variant B), HFA. HFM, HGPS, Hypertelorism-Hypospadias Syndrome, Hypertrophic Car HH, HHHO, HHRH, HHT, Hiatal Hernia-Microcephaly dio myopathy, Hypertrophic Interstitial Neuropathy, Hyper Nephrosis Galloway Type, Hidradenitis Suppurativa, Hidro trophic Interstitial Neuritis, Hypertrophic Interstitial Radicu sadenitis Axillaris, Hidrosadenitis Suppurativa, Hidrotic 25 loneuropathy, Hypertrophic Neuropathy of Refsum, Ectodermal Dysplasias, HIE Syndrome, High Imperforate Hypertrophic Obstructive Cardiomyopathy, Hyperuricemia Anus, High Potassium, High Scapula, HIM, Hirschsprung's Choreoathetosis Self-mutilation Syndrome, Hyperuricemia Disease, Hirschsprung's Disease Acquired, Hirschsprung Oligophrenia, Hypervalinemia, Hypocalcified (Hypominer Disease Polydactyly of Ulnar & Big Toe and VSD, Hirschs alized) Type, Hypochondrogenesis, Hypochrondroplasia, prung Disease with Type D Brachydactyly, Hirsutism, HIS 30 Hypogammaglobulinemia, Hypogammaglobulinemia Tran Deficiency. Histidine Ammonia-Lyase (HAL) Deficiency, sient of Infancy, Hypogenital Dystrophy with Diabetic Ten Histidase Deficiency. Histidinemia, Histidinemia, Histiocy dency, Hypoglossia-Hypodactylia Syndrome, Hypoglyce tosis, Histiocytosis X, HLHS, HLP Type II, HMG, HMI, mia, Hypoglycemia, Exogenous Hypoglycemia, HMSNI, HNHA, HOCM, Hodgkin Disease, Hodgkin’s Dis Hypoglycemia with Macroglossia, Hypoglycosylation Syn ease, Hodgkin’s Lymphoma, Hollaender-Simons Disease, 35 drome Type 1a, Hypoglycosylation Syndrome Type 1a, Holmes-Adie Syndrome, Holocarboxylase Synthetase Defi Hypogonadism with Anosmia, Hypogonadotropic Hypogo ciency, Holoprosencephaly, Holoprosencephaly Malforma nadism and Anosmia, Hypohidrotic Ectodermal Dysplasia, tion Complex, Holoprosencephaly Sequence, Holt-Oram Hypohidrotic Ectodermal Dysplasia Autosomal Dominant Syndrome, Holt-Oram Type Heart-Hand Syndrome, type, Hypohidrotic Ectodermal Dysplasias Autorecessive, Homocystinemia, Homocystinuria, Homocystinuria, 40 Hypokalemia, Hypokalemic Alkalosis with Hypercalciuria, Homogentisic Acid Oxidase Deficiency, Homogentisic Aci Hypokalemic Syndrome, Hypolactasia, Hypomaturation dura, Homozygous Alpha-1-Antitrypsin Deficiency, HOOD, Type (Snow-Capped Teeth), Hypomelanosis of Ito, Hypome Horner Syndrome, Horton's disease, HOS, HOS1, Houston lia-Hypotrichosis-Facial Hemangioma Syndrome, Hypomy Harris Type Achrondrogenesis (Type IA), HPS, HRS, HS, elination Neuropathy, Hypoparathyroidism, Hypophosphata HS, HS, HS, HS, HSAN Type I, HSAN Type II, HSAN-III, 45 sia, Hypophosphatemic Rickets with Hypercalcemia, HSMN, HSMN Type III, HSN I, HSN-III, Huebner-Herter Hypopigmentation, Hypopigmentation, Hypopigmented Disease, Hunner's Patch, Hunner's Ulcer, Hunter Syndrome, macular lesion, Hypoplasia of the Depressor Anguli Oris Hunter Syndrome, Hunter-Thompson Type Acromesomelic Muscle with Cardiac Defects, Hypoplastic Anemia, Hypo Dysplasia, Huntington's Chorea, Huntington's Disease, plastic Congenital Anemia, Hypoplastic Chondrodystrophy, Hurler Disease, Hurler Disease, Hurler Syndrome, Hurler 50 Hypoplastic Enamel-Onycholysis-Hypohidrosis, Hypoplas Scheie Syndrome, HUS, HUS. Hutchinson-Gilford Progeria tic (Hypoplastic-Explastic) Type, Hypoplastic Left Heart Syndrome, Hutchinson-Gilford Syndrome, Hutchinson-We Syndrome, Hypoplastic Left Heart Syndrome, Hypoplastic ber-Peutz Syndrome, Hutchinson-Weber-Peutz Syndrome, Triphalangeal Thumbs, Hypopotassemia Syndrome, Hypos Hutterite Syndrome Bowen-Conradi Type, Hyaline Panneur padias-Dysphagia Syndrome, Hyposmia, Hypothalamic opathy, Hydranencephaly, Hydrocephalus, Hydrocephalus 55 Hamartoblastoma Hypopituitarism Imperforate Anus Poly Agyria and Retinal Dysplasia, Hydrocephalus Internal dactyly, Hypothalamic Infantilism-Obesity, Hypothyroid Dandy-Walker Type, Hydrocephalus Noncommunicating ism, Hypotonia-Hypomentia-Hypogonadism-Obesity Syn Dandy-Walker Type, Hydrocephaly, Hydronephrosis With drome, Hypoxanthine-Guanine Phosphoribosyltransferase Peculiar Facial Expression, Hydroxylase Deficiency, Defect (Complete Absense of), I-Cell Disease, Iatrogenic Hygroma Colli, Hyper-IgE Syndrome, Hyper-IgM Syn 60 Hypoglycemia, IBGC, IBIDS Syndrome, IBM, IBS, IC, drome, Hyper IgM Syndrome, Hyperaldosteronism, Hyper I-Cell Disease, ICD, ICE Syndrome Cogan-Reese Type, Ice aldosteronism With Hypokalemic Alkatosis, Hyperaldoster landic Type Amyloidosis (Type VI), I-Cell Disease, Ichthy onism Without Hypertension, Hyperammonemia, osiform Erythroderma Corneal Involvement and Deafness, Hyperammonemia Due to Carbamylphosphate Synthetase Ichthyosiform Erythroderma Hair Abnormality Growth and Deficiency, Hyperammonemia Due to Ornithine Transcar 65 Men, Ichthyosiform Erythroderma with Leukocyte Vacuola bamylase Deficiency, Hyperammonemia Type II, Hyper-Beta tion, Ichthyosis, Ichthyosis Congenita, Ichthyosis Congenital Carnosinemia, Hyperbilirubinemia I, Hyperbilirubinemia II, with Trichothiodystrophy, Ichthyosis Hystrix, Ichthyosis US 7,662.929 B2 47 48 Hystrix Gravior, Ichthyosis Linearis Circumflexa, Ichthyosis thosis Nigricans, Insulin Lipodystrophy, Insulin dependent Simplex, Ichthyosis Tay Syndrome, Ichthyosis Vulgaris, Ich Diabetes, Intention Myoclonus, Intermediate Cystinosis, thyosis Vulgaris, Ichthyotic Neutral Lipid Storage Disease, Intermediate Maple Syrup Urine Disease, Intermittent Ataxia Icteric Leptospirosis, Icterohemorrhagic Leptospirosis, Ict with Pyruvate Dehydrogenase Deficiency, Intermittent erus (Chronic Familial), Icterus Gravis Neonatorum, Icterus Ataxia with Pyruvate Dehydrogenase Deficiency, Intermit Intermittens Juvenalis, Idiopathic Alveolar Hypoventilation, tent Maple Syrup Urine Disease, Internal Hydrocephalus, Idiopathic Amyloidosis, Idiopathic Arteritis of Takayasu, Interstitial Cystitis, Interstitial Deletion of 4q Included, Inter Idiopathic Basal Ganglia Calcification (IBGC), Idiopathic stitial Deletion of 4q-Included, Intestinal Lipodystrophy, Brachial Plexus Neuropathy, Idiopathic Cervical Dystonia, Intestinal Lipophagic Granulomatosis, Intestinal Lymphang Idiopathic Dilatation of the Pulmonary Artery, Idiopathic 10 iectasia, Intestinal Polyposis I, Intestinal Polyposis II, Intes Dilatation of the Pulmonary Artery, Idiopathic Facial Palsy, tinal Polyposis II, Intestinal Polyposis III, Intestinal Polypo Idiopathic Familial Hyperlipemia, Idiopathic Hypertrophic sis-Cutaneous Pigmentation Syndrome, Intestinal Polyposis Subaortic Stenosis, Idiopathic Hypoproteinemia, Idiopathic Cutaneous Pigmentation Syndrome, Intestinal Immunoglobulin Deficiency, Idiopathic Neonatal Hepatitis, Pseudoobstruction with External Opthalmoplegia, Intracra Idiopathic Non-Specific Ulcerative Colitis, Idiopathic Non 15 nial Neoplasm, Intracranial Tumors, Intracranial Vascular Specific Ulcerative Colitis, Idiopathic Peripheral Periphlebi Malformations, Intrauterine Dwarfism, Intrauterine Syn tis, Idiopathic Pulmonary Fibrosis, Idiopathic Refractory echiae, Inverted Smile And Occult Neuropathic Bladder, Sideroblastic Anemia, Idiopathic Refractory Sideroblastic Iowa Type Amyloidosis (Type IV), IP, IPA, Iridocorneal Anemia, Idiopathic Renal Hematuria, Idiopathic Steatorrhea, Endothelial Syndrome, Iridocorneal Endothelial (ICE) Syn Idiopathic Thrombocythemia, Idiopathic Thrombocythemia, drome Cogan-Resse Type, Iridogoniodysgenesis With Idiopathic Thrombocytopenic Purpura, Idiopathic Thromb Somatic Anomalies, Iris Atrophy with Corneal Edema and ocytopenia Purpura (ITP), IDPA, IDPA, IgA Nephropathy, Glaucoma, Iris Nevus Syndrome, Iron Overload Anemia, IgA Nephropathy, IHSS, Ileitis, Ileocolitis, Illinois Type Iron Overload Anemia, Iron Overload Disease, Irritable Amyloidosis, ILS, IM, IMD2, IMD5, IMD5, Immune Defect Bowel Syndrome, Irritable Colon Syndrome, Isaacs Syn due to Absence of Thymus, Immune Hemolytic Anemia Par 25 drome, Isaacs-Merten Syndrome, Ischemic Cardio myopa oxysmal Cold, Immunodeficiency with Ataxia Telangiecta thy, Isolated Lissencephaly Sequence, Isoleucine 33 Amyloi sia, Immunodeficiency Cellular with Abnormal Immunoglo dosis, Isovaleric Acid CoA Dehydrogenase Deficiency, bulin Synthesis, Immunodeficiency Common Variable Isovaleric Acidaemia, ISOValericacidemia, Isovaleryl CoA Unclassifiable, Immunodeficiency with Hyper-IgM, Immu Carboxylase Deficiency, ITO Hypomelanosis, ITO, ITP, ITP, nodeficiency with Leukopenia, Immunodeficiency-2, Immu 30 IVA, Ivemark Syndrome, Iwanoff Cysts, Jackknife Convul nodeficiency-5 (IMD5). Immunoglobulin Deficiency, Imper Sion, Jackson-Weiss Craniosynostosis, Jackson-Weiss Syn forate Anus, Imperforate Anus with Hand Foot and Ear drome, Jacksonian Epilepsy, Jacobsen Syndrome, Jadassohn Anomalies, Imperforate Nasolacrimal Duct and Premature Lewandowsky Syndrome, Jaffe-Lichenstein Disease, Aging Syndrome, Impotent Neutrophil Syndrome, Inability Jakob's Disease, Jakob-Creutzfeldt Disease, Janeway I, Jan To Open Mouth Completely And Short Finger-Flexor, INAD. 35 eway Dysgammaglobulinemia, Jansen Metaphyseal Dysos INAD. Inborn Error of Urea Synthesis Arginase Type, Inborn tosis, Jansen Type Metaphyseal Chondrodysplasia, Jarcho Error of Urea Synthesis Arginino Succinic Type, Inborn Levin Syndrome, Jaw-Winking, JBS. JBS. JDMS, Jegher's Errors of Urea Synthesis Carbamyl Phosphate Type, Inborn Syndrome, Jegher's Syndrome, Jejunal Atresia, Jeunitis, Error of Urea Synthesis Citrullinemia Type, Inborn Errors of Jejunoileitis, Jervell and Lange-Nielsen Syndrome, Jeune Urea Synthesis Glutamate Synthetase Type, INCL, Inclusion 40 Syndrome, JMS, Job Syndrome, Job-Buckley Syndrome, body myositis, Incomplete Atrioventricular Septal Defect, Johanson-Blizzard Syndrome, John Dalton, Johnson-Stevens Incomplete Testicular Feminization, Incomplete Testicular Disease, Jonston's Alopecia, Joseph’s Disease, Joseph's Dis Feminization, Incontinentia Pigmenti, Incontinentia Pig easeType I, Joseph’s Disease Type II, Joseph’s DiseaseType menti, Incontinenti Pigmenti Achromians, Index Finger III, Joubert Syndrome, Joubert-Bolthauser Syndrome, JRA, Anomaly with Pierre Robin Syndrome, Indiana Type Amy 45 JRA, Juberg Hayward Syndrome, Juberg-Marsidi Syndrome, loidosis (Type II), Indolent systemic mastocytosis, Infantile Juberg-Marsidi Mental Retardation Syndrome, Jumping Acquired Aphasia, Infantile Autosomal Recessive Polycystic Frenchmen, Jumping Frenchmen of Maine, Juvenile Arthri Kidney Disease, Infantile Beriberi, Infantile Cerebral Gan tis, Juvenile Arthritis, Juvenile Autosomal Recessive Poly glioside, Infantile Cerebral Ganglioside, Infantile Cerebral cystic Kidney Disease, Juvenile Cystinosis, Juvenile (Child Paralysis, Infantile Cystinosis, Infantile Epileptic, Infantile 50 hood) Dermatomyositis (JDMS), Juvenile Diabetes, Juvenile Fanconi Syndrome with Cystinosis, Infantile Finnish Type Gaucher Disease, Juvenile Gout Choreoathetosis and Mental Neuronal Ceroid Lipofuscinosis, Infantile Gaucher Disease, Retardation Syndrome, Juvenile Intestinal Malabsorption of Infantile Hypoglycemia, Infantile Hypophasphatasia, Infan Vit B12, Juvenile Intestinal Malabsorption of Vitamin B12, tile Lobar Emphysema, Infantile Myoclonic Encephalopathy, Juvenile Macular Degeneration, Juvenile Pernicious Anemia, Infantile Myoclonic Encephalopathy and Polymyoclonia, 55 Juvenile Retinoschisis, Juvenile Rheumatoid Arthritis, Juve Infantile Myofibromatosis, Infantile Necrotizing Encephal nile Rheumatoid Arthritis, Juvenile Spinal Muscular Atrophy opathy, Infantile Neuronal Ceroid Lipofuscinosis, Infantile Included, Juvenile Spinal Muscular Atrophy ALS Included, Neuroaxonal Dystrophy, Infantile Onset Schindler Disease, Juvenile Spinal Muscular Atrophy Type III, Juxta-Articular Infantile Phytanic Acid Storage Disease, Infantile Refsum Adiposis Dolorosa, Juxta-Articular Adiposis Dolorosa, Disease (IRD), Infantile Sipoidosis GM-2 Gangliosideosis 60 Juxtaglomerular Hyperplasia, Kabuki Make-Up Syndrome, (Type S), Infantile Sipoidosis GM-2 Gangliosideosis (Type S. Kahler Disease, Kallmann Syndrome, Kanner Syndrome, Infantile Sleep Apnea, Infantile Spasms, Infantile Spinal Kanzaki Disease, Kaposi Disease (not Kaposi Sarcoma), Muscular Atrophy (all types), Infantile Spinal Muscular Atro Kappa Light Chain Deficiency, Karsch-Neugebauer Syn phy ALS, Infantile Spinal Muscular Atrophy Type I, Infantile drome, Karsch-Neugebauer Syndrome, Kartagener Syn Type Neuronal Ceroid Lipofuscinosis, Infectious Jaundice, 65 drome-Chronic Sinobronchial Disease and Dextrocardia, Inflammatory Breast Cancer, Inflammatory Linear Nevus Kartagener Triad, Kasabach-Merritt Syndrome, Kast Syn Sebaceous Syndrome. Iniencephaly, Insulin Resistant Acan drome, Kawasaki Disease, Kawasaki Syndrome, KBG Syn US 7,662.929 B2 49 50 drome, KD, Kearns-Sayre Disease, Kearns-Sayre Syndrome, Brain Sclerosis, Lattice Corneal Dystrophy, Lattice Dystro Kearns-Sayre Syndrome, Kennedy Disease, Kennedy Syn phy, Launois-Bensaude, Launois-Cleret Syndrome, Lau drome, Kennedy Type Spinal and Bulbar Muscular Atrophy, rence Syndrome, Laurence-Moon Syndrome, Laurence Kennedy-Stefanis Disease, Kenny Disease, Kenny Syn Moon/Bardet-Biedl, Lawrence-Seip Syndrome, LCA, drome, Kenny Type Tubular Stenosis, Kenny-Caffe Syn LCAD Deficiency, LCAD, LCAD, LCAD, LCADH Defi drome, Kera. Palmoplant. Con. Pes Planus Ony. Periodon. ciency, LCH, LCHAD, LCHAD, LCPD, LeJeune Syndrome, Arach. Keratitis Ichthyosis Deafness Syndrome, Keratoco Leband Syndrome, Leber's Amaurosis, Leber's Congenital nus, Keratoconus, Keratoconus Posticus Circumscriptus, Amaurosis, Congenital Absence of the Rods and Cones, Leb Keratolysis, Keratolysis Exfoliativa Congenita, Keratolytic er's Congenital Tapetoretinal Degeneration, Leber's Con Winter Erythema, Keratomalacia, Keratosis Follicularis, 10 genital Tapetoretinal Dysplasia, Leber's Disease, Leber's Keratosis Follicularis Spinulosa Decalvans, Keratosis Folli Optic Atrophy, Leber's Optic Neuropathy, Left Ventricular cularis Spinulosa Decalvans Ichthyosis, Keratosis Nigricans, Fibrosis, Leg Ulcer, Legg-Calve-Perthes Disease, Leigh's Keratosis Palmoplantaris with Periodontopathia and Ony Disease, Leigh's Disease, Leigh's Syndrome, Leigh's Syn chogryposis, Keratosis Palmoplantaris Congenital Pes Pla drome (Subacute Necrotizing Encephalomyelopathy), Leigh nus Onychogryposis Periodontosis Arachnodactyly, Kerato 15 Necrotizing Encephalopathy, Lennox-Gastaut Syndrome, sis Palmoplantaris Congenital, Pes Planus, Lentigio-Polypose-Digestive Syndrome, Lentigio-Polypose Onychogryphosis, Periodontosis, Arachnodactyly, Acroost Digestive Syndrome, Lenz, Dysmorphogenetic Syndrome, eolysis, Keratosis Rubra Figurata, Keratosis Seborrheica, Lenz, Dysplasia, Lenz, Microphthalmia Syndrome, Lenz Syn Ketoacid Decarboxylase Deficiency, Ketoaciduria, Ketotic drome, LEOPARD Syndrome, Leprechaunism, Lepre Glycinemia, Ketotic Glycinemia, KFS, KID Syndrome, Kid chaunism, Leptomeningeal Angiomatosis, Leptospiral Jaun ney Agenesis, Kidneys Cystic-Retinal Aplasia Joubert Syn dice, Leri-Weill Disease, Leri-Weil Dyschondrosteosis, Leri drome, Killian Syndrome, Killian/Teschler-Nicola Syn Weil Syndrome, LermoyeZ Syndrome, Leroy Disease, Lesch drome, Kiloh-Nevin syndrome III, Kinky Hair Disease, Nyhan Syndrome, Lethal Infantile Cardiomyopathy, Lethal Kinsbourne Syndrome, Kleeblattschadel Deformity, Kleine Neonatal Dwarfism, Lethal Osteochondrodysplasia, Let Levin Syndrome, Kleine-Levin Hibernation Syndrome, 25 terer-Siwe Disease, Leukocytic Anomaly Albinism, Leuko Klinefelter, Klippel-Feil Syndrome, Klippel-Feil Syndrome cytic Inclusions with Platelet Abnormality, Leukodystrophy, Type I, Klippel-Feil Syndrome Type II, Klippel-Feil Syn Leukodystrophy with Rosenthal Fibers, Leukoencephalitis drome Type III, Klippel Trenaunay Syndrome, Klippel Periaxialis Concentric, Levine-Critchley Syndrome, Levulo Trenaunay-Weber Syndrome, Kluver-Bucy Syndrome, suria, Levy-Hollister Syndrome, LGMD, LGS, LHON, KMS, Kniest Dysplasia, Kniest Syndrome, Kobner's Dis 30 LHON, LIC, Lichen Ruber Acuminatus, Lichen Acuminatus, ease, Koebberling-Dunnigan Syndrome, Kohlmeier-Degos Lichen Amyloidosis, Lichen Planus, Lichen Psoriasis, Lig Disease, Kok Disease, Korsakoff Psychosis, Korsakoffs nac-Debre-Fanconi Syndrome, Lignac-Fanconi Syndrome, Syndrome, Krabbe's Disease Included, Krabbe's Leukodys Ligneous Conjunctivitis, Limb-Girdle Muscular Dystrophy, trophy, Kramer Syndrome, KSS, KSS, KTS, KTW Syn Limb Girdle Muscular Dystrophy, Limb Malformations drome, Kufs Disease, Kugelberg-Welander Disease, Kugel 35 Dento-Digital Syndrome, Limit Dextrinosis, Linear Nevoid berg-Welander Disease, Kugelberg-Welander Syndrome, Hypermelanosis, Linear Nevus Sebacous Syndrome, Linear Kugelberg-Welander Syndrome, Kugelberg-Welander Syn Scleroderma, Linear Sebaceous Nevus Sequence, Linear drome, Kussmaul-Landry Paralysis, KWS, L-3-Hydroxy Sebaceous Nevus Syndrome, Lingua Fissurata, Lingua Pli Acyl-CoA Dehydrogenase (LCHAD) Deficiency, Laband cata, Lingua Scrotalis, Linguofacial Dyskinesia, Lip Syndrome, Labhart-Willi Syndrome, Labyrinthine Syn 40 Pseudocleft-hemangiomatous Branchial Cyst Syndrome, drome, Labyrinthine Hydrops, Lacrimo-Auriculo-Dento Lipid Granulomatosis, Lipid Histiocytosis, Lipid Kerasin Digital Syndrome, Lactase Isolated Intolerance, Lactase Type, Lipid Storage Disease, Lipid-Storage myopathy Asso Deficiency, Lactation-Uterus Atrophy, Lactic Acidosis Leber ciated with SCAD Deficiency, Lipidosis Ganglioside Infan Hereditary Optic Neuropathy, Lactic and Pyruvate Acidemia tile, Lipidosis Ganglioside Infantile, Lipoatrophic Diabetes with Carbohydrate Sensitivity, Lactic and Pyruvate Acidemia 45 Mellitus, Lipodystrophy, Lipoid Corneal Dystrophy, Lipoid with Episodic Ataxia and Weakness, Lactic and Pyruvate Hyperplasia-Male Pseudohermaphroditism, Lipoid Hyper Acidemia with Carbohydrate Sensitivity, Lactic and Pyru plasia-Male Pseudohermaphroditism, Lipomatosis of Pan Vate, Lactic acidosis, Lactose Intolerance of Adulthood, Lac creas Congenital, Lipomucopolysaccharidosis Type I, Lipo tose Intolerance, Lactose Intolerance of Childhood, Lactose myelomeningocele, Lipoprotein Lipase Deficiency Familial, Intolerance, LADD Syndrome, LADD, Lafora Disease 50 LIS, LIS1, Lissencephaly 1, Lissencephaly Type I, Lissen Included, Lafora Body Disease, Laki-Lorand Factor Defi cephaly variants with agenesis of the corpus callosum cer ciency, LAM, Lambert Type Ichthyosis, Lambert-Eaton Syn ebellar hypoplasia or other anomalies, Little Disease, Liver drome, Lambert-Eaton Myasthenic Syndrome, Lamellar Phosphorylase Deficiency, LKS, LM Syndrome, Lobar Atro Recessive Ichthyosis, Lamellar Recessive Ichthyosis, Lamel phy, Lobar Atrophy of the Brain, Lobar Holoprosencephaly, lar Ichthyosis, Lamellar Recessive Ichthyosis, Lancereaux 55 Lobar Tension Emphysema in Infancy, Lobstein Disease Mathieu-Weil Spirochetosis, Landau-Kleffner Syndrome, (Type I), Lobster Claw Deformity, Lobster Claw Deformity, Landouzy Deerine Muscular Dystrophy, Landry Ascending Localized Epidermolysis Bullosa, Localized Lipodystrophy, Paralysis, Langer-Salidino Type Achondrogensis (Type II). Localized Neuritis of the Shoulder Girdle, Loeffler's Disease, Langer Giedion Syndrome, Langerhans-Cell Granulomato Loeffler Endomyocardial Fibrosis with Eosinophilia, Loef sis, Langerhans-Cell Histiocytosis (LCH), Large Atrial and 60 fler Fibroplastic Parietal Endocarditis, Loken Syndrome, Ventricular Defect, Laron Dwarfism, Laron Type Pituitary Loken-Senior Syndrome, Long-Chain 3-hydroxyacyl-CoA Dwarfism, Larsen Syndrome, Laryngeal Dystonia, Latah Dehydrogenase (LCHAD), Long Chain Acyl CoA Dehydro (Observed in Malaysia), Late Infantile Neuroaxonal Dystro genase Deficiency, Long-Chain Acyl-CoA Dehydrogenase phy, Late Infantile Neuroaxonal Dystrophy, Late Onset (ACADL), Long-Chain Acyl-CoA Dehydrogenase Defi Cockayne Syndrome Type III (Type C), Late-Onset Dystonia, 65 ciency, Long QT Syndrome without Deafness, Lou Gehrig's Late-Onset Immunoglobulin Deficiency, Late-Onset Immu Disease, Lou Gehrig's Disease Included, Louis-Bar Syn noglobulin Deficiency. Late Onset Pelizaeus-Merzbacher drome, Low Blood Sugar, Low-Density Beta Lipoprotein US 7,662.929 B2 51 52 Deficiency, Low Imperforate Anus, Low Potassium Syn ciency, MCAD, MCAD, MCAD, McArdle Disease, drome, Lowe syndrome, Lowe's Syndrome, Lowe-Bickel McCune-Albright, MCD, McKusick Type Metaphyseal Syndrome, Lowe-Terry-MacLachlan Syndrome, LS, LS, Chondrodysplasia, McKusick Type Metaphyseal Chondrod LTD, Lubs Syndrome, Lubs Syndrome, Luft Disease, Lum ysplasia, MCR, MCTD, Meckel Syndrome, Meckel-Gruber bar Canal Stenosis, Lumbar Spinal Stenosis, Lumbosacral Syndrome, Median Cleft Face Syndrome, Mediterranean Spinal Stenosis, Lundborg-Unverricht Disease, Lundborg Anemia, Medium-Chain Acyl-CoA dehydrogenase (AC Unverricht Disease Included, Lupus, Lupus, Lupus Erythe ADM), Medium Chain Acyl-CoA Dehydrogenase (MCAD) matosus, Luschka-Magendie Foramina Atresia, Lyell Syn Deficiency, Medium-Chain Acyl-CoA Dehydrogenase Defi drome, Lyelles Syndrome, Lymphadenoid Goiter, ciency, Medium Chain Acyl CoA Dehydrogenase Deficiency, Lymphangiectatic Protein-Losing Enteropathy, Lymphangi 10 Medullary Cystic Disease, Medullary Cystic Disease, Med oleiomatosis, Lymphangioleimyomatosis, Lymphangiomas, ullary Sponge Kidney, MEF, Megaesophagus, Megalenceph Lymphatic Malformations, Lynch Syndromes, Lynch Syn aly, Megalencephaly with Hyaline Inclusion, Megalenceph drome I, Lynch Syndrome II, Lysosomal Alpha-N-Acetylga aly with Hyaline Panneuropathy, Megaloblastic Anemia, lactosaminidase Deficiency Schindler Type, Lysosomal Gly Megaloblastic Anemia of Pregnancy, Megalocornea-Mental coaminoacid Storage Disease-Angiokeratoma Corporis 15 Retardation Syndrome, Meier-Gorlin Syndrome, Meige's Diffusum, Lysosomal Glucosidase Deficiency, Lysosomal Lymphedema, Meige's Syndrome, Melanodermic Leukod Glucosidase Deficiency, MAA, Machado Disease, Machado ystrophy, Melanoplakia-Intestinal Polyposis, Melanoplakia Joseph Disease, Macrencephaly, Macrocephaly, Macroceph Intestinal Polyposis, MELAS Syndrome, MELAS, Melkers aly Hemihypertrophy, Macrocephaly with Multiple Lipomas son Syndrome, Melnick-Fraser Syndrome, Melnick-Needles and Hemangiomata, Macrocephaly with Pseudopapilledema Osteodysplasty, Melnick-Needles Syndrome, Membranous and Multiple Hemangiomata, Macroglobulinemia, Macro Lipodystrophy, Mendes Da Costa Syndrome, Meniere Dis glossia, Macroglossia-Omphalocele-Visceromegaly Syn ease, Méniere's Disease, Meningeal Capillary Angiomatosis, drome, Macrostomia Ablepheron Syndrome, Macrothromb Menkes Disease, Menke's Syndrome I, Mental Retardation ocytopenia Familial Bernard-Soulier Type, Macula Lutea Aphasia Shuffling Gait Adducted Thumbs (MASA), Mental degeneration, Macular Amyloidosis, Macular Degeneration, 25 Retardation-Deafness-Skeletal Abnormalities-Coarse Face Macular Degeneration Disciform, Macular Degeneration with Full Lips, Mental Retardation with Hypoplastic 5th Fin Senile, Macular Dystrophy, Macular Type Corneal Dystro gernails and Toenails, Mental Retardation with Osteocarti phy, MAD, MAD, Madelung’s Disease, Maffucci Syndrome, laginous Abnormalities, Mental Retradation-X-linked with Major Epilepsy, Malabsorption, Malabsorption-Ectodermal Growth Delay-Deafness-Microgenitalism, Menzel Type Dysplasia-Nasal Alar Hypoplasia, Maladie de Roger, Mala 30 OPCA, Mermaid Syndrome, MERRF, MERRF Syndrome, die de Tics, Male Malformation of Limbs and Kidneys, Male MERRF, Merten-Singleton Syndrome, MES, Mesangial IGA Turner Syndrome, Malignant Acanthosis, Malignant Acan Nephropathy, Mesenteric Lipodystrophy, Mesiodens-Cata thosis Nigricans, Malignant Astrocytoma, Malignant Atro ract Syndrome, Mesodermal Dysmorphodystrophy, phic Papulosis, Malignant Fever, Malignant Hyperphenyla Mesomelic Dwarfism-Madelung Deformity, Metabolic Aci laninemia, Malignant Hyperphenylalaninemia, Malignant 35 dosis, Metachromatic Leukodystrophy, Metatarsus Varus, Hyperpyrexia, Malignant Hyperthermia, Malignant Mela Metatropic Dwarfism Syndrome, Metatropic Dysplasia, noma, Malignant Tumors of the Central Nervous System, Metatropic Dysplasia I, Metatropic Dysplasia II, Methylma Mallory-Weiss Laceration, Mallory-Weiss Tear, Mallory lonic Acidemia, Methylmalonic Aciduria, Meulengracht's Weiss Syndrome, Mammary Paget’s Disease, Mandibular Disease, MFD1, MG, MH, MHA, Micrencephaly, Micro Ameloblastoma, Mandibulofacial Dysostosis, Mannosidosis, 40 cephalic Primordial Dwarfism I, Microcephaly, Microceph Map-Dot-Fingerprint Type Corneal Dystrophy, Maple Syrup aly-Hiatal Hernia-Nephrosis Galloway Type, Microcephaly Urine Disease, Maple Syrup Urine Disease, Marble Bones, Hiatal Hernia-Nephrotic Syndrome, Microcystic Corneal Marchiafava-Micheli Syndrome, Marcus Gunn Jaw-Winking Dystrophy, Microcythemia, Microlissencephaly, Syndrome, Marcus Gunn Phenomenon, Marcus Gunn Ptosis Microphthalmia, Microphthalmia, Microphthalmia or with jaw-winking, Marcus Gunn Syndrome, Marcus Gunn 45 Anopthalmos with Associated Anomalies, Micropolygyria (Jaw-Winking) Syndrome, Marcus Gunn Ptosis (with jaw With Muscular Dystrophy, Microtia Absent Patellae Micro winking), Marden-Walker Syndrome, Marden-Walker Type gnathia Syndrome, Microvillus Inclusion Disease, MID, Connective Tissue Disorder, Marfan's Abiotrophy, Marfan Midsystolic-click-late systolic murmur syndrome, Achard syndrome, Marfan Syndrome, Marfan Syndrome, Miescher's Type I Syndrome, Mikulicz. Syndrome, Mikulicz Marfan's Syndrome I, Marfan's Variant, Marfan-Achard syn 50 Radecki Syndrome, Mikulicz-Sjogren Syndrome, Mild drome, Marfanoid Hypermobility Syndrome, Marginal Cor Autosomal Recessive, Mild Intermediate Maple Syrup Urine neal Dystrophy, Marie’s Ataxia, Marie's Ataxia, Marie Dis Disease, Mild Maple Syrup Urine Disease, Miller Syndrome, ease, Marie-Sainton Disease, Marie Strumpell Disease, Miller-Dieker Syndrome, Miller-Fisher Syndrome, Milroy Marie-Strumpell Spondylitis, Marinesco-Sjogren Syndrome, Disease, Minkowski-Chauffard Syndrome, Minor Epilepsy, Marinesco-Sjogren-Gorland Syndrome, Marker X Syn 55 Minot-Von Willebrand Disease, Mirror-Image Dextrocardia, drome, Maroteaux Lamy Syndrome, Maroteaux Type Mitochondrial Beta-Oxidation Disorders, Mitrochondrial Acromesomelic Dysplasia, Marshall's Ectodermal Dyspla and Cytosolic, Mitochondrial Cytopathy, Mitochondrial Cyt sias With Ocular and Hearing Defects, Marshall-Smith Syn opathy, Kearn-Sayre Type, Mitochondrial Encephalopathy, drome, Marshall Syndrome, Marshall Type Deafness-Myo Mitochondrial Encephalo myopathy Lactic Acidosis and pia-Cataract-Saddle Nose, Martin-Albright Syndrome, 60 Strokelike Episodes, Mitochondrial myopathy, Mitochon Martin-Bell Syndrome, Martorell Syndrome, MASA Syn drial myopathy Encephalopathy Lactic Acidosis Stroke-Like drome, Massive Myoclonia, Mast Cell Leukemia, Mastocy Episode, Mitochondrial PEPCK Deficiency, Mitral-valve tosis, Mastocytosis With an Associated Hematologic Disor prolapse, Mixed Apnea, Mixed Connective Tissue Disease, der, Maumenee Corneal Dystrophy, Maxillary Mixed Connective Tissue Disease, Mixed Hepatic Porphyria, Ameloblastoma, Maxillofacial Dysostosis, Maxillonasal 65 Mixed Non-Fluent Aphasia, Mixed Sleep Apnea, Mixed Dysplasia, Maxillonasal Dysplasia Binder Type, Maxillo Tonic and Clonic Torticollis, MJD, MKS, MLI, MLII, MLII, palpebral Synkinesis, May-Hegglin Anomaly, MCAD Defi ML III, ML IV. ML Disorder Type I, ML Disorder Type II, US 7,662.929 B2 53 54 ML Disorder Type III, ML Disorder Type IV, MLNS, MMR dation, Muscular Dystrophy Facioscapulohumeral, Muscular Syndrome, MND, MNGIE, MNS, Mobitz I, Mobitz II, Rheumatism, Muscular Rigidity Progressive Spasm, Mus Mobius Syndrome, Moebius Syndrome, Moersch-Woltmann culoskeletal Pain Syndrome, Mutilating Acropathy, Mutilat Syndrome, Mohr Syndrome, Monilethrix, Monomodal ing Acropathy, Mutism, mvp, MVP. MWS, Myasthenia Visual Amnesia, Mononeuritis Multiplex, Mononeuritis Gravis, Myasthenia Gravis, Myasthenia Gravis Pseudopara Peripheral, Mononeuropathym Peripheral, Monosomy 3p2. lytica, Myasthenic Syndrome of Lambert-Eaton, Myelin Monosomy 9p Partial, Monosomy 11q Partial, Monosomy oclastic Diffuse Sclerosis, Myelomatosis, Myhre Syndrome, 13q Partial, Monosomy 18q Syndrome, Monosomy X, Myoclonic Astatic Petit Mal Epilepsy, Myoclonic Dystonia, Monostotic Fibrous Dysplasia, Morgagni-Turner-Albright Myoclonic Encephalopathy of Infants, Myoclonic Epilepsy, Syndrome, Morphea, Morquio Disease, Morquio Syndrome, 10 Myoclonic Epilepsy Hartung Type, Myoclonus Epilepsy Morquio Syndrome A. Morquio Syndrome B. Morquio Associated with Ragged Red Fibers, Myoclonic Epilepsy and Brailsford Syndrome, Morvan Disease, Mosaic Tetrasomy Ragged-Red Fiber Disease, Myoclonic Progressive Familial 9p, Motor Neuron Disease, Motor Neuron Disease, Motor Epilepsy, Myoclonic Progressice Familial Epilepsy, Myo Neuron Syndrome, Motor Neurone Disease, Motoneuron clonic Seizure, Myoclonus, Myoclonus Epilepsy, Myoen Disease, Motoneurone Disease, Motor System Disease (Fo 15 cephalopathy Ragged-Red Fiber Disease, Myofibromatosis, cal and Slow). Moya-moya Disease, Moyamoya Disease, Myofibromatosis Congenital, Myogenic Facio-Scapulo MPS, MPS I, MPSI H, MPS 1 H/S Hurler/Scheie Syndrome, Peroneal Syndrome, Myoneurogastointestinal Disorder and MPS IS Scheie Syndrome, MPS II, MPSIIA, MPS IIB, MPS Encephalopathy, Myopathic Arthrogryposis Multiplex Con II-AR Autosomal Recessive Hunter Syndrome, MPS II-XR, genita, Myopathic Carnitine Deficiency, myopathy Central MPSII-XR Severe Autosomal Recessive, MPS III, MPS IIIA Fibrillar, myopathy Congenital Nonprogressive, myopathy B C and D Sanfiloppo A, MPS IV, MPS IVA and B Morquio Congenital Nonprogressive with Central Axis, myopathy A, MPSV, MPS VI, MPSVI Severe Intermediate Mild Maro with Deficiency of Carnitine Palmitoyltransferase, myopa teaux-Lamy, MPS VII, MPS VII Sly Syndrome, MPS VIII, thy-Marinesco-Sjogren Syndrome, myopathy-Metabolic MPS Disorder, MPS Disorder I, MPS Disorder II, MPS Dis Carnitine Palmitoyltransderase Deficiency, myopathy Mito order III, MPS Disorder VI, MPS Disorder Type VII, MRS, 25 chondrial-Encephalopathy-Lactic Acidosis-Stroke, myopa MS, MSA, MSD, MSL, MSS, MSUD, MSUD, MSUD Type thy with Sarcoplasmic Bodies and Intermediate Filaments, Ib, MSUD Type II, Mucocutaneous Lymph Node Syndrome, Myophosphorylase Deficiency, Myositis Ossificans Progres Mucolipidosis I, Mucolipidosis II, Mucolipidosis II, Siv, Myotonia Atrophica, Myotonia Congenita, Myotonia Mucolipidosis III, Mucolipidosis IV. Mucopolysaccharido Congenita Intermittens, Myotonic Dystrophy, Myotonic sis, Mucopolysaccharidosis I-H. Mucopolysaccharidosis I-S, 30 myopathy Dwarfism Chondrodystrophy Ocular and Facial Mucopolysaccharidosis II. Mucopolysaccharidosis III, Anomalies, Myotubular myopathy, Myotubular myopathy Mucopolysaccharidosis IV. Mucopolysaccharidosis VI, X-linked, Myproic Acid, Myriachit (Observed in Siberia), Mucopolysaccharidosis VII, Mucopolysaccharidosis Type I, Myxedema, N-Acetylglucosamine-1-Phosphotransferase Mucopolysaccharidosis Type II. Mucopolysaccharidosis Deficiency, N-Acetyl Glutamate Synthetase Deficiency, Type III, Mucopolysaccharidosis Type VII, Mucosis, Muco 35 NADH-CoQ reductasedeficiency, Naegeli Ectodermal Dys sulfatidosis, Mucous Colitis, Mucoviscidosis, Mulibrey plasias, Nager Syndrome, Nager Acrofacial Dysostosis Syn Dwarfism, Mulibrey Nanism Syndrome, Mullerian Duct drome, Nager Acrofacial Dysostosis Syndrome, Nager Syn Aplasia-Renal Aplasia-Cervicothoracic Somite Dysplasia, drome, NAGS Deficiency, Nail Dystrophy-Deafness Mullerian Duct-Renal-Cervicothoracic-Upper Limb Syndrome, Nail Dysgenesis and Hypodontia, Nail-Patella Defects, Mullerian Duct and Renal Agenesis with Upper 40 Syndrome, Nance-Horan Syndrome, Nanocephalic Dwarf Limb and Rib Anomalies, Mullerian-Renal-Cervicothoracic ism, Nanocephaly, Nanophthalmia, Narcolepsy, Narcoleptic Somite Abnormalities, Multi-Infarct Dementia Binswanger's syndrome, NARP, Nasal-fronto-faciodysplasia, Nasal Alar Type, Multicentric Castleman's Disease, Multifocal Eosino Hypoplasia Hypothyroidism Pancreatic Achylia Congenital philic Granuloma, Multiple Acyl-CoA Dehydrogenase Defi Deafness, Nasomaxillary Hypoplasia, Nasu Lipodystrophy, ciency, Multiple Acyl-CoA Dehydrogenase Deficiency, Mul 45 NBIA1, ND, NDI, NDP. Necrotizing Encephalomyelopathy tiple Acyl-CoA Dehydrogenase Deficiency/Glutaric Aciduria of Leigh's, Necrotizing Respiratory Granulomatosis, Neill Type II, Multiple Angiomas and Endochondromas, Multiple Dingwall Syndrome, Nelson Syndrome, Nemaline myopa Carboxylase Deficiency, Multiple Cartilaginous Enchon thy, Neonatal Adrenoleukodystrophy, Neonatal Adrenoleu droses, Multiple Cartilaginous Exostoses, Multiple Enchon kodystrophy (NALD), Neonatal Adrenoleukodystrophy dromatosis, Multiple Endocrine Deficiency Syndrome Type 50 (ALD), Neonatal Autosomal Recessive Polycystic Kidney II, Multiple Epiphyseal Dysplasia, Multiple Exostoses, Mul Disease, Neonatal Dwarfism, Neonatal Hepatitis, Neonatal tiple Exostoses Syndrome, Multiple Familial Polyposis, Mul Hypoglycemia, Neonatal Lactose Intolerance, Neonatal tiple Lentigines Syndrome, Multiple Myeloma, Multiple Lymphedema due to Exudative Enteropathy, Neonatal Prog Neuritis of the Shoulder Girdle, Multiple Osteochondroma eroid Syndrome, Neonatal Pseudo-Hydrocephalic Progeroid tosis, Multiple Peripheral Neuritis, Multiple Polyposis of the 55 Syndrome of Wiedemann-Rautenstrauch, Neoplastic Arach Colon, Multiple Pterygium Syndrome, Multiple Sclerosis, noiditis, Nephroblastom, Nephrogenic Diabetes Insipidus, Multiple Sclerosis, Multiple Sulfatase Deficiency, Multiple Nephronophthesis Familial Juvenile, Nephronophthesis Symmetric Lipomatosis, Multiple System Atrophy, Multi Familial Juvenile, Nephropathic Cystinosis, Nephropathy Synostotic Osteodysgenesis, Multisynostotic Osteodysgen Pseudohermaphroditism-Wilms Tumor, Nephrosis-Micro esis with Long Bone Fractures, Mulvihill-Smith Syndrome, 60 cephaly Syndrome, Nephrosis-Neuronal Dysmigration Syn MURCS Association, Murk JansenType Metaphyseal Chon drome, Nephrotic-Glycosuric-Dwarfism-Rickets drodysplasia, Muscle Carnitine Deficiency, Muscle Core Dis Hypophosphatemic Syndrome, Netherton Disease, ease, Muscle Phosphofructokinase Deficiency, Muscular Netherton Syndrome, Netherton Syndrome Ichthyosis, Central Core Disease, Muscular Dystrophy, Muscular Dys Nettleship Falls Syndrome (X-Linked), Neu-Laxova Syn trophy Classic X-linked Recessive, Muscular Dystrophy 65 drome, Neuhauser Syndrome, Neural-tube defects, Neuralgic Congenital With Central Nervous System Involvement, Mus Amyotrophy, Neuralgic Amyotrophy, Neuraminidase Defi cular Dystrophy Congenital Progressive with Mental Retar ciency, Neuraocutaneous melanosis, Neurinoma of the US 7,662.929 B2 55 56 Acoustic Nerve, Neurinoma, Neuroacanthocytosis, Neuroax Oculogastrointestinal Muscular Dystrophy, Oculomandibul onal Dystrophy Schindler Type, Neurodegeneration with odyscephaly with hypotrichosis, Oculomandibulofacial Syn brain iron accumulation type 1 (NBIA1). Neurofibroma of the drome, Oculomotor with Congenital Contractures and Acoustic Nerve, Neurogenic Arthrogryposis Multiplex Con Muscle Atrophy, Oculosympathetic Palsy, ODD Syndrome, genita, Neuromyelitis Optica, Neuromyotonia, Neuromyoto ODD Syndrome, ODOD, Odontogenic Tumor, Odontotri nia, Focal, Neuromyotonia, Generalized, Familial, Neuromy chomelic Syndrome, OFD, OFD Syndrome, Ohio Type Amy tonia, Generalized, Sporadic, Neuronal Axonal Dystrophy loidosis (Type VII), OI. OI Congenita, OI Tarda, Oldfield Schindler Type, Neuronal Ceroid Lipofuscinosis Adult Type, Syndrome, Oligohydramnios Sequence, Oligophrenia Neuronal Ceroid Lipofuscinosis Juvenile Type, Neuronal Micropthalmos, Oligophrenic Polydystrophy, Olivoponto Ceroid Lipofuscinosis Type 1, Neuronopathic Acute Gaucher 10 cerebellar Atrophy, Olivopontocerebellar Atrophy, Olivopon Disease, Neuropathic Amyloidosis, Neuropathic Beriberi, tocerebellar Atrophy with Dementia and Extrapyramidal Neuropathy Ataxia and Retinitis Pigmentosa, Neuropathy of Signs, Olivopontocerebellar Atrophy with Retinal Degenera Brachialpelxus Syndrome, Neuropathy Hereditary Sensory tion, Olivopontocerebellar Atrophy I, Olivopontocerebellar Type I, Neuropathy Hereditary Sensory Type II, Neutral Atrophy II, Olivopontocerebellar Atrophy III, Olivoponto Lipid Storage Disease, Nevii. Nevoid Basal Cell Carcinoma 15 cerebellar Atrophy IV. Olivopontocerebellar Atrophy V. Syndrome, Nevus, Nevus Cavernosus, Nevus Comedonicus, Ollier Disease, Ollier Osteochondromatosis, Omphalocele Nevus Depigmentosus, Nevus Sebaceous of Jadassohn, Visceromegaly-Macroglossia Syndrome, Ondine's Curse, Nezelof's Syndrome, Nezelof's Thymic Aplasia, Nezelof Onion-Bulb Neuropathy, Onion Bulb Polyneuropathy, Ony Type Severe Combined Immunodeficiency, NF, NF1, NF2, choosteodysplasia, Onychotrichodysplasia with Neutrope NF-1, NF-2, NHS, Nieman Pick Disease, Nieman Pick dis nia, OPCA, OPCAI, OPCA II, OPCA III, OPCA IV, OPCA ease Type A (acute neuronopathic form), Nieman Pick dis V. OPD Syndrome, OPD Syndrome Type I, OPD Syndrome easeType B, Nieman Pick Disease Type C (chronic neurono Type II, OPD I. Syndrome, OPD II Syndrome, Opthalmoar pathic form), Nieman Pick disease Type D (Nova Scotia thropathy, Opthalmoplegia-Intestinal Pseudoobstruction, variant), Nieman Pick disease Type E, Nieman Pick disease Opthalmoplegia, Pigmentary Degeneration of the Retina and Type F (sea-blue histiocyte disease), Night Blindness, 25 Cardiomyopathy, Opthalmoplegia Plus Syndrome, Opthal NigroSpinodentatal Degeneration, Niikawakuroki Syn moplegia Syndrome, Opitz BBB Syndrome, Opitz, BBB/G drome, NLS, NM, Noack Syndrome Type I, Nocturnal Myo Compound Syndrome, Opitz, BBBG Syndrome, Opitz-Frias clonus Hereditary Essential Myoclonus, Nodular Cornea Syndrome, Opitz, G. Syndrome, Opitz G/BBB Syndrome, Degeneration, Non-Bullous CIE, Non-Bullous Congenital Opitz, Hypertelorism-Hypospadias Syndrome, Opitz-Kaveg Ichthyosiform Erythroderma, Non-Communicating Hydro 30 gia Syndrome, Opitz, Oculogenitolaryngeal Syndrome, Opitz cephalus, Non-Deletion Type Alpha-Thalassemia/Mental Trigonocephaly Syndrome, Opitz Syndrome, OpSoclonus, Retardation syndrome. Non-Ketonic Hyperglycinemia Type Opsoclonus-Myoclonus, Opthalmoneuromyelitis, Optic I (NKHI), Non-Ketotic Hyperglycinemia, Non-Lipid Reticu Atrophy Polyneuropathy and Deafness, Optic Neuroen loendotheliosis, Non-Neuronopathic Chronic Adult Gaucher cephalomyelopathy, Optic Neuromyelitis, Opticomyelitis, Disease, Non-Scarring Epidermolysis Bullosa, Nonarterio 35 Optochiasmatic Arachnoiditis, Oral-Facial Clefts, Oral-fa sclerotic Cerebral Calcifications, Nonarticular Rheumatism, cial Dyskinesia, Oral Facial Dystonia, Oral-Facial-Digital Noncerebral, Juvenile Gaucher Disease, Nondiabetic Glyco Syndrome, Oral-Facial-Digital Syndrome Type I, Oral-Fa Suria, Nonischemic Cardiomyopathy, Nonketotic Hypogly cial-Digital Syndrome I, Oral-Facial-Digital Syndrome II, cemia and Carnitine Deficiency due to MCAD Deficiency, Oral-Facial-Digital Syndrome III, Oral-Facial-Digital Syn Nonketotic Hypoglycemia Caused by Deficiency of Acyl 40 drome IV. Orbital Cyst with Cerebral and Focal Dermal Mal CoA Dehydrogenase, Nonketotic Glycinemia, Nonne’s Syn formations, Ornithine Carbamyl Transferase Deficiency, drome. Nonne-Milroy-Meige Syndrome. Nonopalescent Ornithine Transcarbamylase Deficiency, Orocraniodigital Opalescent Dentine, Nonpuerperal Galactorrhea-Amenor Syndrome, Orofaciodigital Syndrome, Oromandibular Dys rhea, Nonsecretory Myeloma, Nonspherocytic Hemolytic tonia, Orthostatic Hypotension, Osler-Weber-Rendu disease, Anemia, Nontropical Sprue, Noonan Syndrome, Norepi 45 Osseous-Oculo-Dento Dysplasia, Osseous-Oculo-Dento nephrine, Normal Pressure Hydrocephalus, Norman-Roberts Dysplasia, Osteitis deformans, Osteochondrodystrophy Syndrome, Norrbottnian Gaucher Disease, Norrie Disease, Deformans, Osteochondroplasia, Osteodysplasty of Melnick Norwegian Type Hereditary Cholestasis, NPD, NPS, NS, and Needles, Osteogenesis Imperfect, Osteogenesis Imper NSA, Nuchal Dystonia Dementia Syndrome, Nutritional fecta, Osteogenesis Imperfecta Congenita, Osteogenesis Neuropathy, Nyhan Syndrome, OAV Spectrum, Obstructive 50 Imperfecta Tarda, Osteohypertrophic Nevus Flammeus, Apnea, Obstructive Hydrocephalus, Obstructive Sleep Osteopathia Hyperostotica Scleroticans Multiplex Infantalis, Apnea, OCC Syndrome, Occlusive Thromboaortopathy, Osteopathia Hyperostotica Scleroticans Multiplex Infantalis, OCCS, Occult Intracranial Vascular Malformations, Occult Osteopathyrosis, Osteopetrosis, Osteopetrosis Autosomal Spinal Dysraphism Sequence, Ochoa Syndrome, Ochronosis, Dominant Adult Type, Osteopetrosis Autosomal Recessive Ochronotic Arthritis, OCR, OCRL, Octocephaly, Ocular 55 Malignant Infantile Type, Osteopetrosis Mild Autosomal Albinism, Ocular Herpes, Ocular Myasthenia Gravis, Oculo Recessive Intermediate Typ, Osteosclerosis Fragilis Gener Auriculo-Vertebral Dysplasia, Oculo-Auriculo-Vertebral alisata, Osteosclerotic Myeloma, Ostium Primum Defect (en Spectrum, Oculo-Bucco-Genital Syndrome, Oculocerebral docardial cushion defects included), Ostium Secundum Syndrome with Hypopigmentation, Oculocerebrocutaneous Defect, OTC Deficiency, Oto Palato Digital Syndrome, Oto Syndrome, Oculo-Cerebro-Renal, Oculocerebrorenal Dys 60 Palato-Digital Syndrome Type I, Oto-Palatal-Digital Syn trophy, Oculocerebrorenal Syndrome, Oculocraniosomatic drome Type II, Otodental Dysplasia, Otopalatodigital Syn Syndrome (obsolete), Oculocutaneous Albinism, Oculocuta drome, Otopalataldigital Syndrome Type II, Oudtshoorn neous Albinism Chediak-Higashi Type, Oculo-Dento-Digital Skin, Ovarian Dwarfism Turner Type, Ovary Aplasia Turner Dysplasia, Oculo-Dento-Digital Dysplasia, Oculodentodigi Type, OWR, Oxalosis, Oxidase deficiency, Oxycephaly, tal Syndrome, Oculo-Dento-Osseous Dysplasia, Oculo 65 Oxycephaly, Oxycephaly-Acrocephaly, P-V, PA, PAC, Dento-Osseous Dysplasia, Oculo Gastrointestinal Muscular Pachyonychia Ichtyosiforme, Pachyonychia Congenita with Dystrophy, Oculo Gastrointestinal Muscular Dystrophy, Natal Teeth, Pachyonychia Congenita, Pachyonychia Con US 7,662.929 B2 57 58 genita Keratosis Disseminata Circumscripta (follicularis), Thiolase Deficiency, Persistent Truncus Arteriosus, Perthes Pachyonychia Congenita Jadassohn-Lewandowsky Type, Disease, Petit Mal Epilepsy, Petit Mal Variant, Peutz-Jeghers PAF with MSA, Paget’s Disease, Paget’s Disease of Bone, Syndrome, Peutz-Jeghers Syndrome, Peutz-Touraine Syn Paget’s Disease of the Breast, Paget’s Disease of the Nipple, drome, Peutz-Touraine Syndrome, Peyronie Disease, Pfe Paget’s Disease of the Nipple and Areola, Pagon Syndrome, iffer, Pfeiffer Syndrome Type I, PGAI, PGA II, PGA II, PGA Painful Opthalmoplegia, PAIS, Palatal Myoclonus, Palato III, PGK, PHType I, PHType I, Pharyngeal PouchSyndrome, Oto-Digital Syndrome, Palatal-Oto-Digital Syndrome Type PHD Short-Chain Acyl-CoA Dehydrogenase Deficiency, I, Palatal-Oto-Digital Syndrome Type II, Pallister Syndrome, Phenylalanine Hydroxylase Deficiency, Phenylalaninemia, Pallister-Hall Syndrome, Pallister-Killian Mosaic Syndrome, Phenylketonuria, Phenylketonuria, Phenylpyruvic Oligo Pallister Mosaic Aneuploidy, Pallister Mosaic Syndrome, 10 phrenia, Phocomelia, Phocomelia Syndrome, Phospho Pallister Mosaic Syndrome Tetrasomy 12p. Pallister-W Syn enolpyruvate Carboxykinase Deficiency, Phosphofructoki drome, Palmoplantar Hyperkeratosis and Alopecia, Palsy, nase Deficiency, Phosphoglycerate Kinase Deficiency, Pancreatic Fibrosis, Pancreatic Insufficiency and Bone Mar Phosphoglycerokinase, Phosphorylase 6 Kinase Deficiency, row Dysfunction, Pancreatic Ulcerogenic Tumor Syndrome, Phosphorylase Deficiency Glycogen Storage Disease, Phos Panmyelophthisis, Panmyelopathy, Pantothenate kinase 15 phorylase Kinase Deficiency of Liver, Photic Sneeze Reflex, associated neurodegeneration (PKAN), Papillon-Lefevre Photic Sneezing, Phototherapeutic keratectomy, PHS, Physi Syndrome, Papillotonic Psuedotabes, Paralysis Periodica cist John Dalton, Phytanic Acid Storage Disease, Pi Pheno Paramyotonica, Paralytic Beriberi, Paralytic Brachial Neuri type ZZ, PI, Pick Disease of the Brain, Pick's Disease, Pick's tis, Paramedian Lower Lip Pits-Popliteal Pyerygium Syn Disease, Pickwickian Syndrome, Pierre Robin Anomalad, drome, Paramedian Diencephalic Syndrome, Paramyeloido Pierre Robin Complex, Pierre Robin Sequence, Pierre Robin sis, Paramyoclonus Multiple, Paramyotonia Congenita, Syndrome, Pierre Robin Syndrome with Hyperphalangy and Paramyotonia Congenita of Von Eulenburg, Parkinson's dis Clinodactyly, Pierre-Marie's Disease, Pigmentary Degenera ease, Paroxysmal Atrial Tachycardia, Paroxysmal Cold tion of Globus Pallidus Substantia Nigra Red Nucleus, Pili Hemoglobinuria, Paroxysmal Dystonia, Paroxysmal Dysto Torti and Nerve Deafness, Pili Torti-Sensorineural Hearing nia Choreathetosis, Paroxysmal Kinesigenic Dystonia, Par 25 Loss, Pituitary Dwarfism II, Pituitary Tumor after Adrenalec oxysmal Nocturnal Hemoglobinuria, Paroxysmal Normal tomy, Pityriasis Pilaris, Pityriasis Rubra Pilaris, PJS, PJS, Hemoglobinuria, Paroxysmal Sleep, Parrot Syndrome, Parry PKAN, PKD. PKD. PKD1, PKD2, PKD3, PKU, PKU, Disease, Parry-Romberg Syndrome, Parsonage-Turner Syn PKU1, Plagiocephaly, Plagiocephaly, Plagiocephaly, Plasma drome, Partial Androgen Insensitivity Syndrome, Partial Cell Myeloma, Plasma Cell Leukemia, Plasma Thromboplas Deletion of the Short Arm of chromosome 4, Partial Deletion 30 tin Component Deficiency, Plasma Transglutaminase Defi of the Short Arm of Chromosome 5, Partial Deletion of Short ciency, Plastic Induration Corpora Cavernosa, Plastic Indu Arm of Chromosome 9, Partial Duplication 3d Syndrome, ration of the Penis, PLD, Plicated Tongue, PLS, PMD, Partial Duplication 15q Syndrome, Partial Facial Palsy With Pneumorenal Syndrome, PNH, PNM, PNPDeficiency, POD, Urinary Abnormalities, Partial Gigantism of Hands and Feet POH, Poikiloderma Atrophicans and Cataract, Poikiloderma Nevi-Hemihypertrophy-Macrocephaly, Partial Lipodystro 35 Congenitale, Poland Anomaly, Poland Sequence, Poland phy, Partial Monosomy of Long Arm of Chromosome 11, Syndactyly, Poland Syndrome, Poliodystrophia Cerebri Pro Partial Monosomy of the Long Arm of Chromosome 13, gressiva, Polyarthritis Enterica, Polyarteritis Nodosa, Pol Partial Spinal Sensory Syndrome, Partial Trisomy 11q, Par yarticular-Onset Juvenile Arthritis Type I, Polyarticular-On tington Syndrome, PAT, Patent Ductus Arteriosus, Pathologi set Juvenile Arthritis Type II, Polyarticular-Onset Juvenile cal Myoclonus, Pauciarticular-Onset Juvenile Arthritis, Pau 40 Arthritis Types I and II, Polychondritis, Polycystic Kidney ciarticular-Onset Juvenile Arthritis, Paulitis, PBC, PBS, PC Disease, Polycystic Kidney Disease Medullary Type, Poly Deficiency, PC Deficiency Group A, PC Deficiency Group B, cystic Kidney Disease Medullary Type, Polycystic Liver Dis PC, Eulenburg Disease, PCC Deficiency, PCH, PCLD, PCT, ease, Polycystic Ovary Disease, Polycystic Renal Diseases, PD, PDA, PDH Deficiency, PDH Deficiency, Pearson Syn Polydactyly-Joubert Syndrome, Polydysplastic Epidermoly drome Pyruvate Carboxylase Deficiency, Pediatric Obstruc 45 sis Bullosa, Polydystrophia Oligophrenia, Polydystrophic tive Sleep Apnea, Peeling Skin Syndrome, Pelizaeus-Merz Dwarfism, Polyglandular Autoimmune Syndrome Type III, bacher Disease, Pelizaeus-Merzbacher Brain Sclerosis, Polyglandular Autoimmune Syndrome Type II, Polyglandu Pelizaeus-Merzbacher Brain Sclerosis, Pellagra-Cerebellar lar Autoimmune Syndrome Type I, Polyglandular Autoim Ataxia-Renal Aminoaciduria Syndrome, Pelvic Pain Syn mune Syndrome Type II, Polyglandular Deficiency Syn drome, Pemphigus Vulgaris, Pena Shokeir II Syndrome, Pena 50 drome Type II, Polyglandular Syndromes, Polymorphic Shokeir Syndrome Type II, Penile Fibromatosis, Penile Macula Lutea Degeneration, Polymorphic Macular Degen Fibrosis, Penile Induration, Penta X Syndrome, Pentalogy of eration, Polymorphism of Platelet Glycoprotein Ib, Polymor Cantrell, Pentalogy Syndrome, Pentasomy X, PEPCK Defi phous Corneal Dystrophy Hereditary, Polymyalgia Rheu ciency, Pepper Syndrome, Perheentupa Syndrome, Periar matica, Polymyalgia Rheumatica, Polymyositis and ticular Fibrositis, Pericardial Constriction with Growth Fail 55 Dermatomyositis, Primary Agammag-lobulinemi, Polyneu ure, Pericollagen Amyloidosis, Perinatal Polycystic Kidney ritis Peripheral, Polyneuropathy-Deafness-Optic Atrophy, Diseases, Perineal Anus, Periodic Amyloid Syndrome, Peri Polyneuropathy Peripheral, Polyneuropathy and Polyradicu odic Peritonitis Syndrome, Periodic Somnolence and Morbid loneuropathy, Polyostotic Fibrous Dysplasia, Polyostotic Hunger, Periodic Syndrome, Peripheral Cystoid Degenera Sclerosing Histiocytosis, Polyposis Familial, Polyposis tion of the Retina, Peripheral Dysostosis-Nasal Hypoplasia 60 Gardner Type, Polyposis Hamartomatous Intestinal, Polypo Mental Retardation, Peripheral Neuritis, Peripheral Neuropa sis Hamartomatous Intestinal, Polyposis-Osteomatosis-Epi thy, Peritoneopericardial Diaphragmatic Hernia, Pernicious dermoid Cyst Syndrome, Polyposis Skin Pigmentation Anemia, Pernicious Anemia, Pernicious Anemia, Peromelia Alopecia and Fingernail Changes, Polyps and Spots Syn with Micrognathia, Peroneal Muscular Atrophy, Peroneal drome, Polyps and Spots Syndrome, Polyserositis Recurrent, Nerve Palsy, Peroutka Sneeze, Peroxisomal Acyl-CoA Oxi 65 Polysomy Y. Polysyndactyly with Peculiar Skull Shape, dase, Peroxisomal Beta-Oxidation Disorders, Peroxisomal Polysyndactyly-Dysmorphic Craniofacies Greig Type, Bifunctional Enzyme, Peroxisomal Thiolase, Peroxisomal Pompe Disease, Pompe Disease, Popliteal Pterygium Syn US 7,662.929 B2 59 60 drome, Porcupine Man, Porencephaly, Porencephaly, Por Palsy, Progressive Systemic Sclerosis, Progressive Tapeto phobilinogen deaminase (PBG-D), Porphyria, Porphyria choroidal Dystrophy, Proline Oxidase Deficiency, Propionic Acute Intermittant, Porphyria Acute Intermittent, Porphyria Acidemia, Propionic Acidemia, Propionic Acidemia Type I ALA-D, Porphyria Cutanea Tarda, Porphyria Cutanea Tarda, (PCCA Deficiency), Propionic Acidemia Type II (PCCB Porphyria Cutanea Tarda Hereditaria, Porphyria Cutanea 5 Deficiency), Propionyl CoA Carboxylase Deficiency, Propio Tarda Symptomatica, Porphyria Hepatica Variegate, Porphy nyl CoA Carboxylase Deficiency, Protanomaly, Protanopia, ria Swedish Type, Porphyria Variegate, Porphyriam Acute Protein-Losing Enteropathy Secondary to Congestive Heart Intermittent, Porphyrins, Porrigo Decalvans, Port Wine Failure, Proteus Syndrome, Proximal Deletion of 4q Stains, Portuguese Type Amyloidosis, Post-Infective Poly Included, Proximal Deletion of 4q-Included, PRP PRS, neuritis, Postanoxic Intention Myoclonus, Postaxial Acrofa 10 Prune Belly Syndrome, PS, Pseudo-Hurler Polydystrophy, cial Dysostosis, Postaxial Polydactyly, Postencephalitic Pseudo-Polydystrophy, Pseudoacanthosis Nigricans, Intention Myoclonus, Posterior Corneal Dystrophy Heredi Pseudoachondroplasia, Pseudocholinesterase Deficiency, tary, Posterior Thalamic Syndrome, Postmyelographic Pseudogout Familial, Pseudohemophilia, Pseudohermaphro Arachnoiditis, Postnatal Cerebral Palsy, Postoperative ditism, Pseudohermaphroditism, Pseudohermaphroditism Cholestasis, Postpartum Galactorrhea-Amenorrhea Syn 15 Nephron Disorder-Wilm's Tumor, Pseudohypertrophic Mus drome, Postpartum Hypopituitarism, Postpartum Panhypopi cular Dystrophy, Pseudohypoparathyroidism, tuitary Syndrome, Postpartum Panhypopituitarism, Postpar Pseudohypoparathyroidism, Pseudohypophosphatasia, tum Pituitary Necrosis, Postural Hypotension, Potassium Pseudopolydystrophy, Pseudothalidomide Syndrome, Pseu Losing Nephritis, Potassium Loss Syndrome, Potter Type I doxanthoma Elasticum, Pseudoxanthoma Elasticum, Psoria Infantile Polycystic Kidney Diseases, Potter Type III Poly sis, Psorospermosis Follicularis, PSP, PSS, Psychomotor cystic Kidney Disease, PPH, PPS, Prader-Willi Syndrome, Convulsion, Psychomotor Epilepsy, Psychomotor Equivalent Prader-Labhart-Willi Fancone Syndrome, Prealbumin Tyr-77 Epilepsy, PTC Deficiency, Pterygium, Pterygium Colli Syn Amyloidosis, Preexcitation Syndrome, Preexcitation Syn drome, Pterygium Universale, Pterygolymphangiectasia, drome, Pregnenolone Deficiency, Premature Atrial Contrac Pulmonary Atresia, Pulmonary Lymphangiomyomatosis, tions, Premature Senility Syndrome, Premature Supraven 25 Pulmonary Stenosis, Pulmonic Stenosis-Ventricular Septal tricular Contractions, Premature Ventricular Complexes, Defect, Pulp Stones, Pulpal Dysplasia, Pulseless Disease, Prenatal or Connatal Neuroaxonal Dystrophy, Presenile Pure Alymphocytosis, Pure Cutaneous Histiocytosis, Purine Dementia, Presenile Macula Lutea Retinae Degeneration, Nucleoside Phosphorylase Deficiency, Purpura Hemor Primary Adrenal Insufficiency, Primary Agammaglobuline rhagica, Purtilo Syndrome, PXE, PXE Dominant Type, PXE mias, Primary Aldosteronism, Primary Alveolar HypoVenti 30 Recessive Type, Pycnodysostosis, Pyknodysostosis, Pyk lation, Primary Amyloidosis, Primary Anemia, Primary Ane noepilepsy, Pyroglutamic Aciduria, Pyroglutamicaciduria, mia, Primary Beriberi, Primary Biliary, Primary Biliary Pyrroline Carboxylate Dehydrogenase Deficiency, Pyruvate Cirrhosis, Primary Brown Syndrome, Primary Carnitine Carboxylase Deficiency, Pyruvate Carboxylase Deficiency Deficiency, Primary Central Hypoventilation Syndrome, Pri Group A, Pyruvate Carboxylase Deficiency Group B, Pyru mary Ciliary Dyskinesia Kartagener Type, Primary Cutane 35 vate Dehydrogenase Deficiency, Pyruvate Dehydrogenase ous Amyloidosis, Primary Dystonia, Primary Failure Adreno Deficiency, Pyruvate Dehydrogenase Deficiency, Pyruvate cortical Insufficiency, Primary Familial Hypoplasia of the Kinase Deficiency, q25-qter, q26 or q27-qter, q31 or 32-qter, Maxilla, Primary Hemochromatosis, Primary Hyperhidrosis, QT Prolongation with Extracellular Hypohypocalcinemia, Primary Hyperoxaluria Type I, Primary Hyperoxaluria QT Prolongation without Congenital Deafness, QT Pro Type 1 (PH1), Primary Hyperoxaluria Type 1, Primary 40 longed with Congenital Deafness, Quadriparesis of Cerebral Hyperoxaluria Type II, Primary Hyperoxaluria Type III, Pri Palsy, Quadriplegia of Cerebral Palsy, Quantal Squander, mary Hypogonadism, Primary Intestinal Lymphangiectasia, Quantal Squander, r1, ré, r14, r18, r21, r22, Rachischisis Primary Lateral Sclerosis, Primary Nonhereditary Amyloi Posterior, Radial Aplasia-Amegakaryocytic Thrombocytope dosis, Primary Obliterative Pulmonary Vascular Disease, Pri nia, Radial Aplasia-Thrombocytopenia Syndrome, Radial mary Progressive Multiple Sclerosis, Primary Pulmonary 45 Nerve Palsy, Radicular Neuropathy Sensory, Radicular Neu Hypertension, Primary Reading Disability, Primary Renal ropathy Sensory, Radicular Neuropathy Sensory Recessive, Glycosuria, Primary Sclerosing Cholangitis, Primary Throm Radicular Dentin Dysplasia, Rapid-onset Dystonia-parkin bocythemia, Primary Thrombocythemia, Primary Tumors of Sonism, Rapp-Hodgkin Syndrome, Rapp-Hodgkin (hypo Central Nervous System, Primary Visual Agnosia, Procto hidrotic) Ectodermal Dysplasia syndrome, Rapp-Hodgkin colitis Idiopathic, Proctocolitis Idiopathic, Progeria of Adult 50 Hypohidrotic Ectodermal Dysplasias, Rare hereditary ataxia hood, Progeria of Childhood, Progeroid Nanism, Progeriod with polyneuritic changes and deafness caused by a defect in Short Stature with Pigmented Nevi, Progeroid Syndrome of the enzyme phytanic acid hydroxylase, Rautenstrauch De Barsy, Progressive Autonomic Failure with Multiple Sys Wiedemann Syndrome, Rautenstrauch-Wiedemann Type tem. Atrophy, Progressive Bulbar Palsy, Progressive Bulbar Neonatal Progeria, Raynaud's Phenomenon, RDP. Reactive Palsy Included, Progressive Cardiomyopathic Lentiginosis, 55 Functional Hypoglycemia, Reactive Hypoglycemia Second Progressive Cerebellar Ataxia Familial, Progressive Cerebral ary to Mild Diabetes, Recessive Type Kenny-Caffe Syn Poliodystrophy, Progressive Choroidal Atrophy, Progressive drome, Recklin Recessive Type Myotonia Congenita, Reck Diaphyseal Dysplasia, Progressive Diaphyseal Dysplasia, linghausen Disease, Rectoperineal Fistula, Recurrent Progressive Facial Hemiatrophy, Progressive Familial Myo Vomiting, Reflex Neurovascular Dystrophy, Reflex Sympa clonic Epilepsy, Progressive Hemifacial Atrophy, Progres 60 thetic Dystrophy Syndrome, Refractive Errors, Refractory sive Hypoerythemia, Progressive Infantile Poliodystrophy, Anemia, Refrigeration Palsy, Refsum Disease, Refsums Progressive Lenticular Degeneration, Progressive Lipodys Disease, Regional Enteritis, Reid-Barlow's syndrome, Reif trophy, Progressive Muscular Dystrophy of Childhood, Pro enstein Syndrome, Reifenstein Syndrome, Reiger Anomaly gressive Myoclonic Epilepsy, Progressive Osseous Hetero Growth Retardation, Reiger Syndrome, Reimann Periodic plasia, Progressive Pallid Degeneration Syndrome, 65 Disease, Reimann's Syndrome, Reis-Bucklers Corneal Dys Progressive Pallid Degeneration Syndrome, Progressive trophy, Reiter's Syndrome, Reiter's Syndrome, Relapsing Spinobulbar Muscular Atrophy, Progressive Supranuclear Guillain-Barre Syndrome, Relapsing-Remitting Multiple US 7,662.929 B2 61 62 Sclerosis, Renal Agenesis, Renal Dysplasia-Blindness eroneal myopathy, Scapuloperoneal Muscular Dystrophy, Hereditary, Renal Dysplasia-Retinal Aplasia Loken-Senior Scapuloperoneal Syndrome Myopathic Type, Scarring Type, Renal Glycosuria, Renal Glycosuria Type A, Renal Bullosa, Scarring Bullosa, SCHAD, Schaumann's Disease, Glycosuria Type B, Renal Glycosuria Type O, Renal-Oculo Scheie Syndrome, Schereshevkii-Turner Syndrome, Schilder cerebrodystrophy, Renal-Retinal Dysplasia with Medullary Disease, Schilder Encephalitis, Schilder's Disease, Schindler Cystic Disease, Renal-Retinal Dysplasia with Medullary Disease Type I (Infantile Onset), Schindler Disease Infantile Cystic Disease, Renal-Retinal Dystrophy Familial, Renal Onset, Schindler Disease, Schindler Disease Type II (Adult Retinal Syndrome, Rendu-Osler-Weber Syndrome, Respira Onset), Schinzel Syndrome, Schinzel-Giedion Syndrome, tory Acidosis, Respiratory Chain Disorders, Respiratory Schinzel Acrocallosal Syndrome, Schinzel-Giedion Mid Myoclonus, Restless Legs Syndrome, Restrictive Cardio 10 face-Retraction Syndrome, Schizencephaly, Schmid Type myopathy, Retention Hyperlipemia, Rethore Syndrome (ob Metaphyseal Chondrodysplasia, Schmid Metaphyseal Dys solete), Reticular Dysgenesis, Retinal Aplastic-Cystic Kid ostosis, Schmid-Fraccaro Syndrome, Schmidt Syndrome, neys-Joubert Syndrome, Retinal Cone Degeneration, Retinal Schopf-Schultz-Passarge Syndrome, Schueller-Christian Cone Dystrophy, Retinal Cone-Rod Dystrophy, Retinitis Pig Disease, Schut-Haymaker Type, Schwartz-Jampel-Aberfeld mentosa, Retinitis Pigmentosa and Congenital Deafness, 15 Syndrome, Schwartz-Jampel Syndrome Types 1A and 1B, Retinoblastoma, Retinol Deficiency, Retinoschisis, Retin Schwartz-Jampel Syndrome, Schwartz-Jampel Syndrome oschisis Juvenile, Retraction Syndrome, Retrobulbar Neur Type 2, SCI, D SCID, scleroderma, Scleroderma, Sclerosis opathy, Retrolenticular Syndrome, Rett Syndrome, Reverse Familial Progressive Systemic, Sclerosis Diffuse Familial Coarction, Reye Syndrome, Reye's Syndrome, RGS, Rh Brain, Scott Craniodigital Syndrome With Mental Retarda Blood Factors, Rh Disease, Rh Factor Incompatibility, Rh tion, Scrotal Tongue, SCS, SCS, SD, SDS, SDYS, Seasonal Incompatibility, Rhesus Incompatibility, Rheumatic Fever, Conjunctivitis, Sebaceous Nevus Syndrome, Sebaceous Rheumatoid Arthritis, Rheumatoid Myositis, Rhinosinuso nevus, Seborrheic Keratosis, Seborrheic Warts, Seckel Syn genic Cerebral Arachnoiditis, Rhizomelic Chondrodysplasia drome, Seckel Type Dwarfism, Second Degree Congenital Punctata (RCDP), Acatalasemia, Classical Refsum disease, Heart Block, Secondary Amyloidosis, Secondary Ble RHS, Rhythmical Myoclonus, Rib Gap Defects with Micro 25 pharospasm, Secondary Non-tropical Sprue, Secondary gnathia, Ribbing Disease (obsolete), Ribbing Disease, Rich Brown Syndrome, Secondary Beriberi, Secondary General ner-Hanhart Syndrome, Rieger Syndrome, Rieter's Syn ized Amyloidosis, Secondary Dystonia, Secretory Compo drome, Right Ventricular Fibrosis, Riley-Day Syndrome, nent Deficiency, Secretory IgA Deficiency, SED Tarda, SED Riley-Smith syndrome, Ring Chromosome 14, Ring Chro Congenital, SEDC, Segmental linear achromic nevus, Seg mosome 18, Ring 4, Ring 4 Chromosome, Ring 6. Ring 6 30 mental Dystonia, Segmental Myoclonus, Seip Syndrome, Chromosome, Ring 9, Ring 9 Chromosome R9, Ring 14. Seitelberger Disease, Seitelberger Disease, Seizures, Selec Ring 15, Ring 15 Chromosome (mosaic pattern), Ring 18, tive Deficiency of IgG Subclasses, Selective Mutism, Selec Ring Chromosome 18, Ring 21, Ring 21 Chromosome, Ring tive Deficiency of IgG Subclass, Selective IgM Deficiency, 22, Ring 22 Chromosome, Ritter Disease, Ritter-Lyell Syn Selective Mutism, Selective IgA Deficiency, Self-Healing drome, RLS, RMSS, Roberts SC-Phocomelia Syndrome, 35 Histiocytosis, Semilobar Holoprosencephaly, Seminiferous Roberts Syndrome, Roberts Tetraphocomelia Syndrome, Tubule Dysgenesis, Senile Retinoschisis, Senile Warts, Robertson's Ectodermal Dysplasias, Robin Anomalad, Senior-Loken Syndrome, Sensory Neuropathy Hereditary Robin Sequence, Robin Syndrome, Robinow Dwarfism, Type I, Sensory Neuropathy Hereditary Type II, Sensory Robinow Syndrome, Robinow Syndrome Dominant Form, Neuropathy Hereditary Type I, Sensory Radicular Neuropa Robinow Syndrome Recessive Form, Rod myopathy, Roger 40 thy, Sensory Radicular Neuropathy, Sensory Radicular Neu Disease, Rokitansky's Disease, Romano-Ward Syndrome, ropathy Recessive, Septic Progressive Granulomatosis, Romberg Syndrome, Rootless Teeth, Rosenberg-Chutorian Septo-Optic Dysplasia, Serous Circumscribed Meningitis, Syndrome, Rosewater Syndrome, Rosewater Syndrome, Serum Protease Inhibitor Deficiency, Serum Carnosinase Rosselli-Gulienatti Syndrome, Rothmund-Thomson Syn Deficiency, Setleis Syndrome, Severe Combined Immunode drome, Roussy-Levy Syndrome, RP, RSX-Linked, RS, RS, 45 ficiency, Severe Combined Immunodeficiency with Adenos RSDS, RSH Syndrome, RSS, RSTS, RTS, RTS, RTS, ine Deaminase Deficiency, Severe Combined Immunodefi Rubella Congenital, Rubinstein Syndrome, Rubinstein-Taybi ciency (SCID), Sex Reversal, Sexual Infantilism, SGB Syndrome, Rubinstein Taybi Broad Thumb-Hallux syn Syndrome. Sheehan Syndrome, Shields Type Dentinogenesis drome, Rufous Albinism, Ruhr's Syndrome, Russell's Dien Imperfecta, Shingles, varicella-zoster virus, Ship Beriberi, cephalic Cachexia, Russell’s Syndrome, Russell Syndrome, 50 SHORT Syndrome, Short Arm 18 Deletion Syndrome, Short Russell-Silver Dwarfism, Russell-Silver Syndrome, Russell Chain Acyl CoA Dehydrogenase Deficiency, Short Chain Silver Syndrome X-linked, Ruvalcaba-Myhre-Smith syn Acyl-CoA Dehydrogenase (SCAD) Deficiency, Short Stature drome (RMSS), Ruvalcaba Syndrome, Ruvalcaba Type and Facial Telangiectasis, Short Stature Facial/Skeletal Osseous Dysplasia with Mental Retardation, Sacral Regres Anomalies-Retardation-Macrodontia, Short Stature-Hyper Sion, Sacral Agenesis Congenital, SAE, Saethre-Chotzen 55 extensibility-Rieger Anomaly-Teething Delay, Short Stature Syndrome, Sakati, Sakati Syndrome, Sakati-Nyhan Syn Onychodysplasia, Short Stature Telangiectatic Erythema of drome, Salaam Spasms, Salivosudoriparous Syndrome, Salz the Face, SHORT Syndrome, Shoshin Beriberi, Shoulder man Nodular Corneal Dystrophy, Sandhoff Disease, Sanfil girdle syndrome, Shprintzen-Goldberg Syndrome, Shulman ippo Syndrome, Sanfilippo Type A, Sanfilippo Type B, Syndrome, Shwachman-Bodian Syndrome, Shwachman Santavuori Disease, Santavuori-Haltia Disease, Sarcoid of 60 Diamond Syndrome, Shwachman Syndrome, Shwachman Boeck, Sarcoidosis, Sarcoidosis, Sathre-chotzen, Saturday Diamond-Oski Syndrome, Shwachmann Syndrome, Shy Night Palsy, SBMA, SC Phocomelia Syndrome, SC Syn Drager Syndrome, Shy-Magee Syndrome, SI Deficiency, drome, SCA3, SCAD Deficiency, SCAD Deficiency Adult Sialidase Deficiency, Sialidosis Type I Juvenile, Sialidosis Onset Localized, SCAD Deficiency Congenital Generalized, Type II Infantile, Sialidosis, Sialolipidosis, Sick Sinus Syn SCAD, SCAD, SCAD, SCADH Deficiency, Scalded Skin 65 drome, Sickle Cell Anemia, Sickle Cell Disease, Sickle Cell Syndrome, Scalp Defect Congenital, Scaphocephaly, Hemoglobin C Disease, Sickle Cell-Hemoglobin D Disease, Scaphocephaly, Scaphocephaly, Scapula Elevata, Scapulop Sickle Cell-Thalassemia Disease, Sickle Cell Trait, Sidero US 7,662.929 B2 63 64 blastic Anemias, Sideroblastic Anemia, Sideroblastosis, Sid Stenosis of the Lumbar Vertebral Canal, Stenosis, Steroid eroblastosis, SIDS, Siegel-Cattan-Mamou Syndrome, Sulfatase Deficiency, Stevanovic's Ectodermal Dysplasias, Siemens-Bloch type Pigmented Dermatosis, Siemens Syn Stevens Johnson Syndrome, Stevens-Johnson Syndrome, drome, Siewerling-Creutzfeldt Disease, Siewert Syndrome, STGD, Stickler Syndrome, Stickler Syndrome, Stiff-Man Silver Syndrome, Silver-Russell Dwarfism, Silver-Russell Syndrome, Stiff Man Syndrome, Stiff Person Syndrome, Syndrome, Simmond's Disease, Simons Syndrome, Simplex Still's Disease, Stilling-Turk-Duane Syndrome, Stillis Dis Epidermolysis Bullosa, Simpson Dysmorphia Syndrome, ease, Stimulus-Sensitive Myoclonus, Stone Man Syndrome, Simpson-Golabi-Behmel Syndrome, Sinding-Larsen-Jo Stone Man, Streeter Anomaly, Striatonigral Degeneration hansson Disease, Singleton-Merten Syndrome. Sinus Autosomal Dominant Type, Striopallidodentate Calcinosis, Arrhythmia, Sinus Venosus, Sinus tachycardia, Sirenomelia 10 Stroma, Descemet's Membrane, Stromal Corneal Dystrophy, Sequence, Sirenomelus, Situs Inversus Bronchiectasis and Struma Lymphomatosa, Sturge-Kalischer-Weber Syndrome, Sinusitis, SJA Syndrome, Sjogren Larsson Syndrome Ich Sturge Weber Syndrome, Sturge-Weber Phakomatosis, Sub thyosis, Sjogren Syndrome, Sjogren Larsson Syndrome Ich acute Necrotizing Encephalomyelopathy, Subacute Necrotiz thyosis, Sjögren's Syndrome, SJS, Skeletal dysplasia, Skel ing Encephalomyelopathy, Subacute Spongiform Encephal etal Dysplasia Weismann Netter Stuhl Type, Skin Peeling 15 opathy, Subacute Necrotizing Encephalopathy, Subacute Syndrome, Skin Neoplasms, Skull Asymmetry and Mild Sarcoidosis, Subacute Neuronopathic, Subaortic Stenosis, Retardation, Skull Asymmetry and Mild Syndactyly, SLE, Subcortical Arteriosclerotic Encephalopathy, Subendocar Sleep Epilepsy, Sleep Apnea, SLO, Sly Syndrome, SMA, dial Sclerosis, Succinylcholine Sensitivity, Sucrase-Isomal SMA Infantile Acute Form, SMA I, SMA-III, SMA type I, tase Deficiency Congenital. Sucrose-Isomaltose Malabsorp SMA type II, SMA type III, SMA3, SMAX1, SMCR, Smith tion Congenital. Sucrose Intolerance Congenital, Lemli Opitz Syndrome, Smith Magenis Syndrome, Smith Sudanophilic Leukodystrophy ADL, Sudanophilic Leukod Magenis Chromosome Region, Smith-McCort Dwarfism, ystrophy Pelizaeus-Merzbacher Type, Sudanophilic Leukod Smith-Opitz-Inborn Syndrome, Smith Disease, Smoldering ystrophy Included, Sudden Infant Death Syndrome, Sudecks Myeloma, SMS, SMS, SNE, Sneezing From Light Exposure, Atrophy, Sugio-Kaji Syndrome, Summerskill Syndrome, Sodium valproate, Solitary Plasmacytoma of Bone, Sorsby 25 Summit Acrocephalosyndactyly, Summitt's Acrocephalo Disease, Sotos Syndrome, Souques-Charcot Syndrome, syndactyly, Summitt Syndrome, Superior Oblique Tendon South African Genetic Porphyria, Spasmodic Dysphonia, Sheath Syndrome, Suprarenal glands, Supravalvular Aortic Spasmodic Torticollis, Spasmodic Torticollis, Spasmodic Stenosis, Supraventricular tachycardia, Surdicardiac Syn Wryneck, Spastic Cerebral Palsy, Spastic Colon, Spastic drome, Surdocardiac Syndrome, SVT Sweat Gland Abscess, Dysphonia, Spastic Paraplegia, SPD Calcinosis, Specific 30 Sweating Gustatory Syndrome, Sweet Syndrome, Swiss Antibody Deficiency with Normal Immunoglobulins, Spe Cheese Cartilage Syndrome, Syndactylic Oxycephaly, Syn cific Reading Disability, SPH2, Spherocytic Anemia, Sphero dactyly Type I with Microcephaly and Mental Retardation, cytosis, Spherophakia-Brachymorphia Syndrome, Sphingo Syndromatic Hepatic Ductular Hypoplasia, Syringomyelia, myelin Lipidosis, Sphingomyelinase Deficiency, Spider Systemic Aleukemic Reticuloendotheliosis, Systemic Amy fingers, Spielmeyer-Vogt Disease, Spielmeyer-Vogt-Batten 35 loidosis, Systemic Carnitine Deficiency, Systemic Elastor Syndrome, Spina Bifida, Spina Bifida, Spina Bifida Aperta, rhexis, Systemic Lupus Erythematosus, Systemic Mast Cell Spinal Arachnoiditis, Spinal Arteriovenous Malformation, Disease, Systemic Mastocytosis, Systemic-Onset Juvenile Spinal Ataxia Hereditofamilial, Spinal and Bulbar Muscular Arthritis, Systemic-Onset Juvenile Arthritis, Systemic Scle Atrophy, Spinal Diffuse Idiopathic Skeletal Hyperostosis, rosis, Systopic Spleen, T-Lymphocyte Deficiency, Tachyali Spinal DISH, Spinal Muscular Atrophy, Spinal Muscular 40 mentation Hypoglycemia, Tachycardia, Takahara syndrome, Atrophy, Spinal Muscular Atrophy All Types, Spinal Muscu Takayasu Disease, Takayasu Arteritis, Takayasu Arteritis, lar Atrophy Type ALS, Spinal Muscular Atrophy-Hypertro Talipes Calcaneus, Talipes Equinovarus, Talipes Equinus, phy of the Calves, Spinal Muscular Atrophy Type I, Spinal Talipes Varus, Talipes Valgus, Tandem Spinal Stenosis, Muscular Atrophy Type III, Spinal Muscular Atrophy type 3. Tangier Disease, Tapetoretinal Degeneration, TAR Syn Spinal Muscular Atrophy-Hypertrophy of the Calves, Spinal 45 drome, Tardive Dystonia, Tardive Muscular Dystrophy, Tar Ossifying Arachnoiditis, Spinal Stenosis, Spino Cerebellar dive Dyskinesia, Tardive Oral Dyskinesia, Tardive Dyskine Ataxia, Spinocerebellar Atrophy Type I, Spinocerebellar sia, Tardive Dystonia, Tardy Ulnar Palsy, Target Cell Anemia, Ataxia Type I (SCA1), Spinocerebellar Ataxia Type II Tarsomegaly, Tarui Disease, TAS Midline Defects Included, (SCAII), Spinocerebellar Ataxia Type III (SCAIII), Spinoc TAS Midline Defect, Tay Sachs Disease, Tay Sachs Sphin erebellar Ataxia Type III (SCA 3), Spinocerebellar Ataxia 50 golipidosis, Tay Sachs Disease, Tay Syndrome Ichthyosis, Type IV (SCAIV), Spinocerebellar Ataxia Type V (SCAV), Tay Sachs Sphingolipidosis, Tay Syndrome Ichthyosis, Taybi Spinocerebellar Ataxia Type VI (SCAVI), Spinocerebellar Syndrome Type I, Taybi Syndrome, TCD, TCOF1, TCS, TD, Ataxia Type VII (SCAVII), Spirochetal Jaundice, Splenic TDO Syndrome, TDO-I, TDO-II, TDO-III, Telangiectasis, Agenesis Syndrome, Splenic Ptosis, Splenoptosis, Split Hand Telecanthus with Associated Abnormalities, Telecanthus Deformity-Mandibulofacial Dysostosis, Split Hand Defor 55 With Associated Abnormalities, Telecanthus-Hypospadias mity-Mandibulofacial Dysostosis, Split Hand Deformity, Syndrome, Temporal Lobe Epilepsy, Temporal Arteritis/Gi Split-Hand Deformity, Spondyloarthritis, Spondylocostal ant Cell Arteritis, Temporal Arteritis, TEN, Tendon Sheath Dysplasia Type I, Spondyloepiphyseal Dysplasia Tarda, Adherence Superior Obliqu, Tension Myalgia, Terminal Spondylothoracic Dysplasia, Spondylotic Caudal Radicul Deletion of 4q Included, Terminal Deletion of 4q-Included, opathy, Sponge Kidney, Spongioblastoma Multiforme, Spon 60 Terrian Corneal Dystrophy, Teschler-Nicola/Killian Syn taneous Hypoglycemia, Sprengel Deformity, Spring Oph drome, Tethered Spinal Cord Syndrome, Tethered Cord Mal thalmia, SRS, ST, Stale Fish Syndrome, Staphyloccal formation Sequence, Tethered Cord Syndrome, Tethered Cer Scalded Skin Syndrome, Stargardt’s Disease, Startle Disease, vical Spinal Cord Syndrome, Tetrahydrobiopterin Status Epilepticus, Steele-Richardson-Olszewski Syndrome, Deficiencies, Tetrahydrobiopterin Deficiencies, Tetralogy of Steely Hair Disease, Stein-Leventhal Syndrome, Steinert 65 Fallot, Tetralogy of Fallot, Tetraphocomelia-Thrombocy Disease, Stengel’s Syndrome, Stengel-Batten-Mayou topenia Syndrome, Tetrasomy Short Arm of Chromosome 9, Spielmeyer-Vogt-Stock Disease, Stenosing Cholangitis, Tetrasomy 9p, Tetrasomy Short Arm of Chromosome 18, US 7,662.929 B2 65 66 Thalamic Syndrome, Thalamic Pain Syndrome, Thalamic Familial Incomplete Male Pseudohermaphroditism, Type I Hyperesthetic Anesthesia, Thalassemia Intermedia, Thalas Gaucher Disease. Type I (PCCA Deficiency). Type I semia Minor, Thalassemia Major. Thiamine Deficiency, Tyrosinemia, Type II Gaucher Disease, Type II Histiocytosis, Thiamine-Responsive Maple Syrup Urine Disease. Thin Type II (PCCB Deficiency). Type II Tyrosinnemia, Type IIA Basement-Membrane Nephropathy. Thiolase deficiency, Distal Arthrogryposis Multiplex Congenita, Type III Gaucher RCDP. Acyl-CoA dihydroxyacetonephosphate acyltrans Disease, Type III Tyrosinemia, Type III Dentinogenesis ferase. Third and Fourth Pharyngeal Pouch Syndrome. Third Imperfecta, Typical Retinoschisis, Tyrosinase Negative Albi Degree Congenital (Complete) Heart Block, Thomsen Dis nism (Type I), Tyrosinase Positive Albinism (Type II), ease, Thoracic-Pelvic-Phalangeal Dystrophy, Thoracic Spi Tyrosinemia type I acute form, Tyrosinemia type I chronic nal Canal, Thoracoabdominal Syndrome, Thoracoabdominal 10 form, Tyrosinosis, UCE, Ulcerative Colitis, Ulcerative Colitis Ectopia Cordis Syndrome. Three M Syndrome, Three-M Chronic Non-Specific, Ulnar-Mammary Syndrome, Ulnar Slender-Boned Nanism, Thrombasthenia of Glanzmann and Mammary Syndrome of Pallister, Ulnar Nerve Palsy, UMS, Naegeli, Thrombocythemia Essential, Thrombocytopenia Unclassified FODs, Unconjugated Benign Bilirubinemiav, Absent Radius Syndrome, Thrombocytopenia-Hemangioma Underactivity of Parathyroid, Unilateral Ichthyosiform Syndrome, Thrombocytopenia-Absent Radii Syndrome, 15 Erythroderma with Ipsilateral Malformations Limb, Unilat Thrombophilia Hereditary Due to ATIII, Thrombotic Throm eral Chondromatosis, Unilateral Defect of Pectoralis Muscle bocytopenic Purpura, Thromboulcerative Colitis, Throm and Syndactyly of the Hand, Unilateral Hemidysplasia Type, boulcerative Colitis, Thymic Dysplasia with Normal Immu Unilateral Megalencephaly, Unilateral Partial Lipodystro noglobulins, Thymic Agenesis, Thymic Aplasia DiGeorge phy, Unilateral Renal Agenesis, Unstable Colon, Unverricht Type, Thymic Hypoplasia Agammaglobulinemias Primary Disease, Unverricht-Lundborg Disease, Unverricht-Lund Included, Thymic Hypoplasia DiGeorge Type, Thymus Con borg-Laf Disease, Unverricht Syndrome, Upper Limb-Car genital Aplasia, Tic Douloureux, Tics, Tinel’s syndrome, diovascular Syndrome (Holt-Oram), Upper Motor Neuron Tolosa Hunt Syndrome, Tonic Spasmodic Torticollis, Tonic Disease, Upper Airway Apnea, Upper Airway Apnea, Urea Pupil Syndrome, Tooth and Nail Syndrome, Tooth and Nail Cycle Defects or Disorders, Urea Cycle Disorder Arginase Syndrome, Torch Infection, TORCH Syndrome, Torsion 25 Type, Urea Cycle Disorder Arginino Succinase Type, Urea Dystonia, Torticollis, Torticollis, Total Lipodystrophy, Total Cycle Disorders Carbamyl Phosphate Synthetase Type, Urea anomalous pulmonary venous connection, Touraine's Aph Cycle Disorder Citrullinemia Type, Urea Cycle Disorders thosis, Tourette Syndrome, Tourette's disorder, Townes N-Acrtyl Glutamate Synthetase Typ, Urea Cycle Disorder Brocks Syndrome, Townes Syndrome, Toxic Paralytic Ane OTC Type, Urethral Syndrome, Urethro-Oculo-Articular mia, Toxic Epidermal Necrolysis, Toxopachyosteose 30 Syndrome, Uridine Diphosphate Glucuronosyltransferase Diaphysaire Tibio-Peroniere, Toxopachyosteose, Toxoplas Severe Def. Type I, Urinary Tract Defects, Urofacial Syn mosis. Other Agents Rubella Cytomegalovirus Herpes Sim drome, Uroporphyrinogen III cosynthase, Urticaria pigmen plex, Tracheoesophageal Fistula with or without Esophageal tosa, Usher Syndrome, Usher Type I, Usher Type II, Usher Atresia, Tracheoesophageal Fistula, Transient neonatal Type III, Usher Type IV. Uterine Synechiae, Uoporphyrino myasthenia gravis, Transitional Atrioventricular Septal 35 gen I-synthase, Uveitis, Uveomeningitis Syndrome, V-CJD. Defect, Transposition of the great arteries, Transtelephonic VACTEL Association, VACTERL Association, VACTERL Monitoring, Transthyretin Methionine-30 Amyloidosis Syndrome, Valgus Calcaneus, Valine Transaminase Defi (Type I), Trapezoidocephaly-Multiple Synostosis Syndrome, ciency, Valinemia, Valproic Acid, Valproate acid exposure, Treacher Collins Syndrome, Treacher Collins-Franceschetti Valproic acid exposure, Valproic acid, Van Buren's Disease, Syndrome 1, Trevor Disease, Triatrial Heart, Tricho-Dento 40 Van der Hoeve-Habertsma-Waardenburg-Gauldi Syndrome, Osseous Syndrome, Trichodento Osseous Syndrome, Tri Variable Onset Immunoglobulin Deficiency Dysgamma chopoliodystrophy, Trichorhinophalangeal Syndrome, Tri globulinemia, Variant Creutzfeldt-Jakob Disease (V-CJD), chorhinophalangeal Syndrome, Tricuspid atresia, Varicella Embryopathy, Variegate Porphyria, Variegate Por Trifunctional Protein Deficiency, Trigeminal Neuralgia, Trig phyria, Variegate Porphyria, Vascular Birthmarks, Vascular lyceride Storage Disease Impaired Long-Chain Fatty Acid 45 Dementia Binswanger's Type, Vascular Erectile Tumor, Vas Oxidation, Trigonitis, Trigonocephaly, Trigonocephaly, cular Hemophilia, Vascular Malformations, Vascular Malfor Trigonocephaly, Trigonocephaly Syndrome, Trigonocephaly mations of the Brain, Vasculitis, Vasomotor Ataxia, Vaso “C” Syndrome, Trimethylaminuria, Triphalangeal Thumbs pressin-Resistant Diabetes Insipidus, Vasopressin-Sensitive Hypoplastic Distal Phalanges-Onychodystrophy, Tripha Diabetes Insipidus, VATER Association, V.cfsyndrome, Vcfs, langeal Thumb Syndrome, Triple Symptom Complex of Beh 50 Velocardiofacial Syndrome, VeloCardioFacial Syndrome, cet, Triple X Syndrome, Triplo X Syndrome, Triploid Venereal Arthritis, Venous Malformations, Ventricular Fibril Syndrome, Triploidy, Triploidy Syndrome, Trismus lation, Ventricular Septal Defects, Congenital Ventricular Pseudocamptodactyly Syndrome, Trisomy, Trisomy G Syn Defects, Ventricular Septal Defect, Ventricular Tachycardia, drome, Trisomy X, Trisomy 6q Partial, Trisomy 6q Syndrome Venual Malformations, VEOHD, Vermis Aplasia, Vermis Partial, Trisomy 9 Mosaic, Trisomy 9P Syndrome (Partial) 55 Cerebellar Agenesis, Vernal Keratoconjunctivitis, Verruca, Included, Trisomy 11q Partial, Trisomy 14 Mosaic, Trisomy Vertebral Anal Tracheoesophageal Esophageal Radial, Verte 14 Mosaicism Syndrome, Trisomy 21 Syndrome, Trisomy 22 bral Ankylosing Hyperostosis, Very Early Onset Hunting Mosaic, Trisomy 22 Mosaicism Syndrome, TRPS, TRPS1, ton's Disease, Very Long Chain Acyl-CoA Dehydrogenase TRPS2, TRPS3, True Hermaphroditism, True Hermaphrodit (VLCAD) Deficiency, Vestibular Schwannoma, Vestibular ism, Truncus arteriosus, Tryptophan Malabsorption, Tryp 60 Schwannoma Neurofibromatosis, Vestibulocerebellar, Vir tophan Pyrrolase Deficiency, TS, TTP, TTTS, Tuberous Scle chow's Oxycephaly, Visceral Xanthogranulomatosis, Vis rosis, Tubular Ectasia, Turcot Syndrome, Turner Syndrome, ceral Xantho-Granulomatosis, Visceral myopathy-External Turner-Kieser Syndrome, Turner Phenotype with Normal Opthalmoplegia, Visceromegaly-Umbilical Hernia-Macro Chromosomes (Karyotype), Turner-Varny Syndrome, Turri glossia Syndrome, Visual Amnesia, Vitamin A Deficiency, cephaly, Twin-Twin Transfusion Syndrome, Twin-to-Twin 65 Vitamin B-1 Deficiency, Vitelline Macular Dystrophy, Viti Transfusion Syndrome, Type A, Type B, Type AB, Type O, ligo, Vitiligo, Vitiligo Capitis, Vitreoretinal Dystrophy, VKC, Type I Diabetes, Type I Familial Incomplete Male, Type I VKH Syndrome, VLCAD, VLCAD, Vogt Syndrome, Vogt US 7,662.929 B2 67 68 Cephalosyndactyly, Vogt Koyanagi Harada Syndrome, Vogt myopathy and Neutropenia, X-Linked Centronuclear myopa Koyanagi Harada Syndrome, Vogt Koyanagi Harada Syn thy, X-linked Copper Deficiency, X-linked Copper Malab drome, Von Bechterew-Strumpell Syndrome, Von Eulenburg Sorption, X-Linked Dominant Conradi-Hunermann Syn Paramyotonia Congenita, Von Frey's Syndrome, Von Gierke drome, X-Linked Dominant Inheritance Agenesis of Corpus Disease, Von Hippel-Lindau Syndrome, Von Mikulicz. Syn Callosum, X-Linked Dystonia-parkinsonism, X-Linked Ich drome, Von Recklinghausen Disease, Von Willebrandt Dis thyosis, X Linked. Ichthyosis, X-Linked Infantile Agamma ease, VP. Vrolik Disease (Type II), VSD, VSD, Vulgaris Type globulinemia, X-Linked Infantile Nectrotizing Encephalopa Disorder of Cornification, Vulgaris Type Ichthyosis, W Syn thy, X-linked Juvenile Retinoschisis, X-linked drome, Waardenburg Syndrome, Waardenburg-Klein Syn Lissencephaly, X-linked Lymphoproliferative Syndrome, drome, Waardenburg Syndrome Type I (WS1), Waardenburg 10 X-linked Mental Retardation-Clasped Thumb Syndrome, Syndrome Type II (WS2), Waardenburg Syndrome Type IIA X-Linked Mental Retardation with Hypotonia, X-linked (WS2A), Waardenburg Syndrome Type IIB (WS2B), Mental Retardation and Macroorchidism, X-Linked Progres Waardenburg Syndrome Type III (WS3), Waardenburg Syn sive Combined Variable Immunodeficiency, X-Linked drome Type IV (WS4), Waelsch's Syndrome, WAGR Com Recessive Conradi-Hunermann Syndrome, X-Linked Reces plex, WAGR Syndrome, WAGR Syndrome, Waldenstroems 15 sive Severe Combined Immunodeficiency, X-Linked Reces Macroglobulinemia, Waldenstrom's Purpura, Waldenstrom's sive Severe Combined Immunodeficiency, X-Linked Retin Syndrome, Waldmann Disease, Walker-Warburg Syndrome, oschisis, X-linked Spondyloepiphyseal Dysplasia, Xanthine Wandering Spleen, Warburg Syndrome, Warm Antibody Oxidase Deficiency (Xanthinuria Deficiency, Hereditary), Hemolytic Anemia, Warm Reacting Antibody Disease, Xanthinuria Deficiency, Hereditary (Xanthine Oxidase Defi Wartenberg Syndrome, WAS, Water on the Brain, Watson ciency), Xanthogranulomatosis Generalized, Xanthoma Syndrome, Watson-Alagille Syndrome, Waterhouse-Frider Tuberosum, Xeroderma Pigmentosum, Xeroderma Pigmen ichsen syndrome, Waxy Disease, WBS. Weaver Syndrome, tosum Dominant Type, Xeroderma Pigmentosum Type A I Weaver-Smith Syndrome, Weber-Cockayne Disease, Wege XPA Classical Form, Xeroderma Pigmentosum Type B II ner's Granulomatosis, Wegener's Granulomatosis, Weil Dis XPB, Xeroderma Pigmentosum Type E V XPE, Xeroderma ease, Weil Syndrome, Weill-Marchesani, Weill-Marchesani 25 Pigmentosum Type C III XPC, Xeroderma Pigmentosum Syndrome, Weill-Reyes Syndrome, Weismann-Netter-Stuhl Type D IV XPD, Xeroderma Pigmentosum Type F VI XPF, Syndrome, Weissenbacher-Zweymuller Syndrome, Wells Xeroderma Pigmentosum Type G VII XPG, Xeroderma Pig Syndrome, Wenckebach, Werdnig-Hoffman Disease, Werd mentosum Variant Type XP-V. Xeroderma-Talipes- and nig-Hoffmann Disease, Werdnig-Hoffmann disease, Werd Enamel Defect, Xerodermic Idiocy, Xerophthalmia, Xerotic nig-Hoffman Disease, Werdnig-Hoffman Paralysis, Wer 30 Keratitis, XLP, XO Syndrome, XP, XX Male Syndrome, Sex lhofs Disease, Werner Syndrome, Wernicke's (C) I Reversal, XXXXX Syndrome, XXY Syndrome, XYY Syn Syndrome, Wernicke's aphasia, Wernicke-Korsakoff Syn drome, XYY Chromosome Pattern, Yellow Mutant Albinism, drome, West Syndrome, Wet Beriberi, WHCR, Whipple's Yellow Nail Syndrome, YKLYoung Female Arteritis, Yunis Disease, Whipple Disease. Whistling face syndrome, Whis Varon Syndrome, YY Syndrome, Z-E Syndrome, Z- and tling Face-Windmill Vane Hand Syndrome, White-Darier 35 -Protease Inhibitor Deficiency, Zellweger Syndrome, Zell Disease, Whitnall-Norman Syndrome, Whorled nevoid weger syndrome, Zellweger cerebro-hepato-renal syndrome, hypermelanosis, WHS, Wieacker Syndrome, Wieacher Syn ZES, Ziehen-Oppenheim Disease (Torsion Dystonia), Zim drome, Wieacker-Wolff Syndrome, Wiedmann-Beckwith mermann-Laband Syndrome, Zinc Deficiency Congenital, Syndrome, Wiedemann-Rautenstrauch Syndrome, Wilder Zinsser-Cole-Engman Syndrome, ZLS, Zollinger-Ellison vanck Syndrome, Willebrand-Juergens Disease, Willi-Prader 40 Syndrome. Syndrome, Williams Syndrome, Williams Syndrome, Will As used herein a "cancer refers to a group of diseases and iams-Beuren Syndrome, Wilms Tumor, Wilms Tumor disorders that are characterized by uncontrolled cellular Aniridia-Gonadoblastoma-Mental Retardation Syndrome, growth (e.g. formation of tumor) without any differentiation Wilms Tumor Aniridia Gonadoblastoma Mental Retardation, of those cells into specialized and different cells. Cancers Wilms Tumor-Aniridia-Genitourinary Anomalies-Mental 45 which can be treated using the methods of the present inven Retardation Syndrome, Wilms Tumor-Pseudohermaphrodit tion include, without being limited to, ABL1 protooncogene, ism-Nephropathy, Wilms Tumor and Pseudohermaphrodit AIDS Related Cancers, Acoustic Neuroma, Acute Lympho ism, Wilms Tumor-Pseuodohermaphroditism-Glomerulopa cytic Leukaemia, Acute Myeloid Leukaemia, Adenocystic thy, Wilson's Disease, Winchester Syndrome, Winchester carcinoma, Adrenocortical Cancer, Agnogenic myeloid Grossman Syndrome, Wiskott-Aldrich Syndrome, Wiskott 50 metaplasia, Alopecia, Alveolar soft-part sarcoma, Anal can Aldrich Type Immunodeficiency. Witkop Ectodermal cer, Angiosarcoma, Aplastic Anaemia, Astrocytoma, Ataxia Dysplasias. Witkop Tooth-Nail Syndrome. Wittmaack-Ek telangiectasia, Basal Cell Carcinoma (Skin), Bladder Cancer, bom Syndrome, WM Syndrome, WMS, WMS, WNS, Wohl Bone Cancers, Bowel cancer, Brain Stem Glioma, Brain and fart-Disease, Wohlfart-Kugelberg-Welander Disease, Wolf CNS Tumors, Breast Cancer, CNS tumors, Carcinoid Syndrome, Wolf-Hirschhorn Chromosome Region (WHCR), 55 Tumors, Cervical Cancer, Childhood Brain Tumors, Child Wolf-Hirschhorn Syndrome, Wolff-Parkinson-White Syn hood Cancer, Childhood Leukaemia, Childhood Soft Tissue drome, Wolff-Parkinson-White syndrome, Wolff Parkinson Sarcoma, Chondrosarcoma, Choriocarcinoma, Chronic White Syndrome, Wolfram Syndrome, Wolman Disease (Ly Lymphocytic Leukaemia, Chronic Myeloid Leukaemia, Col somal Acid Lypase Deficiency), Woody Guthrie's Disease, orectal Cancers, Cutaneous T-Cell Lymphoma, Dermatofib WPW Syndrome, WPW Syndrome, Writer's Cramp, WS, 60 rosarcoma-protuberans, Desmoplastic-Small-Round-Cell WS, WS, WSS, WWS, Wyburn-Mason Syndrome, Wyburn Tumor, Ductal Carcinoma, Endocrine Cancers, Endometrial Mason Syndrome, X-Linked Addison's Disease, X-linked Cancer, Ependymoma, Esophageal Cancer, Ewing's Sar Adrenoleukodystrophy (X-ALD), X-linked Adult Onset coma, Extra-Hepatic Bile Duct Cancer, Eye Cancer, Eye: Spinobulbar Muscular Atrophy, X-linked Adult Spinal Mus Melanoma, Retinoblastoma, Fallopian Tube cancer, Fanconi cular Atrophy, X-Linked Agammaglobulinemia with Growth 65 Anaemia, Fibrosarcoma, Gall Bladder Cancer, Gastric Can Hormone Deficiency, X-Linked Agammaglobulinemia, cer, Gastrointestinal Cancers, Gastrointestinal-Carcinoid Lymphoproliferate X-Linked Syndrome, X-linked Cardio Tumor, Genitourinary Cancers, Germ Cell Tumors, Gesta US 7,662.929 B2 69 70 tional-Trophoblastic-Disease, Glioma, Gynaecological having modified backbones include those that retain a phos Cancers, Haematological Malignancies, Hairy Cell Leu phorus atom in the backbone and those that do not have a kaemia, Head and Neck Cancer, Hepatocellular Cancer, phosphorus atom in the backbone. For the purposes of this Hereditary Breast Cancer. Histiocytosis, Hodgkin’s Disease, specification, and as sometimes referenced in the art, modi Human Papillomavirus, Hydatidiform mole, Hypercalcemia, fied oligonucleotides that do not have a phosphorus atom in Hypopharynx Cancer, IntraCcular Melanoma, Islet cell can their internucleoside backbone can also be considered to be cer, Kaposi's sarcoma, Kidney Cancer, Langerhan's-Cell oligonucleosides. Histiocytosis, Laryngeal Cancer, Leiomyosarcoma, Leu Preferred modified oligonucleotide backbones containing kaemia, Li-Fraumeni Syndrome, Lip Cancer, Liposarcoma, a phosphorus atom therein include, for example, phospho Liver Cancer, Lung Cancer, Lymphedema, Lymphoma, 10 rothioates, chiral phosphorothioates, phosphorodithioates, Hodgkin’s Lymphoma, Non-Hodgkin’s Lymphoma, Male phosphotriesters, aminoalkylphosphotriesters, methyl and Breast Cancer, Malignant-Rhabdoid-Tumor-of-Kidney, other alkyl phosphonates including 3'-alkylene phospho Medulloblastoma, Melanoma, Merkel Cell Cancer, Mesothe nates, 5'-alkylene phosphonates and chiral phosphonates, lioma, Metastatic Cancer, Mouth Cancer, Multiple Endocrine phosphinates, phosphoramidates including 3'-amino phos Neoplasia, Mycosis Fungoides, Myelodysplastic Syn 15 phoramidate and aminoalkylphosphoramidates, thionophos dromes, Myeloma, Myeloproliferative Disorders, Nasal Can phoramidates, thionoalkylphosphonates, thionoalkylphos cer, Nasopharyngeal Cancer, Nephroblastoma, Neuroblas photriesters, selenophosphates and boranophosphates having toma, Neurofibromatosis, Nijmegen Breakage Syndrome, normal 3'-5' linkages. 2'-5' linked analogs of these, and those Non-Melanoma Skin Cancer. Non-Small-Cell-Lung-Cancer having inverted polarity wherein one or more internucleotide (NSCLC), Ocular Cancers, Oesophageal Cancer, Oral cavity linkages is a 3' to 3',5' to 5' or 2 to 2" linkage. Preferred Cancer, Oropharynx Cancer, Osteosarcoma, Ostomy Ovarian oligonucleotides having inverted polarity comprise a single 3' Cancer, Pancreas Cancer, Paranasal Cancer, Parathyroid Can to 3' linkage at the 3'-most internucleotide linkage i.e. a single cer, Parotid Gland Cancer, Penile Cancer, Peripheral-Neuro inverted nucleoside residue which may be a basic (the nucle ectodermal-Tumors, Pituitary Cancer, Polycythemia vera, otide is missing or has a hydroxyl group in place thereof). Prostate Cancer, Rare-cancers-and-associated-disorders, 25 Various salts, mixed salts and free acid forms are also Renal Cell Carcinoma, Retinoblastoma, Rhabdomyosar included. coma, Rothmund-Thomson Syndrome, Salivary Gland Can Representative United States patents that teach the prepa cer, Sarcoma, Schwannoma, Sezary syndrome, Skin Cancer, ration of the above phosphorus-containing linkages include, Small Cell Lung Cancer (SCLC), Small Intestine Cancer, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; Soft Tissue Sarcoma, Spinal Cord Tumors, Squamous-Cell 30 4476,301: 5,023,243; 5,177, 196; 5,188,897: 5,264,423; Carcinoma-(skin), Stomach Cancer, Synovial sarcoma, Tes 5,276,019; 5,278.302: 5,286,717; 5,321,131; 5,399,676: ticular Cancer, Thymus Cancer, Thyroid Cancer, Transi 5,405,939; 5,453,496; 5.455,233; 5,466,677: 5,476,925; tional-Cell-Cancer-(bladder), Transitional-Cell-Cancer 5,519,126; 5,536,821; 5,541,306; 5,550,111: 5,563,253; (renal-pelvis-/-ureter), Trophoblastic Cancer. Urethral 5,571,799; 5,587,361; 5,194.599; 5,565,555; 5,527,899; Cancer, Urinary System Cancer, Uroplakins, Uterine sar 35 5,721218: 5,672,697 and 5,625,050. coma, Uterus Cancer, Vaginal Cancer, Vulva Cancer, Walden Preferred modified oligonucleotide backbones that do not strom's-Macroglobulinemia, Wilms Tumor. include a phosphorus atom therein have backbones that are The compounds of the invention can be utilized in phar formed by short chain alkyl or cycloalkyl internucleoside maceutical compositions by adding an effective amount of a linkages, mixed heteroatom and alkyl or cycloalkyl inter compound to a suitable pharmaceutically acceptable diluent 40 nucleoside linkages, or one or more short chain heteroatomic or carrier. Use of the compounds and methods of the invention or heterocyclic internucleoside linkages. These include those may also be useful prophylactically. having morpholino linkages (formed in part from the Sugar As is known in the art, a nucleoside is a base-Sugar com portion of a nucleoside); siloxane backbones; Sulfide, Sulfox bination. The base portion of the nucleoside is normally a ide and sulfone backbones; formacetyl and thioformacetyl heterocyclic base. The two most common classes of Such 45 backbones; methylene formacetyl and thioformacetyl back heterocyclic bases are the purines and the pyrimidines. bones; riboacetyl backbones; alkene containing backbones; Nucleotides are nucleosides that further include a phosphate Sulfamate backbones; methyleneimino and methylenehy group covalently linked to the Sugar portion of the nucleoside. drazino backbones; Sulfonate and Sulfonamide backbones; For those nucleosides that include a pentofuranosyl Sugar, the amide backbones; and others having mixed N, O, S and CH phosphate group can be linked to either the 2, 3" or 5' 50 component parts. hydroxyl moiety of the Sugar. In forming oligonucleotides, Representative United States patents that teach the prepa the phosphate groups covalently link adjacent nucleosides to ration of the above oligonucleosides include, but are not one another to form a linear polymeric compound. In turn, the limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; respective ends of this linear polymeric compound can be 5,214,134: 5,216,141, 5,235,033: 5,264,562; 5,264,564: further joined to form a circular compound, however, linear 55 5,405,938; 5,434,257; 5,466,677; 5,470,967: 5489,677; compounds are generally preferred. In addition, linear com 5,541,307: 5,561.225; 5,596,086; 5,602,240; 5,610,289; pounds may have internal nucleotide complementarity and 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; may therefore fold in a manner as to produce a fully or 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and partially double-stranded compound. Within oligonucle 5,677,439. otides, the phosphate groups are commonly referred to as 60 In other preferred oligonucleotide mimetics, both the Sugar forming the internucleoside backbone of the oligonucleotide. and the internucleoside linkage (i.e. the backbone), of the The normal linkage or backbone of RNA and DNA is a 3' to nucleotide units are replaced with novel groups. The nucle 5' phosphodiester linkage. otide units are maintained for hybridization with an appropri Specific examples of preferred antisense or sense com ate target nucleic acid. One such compound, an oligonucle pounds useful in this invention include oligonucleotides con 65 otide mimetic that has been shown to have excellent taining modified backbones or non-natural internucleoside hybridization properties, is referred to as a peptide nucleic linkages. As defined in this specification, oligonucleotides acid (PNA). In PNA compounds, the sugar-backbone of an US 7,662.929 B2 71 72 oligonucleotide is replaced with an amide containing back 5,519,134: 5,567,811: 5,576.427: 5,591,722; 5,597,909; bone, in particular an aminoethylglycine backbone. The 5,610,300; 5,627,053: 5,639,873; 5,646,265; 5,658,873; nucleotides are retained and are bound directly or indirectly 5,670,633; 5,792,747; and 5,700,920. to aza nitrogen atoms of the amide portion of the backbone. A further preferred modification of the sugar includes Representative United States patents that teach the prepara Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl tion of PNA compounds include, but are not limited to, U.S. group is linked to the 3' or 4' carbon atom of the Sugar ring, Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Further thereby forming a bicyclic Sugar moiety. The linkage is pref teaching of PNA compounds can be found in Nielsen et al., erably a methylene (-CH2—), group bridging the 2' oxygen Science 254: 1497-1500, 1991. atom and the 4' carbon atom wherein n is 1 or 2. LNAs and Preferred embodiments of the present invention are oligo 10 preparation thereof are described in WO 98/39352 and WO nucleotides with phosphorothioate backbones and oligo 99/14226. nucleosides with heteroatom backbones, and in particular Oligonucleotides may also include nucleotide (often CH NH-O CH2—, —CH N(CH)—O CH referred to in the art simply as “base') modifications or sub known as a methylene (methylimino) or MMI backbone, stitutions. As used herein, “unmodified’ or “natural nucle CH2—O N(CH)—CH2—, CH, N(CH) N 15 otides include the purine bases adenine (A) and guanine (G), (CH)—CH2— and —O N(CH)—CH-CH and the pyrimidine bases thymine (T), cytosine (C) and uracil wherein the native phosphodiester backbone is represented (U). Modified nucleotides include other synthetic and natural as —O—P O—CH2—I of the above referenced U.S. Pat. nucleotides such as 5-methylcytosine (5-me-C), 5-hy No. 5,489,677, and the amide backbones of the above refer droxymethyl cytosine, Xanthine, hypoxanthine, 2-aminoad enced U.S. Pat. No. 5,602.240. Also preferred are oligonucle enine, 6-methyl and other alkyl derivatives of adenine and otides having morpholino backbone structures of the above guanine, 2-propyl and other alkyl derivatives of adenine and referenced U.S. Pat. No. 5,034,506. guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, Modified oligonucleotides may also contain one or more 5-halouracil and cytosine, 5-propynyl ( C=C CH) Substituted Sugar moieties. Preferred oligonucleotides com uracil and cytosine and other alkynyl derivatives of pyrimi prise one of the following at the 2' position: OH: F: O-, S-, or 25 dine bases, 6-aZo uracil, cytosine and thymine, 5-uracil N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thio O-alkyl, wherein the alkyl, alkenyl and alkynyl may be sub alkyl, 8-hydroxyl and other 8-Substituted adenines and gua stituted or unsubstituted C to Co alkyl or C to Coalkenyl nines, 5-halo particularly 5-bromo, 5-trifluoromethyl and and alkynyl. Particularly preferred are O(CH), OCH, other 5-substituted uracils and cytosines, 7-methylguanine O(CH), OCH, O(CH), NH, O(CH), CH, O(CH), 30 and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-aza ONH, and O(CH)ON(CH2)CH, where n and m are guanine and 8-azaadenine, 7-deazaguanine and 7-deaZaad from 1 to about 10. Other preferred oligonucleotides com enine and 3-deazaguanine and 3-deazaadenine. Further prise one of the following at the 2' position: C to Co lower modified nucleotides include tricyclic pyrimidines such as alkyl, Substituted lower alkyl, alkenyl, alkynyl, alkaryl, phenoxazine cytidine(1H-pyrimido5,4-b1,4)benzoxazin aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, 35 2(3H)-one), phenothiazine cytidine(1H-pyrimido5,4-b1, CF. OCF, SOCH, SOCHONO., NO, N, NH, hetero 4benzothiazin-2(3H)-one), G-clamps such as a substituted cycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalky phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido lamino, Substituted silyl, an RNA cleaving group, a reporter 5,4-b1,4)benzoxazin-2(3H)-one), carbazole cytidine (2H group, an intercalator, a group for improving the pharmaco pyrimido-4,5-bindol-2-one), pyridoindole cytidine(H-py kinetic properties of an oligonucleotide, or a group for 40 rido 3'2':4.5 pyrrolo2,3-dipyrimidin-2-one). Modified improving the pharmacodynamic properties of an oligonucle nucleotides may also include those in which the purine or otide, and other Substituents having similar properties. A pyrimidine base is replaced with other heterocycles, for preferred modification includes 2'-methoxyethoxy(2'-O- example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyri CHCHOCH, also known as 2'-O-(2-methoxyethyl) or dine and 2-pyridone. Further nucleotides include those dis 2'-MOE) (Martin et al., Helv. Chim. Acta, 78: 486-504, 1995) 45 closed in U.S. Pat. No. 3,687,808, those disclosed in The i.e., an alkoxyalkoxy group. A further preferred modification Concise Encyclopedia Of Polymer Science And Engineering, includes 2'-dimethylaminooxyethoxy, i.e. a O(CH)ON pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, (CH) group, also known as 2'-DMAOE, as described in 1990, those disclosed by Englischet al., Angewandte Chemie, examples hereinbelow, and 2'-dimethylaminoethoxyethoxy International Edition, 30: 613, 1991, and those disclosed by (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl 50 Sanghvi, Y. S., Chapter 15, Antisense Research and Applica or 2'-DMAEOE), i.e., 2'-O-CH O CH N(CH), tions, pages 289-302, Crooke, S.T. and Lebleu, B., ed., CRC also described in examples hereinbelow. Press, 1993. Certain of these nucleotides are particularly use Other preferred modifications include 2'-methoxy(2'-O- ful for increasing the binding affinity of the compounds of the CH), 2-aminopropoxy(2'-OCHCHCH-NH), 2-allyl (2'- invention. These include 5-substituted pyrimidines, 6-aZapy CH-CH=CH-), 2'-O-allyl (2'-O CH-CH=CH-) and 55 rimidines and N-2, N-6 and O-6 substituted purines, includ 2'-fluoro (2'-F). The 2'-modification may be in the arabino ing 2-aminopropyladenine, 5-propynyluracil and 5-propy (up) position or ribo (down) position. A preferred 2'-arabino nylcytosine. 5-methylcytosine substitutions have been shown modification is 2'-F. Similar modifications may also be made to increase nucleic acid duplex stability by 0.6-1.2°C. and are at other positions on the oligonucleotide, particularly the 3' presently preferred base Substitutions, even more particularly position of the sugar on the 3' terminal nucleotide or in 2'-5' 60 when combined with 2'-O-methoxyethyl sugar modifica linked oligonucleotides and the 5' position of 5' terminal tions. nucleotide. Oligonucleotides may also have Sugar mimetics Representative United States patents that teach the prepa Such as cyclobutyl moieties in place of the pentofuranosyl ration of certain of the above noted modified nucleotides as sugar. Representative United States patents that teach the well as other modified nucleotides include, but are not limited preparation of such modified Sugar structures include, but are 65 to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319, Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367, 080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 066; 5,432,272; 5.457,187;5,459.255;5,484,908: 5,502,177; US 7,662.929 B2 73 74 5,525,711; 5,552,540: 5,587,469; 5,594,121, 5,596,091; The present invention also includes antisense or sense 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and compounds which are chimeric compounds. "Chimericanti 5,681,941. sense compounds or "chimeras', in the context of this inven Another modification of the oligonucleotides of the inven tion, are antisense or sense compounds, particularly oligo tion involves chemically linking to the oligonucleotide one or 5 nucleotides, which contain two or more chemically distinct more moieties or conjugates which enhance the activity, cel regions, each made up of at least one monomer unit, i.e., a lular distribution or cellular uptake of the oligonucleotide. nucleotide in the case of an oligonucleotide compound. These These moieties or conjugates can include conjugate groups oligonucleotides typically contain at least one region wherein covalently bound to functional groups such as primary or the oligonucleotide is modified so as to confer upon the oli secondary hydroxyl groups. Conjugate groups of the inven 10 gonucleotide increased resistance to nuclease degradation, tion include intercalators, reporter molecules, polyamines, increased cellular uptake, increased Stability and/or increased polyamides, polyethylene glycols, polyethers, groups that binding affinity for the target nucleic acid. An additional enhance the pharmacodynamic properties of oligomers, and region of the oligonucleotide may serve as a Substrate for groups that enhance the pharmacokinetic properties of oligo enzymes capable of cleaving RNA:DNA or RNA:RNA mers. Typical conjugate groups include cholesterols, lipids, 15 hybrids. By way of example, RNAse H is a cellular endonu phospholipids, biotin, phenazine, folate, phenanthridine, clease which cleaves the RNA strand of an RNA:DNA anthraquinone, acridine, fluoresceins, rhodamines, cou duplex. Activation of RNase H, therefore, results in cleavage marins, and dyes. Groups that enhance the pharmacodynamic of the RNA target, thereby greatly enhancing the efficiency of properties, in the context of this invention, include groups that oligonucleotide-mediated inhibition of gene expression. The improve uptake, enhance resistance to degradation, and/or cleavage of RNA:RNA hybrids can, in like fashion, be strengthen sequence-specific hybridization with the target accomplished through the actions of endoribonucleases, such nucleic acid. Groups that enhance the pharmacokinetic prop as RNAse, which cleaves both cellular and viral RNA. erties, in the context of this invention, include groups that Cleavage of the RNA target can be routinely detected by gel improve uptake, distribution, metabolism or excretion of the electrophoresis and, if necessary, associated nucleic acid compounds of the present invention. Representative conju 25 hybridization techniques known in the art. gate groups are disclosed in International Patent Application Chimeric antisense or sense compounds of the invention PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. may be formed as composite structures of two or more oligo 6,287,860, the entire disclosure of which are incorporated nucleotides, modified oligonucleotides, oligonucleosides herein by reference. Conjugate moieties include but are not and/or oligonucleotide mimetics as described above. Such limited to lipid moieties such as a cholesterol moiety, cholic 30 compounds have also been referred to in the art as hybrids or acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an gapmers. Representative United States patents that teach the aliphatic chain, e.g., dodecandiolor undecyl residues, a phos preparation of such hybrid structures include, but are not pholipid, e.g., di-hexadecyl-rac-glycerol or triethylammo limited to, U.S. Pat. Nos. 5,013,830; 5,149,797: 5,220,007: nium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a 5,256,775; 5,366,878; 5.403,711; 5,491,133; 5,565,350; polyamine or a polyethylene glycol chain, or adamantane 35 5,623,065; 5,652,355; 5,652,356; and 5,700,922. acetic acid, a palmityl moiety, or an octadecylamine or hexy The compounds of the invention may also be admixed, lamino-carbonyl-oxycholesterol moiety. Oligonucleotides of encapsulated, conjugated or otherwise associated with other the invention may also be conjugated to active drug Sub molecules, molecule structures or mixtures of compounds, as stances, for example, aspirin, warfarin, phenylbutaZone, ibu for example, liposomes, receptor-targeted molecules, oral, profen, Suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, 40 rectal, topical or other formulations, for assisting in uptake, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufe distribution and/or absorption. Representative United States namic acid, folinic acid, a benzothiadiazide, chlorothiazide, a patents that teach the preparation of such uptake, distribution diazepine, indomethicin, a barbiturate, a cephalosporin, a and/or absorption-assisting formulations include, but are not Sulfa drug, an antidiabetic, an antibacterial or an antibiotic. 45 limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016: Representative United States patents that teach the prepa 5,459,127: 5,521,291; 5,543,158; 5,547,932; 5,583,020; ration of such oligonucleotide conjugates include, but are not 5,591,721: 4,426,330; 4,534,899; 5,013,556; 5,108,921; limited to, U.S. Pat. Nos. 4,828,979: 4,948,882: 5,218, 105; 5,213,804: 5,227,170: 5,264.221; 5,356,633; 5,395,619; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,416,016; 5,417,978; 5,462,854; 5,469,854: 5,512,295; 5,580,731: 5,580,731: 5,591,584; 5,109,124; 5,118,802: 50 5,527,528: 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,138,045; 5,414,077; 5,486,603: 5,512,439; 5,578,718; 5,595.756, each of which is herein incorporated by reference. 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; The antisense or sense compounds of the invention encom 4,789,737; 4,824.941; 4,835,263; 4,876,335; 4,904,582: pass any pharmaceutically acceptable salts, esters, or salts of 4,958,013; 5,082,830; 5,112,963: 5,214,136; 5,082,830; Such esters, or any other compound which, upon administra 5,112,963: 5,214,136: 5,245,022: 5,254,469; 5,258,506; 55 tion to an animal, including a human, is capable of providing 5,262,536; 5,272,250; 5,292,873; 5,317,098: 5,371,241, (directly or indirectly) the biologically active metabolite or 5,391,723; 5,416.203, 5,451,463: 5,510,475; 5,512,667; residue thereof. Accordingly, for example, the disclosure is 5,514,785: 5,565,552; 5,567,810; 5,574,142: 5,585,481; also drawn to prodrugs and pharmaceutically acceptable salts 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and of the compounds of the invention, pharmaceutically accept 5,688,941, certain of which are commonly owned with the 60 able salts of Such prodrugs, and other bioeduivalents. instant application, and each of which is herein incorporated The term “prodrug indicates a therapeutic agent that is by reference. prepared in an inactive form that is converted to an active It is not necessary for all positions in a given compound to form (i.e., drug) within the body or cells thereof by the action be uniformly modified, and in fact more than one of the of endogenous enzymes or other chemicals and/or condi aforementioned modifications may be incorporated in a 65 tions. In particular, prodrug versions of the oligonucleotides single compound or even at a single nucleoside within an of the invention are prepared as SATE (S-acetyl-2-thioethyl) oligonucleotide. phosphate derivatives according to the methods disclosed in US 7,662.929 B2 75 76 WO 93/24510 to Gosselinet al., published Dec. 9, 1993 or in invention. Emulsions and their uses are well known in the art WO94/26764 and U.S. Pat. No. 5,770,713 to Imbach et al. and are further described in U.S. Pat. No. 6,287,860, which is The term “pharmaceutically acceptable salts' refers to incorporated herein in its entirety. physiologically and pharmaceutically acceptable salts of the Formulations of the present invention include liposomal compounds of the invention: i.e., salts that retain the desired formulations. As used in the present invention, the term "lipo biological activity of the parent compound and do not impart Some” means a vesicle composed of amphiphilic lipids undesired toxicological effects thereto. For oligonucleotides, arranged in a spherical bilayer or bilayers. Liposomes are preferred examples of pharmaceutically acceptable salts and unilamellar or multilamellar vesicles which have a membrane their uses are further described in U.S. Pat. No. 6,287,860. formed from a lipophilic material and an aqueous interior that The present invention also includes pharmaceutical com 10 contains the composition to be delivered. Cationic liposomes positions and formulations which include the antisense or are positively charged liposomes which are believed to inter sense compounds or interactive compounds of the present act with negatively charged DNA molecules to form a stable invention. The pharmaceutical compositions of the present complex. Liposomes that are pH-sensitive or negatively invention may be administered in any number of ways charged are believed to entrap DNA rather than complex with depending upon whether local or systemic treatment is 15 it. Both cationic and noncationic liposomes have been used to desired and upon the area to be treated. Administration may deliver DNA to cells. be topical (including ophthalmic and to mucous membranes Liposomes also include “sterically stabilized liposomes, a including vaginal and rectal delivery), pulmonary, e.g., by term which, as used herein, refers to liposomes comprising inhalation or insufflation of powders or aerosols, including by one or more specialized lipids that, when incorporated into nebulizer; intratracheal, intranasal, epidermal and transder liposomes, result in enhanced circulation lifetimes relative to mal), oral or parenteral. Parenteral administration includes liposomes lacking Such specialized lipids. Examples of steri intravenous, intraarterial, Subcutaneous, intraperitoneal or cally stabilized liposomes are those in which part of the intramuscular injection or infusion; or intracranial, e.g., vesicle-forming lipid portion of the liposome comprises one intrathecal or intraventricular, administration. The com or more glycolipids or is derivatized with one or more hydro pounds may be modified for oral administration. For 25 philic polymers. Such as a polyethylene glycol (PEG) moiety. example, oligonucleotides with at least one 2'-O-methoxy Liposomes and their uses are further described in U.S. Pat. ethyl modification are useful for oral administration. Pharma No. 6,287,860, which is incorporated herein in its entirety. ceutical compositions and formulations for topical adminis The pharmaceutical formulations and compositions of the tration may include transdermal patches, ointments, lotions, present invention may also include Surfactants. The use of creams, gels, drops, Suppositories, sprays, liquids and pow 30 Surfactants in drug products, formulations and in emulsions is ders. Conventional pharmaceutical carriers, aqueous, powder well known in the art. Surfactants and their uses are further or oily bases, thickeners and the like may be necessary or described in U.S. Pat. No. 6,287,860. desirable. Coated condoms, gloves and the like may also be In one embodiment, the present invention employs various useful. penetration enhancers to effect the efficient delivery of The pharmaceutical formulations of the present invention, 35 nucleic acids, particularly oligonucleotides. In addition to which may conveniently be presented in unit dosage form, aiding the diffusion of non-lipophilic drugs across cell mem may be prepared according to conventional techniques well branes, penetration enhancers also enhance the permeability known in the pharmaceutical industry. Such techniques of lipophilic drugs. Penetration enhancers may be classified include the step of bringing into association the active ingre as belonging to one of five broad categories, i.e., Surfactants, dients with the pharmaceutical carrier(s) or excipient(s). In 40 fatty acids, bile salts, chelating agents, and non-chelating general, the formulations are prepared by uniformly and inti non-Surfactants. Penetration enhancers and their uses are fur mately bringing into association the active ingredients with ther described in U.S. Pat. No. 6,287,860. liquid carriers or finely divided solid carriers or both, and One of skill in the art will recognize that formulations are then, if necessary, shaping the product. routinely designed according to their intended use, i.e. route The compositions of the present invention may be formu 45 of administration. lated into any of many possible dosage forms such as, but not Preferred formulations for topical administration include limited to, tablets, capsules, gel capsules, liquid syrups, soft those in which the oligonucleotides of the invention are in gels, Suppositories, and enemas. The compositions of the admixture with a topical delivery agent such as lipids, lipo present invention may also be formulated as Suspensions in Somes, fatty acids, fatty acid esters, steroids, chelating agents aqueous, non-aqueous or mixed media. Aqueous Suspensions 50 and Surfactants. Preferred lipids and liposomes include neu may further contain Substances which increase the Viscosity tral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyris of the Suspension including, for example, sodium carboxym toylphosphatidyl choline DMPC, distearolyphosphatidyl ethylcellulose, Sorbitol and/or dextran. The Suspension may choline) negative (e.g. dimyristoylphosphatidyl glycerol also contain stabilizers. DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl Pharmaceutical compositions of the present invention 55 DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). include, but are not limited to, Solutions, emulsions, foams For topical or other administration, oligonucleotides of the and liposome-containing formulations. The pharmaceutical invention may be encapsulated within liposomes or may form compositions and formulations of the present invention may complexes thereto, in particular to cationic liposomes. Alter comprise one or more penetration enhancers, carriers, excipi natively, oligonucleotides or interactive molecules (e.g. anti ents or other active or inactive ingredients. 60 bodies) may be complexed to lipids, in particular to cationic Emulsions are typically heterogenous systems of one liq lipids. Preferred fatty acids and esters, pharmaceutically uid dispersed in another in the form of droplets usually acceptable salts thereof, and their uses are further described in exceeding 0.1 um in diameter. Emulsions may contain addi U.S. Pat. No. 6,281,860. tional components in addition to the dispersed phases, and the Compositions and formulations for oral administration active drug which may be present as a solution in either the 65 include powders or granules, microparticulates, nanoparticu aqueous phase, oily phase or itself as a separate phase. Micro lates, Suspensions or solutions in water or non-aqueous emulsions are included as an embodiment of the present media, capsules, gel capsules, Sachets, tablets or minitablets. US 7,662.929 B2 77 78 Thickeners, flavoring agents, diluents, emulsifiers, dispersing tion may contain two or more antisense or sense compounds aids or binders may be desirable. Preferred oral formulations or tow or more interactive compounds targeted to different are those in which oligonucleotides of the invention are regions of the same nucleic acid target or protein. administered in conjunction with one or more penetration The formulation of therapeutic compositions and their sub enhancers surfactants and chelators. Preferred surfactants sequent administration (dosing) is within the skill of those in include fatty acids and/or esters or salts thereof, bile acids the art. Dosing is dependent on severity and responsiveness of and/or salts thereof. Preferred bile acids/salts and fatty acids the disease state to be treated, with the course of treatment and their uses are further described in U.S. Pat. No. 6,287, lasting from several days to several months, or until a cure is 860, which is incorporated herein in its entirety. Also pre effected or a diminution of the disease state is achieved. ferred are combinations of penetration enhancers, for 10 Optimal dosing schedules can be calculated from measure example, fatty acids/salts in combination with bile acids/ ments of drug accumulation in the body of the patient. Per salts. A particularly preferred combination is the Sodium salt Sons of ordinary skill can easily determine optimum dosages, of lauric acid, capric acid and UDCA. Further penetration dosing methodologies and repetition rates. Optimum dosages enhancers include polyoxyethylene-9-lauryl ether, polyoxy may vary depending on the relative potency of individual ethylene-20-cetyl ether. Oligonucleotides or antibodies or 15 compounds, and can generally be estimated based on ECsos other interactive molecules of the invention may be delivered found to be effective in invitro and in vivo animal models. In orally, in granular form including sprayed dried particles, or general, dosage is from 0.01 ug to 100 g per kg of body complexed to form micro or nanoparticles. Oligonucleotide weight, and may be given once or more daily, weekly, complexing agents and their uses are further described in U.S. monthly or yearly, or even once every 2 to 20 years. Persons Pat. No. 6,287,860. of ordinary skill in the art can easily estimate repetition rates Compositions and formulations for parenteral, intrathecal for dosing based on measured residence times and concen or intraventricular administration may include sterile aque trations of the drug in bodily fluids or tissues. Following ous solutions which may also contain buffers, diluents and successful treatment, it may be desirable to have the patient other suitable additives such as, but not limited to, penetration undergo maintenance therapy to prevent the recurrence of the enhancers, carrier compounds and other pharmaceutically 25 disease state, wherein the compound is administered in main acceptable carriers or excipients. tenance doses, ranging from 0.01 g to 100 g per kg of body Certain embodiments of the present invention provide weight, once or more daily, to once every 20 years. Examples pharmaceutical compositions containing one or more oligo ofeffective amounts include 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, meric compounds and one or more other chemotherapeutic 0.07, 0.08, 0.09, 0.1, 0.2,0.3, 0.4,0.5,0.6,0.7, 0.8, 0.9, 1.0, agents. Examples of Such chemotherapeutic agents include 30 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, but are not limited to cancer chemotherapeutic drugs such as 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37, daunorubicin, daunomycin, dactinomycin, doxorubicin, epi 38, 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, rubicin, idarubicin, esorubicin, bleomycin, mafosfamide, 55, 56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, ifosfamide, cytosine arabinoside, bis-chloroethylnitroSurea, 72, 73,74, 75,76, 77,78, 79,80, 81,82, 83, 84,85, 86, 87,88, buSulfan, mitomycin C, actinomycin D. mithramycin, pred 35 89, 90,91, 92,93, 94, 95, 96, 97,98, 99 and 100 g/kg body nisone, hydroxyprogesterone, testosterone, tamoxifen, dac weight. arbazine, procarbazine, hexamethylmelamine, pentameth The present invention is further described by the following ylmelamine, mitoxantrone, amsacrine, chlorambucil, non-limiting Examples. methylcyclohexylnitroSurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cyt 40 Example 1 arabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil Cell Line (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol. Vincristine, vinblastine, etoposide The MDA-MB 231 human breast cancer cell line was (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, 45 obtained from American tissue culture collection (Rockville, teniposide, cisplatin and diethylstilbestrol (DES). When used USA) and cultivated at 37°C. in 100% (v/v) air, and main with the compounds of the invention, such chemotherapeutic tained in Leibovitz L-15 Medium (Sigma, St Louis, Mo., agents may be used individually (e.g., 5-FU and oligonucle USA), supplemented with 10% foetal calf serum (CSL, Mel otide), sequentially (e.g., 5-FU and oligonucleotide for a bourne, Australia) and antibiotic/antimycotic reagents period of time followed by MTX and oligonucleotide), or in 50 (Sigma, St Louis, Mo., USA). combination with one or more other Such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radio Example 2 therapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory Isolation of the cDNA for Human HAS2 and drugs and corticosteroids, and antiviral drugs, including but 55 Construction of an Antisense Expression Vector not limited to ribivirin, Vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Com The cDNA for human HAS2 was generated by designing binations of antisense or sense compounds and other non gene specific primers from the published sequence of antisense drugs are also within the scope of this invention. Watanabe and Yamaguchi (1996; Genbank accession no. Two or more combined compounds may be used together or 60 U54804) and consisted of the following primers: sense sequentially. 5">GAGCTGAACAAGATGCATTGTGAGAGC (SEQ ID In another related embodiment, compositions of the inven NO: 1) and antisense 5'GACATGGTGCTTGATGTAT tion may contain one or more antisense or sense compounds, GATCTTCCAT (SEQID NO: 2). Total RNA harvested from or one or more interactive molecules Such as antibodies tar exponentially dividing human dermal fibroblasts was used as geted to a first nucleic acid target or protein and one or more 65 the template for RT-PCR to generate a 1.7 kb clNA fragment additional compounds targeted to a second nucleic acid target of HAS2, which was cloned directly into pGEMR-T vector or protein. Alternatively, compositions of the Subject inven (Promega Corporation, Madisom, USA). The cDNA for US 7,662.929 B2 79 80 HAS2 was subsequently subcloned into the pCI-Neo expres GAPDH antisense, 5' GAGTTAAAA-GCAGCCCTGGTG 3' sion vector (Promega Corporation, Madisom, USA) and iso (SEQ ID NO: 16); GAPDH probe, 5' TTTGGTCGTAT lated clones containing the insert in the antisense orientation TGGGCGCCTGG3' (SEQ ID NO: 17). For HAS internal were identified by restriction endonuclease mapping and probes the reporter dye 6-carboxylfluorescein (6-FAMTM) automated sequencing. and quencher 6-carboxytetramethylrhodamine (TAMRATM) were labelled at the 5' and 3' respectively. For GAPDH inter Example 3 nal probes the reporter 6-FAMTM was substituted with VICTM (Applied Biosystems California, USA). The PCR reaction Transfection of Human ASHAS2 and Mock into was performed in a final volume of 30 pland consisted of 1 x MDA-MB 231 Human Breast Cancer Cells 10 Taqman reaction mix, 6 uM of HAS forward and reverse primer, 1.5 pM of probe, 1 pM of each GAPDH primer and The ASHAS2-pCl-Neo construct and pCl-neo vector were 500 nM of GAPDH probe. PCR amplification was by dena transfected into human MDA-MB 231 breast cells using turation for 10 minutes at 95°C. followed by annealing for 2 LipofectamineTM plus reagent (Gibco life technologies, minutes at 50° C. followed by 40 cycles of 15 seconds at 95° USA) according to the manufactures instructions. Prior to 15 C. and 1 minute at 60° C. Thermocycling and fluorescence commencing studies transfected cells were selected for at measurement were performed in a ABI Prism 7700R least one month in the presence of 500 pg/mL G418 antibi sequence detection system (Applied BioSystems, California, otic. Transfected cells were selected for at least one month in USA). To allow comparison between samples the relative the presence of 500 lug/mL G418 antibiotic. Resistant colo hyaluronan synthase signals were normalised with internal nies were then harvested and established as stable cell lines. GAPDH control measurements. Example 4 Example 6 Detecting the Incorporation of the Stable Characterization of Hyaluronidase Gene Expression Transfection into the Genome 25 To determine the state of hyaluronidase gene expression PCR on purified genomic DNA isolated from ASHAS2 for HYAL1, 2 and 3, RT-PCR was performed on total RNA pCINeo transfectants was performed to confirm the incorpo extracted from experimental cells harvested at 80 and 100% ration of the antisense construct into the genome. In brief, a confluency. The gene specific primer sets were designed from gene specific primer for pCINeo: 5'-GCACAGATGCG 30 sequences retrieved from GenBank and consisted of: HYAL1 TAAGGAG-3' (SEQID NO:3) was used in combination with (GenBank accession no. NM007312) sense, 5'-GCACAGG two specific HAS2 primers of the following sequence: GSP2 GAAGTCACAGATGTATGTGC-3 (SEQ ID NO:18): Sense 5'-GCTGTGTACATGACCTCGCGCTTGCCGCC-3' HYAL1 antisense, 5'-CCACTGGTCACGTTCAGGAT (SEQ ID NO:4) and GSP4 sense, 5'-GGCGGGAAG GAAG-3 (SEQID NO:19)'; HYAL2 (GenBank accession no. TAAACTCGAC-3' (SEQ ID NO:5). When used in the fol 35 NM003773) sense 5'-GATGTGTATCGCC-GGTTAT lowing combination; pCIneo/GSP2 and pCIneo/GSP4 CACGCC-3' (SEQID NO:20); HYAL2 antisense 5'-CGTA expected size products of 1443 and 2223 bp were amplified GACTGGGAG-TGCATGGTTGGC-3' (SEQ ID NO:21): respectively. HYAL3 (GenBank accession no. NM003549) sense, 5'-GCACTGATGGAGGATACGCTGCG-3 (SEQ ID Example 5 40 NO:22); HYAL3 antisense, 5'-GCTGGTGACTG-CAGGC CATCGCTGC-3' (SEQ ID NO:23). Amplified sequences Quantification of mRNA for HAS1, 2 and 3 were visualised by agarose gel electrophoresis containing ethidium bromide and identity confirmed by automated DNA Real time PCR was used to quantitate the relative mRNA sequencing. levels of HAS1, HAS2, and HAS3 in parental, mock and 45 ASHAS2 transfected cells using gene specific primers and an Example 7 internal oligonucleotide probe. In brief, total RNA was puri fied from experimental cells using Rineasy R (Qaigen, Mel Cell Proliferation Assay bourne, Australia) which was then used to generate single stranded cDNA by incubating 2 ug RNA with 0.5 ug/uIL 50 Parental, mock and ASHAS2 transfectants were harvested random primers and SuperScript reverse trancriptase. For at approximately 80% confluency and seeded in to 24-well quantitative real time PCR gene specific primers for each plates at differing cell densities, ranging from 5x10 cells to HAS isoform and an internal oligonucleotide probe were 9x10" cells/well. The rate of cell growth was then followed used. In brief, the primers consisted of the following: HASI, for 24, 48,72, and 96 hours after plating. All cell counts were sense, 5'CCTGCATCAGCGGTCCTCTA3' (SEQID NO: 6): 55 determined using an automated Coulter counter. HAS1 antisense, 5'GCCGGTCA-TCCCCAAAAG 3' (SEQ IDNO:7); HAS1 probe, 5' AACCTCTTGCAGCAGTTTCT Example 8 TGAGGCC 3' (SEQ ID NO: 8); HAS2 sense, 5' CAGTC CTGGCTTCGAGCAG3' (SEQID NO:9); HAS2 antisense, Immunohistochemistry 5' TTGGGAGAAAAGTCTTTGGCT 3' (SEQ ID NO: 10); 60 HAS2 probe, 5' CCATTGAACCAG-AGACTTGAAA To allow immunodetection and comparison between CAGCCC 3' (SEQID NO: 11); HAS3 sense, 5'TTGCACT parental, mock and ASHAS2-pCNeo transfected MDA-MB GTGGTCGTCAACTT 3' (SEQ ID NO: 12); HAS3 anti 231 cells specific antibodies to HAS2 and Hyal2 were kindly sense, 5' GTCGAGGTCAAACGTTGTGAG3' (SEQID NO: gifted from Dr Paraskevi Heldin and Dr Robert Stern respec 13); HAS3 probe, 5' TCAAATCAAAAACAGGCAGGTA 65 tively. Anti-human CD44 Clone DF 1485 was purchased from CAGGTAGTGG 3' (SEQ ID NO: 14); GAPDH sense, DAKO (Denmark) and used according to manufacturers 5'AAGGTGAAGGTCGGAGTCAAC 3' (SEQ ID NO: 15); instructions. Cells were seeded into 8-well chamber slides at US 7,662.929 B2 81 82 a density of 2x10 cells/well and grown for a further 24 hours Optiflot inverted phase contrast microscope (Nikon Com at 37°C. The cells were fixed in Histochoice(R) for 15 minutes pany, Japan) 24 h and 60 h after plating. before blocking heterophile proteins by incubation in PBS containing 10% FCS. The primary antibodies were diluted to Example 12 (cite concentration NOT dilution) in antibody diluent (PBS containing 1% human serum and 1% FCS) then incubated on Effect of the HA Production slides for 60 min at room temperature. Endogenous peroxi Cells were seeded at 2.5x10/cells in 25 cm culture flasks dase activity was blocked by immersion of slides in 0.3% and incubated at 37° C. for 24 h, 48 h, 72 h, 96 h, 120 hand H2O in methanol for 20 min prior to incubation with a 10 144 h. At each time points cells were trypsinized and counted peroxidase-conjugated rabbit anti-sheep secondary antise using an automated coulter counter. HA concentration in the rum for 60 minat RT. The immunocomplexes were visualised harvested culture medium was determined using a hyaluronic by applying 3,3'-Diaminobenzidene substrate (Sigma Fast acid binding protein (HABP) assay, with the standards and DAB) for 5-10 minutes, then counterstained with haematoxy reaction buffer provided Corgenix Inc (Colorado, USA). 15 lin, dehydrated and mounted. Example 13 Example 9 Size Exclusion Chromatography to Determine MW of HA Synthesized Cell Cycle Analysis by Flow Cytometry Cells were seeded at 7.5x10 cells in 75 cm culture flasks The transfected and control cells were seeded at 2x10 and grown for 24h in complete medium Supplemented with 5 cells/25 cm flask in the presence of 2 mM thymidine and uCi of D-6-H-Glucosamine hydrochloride. a. To deter grown until 50% confluent. Cells were washed then returned mine the MW of H-HA in the medium, samples were sub to normal culture medium and harvested, by trypsinisation, at 25 jected to size exclusion chromatography on a Sephacryl S-1000 SF. In brief, gel column (1.6 mx90 m) were packed the following time points; Oh, 4 h, 8 h, 12 h, 16 h, 20h, 24 h. according to manufactures instructions, equilibrated and 28 h, 32 h, and 36 h then fixed in 95% ethanol for 2 hat 4°C. eluted with phosphate buffer containing 0.2% (v/v) TX-100. Cells were pretreated with 100 ug/mL RNAase (Sigma) and The molecular weight of HA in the culture medium was 50 ug/ml propidium iodide (, Sigma) for 30 minutes at 37°C. 30 calculated using linear regression of K versus HA of known before determining the cell cycle stage in a FACS-CaliburTM molecular weights ranging from >1.67x10", K-0 to 4.4x analytical instrument (Becton Dickinson, San Jose, Calif.). 10, K=1. Fraction range of column S-10007x10-1.7x107 Da. Example 10 35 Example 14 Migration Assay Mammary Fat Pad Inoculation of MDA-MB 231 Cells The Boyden chamber chemoinvasion assay was performed as described previously (Thompson et al., 1992). Matrigel R. 40 Parental, mock and ASHAS2 transfected cells were har (50 ug) was dried onto polycarbonate filters (12 um pore, PVP Vested in the logarithmic growth phase by Scraping. Cells free, Nucleopore, Pleasanton, Calif.) and then reconstituted at were resuspended to a final density of 2x10 cells in L-15 37° C. Normal growth media (L-15 medium) containing medium supplemented with 0.1% glucose +/-Matrigel R. 0.1% bovine serum albumin (Miles Biochemicals, Kankakee, (v/v WHAT IS THE PERCENTAGE2) then immediately 45 injected into the mammary fatpad of 5 weeks old female CBA Ill.) was used as the chemoattractant. Cells were harvested in nude mice (n=11 does each treatment group consist of 11). the logarithmic growth phaseby trypsinisation, washed twice Tumor growth was recorded twice weekly by measuring three with serum-free L-15 medium containing 0.1% bovine serum perpendicular diameters (d1,d2, d3). Tumor volume was then albumin then seeded at 300,000 cells/1 ml chamber and calculated using the formula: (/6)7t(d1 d2d3). On the day 84 70,000 cells/0.2 ml chamber. Each experiment was per 50 mice were humanely killed and liver, kidneys, brain and lungs formed in triplicate. Chambers were incubated in a humidi removed at autopsy and stored at -20° C. For histological fied incubator at 37° C. for 6 hours. To determine the popu examination half of the primary tumor was fixed in 4% form lation of cells which had traversed the Matrigel R, the filters aldehyde and embedded in paraffin, then 5um sections from were stained with Diff-QuikR (American Scientific Products, this tissue was examined by H&E staining. The remaining 55 portion of the tumor was frozen at -20° C. until further McGaw PK., IL) then counted. analysis. Example 11 Example 15 Particle Exclusion Assay and Cell Morphology 60 DNA Extraction from Soft Organs and Quantification of Metastasis of MDA-MD 231 The HA-dependent pericellular matrix was visualised around breast cancer cells from control and transfected cul Quantitative Alu PCR was used to detect metastasis of tures by the exclusion offixed human erythrocytes described MDA-MD 231 from the primary tumor to other organs col by Clarris & Fraser (1968). Morphological differences as 65 lected at autopsy. In brief, DNA was extracted by griding well as the particle exclusion assay in the control and trans samples under liquid nitrogen and resuspending in a DNA fected MDA-MB 231 cells were photographed on a Nikon lysis buffer. DNA was then purified using standard phenol US 7,662.929 B2 83 84 chloroform methodology followed by ethanol precipitation Both parental and mock transfected control cultures and reconstition in TE buffer. The purified DNA was adjusted stained positive for the HA receptor CD44 and Hyal-2. The to a final concentration of 10 ng/pL in TE buffer pH 7.2. staining for CD44 in both controls was most evident in the aliquoted and stored at -20° C. until analysis. To remove plasma membrane with areas of intense focal membrane exogenous human DNA contamination the reaction mix was 5 staining (FIG. 1 panel E). No CD44 epitope reactivity could treated with 17 U/ml nuclease S7 (Roche) in the presence of be detected in ASHAS2 transfectants (FIG. 1 panel F). Simi 1 mM CaCl at 37° C. for 24 hours prior to PCR. Quantitative lar observation were recorded for the reactivity with Hyal-2 Alu PCR was then performed on purified gemomic DNA antibody where control cultures stained positively, which samples (10 ng) in a Gene Amp 5700R Sequence Detection localised to the plasma membrane and also appeared as cyto System (Applied Biosystems, Australia). In brief, each 10 plasmic vesicles whereas no reactivity could be detected in sample was tested in duplicate in a final reaction volume of 25 ASHAS2 transfectants. These results indicate that perturba uL consisting of 0.625 UTaq DNA polymerase (Roche: Man tion of functional CD44 and Hyal2, as observed in ASHAS2 nheim, Germany), 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl, transfectants, alter the catabolism of HA culminating in a 50 mMKCI, 200uM dNTPs, 8% DMSO, 1 pg/ml 6-carboxy significant increase in the amount HA in the culture medium. X-rhodamine (Molecular Probes; Eugene, Oreg. USA). 1 in 15 40000 dilution of SYBR Green I (Molecular Probes) and 100 Example 18 nM of each Alu primer. Following an initial denaturation incubation at 95° C. for 2 minutes, amplification occurred Characteristics of MDA MB 231 Breast Cancer Cell over 40 cycles, which consisted of denaturation at 95°C. for in a Tumor Xenograft Model 5 seconds, annealing at 65° C. for 60 seconds, and extension at 75° C. for 15 seconds during which the intensity of fluo Interestingly, antisense inhibition of HAS2 profoundly rescence was measured. A dissociation curve was then gen altered the expression of Hyal-1,2 and 3 in MDA-MD 231. erated from 60° C. to 95°C. On each 96-well reaction plate, Hyal-3 could not be detected in both parental or mock trans a standard curve was prepared by serially diluting human fectants, which both expressed comparable levels of mRNA DNA into mouse DNA which permitted the quantification of 25 for Hyal-1 and to a much greater extent Hyal-2, which was the tissue burden of human tumor cells in the mouse organs also comparable between these two controls (FIG. 2). In removed at autopsy. contrast, inhibition of HAS2 expression resulted in the down regulation of Hyal-2 mRNA to the point where it was not Example 16 detectable even after 35 cycles of PCR. Hyal-1 expression in 30 antisense transfectants was moderately increased when com Transfection of Antisense HAS2 in MDA-MB 231 pared with both parental and mock controls and Hyal-3 was Transfected Cells also detected in the antisense transfectants. Thus by prevent ing the production of a functional HAS2 protein in the MDA Incorporation of the antisense HAS2-pCINeo construct MD) 231 cell line, Hyal-2 gene expression has been down into the genome of MDA-MB 231 was confirmed by PCR regulated concomitant to the upregulation of HAS 1 and analysis on highly purified DNA extracted from the trans Hyal3, genes that are not normally expressed in this cell line. fected cells. When used in the following combination; pCI Immunohistochemistry with a specific HAS2 antibody was neo/GSP2 and pCIneo/GSP4 expected size products of 1443 used to determine the extent of cell surface reactivity. and 2223 bp were reproducibly amplified from stable clones Whereas both parental and mock transfected cells stained harbouring the antisense HAS2 construct. Genomic DNA positively for HAS2 protein (FIG. 1, panel B), which loca isolated from parental and mock transfected tested negative. lised mostly to the plasma membrane, efficient blockage of Example 17 translation in the antisense HAS2 transfectants was evi denced by the lack of immunoreactivity with the HAS2 anti Transfection with Antisense HAS2 Alters Expression body (FIG. 1 panel C). Profiles of HAS and Hyaluronidase Genes in 45 The molecular mass of HA synthesised by parental, mock MDA-MEB 231 and antisense transfected cells was determined by Sephacyl(R) S-1000 size exclusion chromatography. The parental cell line Endogenous levels of mRNA for HAS2 in parental cells synthesised three distinct molecular weights of HA estimated were quantitated using real time PCR and compared with the to be 3000 kDa, 40,000 and 100,000 Da respectively which values obtained from mock and antisense HAS2 transfected 50 reflects the products of the HAS isoforms expressed in the cells. Concomitant to these experiments, HAS1 and HAS3 parental cell line, notably HAS2 and 3. Antisense HAS2 mRNA levels were also quantitated using real time PCR with transfectants synthesised HA which was eluted in the void HYAL1, 2 and 3 expression characterised by standard RT volume that corresponds to a molecular weight >1.67x10. PCR methodology. To allow comparison of real time HAS Another fraction corresponding to a Mw of 100,000 Da was expression between transfected and parental cells the level of 55 also detected in the medium from antisense transfectants but each mRNA quantitated was normalised with respective the percentage of radioactive precursor incorporation was internal GAPDH controls. The endogenous level of HAS2 much less than that observed in the parental cell line (FIG. 2). mRNA expression in parental cells is shown in FIG. 1a, These elution profiles were shown to be 100% susceptible to which was slightly decreased in the mock transfectants. In digestion with Streptomyces hyaluronidase. contrast, mRNA expression in ASHAS2 transfected cells was 60 Antisense inhibition of HAS2 results in altered hyaluronan increased 3- to 4-fold and 8- to 9-fold when compared with metabolism. Due to the altered HAS and HYAL gene expres parental and mock transfectants cells respectively (FIG. 1a). sion in ASHAS2 MDA-MB 231 transfectants the amount of Moderate HAS3 expression was also detected and was com hyaluronan in cell contact culture medium was quantitated parable in parental mock and antisense transfected cells FIG. using an enzyme linked protein assay specific for HA. HA 1b. Consistent throughout this study was the expression of 65 production was quantitated from samples collected in tripli HAS1 in antisense transfectants which could not be detected cate at the same time points established in the proliferation in both parental cells and mock transfectants (FIG. 1b). assay. The data collected was graphed as HA synthesised US 7,662.929 B2 85 86 (picogram per cell: pg/cell/day). Cell contact medium from chemoinvasion assay using the Boyden chamber was used. antisense HAS2-MDA-MB231 transfectants contained a sig Migratory rates were then compared between parental, mock nificantly greater amount of hyaluronan when compared with and ASHAS2 transfected MDA MB-231. Both parental and either parental cells of mock transfectants (FIG. 3). On aver mock transfectants displayed typical migratory behaviour age ASHAS2 cultures synthesised 6.79 pg of HA/cell/day with 100% of cell population invading the matrigel onto the over the duration of the experiment with one noticeable underlying filter (FIG. 6). In contrast, stable transfectants exception at 48 hours where synthesis was increased to 12 harbouring antisense HAS2 resulted in 93% inhibition of pg/cell/day. In contrast parental and mock transfectants syn migration when compared with either controls tested (FIG. thesised approximately 1.1 and 1.4 pgHA/cell/day respec 6). tively over the duration of the experiment. The exclusion of 10 fixed erythrocytes was used to indirectly visualise the HA Example 20 pericellular matrix in the ASHAS2 transfectants which was then compared with that observed in the parental or mock HAS2 Inhibition Totally Inhibits the Growth and transfectants. In these experiments there was no evidence to Progression of Primary and Secondary Breast Cancer Suggest any gross difference in the thickness of the pericel 15 lular matrix, which was comparable to that observed in con To examine the effects of antisense inhibition of HAS2 on trol cultures (FIG. 3b). tumor growth, parental, mock and ASHAS2 transfectants Throughout the experiments the morphology of the anti inoculated into the mammary fat pad of nude mice. Primary sense transfected cells were compared with control cells. The tumor growth was followed over a 12 week period following ASHAS2 transfectants were readily distinguishable by their implantation after which the extent of metastasis to other morphology which was akin to cells undergoing mitosis and/ organs detected using Alu PCR. Mice inoculated with paren or migration, that is, Small rounded cells that were loosely tal or mock transfected MDA MB 231 readily established adhered to the growth surface. Consistent throughout these primary tumors which were comparable in growth over the observations was the decrease in cell number in ASHAS2 duration of the 12 week experiment (FIG. 7). In contrast, transfectants when compared with control cultures. 25 however, mice inoculated with ASHAS2 transfectants did not establish primary tumors (FIG. 7). In other experiments Example 19 Matrigel was also included in the inoculation medium used to ensure viability of injected ASHAS2 transfectants. Again, no HAS2 Inhibition Decreases Breast Cancer Cell primary tumor could be detected over the duration of the 12 Proliferation and Migration in Vitro 30 week experiment (data not shown). As assessed by Alu PCR, metastasis was most prevalent in brain, and lung but was also To compare the effect of antisense inhibition of HAS2 detected in kidneys and the liver in samples prepared from during active cell growth, parental, mock and ASHAS2 trans mice injected with either parental or mock transfectant MDA fected cells were seeded at identical sub-confluent densities MD 231 cells (FIG. 7b). Despite the reported sensitivity of and at defined times were harvested and the total cell count 35 this assay, which is able to detect 1 human cell/1x10' mouse estimated using a Coulter counter. In both control cultures a cells, no metastasis could be found in the aforementioned doubling of cell number every 24 hours was observed until the organs in mice that were injected with ASHAS2 transfectants 72 hour sample point where cultures reached confluency (FIG. 7) were determined to find any metastasis to soft (FIG. 4). In contrast stable transfectants harbouring ASHAS2 organs, however, there were no detectable metastases with the cell growth was profoundly affected by the lack of a func 40 HAS2 antisense and significantly high levels of metastasis tional HAS2 protein. Specifically, ASHAS2 transfectants dis were found in the brain and lung compared to the kidney and played a lag period of approximately 24 hours to reach similar liver in the parental mice groups (FIG. 7b). densities to that observed in control cultures at all subsequent time points where cell number was enumerated (FIG. 4). Example 21 Confluency in ASHAS2 cultures occurred at approximately 45 96- to 120 hours of cell growth after seeding compared with 72 hours in both control cultures. These observations there Over-Expression of HAS2, HYAL2 and CD44 fore highlight the importance of the co-ordinated expression Correlates with the Invasiveness of Breast Cancer of a functional HAS2 in cell proliferation. Concomitant to these observations flow cytometric analy 50 Culture of Human Breast Cancer Cells sis was also performed on parental, mock and ASHAS2 trans Aneuploid human breast adenocarcinoma cell lines, MDA fectants to determine relative DNA content at defined time MB-231, MDA-MB-435, MDA-MB-468, MDA-MB-453, points after plating at sub-confluent densities (FIG. 5). The MDA-MB-361, T47D, MCF-7A, BT-549, ZR-75-1 and percentage of the ASHAS2 transfected cells in the cell cycle Hs578T were obtained from the American Tissue Culture phases Go/G, S and G/M 28 hours after plating were 80%, 55 Collection, Rockville, USA. All cell culture propagation 0% and 9% respectively (FIG. 5). In contrast the correspond reagents were obtained from Sigma, St Louis, Mo., USA. Cell ing figures in the parental cells for cell cycle phases Go/G, S lines, MDA-MB-231, MDA-MB-435, MDA-MB-468, and G/M were 4%, 75% and 15% respectively (FIG. 5). MDA-MB-453 and MDA-MB-361 were routinely grown and These results are consistent with the observation in the lag subcultured as a monolayer in 175 cm2 culture flasks in period of 24 hours in the proliferation assay where antisense 60 Leibovitz L-15 Medium supplemented with 10% fetal calf inhibition induced a transient delay of entry into S-phase by serum (FCS) at 37°C. in 100%(v/v) air. The ZR-75-1 cell line approximately 24 hours (FIG. 5) thereby reinforcing the was grown in RPMI Medium supplemented with 10% FCS, 2 importance of HAS2 expression during cellular proliferation mM L-glutamine, 1.5 g/L Sodium bicarb. 4.5 g/L glucose, 10 in cultures of MBA-MD-231. mM HEPES, 1 mM sodium pyruvate at 37° C. in humidity The ability for cancer cells to migrate is a fundamental 65 controlled incubator in 5%(v/v) CO. The T47D cell line was characteristic in highly metastatic cancer cells. To character maintained in a humidified incubator at 37°C. in 5% CO in ise the highly invasive characteristics of MDA MB-231 the RPMI supplemented with 10% FCS, 4.5 g/L of glucose, 10 US 7,662.929 B2 87 88 mM HEPES, 1 mM sodium pyruvate, 7.1 ug/ml of insulin. Quantitation of the Synthesis and Catabolism of Liberated BT-549 cell line was maintained in a humidified incubator at and Cell-Associated Hyaluronan 37° C. in 5% CO, in RPMI supplemented with 10% FCS and Triplicate cultures of the human breast cancer cell lines 0.8 ug/ml of insulin. His378T cell line was cultivated in a were seeded at 7.5x10 cells/75 cm culture flask and were humidified incubator at 37° C. in 5% CO, in DMEM supple 5 grown with 400 ug/ml of dextran sulphate (500 kDa Mand mented with 10% FCS and 10 ug/ml of insulin. MCF-7 cell 17% sulphur-substituted; Pharmacia Fine Chemicals, Upp line was cultivated in a humidified incubator at 37°C. in 5% sala, Sweden) as a means of inhibiting endogenous hyalu CO, in MEM supplemented with 10% FCS, 1 mM sodium ronidase activity and enabling the characterisation of hyalu pyruvate and 10 ug/ml of insulin. All cell cultures were rou ronidase digestion products (Udabage et al., 2004). Cultures tinely maintained in media containing antibiotic/antimycotic 10 were grown for 24h during which time cell cultures reached reagents. 85% confluence and then for a further 24h until growth arrest was observed. At the conclusion of the incubation period, Quantification of mRNA for HAS1, 2 and 3 cells were harvested by trypsinization and counted using a Real time and comparative reverse transcriptase PCR were Coulter counter. Media was used for quantitation of the lib 15 erated HA. Cell-associated extracellular HA was obtained by used respectively to quantitate the relative mRNA levels of centrifugation of the cell/trypsin fraction at 400 g in a Beck the HA synthases (HAS 1-3) in the ten human breast cancer man TJ-6 centrifuge where the Supernatant was quantitated cell lines by using gene specific primers and an internal oli for HA. Intracellular HA concentration was determined by gonucleotide probe (Table 2). RNA was extracted from trip treating the cell pellet as follows: the cell pellet was lysed licate cultures of cells grown to both exponential and plateau under hypotonic conditions by resuspending in 10 mM phase using RNeasy(R) Mini Kits (QIAGEN, Basel, Switzer HEPES pH 7.2 followed by disruption in a Dounce homoge land). In brief, total RNA was purified from exponentially niser using 20 strokes every 15 min. Cell lysis was confirmed growing cells using TRI-reagent(R) (Sigma) which was used to by Giemsa stain and examination by light microscopy. To generate single stranded cDNA by incubating 2 ug RNA with dissociate the HA from binding proteins, the cell lysate was 0.5 g/ul random primers and SuperscripTM reverse tran 25 heated to 37° C. with 0.5% v/v Triton X-114 in 10 mM criptase (Invitrogen, Carlsbad, Calif., USA). For quantitative HEPES buffer pH 7.2 (Prehm, 1990). The HA/detergent real time PCR gene specific primers for each HAS isoform micelles were centrifuged at 1500 g for 5 min and the upper and an internal oligonucleotide probe were used. For HAS aqueous phase was analysed for HA. The individual analyses internal probes the reporter dye 6-carboxylfluorescein of the intra and extracellular HA fractions were not within the (6-FAMTM) and quencher 6-carboxytetramethyl rhodamine 30 detection limits of the HAELISA (>50 ng/ml), therefore the (TAMRATM) was labelled at the 5' and 3' respectively. For extracellular and intracellular fractions were pooled and char GAPDH internal probes the reporter 6-FAMTM was substi acterised for HA concentrations. tuted with VICTM (Applied Biosystems, Foster City, Calif., Hyaluronan production was quantitated using an enzyme USA). The PCR reaction was performed in a final volume of linked HA binding protein assay (Corgenix Inc., Colorado, 30 ul and consisted of 1x Taqman reaction mix, 6 uM of HAS USA). The assay was performed as directed by manufactur er's instructions. In brief, duplicate 100 ul of samples and the forward and reverse primer, 1.5 LM of probe, 1 uM of each HA standards (0 ng/ml, 50 ng/ml, 100 ng/ml, 200 ng/ml, 500 GAPDH primer and 500 nM of GAPDH probe. PCR ampli ng/ml and 800 ng/ml) were aliquoted into a 96 well plate fication was performed by denaturation for 10 min at 95°C. coated with HA binding protein (HABP), incubated for 60 followed by annealing for 2 min at 50° C. followed by 40 40 minutes at room temperature (RT) followed by four washes cycles of 15 seconds at 95°C. and 1 min at 60°C. Thermocy with PBS. One hundred ul of HABP conjugated to horse cling and fluorescence measurement were performed in an radish peroxidase was added and incubated at for 30 minutes ABI Prism 7700R) sequence detection system (Applied Bio at RT. After further PBS washes the reaction was visualised systems). Relative quantitation was performed by normaliz with 100 ul of 3,3',5,5'-tetramethylbenzidine (TMB) after a ing threshold cycle (Ct) values of each sample gene with Ct 45 30 min, RT incubation. The reaction was sopped with 100 ul values of the GAPDH. ACt corresponds to the difference of 0.36N sulfuric acid and read at 450 nm (650 nm reference) between the Ct of the HAS genes of interest and the Ct of the in a BioRad 350 microplate reader. Growth media that had not GAPDH. Data are presented as fold-change difference rela been exposed to cells was used to determine the endogenous tive to parental (arbitrarily set to 100) calculated according to HA background, this figure was subtracted from all results. the formula describing relative PCR quantitation 2^' 50 ACCAA DH). Visualisation of the Hyaluronan Gylcocalyx The HA-dependent pericellular matrix was visualised Characterisation of Hyaluronidase Gene Expression around the breast cancer cells by the addition offixed human To determine the hyaluronidase gene expression for erythrocytes as described by Clarris & Fraser (1968). In brief, HYAL-1, 2 and 3, RT-PCR was performed on total RNA 55 human erythrocytes were fixed overnight in 1.5% V/v form extracted from cells in both the exponential and growth aldehyde in PBS at RT and were then washed exhaustively in arrested phases. The gene specific primer sets were designed PBS. In the last wash sodium azide was added to a final from sequences retrieved from GenBank(R) (refer Table 2). concentration of 0.1% V/v and the cells stored at 4°C. Breast Amplified sequences were visualised by agarose gel electro cancer monolayers were washed twice in PBS, 37° C. and phoresis containing ethidium bromide and their identity con 60 then incubated with 5 ml PES to which 50 ul of fixed eryth firmed by automated DNA sequencing. To quantitate the rela rocytes (~10 cells/ml) was added. The particles were allowed tive abundance of each PCR product, ethidium bromide to settle for 15-30 min after which the HA-dependent peri stained agarose gels containing amplified fragments were cellular matrix was recorded by photography on a Nikon subjected to densitometric analysis using ProXpressTM Optiflot inverted phase contrast microscope. The specificity Imager (Perkin Elmer, Boston, Mass., USA) and the data 65 of this method was demonstrated by incubation of the breast analysed using PhoretixTM 1D software (Phoretic Interna cancer cultures with Streptomyces hyaluronidase, where cells tional, Newcastle, UK). were covered with 10 units/ml of hyaluronidase followed by US 7,662.929 B2 89 90 incubation at 37°C. for 15-30 min. Monolayers were washed disruption in a Dounce homogeniser using 20 strokes every twice in PBS, 37° C. and covered with a 5 ml suspension of 15 minutes. Cell lysis was confirmed by Giemsa stain of cell fixed erythrocytes as previously described. The particles were lysate and examination by light microscopy. Cell lysate allowed to settle for 15-30 min, observed and photographed preparations were denatured at 65° C. for 5 min and loaded as described above. (15-30pg of protein per lane) onto a 10% polyacrylamide gel. Characterisation of the Molecular Weight of Hyaluronan Pro Electrophoresis was performed on a Bio-Rad minigel appa duced by Human Breast Cancer Cells ratus. Proteins were transferred to nitrocellulose membranes Cells were seeded at 7.5x10 cells/75 cm culture flaskand and blocked for 1 h with Tris-buffered saline containing 5% were grown for 24h in growth media containing 400 ug/ml nonfat dry milk and 0.1% Tween-20. Membranes were then DS and 250pCiD-6-Hglucosamine hydrochloride (Perkin 10 washed and probed with the appropriate antibody diluted in Elmer, Boston, Mass., USA). At the conclusion of the 24h Tris-buffered saline containing 5% bovine serum albumin incubation period, the media was removed and exhaustively (for polyclonal antibodies) or 5% nonfat dry milk (for mono dialysed (Mr exclusion of 6 kDa) against 10 mM Tris-HCl/ clonal antibodies). The antibodies used for detection were 50 0.15M sodium chloride/0.02% sodium azide pH 7.4 at 4°C. ug of CD44s monoclonal antibody (Hybridoma Bank, USA) The dialysate and dialysis fluid were chromatographically 15 or 25 pg RHAMM (kindly donated by R. Savani, University analysed for the identification of HHA and its degradation of Pennsylvania School of Medicine, USA). The secondary products. HHA of >5 kD was subjected to size exclusion antibodies used were anti-rabbit IgG (New England Bio-labs) chromatography in a Sephacryl R. S-1000 gel eluted in 0.15M and rabbit anti-rat IgG (Bio-Rad), which were conjugated NaCl/phosphate pH 7.25 which contained 19 mMNaH2PO, with horseradish peroxidase. Immunoreactive bands were 38 mMNaHPO and 94 mMNaCI at 13.6 ml/h. The dialysis detected by enhanced chemiluminescence, and the sizes of fluid (molecules <5 kD) was subjected to size exclusion chro proteins were estimated using prestained molecular weight matography in a Superose(R) 12 gel eluted in the above-men standards. Immunoreactive bands were quantified by densi tioned buffer at an elution rate of 20 ml/h. Molecular weight tometry. analysis using ProXpressTM Imager (Perkin Elmer, estimations were calculated using calibration data for HA in Boston, Mass., USA) and the data analysed using PhoretixTM Sephacryl(R) S-1000 and Superose(R) 12 data generated from 25 1D software (Phoretic International, Newcastle, UK). commercially purchased HA fractions of high monodisper Highly Invasive Breast Cancer Cells Preferentially Express sity ranging from 10k to 5000 kDa (CPN, Czech Republic HAS2 and Pharmacia). To determine the percentage incorporation Endogenous levels of mRNA for the various HA synthase D-6-H glucosamine hydrochloride into Ha macromol isoforms were quantitated in 10 different human breast cancer ecules, the non-dialysable (molecules >5 kDa) dpm was sub 30 cell lines using real time PCR and comparative RT-PCR (see jected to digestion by 10 TRU of Streptomyces hyaluronidase Table 3). HAS1 mRNA was not detected in any of the ten at pH 6, 37°C. for 24 h. Digested material was subjected to breast cancer cell lines. HAS2 mRNA was detected in all the chromatography in both Sephacryl(R) S-1000 and Superose(R) breast cancer cell lines which demonstrated an invasiveness 12 where profiles were compared to equivalent undigested of >80% where the highly invasive BT-549 and Hss78T cell sample. Any Himaterial not digested by hyaluronidase was 35 lines expressed up to 205 times more HAS2 mRNA than the excluded from the chromatography profiles. For the calcula non-invasive MDA-MB 453 cell line. Negligible differences tion of column recoveries, counts in each fraction were taken in HAS2 mRNA were observed between exponentially grow as significant when >3 S.D. above the mean background dpm, ing and growth arrested cells. All cell lines expressed low with the background determined taking an equal number of levels of HAS3 mRNA, but it was interesting to note that in sample points before and after Vo and Vt, where the average 40 cells with a low invasive potential (<26%) no HAS3 mRNA number taken was 20. was detected in growth arrested cells, while in the highly Evaluation of Breast Cancer Cell Line Invasiveness: Boyden invasive cell lines the transcription of this gene continued. Chamber Migration Assay The expression of HAS3 in all breast cancer cell lines, more Invasion Assays were Performed Using Modified Boyden 45 particularly in the less invasive cell lines suggests that this Chambers with Polycarbonate Nucleopore membrane (Corn HAS isoform is primarily responsible for the synthesis of ing, Corning, N.Y., USA). Pre-coated filters (6.5 mm in diam basal levels of HA production necessary for normal cell func eter, 12 um pore-size, Matrigel 100 ug/cm) were rehydrated tion and HAS2 is required for the rapid synthesis of large with 100 ul of Leibovitz L-15 media supplemented with 0.1% quantities of HA required for cancer invasion. w/v BSA (Sigma). Exponentially growing cells were har 50 The Glycocalyx in Exponentially Growing Breast Cancer vested with trypsin/EDTA (Sigma), washed twice with Cells is Generated by HAS2 serum-free growth medium containing 0.1% w/v. BSA then Utilising the HA quantitation and particle exclusion assay added to the top chamber (3x10 cells/1 ml chamber). Normal it was possible to uniquely demonstrate that when breast growth media containing 10% V/v FCS was used as the chemo cancer cells are in exponential growth phase any cell-associ attractant. After incubation for 6 hat 37°C., non-invaded cells 55 ated HA is only detected in cells expressing HAS2 (Table 3). on the upper surface of the filter were wiped with a cotton In the exponentially growing, less invasive breast cancer phe swab, and migrated cells on the lower surface of the filter notype which preferentially expressed HAS3, none of the were fixed and stained with Diff-Quick kit. Invasiveness was synthesised HA was retained as part of the glycocalyx, the determined by counting cells in five microscopic fields per retention of the HA into the pericellular matrix only occurred well, and the extent of invasion was expressed as an average 60 after the cells have reached growth arrest. This finding is number of cells per microscopic field. Each experiment was contrary to studies in other cell types where it was suggested performed in triplicate on two separate days where data is that HAS3 expression resulted in the retention of a pericellu represented as % of migrating cells compared to the parental lar matrix (Itano et al., 1999a; Liu et al., 1996). During senes cell line. cence, in general, the quantity of HA liberated into the media Quantitation of Hyaluronan Receptors, RHAMM and CD44 65 by HAS3 expressing cell lines significantly, in some cases Cell extracts were obtained by hypotonic lysis of exponen total inhibition of HA liberation was observed, followed by tially growing cells in 10 mM HEPES pH 7.2 followed by the retention of the HA in the cell-associated fraction. During US 7,662.929 B2 91 92 senescence, highly invasive cell lines released 40-60% less Increased Expression of Hyal-1 and Hyal-2 Induces Invasive HA into the extracellular environment, but retained 2-22 fold ness in Human Breast Cancer Cell Lines more HA in the pericellular matrix. The quantitation of the Utilising competitive reverse transcription polymerase cell-associated HA was substantiated by the red cell exclu chain reaction (RT-PCR), Hyal-1, 2 and 3 was detected in sion assay which only demonstrated the presence of a peri varying quantities in all cell lines, while PH-20 was not cellular coat in the exponentially growing MDA-MB 231, detected using these amplification conditions. When compar BT-549 and HS578T cell lines. ing the expression of Hyal-1 and Hyal-2 expression in the less invasive cell lines (s30% of a cell population demonstrating HAS 2 and HAS3 Liberate High Molecular Hyaluronan migration) the mRNA for both of the enzymes were of which is Rapidly Depolymerised 10 approximate equal expression. As cells became more invasive Chromatographic characterisation of the liberated HA the expression of both the Hyal-1 and Hyal-2 mRNA (tStreptomyces hyaluronidase digestion) from cells which increased where Hyal-2 was often expressed at levels of 5-7 had undergone both exponential proliferation and growth fold higher than the Hyal-1 mRNA. In the least invasive cell arrest demonstrated that 80-98% of the HIglucosamine was lines the transcription of Hyal-1 and 2 was inhibited during incorporated into HHA, with the remaining HIdpm iden 15 senescence, while in the highly invasive cell lines the level of tified as a pronase digestible macromolecule of approxi mRNA expression was maintained or slightly increased dur mately 50kDa (See Table 4). All graphs represented in FIGS. ing growth arrest. 8A-H have had any peaks associated with Streptomyces The Cellular Turnover of Hyaluronan Decreases with hyaluronidase resistant material removed from the profile. Increased Cellular Invasion The least invasive cell line, MDA-MB 453 which only As seen in Table 4, as the invasive potential of the breast expressed HAS3 liberated monodisperse HA of 10000 kDa, cancer cell increased the turnover rate of liberated HA while the equivalent sample from cells grown without inhi decreased, indicating that highly invasive cells may requirean bition of the endogenous hyaluronidase (DxS culture) exhib extracellular environment rich in HA or that the degradative ited depolymerisation of 22% of the liberated HA, into a 60 pathways of the cells had reached the maximum functioning kDa to 600 kDa with 78% degraded to 30kDa (FIG.8A). The 25 capacity. This study has uniquely identified the expression of most invasive cell lines, BT-549 and His378T which both Hyal-3 in breast cancer where there is an inverse relationship primarily expressed HAS2 and a very low expression of between cell invasiveness and Hyal-3 expression. The iden HAS3, both liberated large quantities of 10 000 kDa HA tification of Hyal-3 in breast cancer cells was unexpected as which in the presence of active hyaluronidases, was rapidly this gene has been reported in mammalian testis and bone degraded into the HA fragments of 10, 20 and 40 kDa (FIGS. 30 marrow (Csoka et al., 2001), but as yet has to demonstrate 8E & G). The MDA MB-231 which expressed moderate activity in standard hyaluronidase assays (Stern, 2003). levels of HAS2 and very low levels of HAS3, produced a High Levels of CD44 Epitope Correlates with Increased Cell polydisperse HA which had several peaks with the modal Mr Invasiveness, Elevated HAS2, Hyal-1 and Hyal-2 Expression of 600 to 10 000 kDa and smaller fractions at 60 and 200 kDa, Quantitation of the RHAMM receptor did not exhibit a while after exposure to endogenous degradation processes 35 strong correlation with any particular HAS isoform or the these macromolecules were degraded to 20, 40 and 500 kDa prevalent expression of hyaluronidase or cell invasiveness (FIG. 8B). however there did appear to be an inverse relationship Analysis of the cell-associated HA demonstrated that when between CD44 and RHAMM expression (FIGS. 9A & B). the normal HA degradation processes were inhibited by dex With the exception of the moderately invasive cell line, tran sulphate a very high Mr HA could be detected as well as 40 MDA-MB 468 there was a proportional relationship between oligomers of intermediate Mr. ranging from 20 to 200 kDa. HAS2, Hyal-1 Hyal-2, CD44 and breast cancer cell invasive When the hyaluronidase and other potential degradative pro ness (Tables 3 & 4). When examining the catabolic potential cesses were inhibited by dextran Sulphate only small frag of a breast cancer cell; the higher the CD44 and Hyal-2 ments of HA ranging from 10 to 70 kDa were found associ expression, the greater the cells’ ability to degrade large quan ated with the cell fraction (Table 5). tities of HA (Table 4).
TABL E 2
Gene Sense Primer Reverse Primer Hybridisation Probe
HAS1 is CCTGCATCAGCGGTCCTCTA 3 s' GCCGGTCA-TCCCCAAAAG 3." s' AACCTCTTGCAGCAGTTTCTTGAGG (SEO ID NO: 27) (SEQ ID NO:34) CC 3 (SEQ ID NO: 41)
HAS2 5. CAGTCCTGGCTTCGAGCAG 3." 5 TTGGGAGAAAAGTCTTTGGCT 3 5. CCATTGAACCAGAGACTTGAAACAG (SEQ ID NO:28) (SEO ID NO:35) CCC 3' (SEQ ID NO: 42)
HAS3 is TTGCACTGTGGTCGTCAACTT 3. ' s' GTCGAGGTCAAACGTTGTGAG 3." 5 TCAAATCAAAAACAGGCAGGTACAG (SEQ ID NO: 29) (SEQ ID NO:36) GTAGTGG 3." (SEQ ID NO : 43)
GAPDH 5' AAGGTGAAGGTCGGAGTCAAC 3 s' GAGTTAAAA-GCAGCCCTGGTG 3." s' TTTGGTCGTATTGGGCGCCTGG 3." (SEQ ID NO:30) (SEO ID NO:37) (SEQ ID NO:44)
Hyali-1 5' GCACAGGGAAGTCACAGATGTATGTGC 3' 5. CCACTGGTCACGTTCAGGATGAAG-3 (SEQ ID NO:31) (SEQ ID NO:38)
Hyal-2 5' GATGTGTATCGCC- GGTTATCACGCC 3' 5' CGTAGACTGGGAGTGCATGGTTGGC 3'; (SEQ ID NO:32) (SEO ID NO:39) US 7,662.929 B2 93 94
TABLE 2 - continued
Gene Sense Primer Reverse Primer Hybridisation Probe
Hyal-3 5' GCACTGATGGAGGATACGCTGCG 3' s' GCTGGTGACTGCAGGCCATCGCTGC 3' (SEQ ID NO:33) (SEQ ID NO: 40)
TABLE 3 Hyaluronan Production Invasive Potential CD44 Hyaluronan Synthase Expression fg/cell/24h (% of Expression HAS2 HAS3 Liberated Cell-associated
Breast Cancer migratory (densitometry EXP. PLAT. EXP. PLAT. EXP. PLAT. EXP. PLAT. Cell Line cells) unitsug protein) Phase Phase Phase Phase Phase Phase Phase Phase MDA-MEB-453 1 O O O 1 O 594 139 O 64 MDA-MEB-361 2 O O O 1 O 255 46 O 8O MDA-MEB-468 23 1.9 O O 3 O 616 O O 38 ZRL-75-1 26 O O O O.S O 637 627 O 26 T47D 26 O.1 O O 2 O 1523 O O 71 MCF-7A 31 O.1 O O 1 1 1623 313 O 64 MDA-MEB-435 48 O.9 O O O.S O.S 376 92 O 44 MDA-MEB-231 8O 1.1 14 16 1 1 64SO 1137 250 351 BT-549 92 1.5 92 91 8 8 13087 5278 125 2793 HSS78T 100 3.6 208 205 O.2 O.2 12711 4567 52 102 *HAS expression as determined by real time RT-PCR where figures are expressed as the fold difference a percentage of the least invasive cell line MDA-MB 453 0 indicates where gene or hyaluronan was not detected
TABLE 4 Invasive Potential CD44 Hyaluronidase Gene Expression* (% of Expression Hyal-1 Hyal-2 Hyal-3 Breast Cancer migratory (densitometry EXP, PLAT. EXP, PLAT. EXP, PLAT. Cell Line cells) units/ug protein) Phase Phase Phase Phase Phase Phase
MDA-MEB-453 1 O 1 O 1 O 1 1 MDA-MEB-361 2 O 1 O 1 O 5 2 MDA-MEB-468 23 1.9 5 O 5 O 10 10 ZRL-75-1 28 O 10 O 11 O 14 O T47D 26 O.1 16 O 17 O 5 30 MCF-7A 31 O.1 5 O 5 O 25 5 MDA-MEB-435 48 O.9 14 16 103 105 75 76 MDA-MEB-231 8O 1.1 30 30 155 158 35 O BT-549 92 1.5 28 30 18O 192 5 O HSS78T 1OO 3.6 29 35 2O1 205 O O Hyaluronan Turnover (fg/cell/24 h)
Liberated Cell-associated
Breast Cancer EXP. PLAT. EXP. PLAT. Cell Line Phase Phase Phase Phase MDA-MEB-453 594 (100%) 139 (100%) O 6 (9%) MDA-MEB-361 255 (100%) 46 (100%) O 44 (55%) MDA-MEB-468 616 (100%) O O 6 (16%) ZRL-75-1 594 (93%) 367 (59%) O 0.8 (3%) T47D 1308 (86%) O O 17 (24%) MCF-7A 1623 (100%) 313 (100%) O 35 (30%) MDA-MEB-435 376 (100%) 92 (100%) O 19 (43%) MDA-MEB-231 2020 (31%) 880 (77%) O 46 (13%) BT-549 1476 (11%) 914 (17%) 81 (49%) 1405 (50%) HSS78T 2990 (24%) 1756 (38%) 34 (65%) 41 (40%) * Hyal expression as determined by RT-PCR and digitisation of bands where figures fold difference in expression when compared to the least invasive cell line MDA-MB 453 0 indicates where gene or hyaluronan is not detected () Figures in brackets represent the % of HA which is degraded/cell/24h US 7,662.929 B2 96
TABLE 5 Invasive Characterisation of liberated HA Potential Mof HA (% of HAS Gene Hyal Gene degradation Breast Cancer migratory Expression Expression Modal M. products Cell Line cells) HAS2 HAS3 Hyal-1 Hyal-2 Hyal-3 (kDa) % of HA (kDa) % of HA
MDA-MEB-453 1 O 1 1 1 1 10 OOO 100 25 67 70 11 800 3 3OOO 7 6000 12 MDA-MEB 231 8O 14 1 30 155 35 60 36 2O 37 2OO 36 40 41 600 to 10 OOO 28 500 22 BT-549 92 92 8 28 18O 5 10 OOO 100 10 66 2O 11 40 HSS78T 1OO 208 O.2 29 2O1 O 10 OOO 100 10 9 2O 28 40 41
Characterisation of cell-associated HA Mof HA degradation Breast Cancer Modal Mr products Cell Line (kDa) % of HA (kDa) % of HA
MDA-MEB-453 60 23 10 22 1OO 24 2O 78 10 OOO 53 MDA-MEB 231 2OO 39 2O 23 500 38 40 33 660 23 70 44 BT-549 2O 21 10 9 60 41 2O 26 10 OOO 38 40 46 60 8 HSS78T 10 OOO 100 10 27 2O 36 HAS expression as determined by real time RT-PCR where figures are expressed as the fold difference a percentage of the least invasive cell line MDA-MB 453 Hyal expression as determined by RT-PCR and digitisation of bands where figures fold difference in expression when compared to the least invasive cell line MDA-MB 453
Example 22 TGTGAGAGC-3' (SEQ ID NO: 45) and antisense, 5'-GA CATGGTGCTTGATGTATGATCTTCCAT-3' (SEQID NO: 45 46). Total RNA harvested from exponentially dividing human Antisense-Medicated Suppression of Hyaluronan dermal fibroblasts was used as the template for RT-PCR, Synthase 2 Inhibits the Tumor Genesis and generating a 1.7 kb clNA fragment of HAS2, which was Progression of Breast cloned directly into pGEM(R)-T vector (Promega, Madison, USA). The cDNA for HAS2 was subsequently subcloned into 50 the pCl-neo expression vector (Promega) and isolated clones containing the insert in the antisense orientation (ASHAS2 Cell Culture construct) were identified by restriction endonuclease map ping and automated sequencing. Aneuploid human breast adenocarcinoma cell line MDA MB 231 (American Tissue Culture Collection, Rockville, Md., USA) was selected based on the expression of HAS2. 55 Transfection and Validation of MDA-MB 231 Human Breast Cells were propagated in monolayer culture in Leibovitz Cancer Cells with ASHAS2 and Mock Constructs L-15 Medium (Sigma, St Louis, Mo., USA), supplemented with supplemented with 10% FCS, 100 units/ml penicillin The ASHAS2-pCI-Neo construct and mock control (pCl and 100 mg/ml Streptomycin. neo vector without insert) were transfected into human MDA 60 MB 231 breast cancer cells using LipofectamineTM plus reagent (Gibco Life Technologies, Melbourne, Victoria, Aus Construction of Antisense Expression Vector tralia) according to the manufacturers instructions. For at least one month, prior to commencing studies, transfected The cDNA open reading frame for human HAS2 was gen cells were selected in the presence of 500 ug/ml G418 anti erated by designing gene specific primers from the published 65 biotic (Promega). Stable cell lines were established by har sequence of Watanabe and Yamaguchi and consisted of the vesting and pooling of antibiotic-resistant colonies. Confir following primers: sense, 5'-GAGCTGAACAAGATGCAT mation of the stable incorporation of the antisense HAS2 US 7,662.929 B2 97 98 construct into the genome was performed using PCR on puri 24, 48, 72.96, 120 and 144h. After the defined growth period, fied genomic DNA. In brief, a gene specific primer for pCl cells were detached using 0.25% w/v trypsin and cell number neo: 5'-GCACAGATGCGTAAGGAG-3' (SEQ ID NO: 47) determined using a Coulter counter (Beckman, Coulter, Aus was used in combination with two specific HAS2 primers of tralia). the following sequence: GSP2 sense 5'-GCTGTGTACAT 5 Immunohistochemical Identification of Hyaluronan Syn GACCTCGCGCTTGCCGCC-3' (SEQ ID NO: 48) and thase, Hyaluronidases and CD44 GSP4 sense, 5'-GGCGGGAAGTAAACTCGAC-3' (SEQID NO: 49). When used in the following combination; pCl-neo/ The comparative effect of HAS2 inhibition on the expres GSP2 and pCl-neo/GSP4, expected size products of 1443 bp sion of HA synthase, hyaluronidase and HA receptors was and 2223 bp were amplified respectively. The products of 10 performed on parental, mock and ASHAS2 transfected PCR were identified by restriction endonuclease mapping MDA-MB 231 cells. Eight-well chamber slides were plated and automated sequencing. at a density of 2x10 cells/well and cells were attached for 24 Quantification of mRNA for HAS1, 2 and 3 h. Cells were fixed in Histochoice (Sigma) for 15 min then Real time PCR using gene specific primers and an internal washed 3x5 min in PBS. Heterophile proteins were blocked oligonucleotide probe was used to quantitate the relative 15 by incubation with 10% FCS for 10 min, followed by a PBS mRNA levels of HAS1, HAS2, and HAS3 in parental, mock rinse. The antisera or antibodies were against CD44H and ASHAS2 transfected cells (Table 2). In brief, total RNA (DAKO, Copenhagen, Denmark) HYAL1, HYAL2. (kindly was purified from exponentially growing cells using TRI donated by R. Stern, University of San Francisco, USA), reagent (Sigma). The total RNA was used to generate single HAS2 (kindly donated by P. Heldin, Ludwig Institute for stranded cDNA by incubating mg RNA with 0.5 g/ul ran Cancer Research, Uppsala, Sweden) were diluted in PBS dom primers and Superscript reverse trancriptase (Invitrogen, containing 1% human serum/1% FCS where detection anti Carlsbad, Calif., USA). For quantitative real time PCR gene bodies were applied for 60 min at 25°C. Endogenous peroxi specific primers for each HAS isoform and an internal oligo dase activity was blocked by immersion in 0.3% HO in nucleotide probe were used. For HAS internal probes the methanol for 20 min. Following an additional PBS wash, reporter dye 6-carboxylfluorescein (6-FAMTM) and quencher 25 Swine anti rabbit or rat anti mouse peroxidase-conjugated 6-carboxytetramethylrhodamine (TAMRATM) was labelled secondary antiserum (DAKO) was applied for 60 min at RT, at the 5' and 3' respectively. For GAPDH internal probes the followed by 3x5 min washes in PBS. Epitope was visualised reporter 6-FAMTM was substituted with VICTM (Applied Bio with Sigma Fast DAB (3,3'-diaminobenzidine, Sigma) after systems, Foster City, Calif., USA). The PCR reaction was application for 5-10 min at RT. Slides were washed in tap performed in a final volume of 30 pland consisted of 1 x 30 water for 10 min, counterstained with haematoxylin, dehy Taqman reaction mix, 6 uM of HAS forward and reverse drated and mounted. primer, 1.5uM of probe, 1M of each GAPDH primer and 500 nM of GAPDH probe. PCR amplification was performed by Cell Cycle Analysis by Flow Cytometry denaturation for 10 min at 95°C. followed by annealing for 2 min at 50° C. followed by 40 cycles of 15 seconds at 95°C. The transfected and control cells were seeded at 2x10 and 1 min at 60° C. Thermocycling and fluorescence mea cells/25 cm and grown with 2 mM thymidine until 50% surement were performed in an ABI Prism 7700R sequence confluent. After reaching 50% confluence, cells were grown detection system (Applied BioSystems). Relative quantita in thymidine-free culture medium. Cells were harvested, by tion was performed by normalizing threshold cycle (Ct) val 40 trypsinisation at 0, 4, 8, 12, 16, 20, 24, 28, 32, and 36 h ues of each sample gene with Ct values of the GAPDH. ACt followed by fixation in 95% ethanol for 2 hat 4°C. Cells were corresponds to the difference between the Ct of the HAS pre-treated with RNAase (100 ug/ml) (Sigma) and 50 ug/ml genes of interest and the Ct of the GAPDH. Data are presented propidium iodide (Sigma) for 30 min at 37° C. before deter as fold-change difference relative to parental (arbitrarily set mining the stage of cell cycle stage using a FACS-CaliburTM to 100) calculated according to the formula describing rela 45 analytical instrument (Becton Dickinson, San Jose, Calif., tive PCR quantitation 2-(ACH-1S-AC4D). USA). Characterization of Hyaluronidase Gene Expression Cell migration assay. Invasion assays were performed To determine the hyaluronidase gene expression for using modified Boyden chambers with polycarbonate Nucle HYAL1, 2 and 3, RT-PCR was performed on total RNA opore membranes (Corning, Corning, N.Y., USA). Pre extracted from cells in both the exponential and growth 50 coated filters (6.5 mm in diameter, 12 um pore-size, Matri arrested phases. The gene specific primer sets were designed gel(R) 100 ug/cm) were rehydrated with 100 ul of Leibovitz from sequences retrieved from GenBank(R) (refer Table 2). L-15 media supplemented with 0.1% w/v. BSA (Sigma). Amplified sequences were visualised by agarose gel electro Exponentially growing cells were harvested with trypsin/ phoresis containing ethidium bromide and their identity con EDTA (Sigma). Before addition to the top chamber of the firmed by automated DNA sequencing. To quantitate the rela 55 Boyden apparatus, 3x10 cells/1 ml chamber were washed tive abundance of each PCR product, ethidium bromide twice with serum-free growth medium containing 0.1% w/v. stained agarose gels containing amplified fragments were BSA. Normal growth media containing boo V/v FCS was subjected to densitometric analysis using ProXpressTM used as the chemo attractant. After incubation for 6 h at 37° Imager (Perkin Elmer, Boston, Mass., USA) and the data C., non-invaded cells on the upper surface of the filter were analysed using PhoretixTM 1D software (Phoretic Interna 60 wiped with a cotton Swab, and migrated cells on the lower surface of the filter were fixed and stained with Diff-QuickR tional, Newcastle, UK). kit. Invasiveness was determined by counting cells in five Cell Proliferation Assay microscopic fields per well, and the extent of invasion was Exponentially growing, parental, mock and ASHAS2 expressed as an average number of cells per microscopic transfectants were plated into 24-well plates (2.5 cm/well) at 65 field. Each experiment was performed in triplicate on two cell densities, ranging from 5x10 to 9x10" cells/well. The separate days where data is represented as % of migrating effect of HAS2 inhibition on cell proliferation was studied for cells compared to the parental cell line. US 7,662.929 B2 99 100 Particle Exclusion Assay and Cell Morphology dance with the Australian National Health and Medical The HA-dependent pericellular matrix was visualised Research Councils guidelines for the care and use of labora around breast cancer cells from control and transfected cul tory animals. Five-week-old CBA nude mice (Walter and tures by the exclusion of fixed human erythrocytes as previ Eliza Hall, Melbourne, Victoria, Australia) were randomly ously described by Clarris and Fraser. Morphological differ divided into three groups (n=11/group) for the generation of ences as well as the particle exclusion assay in the control and parental, mock and ASHAS2 tumours. Cells were harvested transfected MDA-MB 231 cells were photographed on a in the logarithmic growth phase by Scraping, resuspended to Nikon Optiflot inverted phase contrast microscope (Nikon) a final density of 2x10 cells in L-15 medium supplemented 24 and 60 h after plating. with 0.1% glucose +5 mg/ml Matrigel followed by immediate Quantitation of Liberated HA 10 injected into the mammary fat. Tumour growth was recorded Triplicate cultures of parental, mock transfected and twice weekly by measuring three perpendicular diameters ASHAS2 human breast cancer MDA-MB 231 cells were (d1,d2, d3). Tumour Volume was then calculated using the seeded at 2.5x10 cells/25 cm and incubated for 24, 48,72, formula: (/6)7L (d1 d2d3). On day 84 after initiation of the 96, 120 and 144 h. At the conclusion of the incubation period, tumours mice were humanely killed. The liver, kidneys, brain cells were harvested by trypsinisation and counted using a 15 and lungs removed at autopsy and stored at -20°C. until Alu Coulter counter. Media was used for quantitation of liberated PCR analysis was performed. For pathological assessment HA. The liberated HA was quantitated using an enzyme half of the primary tumour was fixed in 4% formaldehyde and linked HA binding protein assay (HABP) (Corgenix Inc. embedded in paraffin, 5 um sections were examined after Westminster, Colo., USA). The assay was performed accord hematoxylin and eosin staining. ing to the manufacturer's instructions. In brief, duplicate 100 Intracardiac Inoculation of Breast Cancer Cells ul of samples and the HA standards (0.50, 100, 200, 500 and Before intracardiac tumour inoculation mice were anaes 800 ng/ml) were aliquoted into a 96 well plate coated with thetised with an intraperitoneal mixture of ketamine (50 HABP, and incubated at room temperature (RT) for 60 min. mg/kg) and xylazine (5 mg/kg). The MDA-MB 231 cells Samples were washed four times with PBS. One hundred ul were prepared as previously described and resuspended to of HABP conjugated to horse-radish peroxidase was added 25 1x10 cells/0.1 ml. The cell suspension was drawn into a 1 ml and incubated at RT for 30 min. After additional PBS washes, Syringe fitted with a 25-gauge needle and 0.1 ml injected into the reaction was visualised with 100 ul of 3,3',5,5'-tetrameth the left ventrical. Mice were laid on a heated pad for recovery ylbenzidine (TMB) after a 30 min, RT incubation. The reac before returning to the cages. Periodically, radiographic tion was stopped with 100 ul of 0.36Nsulphuric acid and read analysis for bone osteolysis was performed. For this, mice at 450 nm (650 nm reference) in a BioRad 350 microplate 30 were anaesthetised (as previously described) and X-rayed in reader. Growth media which had not been exposed to cells a prone position against the X-Omat film (Eastman Kodak was used to determine the endogenous HA levels. Endog Co., Rochester, N.Y., USA) and exposed with X-rays of 35 enous HA levels were subtracted from all HA estimation kV for 30 sec using a Cabinet X-ray system-Faxitron Series, results. 35 Hewlett-Packard Co. (Model MX20 with a 20 um focal Characterization of Hyaluronan Molecular Weight Using source: Faxitron X-ray Corp., Illinois, USA). Animal health Size Exclusion Chromatography and survival rate was observed until their euthanasia due to Cells were seeded at 7.5x10 cells/75 cm culture flaskand one of the following medical reasons; severe weights lose, were grown for 24 h in growth media containing 250 uCi hyperventilation, paralysis, or bone fracture. Collected D-6-Hlglucosamine hydrochloride (Perkin Elmer). At the 40 organs: liver, kidneys, brain and lungs were removed and conclusion of the 24 h incubation period, the media was stored at -20°C. until Alu PCR analysis was performed. To removed and exhaustively dialysed (M, exclusion of 6 kDa) determine the median survival time a survival curve was against 10 mM Tris-HC1/0.15M sodium chloride/0.02% plotted using Prism stats program (Kaplan-Meier Survival) sodium azide pH 7.4 at 4°C. The dialysate and dialysis fluid with the days elapsed following intracardiac inoculations. P were chromatographically analysed for the identification of 45 value was calculated for the comparison of the survival HHA and its degradation products. HHA of >5 kD was CUWCS. Subjected to size exclusion chromatography in a Sephacryl Alu PCR Quantification of Metastasis S-1000 gel eluted in 0.15M NaCl/phosphate pH 7.25 which Quantitative Alu PCR was used to detect metastasis of contained 19 mM NaH2PO4, 38 mM NaHPO and 94 mM MDA-MB 231 from the primary tumour to secondary organs. NaCl at 13.6 ml/h. The dialysis fluid (molecules <5 kDa) was 50 Inbrief, DNA was extracted by grinding samples under liquid Subjected to size exclusion chromatography in a Superose 12 nitrogen and resuspending in a DNA lysis buffer (100 mM gel eluted in the above-mentioned buffer at an elution rate of NaCl, 20 mM Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 0.4% 20 ml/h. Molecular weight estimations were calculated using (v/v) SDS). DNA was purified using phenol-chloroform calibration data for HA in Sephacryl S-1000 and Superose 12, methodology followed by ethanol precipitation and reconsti where data was generated from varying MW of HA ranging 55 tution in TE buffer. The purified DNA was adjusted to a final from 800 Da to 10,000 kDa (CPN, Czech Republic and Phar concentration of 10 ng/ul in TE buffer pH 7.2, aliquoted and macia). To ensure that the D-6-Hlglucosamine hydrochlo stored at -20°C. until analysis. To remove exogenous human ride was used as a sole precursor for HA production, the DNA contamination the reaction mix, prior to addition of non-dialysable (molecules >5 kDa) Dpm was subjected to primers, was treated with 17 U/ml nuclease S7 (Roche Diag digestion by 10 TRU of Streptomyces hyaluronidase (Calbio 60 nostics, Germany) in the presence of 1 mM CaCl at 37°C. for chem, Germany) at pH 6, 37° C. for 24 h. Digested material 24h prior to PCR. Nuclease S7 was then inactivated at 90° C. was subjected to chromatography in both Sephacryl S-1000 for 30 min following the addition of 4 mM EGTA. Quantita and Superose 12 where profiles were compared to equivalent tive Alu PCR was then performed on purified genomic DNA undigested Samples. samples (10 ng) in a GeneAmp 5700 Sequence Detection Generation of Mammary Fat Subcutaneous Tumours 65 System (Applied BioSystems). Each sample was tested in Animal studies were conducted with full ethical approval duplicate in a final reaction Volume of 25 Jul consisting of from the relevant institutional ethics committee, and in accor 0.625 U Taq DNA polymerase (Roche. Mannheim, Ger US 7,662.929 B2 101 102 many), 10 mM Tris-HCl pH 8.3, 1.5 mMMgCl, 50 mMKC1, PCR. This observation is reinforced by the lack of immunore 200uMdNTPs, 8% DMSO, 1 g/ml 6-carboxy-X-rhodamine activity of ASHAS2 MDA-MB 231 stable transfectants with (Molecular Probes; Eugene, Oreg. USA), 1 in 40000 dilution the HYAL2 antibody where staining localised to the plasma of SYBR Green I (Molecular Probes) and 100 nM of each Alu membrane and also appeared as cytoplasmic vesicles. primer (Alu sense 5'-GTGAAACCCCGTCTCTAC HYAL1 expression in antisense transfectants was moderately TAAAAATACAAA-3' (SEQ ID NO:50); Alu antisense up regulated when compared with both parental and mock 5'-GCGATCTCGGCTCACTGCAA-3' (SEQ ID NO:51). controls. These observations were consistent from total RNA Following initial denaturation incubation at 95°C. for 2 min, extracted from either sub-confluent or confluent cultures. amplification occurred over 40 cycles, which consisted of CD44 was Down-Regulated by the Inhibition of HAS2 denaturation at 95°C. for 5 seconds, annealing at 65° C. for 10 60 seconds, and extension at 75° C. for 15 seconds during The expression of the HA receptor, CD44 was down regu which the intensity of fluorescence was measured. A disso lated in the ASHAS2 cells (FIG. 12A) when compared with ciation curve was then generated from 60° C. to 95°C. On parental and mock transfectants (FIG. 12B). The staining for each96-well reaction plate, a standard curve was prepared by CD44 in both controls was most evident in the plasma mem serially diluting human DNA into mouse DNA that permitted 15 brane with areas of intense focal membrane staining. the quantification of the tissue burden of human tumour cells Antisense Inhibition of HAS2 Alters Hyaluronan Metabo in the mouse organs removed at autopsy. lism Conformation of Antisense HAS2 Stable Transfection in Due to the altered HAS and HYAL expression in ASHAS2 MDA-MB 231 Cells MDA-MB 231 transfectants the amount of liberated HA was Incorporation of the antisense HAS2-pCl-neo construct quantitated. ASHAS2 MDA-MB 231 transfectants liberated into the genome of MDA-MB 231 was confirmed by PCR significantly greater quantities of HA when compared with analysis of highly purified genomic DNA extracted from either the parental cell line or mock transfectants (FIG. 13). transfected cells. When used in the following combination; Over the duration of the experiment, ASHAS2 cultures syn pCl-neo/GSP2 and pCl-neo/GSP4 expected size products of thesised an average of 6.94 pg. HA/cell/day with one notice 1443 bp and 2223 bp were reproducibly amplified from stable 25 able exception at 24 h after plating, where synthesis was clones harbouring the antisense HAS2 construct. Genomic increased to approximately 15.4 pg/cell/day, in contrast to DNA isolated from parental and mock transfected tested parental and mock transfectants that synthesised approxi negative. mately 2 and 1.6 pg|HA/cell/day, respectively. Transfection of MDA-MB 231 Breast Cancer Cells with 30 Antisense Inhibition of HAS2Did not Affect Cell-Associated Antisense HAS2 Reduces HAS mRNA and Totally Inhibits Hyaluronan the Expression of the HAS2 Protein The exclusion offixed erythrocytes was used to indirectly Endogenous levels of mRNA for HAS2 in parental cells visualise the HA pericellular matrix. When compared with were quantitated using real time RT-PCR and compared with parental and mock transfectants, the inhibition of HAS2 did the values obtained from mock and antisense HAS2 transfec 35 not result in any gross difference in the thickness of the HA tants. Concomitant to these experiments, HAS1 and HAS3 pericellular matrix and Subsequent cell-associated HA. mRNA levels were also quantitated using real time PCR with Modulation of HAS2 Expression Alters the Molecular HYAL1, 2 and 3 expression characterised by standard RT Weight of Hyaluronan Produced by MDA-MB 231 Breast PCR methodology. To allow comparison of real time HAS Cancer Cells expression between transfected and parental cells the level of 40 Media removed from the ASHAS2 MDA-MB 231 trans each mRNA quantitated was normalised with respective to fectants was highly viscous when compared to control cell their internal GAPDH controls. When comparing the endog lines. Digestion of the media with Streptomyces hyalu enous level of HAS2 mRNA expression in parental cells and ronidase demonstrated that >98% the H glucosamine had transfectants, there were no observed differences between the been incorporated into H HA, with the remaining 2% of parental and mock-transfected cell lines. In contrast, mRNA 45 HIdpm was associated with Pronase digestible macromol expression in ASHAS2 stable transfected cells was decreased ecules of -50 kDa. All figures represent data where this by 50% when compared with parental and mock transfectants reactivity been removed. The MW of HA synthesised by respectively (p=0.008) (FIG. 10A). Moderate HAS3 expres parental, mock and antisense transfected cells was deter sion was also detected and was comparable in parental, mock mined by Sephacryl S-1000 size exclusion chromatography. and antisense transfected cells, where HAS1 could not be 50 The parental cell line synthesised three distinct MW of HA detected in any of the treatment groups (data not shown). which were estimated to be 100, 400 and 3000 kDa poten Immunohistochemical detection of HAS2 with isoform-spe tially reflecting the synthetic products of the prevalently cific monoclonal antibody demonstrated that stable transfec expressed HAS isoforms, HAS2 and 3 respectively (FIG. 14). tion with ASHAS2 resulted in the effective blocking of trans In contrast, antisense HAS2 transfectants synthesised HA lation of the HAS2 protein (FIG. 10B). Whereas both parental 55 corresponding to a MW of >10,000 kDa where a minor frac and mock transfected cells exhibited a high degree of HAS2 tion (5.2%) corresponding to a molecular weight 100 kDa expression as indicated by positive epitope staining (FIG. was also detected. 10C). HAS2 Inhibition Decreases Breast Cancer Cell Proliferation Inhibition of HAS2 Alters Hyaluronidase Expression 60 and Arrests the Cell Cycle in Go/G Antisense inhibition of HAS2 significantly altered the Comparison of the effect of antisense inhibition of HAS2 expression of HYAL1,2 and 3 (FIG.11). HYAL3 could not be on cell proliferation and the progression of cell cycle during detected in either parental or mock transfectants, but the periods of active cell growth demonstrated that in both paren inhibition of HAS2 resulted in the expression of HYAL3 tal and mock-transfected cells, a doubling of cell number (FIG. 11). Inhibition of HAS2 expression, however, resulted 65 occurred every 24h where plateau growth phase was reached in the down regulation of gene expression for HYAL2 mRNA at 72 h (FIG. 15A). In ASHAS2 stable transfectants the lack to the point where it was not detectable even after 35 cycles of of a functional HAS2 altered cell proliferation by exhibiting US 7,662.929 B2 103 104 a lag period of approximately 24h, reaching growth arrest by vival period, 72 days and 77 days when compared to the 96 to 120 h (FIG. 15A). Concomitant to these observations ASHAS2 animals which had a mean survival time of 124 days flow cytometric analysis was also performed on parental, (p=0.0001) (FIG. 18B). mock and ASHAS2 transfectants to determine relative DNA content at defined time points after plating at Sub-confluent Example 23 densities. The percentage of the ASHAS2 transfected cells in the cell cycle phases Go/G, S and G/M 20 h after plating Production of HAS Antiserum were 79%, 4% and 5% as seen FIGS. 15B, C and D respec tively. In contrast the corresponding figures in the parental On the basis of the predicted amino acid sequence for 10 hHAS1, three short antigenic peptides were designed and cell line for the cell cycle phases, G/G, S and G/M were synthesised by Solid phase amino acid synthesis and purified approximately 10%, 84% and 13% respectively (FIGS. 15B, by reverse-phase high-pressure chromatography. The pep C and D). Mock transfectants were comparable to the parental tides were determined to be 99.9% pure as shown by mass cell line. In contrast, antisense inhibition of HAS2 caused a spectrometry. The production, purification, conjugation to transient delay (approximately 24 h) of entry into S phase 15 diphtheria toxoid (DT), and purity testing of the peptides (FIG.15C). These results are consistent with the observation were performed by Chiron Mimitopes (Melbourne, Austra in the 24 h lag period in growth rate observed in the prolif lia). The sequence of each immunising peptide is shown in eration assay. Table 7.
Suppression of HAS2 Reduces the Migration of Human TABLE 7 Breast Cancer Characteristics of the immunising peptides Migration of the breast cancer cells was ameliorated by the used to raise polyclonal antibodies to HA inhibition of HAS2 as indicated by the inability of the synthase. ASHAS2 transfectants to migrate across a Matrigel mem 25 Hypothesised brane (FIG.16). Comparison of cellular migratory rates dem species cross onstrated that both the parental and mock transfectants dis Immunising reactivity played typical invasive phenotypes with 100% of the cell peptide Amino acid sequence mouse human populations permeating the Matrigel, in contrast, only 7% of 30 HAS418 AARGPLDAATCRALLYPRARW -We --"We the HAS2 stable transfectants maintained the ability to invade (SEQ ID NO:24) the Matrigel membrane. 49->58 Cys' 94->103 HAS2 Inhibition Totally Inhibits the Initiation and Progres HAS419 GGLWRSWAHEA -We --"We (SEQ ID NO: 25) sion of Primary Breast Cancer in Vivo 35 48O->490 Mice intradermally inoculated with parental or mock HAS421 GAYREWEAEDPGRLAWE --"We --"We transfected MDA-MB 231 readily established primary (SEQ ID NO: 26) tumours that were comparable in growth over the duration of 146-162 the 12-week experiment (FIG. 17A). In contrast, however, mice inoculated with ASHAS2 transfectants did not establish 40 HAS immunising peptides 418 and 419 were selected on primary tumours (FIG. 17A). To ensure that the lack of areas of heterogeneity between species indicating that they tumour growth was not a result of a poor cell viability of the would be human-specific, while HAS421 was homologous to cell inoculum, in one set of experiments, Matrigel was also both mouse and human. included in the inoculation medium. Again, no primary 45 Border Leicester Merino cross-bred sheep were injected tumour could be detected over the duration of the 12-week intramuscularly at two sites with the peptides (0.2-0.5 mg) experiment. When quantitating the spread of the primary dissolved in complete Freund's adjuvant and again two weeks cancer, the highly sensitive Alu PCR assay demonstrated that later in incomplete Freud’s adjuvant. At day 35, the sheep metastasis in animals inoculated with parental and mock were bled, and the serum separated by centrifugation, and transfected was most prevalent in brain and lung, but was also 50 stored at -20° C. All serum collected was tested with an enzyme-linked immunosorbent assay for antibodies specific detected in kidneys and liver transfectants. Mice injected with for the peptide and carrier protein. The immunising peptide MDA-MB 231 ASHAS2 did not exhibit metastasis to any was coupled to thiopropyl-Sepharose 6B gel (Amersham organs (FIG. 17B). Pharmacia Biotech, Uppsala, Sweden) by cyanogen bromide Modulation of HAS2 Inhibited the Formation of Secondary 55 activation and the specific antibodies were extracted from the Tumours and Increased Animal Survival polyclonal sheep HAS antiserum by affinity chromatography. In brief 5 mL of serum was mixed with 3 mL of PBS and When quantitating the metastasis of the breast cancer after mixed with affinity/ligand resin for 1 hour at room tempera intracardiac inoculation, animals inoculated with parental ture, followed by three washes of 5 mL PBS. The antibodies and mock-transfected demonstrated prevalent spread of the 60 were eluted in 0.1M glycine pH 2.8 and were immediately cancer to the brain, liver, kidneys, lung and bone while mice neutralised to pH 7.2 by the addition of 0.1M NaOH. injected with MDA-MB 231 ASHAS2 did not exhibit HAS polyclonal antibodies were then concentrated in an metastasis to any organs (FIG. 18A). Bone lesions were Amicon cell concentrator fitted with a YM30 Diafilo filter. The observed in several mice from the control groups while protein concentration of each affinity purified antibody was ASHAS2 inoculated mice did not present with any bone 65 determined by the BCA assay (Pierce, U.S.A). The sterility of lesions. Mice inoculated with parental or mock-transfected the antibodies used in immunohistochemistry or immunob MDA-MB 231 cells demonstrated a significantly shorter sur lotting was assured by the addition of 0.1% w/v sodium azide, US 7,662.929 B2 105 106 before storage at -20°C. in aliquots. Antibodies intended for Knudson et al., The role and regulation of tumor-associated addition to cell cultures was stored at -20°C. without azide. hyaluronan. In: The Biology of Hyaluronan. (Editors. Those skilled in the art will appreciate that the invention Evered, D. & Whelan, J) Ciba foundation symposium 143. described herein is susceptible to variations and modifica J Wiley and Sons, Chichester: pp. 150-169, 1989 tions other than those specifically described. It is to be under 5 Kohler et al., Nature 256:495 (1975) stood that the invention includes all Such variations and modi Kojima et al., Cancer Res. 35, 542-547, 1975 fications. The invention also includes al steps, features, Kortt et al., Protein Engineering 10: 423, 1997 compositions and compounds referred to or indicated in this Kosaki et al., Cancer Res. 59, 1141-1145, 1999 specification individually or collectively, and any and all Larricket al., Bio/Technology 7: 934, 1989 combinations of any two or more steps or features. 10 Larson et al., Cytometry: 41, 203-208, 2000 Larsson et al., J. Biotechnol. 80, 143-157, 2000 BIBLIOGRAPHY Laurent and Fraser, Hval. FASEB.J. 6, 2397-2404, 1992 Laurent and Killander, J. Chromatogr. 14, pp. 317-330, 1964 Altschul et al., J. Mol. Biol. 215, 430-410, 1990 Liu et al., Proc. Natl. Acad. Sci. USA 84: 3439, 1987 Antibodies: A Laboratory Manual, Harlow and Lane (eds.), 15 Liu et al., Cancer Res... 61, 5207-5214, 2001 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Madden et al., Drug Disc. Today: 5, 415-423, 2000 N.Y., (1988) Marks et al., J. Mol. Biol. 222:581-597, 1991 Banerji et al., J. Cell Biol. 144, 789-801, 1999 Mathew and Dorfman, Physiol. Rev. 35,381-402, 1955 Bird, Science 242: 423, 1988 McKee, et al., J. Biol. Chem. 272, 8013-8018, 1997 Bourguignon et al., Biol. Chem. 272, 27913-27918, 1997 Montgomery et al., Proc. Natl. Acad. Sci, USA: 95, 15502 Brazma and Vilo, FEBS Lett.: 480, 17-24, 2000 15507, 1998 Camenisch et al., J. Clin. Invest... 106,349-360, 2000 Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855, Caulli et al., J. Cell Biochem. Suppl.: 31, 286-296, 1998 1984 Celis et al., FEBS Lett. 480, 2-16, 2000 Munder et al. (Appl. Microbiol. Biotechnol. 52(3): 311-320, Clackson et al., Nature 352:624–628, 1991 25 1999 Clarris et al. On the pericellular Zone of some mammalian Ng and Schwartz, J. Biol. Chem. 264, 11776-11783, 1989 cells in vitro. Exp Cell Res 49:181-193, 1968 Oksala et al., J. Histochem. Cytochem.: 43, 125-135, 1995 Csoka et al., The six hyaluronidase-like genes in the human Pauli and Knudson, Human Path. 19, 628-639, 1988 and mouse genomes. Matrix Biol 20: 499-508, 2001 Pezzuto et al., Eds. Chapman and Hall, New York, 1993 Culty et al., J. Cell Physiol. 160,275-286, 1994 30 Philipson and Schwartz, J. Biol. Chem.: 259, pp. 5017-5023, Elbashir et al., Nature: 411, 494-498, 2001 1984 Elbashire et al., Genes Dev. 15, 188-120, 2001 Philipson et al., Biochem. 24, 7899-7906, 1985 Entwistle et al., J. Cell. Biochem. 61,569-577, 1996 Prashar and Weissman, Meth-Enzymol. 303, 258-272, 1999 Erickson et al., Science 249: 527-533, 1990 Prehm, P and Mausolf, Biochem. J. 235, 887-889, 1986 Fire et al., Nature. 391, 806-811, 1998 35 Prehm, P. Biochem. J.: 220, pp. 597-600, 1984 Fries et al., Virchows. Archiv. 424: 7-12, 1994 Prehm P. Release of hyaluronate from eukaryotic cells. Bio Fuchs et al., Anal. Biochem. 286,91-98, 2000 chem J 267: 185-189, 1990 Going and Gusterson, Eur: J. Cancer. 35, 1895-1904, 1999 Presta, Curr. Op. Struct. Biol. 2:593-596, 1992 Gunthert et al., Cell. 65, pp. 13-24, 1991 Reichmann et al., Nature 332:323-329, 1988 Guo and Kempheus, Cell: 81, 611-620, 1995 40 Rilla et al., J. Cell Sci. 115, 3633-3643, 2002 Hodgson (Bio/Technology 9:19-21, 1991) Shyjan et al., J. Biol. Chem.: 271, pp. 23395-23399, 1996 Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879, 1988 Simpson et al., American J. Path. 161, pp. 849-857, 2002 Itano et al., Biochem. Biophys. Res. Comm. 222, 816-821, Spicer and McDonald, J. Biol. Chem.: 273, 1923-1932, 1998 1996 Spicer and Nguyen, Biochem. Soc. Trans. 27, 109-115, 1999 Itano et al., Three isoforms of mammalian hyaluronan Syn 45 Spicer et al., Genomics. 41,493-497, 1997 thases have distinct enzymatic properties. J Biol Chem Spicer et al., J. Biol. Chem. 272, 8957-8961, 1997 274; 25085-25092, 1999 Stern R, Devising a pathway for hyaluronan catabolism: are Itano et al., Cancer Res. 59, 2499-2504, 1999 we there yet? Glycobiology 13:105R-115R, 2003 Itano et al., Proc. Natl. Acad. Sci. 99,3609-3614, 2002 Sutcliffe et al., Proc. Natl. Acad. Sci. USA.: 97, 1976-1981, Johnson et al., “Peptide Turn Mimetics' in Biotechnology and 50 Pharmacy 2OOO Jones et al., Nature 321:522-525, 1986 Syet al., J. Exp. Med. 174, pp. 859-866, 1991 Jungblut et al., Electrophoresis: 20, 2100-2110, 1999 Tabara et al., Sci. 282, 430-431, 1998 Jurecic and Belmont, Curr. Opin. Microbiol. 3, 316-321, Tester et al., Clin. & Exp. Metast. O. 1-7, 2002 2OOO 55 Thompson et al., J. Cell Physiol. 150, 534-544, 1992 Kabat et al. in Sequences of Proteins of Immunological Inter Tijsterman et al., Science: 295, 694-697, 2002 est, 5th Ed., US Dept. of Health and Human Services, PHS, Timmons and Fire, Nature: 395, 854, 1998 NIH, NIH Publication No. 91-3242, 1991 Timmons et al., Gene: 263, 103-112, 2001 Kennet et al. (eds.), Monoclonal Antibodies, Hybridomas: A Tool, B., Glycosaminogloans in morphogenesis. In. Cell New Dimension in Biological Analyses, Kennet et al. 60 Biology of the extracellular matrix. (Editor. Hay, E. D.) (eds.), Plenum Press, New York (1980); and Antibodies: A Plenum Press, New York: pp. 259-294, 1981 Laboratory Manual, Harlow and Lane (eds.), Cold Spring Toole, B. P. Current Opin. in Cell Biol. 2, 839-844, 1990 Harbor Laboratory Press, Cold Spring Harbor, N.Y., Toole, B. P. J. Inter. Med. 242, 35-40, 1997 (1988). Turley and Torrance, Exp. Cell. Res. 161, 17-28, 1985 Knudson and Knudson, FASEB. 7: pp. 1233-1241, 1993 65 Tuschl et al., Genes Dev. 13,319.1-3197, 1999 Knudson and Knudson, The hyaluronan receptor, CD44. U.S. Pat. No. 4,816,567 1999 U.S. Pat. No. 4,946,778 US 7,662.929 B2 107 108 Udabage et al., Inhibition of hyaluronan degradation by dex- Weissmann and Meyer, J. Am. Chem. Soc. 76, pp. 1753, 1954 tran Sulphate facilitates characterisation of hyaluronan Wells, Methods Enzymol. 202: 2699-2705, 1991 synthesis: an in vitro and in vivo study Glycoconjugate J Winter and Harris, TIPS 14: 139, 1993 (in Press), 2004 Young et al., Nat. Biotechnol. 16(10): 946-950, 1998 Victor et al., J. Cancer. 82, 77-83, 1999 5 - ... Ward et al., Nature 334: 544, 1989 Xing et al., Oral Diseases. 4, 241-247, 1998 Watanabe and Yamaguchi, J. Biol. Chem. 271,22945-22948, Zhang and Madden, Genome Res. 7,649-656, 1997 1996 Zhang et al., Cancer Res. 55, 428-433, 1995
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 51
<21 Os SEQ ID NO 1 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for human HAS2 <4 OOs SEQUENCE: 1 gagctgaaca agatgcattg tagagc 27
<21 Os SEQ ID NO 2 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for human HAS2 <4 OOs SEQUENCE: 2 gacatggtgc titgatgitat g at citt coat 29
<21 Os SEQ ID NO 3 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Primer for PCINed
<4 OOs SEQUENCE: 3 gcacagatgc gtaaggag 18
<21 Os SEQ ID NO 4 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for GSP2 <4 OOs SEQUENCE: 4 gctgtgtaca tacct cqcg Cttgcc.gc.c 29
<21 Os SEQ ID NO 5 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for GSP4 <4 OOs SEQUENCE: 5
ggcgggaagt aaact cac 19
<21 Os SEQ ID NO 6 &211s LENGTH: 2O &212s. TYPE: DNA US 7,662.929 B2 109 110
- Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS1 <4 OOs, SEQUENCE: 6 cctgcatcag cqgtcc ticta
<210s, SEQ ID NO 7 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antiense primer for HAS1 <4 OO > SEQUENCE: 7 gccggit catc cccaaaag 18
<210s, SEQ ID NO 8 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS2 <4 OOs, SEQUENCE: 8 aacct cittgc agcagtttct tdaggcc 27
<210s, SEQ ID NO 9 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS2 <4 OOs, SEQUENCE: 9
Cagt cctggc titcgagcag 19
<210s, SEQ ID NO 10 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HAS2 <4 OOs, SEQUENCE: 10 ttgggaga aa agt ctittggc t 21
<210s, SEQ ID NO 11 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS2 <4 OOs, SEQUENCE: 11 c cattgaacc agagacittga aac agcc.c 28
<210s, SEQ ID NO 12 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS3 <4 OOs, SEQUENCE: 12 ttgcactgtg gtcgtcaact t 21 US 7,662.929 B2 111 112
- Continued
<210s, SEQ ID NO 13 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HAS3 <4 OOs, SEQUENCE: 13 gtcgaggit ca aacgttgtga g 21
<210s, SEQ ID NO 14 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS3 <4 OOs, SEQUENCE: 14 tcaaatcaaa aac aggcagg tacagg tagt gg 32
<210s, SEQ ID NO 15 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for GAPDH <4 OOs, SEQUENCE: 15 aaggtgaagg toggagt caa C 21
<210s, SEQ ID NO 16 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for GAPDH <4 OOs, SEQUENCE: 16 gagittaaaag cagccCtggit g 21
<210s, SEQ ID NO 17 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for GAPDH <4 OOs, SEQUENCE: 17 tittggit cqta ttgggcgc.ct gg 22
<210s, SEQ ID NO 18 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HYAL1 <4 OOs, SEQUENCE: 18 gcacagggaa gtcacagatg tatgtgc 27
<210s, SEQ ID NO 19 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 7,662.929 B2 113 114
- Continued <223> OTHER INFORMATION: Antisense primer for HYAL1 <4 OOs, SEQUENCE: 19 C Cactggt ca C9ttcaggat gaag 24
<210s, SEQ ID NO 2 O &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HYAL2 <4 OOs, SEQUENCE: 2O gatgtgtatic gcc.ggittatc acgc.c 25
<210s, SEQ ID NO 21 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HYAL2 <4 OOs, SEQUENCE: 21 cgtag actgg gagtgcatgg ttggc 25
<210s, SEQ ID NO 22 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HYAL3 <4 OOs, SEQUENCE: 22 gCactgatgg aggatacgct gcg 23
<210s, SEQ ID NO 23 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HYAL3 <4 OOs, SEQUENCE: 23 gctggtgact gcaggc catc gctgc 25
<210s, SEQ ID NO 24 &211s LENGTH: 21 212. TYPE: PRT <213s ORGANISM: human
<4 OOs, SEQUENCE: 24 Ala Ala Arg Gly Pro Lieu. Asp Ala Ala Thr Cys Arg Ala Lieu. Lieu. Tyr 1. 5 1O 15 Pro Arg Ala Arg Val 2O
<210s, SEQ ID NO 25 &211s LENGTH: 11 212. TYPE: PRT <213s ORGANISM: human
<4 OOs, SEQUENCE: 25 Gly Gly Lieu Val Arg Ser Val Ala His Glu Ala 1. 5 1O US 7,662.929 B2 115 116
- Continued
<210s, SEQ ID NO 26 &211s LENGTH: 17 212. TYPE: PRT <213s ORGANISM: human
<4 OOs, SEQUENCE: 26 Gly Ala Tyr Arg Glu Val Glu Ala Glu Asp Pro Gly Arg Lieu Ala Val 1. 5 1O 15
Glu
<210s, SEQ ID NO 27 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS1 <4 OOs, SEQUENCE: 27 cctgcatcag cqgtcc ticta 2O
<210s, SEQ ID NO 28 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS2 <4 OOs, SEQUENCE: 28 cagt cctggc titcgag cag 19
<210s, SEQ ID NO 29 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS3 <4 OOs, SEQUENCE: 29 ttgcactgtg gtcgtcaact t 21
<210s, SEQ ID NO 3 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer GAPDH <4 OOs, SEQUENCE: 30 alaggtgaagg toggagt caa C 21
<210s, SEQ ID NO 31 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HYAL1 <4 OOs, SEQUENCE: 31 gcacagggaa gtcacagatg tatgtgc 27
<210s, SEQ ID NO 32 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 7,662.929 B2 117 118
- Continued <223> OTHER INFORMATION: Sense primer for HYAL2 <4 OOs, SEQUENCE: 32 gatgtgtatic gcc.ggittatc acgc.c 25
<210s, SEQ ID NO 33 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HYAL3 <4 OOs, SEQUENCE: 33 gCactgatgg aggatacgct gcg 23
<210s, SEQ ID NO 34 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HAS1 <4 OOs, SEQUENCE: 34 gccggit catc cccaaaag 18
<210s, SEQ ID NO 35 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HAS2 <4 OOs, SEQUENCE: 35 ttgggaga aa agt ctittggc t 21
<210s, SEQ ID NO 36 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HAS3 <4 OOs, SEQUENCE: 36 gtcgaggit ca aacgttgtga g 21
<210s, SEQ ID NO 37 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for GAPDH <4 OO > SEQUENCE: 37 gagittaaaag cagccCtggit g 21
<210s, SEQ ID NO 38 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HYAL1 <4 OOs, SEQUENCE: 38
C Cactggt ca C9ttcaggat gaag 24 US 7,662.929 B2 119 120
- Continued <210s, SEQ ID NO 39 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HYAL2 <4 OOs, SEQUENCE: 39 cgtag actgg gagtgcatgg ttggc 25
<210s, SEQ ID NO 4 O &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HYAL3 <4 OOs, SEQUENCE: 4 O gctggtgact gcaggc catc gctgc 25
<210s, SEQ ID NO 41 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Hybridisation probe for HAS1
<4 OOs, SEQUENCE: 41 aacct cittgc agcagtttct tdaggcc 27
<210s, SEQ ID NO 42 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Hybridisation probe for HAS2 <4 OOs, SEQUENCE: 42 c cattgaacc agagacittga aac agcc.c 28
<210s, SEQ ID NO 43 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Hybridisation probe for HAS3 <4 OOs, SEQUENCE: 43 tcaaatcaaa aac aggcagg tacagg tagt gg 32
<210s, SEQ ID NO 44 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Hybridisation probe for GAPDH <4 OOs, SEQUENCE: 44 tittggit cqta ttgggcgc.ct gg 22
<210s, SEQ ID NO 45 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sense primer for HAS2 US 7,662.929 B2 121 122
- Continued <4 OOs, SEQUENCE: 45 gagdtgaaca agatgcattg tagagc 27
<210s, SEQ ID NO 46 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense primer for HAS2 <4 OOs, SEQUENCE: 46 gacatggtgc titgatgitatg atct tccat 29
<210s, SEQ ID NO 47 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer for pCL-neo <4 OOs, SEQUENCE: 47 gcacagatgc gtaaggag 18
<210s, SEQ ID NO 48 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GSP2 sense primer
<4 OOs, SEQUENCE: 48 gctgttgtaca tacct cqcg Cttgcc.gc.c 29
<210s, SEQ ID NO 49 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GSP4 sense primer
<4 OOs, SEQUENCE: 49 ggcgggaagt aaacticgac 19
<210s, SEQ ID NO 50 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Alu sense primer
<4 OOs, SEQUENCE: 50 gtgaaacccc gtc.t.ctacta aaaatacaaa 3 O
<210s, SEQ ID NO 51 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Alu antisense primer
<4 OOs, SEQUENCE: 51 gcgatctogg ct cactgcaa. US 7,662.929 B2 123 124 The invention claimed is: antibody, and antigen-binding fragment and a humanized 1. An isolated antibody which reduces the level of hyalu antibody. roman synthase (HAS) activity wherein said antibody specifi 4. The isolated antibody of claim3 wherein the antibody is cally binds targeted antigen of SEQID NO: 25 within HAS1. a monoclonal antibody or an antigen-binding fragment 2. The isolated antibody of claim 1 wherein the HAS activ 5 thereof. ity is selected from the group consisting of HAS1, HAS2 and 5. A pharmaceutical composition comprising an antibody HAS3 activity. of claim 1 and one or more pharmaceutically acceptable 3. The isolated antibody of claim 1 or 2 wherein the anti carriers and/or diluents. body is selected form a monoclonal antibody, polyclonal k k k k k