1 Na+ Influx Via Orai1 Inhibits Intracellular ATP Induced Mtorc2 Signaling To

1 Na+ Influx via Orai1 Inhibits Intracellular ATP Induced mTORC2 Signaling to

2 Disrupt CD4 T Cell Gene Expression and Differentiation

4 Yong Miao, Jaya Bhushan, Adish Dani and Monika Vig*

5 Department of Pathology and Immunology

6 Washington University School of Medicine, St. Louis MO 63110, USA

7 *Correspondence to: [email protected]

1 23 Abstract: T cell effector functions require sustained calcium influx. However, the

24 signaling and phenotypic consequences of non-specific sodium permeation via calcium

25 channels remain unknown. α-SNAP is a crucial component of Orai1 channels, and its

26 depletion disrupts the functional assembly of Orai1 multimers. Here we show that α-

27 SNAP hypomorph, hydrocephalos with hopping gait, Napahyh/hyh mice harbor significant

28 defects in CD4 T cell gene expression and Foxp3 regulatory T cell (Treg) differentiation.

29 Mechanistically, TCR stimulation induced rapid sodium influx in Napahyh/hyh CD4 T cells,

30 which reduced intracellular ATP, [ATP]i. Depletion of [ATP]i inhibited mTORC2

31 dependent NFκB activation in Napahyh/hyh cells but ablation of Orai1 restored it.

32 Remarkably, TCR stimulation in the presence of monensin phenocopied the defects in

33 Napahyh/hyh signaling and Treg differentiation, but not IL-2 expression. Thus, non-specific

34 sodium influx via bonafide calcium channels disrupts unexpected signaling nodes and

35 may provide mechanistic insights into some divergent phenotypes associated with Orai1

36 function.

2 46 Introduction:

47 A sustained rise in cytosolic calcium levels is necessary for nuclear translocation

48 of calcium dependent transcription factors such as nuclear factor of activated T cell

49 (NFAT) (Crabtree, 1999, Parekh and Putney, 2005, Winslow et al., 2003, Macian, 2005,

50 Vig and Kinet, 2009, Vig and Kinet, 2007, Crabtree, 2001). NFAT proteins are essential

51 for the development of several tissues but have been found to be dispensable for thymic

52 development and function of Foxp3 regulatory T cells (Tregs) (Crabtree and Olson,

53 2002, Crabtree, 2001, Crabtree, 1999, Timmerman et al., 1997, Vaeth et al., 2012). The

54 role of proteins directly involved in sustained calcium influx, however, remains less well

55 established. Specifically, genetic ablation of ORAI1, the pore forming subunit of calcium

56 release activated calcium (CRAC) channels (Vig et al., 2006b, Vig et al., 2006a, Peinelt

57 et al., 2006), partially inhibits T cell effector cytokines in mice and does not affect Foxp3

58 Treg development (Vig et al., 2008, Vig and Kinet, 2009, Gwack et al., 2008, McCarl et

59 al., 2010). The role of ORAI2 as well as ORAI3, the two closely related homologs of

60 ORAI1 that are highly expressed in mouse T cells remains unestablished in mice and

61 humans although all ORAIs are capable of reconstituting CRAC currents in vitro (Mercer

62 et al., 2006, Lis et al., 2007, DeHaven et al., 2007).

63 STIM1 and STIM2, the ER resident calcium sensor proteins, are required for ER

64 calcium release and Orai1 activation and T lymphocyte effector functions (Oh-Hora et

65 al., 2008). However, ablation of STIMs, but not ORAIs, affects thymic development of

66 Tregs (Oh-Hora et al., 2013, McCarl et al., 2010) and ablation of STIMs, but not ORAI1,

67 resulting in multi-organ autoimmunity in mice and humans (Oh-Hora et al., 2008, McCarl

68 et al., 2010, Picard et al., 2009). Because STIMs perform several additional functions

3 69 such as regulation of calcium selectivity of ORAI1 channels (McNally et al., 2012) as

70 well as inhibition of voltage gated calcium channel Cav1.2 (Wang et al., 2010, Park et

71 al., 2010), role of sustained calcium influx or store-operated calcium entry (SOCE) in the

72 development of Tregs and autoimmunity remains correlative (Oh-Hora et al., 2008, Oh-

73 Hora et al., 2013). Likewise, the phenotypes of human patients harboring different Stim

74 and Orai mutations range from immunodeficiency to autoimmunity and cancer. Despite

75 this diversity, all phenotypes are currently correlated with reduced SOCE (Picard et al.,

76 2009).

77 We have previously shown that α-soluble NSF-attachment protein (α-SNAP), a

78 cytosolic protein traditionally studied in the context of soluble NSF attachment protein

79 receptor (SNARE) complex disassembly and membrane trafficking (Clary et al., 1990),

80 directly binds Stim1 and Orai1 and is necessary for the functional assembly and ion

81 specificity of multimeric Orai1 channels (Miao et al., 2013, Li et al., 2016). In addition, α-

82 SNAP has been implicated in AMP kinase (AMPK) inhibition and zippering of SNAREs

83 in vitro (Park et al., 2014, Baur et al., 2007, Wang and Brautigan, 2013). SNAREs play a

84 direct role in exocytosis and are therefore required for cytotoxic T, natural killer and

85 mast cell degranulation (Baram et al., 2001, Puri et al., 2003, Hepp et al., 2005, Suzuki

86 and Verma, 2008). However, the role of α-SNAP is less clear in vivo, and remains

87 unexplored in the immune system. α-SNAP deletion is embryonic lethal in mice and a

88 hypomorphic missense mutation in α-SNAP, hydrocephalous with hopping gait,

89 (Napahyh/hyh) has been previously reported to cause neuro-developmental defects

90 (Bronson and Lane, 1990, Chae et al., 2004, Hong et al., 2004).

91 Here we show that reduced expression of α-SNAP causes unexpected defects in

4 92 CD4 T cell signaling, gene expression and Foxp3 Treg differentiation. Using RNAi

93 mediated ablation of Orai1 in Napahyh/hyh CD4 T cells and monensin treatment of

94 wildtype CD4 T cells, we demonstrate that Orai1 mediated sodium influx, but not

hyh/hyh 95 reduced SOCE, depletes [ATP]i in T cell receptor (TCR) stimulated Napa CD4 T

96 cells. Furthermore, we find that depletion of [ATP]i levels disrupts mTORC2 activation

97 which, in turn, inhibits NFκB activation and in vivo as well as in vitro differentiation of

98 Foxp3 Tregs in Napahyh/hyh mice. Therefore, analysis of α-SNAP deficient mice reveals

99 that non-specific sodium permeation via Orai1 disrupts a novel signaling node and could

100 provide alternate mechanistic insights into the diversity of phenotypes observed in Stim

101 and Orai mutant human patients.

102

103

104

105

106

107

108

109

110

5 111 Results:

112 Napahyh/hyh mice harbor severe defects in the production of CD4 T cell

113 effector cytokines

114 Mice bearing Napahyh/hyh mutation on a mixed background have been

115 characterized previously in the context of neurodevelopmental disorders (Bronson and

116 Lane, 1990, Chae et al., 2004, Hong et al., 2004). We backcrossed Napahyh/hyh mice on

117 to C57BL/6 background and found that homozygous mutant Napahyh/hyh mice were

118 significantly smaller in size and died perinatally, within 2-3 weeks. To overcome the

119 issue of perinatal lethality, we generated fetal liver chimeras using irradiated CD45.1+

120 congenic recipients reconstituted with CD45.2+ wildtype or Napahyh/hyh E15.5 embryos.

121 We analyzed fetal liver chimeras at 8-12 week post-transfer and found that the

122 reconstitution efficiency and total thymic (Figure 1A) and spleen cell numbers (Figure

123 1B) were comparable in wildtype (WT) and Napahyh/hyh chimeras. Relative abundance of

124 CD4 and CD8 T cells in the thymus (Figure 1C) and spleen (Figure 1D) was also normal

125 in Napahyh/hyh fetal liver chimeras. Therefore, we performed all the subsequent analysis

126 of wildtype and Napahyh/hyh CD4 T cells and Foxp3 Tregs using fetal liver chimeras,

127 unless otherwise specified.

128 α-SNAP null mice are embryonic lethal and, in accordance with previous reports,

129 Napahyh/hyh CD4 T cells showed ~40% depletion of α-SNAP levels (Figure 1E). Given

130 the role of α-SNAP in SNARE recycling (Clary et al., 1990), we first compared the levels

131 of cell surface receptors. Surprisingly, surface expression TCR and co-receptors was

132 found to be normal in Napahyh/hyh peripheral CD4 T cells (Figure 1F). Resting Napahyh/hyh

6 133 T lymphocytes showed largely normal surface expression of CD25, CD44 and CD69

134 and their up-regulation following receptor mediated stimulation was comparable to WT

135 (Figure 1G).

136 CRAC channel components, Orai1 and Stim1 are necessary for optimal

137 production and secretion of several T cell effector cytokines (Vig et al., 2008, Vig and

138 Kinet, 2009, Gwack et al., 2008, Oh-Hora et al., 2008). However, given a partial

139 depletion of α-SNAP in Napahyh/hyh mice, we first sought to determine whether

140 Napahyh/hyh CD4 T cells showed defects in the production of effector cytokines.

141 Surprisingly, we found significant defects in IL-2 (Figure 1H, 1J) and TNF-α production

142 by TCR stimulated Napahyh/hyh CD4 T cells (Figure 1I, 1J). Napahyh/hyh CD4 T cells

143 cultured under T helper 1 (Th1) polarizing conditions showed a minor defect in IFN-γ

144 production (Figure 1K & 1M), however, we observed a robust defect in IL-4 expression

145 in Th2 polarized Napahyh/hyh CD4 T cells (Figure 1L & 1M). Intracellular levels of T-bet or

146 Gata-3 did not appear to be significantly altered in Napahyh/hyh mice (Figure 1, figure

147 supplement 1). Furthermore, Napahyh/hyh CD4 T cells (Figure 1N-1O) and splenocytes

148 (Figure 1P) showed a partial defect in anti-CD3 induced proliferation. Taken together,

149 these data demonstrate that Napahyh/hyh CD4 T lymphocytes harbor a significant defect

150 in the production of several key effector cytokines, while exhibiting normal levels of cell

151 surface receptors.

152

153 Napahyh/hyh mice harbor significant defects in the differentiation of Foxp3

154 regulatory T cells in vivo and in vitro

7 155 Stim1-/-Stim2-/- mice (Oh-Hora et al., 2013), but neither Orai1-/- (McCarl et al.,

156 2010) nor Nfatc1-/-Nfatc2-/- mice (Vaeth et al., 2012), harbor defects in the

157 development of thymic Foxp3 regulatory T cells (Tregs). Interestingly, analysis of

158 Napahyh/hyh fetal liver chimeras of 8-12 weeks showed lower percentage (Figure 2A) as

159 well as total number (Figure 2, figure supplement 1) of thymic Foxp3 Tregs when

160 compared to WT. Mixed fetal liver chimeras of WT and Napahyh/hyh showed further

161 reduced percentages of Napahyh/hyh Foxp3 Tregs in the thymus (Figure 2B) as well as

162 peripheral lymphoid tissues (Figure 2C) and Napahyh/hyh Foxp3 Tregs consistently

163 showed lower surface expression of CD44 (Figure 2D) and GITR (Figure 2E). These

164 data suggest additional potential defects in the homing (Luo et al., 2016) and in vivo

165 expansion of Foxp3 Tregs (Ronchetti et al., 2015, Ephrem et al., 2013, Liao et al.,

166 2010). Indeed, lamina propria of Napahyh/hyh chimeras showed further reduced numbers

167 of Foxp3 Tregs (Figure 2F). Interestingly, in vitro differentiation of Napahyh/hyh CD4 T

168 cells also yielded lower percentage (Figure 2G) and number (Figure 2, figure

169 supplement 2) of Foxp3 iTregs. Taken together, these data demonstrate a crucial role

170 for α-SNAP in Foxp3+ Treg differentiation in vivo as well as in vitro.

171

172 Orai1 mediated sodium influx inhibits Foxp3+ iTreg differentiation by

173 disrupting NFκB activation in Napahyh/hyh CD4 T cells

174 We have previously shown that α-SNAP is an integral component of the CRAC

175 channel complex, where it facilitates the functional assembly as well as ion selectivity of

176 Orai1 multimers via specific molecular interactions (Li et al., 2016). Because Orai1-/-

8 177 mice do not show a defect in Foxp3 regulatory T cell development (Vig et al., 2008, Vig

178 and Kinet, 2009, Gwack et al., 2008, McCarl et al., 2010), we hypothesized that non-

179 specific sodium permeation via Orai1 could lead to reduced generation of thymic and

180 iTregs in Napahyh/hyh mice.

181 In agreement with our previous findings (Miao et al., 2013), stimulation of

182 Napahyh/hyh CD4 T cells via TCR (Figure 3A, 3B) or Thapsigargin (TG) (Figure 3C)

183 induced lower SOCE. More strikingly though, Napahyh/hyh, but not wildtype CD4 T cells,

184 showed rapid and significant sodium entry in response to TCR as well as TG stimulation

185 (Figure 3D, 3E). Interestingly, RNAi mediated depletion of Orai1 in Napahyh/hyh cells

186 abolished sodium influx, demonstrating that sodium enters via Orai1 in TCR stimulated

187 Napahyh/hyh CD4 T cells (Figure 3F). Furthermore, replacement of extracellular sodium

188 with a membrane impermeable organic monovalent cation, N-methyl-D-glucamine

189 (NMDG) abolished fluorescence shift of the sodium dye, SBFI (Figure 3F), establishing

190 its specificity for sodium and the direction of sodium flux in receptor stimulated CD4 T

191 cells. Of note, treatment of wildtype CD4 T cells with monensin, a non-specific sodium

192 ionophore, induced similar levels of sodium influx (Figure 3G) when compared to

193 Napahyh/hyh CD4 T cells.

194 In agreement with reduced SOCE, we observed that nuclear translocation of

195 NFAT was defective in Napahyh/hyh CD4 T cells (Figure 3H). However, nuclear

196 translocation of NFκB p65 and c-Rel transcription factors was also severely inhibited in

197 TCR stimulated Napahyh/hyh CD4 T cells (Figure 3H, 3I), although we observed no

198 significant defect in T cell receptor-proximal signaling events or MAPK activation (Figure

199 3J, 3K). TCR proximal signaling requires an interplay of several cell surface receptors,

9 200 co-receptors and membrane proximal kinases, thus further reinforcing our observations

201 that membrane receptor signaling events remain unperturbed in Napahyh/hyh T cells.

202 To determine whether defects in NFκB translocation were due to reduced SOCE

203 versus non-selective sodium influx, we first depleted Orai1 expression in CD4 T cells

204 using RNAi. Orai1 depletion lead to reduced SOCE (Figure 3L) and nuclear

205 translocation of NFAT (Figure 3M). However, NFκB activation (Figure 3N) and iTreg

206 differentiation (Figure 3O) were normal in Orai1 depleted CD4 T cells. On the other

207 hand, stimulation of wildtype CD4 T cells in the presence of monensin did not affect IL-2

208 expression (Figure 3P) or NFAT activation (Figure 3Q), but inhibited NFκB activation

209 (Figure 3R) and iTreg differentiation (Figure 3S). Taken together, these data show that

210 TCR induced non-selective sodium influx via Orai1 inhibits NFκB activation to restrict

211 Foxp3 T cell development in Napahyh/hyh mice.

hyh/hyh 212 TCR induced non-specific sodium influx depletes [ATP]i in Napa CD4

213 T cells

214 Next, by examining additional signaling events in TCR stimulated Napahyh/hyh

215 CD4 T cells, we sought to understand the molecular basis by which NFκB activation is

216 defective. The sodium potassium ATPase (Na K ATPase) maintains resting membrane

217 potential by pumping out intracellular sodium using ATP hydrolysis. The Na K ATPase

218 can consume ~30-40% of cellular ATP at any given time in resting cells (Torres-Flores

219 et al., 2011), hence we reasoned that TCR induced abnormal sodium entry could cause

220 an acute metabolic burden in Napahyh/hyh cells. Therefore, we measured the change in

221 [ATP]i levels in resting and TCR stimulated CD4 T cells at different time points post

10 222 stimulation. Interestingly, wildtype CD4 T cells showed a rapid and significant rise in

hyh/hyh 223 [ATP]i upon TCR ligation (Figure 4A). Napa CD4 T cells not only failed to show this

224 increase but instead showed ~25% drop in [ATP]i (Figure 4A) that was sustained for at

225 least 6 hours post-stimulation.

226 To determine whether the defect in [ATP]i rise was due to sodium influx, we

227 exchanged extracellular sodium with NMDG, and found that the [ATP]i rise was largely

228 restored in Napahyh/hyh T cells (Figure 4A). Stimulation of wildtype CD4 T cells in the

229 presence of monensin also depleted [ATP]i levels (Figure 4B) and RNAi mediated

hyh/hyh 230 depletion of Orai1 in Napa CD4 T cells largely restored the [ATP]i depletion (Figure

231 4C).

232 Naïve CD4 T cells depend on Oxidative Phosphorylation to generate [ATP]i. To

233 determine whether the mitochondrial number and function were normal in Napahyh/hyh

234 CD4 T cells, we stained Napahyh/hyh CD4 T cells with MitoTracker green and found that

235 their mitochondrial content was normal (Figure 4D). Oxygen consumption rate (OCR),

236 extracellular acidification rate (ECAR) and the respiratory capacities of naïve (Figure

237 4E, 4F), receptor stimulated (Figure 4G, 4H) and TH0 differentiated (Figure 4I, 4J)

238 Napahyh/hyh CD4 T cells were also largely comparable to wildtype T cells. Taken

239 together, these data demonstrate that non-specific sodium influx, but not compromised

hyh/hyh 240 mitochondrial health, underlies depletion of [ATP]i in receptor stimulated Napa

241 CD4 T cells.

hyh/hyh 242 Depletion of [ATP]i inhibits mTORC2 activation in Napa CD4 T cells

243 Extracellular ATP [ATP]e has been extensively studied in the context of T cell

11 244 activation (Schenk et al., 2008, Ledderose et al., 2014) autoimmunity and graft versus

245 host disease (Atarashi et al., 2008, Wilhelm et al., 2010) but the physiological

246 significance of TCR induced acute rise in [ATP]i remains unknown. We hypothesized

247 that although dispensable for TCR proximal signaling (Figure 3J, 3K), TCR induced

248 [ATP]i rise could be necessary to support the relatively distal signaling events following

249 TCR activation. Recently, mTORC2 has emerged as a crucial, but complex, player in T

250 cell differentiation (Chi, 2012). mTORC2 can sense a variety of upstream signals and

251 according to one report, directly senses ATP and phosphorylates AKT Thr450 in vitro

252 (Chen et al., 2013). The upstream activator of mTORC2 in CD4 T cells, however,

253 remains unestablished (Masui et al., 2014, Navarro and Cantrell, 2014). Therefore, we

254 assessed the phosphorylation of AKT Ser473, a well-established mTORC2 target in

255 TCR stimulated Napahyh/hyh CD4 T cells. Napahyh/hyh CD4 T cells showed significantly

256 reduced phosphorylation of AKT Ser473 (Figure 5A), but not Thr308 (Figure 5B), the

257 mTORC1 target site. Furthermore, TCR stimulation of wildtype CD4 T cells in the

258 presence of monensin also blocked AKT Ser473 phosphorylation (Figure 5C) but not

259 Thr308 (Figure 5D). In accordance with these observations, phosphorylation of

260 mTORC1 substrate, 4E-BP1 was normal in Napahyh/hyh CD4 T cells (Figure 5E).

261 Remarkably, Orai1 depletion in Napahyh/hyh CD4 T cells restored AKT Ser473

262 phosphorylation (Figure 5F). Importantly, the levels of mTORC2 complex proteins were

263 largely comparable in WT and Napahyh/hyh CD4 T cell WCLs (Figure 5G). These data

264 demonstrate that Orai1 mediated sodium influx and the consequent drop in [ATP]i

265 disrupts TCR induced mTORC2 activation.

266

12 267 mTORC2 regulates NFκB activation via multiple signaling intermediates in

268 Napahyh/hyh CD4 T cells

269 mTORC2 has been shown to regulate NFκB activation via many different

270 signaling intermediates including AGC kinase, AKT (Masui et al., 2014), PKC-θ or IκB-α

271 (Lee et al., 2010, Tanaka et al., 2011). Indeed, in addition to AKT Ser473 (Figure 5A),

272 phosphorylation of PKC-θ (Figure 6A), IKK-β (Figure 6B) and IκB-α (Figure 6C) was

273 also reduced in TCR stimulated Napahyh/hyh CD4 T cells. Of note, similar to AKT Ser473

274 (Figure 5F), IκB-α phosphorylation was restored in Napahyh/hyh CD4 T cells upon

275 ablation of Orai1 (Figure 6D). Given that monensin has also been reported to inhibit

276 NFκB activation (Deng et al., 2015), our data demonstrate that defective mTORC2

277 signaling results in the inhibition of nuclear translocation of NFκB in Napahyh/hyh CD4 T

278 cells.

279 c-rel-/- mice harbor a significant defect in the development as well as function of

280 Foxp3 T cells (Isomura et al., 2009, Ruan et al., 2009, Long et al., 2009). Paradoxically,

281 ablation of mTORC2 complex proteins enhances Foxp3 T cell development (Delgoffe et

282 al., 2009) (Lee et al., 2010). Indeed, despite a strong defect in c-Rel and NFκB p65

283 activation, we observed only a partial decrease in Napahyh/hyh Foxp3 T cell development

284 in vivo and well as in vitro (Figure 2). To resolve this conundrum, we explored other

285 known targets of mTORC2 and found that the nuclear export of FOXO-1 was also

286 partially inhibited (Figure 6E). FOXO-1 is necessary for Foxp3 Treg development

287 (Kerdiles et al., 2010). However, its inactivation was recently shown to be required for

288 the activation and tumor infiltration of Foxp3 Tregs in vivo (Luo et al., 2016). In

13 289 agreement with those findings, reduced export of FOXO-1 may partially restore Foxp3

290 expression in Napahyh/hyh iTregs, but inhibit their activation or expansion in vivo.

291

292 TCR stimulated Napahyh/hyh CD4 T cells show significantly altered gene

293 expression

294 To analyze the cumulative effect of a concomitant defect in the activation of NFAT,

295 NFκB and nuclear export of FOXO-1 on gene expression, we performed RNA

296 sequencing on TCR stimulated wildtype and Napahyh/hyh CD4 T cells (Figure 6F, 6G).

297 Principal component analysis (PCA) on Napahyh/hyh and WT samples showed that gene

298 expression from Napahyh/hyh replicates were highly correlated between themselves and

299 clustered distinctly from wildtype samples (Figure 6F). ~500 genes from TCR receptor

300 stimulated Napahyh/hyh CD4 T cells were up or downregulated by >2 fold compared to

301 their expression in WT cells. The list of differentially expressed genes can be found at

302 (http://datadryad.org/review?doi=doi:10.5061/dryad.202fn).

303

304 A scatter plot of these gene expression values from Napahyh/hyh and WT samples

305 is shown in Figure 6G and the average fold change in the expression of a few

306 representative targets of NFκB, NFAT and FOXO-1 are shown in Figure 6H. We

307 grouped the differentially expressed genes into pathways using a pathway analysis

308 software. The non-redundant pathways with at least 10% representation of total genes

309 were considered significantly disrupted and top 50 of those are listed in (Figure 6-

310 source data 1). Thus, receptor induced non-specific sodium influx disrupts a novel

14 hyh/hyh 311 [ATP]i → mTORC2 signaling node in Napa CD4 T cells, contributing to wide-

312 spread and severe defects in CD4 T cell gene expression, effector cytokine production

313 and Foxp3 regulatory T cell development. To our knowledge, an early rise in [ATP]i

314 levels upon TCR stimulation, its sensitivity to sodium permeation and its direct role in

315 the activation of mTORC2 signaling node have not been reported previously.

316

317 Ectopic expression of α-SNAP can restore defects in Napahyh/hyh CD4 T cell

318 effector cytokine production

319 Previous characterization of developmental defects in the neuroepithelium of

320 Napahyh/hyh mice have suggested that the M105I mutation causes lower levels of α-

321 SNAP due to mRNA instability, without altering α-SNAP function (Chae et al., 2004).

322 Indeed, similar to Napahyh/hyh CD4 T cells, RNAi mediated reduction of α-SNAP

323 expression inhibited SOCE (Figure 7A) and the expression of key effector cytokines

324 (Figure 7B) in primary CD4 T cells. Yet, some recent studies have reported that purified

325 M105I α-SNAP protein displays altered function in vitro (Rodriguez et al., 2011, Park et

326 al., 2014). Therefore, we wondered whether protein intrinsic functional defects in M105I

327 α-SNAP contribute to Napahyh/hyh immunodeficiency. To test this, we reconstituted

328 Napahyh/hyh CD4 T cells with WT or M105I α-SNAP. Both WT as well as M105I mutant α-

329 SNAP fully restored intracellular IL-2 production (Figure 7C) as well as SOCE (Figure

330 7D) in Napahyh/hyh T cells. Consistent with these data, purified M105I α-SNAP protein

331 bound to Stim1 and Orai1 as efficiently as WT α-SNAP in in vitro pull down assays

332 (Figure 7E). Further, ectopic expression of M105I α-SNAP in HEK 293 cells revealed its

333 cytosolic localization in resting cells (Figure 7F) as well as co-clustering with Stim1 in

15 334 ER-PM junctions of store-depleted cells (Figure 7G), identical to WT α-SNAP

335 localization patterns observed previously (Miao et al 2013). Taken together, these data

336 show that M105I α-SNAP is functionally similar to WT α-SNAP in its ability to support

337 SOCE and CD4 T cell gene expression.

338 Figure 8 summarizes the signaling nodes affected by TCR induced non-specific

339 sodium influx in α-SNAP deficient, Napahyh/hyh CD4 T cells contributing to severely

340 altered gene expression, reduced production of CD4 T cell effector cytokines and Foxp3

341 Treg development.

342

343

344

345

346

347

348

349

350

351

16 352 Discussion:

353 We have shown that TCR induced, Orai1 mediated sodium influx disrupts a novel

354 ATP dependent signaling cascade and the development of Foxp3 regulatory T cells.

355 High extracellular sodium has been previously shown to upregulate T helper 17

356 differentiation (Wu et al., 2013, Kleinewietfeld et al., 2013). However, to our knowledge,

357 signaling and phenotypic defects resulting from TCR induced non-specific sodium influx

358 via a well characterized calcium channel have not been explored previously. Given that

359 deletion or functional ablation of Orai1 inhibits a linear signaling pathway culminating in

360 NFAT activation (Feske et al., 2006), Napahyh/hyh mice would be an excellent model for

361 further analyses of in vivo phenotypes resulting from permeation and ion selectivity

362 defects in CRAC channels of mice and humans.

363 Our findings may also provide mechanistic insights into the previous

364 association of elevated expression of α-SNAP with some aggressive forms of

365 colorectal cancer (Grabowski et al., 2002). Likewise, monensin mediated inhibition of

366 Foxp3 iTreg development could, in part, explain the mechanisms underlying its effective

367 re-purposing in the treatment of several different types of cancers (Deng et al., 2015)

368 (Tumova et al., 2014).

369 Na K ATPase is ubiquitously expressed and during periods of heightened cellular

370 activity, such as action potentials in neurons, Na K ATPase is estimated to consume >

371 70% of [ATP]i. ATP hydrolysis is therefore used as a reliable readout for Na K ATPase

372 activity in vitro (Weigand et al., 2012). Indeed, sodium influx in TCR stimulated

hyh/hyh 373 Napa CD4 T cells correlated well with [ATP]i levels in our study and no additional

17 374 defects were observed in the mitochondrial content or morphology (Li et al., 2016).

375 Therefore, it is reasonable to conclude that depletion of [ATP]i resulted from increased

376 Na K ATPase activity in receptor stimulated Napahyh/hyh CD4 T cells. Because Orai1

377 ablation prevented sodium influx, [ATP]i depletion and reversed mTORC2 signaling

378 defects in Napahyh/hyh CD4 T cells, these data conclusively demonstrate that sodium

379 permeation via Orai1 depleted [ATP]i.

380 Following antigen receptor stimulation, surplus [ATP]i has been shown to get

381 exported from T cells and bind P2X receptors to sustain calcium influx in an autocrine

382 manner (Schenk et al., 2008, Yip et al., 2009). Thus, a decrease in [ATP]i could further

383 compound the defect in sustained calcium flux and NFAT activation in Napahyh/hyh CD4

384 T cells.

385 Genetic ablation of individual components of mTORC2 complex has

386 demonstrated its important role in CD4 T cell homeostasis and helper T cell and Foxp3

387 Treg differentiation (Gamper and Powell, 2012, Chapman and Chi, 2014, Masui et al.,

388 2014, Delgoffe et al., 2009, Navarro and Cantrell, 2014). However, because the

389 upstream activator of mTORC2 is unestablished in T cells (Navarro and Cantrell, 2014,

390 Masui et al., 2014), its role could be more complex and context dependent in vivo.

391 Adding to this complexity, mTORC2 regulates a variety of downstream targets (Laplante

392 and Sabatini, 2009, Laplante and Sabatini, 2012). For instance, mTORC2→NF-κB

393 signaling is involved in cancer progression downstream of EGFR (Tanaka et al., 2011).

394 Intriguingly, while mTORC2 inhibits Foxp3 Treg differentiation (Delgoffe et al., 2009),

395 NFκB has been shown to be necessary for Treg development and function (Isomura et

18 396 al., 2009, Ruan et al., 2009, Long et al., 2009). Likewise, FOXO-1 has a dual role in

397 Treg development versus activation (Kerdiles et al., 2010, Luo et al., 2016). While its

398 ablation inhibits Foxp3 Treg development, it inactivation is necessary for Treg

399 activation, homing and tumor infiltration (Kerdiles et al., 2010, Luo et al., 2016).

400 Future analyses of Napahyh/hyh mice would therefore provide a good model to

401 understand the consequences of simultaneous inhibition of NFAT and mTORC2

402 dependent signaling pathways on CD4 T cell homeostasis, differentiation and function

403 in specific physiological and disease contexts in vivo.

404 It is intriguing that membrane trafficking of TCR and co-receptors was completely

405 normal in Napahyh/hyh CD4 T cells. This result can be explained by considering a

406 competitive binding model for the interactions of α-SNAP with membrane trafficking

407 proteins and the Orai-Stim complex. A significant fraction of α-SNAP has been shown to

408 be sequestered by its binding to monomeric syntaxins in resting cells (Batiz et al., 2009,

409 Rodriguez et al., 2011). Furthermore, we have found that the affinity of α-SNAP for

410 SNAREs is significantly higher when compared to its affinity for Stim1 and Orai1

411 (Bhojappa et al. unpublished findings). Higher affinity and constitutive association of α-

412 SNAP with SNAREs could explain the relatively intact membrane trafficking of proteins

413 in Napahyh/hyh CD4 T cells which harbor only a partial depletion of α-SNAP levels when

414 compared to more robust defects in supporting CRAC channel function. (Bronson and

415 Lane, 1990, Chae et al., 2004, Hong et al., 2004).

416 In summary, we have identified a novel [ATP]i → mTORC2 dependent signaling

417 axis, demonstrated its requirement for CD4 and Foxp3 regulatory T cell differentiation

19 418 and established its sensitivity to non-specific sodium influx via Orai1.

419

420

421

422

423

424

425

426

427

428

429

430

431

432

433

434

20 435 References:

436 ATARASHI, K., NISHIMURA, J., SHIMA, T., UMESAKI, Y., YAMAMOTO, M., ONOUE, M., YAGITA, 437 H., ISHII, N., EVANS, R., HONDA, K. & TAKEDA, K. 2008. ATP drives lamina propria T(H)17 438 cell differentiation. Nature, 455, 808-12. 439 BARAM, D. S.-E., R, MEKORI, Y. A. & SAGI-EISENBERG, R. 2001. Synaptotagmin regulates mast 440 cell functions. Immunol Rev, 179, 25-34. 441 BATIZ, L. F., DE BLAS, G. A., MICHAUT, M. A., RAMIREZ, A. R., RODRIGUEZ, F., RATTO, M. H., 442 OLIVER, C., TOMES, C. N., RODRIGUEZ, E. M. & MAYORGA, L. S. 2009. Sperm from hyh 443 mice carrying a point mutation in alphaSNAP have a defect in acrosome reaction. PloS 444 one, 4, e4963. 445 BAUR, T., RAMADAN, K., SCHLUNDT, A., KARTENBECK, J. & MEYER, H. H. 2007. NSF- and SNARE- 446 mediated membrane fusion is required for nuclear envelope formation and completion 447 of nuclear pore complex assembly in Xenopus laevis egg extracts. J Cell Sci, 120, 2895- 448 903. 449 BRONSON, R. T. & LANE, P. W. 1990. Hydrocephalus with hop gait (hyh): a new mutation on 450 chromosome 7 in the mouse. Brain research. Developmental brain research, 54, 131-6. 451 CHAE, T. H., KIM, S., MARZ, K. E., HANSON, P. I. & WALSH, C. A. 2004. The hyh mutation 452 uncovers roles for alpha Snap in apical protein localization and control of neural cell 453 fate. Nature genetics, 36, 264-70. 454 CHAPMAN, N. M. & CHI, H. 2014. mTOR signaling, Tregs and immune modulation. 455 Immunotherapy, 6, 1295-311. 456 CHEN, C. H., KIYAN, V., ZHYLKIBAYEV, A. A., KAZYKEN, D., BULGAKOVA, O., PAGE, K. E., 457 BERSIMBAEV, R. I., SPOONER, E. & SARBASSOV DOS, D. 2013. Autoregulation of the 458 mechanistic target of rapamycin (mTOR) complex 2 integrity is controlled by an ATP- 459 dependent mechanism. J Biol Chem, 288, 27019-30. 460 CHI, H. 2012. Regulation and function of mTOR signalling in T cell fate decisions. Nat Rev 461 Immunol, 12, 325-38. 462 CLARY, D. O., GRIFF, I. C. & ROTHMAN, J. E. 1990. SNAPs, a family of NSF attachment proteins 463 involved in intracellular membrane fusion in animals and yeast. Cell, 61, 709-21. 464 CRABTREE, G. R. 1999. Generic signals and specific outcomes: signaling through Ca2+, 465 calcineurin, and NF-AT. Cell, 96, 611-4. 466 CRABTREE, G. R. 2001. Calcium, calcineurin, and the control of transcription. J Biol Chem, 276, 467 2313-6. 468 CRABTREE, G. R. & OLSON, E. N. 2002. NFAT signaling: choreographing the social lives of cells. 469 Cell, 109 Suppl, S67-79. 470 DEHAVEN, W. I., SMYTH, J. T., BOYLES, R. R. & PUTNEY, J. W., JR. 2007. Calcium inhibition and 471 calcium potentiation of Orai1, Orai2, and Orai3 calcium release-activated calcium 472 channels. J Biol Chem, 282, 17548-56. 473 DELGOFFE, G. M., KOLE, T. P., ZHENG, Y., ZAREK, P. E., MATTHEWS, K. L., XIAO, B., WORLEY, P. 474 F., KOZMA, S. C. & POWELL, J. D. 2009. The mTOR kinase differentially regulates effector 475 and regulatory T cell lineage commitment. Immunity, 30, 832-44.

21 476 DENG, Y., ZHANG, J., WANG, Z., YAN, Z., QIAO, M., YE, J., WEI, Q., WANG, J., WANG, X., ZHAO, 477 L., LU, S., TANG, S., MOHAMMED, M. K., LIU, H., FAN, J., ZHANG, F., ZOU, Y., LIAO, J., QI, 478 H., HAYDON, R. C., LUU, H. H., HE, T. C. & TANG, L. 2015. Antibiotic monensin synergizes 479 with EGFR inhibitors and oxaliplatin to suppress the proliferation of human ovarian 480 cancer cells. Sci Rep, 5, 17523. 481 DONOSO, P., MILL, J. G., O'NEILL, S. C. & EISNER, D. A. 1992. Fluorescence measurements of 482 cytoplasmic and mitochondrial sodium concentration in rat ventricular myocytes. J 483 Physiol, 448, 493-509. 484 EPHREM, A., EPSTEIN, A. L., STEPHENS, G. L., THORNTON, A. M., GLASS, D. & SHEVACH, E. M. 485 2013. Modulation of Treg cells/T effector function by GITR signaling is context- 486 dependent. Eur J Immunol, 43, 2421-9. 487 FESKE, S., GWACK, Y., PRAKRIYA, M., SRIKANTH, S., PUPPEL, S. H., TANASA, B., HOGAN, P. G., 488 LEWIS, R. S., DALY, M. & RAO, A. 2006. A mutation in Orai1 causes immune deficiency by 489 abrogating CRAC channel function. Nature, 441, 179-85. 490 GAMPER, C. J. & POWELL, J. D. 2012. All PI3Kinase signaling is not mTOR: dissecting mTOR- 491 dependent and independent signaling pathways in T cells. Front Immunol, 3, 312. 492 GRABOWSKI, P., SCHONFELDER, J., AHNERT-HILGER, G., FOSS, H. D., HEINE, B., SCHINDLER, I., 493 STEIN, H., BERGER, G., ZEITZ, M. & SCHERUBL, H. 2002. Expression of neuroendocrine 494 markers: a signature of human undifferentiated carcinoma of the colon and rectum. 495 Virchows Arch, 441, 256-63. 496 GWACK, Y., SRIKANTH, S., OH-HORA, M., HOGAN, P. G., LAMPERTI, E. D., YAMASHITA, M., 497 GELINAS, C., NEEMS, D. S., SASAKI, Y., FESKE, S., PRAKRIYA, M., RAJEWSKY, K. & RAO, A. 498 2008. Hair loss and defective T and B cell function in mice lacking ORAI1. Mol Cell Biol. 499 HEPP, R., PURI, N., HOHENSTEIN, A. C., CRAWFORD, G. L., WHITEHEART, S. W. & ROCHE, P. A. 500 2005. Phosphorylation of SNAP-23 regulates exocytosis from mast cells. J Biol Chem, 501 280, 6610-20. 502 HONG, H. K., CHAKRAVARTI, A. & TAKAHASHI, J. S. 2004. The gene for soluble N-ethylmaleimide 503 sensitive factor attachment protein alpha is mutated in hydrocephaly with hop gait 504 (hyh) mice. Proceedings of the National Academy of Sciences of the United States of 505 America, 101, 1748-53. 506 ISOMURA, I., PALMER, S., GRUMONT, R. J., BUNTING, K., HOYNE, G., WILKINSON, N., BANERJEE, 507 A., PROIETTO, A., GUGASYAN, R., WU, L., MCNALLY, A., STEPTOE, R. J., THOMAS, R., 508 SHANNON, M. F. & GERONDAKIS, S. 2009. c-Rel is required for the development of 509 thymic Foxp3+ CD4 regulatory T cells. J Exp Med, 206, 3001-14. 510 KERDILES, Y. M., STONE, E. L., BEISNER, D. R., MCGARGILL, M. A., CH'EN, I. L., STOCKMANN, C., 511 KATAYAMA, C. D. & HEDRICK, S. M. 2010. Foxo transcription factors control regulatory T 512 cell development and function. Immunity, 33, 890-904. 513 KLEINEWIETFELD, M., MANZEL, A., TITZE, J., KVAKAN, H., YOSEF, N., LINKER, R. A., MULLER, D. 514 N. & HAFLER, D. A. 2013. Sodium chloride drives autoimmune disease by the induction 515 of pathogenic TH17 cells. Nature, 496, 518-22. 516 LAPLANTE, M. & SABATINI, D. M. 2009. mTOR signaling at a glance. J Cell Sci, 122, 3589-94. 517 LAPLANTE, M. & SABATINI, D. M. 2012. mTOR signaling in growth control and disease. Cell, 149, 518 274-93.

22 519 LEDDEROSE, C., BAO, Y., LIDICKY, M., ZIPPERLE, J., LI, L., STRASSER, K., SHAPIRO, N. I. & JUNGER, 520 W. G. 2014. Mitochondria are gate-keepers of T cell function by producing the ATP that 521 drives purinergic signaling. J Biol Chem, 289, 25936-45. 522 LEE, K., GUDAPATI, P., DRAGOVIC, S., SPENCER, C., JOYCE, S., KILLEEN, N., MAGNUSON, M. A. & 523 BOOTHBY, M. 2010. Mammalian target of rapamycin protein complex 2 regulates 524 differentiation of Th1 and Th2 cell subsets via distinct signaling pathways. Immunity, 32, 525 743-53. 526 LI, P., MIAO, Y., DANI, A. & VIG, M. 2016. alpha-SNAP regulates dynamic, on-site assembly and 527 calcium selectivity of Orai1 channels. Mol Biol Cell, 27, 2542-53. 528 LIAO, G., NAYAK, S., REGUEIRO, J. R., BERGER, S. B., DETRE, C., ROMERO, X., DE WAAL MALEFYT, 529 R., CHATILA, T. A., HERZOG, R. W. & TERHORST, C. 2010. GITR engagement preferentially 530 enhances proliferation of functionally competent CD4+CD25+FoxP3+ regulatory T cells. 531 Int Immunol, 22, 259-70. 532 LIS, A., PEINELT, C., BECK, A., PARVEZ, S., MONTEILH-ZOLLER, M., FLEIG, A. & PENNER, R. 2007. 533 CRACM1, CRACM2, and CRACM3 are store-operated Ca2+ channels with distinct 534 functional properties. Curr Biol, 17, 794-800. 535 LONG, M., PARK, S. G., STRICKLAND, I., HAYDEN, M. S. & GHOSH, S. 2009. Nuclear factor-kappaB 536 modulates regulatory T cell development by directly regulating expression of Foxp3 537 transcription factor. Immunity, 31, 921-31. 538 LUO, C. T., LIAO, W., DADI, S., TOURE, A. & LI, M. O. 2016. Graded Foxo1 activity in Treg cells 539 differentiates tumour immunity from spontaneous autoimmunity. Nature, 529, 532-6. 540 MACIAN, F. 2005. NFAT proteins: key regulators of T-cell development and function. Nature 541 reviews. Immunology, 5, 472-84. 542 MASUI, K., CAVENEE, W. K. & MISCHEL, P. S. 2014. mTORC2 in the center of cancer metabolic 543 reprogramming. Trends Endocrinol Metab, 25, 364-73. 544 MCCARL, C. A., KHALIL, S., MA, J., OH-HORA, M., YAMASHITA, M., ROETHER, J., KAWASAKI, T., 545 JAIRAMAN, A., SASAKI, Y., PRAKRIYA, M. & FESKE, S. 2010. Store-operated Ca2+ entry 546 through ORAI1 is critical for T cell-mediated autoimmunity and allograft rejection. 547 Journal of immunology, 185, 5845-58. 548 MCNALLY, B. A., SOMASUNDARAM, A., YAMASHITA, M. & PRAKRIYA, M. 2012. Gated regulation 549 of CRAC channel ion selectivity by STIM1. Nature, 482, 241-5. 550 MERCER, J. C., DEHAVEN, W. I., SMYTH, J. T., WEDEL, B., BOYLES, R. R., BIRD, G. S. & PUTNEY, J. 551 W., JR. 2006. Large store-operated calcium selective currents due to co-expression of 552 Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J Biol Chem, 281, 24979-90. 553 MIAO, Y., MINER, C., ZHANG, L., HANSON, P. I., DANI, A. & VIG, M. 2013. An essential and NSF 554 independent role for alpha-SNAP in store-operated calcium entry. Elife, 2, e00802. 555 NAVARRO, M. N. & CANTRELL, D. A. 2014. Serine-threonine kinases in TCR signaling. Nat 556 Immunol, 15, 808-14. 557 NEGULESCU, P. A. & MACHEN, T. E. 1990. Intracellular ion activities and membrane transport in 558 parietal cells measured with fluorescent dyes. Methods Enzymol, 192, 38-81. 559 OH-HORA, M., KOMATSU, N., PISHYAREH, M., FESKE, S., HORI, S., TANIGUCHI, M., RAO, A. & 560 TAKAYANAGI, H. 2013. Agonist-selected T cell development requires strong T cell 561 receptor signaling and store-operated calcium entry. Immunity, 38, 881-95.

23 562 OH-HORA, M., YAMASHITA, M., HOGAN, P. G., SHARMA, S., LAMPERTI, E., CHUNG, W., 563 PRAKRIYA, M., FESKE, S. & RAO, A. 2008. Dual functions for the endoplasmic reticulum 564 calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol, 9, 565 432-43. 566 PAREKH, A. B. & PUTNEY, J. W., JR. 2005. Store-operated calcium channels. Physiol Rev, 85, 757- 567 810. 568 PARK, C. Y., SHCHEGLOVITOV, A. & DOLMETSCH, R. 2010. The CRAC channel activator STIM1 569 binds and inhibits L-type voltage-gated calcium channels. Science, 330, 101-5. 570 PARK, Y., VENNEKATE, W., YAVUZ, H., PREOBRASCHENSKI, J., HERNANDEZ, J. M., RIEDEL, D., 571 WALLA, P. J. & JAHN, R. 2014. alpha-SNAP interferes with the zippering of the SNARE 572 protein membrane fusion machinery. J Biol Chem, 289, 16326-35. 573 PEINELT, C., VIG, M., KOOMOA, D. L., BECK, A., NADLER, M. J., KOBLAN-HUBERSON, M., LIS, A., 574 FLEIG, A., PENNER, R. & KINET, J. P. 2006. Amplification of CRAC current by STIM1 and 575 CRACM1 (Orai1). Nat Cell Biol, 8, 771-3. 576 PICARD, C., MCCARL, C. A., PAPOLOS, A., KHALIL, S., LUTHY, K., HIVROZ, C., LEDEIST, F., RIEUX- 577 LAUCAT, F., RECHAVI, G., RAO, A., FISCHER, A. & FESKE, S. 2009. STIM1 mutation 578 associated with a syndrome of immunodeficiency and autoimmunity. N Engl J Med, 360, 579 1971-80. 580 PURI, N., KRUHLAK, M. J., WHITEHEART, S. W. & ROCHE, P. A. 2003. Mast cell degranulation 581 requires N-ethylmaleimide-sensitive factor-mediated SNARE disassembly. J Immunol, 582 171, 5345-52. 583 RODRIGUEZ, F., BUSTOS, M. A., ZANETTI, M. N., RUETE, M. C., MAYORGA, L. S. & TOMES, C. N. 584 2011. alpha-SNAP prevents docking of the acrosome during sperm exocytosis because it 585 sequesters monomeric syntaxin. PloS one, 6, e21925. 586 RONCHETTI, S., RICCI, E., PETRILLO, M. G., CARI, L., MIGLIORATI, G., NOCENTINI, G. & RICCARDI, 587 C. 2015. Glucocorticoid-induced tumour necrosis factor receptor-related protein: a key 588 marker of functional regulatory T cells. J Immunol Res, 2015, 171520. 589 RUAN, Q., KAMESWARAN, V., TONE, Y., LI, L., LIOU, H. C., GREENE, M. I., TONE, M. & CHEN, Y. H. 590 2009. Development of Foxp3(+) regulatory t cells is driven by the c-Rel enhanceosome. 591 Immunity, 31, 932-40. 592 SCHENK, U., WESTENDORF, A. M., RADAELLI, E., CASATI, A., FERRO, M., FUMAGALLI, M., 593 VERDERIO, C., BUER, J., SCANZIANI, E. & GRASSI, F. 2008. Purinergic control of T cell 594 activation by ATP released through pannexin-1 hemichannels. Sci Signal, 1, ra6. 595 SUZUKI, K. & VERMA, I. M. 2008. Phosphorylation of SNAP-23 by IkappaB kinase 2 regulates 596 mast cell degranulation. Cell, 134, 485-95. 597 TANAKA, K., BABIC, I., NATHANSON, D., AKHAVAN, D., GUO, D., GINI, B., DANG, J., ZHU, S., 598 YANG, H., DE JESUS, J., AMZAJERDI, A. N., ZHANG, Y., DIBBLE, C. C., DAN, H., 599 RINKENBAUGH, A., YONG, W. H., VINTERS, H. V., GERA, J. F., CAVENEE, W. K., 600 CLOUGHESY, T. F., MANNING, B. D., BALDWIN, A. S. & MISCHEL, P. S. 2011. Oncogenic 601 EGFR signaling activates an mTORC2-NF-kappaB pathway that promotes chemotherapy 602 resistance. Cancer Discov, 1, 524-38. 603 TIMMERMAN, L. A., HEALY, J. I., HO, S. N., CHEN, L., GOODNOW, C. C. & CRABTREE, G. R. 1997. 604 Redundant expression but selective utilization of nuclear factor of activated T cells 605 family members. Journal of immunology, 159, 2735-40.

24 606 TORRES-FLORES, V., PICAZO-JUAREZ, G., HERNANDEZ-RUEDA, Y., DARSZON, A. & GONZALEZ- 607 MARTINEZ, M. T. 2011. Sodium influx induced by external calcium chelation decreases 608 human sperm motility. Hum Reprod, 26, 2626-35. 609 TUMOVA, L., POMBINHO, A. R., VOJTECHOVA, M., STANCIKOVA, J., GRADL, D., KRAUSOVA, M., 610 SLONCOVA, E., HORAZNA, M., KRIZ, V., MACHONOVA, O., JINDRICH, J., ZDRAHAL, Z., 611 BARTUNEK, P. & KORINEK, V. 2014. Monensin inhibits canonical Wnt signaling in human 612 colorectal cancer cells and suppresses tumor growth in multiple intestinal neoplasia 613 mice. Mol Cancer Ther, 13, 812-22. 614 VAETH, M., SCHLIESSER, U., MULLER, G., REISSIG, S., SATOH, K., TUETTENBERG, A., JONULEIT, 615 H., WAISMAN, A., MULLER, M. R., SERFLING, E., SAWITZKI, B. S. & BERBERICH-SIEBELT, F. 616 2012. Dependence on nuclear factor of activated T-cells (NFAT) levels discriminates 617 conventional T cells from Foxp3+ regulatory T cells. Proc Natl Acad Sci U S A, 109, 16258- 618 63. 619 VIG, M., BECK, A., BILLINGSLEY, J. M., LIS, A., PARVEZ, S., PEINELT, C., KOOMOA, D. L., 620 SOBOLOFF, J., GILL, D. L., FLEIG, A., KINET, J. P. & PENNER, R. 2006a. CRACM1 multimers 621 form the ion-selective pore of the CRAC channel. Curr Biol, 16, 2073-9. 622 VIG, M., DEHAVEN, W. I., BIRD, G. S., BILLINGSLEY, J. M., WANG, H., RAO, P. E., HUTCHINGS, A. 623 B., JOUVIN, M. H., PUTNEY, J. W. & KINET, J. P. 2008. Defective mast cell effector 624 functions in mice lacking the CRACM1 pore subunit of store-operated calcium release- 625 activated calcium channels. Nat Immunol, 9, 89-96. 626 VIG, M. & KINET, J. P. 2007. The long and arduous road to CRAC. Cell Calcium, 42, 157-62. 627 VIG, M. & KINET, J. P. 2009. Calcium signaling in immune cells. Nature immunology, 10, 21-7. 628 VIG, M., PEINELT, C., BECK, A., KOOMOA, D. L., RABAH, D., KOBLAN-HUBERSON, M., KRAFT, S., 629 TURNER, H., FLEIG, A., PENNER, R. & KINET, J. P. 2006b. CRACM1 is a plasma membrane 630 protein essential for store-operated Ca2+ entry. Science, 312, 1220-3. 631 WANG, L. & BRAUTIGAN, D. L. 2013. alpha-SNAP inhibits AMPK signaling to reduce 632 mitochondrial biogenesis and dephosphorylates Thr172 in AMPKalpha in vitro. Nat 633 Commun, 4, 1559. 634 WANG, Y., DENG, X., MANCARELLA, S., HENDRON, E., EGUCHI, S., SOBOLOFF, J., TANG, X. D. & 635 GILL, D. L. 2010. The calcium store sensor, STIM1, reciprocally controls Orai and CaV1.2 636 channels. Science, 330, 105-9. 637 WEIGAND, K. M., SWARTS, H. G., FEDOSOVA, N. U., RUSSEL, F. G. & KOENDERINK, J. B. 2012. 638 Na,K-ATPase activity modulates Src activation: a role for ATP/ADP ratio. Biochim Biophys 639 Acta, 1818, 1269-73. 640 WILHELM, K., GANESAN, J., MULLER, T., DURR, C., GRIMM, M., BEILHACK, A., KREMPL, C. D., 641 SORICHTER, S., GERLACH, U. V., JUTTNER, E., ZERWECK, A., GARTNER, F., PELLEGATTI, P., 642 DI VIRGILIO, F., FERRARI, D., KAMBHAM, N., FISCH, P., FINKE, J., IDZKO, M. & ZEISER, R. 643 2010. Graft-versus-host disease is enhanced by extracellular ATP activating P2X7R. Nat 644 Med, 16, 1434-8. 645 WINSLOW, M. M., NEILSON, J. R. & CRABTREE, G. R. 2003. Calcium signalling in lymphocytes. 646 Curr Opin Immunol, 15, 299-307. 647 WU, C., YOSEF, N., THALHAMER, T., ZHU, C., XIAO, S., KISHI, Y., REGEV, A. & KUCHROO, V. K. 648 2013. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature, 649 496, 513-7.

25 650 YIP, L., WOEHRLE, T., CORRIDEN, R., HIRSH, M., CHEN, Y., INOUE, Y., FERRARI, V., INSEL, P. A. & 651 JUNGER, W. G. 2009. Autocrine regulation of T-cell activation by ATP release and P2X7 652 receptors. FASEB J, 23, 1685-93. 653

654

655

656

657

658

659

660

661

662

663

664

665

666

667

668

669

670

671

672

673

26 674 Materials and Methods:

675

676 Mice: Napahyh/hyh (RRID: MGI:1856610) mice were obtained from Jackson Laboratory

677 (strain number: 001035, strain name: B6C3Fe a/a-Napahyh/hyh/J) and backcrossed onto

678 C57BL/6J until they were >99.4% C57BL/6J and with the help of speed congenics core

679 (RDCC) of the Washington University. All animal experiments were performed

680 according to the guidelines of the Animal Studies Committee of the Washington

681 University School of Medicine in Saint Louis, Protocol Approval Number 20150289.

682

683 Genotyping: For genotyping Napahyh/hyh mice a Custom TaqMan SNP Genotyping

684 Assay developed by Applied Biosystems was used. Forward primer:

685 TCTTTGCTCCCTAGAGGCCATTA, Reverse primer:

686 CAAGCAACCCTTACCATGTCTGTAT, Reporter 1 (VIC): CTGTCTGATGAGAGCAA,

687 Reporter 2 (FAM): ACTGTCTGATAAGAGCAA.eque

688

689 Fetal Liver chimeras: CD45.1 males from Charles River were used as recipient mice

690 for fetal liver chimeras. Recipient mice were irradiated at 850 rads and fetal livers

691 extracted from E15.5 wildtype or Napahyh/hyh donor embryos were injected into 3 to 4

692 recipients each. At least 3 to 4 chimeras were analyzed per experiment and a total of 30

693 to 40 chimeras of each group were generated and analyzed as part the entire study. All

694 chimeras were analyzed 8 to 12 week post-reconstitution.

695

27 696 Technical and Biological Replicates: Unless otherwise specified within figure

697 legends, ‘n’ denotes technical as well as biological replicates. For instance, n=3 means

698 3 technical repeats from 3 independent chimera pairs across 2 to 3 injections.

699

700 Cell Isolation from Chimeras and CD4 T Cell Sorting: For each experiment, spleen

701 and lymph nodes were harvested from wildtype and Napahyh/hyh fetal liver chimeras and

702 subjected to two step sorting. CD4+ T cells were first enriched using MACS CD4+ T cell

703 purification kit (Miltenyi Biotech Inc.) according to manufacturer’s instructions. CD4 T

704 cell purity was routinely >95%. To obtain unperturbed CD45.2+CD4+ double positive

705 cells, MACS enriched cells were stained with anti-CD45.1 APC and sorted using Aria II

706 by gating on CD45.1 negative cells.

707

2+ 708 Measurement of Single Cell SOCE and [Ca ]i: CD45.2+CD4+ T lymphocytes were

709 sorted from chimeras and plated on coverslips. Cells were loaded with 1μM Fura-2-AM

710 (Life Technologies) in Ringer’s buffer (135 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM

711 MgCl2, 5.6 mM Glucose, and 10 mM Hepes, pH 7.4) for 40 min in the dark, washed, and

712 used for imaging. Baseline images were acquired for 1 minute and then cells were

713 simulated with 10μg/ml soluble anti-CD3 (Biolegend catalog# 100331) plus 5 μg/ml

714 secondary antibody (Biolegend catalog# 405501) and imaged simultaneously in

715 nominally calcium free Ringer’s buffer for 5 to 6 minutes. Subsequently, extracellular

716 calcium was replenished and cells were imaged for an additional 5-6 minutes. 50 to 200

717 cells were analyzed per group in each experiment. An Olympus IX-71 inverted

718 microscope equipped with a Lamda-LS illuminator (Sutter Instrument, Novato, CA),

28 719 Fura-2 (340/380) filter set (Chroma, Bellows Falls, VT), a 10X 0.3NA objective lens

720 (Olympus, UPLFLN, Japan), and a Photometrics Coolsnap HQ2 CCD camera was used

721 to capture images at a frequency of ~1 image pair every 1.2 seconds. Data were

722 acquired and analyzed using MetaFluor (Molecular Devices, Sunnyvale, CA), Microsoft

723 Excel, and Origin softwares. To calculate [Ca]i, Fura-2 Calcium Imaging Calibration Kit

724 (Life technologies) was used according to manufacturer's instructions. Briefly, standard

725 samples containing dilutions of free Ca2+ (0 to 39 μM) were imaged as described above

2+ 726 to obtain the constant Kd. [Ca ]i was then determined using the following equation:

380 + [R − R ] F  2  = × min × max 727 Ca  Kd 380 [R −R] F max min

728 where R is the ratio of 510 nm emission intensity with excitation at 340 nm versus 380

2+ 2+ 380 729 nm; Rmin is the ratio at zero free Ca ; Rmax is the ratio at saturating free Ca ; F max is

380 730 the fluorescence intensity with excitation at 380 nm, for zero free Ca2+; and F min is the

731 fluorescence intensity at saturating free Ca2+. SOCE was calculated as (SOCE=highest

2+ 2+ 2+ 732 [Ca ]i – basal [Ca ]i), where highest [Ca ]i was the highest value after replenishing

2+ 2+ 733 extracellular calcium and basal [Ca ]i was the lowest [Ca ]i, following store-depletion in

734 calcium free buffer. Percentage of average SOCE in Napahyh/hyh or α-SNAP RNAi

735 treated samples was then determined by setting the average of wildtype SOCE to

736 100%.

737

738 Measurement of Single Cell [Na]i: CD45.2+CD4+ T cells were sorted from chimeras,

739 plated onto coverslips and loaded with 2.5 μM SBFI-AM (Life Technologies) in Hank’s

740 balanced salt solution (HBSS) buffer at room temperature for 40 min in the dark,

741 washed and used for imaging. Baseline images were acquired for 1 minute and then

29 742 cells were stimulated with 10μg/ml soluble anti-CD3 (Biolegend catalogue#100331) plus

743 5 μg/ml secondary antibody (Biolegend catalogue #405501) and imaged simultaneously

744 in HBSS buffer. SBFI was alternatively excited at 340 and 380 nm, and images were

745 collected at 510 nm emission wavelength using the microscope setup described above.

+ 746 Nearly 150 cells were analyzed per group. To calculate [Na ]i, SBFI was calibrated in

747 vivo in T lymphocytes based on the protocol described previously (Negulescu and

748 Machen, 1990, Donoso et al., 1992). Briefly, cells were loaded with SBFI and imaged in

+ 749 the buffer containing serial dilutions of free [Na ] concentration ranging from 0 and 150

750 mM, which were obtained by mixing Na+ free (130 mM potassium gluconate and 30 mM

751 KCl) and Na+ MAX (130 mM sodium gluconate and 30 mM NaCl) soultions. To

752 equilibrate extracellular and intracellular sodium, cells were treated with monovalent

753 cation ionophore gramicidin D at 5 μM. After imaging cells in at least five dilutions,

+ + 754 standard curve was obtained by plotting [Na ] on (x-axis) vs. [Na ]/(1/R0-1/R) on (y-

755 axis), where R is the ratio of emission intensity at 510 nm with excitation at 340 nm

+ 756 versus 380 nm; R0 is the ratio at zero Na . From the above equation, the apparent Kd of

+ 757 SBFI in T lymphocytes was obtained and [Na ]i of experimental samples was then

758 calculated using the constants derived from the regression line.

759

760 Intracellular ATP quantification: CD45.2+CD4+ T lymphocytes were sorted from

761 chimeras and stimulated with 10μg/ml anti-CD3, 5 μg/ml secondary antibody and 2

762 μg/ml anti-CD28 for indicated times. Subsequently, cells were washed using cold

763 HBSS, pelleted and boiled in 100μl TE buffer at 95 °C for 5 to 7 minutes, and spun at

764 14000 RPM for 3 minutes. Supernatants containing intracellular ATP and ATP standard

30 765 were then diluted using ATP assay solution according to manufacturer's instructions

766 (ATP Determination Kit, Molecular Probes). Luminescence in standard and

767 experimental samples was measured using FlexStation III and intracellular ATP in

768 experimental samples was calculated using ATP standard curve.

769

770 Whole Cell Lysates (WCLs), SDS-PAGE and Western Blot: CD45.2+CD4+ T

771 lymphocytes were sorted from chimeras and stimulated with 10μg/ml soluble anti-CD3

772 plus 5 μg/ml secondary antibody, and 2μg/ml soluble anti-CD28 (Biolegend) in HBSS at

773 37 °C for indicated times. Post-stimulation, cells were suspended in cold HBSS, pelleted

774 down and lysed in RIPA buffer (Cell signaling). WCLs were boiled with Laemmli sample

775 buffer containing 100mM DTT and resolved using 10 or 12% SDS-polyacrylamide gel.

776 Proteins were transferred by western blotting to nitrocellulose membrane and probed

777 with respective antibodies as described previously (Miao et al., 2013).

778

779 Nuclear and cytosolic extracts: CD45.2+CD4+ T lymphocytes were sorted from

780 chimeras and stimulated with 10μg/ml soluble anti-CD3 (Biolegend) and 5μg/ml

781 secondary antibody for 30 min. Cytoplasmic and nuclear extracts were prepared using

782 Thermo Scientific NE-PER kit as per manufacturer instructions and subjected to SDS-

783 PAGE gel and Western Blot as described previously (Miao et al., 2013).

784

785 Gene expression analysis: Total RNA was extracted from cells by using RNeasy mini

786 kit (QIAGEN), reverse transcribed to cDNA with M-MLV RT-PCR (Promega) and used

787 for Q-PCR. GAPDH and 18S rRNA were first used as housekeeping genes for

31 788 normalization of expression. Because Ct values for GAPDH were closer to the Ct values

789 of genes being analyzed here, final normalization was done using GAPDH. After

790 normalization, gene expression in WT was set to 1 for each gene and relative

791 expression in Napa hyh/hyh was calculated.

792

793 RNA sequencing: CD45.2+CD4+ T lymphocytes were sorted from chimeras using

794 MACS beads and BD Aria II and stimulated using plate coated 10μg/ml anti-CD3 along

795 with 2μg/ml soluble anti-CD28 for 6 hours. Following stimulation, total RNA was

796 extracted by using RNeasy mini kit (QIAGEN) and submitted for quantification, library

797 preparation, sequencing, and initial bioinformatics analysis to Genewiz (South Plainfield,

798 NJ). Briefly, RNA samples were quantified using Qubit 2.0 Fluorometer (Life

799 Technologies, Carlsbad, CA) and RNA integrity was checked with 2100 Bioanalyzer

800 (Agilent Technologies, Palo Alto, CA). Whole transcriptome RNA enrichment was

801 performed using Ribozero rRNA Removal Kit (1:1 mixture of Human/Mouse/Rat probe

802 and Bacteria probe) (Illumina, San Diego, CA). For RNA sequencing library

803 preparation, NEB Next Ultra RNA Library Prep Kit for Illumina was used by following the

804 manufacturer’s recommendations (NEB, Ipswich, MA). Briefly, enriched RNAs were

805 fragmented for 15 minutes at 94 °C. First strand and second strand cDNA were

806 subsequently synthesized. cDNA fragments were end repaired and adenylated at

807 3’ends, and universal adapter was ligated to cDNA fragments, followed by index

808 addition and library enrichment with limited cycle PCR. Sequencing libraries were

809 validated using a DNA Chip on the Agilent 2100 Bioanalyzer (Agilent Technologies),

32 810 and quantified by using Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) as well as by

811 quantitative PCR (Applied Biosystems, Carlsbad, CA).

812

813 The sequencing libraries were multiplexed, clustered on a single flow cell and loaded on

814 the Illumina HiSeq 2500 instrument. Samples were sequenced using a 1x100 Single

815 Read (SR) Rapid Run configuration. Image analysis and base calling were conducted

816 using the HiSeq Control Software (HCS) on the HiSeq 2500 instrument. Raw sequence

817 data (.bcl files) generated from Illumina HiSeq 2500 was converted into fastq files and

818 de-multiplexed using Illumina bcl2fastq v1.8.4 program. One mismatch was allowed for

819 index sequence identification. Gene expression analysis was performed using the CLC

820 Genomics Workbench software, by trimming sequence reads to remove low quality

821 bases at ends, followed by mapping sequence reads to the mouse genome (Refseq)

822 and calculating gene expression values as Reads Per Kilobase of transcript per Million

823 mapped reads (RPKM). Gene expression data were further filtered to remove

824 transcripts using the following criterion: i) students t-test p value >0.05 between

825 biological replicates, ii) <2-fold change, iii) genes with <10 total exon reads in wildtype

826 group. The list of differentially expressed, filtered genes was deposited at Datadryad

827 (http://datadryad.org/review?doi=doi:10.5061/dryad.202fn). The data were also

828 subjected to pathway analysis using the Metacore software (Thomson Reuters, NY) and

829 top 50 pathways with a p-value <0.05 are displayed in Figure 6-source data 1.

830

831 Intracellular cytokine staining: Naïve or differentiated T cells were stimulated with

832 PMA (20nM) and Ionomycin (1 μg/ml) and brefeldin A (Biolegend) for 5 to 6 hours and

33 833 stained using anti-CD4 or anti-CD8 surface markers (Biolegend). Subsequently, cells

834 were fixed and permeabilized and incubated with anti-IL-2, anti-IL-4 or anti-IFN-γ

835 antibodies (Biolegend) and analyzed using FACS Calibr or LSR Fortessa analyzers and

836 Flow Jo software (BD Biosciences).

837

838 T cell proliferations: Naïve CD45.2+CD4+ T lymphocytes were sorted from chimeras

839 and labeled with 10 μM CFSE, washed and stimulated with 5μg/ml plate-coated anti-

840 CD3 along with 2 μg/ml soluble anti-CD28 for 72 hours, stained with anti-CD4 antibody

841 and analyzed using LSR Fortessa flowcytometer. In some experiments, unfractionated

842 splenocytes were stimulated with soluble anti-CD3 and anti-CD28 for 48 hours, pulsed

843 with 1μCi 3H thymidine for additional 12-16 hours, harvested and counted.

844

845 Th1/Th2 differentiation: CD4 T cells were purified from chimeras and stimulated with

846 5μg/ml plate-coated anti-CD3 and 2μg/ml soluble anti-CD28 in the presence of

847 cytokines and neutralizing antibodies for 2 days. For Th1: 20 ng/ml IL-2, 20 ng/ml IL-12,

848 10μg/ml anti-IL-4 and for Th2: 20 ng/ml IL-2, 50 ng/ml IL-4 was used. After 48 hrs cells

849 were washed and cultured in the above cocktail of cytokines and antibodies for an

850 additional 3 days. Cells were then stimulated with 20 nM PMA, 1 μg/ml ionomycin and

851 brefelin A (Biolegend) for 5-6 hr and stained for Th1/Th2 signature cytokines or

852 transcription factors T-bet/Gata-3 as mentioned above.

853

854 Foxp3 Treg differentiation and staining: CD45.2+CD4+ T lymphocytes were sorted

855 from chimeras and differentiated with 10μg/ml plate coated anti-CD3, 2μg/ml soluble

34 856 anti-CD28 and 10ng/ml TGF-β for 5 days and analyzed. Thymocytes, lymph node,

857 splenocytes or in vitro differentiated Treg cells were stained with anti-CD4 and anti-

858 CD25 surface markers, then fixed and permeabilized with Fix/Perm buffers (Biolegend)

859 and stained with Alexa647-FoxP3 (Biolegend).

860

861 RNAi in primary T lymphocytes: α-SNAP targeting sequence,

862 (CGCCAAAGACTACTTCTTCAA), was subcloned into MSCV-LTRmiR30-PIG retroviral

863 vector (Openbiosystems). Viral supernatants were made according to manufacturer's

864 instruction. For infections, T cells were stimulated with anti-CD3 for 24 hours prior to

865 infection and spun with the viral supernatant and polybrene (8μg/ml) at high speed for

866 90 min. GFP positive cells were analyzed 3-day post infection.

867

868 T cell transfections: Naïve T cells were transfected using Amaxa Mouse T Cell

869 Nucleofector Kit (Lonza) according to manufacturer's instructions. Cells were analyzed

870 ~16 hours post transfection.

871

872 Cell lines and transfection: HEK293 cells were obtained from ATCC

873 (RRID:ATCC:CRL-1573), expanded and cultured in DMEM containing 10% FBS, L-

874 glutamine, non-essential amino acids and sodium pyruvate. Cells were co-transfected

875 with CFP-Stim1 and YFP-α-SNAP or YFP-α-SNAP M105I expressing vectors, using

876 Lipofectamine 2000 (Life technologies, USA) and imaged using TIRF illumination as

877 described previously (Miao et al., 2013). Cell line stocks were tested for mycoplasma

878 contamination using Lonza Mycoalert (Lonza) every few years.

35 879

880 In vitro binding and Western Blotting: myc-tagged Orai1 and Stim1 proteins were

881 immunoprecipitated from HEK293 (RRID:ATCC:CRL-1573) cells and beads were

882 incubated with purified recombinant α-SNAP WT or M105I for 1 hr at 4°C. Post-

883 incubation, beads were washed three times and protein complexes eluted by boiling in

884 SDS containing sample buffer and subjected to SDS-PAGE and western blotting as

885 described previously (Miao et al., 2013).

886

887 Statistical analysis: Statistical significance represented as p value was calculated

888 using unpaired student’s t-test, unless otherwise specified. * p<0.05, ** p<0.01, ***

889 p<0.001.

890

891 Acknowledgements: We thank Grzegorz B. Gmyrek, Leah Owens and Cathrine Miner

892 for technical assistance. Yinan wang for help with generation of fetal liver chimeras.

893 Chyi Song Hsieh for advice on Foxp3 regulatory T cell analysis. This work was

894 supported in part by, NIH-NIAID grant AI108636 and ACS-RSG 14-040-01-CSM.

895

896

897

898

899

900

36 901 Figure Legends:

902

903 Figure 1: Napahyh/hyh mice harbor severe defects in the production of CD4 T cell

904 effector cytokines. 1A & 1B. Representative FACS profile showing the reconstitution

905 efficiency and average cell yields from the thymus (1A) and spleen (1B) of WT (black)

906 and Napahyh/hyh (red) fetal liver chimeric mice. (n=25). 1C & 1D. Representative FACS

907 profile showing the percentage of CD4+, CD8+ single and double positive thymocytes in

908 CD45.2+ gated cells from WT and Napahyh/hyh chimera thymii (1C) and spleen (1D).

909 (n=10). 1E. Representative Western Blot for α-SNAP in whole cell lysates prepared

910 from WT and Napahyh/hyh lymph node cells. (n>5). 1F. FACS profiles showing surface

911 staining of WT (black) and Napahyh/hyh (red) spleen cells with anti-CD4, anti-CD8, anti-

912 CD3, anti-CD28 and anti-TCRβ respectively. (n=5). 1G. FACS profiles of resting (thin

913 lines) and receptor stimulated (thick lines); WT (black) and Napahyh/hyh (red) CD4 T cells

914 stained for various activation markers. (n=3). 1H-1J. FACS profiles showing intracellular

915 staining for IL-2 (1H, 1J) and TNF-α (1I, 1J) in WT (black) and Napahyh/hyh (red) CD4 T

916 cells 6 hours post-stimulation. Grey peak shows unstimulated control. (n=5 repeats from

917 5 chimeras each). 1K-1M. FACS profiles showing intracellular cytokine staining for Th1

918 (1K, 1M) and Th2 signature cytokines (1L, 1M) in polarized WT (black) and Napahyh/hyh

919 (red) CD4 T lymphocytes. Grey line shows undifferentiated control. (n=3). 1N, 1O.

920 CFSE dilution profiles (1N) and their quantifications (1O), showing proliferation of WT

921 (black) and Napahyh/hyh (red) CD4 T cells in response to plate bound anti-CD3 and anti-

922 CD28. Light traces show unstimulated control. (n=3). 1P. Representative plot showing

923 proliferation of WT (black) and Napahyh/hyh (red) splenocytes in response to soluble anti-

37 924 CD3 and anti-CD28, estimated using 3H thymidine incorporation. (n=3). (See also

925 Figure 1, figure supplement 1).

926

927 Figure 2: Napahyh/hyh mice harbor significant defects in the differentiation of

928 Foxp3 regulatory T cells in vivo and in vitro. 2A. A representative FACS profile and

929 dot plot showing the percentage of Foxp3+ CD25+ cells in the CD4+CD45.2+

930 population from WT and Napahyh/hyh chimera thymii. (n=3 with 2 chimeras/experiment).

931 2B. Dot plot showing the percentage of WT and Napahyh/hyh Foxp3+ cells in mixed

932 chimera thymii. (n=4 with 2-3 chimeras/experiment). p value from paired student’s t-

933 test. 2C. Dot plots showing the percentage of WT and Napahyh/hyh Foxp3+ cells in

934 various lymphoid tissues of mixed chimeras. (n=4 with 2-3 chimeras/experiment). 2D.

935 Representative FACS profile and dot plots showing mean fluorescence intensity (MFI)

936 of surface expression of CD44 on WT (black) and Napahyh/hyh (red) Foxp3+ cells from

937 thymus, spleen and mesenteric lymph nodes (MLN). (n=4 with 2 chimeras/experiment).

938 2E. Representative FACS profile and dot plot showing mean fluorescence intensity

939 (MFI) of surface expression of GITR on WT (black) and Napahyh/hyh (red) Foxp3+ cells

940 from spleen. (n=3). 2F. Dot plot showing the percentage of WT and Napahyh/hyh Foxp3+

941 cells in the lamina propria CD4 T cells isolated from mixed chimeras. (n=3 with 2

942 chimeras/experiment). 2G. Representative dot plot showing the normalized percentage

943 of WT (black) and Napahyh/hyh (red) Foxp3+ cells in in vitro differentiated CD4 T cells.

944 (n=7). p value from paired student’s t test. (See also Figure 2-source data1 and 2).

945 Figure 3: Orai1 mediated sodium influx inhibits Foxp3 iTreg differentiation by

946 disrupting NFκB activation in Napahyh/hyh CD4 T cells. 3A-3C. Representative Fura-2

38 947 profiles showing real-time change in average cytosolic calcium levels in WT (black) or

948 Napahyh/hyh (red) CD4 T cells stimulated with anti-CD3 antibody (3A & 3B). (n=5 with

949 ~50 to 100 cells per experiment) or thapsigargin (TG) (3C) (n=3 with ~50 to 100 cells

950 per experiment). Percent SOCE was calculated by normalizing average WT response to

951 100 and then calculating the % response of Napahyh/hyh CD4 T cells. 3D & 3E. Average

hyh/hyh 952 SBFI profiles showing real-time change in [Na]i of WT (black) and Napa (red) CD4

953 T cells stimulated with anti-CD3 antibody (3D) (n=5 with ~50 to 100 cells per

954 experiment) or TG (3E) (n=1 with ~50 to 100 cells per experiment). 3F. Average SBFI

955 profiles of anti-CD3 stimulated WT (black) and Napahyh/hyh CD4 T cells treated with

956 scramble RNAi (red) or Orai1 RNAi (blue); (magenta) anti-CD3 stimulated Napahyh/hyh T

957 cells where [Na]e was replaced with NMDG. (n=1 with ~50 to 100 cells per experiment).

958 3G. SBFI profiles of WT CD4 T cells, treated with Monensin (red) or untreated (black).

959 (n=1 with ~50 to 100 cells per experiment). 3H, 3I. Western Blot for cytosolic and

960 nuclear NFAT1 and NFκB p65 (3H) or c-Rel (3I) in receptor stimulated WT and

961 Napahyh/hyh CD4 T cells. (n=4). 3J, 3K Western Blot for total and phospho-Lck, ZAP-70

962 and PLC- γ (3J) and total and phospho-Erk1/2, p38 and Jnk (3K) in receptor stimulated

963 WT and Napahyh/hyh CD4 T cell WCLs. (n=3). 3L. Representative Fura-2 profiles

964 showing real-time change in average cytosolic calcium levels in scramble (black) or

965 Orai1 RNAi treated (red) CD4 T cells stimulated with anti-CD3 antibody. (n=2 with ~50

966 to 100 cells per experiment). 3M, 3N. Western Blot for cytosolic and nuclear NFAT (3M)

967 and NFκB p65 (3N) in receptor stimulated scramble (scr) or Orai1 RNAi (Orai1) treated

968 WT CD4 T cells. 3O. Representative dot plot showing the normalized percentage of

969 Foxp3+ cells in scr (black) and Orai1 RNAi treated (Orai1) CD4 T cells differentiated in

39 970 vitro. (n=3), p value from paired student’s t-test. 3P. FACS profiles showing intracellular

971 IL-2 expression in WT CD4 T cells, receptor stimulated in the presence (red) or absence

972 (black) of monensin. (n=2). 3Q, 3R. Western Blot for cytosolic and nuclear NFAT1 (3Q)

973 and NFκB p65 (3R) in receptor stimulated WT CD4 T cells with or without monensin.

974 (n=2). 3S. Bar plot showing % Foxp3+ cells differentiated in vitro, in the absence or

975 presence of different doses of monensin. (n=3).

hyh/hyh 976 Figure 4: TCR induced non-specific sodium influx depletes [ATP]i in Napa

977 CD4 T cells. 4A. Percent change in intracellular ATP levels [ATP]i in anti-CD3

978 stimulated WT and Napahyh/hyh CD4 T cells, measured at different times post-

979 stimulation. (n=6). 4B. Percent change in intracellular ATP levels [ATP]i in WT CD4 T

980 cells, stimulated with anti-CD3 in the presence or absence of Monensin. (n=2). 4C.

981 Percent change in intracellular ATP levels [ATP]i in anti-CD3 stimulated WT and

982 Napahyh/hyh CD4 T cells, treated with scramble (scr) or Orai1 RNAi (Orai1). (n=2). 4D.

983 FACS profiles of WT (black) and Napahyh/hyh (red) CD4 T cells stained with Mitotracker

984 green. (n=2). 4E-4J. OCR and ECAR profiles of naive (4E, 4F), TCR receptor

985 stimulated for 6 hours (4G, 4H), or TH0 (4I, 4J) WT (black) and Napahyh/hyh (red) CD4 T

986 cells. (n= 2 each).

hyh/hyh 987 Figure 5: Depletion of [ATP]i inhibits mTORC2 activation in Napa CD4 T

988 cells. 5A, 5B. Western Blot for total and pS473 (5A) or pT308 (5B) phospho-AKT in

989 receptor stimulated WT and Napahyh/hyh CD4 T cell WCLs at different times post-

990 activation. (n=3). 5C, 5D. Western Blot for total and pS473 phospho-AKT (5C) or pT308

991 phospho-AKT (5D) in WT CD4 T cells receptor stimulated in the presence or absence of

992 monensin. (n=2). 5E. Western Blot for total and phospho- pT37/46 4E-BP1 in receptor

40 993 stimulated WT and Napahyh/hyh CD4 T cell WCLs. 5F. Western Blot for total and pS473

994 phospho-AKT in WCLs of receptor stimulated WT and Napahyh/hyh CD4 T cells, treated

995 with scramble (scr) or Orai1 RNAi (Orai1). (n=2). 5G. Western Blot for mTORC2

996 complex proteins in the WCLs of receptor stimulated WT and Napahyh/hyh CD4 T cells.

997 (n=2).

998 Figure 6: mTORC2 regulates NFκB activation via multiple signaling intermediates

999 in Napahyh/hyh CD4 T cells. (6A-6C) Western Blots for total and pT538 phospho-PKC-θ

1000 (6A), phospho-IKKβ (6B) and phospho-IκB-α (6C) in WCLs of receptor stimulated WT

1001 and Napahyh/hyh CD4 T cells. (n=2). 6D. Western Blot for total and phospho-IκB-α in

1002 WCLs of receptor stimulated WT and Napahyh/hyh CD4 T cells, treated with scr or Orai1

1003 RNAi. 6E. Western Blot for cytosolic and nuclear FOXO-1 in receptor stimulated WT

1004 and Napahyh/hyh CD4 T cells. (n=3). 6F. Principal component analysis (PCA) on gene

1005 expression data from TCR stimulated WT and Napahyh/hyh CD4 T cell RNA. (n=2 from 2

1006 independent chimeras each). 6G. Scatter plot showing the normalized means of gene

1007 expression values (RPKM) in Napahyh/hyh and WT CD4 T cells after filtering for genes as

1008 described in methods. 6H. Bar plot showing fold change in the expression of a few

1009 representative genes between WT and Napahyh/hyh samples from 6F,6G. (See also

1010 Figure 6-source data 1).

1011 Figure 7: Ectopic expression of M105I α-SNAP mutant restores the defects in

1012 Napahyh/hyh CD4 T cells. 7A. Average cytosolic calcium levels, measured using FURA

1013 2AM, in scr (black) and α-SNAP RNAi (red) treated cells stimulated with anti-CD3

1014 antibody to measure SOCE. (n=3 with ~50 to 100 cells per experiment). 7B.

41 1015 Quantitative PCR to estimate the expression of key effector cytokines in scr (black) and

1016 α-SNAP RNAi (red) treated Th0 cells. (n=2 repeats; samples from 3 repeats of RNAi).

1017 7C. Representative FACS profiles showing intracellular IL-2 staining in WT and

1018 Napahyh/hyh CD4 T cells reconstituted with EV, WT or M105I α-SNAP. (n=3). 7D.

1019 Average cytosolic calcium levels in anti-CD3 stimulated WT and Napahyh/hyh CD4 T cells

1020 expressing empty vector (EV), WT or M105I α-SNAP. (n=2 with ~50 to 200 cells each).

1021 7E. Western Blot showing in vitro binding of WT and M105I α-SNAP to Stim1 and Orai1.

1022 (n=2). 7F. Confocal images of HEK293 cells expressing WT or M105I α-SNAP and

1023 stained with anti-α-SNAP antibody (Scale bar 10μm). (n=2; 5 to 6 cells/ per group/

1024 experiment). 7G. TIRF images of store-depleted HEK293 cells co-expressing CFP-

1025 Stim1 and YFP-tagged WT or M105I α-SNAP. (Scale bar 10μm). (n=2 with 5 to 6 cells/

1026 per group/ experiment).

1027 Figure 8: Summary of signaling nodes affected by TCR induced non-specific

1028 sodium influx.

1029

1030 Figure Supplements:

1031 Figure 1, figure supplement 1. Bar plot showing the average MFIs of the intracellular

1032 staining for T-bet and GATA-3 in Th1 and Th2 differentiated WT (black) and Napahyh/hyh

1033 (red) CD4 T cells, respectively. (n=3).

1034

42 Figure 1

A Thymus B Spleen

ns WT Napahyh/hyh ns WT Napahyh/hyh CD45.2 CD45.2 % cell count % cell count WT Napahyh/hyh hyh/hyh WT Napa CD45.1 CD45.1 C Thymus D Spleen E WT Napahyh/hyh hyh/hyh CD4 CD8 WT Napa ns ns α-SNAP

CD8 GAPDH normalized frequency normalized frequency

CD4 WT Napahyh/hyh WT Napahyh/hyh

cell count

CD4 CD8 CD3 CD28 TCR-β

G H I J 60

* 20 cell count Cytokine % cell count ***

0 CD25 CD44 CD69 IL-2 TNF-α IL-2 TNF-α

K L M N O 2 60 50 1 * 40 ** 3 25 cell count cell count

20 cell count * *** cell count % 0 Cytokine % 1 2 3 0 IFN-γ IL4 IFN-γ IL4 CFSE

P 8000

6000

cpm 4000

2000

0 NS 0.01 0.1 1 μg/ml Figure 2 A CD4+ B WT Napahyh/hyh ** p=0.0051 *** p<0.0001

0.6 1.5

0.4 1.0 Foxp3

0.2 in CD4+ in CD4+ 0.5 Foxp3+ CD25+% Foxp3+

Foxp3+ CD25+% Foxp3+ 0 0 WT Napahyh/hyh WT Napahyh/hyh CD25

MLN spleen Thymus C MLN spleen blood D ***p=0.0009 ***p<0.0001 ***p<0.0001 ***p<0.0001 ***p<0.0001 ***p<0.0001 20 4 3

2 in Foxp3+

10 normalized cell count MFI of CD44 in CD4+ 1

Foxp3+ CD25+% Foxp3+ 0 0 WT WT WT WT WT WT CD44 hyh/hyh hyh/hyh hyh/hyh hyh/hyh hyh/hyh hyh/hyh Napa Napa Napa Napa Napa Napa

E F G *** p<0.0001 ***p=0.0006 *** p<0.0001 100 20 200

10 50 in CD4+ Foxp3+ % Foxp3+

cell count 100 Normalized in Foxp3+ MFI of GITR Foxp3+ CD25+% Foxp3+ 0 0 0 WT Napahyh/hyh WT Napahyh/hyh WT Napahyh/hyh GITR Figure 3

A 0 mM Ca 1.8 mM Ca B C anti-CD3 120 120

90 90 60 *** 60 *** % SOCE % SOCE 30 30 0 0 WT Napahyh/hyh WT Napahyh/hyh

D Ca 1.2 mM, Na 140 mM E Ca 1.2 mM, Na 140 mM F Ca 1.2 mM, Na 140 mM G Ca 1.2 mM, Na 140 mM anti-CD3 TG anti-CD3 Monensin

H J K WT Napahyh/hyh Cytoplasmic Nuclear hyh/hyh anti-CD3: - + - + anti-CD3 WT Napa hyh/hyh WT Napa hyh/hyh WT Napa + - + - + anti-CD3: - + - + - + - + anti-CD4 Erk1/2 pT202/Y204 Lck pY394 NFAT1 Lck Erk2 NFkB p65

ZAP70 pY319 p38 pT180/Y182 GAPDH Lamin B ZAP70 p38 I Cytoplasmic Nuclear PLCγ1 pY783 SAPK/JNK pT183/Y185 WT Napahyh/hyh WT Napahyh/hyh PLCγ1 anti-CD3: - + - + - + - + SAPK/JNK c-Rel

GAPDH Lamin B

L M scr Orai1 RNAi O anti-CD3: - + - + 0 mM Ca 1.8 mM Ca n.s. p=0.29 anti-CD3 NFAT1 100 Lamin B

N scr Orai1 RNAi 50 anti-CD3: - + - + Foxp3+ % Foxp3+ NFkB p65 Normalized 0 scr Orai1 RNAi Lamin B

P Q anti-CD3: - + + S Monensin: - - + 100

NFAT1 50 Lamin B Foxp3+ % Foxp3+ Normalized R anti-CD3: - + + 0 0 25 50 100 nM

cell count Monensin: - - +

NFkB p65

Lamin B IL2 Figure 4

A B C 1 min 5 min 30 min 6 hr 1 min 5 min 30 min 6 hr 1 min 5 min 30 min 6 hr i TP] 40 i 40 A i TP] A 40 TP] A 0 0 0 % change in [

-40 % change in [ -40 % change in [ WT WT WT WT hyh/hyh hyh/hyh hyh/hyh hyh/hyh -40 ctrl monensin ctrl monensin ctrl monensin ctrl monensin Napa Napa Napa Napa scr scr scr scr Orai1 Orai1 Orai1 Orai1 hyh/hyh hyh/hyh hyh/hyh hyh/hyh WT scr WT Orai1 WT scr WT Orai1 WT scr WT Orai1 WT scr WT Orai1 hyh/hyh hyh/hyh hyh/hyh hyh/hyh hyh/hyh hyh/hyh hyh/hyh hyh/hyh Napa (NMDG) Napa (NMDG) Napa (NMDG) Napa (NMDG) Napa Napa Napa Napa Napa Napa Napa Napa D E F

cell count

MitoTracker Green

G H I J Figure 5

A WT Napahyh/hyh C Monensin ctrl anti-CD3: 0 10’ 30’ 6h 0 10’ 30’ 6h anti-CD3: 0 10’ 30’ 6h 10‘ 30’ 6h AKT pS473 AKT pS473 AKT total AKT total

B WT Napahyh/hyh D anti-CD3: 0 30’ 30’ anti-CD3: 0 6 0 6 h Monensin: - - + AKT pT308 AKT pT308 AKT total AKT total

hyh/hyh E WT Napahyh/hyh F WT Napa anti-CD3: 0 30’ 0 30’ scr Orai1 scr Orai1 RNAi anti-CD3: 0 30’ 6h 0 30’ 6h 0 30’ 6h 0 30’ 6h 4E-BP1 pT37/46 AKT pS473 4E-BP1 AKT total Actin

G WT Napahyh/hyh WT Napahyh/hyh WT Napahyh/hyh

anti-CD3: 0 30’ 6h 0 30’ 6h anti-CD3: 0 30’ 6h 0 30’ 6h anti-CD3: 0 30’ 6h 0 30’ 6h GβL mTOR Rictor Sin Actin Actin Actin Figure 6

hyh/hyh A WT Napahyh/hyh B WT Napa C WT Napahyh/hyh anti-CD3: 0 30’ 0 30’ anti-CD3: 0 10’ 30’ 0 10’ 30’ anti-CD3: 0 10’ 30’ 0 10’ 30’ PKCθ pT538 IKKα/β pS176/180 IkBα pS32 PKCθ total IKKβ Actin Actin

D WT Napahyh/hyh E Cytoplasmic Nuclear hyh/hyh hyh/hyh scr Orai1 scr Orai1 RNAi WT Napa WT Napa anti-CD3: 0 30’ 0 30’ 0 30’ 0 30’ anti-CD3: 0 30’ 0 30’ 0 30’ 0 30’

IkBα pS32 FOXO1

Actin

Actin Lamin B

F G H hyh/hyh Bcl2a1d Napa 1 Il15ra 0.5 hyh/hyh Napa 2 Il2ra Il4 Bcl2l1 0.0

gene expression Tnfrsf4 Lag3 PC2 Icos normalized mean hyh/hyh Sgk3 -0.5 WT1 S1pr1

WT2 Napa Bcl9l 0.4 0.5 0.6 -25 -20 -15 -10 -5 0 5 PC1 WT gene expression Normalized Fold change normalized mean Figure 7

A 0 mM Ca 1.8 mM Ca B anti-CD3

*** ** *** % SOCE normalized Gene/GAPDH ***

Scr RNAi α-SNAP RNAi IL-2 IL-4 IFN-γ

C D E WT+EV 0 mM Ca 1.8 mM Ca Napa hyh/hyh +EV Napahyh/hyh +WT anti-CD3 IP: CTRLIP: Stim1IP: Orai1 IP: CTRLIP: Stim1IP: Orai1 Napa hyh/hyh +M105I α-SNAP

WT+EV Napa hyh/hyh +M105I Napahyh/hyh +WT cell count Napa hyh/hyh +EV Stim1

IL-2 Orai1

+ α-SNAP-WT + α-SNAP-M105I

F G α-SNAP-WT DAPI CFP-Stim1 YFP-α-SNAP-WT

α-SNAP-M105I CFP-Stim1 YFP-α-SNAP-M105I Figure 8

WT MHC Napahyh/hyh

Na + K + TCR Orai1 ATPase

ADP ATP + Na WT

ATP

IP3 ATP Napahyh/hyh

mTORC2 Ca2+ Ca2+ IP3R stim NF휅B ER NFAT

Gene expression Figure 1 - figure supplement 1

ns ns 700 300

350 150 MFI of Gata-3 MFI of T-bet 0 0 WT Napahyh/hyh WT Napahyh/hyh Figure 6 -source data 1

Enrichment by Pathway Maps Number Maps p-value 1 Immune response_Generation of memory CD4+ T cells 7.72E-08 2 Development_Cytokine-mediated regulation of megakaryopoiesis 3.92E-07 3 Immune response_Differentiation of natural regulatory T cells 9.28E-06 4 Immune response_CD40 signaling 1.16E-05 5 Apoptosis and survival_Anti-apoptotic TNFs/NF-kB/Bcl-2 pathway 3.27E-05 6 Immune response_CD137 signaling in immune cell 3.38E-05 7 Transport_RAN regulation pathway 3.41E-05 8 Apoptosis and survival_Granzyme A signaling 4.14E-05 9 Immune response_CRTH2 signaling in Th2 cells 4.47E-05 10 Signal transduction_PTMs in IL-23 signaling pathway 5.04E-05 11 Cell cycle_Role of Nek in cell cycle regulation 6.09E-05 12 Immune response_IL-2 activation and signaling pathway 9.12E-05 13 Development_PEDF signaling 9.12E-05 14 Development_G-CSF signaling 9.12E-05 15 Immune response_IL-15 signaling via JAK-STAT cascade 1.23E-04 16 Immune response_IFN alpha/beta signaling pathway 1.52E-04 17 Immune response_Th17, Th22 and Th9 cell differentiation 1.93E-04 18 Immune response_Th1 and Th2 cell differentiation 2.23E-04 19 Transcription_Epigenetic regulation of gene expression 2.42E-04 20 Immune response_CCR5 signaling in macrophages and T lymphocytes 2.70E-04 21 Immune response_IL-10 signaling pathway 4.10E-04 22 Immune response_IL-4 - antiapoptotic action 4.58E-04 23 Immune response_Naive CD4+ T cell differentiation 4.87E-04 24 Immune response_IL-15 signaling 4.99E-04 25 Apoptosis and survival_Regulation of Apoptosis by Mitochondrial Proteins 7.22E-04 26 Development_GM-CSF signaling 7.68E-04 27 7.68E-04 28 Translation_IL-2 regulation of translation 8.52E-04 29 Development_Regulation of telomere length and cellular immortalization 9.53E-04 30 Immune response_IL-9 signaling pathway 1.09E-03 31 Immune response_IL-16 signaling pathway 1.16E-03 32 Development_Thrombopoetin signaling via JAK-STAT pathway 1.24E-03 33 Apoptosis and survival_APRIL and BAFF signaling 1.57E-03 34 Immune response_IL-27 signaling pathway 1.74E-03 35 Immune response_IL-17 signaling pathways 2.01E-03 36 Immune response_IL-18 signaling 2.01E-03 37 Immune response_IL-23 signaling pathway 2.04E-03 38 Apoptosis and survival_Lymphotoxin-beta receptor signaling 2.20E-03 39 Immune response_IL-7 signaling in B lymphocytes 2.45E-03 40 Signal transduction_AKT signaling 2.45E-03 41 Immune response_IL-4 signaling pathway 2.71E-03 42 Immune response_TNF-R2 signaling pathways 3.00E-03 43 Immune response_NF-AT signaling and leukocyte interactions 3.63E-03 44 Immune response_TLR5, TLR7, TLR8 and TLR9 signaling pathways 3.99E-03 45 Development_TGF-beta receptor signaling 4.76E-03 46 Immune response_T regulatory cell-mediated modulation of effector T cell and NK cell functions 6.11E-03 47 ATP/ITP metabolism 6.15E-03 48 Development_S1P1 receptor signaling via beta-arrestin 6.41E-03 49 Immune response_IL-22 signaling pathway 6.41E-03 50 Immune response _IFN gamma signaling pathway 6.62E-03