Species Limits and Phylogeny of Burrowing Snakes of The

Home , Achalinus, Achalinus rufescens, Arizona (snake), Atractaspidinae, Azemiops, Boodontinae

Phylogenetic Biology of the Burrowing Snake Tribe Sonorini (Colubridae)

Item Type text; Electronic Dissertation

Authors Holm, Peter, 1959-

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 30/09/2021 03:36:11

Link to Item http://hdl.handle.net/10150/196086 1

PHYLOGENETIC BIOLOGY OF THE BURROWING SNAKE TRIBE SONORINI (COLUBRIDAE)

by Peter Alfred Holm

______

A Dissertation Submitted to the Faculty of the DEPARTMENT OF ECOLOGY AND EVOLUTIONARY BIOLOGY In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY In the Graduate College THE UNIVERSITY OF ARIZONA

2 0 0 8 2

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Peter Holm entitled Phylogenetic Biology of the Burrowing Snake Tribe

Sonorini (Colubridae) and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy

______Date: December 17, 2007 Judith Bronstein

______Date: December 17, 2007 Brian Enquist

______Date: December 17, 2007 Peter Reinthal

______Date: December 17, 2007 Cecil Schwalbe

Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.

______Date: December 17, 2007 Dissertation Director: Judith Bronstein

______Date: December 17, 2007 Co-Chair: Cecil Schwalbe 3

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at The University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment the proposed use of the material is in the interests of scholarship. In all other instances, however, permission must be obtained from the author.

SIGNED: ______Peter Holm______

ACKNOWLEGEMENTS

Completion of this project has been a long and eventful journey from my original conception of it in 1994, first presentation of results in La Paz 2000, and to its resurrection and final defense in 2007. This would not have been possible without the assistance and encouragement of many. Charles Lowe welcomed me back into the herpetology lab at the University of Arizona in 1992. He encouraged me to pursue thus project and I am sure he would have liked to do it himself. John Lundberg was willing to take me on as a graduate student even though my interest was in snakes rather than catfishes. I really did enjoy his course on South America. Committee members Judie Bronstein, Alan DeQuiroz, Harry Greene, Phil Hastings, Wayne Maddison, Peter Reinthal, Cecil Schwalbe, and Oscar Ward helped me to overcome many obstacles and provided valuable insight into the science of biology. Graduate coordinators Suzanne LaClair and Sue Whitworth really helped to keep my program alive.

I am grateful to Kent Beaman, George Bradley, Mike Douglas, Darrel Frost, Steve Gotte, Harry Greene, Lee Grismer, Michelle Koo, Charles Lowe, John Lundberg, Roy McDiarmid, Robert McCord, Brad Moon, Charlie Painter, Philip Rosen, Greg Schneider, Sally Shelton, John Simmons, Barbara Stein, Thomas Van Devender, Wayne Van Devender, and Humberto Wong for their assistance with loans and workspace. Robert McCord, Thomas Van Devender, and Wayne Van Devender provided their osteological collections. Dennis Cornejo, Brad Moon, Cecil Schwalbe, Thomas Van Devender, and Wayne Van Devender provided many color slides of live specimens. Pete Mayne and Philip Rosen collaborated on field studies. I thank Judie Bronstein, Darrel Frost, David Maddison, Wayne Maddison, Robert McCord, Peter Reinthal, Cecil Schwalbe, and Dale Turner for their comments on one or more versions of the manuscript. I also thank Al Agellon for assistance and patience with my molecular work. The molecular component of this investigation was funded by a grant from the Research Training Group in the Department of Ecology and Evolutionary Biology, University of Arizona.

DEDICATION

To all those who have gone before me, I owe the world and the promise it holds.

To my parents, I owe my interest in science beginning with that first trip to the American

Museum of Natural History when I was six. 6

TABLE OF CONTENTS

ABSTRACT...... 9

INTRODUCTION ...... 10

PRESENT STUDY...... 12

APPENDIX A. PART ONE: MORPHOLOGICAL VARIATION AND SPECIATION IN THE BURROWING SNAKE GENUS CHILOMENISCUS (COLUBRIDAE)...... 15

Abstract...... 16 Introduction...... 17 Materials and Methods...... 19 Geographic variation...... 20 Taxonomy ...... 26 Status of unbanded specimens ...... 27 Probable mislabeled specimens...... 28 Species Accounts ...... 29 Patterns of Morphological Diversification ...... 38 Environment...... 38 Fossorial traits...... 39 Primitive traits ...... 40 Speciation...... 41 Cape Region vicariance...... 41 Gulf of California...... 42 Mid-Peninsular seaway ...... 43 Reticulate Evolution ...... 44 Unresolved Questions ...... 46 Key to the Species of Chilomeniscus...... 46 Acknowledgements...... 47 Literature Cited...... 48 Tables, Figures, and Appendices ...... 52

APPENDIX B. PART TWO: PHYLOGENETIC SYSTEMATICS OF THE BURROWING SNAKE TRIBE SONORINI (COLUBRIDAE)...... 64 7

Abstract...... 65 Introduction...... 66 Materials and Methods...... 68 Molecular data set ...... 69 Morphological data set...... 70 Phylogenetic analysis ...... 84 Results...... 85 Molecular analysis...... 85 Variability of the molecular results ...... 86 Status of Carphophis amoenus ...... 87 Nearest relatives of the Sonorini ...... 87 Monophyly of the Sonorini...... 88 Relationships within the Sonorini...... 88 Morphological analysis ...... 89 Variability of the morphological results...... 90 Comparison of morphological and molecular results ...... 91 Discussion...... 91 Systematics of New World Colubroidea ...... 91 Monophyly of the Sonorini...... 94 Tantilla Clade ...... 95 Ficimia Clade ...... 103 Sonora Clade ...... 105 The future of sonorinine Systematics...... 107 Acknowledgements...... 107 Literature Cited...... 108 Tables, Figures, and Appendices ...... 118

APPENDIX C. PART THREE: MORPHOLOGICAL AND ECOLOGICAL DIVERSIFICATION OF THE BURROWING SNAKE TRIBE SONORINI (COLUBRIDAE) ...... 184

Abstract...... 185 Introduction...... 186 Methods ...... 188 Assessment of fossoriality ...... 188 Ecology ...... 189 Analysis of character evolution ...... 191 Phylogenetic hypothesis...... 192 Results...... 193 8

Morphology...... 193 Diet and feeding behavior...... 195 Reproduction...... 198 Predation and antipredator behavior...... 200 Environment and activity...... 202 Highly fossorial sonorinines...... 204 Discussion...... 211 Phylogenetic context...... 211 Biogeography...... 212 Slenderization and miniaturization...... 214 Fossoriality ...... 217 Acknowledgements...... 218 Literature Cited...... 219 Tables, Figures, and Appendices ...... 227

ABSTRACT

The Sonorini is a diverse assemblage of cryptozoic to fossorial snakes. Molecular

and morphological evidence is ambiguous as to whether the tribe is monophyletic or

consists of two or more independent clades. Morphological analysis, using Coluber

constrictor and Liochlorophis vernalis as outgroups, indicates that the genera Conopsis,

Ficimia, Gyalopion, Pseudoficimia, Stenorrhina, and Sympholis form the sister group to

Chilomeniscus, Chionactis, and Sonora. This clade, in turn, is sister to Scolecophis and

Tantilla. The putative genera Geagras and Tantillita are nested within the Tantilla calamarina and T. taeniata species groups, respectively.

Each of the three major clades contains one or more highly fossorial forms that

appear to be independently derived. Morphometric and natural history data from museum

specimens, field studies, and the literature indicate that taxa with highly fossorial

morphologies specialize on buried prey. Sympholis is at least a part-time commensal of

leaf-cutting ants that feeds on beetle grubs; Chilomeniscus is a soil burrower that feeds on

burrowing roaches and vermiform beetle larvae, whereas other members of the Ficimia

and Sonora clades feed on various combinations of arachnids, orthopterans, and beetle

grubs. Geagras redimitus, presumably a detritus burrower, feeds on vermiform beetle

larvae, whereas Scolecophis and most Tantilla feed on centipedes. At least three other

Tantilla species, including T. gracilis, T. relicta, and T. vermiformis, show parallel trends

towards miniaturization, fossorial morphology, and diet of insect larvae.

INTRODUCTION

My fascination with amphibians and reptiles, especially snakes, dates back to my early childhood in southern Florida. Unlike wild birds and mammals, I could actually catch snakes with my bare hands. Despite their apparently simple and specialized body plan, snakes exhibit considerable variation in life form and have radiated to inhabit nearly all biotic communities. Physical limitations of these legless animals must play an ever important role in their evolution. To capture prey, snakes must use stealth or select prey that are less mobile. To avoid predators, snakes must navigate in relatively predator-free environments, be nearly invisible, appear dangerous, or use trickery to escape. As with most predators, snake morphology is subject to adaptive tradeoffs involving locomotion in different habitats, prey capture and handling, defense, and reproduction.

Major evolutionary changes in morphology appear to be correlated with shifts in ecology. Interdependence of various ecological and morphological parameters makes it difficult to go beyond functional morphology and correlation to explanatory hypotheses without a historical framework. Few studies of snakes have attempted to generate a phylogeny for a diverse group and then use that phylogeny as a framework to explore the evolution of life forms and ecologies.

Perhaps the most important prediction in biology comes from two fundamental assertions in Darwin’s Origin of Species. First, ancestral species give rise to descendent species, resulting in a tree-like pattern of relationships. Second, heritable changes occur along lines of descent (i.e., along the branches of the tree). From these two premises, one 11

can predict that variation in the biological world should be arranged in nested sets (i.e., a hierarchical pattern). This is rather profound because it is neither random, nor regular, and it is easily verified. It is of particular importance to phylogenetic biology because it allows one to reconstruct a phylogenetic tree from a table of character variation under the assumption of parsimony.

I decided to study the evolution of one diverse group of related snake species.

Several such groups dominate the North American snake fauna, including pitvipers

(Crotalinae), garter snakes and their allies (Thamnophiini), rat snakes (Lampropeltini), racers (Colubrini), and burrowing snakes (Sonorini). Sonorini was the least studied group and the one that attracted me to the American Southwest.

I report on an investigation into the phylogenetic biology of the Sonorini. The work is presented in three manuscripts, included as Parts 1-3. In the following section, I provide a summary based on the three manuscript abstracts. 12

PRESENT STUDY

In Part One, I selected a highly fossorial group of sonorinines, the sand snakes or genus Chilomeniscus. My intent was to focus on individual, ecotypic, and geographic variation of fossorial traits to gain insight into their evolution. That effort became a revision of species taxonomy and yielded some interesting patterns of morphological variation.

Examination of morphology and geographic distribution revealed five allopatric species of Chilomeniscus based on concordant discontinuities in diagnostic traits. New diagnoses and a key are provided. Chilomeniscus stramineus is restricted to the southeastern Cape in the Cape Region of Baja California. Chilomeniscus fasciatus is resurrected to accommodate all peninsular populations occurring north and west of the

Sierra de la Laguna. All Arizona, Sonora, and Sinaloa populations belong to C. cinctus.

Three species, C. cinctus, C. fasciatus, and the island endemic, C. punctatissimus, are polymorphic for banded and unbanded color patterns. The island endemic, C. savagei is a monomorphic banded species, whereas C. stramineus is a monomorphic unbanded species.

Whereas individual fossorial traits vary widely among Chilomeniscus, the overall degree of fossoriality varies much less. Peripheral populations tend to exhibit similar primitive traits and unique derived traits. Some variation is correlated with ecological gradients. Geological evidence suggests nearly simultaneous vicariance during the

Pliocene. However, multiple episodes of secondary contact and the peripheral 13

distribution of primitive species suggest multiple invasions of the Cape Region and possibly a taxon cycle.

In Part Two, I produced a phylogeny of the Sonorini to serve as the historical framework for a subsequent investigation of diversification. Part Two also resulted in the generic reallocation of several species and greater insight into the composition of species groups in the genus Tantilla.

Morphological analysis, using Coluber constrictor and Liochlorophis vernalis as outgroups, indicates that the genera Conopsis, Ficimia, Gyalopion, Pseudoficimia,

Stenorrhina, and Sympholis form the sister group to Chilomeniscus, Chionactis, and

Sonora. This clade, in turn, is sister to Scolecophis and Tantilla. The genera Geagras and

Tantillita are nested within the Tantilla calamarina and T. taeniata species groups, respectively. Tantilla alticola, T. bairdi, T. moesta, T. schistosa, and T. semicincta are also added to the T. taeniata group and T. petersi is added to the T. melanocephala group.

Species with many unique character states, including T. albiceps, T. nigra, T. shawi, and

T. supracincta, are difficult to classify.

Molecular analyses using parsimony, distance, and Bayesian criteria placed one

or more outgroup species between two clades of sonorinines. Some analyses placed

Scolecophis away from Tantilla. Results suggest that sonorinines may consist of two

monophyletic groups that are closely related to Phyllorhynchus, Trimorphodon, and some colubrine racers. An osteological examination of 28 outgroup taxa revealed that

Carphophis amoenus possesses a modified septomaxilla that may be otherwise unique to sonorinines. However, molecular analyses clearly placed Carphophis with North 14

American xenodontines.

Finally, Part Three explored the ecological and morphological diversification of sonorinines. The colubrid snake tribe Sonorini is a remarkably diverse assemblage of over eighty species that range from desert to rainforest and is centered in the tropical deciduous forest of west central Mexico. I used morphological characters and some mitochondrial DNA sequences to reconstruct phylogenetic relationships, providing a framework to explore morphological and ecological diversification. Morphometric and natural history data from museum specimens, field studies, and the literature indicate that taxa with highly fossorial morphologies specialize on buried prey. Sympholis is at least a part-time commensal of leaf-cutting ants that feeds on beetle grubs; Chilomeniscus is a soil burrower that feeds on burrowing roaches and vermiform beetle larvae, whereas other members of the Ficimia and Sonora clades feed on various combinations of arachnids, orthopterans, and beetle grubs. Geagras redimitus, presumably a detritus burrower, feeds on vermiform beetle larvae, whereas Scolecophis and most Tantilla feed on centipedes. At least three other Tantilla species, including T. gracilis, T. relicta, and

T. vermiformis, show parallel trends towards miniaturization, fossorial morphology, and diet of insect larvae. With a maximum known length of 171mm, T. vermiformis may be the smallest known alenthophidian.

APPENDIX A. PART ONE: MORPHOLOGICAL VARIATION AND SPECIATION IN THE BURROWING SNAKE GENUS CHILOMENISCUS (COLUBRIDAE)

Abstract

Examination of morphology and geographic distribution of the genus

Chilomeniscus revealed five allopatric species based on concordant discontinuities in diagnostic traits. New diagnoses and a key are provided. Chilomeniscus stramineus is restricted to populations in the southeastern Cape in the Cape Region of Baja California.

Chilomeniscus fasciatus is resurrected to accommodate all peninsular populations occurring north and west of the Sierra de la Laguna. All Arizona, Sonora, and Sinaloa populations belong to C. cinctus. Three species, C. cinctus, C. fasciatus, and the island endemic, C. punctatissimus, are polymorphic for banded and unbanded color patterns.

The island endemic, C. savagei, is a monomorphic banded species, whereas C. stramineus is a monomorphic unbanded species.

Whereas fossorial traits vary widely among Chilomeniscus, the overall degree of fossoriality varies much less. Peripheral populations tend to exhibit similar primitive traits and unique derived traits. Some variation is correlated with ecological gradients.

Geological evidence suggests nearly simultaneous vicariance during the Pliocene.

However, multiple episodes of secondary contact and the peripheral distribution of primitive species suggest multiple invasions of the Cape Region and possibly a taxon cycle.

Introduction

Sand snakes possess highly derived and fossorial morphologies for the tribe

Sonorini, as indicated by reduced cephalic scutellation, small eye, and short tail. They are

highly sedentary and exhibit considerable geographic variation. Various characters

exhibit clinal variation, local polymorphism, or major discontinuities in geographic

trends. The genus range is over two thousand kilometers long, wrapped around the Gulf

of California, and generally within one hundred kilometers of the coast except for

populations in the Gila and Yaqui River basins of Arizona and Sonora. Chilomeniscus likely includes subdivided populations at various stages of speciation based geographic variation, discontinuous distribution, and a taxonomic history that, at one time or another, recognized 8 forms. Putative species include endemic peripheral isolates and at least one widespread complex with highly differentiated populations.

A close relationship between Chilomeniscus and Chionactis has been suggested

by Klauber (1951) and Bury et al. (1970), whereas Chionactis and Sonora have long been

considered close (Stickel 1943). Molecular and morphological phylogenetic analyses

(Part 2) disagreed as to the arrangement. The molecular analysis placed Chionactis and

Sonora together, whereas the morphological analysis placed Chilomeniscus and

Chionactis together. However, both analyses indicated that these three genera form a distinct clade within the tribe Sonorini. The genera Sonora, Chionactis, and

Chilomeniscus seem to form a morphocline of increasing fossorial specialization (Part 3).

Eight taxa of Chilomeniscus, six species and two subspecies, have been described since 1860. Four species were recognized in the 1800's (Cope 1900). These were C. 18

stramineus Cope (1860), C. cinctus Cope (1861), C. ephippicus Cope (1867), and C. fasciatus (Cope, 1892). Mocquard (1899) combined C. fasciatus with C. cinctus and Van

Denburgh and Slevin (1913) united C. ephippicus with C. cinctus. Insular endemics, C. punctatissimus (Van Denburgh and Slevin 1921) and C. savagei (Cliff 1954) were added so that four species are generally recognized. Recent taxonomy identified all unbanded specimens as C. stramineus and, except for the two island endemic species all banded snakes are treated as C. cinctus (Banta and Leviton 1963, Stebbins 1985). Grismer et al.

(2002) proposed combining all material under C. stramineus except for the island endemic C. savagei.

Other changes have been proposed but not followed. Schmidt (1922) alternatively united C. fasciatus with C. ephippicus while retaining C. cinctus. Smith and Taylor

(1945) included C. punctatissimus as a junior synonym of C. cinctus. However, Banta and Leviton (1963) and Flores-Villela (1993) retained it as a distinct species. Bogert and

Oliver (1945), observing differences between mainland and peninsular C. cinctus, suggested the possibility of resurrecting C. fasciatus to accommodate the latter.

This paper explores geographic variation in Chilomeniscus, revises species level taxonomy, and discusses speciation in light of geological evidence. My original reason for initiating a study of Chilomeniscus was to see if ecological correlates of geographic variation could shed light on the evolution of fossorial traits. After completing an investigation of fossorial traits in Chilomeniscus, it became clear that the deepest divisions within the group were not consistent with currently recognized species limits as summarized by Banta and Leviton (1963) and Stebbins (1985). My taxonomic 19

conclusions also differ from those of Grismer et al. (2002).

Materials and Methods

I examined specimens from all geographic regions, with some emphasis on type

localities, and included all available size classes. First I examined 185 specimens in detail

as part of a study of fossorial morphology. I subsequently compiled data on selected

characters for an additional 625 snakes including museum specimens, published

accounts, and unpublished photographs and field notes.

Some characters exhibit sexual dimorphism. I determined sex by dissection, the

presence of everted hemipenes, by examining tail base diameter, or by plotting ventral

scale count minus subcaudal scale count on one axis and tail length divided by snout-vent

length on the other. Many preserved specimens already had ventral and subcaudal

incisions permitting observation of ovaries in females and retracted hemipenes in males.

Nearly all snakes sexed by dissection resolved into two clusters determined by sexual

dimorphism, permitting reliable estimation of sex for undissected individuals.

Snout-vent and tail lengths were recorded to the nearest 1mm. Dorsal and lateral

images of the heads of 185 specimens were produced with a camera lucida and landmark

distances were recorded to the nearest 0.01 to 0.002mm as magnification ranged from 10

to 50X. Refer to Stebbins (1985) or Conant and Collins (1991) for labeled illustrations of

head scutellation.

I evaluated diagnostic characters reported in the literature and attempted to

discover new characters. Many useful characters appear in the original taxonomic 20

descriptions, revisions, and keys. In order to discover other, potentially informative characters, I arranged specimens on a table in a pattern approximating their geographic distribution. I also examined camera lucida images of heads in a similar manner. This procedure helped to reveal differences in mean or frequency between geographic regions.

I assessed whether a character was primitive (pleisiomorphic) or derived (apomorphic) by comparing the condition in Chilomeniscus with that of Chionactis, Sonora, and more distantly related members (outgroups) of the Sonorini. I did not make an assessment if the condition was variable among outgroups.

There are many ways to compare specimens and partition the series into species.

Concordance of multiple, independent differences would provide good evidence for resolving sympatric species. One or more discrete differences would be sufficient to diagnose allopatric species. Examining variation in a geographic context facilitated the distinction of variation within and between species. I considered a major difference between proximate populations of two putative species to be valid even if more distal populations were less distinct. I reasoned that such a difference was evidence that the two putative species had a sufficient history as separate evolutionary units. Finally, I compared species distributions to both current and historical geographic barriers to shed light on possible speciation mechanisms.

Geographic variation

Apical dots: A dark brown to black dot or streak on the posterior tip of each

dorsal scale except for the lower one or two rows (Fig. 1). This was a key character in the 21

original description of C. stramineus (Cope 1860). Apical dots appear only on unbanded snakes. This condition is found on all snakes south and east of the Sierra de la Laguna, from San Bartolo to Cabo San Lucas. I will herein refer to this area as the southeastern

Cape. To the north and west of this region, occasional specimens have some faint apical dots confined to the anterior portion of the body.

Rostral: Rostral plate contacting the prefrontals and separating the internasals

(Fig. 2). This was a key character in the original description of C. cinctus (Cope 1861).

This condition appears in nearly every specimen except for material from Islas Cerralvo,

Espiritu Santo, and Partida Sur, as well as the southeastern Cape. Exceptions to this trend include three specimens from Arroyo Seco at the northern limit in Baja California and four specimens at the Isthmus of La Paz. One specimen from Alamos, Sonora, has the right internasal reaching the midline and touching the left prefrontal but not the left internasal. Contact between the internasals is the primitive state and is confined to the most peripheral locations. A mensural extension of this character is the width of the gap between internasals when present. The gap tends to be wider in mainland specimens than elsewhere.

Rings: Dark brown to black rings completely encircling the body. This was another key character in the original description of C. cinctus (Cope 1861). Specimens in which more than half of the bands encircle the body are found in only three regions: Isla

Cerralvo; from Ballenas Bay and northward along the Pacific Coast, including Isla

Cedros; and southeastern Sonora. Complete rings are also primitive and confined to peripheral populations. 22

Loreal: Prefrontals and supralabials separated. This was a key character in the original description of C. ephippicus (Cope 1867). This primitive condition is due either to the presence of a loreal plate or to contact between the nasal and preocular. I interpret the latter as fusion between the loreal and postocular because both states appear in the same populations. The primitive condition is found most commonly in Arizona, occasionally in Sonora and northern Baja California. One specimen from the southeastern

Cape (CAS 154113) has a loreal plate on the left side.

Loss of the loreal plate leading to contact between the prefrontal and supralabials is a derived condition common to many fossorial snakes. A mensural extension of this character is the length of contact between prefrontal and supralabials when present. This length tends to be shorter in mainland specimens than elsewhere.

Saddles: Dark bands not reaching the venter. This was another key character in the original description of C. ephippicus (Cope 1867). Dark saddles instead of rings tend to occur in more arid regions throughout Baja California and the mainland. Intermediate between true saddles and rings are bands that reach the venter but do not encircle the body.

Spots: A dark brown central spot on each scale of the pale bands. This was a key character in the original description of C. punctatissimus (Van Denburgh and Slevin

1921). This spotting is indistinguishable from the spotting on unbanded snakes described as C. stramineus esterensis by Hoard (1939). Similar spots appear on some banded snakes throughout Baja California del Sur except for the southeastern Cape. Each spot generally covers most of the anterior and central portion of a scale with the pale lateral 23

and posterior edges giving the impression of a pale net. Where spots occur, there is a continuum from well developed to poorly developed to absent. Only one specimen from the mainland (UAZ 45016) has similar spots and they are poorly developed.

Number of ventrals: This was a key character in the original description of C. stramineus esterensis (Hoard 1939). Snakes from the arid Pacific coast of Baja California del Sur have a much higher ventral count than snakes from the more mesic Cape Region.

A similar pattern occurs on the mainland, where snakes from the Sonoran Desert have a higher ventral count than snakes from the thornscrub and tropical deciduous forest of southeastern Sonora. Snakes from Isla Cerralvo also have a very high ventral count, which contrasts with neighboring Islas Espiritu Santo and Partida Sur as well as the adjacent coast of Baja California. A high ventral count is primitive (i.e., the ancestral state).

Number of subcaudals: This was another key character in the original description of C. stramineus esterensis (Hoard 1939). Hoard found that snakes from La

Paz had a higher average subcaudal count than snakes from Estero Salinas. Although I found a difference as well, it was not statistically significant. A high subcaudal count is primitive.

Number of black bands: Bands include rings and saddles. Bogert and Oliver

(1945) noted that peninsular specimens tended to have more bands than mainland specimens. On each side of the Gulf of California, snakes with a higher band count tend to have fewer bands that encircle the body or even reach the venter. Also, where both banded and unbanded snakes occur together, the banded specimens have a higher average 24

band count than in other regions.

Frontal: Frontal expanded anteriorly, contacting the internasals, and separating the prefrontals (Fig. 2). This was a key character in the original description of C. savagei

(Cliff 1954). This condition appears on all banded snakes from Isla Cerralvo, some snakes from Islas Espiritu Santo and Partida Sur as well as some snakes from the southeastern Cape. Snakes from Islas Espiritu Santo and Partida Sur with this condition differ in that the frontal contacts the internasals unequally (Fig. 2). Contact between the prefrontals is primitive.

Nasal: Most specimens have a suture that passes through the naris and completely divides the fused nasal-internasal. Two specimens from southeastern Sonora (LACM

103473, 103475) are primitive and have distinct internasal and nasal plates compared to the fused internasal-nasal I observed in all other specimens.

Many snakes have two sutures below the naris. This is most common on the mainland and the northern peninsula. Some have no sutures below the naris and this is most common in the Isla Cerralvo population.

Position of the largest infralabial: Generally the fourth or fifth infralabial from the anterior is clearly largest. Occasionally they appear equal or, more rarely, the third or sixth are largest. In most Sonorini, the fourth is largest. The fourth infralabial is largest in

98.0% of the specimens from the southeastern Cape, 80.0% from Isla Cerralvo, 69.3% from the mainland, 11.9% from Islas Espiritu Santo and Partida Sur, and 10.6% from the remainder of the peninsula. The primitive condition is for the fourth infralabial to be largest. 25

Temporal: Length of contact between anterior temporal and seventh supralabial.

This length tends to be larger in mainland specimens than elsewhere. The primitive condition is for this length to be smaller or absent. It is absent in snakes with two posterior temporals. One specimen from Isla Cerralvo and few from the southeastern

Cape have two posterior temporals instead of the usual one.

Postorbital dark spot: This only occurs in the southeastern Cape where it is present on two thirds of all specimens. The spot appears to be derived from the first band or head crescent of banded snakes.

Midline pinstripes: Dark nuchal pinstripes present on scale midlines (unbanded specimens). This only occurs in the southeastern Cape.

Edge pinstripes: Dark nuchal pinstripes present on scale edges (unbanded specimens). This occurs on mainland and peninsular specimens but not on snakes from the southeastern Cape.

Pale spots: Dark bands with pale spots. This only occurs on specimens from Isla

Espiritu Santo and on the peninsula from around the Sierra de la Giganta. This is within the geographic range of specimens having spots in the pale bands.

Intermediate pattern: Where banded and unbanded snakes occur together there may be snakes with an apparently intermediate pattern. Some snakes from Loreto, south to the Sierra de la Laguna, have numerous faint bands. Banta and Leviton (1963, Fig. 3) provides an example. Other specimens have so many bands they become indistinct posteriorly. Some have pale spots in the dark bands and dark spots in the pale bands that further obscure the pattern. Many specimens from Isla Espiritu Santo appear this way. 26

Some specimens from the north and west side of the Sierra de la Laguna are dark with pairs of blotches visible anteriorly (e.g., MVZ 190067). A few are pale with a single conspicuous nape band (LSUHC 1754).

Apparent intermediate specimens from the mainland have vague bands consisting of two or four black spots each and becoming less regular posteriorly.

Taxonomy

I recognize five allopatric species of Chilomeniscus based on the identification of

multiple character discontinuities. Species geographic distributions are mapped in Figure

3. Summary statistics for characters are provided in Tables 1 and 2 and aspects of color

pattern are summarized in Table 3. Chilomeniscus savagei and C. stramineus sensu

stricto, were the easiest to recognize. The remaining three species exhibit fewer major

differences but justify recognition.

Although the spotted color pattern of C. punctatissimus is similar to some

specimens around the Sierra de la Giganta, it differs from those of more proximal

localities around La Paz. It also differs by its primitive arrangement of internasals in

contact at the midline. Therefore, I believe that it justifies separate status from the

widespread species. Furthermore, its island distribution provides a plausible hypothesis

for speciation.

Despite broad overlap in many characters, I partitioned the remaining widespread

material into mainland and peninsular species because, when characters are considered

together, the two groups appear distinct (Fig. 4). Also, similarity between the two species 27

for some characters involves distal rather than proximal populations (i.e., specimens from the northern peninsula are not similar to those from northwestern Sonora or southwestern

Arizona), suggesting a long period of isolation. The oldest available name for the peninsular species is C. fasciatus (Cope). Chilomeniscus cinctus and C. fasciatus are cryptic species because one needs a dissecting scope outfitted with an ocular micrometer or camera lucida in order to measure diagnostic characters. Cope’s (1900) line drawings indicate typical relative differences between these species for the internasal, loreal, and temporal areas of the head.

Status of unbanded specimens

With few exceptions, I found that nearly all unbanded museum specimens were cataloged as C. stramineus, even if they lacked characteristics of the type description such as contact between the internasals and apical dots. In three regions where many banded and unbanded snakes have been found together, there is no significant difference between the two forms with respect to any other character (Tables 1 and 2). Furthermore, each of these regions includes specimens that appear intermediate between banded and unbanded states. I concur with suggestions by Stebbins (1985) and Grismer (1994) that where both patterns exist, they represent polymorphic populations. However, populations in the different regions are not necessarily conspecific and they all differ strikingly from

C. stramineus of the southeastern Cape Region.

When Cope (1892) described C. s. fasciatus, he stated that there were no differences between it and C. s. stramineus in squamation. He based his description on 28

two banded specimens collected by Mr. Belding at La Paz in 1882. According to Van

Denburgh (1895), Mr. Belding collected both C. fasciatus and C. stramineus in La Paz in

1882. I believe that when Cope described C. s. fasciatus, he was examining banded and unbanded C. fasciatus and no C. stramineus sensu stricto for comparison. Furthermore, he apparently didn’t review his original description of C. stramineus or he would have noticed the difference in head scutellation.

Probable mislabeled specimens

UAZ 39526 is clearly a specimen from southeastern Sonora, yet has a recorded locality of 12 miles east of Ajo, Arizona. It was a former Arizona-Sonora Desert Museum

(ASDM) specimen that was collected within a week of another from Navajoa, Sonora.

According to specimen records, both were kept alive at ASDM through the fall and winter. The Sonoran specimen card had been subsequently annotated "specimen missing".

Two LSUHC specimens, 1755 and 1760, appear to have had their labels transposed. Similarly, LACM 51630 and 51631 appear to have had their labels switched.

Each case involves a specimen from the vicinity of La Paz and another from the southeastern Cape, but the specimens are clearly C. stramineus and C. fasciatus, respectively. Also, each case involves a pair of specimens that were collected at about the same time. I therefore conclude that the labels were inadvertently switched.

Powers and Banta (1974) described an unbanded specimen from Isla Cerralvo.

Although I could only examine the photograph, the specimen is clearly C. fasciatus. Its 29

distinctive nape band is remarkably similar to LSUHC 1754 from the northern Sierra de la Laguna. Grismer et al. (2002) suggested that this Isla Cerralvo specimen was probably mislabeled.

Species Accounts

Chilomeniscus cinctus Cope

Chilomeniscus cinctus Cope, 1861, Proc. Acad. Nat. Sci. Philadelphia, 13:303 (type

MCZ 24; near Guaymas, Sonora, Mexico).

Chilomeniscus ephippicus Cope, 1867, Proc. Acad. Nat. Sci. Philadelphia, 19:85 (type

USNM 8897; Arizona Valley=Owens Valley, California--Sonora subregion).

Diagnosis.-The Sonoran burrowing snake, C. cinctus, is distinguished from C. stramineus by the absence of apical dots on all dorsal scales of the body and tail, and from C. savagei by the absence of contact between the frontal and internasals. It is distinguished from C. punctatissimus by the presence of a gap between the internasals or fewer than 35 bands. The following combination of characters distinguishes C. cinctus from C. fasciatus: total bands, excluding tip of tail, less than 21or (A+N-P)/I>0.27, where

A=length of border between anterior temporal and seventh supralabial, N=width gap between internasals, P=length of the border between prefrontals, and I=width of the interorbital distance.

Remarks.-Black and white photographs appear in Banta and Leviton (1963; Figs.

2 and 7) and color photos in Grismer et al. (2002; Fig. 2 bottom and middle right, and 30

Fig. 3 upper right—mislabeled in caption). Cope's description of C. ephippicus was based on two characters distinguishing it from C. cinctus. First, the prefrontals are separated from the supralabials by contact of the preocular and nasal. Second, the black bands form saddles in contrast to the annulate condition in C. cinctus. Van Denburgh and Slevin

(1913) found the prefrontal in contact with the supralabials in only five of ten sides (5 snakes from Arizona) and elected not to recognize C. ephippicus. They gave no reason for ignoring the color pattern character.

Geographic variation.-Specimens from southeastern Sonora and Sinaloa are characterized by black bands usually reaching the ventrals, numbering 16 to 21 (average

18.8, N=33) on the head through tail, excluding tip, black bands 3.5 to 6 scales long at midbody; prominent dark flecks on chin; ground color orange red dorsally, grading to yellow cream ventrally; prefrontal usually in broad contact with supralabials, rarely a loreal present; internasals narrowly to moderately separated by rostral; prefrontals in moderate to broad contact at midline; fifth infralabial largest in 68.5% (N=54 sides); ventrals 106-116 (average 110.1, N=17) in males, and 111-122 (average (114.8, N=10) in females. This assemblage occurs in central and southern Sonora from the Rio Yaqui west to the Sierra Libre and Guaymas, and from Santa Ana south to northern Sinaloa. It is known from tropical thornscrub and deciduous forest and probably represents an ecotype.

The remaining material corresponds to Cope’s Chilomeniscus ephippicus.

Specimens may be unbanded, spotted, or banded; black saddles or bands rarely forming complete rings, numbering 20 to 35 (average=24.6, N=426), on the head through tail, excluding tip, black bands 2 to 4 scales long at midbody; ground color orange dorsally, 31

grading to yellow cream ventrally; prefrontal separated from or in narrow contact with supralabials or a loreal is present; internasals widely separated by rostral; prefrontals in broad contact at the midline; fifth infralabial largest in 24.8% (N=400 sides); ventrals

110-120 (average 115.6, N=54) in males, and 118-126 (average (121.4, N=41) in females.

One unbanded specimen, UAZ 50666, was collected from along the Agua Fria

River north of Phoenix, Arizona. Otherwise, unbanded specimens are restricted to coastal sand dunes ranging from just north of Puerto Lobos south to Estero Tastiota and on the north side of Isla Tiburon. Within this range, some specimens possess dark spots arranged in vague bands anteriorly, elongate nape blotches are present or not, and there is usually a faint, plum-colored head crescent; ground color orange dorsally, grading to creamy yellow ventrally.

Distribution.-Southern Arizona to northern Sinaloa and including Isla Tiburon.

Ecological distribution includes desertscrub, thornscrub, and tropical deciduous forest between sea level and 1000 meters elevation.

Chilomeniscus fasciatus (Cope)

Chilomeniscus stramineus fasciatus Cope, 1892, Proc. U. S. Nat. Mus., 14:595 (type

USNM 12630; La Paz, Baja California).

Chilomeniscus stramineus esterensis Hoard, 1939, Jour. Ent. Zool., 31:45-46 (type LMK

30368; Estero Salina, Baja California).

Diagnosis.-The peninsular burrowing snake, C. fasciatus, is distinguished from C. stramineus by the absence of apical dots on all dorsal scales of the body and tail, and from C. savagei by the absence of contact between the frontal and internasals. It is distinguished from C. punctatissimus by any one of the following: the presence of a distinct gap between the internasals, fewer than 35 bands, or scale counts outside of the following ranges for C. punctatissimus: ventrals 112-120 in males and 118-124 in females, and subcaudals 25-27 in males and 19-25 in females. It is distinguished from C. cinctus by total bands, excluding tip of tail, greater than 20 when present and (A+N-

P)/I<0.27, where A=length of border between anterior temporal and seventh supralabial,

N=width gap between internasals, P=length of the border between prefrontals, and

I=width of the interorbital distance.

Remarks.-Black and white photographs appear in Banta and Leviton (1963; Figs.

3, 6, 8-9) and color photos in Grismer et al. (2002; Fig.2 upper right and middle left, and

Fig. 3 lower left and lower right—mislabeled in caption). Generally, banded specimens have been treated as C. cinctus and unbanded specimens as C. stramineus. The binomial was first used by Van Denburgh (1895). Schmidt (1922) united C. fasciatus with C. ephippicus to accommodate snakes with incomplete bands while retaining C. cinctus for specimens with bands encircling the body. He also assigned USNM 37521 from

Margarita Island to C. punctatissimus based on its high band count despite lacking spots.

Banta and Leviton (1963) and Powers and Banta (1974) claimed that C. s. esterensis has the internasals in contact when, in fact, not a single specimen has this condition. In the original description of C. s. esterensis, Hoard (1939) explicitly stated that the internasals 33

were separated.

Geographic variation.-Northern specimens near the Pacific Coast from Valle

Trinidad, south to Ballenas Bay and including Isla Cedros have a color pattern of black rings encircling the body. Those nearer the Gulf Coast, including Bahia de los Angeles are paler with bands that do not encircle the body. None of the specimens from Baja

California del Norte is unbanded and none has dark spots in the pale bands.

In the southern peninsula, snakes may be banded or unbanded, and spots may be present in the pale interspaces of banded specimens or scattered throughout on unbanded ones. Nearly all of the banded southern specimens have a grayish headband followed by dark flecks on the side. Unbanded snakes occur in the Magdalena Plain and Cape Region.

Specimens from the Magdalena Plain exhibit the largest body size (299mm) and highest average ventral counts (122.3 males, 127.4 females) for the species. Most specimens are unbanded. Unbanded specimens from the Magdalena Plain were formerly recognized as C. stramineus esterensis.

In the Cape Region, the proportion of banded and unbanded snakes is nearly equal. The unbanded specimens may be pale or dark; the latter are more prevalent in the mesic slopes of the Sierra de la Laguna. Some unbanded snakes have faint bands or slightly offset, paired spots visible on the anterior of the dorsum.

Distribution.-Baja California from Valle de Trinidad to Todos Santos on the

Pacific versant and from Bahia de los Angeles to Bahia de los Muertos on the Gulf of

California versant. Also known from Isla Monserrate (SDSNH 50173), Isla San Jose (SU

14035, Cliff 1954 as C. cinctus), Isla San Marcos (SDSNH 50174), and Isla Cerralvo in 34

the Gulf of California (Powers and Banta 1974, as C. stramineus) and from Isla Cedros in the Pacific Ocean (CNHM 130286 and MCZ 19731, Banta and Leviton 1963 as C. cinctus), Isla Danzante (HMLP 1750, Grismer 1989 as C. cinctus), and Isla Magdalena

(USNM 37521) in the Pacific Ocean. This species occurs in the Vizcaino, Central Gulf

Coast, and Magdalena subdivisions of the Sonoran Desert as well as California

Coastalscrub to the north and arid tropical forest to the south. The elevation range is sea level to 400 meters.

Chilomeniscus punctatissimus Van Denburgh and Slevin

Chilomeniscus punctatissimus Van Denburgh and Slevin, 1921, Proc. California Acad.

Sci., ser. 4 11:98 (type CAS 49156; Isla la Partida, Espiritu Santo Island, Baja

California).

Diagnosis.-The island burrowing snake, C. punctatissimus, is distinguished from

C. stramineus by the absence of apical dots on all dorsal scales of the body and tail and from C. savagei by its lower ventral counts, 112-120 in males and 118-124 in females, compared to 127-134 and 136-138 respectively in C. savagei. Chilomeniscus cinctus and

C. fasciatus are distinguished from C. punctatissimus by any one or more of the following: the presence of a gap between the internasals, fewer than 35 bands, or scale counts outside of the following ranges for C. punctatissimus (ventrals 112-120 in males and 118-124 in females, and subcaudals 25-27 in males and 19-25 in females).

Remarks.-A black and white photograph of the holotype appears in Banta and 35

Leviton (1963, Fig. 4) and a color photo in Grismer et al. (2002; Fig.3 upper left).

Validity of this species was questioned by Linsdale (1932) based on the occurrence of spots in the pale interspaces of specimens on the peninsula. Murphy (1983) also considered recognition unwarranted because color pattern similarity with some peninsular specimens and because of the young age of the islands according to Gastil et al. (1983).

The type locality is unclear. A narrow channel separates Isla Partida Sur from Isla

Espiritu Santo, at least during high tide. The locality for UAZ 50333 states Isla Partida

Sur. The remaining specimens are definitely from Isla Espiritu Santo and many are from

Playa Lopone on the southeastern shore. This may seem trivial, but if both the holotype and UAZ 50333 are specifically from Isla Partida Sur, then there may be geographic differentiation. These two specimens are very similar to each other and different from the remaining material. Specimens possibly from Isla Partida can be distinguished from the definite Isla Espiritu Santo specimens by any one of the following characters. All bands impinge on the ventral scales, tail bands number 6, spots on dorsal scales in the pale interspaces are well defined, and the prefrontals are separated. Among the definite Isla

Espiritu Santo specimens, none to less than half of the bands impinge on the ventrals, there are 7-12 tail bands, spots in the pale interspaces are poorly defined and sometimes absent, and only one specimen out of 20 has the prefrontals separated.

Distribution.-Isla Partida Sur and Isla Espiritu Santo in the Gulf of California near

La Paz.

Chilomeniscus savagei Cliff

Chilomeniscus savagei Cliff, 1954, Trans. San Diego Soc. Nat. Hist., 12:71 (type SU

14031; Isla Cerralvo, Baja California).

Diagnosis.-The Cerralvo burrowing snake, C. savagei, is the only banded snake with the frontal in broad contact with both internasals and lacking dark spots in the pale bands.

Remarks.-A black and white photograph of the paratype appears in Banta and

Leviton (1963, Fig. 5) and a color photo in Mara (1997). This species is found in both sand dunes and arroyos (Banks and Farmer 1962). Cliff (1954) described the color of a living specimen as having a pinkish-orange suffusion in the pale interspaces and on the venter. The prefrontals are usually widely separated by a forward extension of the frontal.

This separation is occasionally narrow, being nearly identical to the condition observed in some C. stramineus.

Distribution.-Isla Cerralvo, in the Gulf of California east of La Paz, Baja

California Sur, Mexico.

Chilomeniscus stramineus Cope

Chilomeniscus stramineus Cope, 1860, Proc. Acad. Nat. Sci. Philadelphia, 12:339 (type

USNM 4674; Cabo San Lucas, Baja California).

Diagnosis.-The San Lucan burrowing snake, C. stramineus, is an invariably 37

unbanded species that can be distinguished from all other Chilomeniscus as follows: each dorsal scale except for the lower one or two rows possesses a dark streak from the scale center to the posterior edge or confined to the apical pit as a dot; a paler version of apical dots or streaks appears in some specimens of other species, but it is invariably absent on many posterior dorsals and appears as an irregularly shaped fleck.

Remarks.-A black and white photograph appears in Banta and Leviton (1963, Fig.

1) and a color photo in Grismer et al. (2002; Fig.2 upper left). Many additional characters distinguish C. stramineus, even from proximal unbanded C. fasciatus. In C. stramineus dark stippling, appearing as nuchal pinstripes is confined to the scale midline; in contrast, unbanded forms of C. fasciatus have dark stippling on the scale edges. Unbanded, peninsular C. fasciatus also tend to have dark pigment concentrated towards the anterior of each dorsal scale, which is not seen in C. stramineus. Nearly two thirds of C. stramineus have a postorbital dark spot, a condition not seen in other species. The internasals in C. stramineus are usually in contact at the midline and are never separated by broad contact between the rostral and prefrontals. In C. stramineus the fourth infralabial is largest, whereas in C. fasciatus it is usually the fifth. In C. stramineus dorsal scale rows invariably reduce to 13 anterior to the 25th vertebral and most specimens reduce to 12 rows further posteriorly. Specimens from arid lowland areas tend to be slightly paler than those from the canyons of the Sierra de la Laguna. I observed live specimens that were pale pinkish-orange.

Grismer et al. (2002) apparently included unbanded specimens from north of the

Sierra de la Laguna in their spotted-unbanded pattern class. However, I examined the 38

same specimens and none has the apical dot pattern illustrated in Fig. 1 or the photos cited above. Assuming that Grismer et al. (2002) included C. fasciatus in their spotted- unbanded pattern class, they would not have observed other concordant character differences.

Distribution.-Extreme southeastern Baja California, east of the Sierra de la

Laguna and south of the Sierra la Gata. Found primarily in a disjunct portion of the

Central Gulf Coast subdivision of the Sonoran Desert with a marginal occurrence in arid tropical forest.

Patterns of Morphological Diversification

Environment

Several traits appear to be correlated with environment. The most striking feature

of phenotypic variation involves banded and unbanded color patterns. Two geographic

assemblages of populations with unbanded snakes are widely disjunct and nested within

populations of entirely banded snakes, suggesting the possibility of two independent

origins. All unbanded Chilomeniscus, with the exception of UAZ 50666 from Arizona,

are less than 35 km from the coast and are associated with extensive sand dunes or other

sandy habitats. A uniform color pattern appears to be more cryptic on sand, whereas

bands would be more cryptic on gravel or detritus. Spots in the pale interspaces of

banded snakes could have a similar effect of reducing contrast between pale and dark

bands.

Chilomeniscus cinctus from the more humid environments of southeastern Sonora 39

are characterized by wide dark bands that completely encircle the body. In contrast, those from the arid Sonoran Desert are unbanded or the bands are narrower and do not encircle the body. The ecotypic distinction between northern and southern C. cinctus is comparable to other taxa for which subspecies have been recognized, including

Phyllorhynchus decurtatus nubilus and P. d. morrisi; Salvadora hexalepis hexalepis and

S. h. deserticola; and Micruroides euryxanthus euryxanthus and M. e. australis. In each case, a pale or narrow banded desert race contrasts with a dark or wide-banded tropical race. Similarly, a dark brown unbanded C. fasciatus inhabits tropical forest in the Sierra de la Laguna. Although this pattern resembles Gloger’s Rule, its adaptive significance is unclear.

Ventral scale counts vary inversely with mean annual precipitation, although C. savagei appears to deviate from this trend. Similar trends appear in other sonorinines

(Part 3), but the adaptive significance of this trend is also unclear.

Other patterns may be related to soil texture. Chilomeniscus cinctus from the

Central Gulf Coast have a snout that is longer, flatter, and wider than those from thornscrub and tropical deciduous forests of southeastern Sonora. Aeolian sands on the coastal dunes are finer, more homogeneous, and more fluid-like, compared to the coarser fluvial sands and humus of interior habitats.

Fossorial traits

Several variable traits are probably related to fossoriality, including small eye, short tail, elongation of the snout, loss of the loreal, loss of the lower posterior temporal, expansion of the rostral, and expansion of the frontal. Expansion of the rostral, measured 40

as length of the rostral plus the gap it forms between the internasals, is inversely correlated with expansion of the frontal, measured as length of the frontal plus the gap it forms between the prefrontals (Fig. 5a). These two traits reach their greatest degree of development in C. cinctus and C. savagei, respectively. They appear to be separate solutions to the same problem of reducing friction during sand burrowing.

Similarly, there is an inverse relationship between the loreal and temporal characters (Fig. 5b; see Geographic Variation for definitions). As a consequence, there is less variation in the overall degree of fossoriality among specimens than would be expected, based on variation of individual traits.

Some fossorial traits vary allometrically with body size. Relative eye diameter decreases whereas relative snout length increases with increasing head length.

Primitive traits

Another interesting pattern is the peripheral and often disjunct distribution of primitive (i.e., ancestral) traits, including presence of loreals, distinct nasals, contact between internasals, two posterior temporals, high ventral and subcaudal counts, and dark rings encircling the body. Populations with the most primitive traits include C. savagei,

C. stramineus, the southeastern (tropical) population of C. cinctus, and the northwestern

(fog desert) population of C. fasciatus. A combination of isolation and selection in different environments is probably responsible for this pattern.

The variation falls into two major patterns. One conforms to the phylogenetic hypothesis for Chilomeniscus (Part 2), which places C. cinctus and C. fasciatus together with Cape endemics at the base. The other pattern suggests that C. cinctus is basal, 41

followed by C. fasciatus, and then the Cape endemics. These two patterns are consistent with a history of geographic variation in the common ancestor followed by simultaneous isolation and speciation.

Speciation

Each species of Chilomeniscus is separated from its neighbors by one or more

geographic barriers. Any explanation of speciation in Chilomeniscus should consider the

relative ages of these barriers, whether or not they have existed continuously, and the

occurrence of barriers no longer in existence. The geographically most parsimonious

explanation for speciation would conform to known vicariant events where land masses

were separated by water barriers. Increasingly less parsimonious explanations might

invoke an increasing number of dispersal events, to the point where any conceivable

scenario is possible. Factors affecting vicariance include changing sea level, horizontal faulting, and changing land elevation. Glacial cycles are the primary factor affecting sea

level, whereas tectonic events affect faulting. Erosion, volcanism, uplifting, and

downwarping all affect land elevation.

Cape Region vicariance

Two periods of significantly higher sea level occurred during the Pliocene at 5.1-

3.8 Mya and 3.3-2.9 million years ago (Mya) (Haq et al. 1987). Due to horizontal

faulting, a deep-water channel has isolated Isla Cerralvo since the Pliocene (Gastil et al.

1983). The existence of C. savagei on Isla Cerralvo suggests that Chilomeniscus were

present in the Cape Region and perhaps throughout the peninsula in the Pliocene. 42

Inundation of the Isthmus of La Paz and the San Jose del Cabo Trough separated the

Cape Region into two large islands (Grismer 1994 citing McCloy 1984).

The simplest explanation would call for the origin of C. savagei on Isla Cerralvo and C. stramineus on the southeastern Cape Island. Today, the Sierra de la Laguna effectively isolates C. stramineus from C. fasciatus because the species occur mainly in sandy environments of coastal plains and riparian corridors. The origin of C. punctatissimus is more problematic. Islas Partida Sur and Espiritu Santo are separated from the peninsula by a shallow channel and would likely have been connected to it during the last glacial maximum of the Pleistocene (Gastil et al. 1983). It is unclear if these islands existed during the Pliocene or even during prior interglacial periods. I hypothesize that C. punctatissimus originated in the Pliocene on the northwestern Cape

Island. Following reestablishment of the Isthmus of La Paz, peninsular Chilomeniscus invaded the northwestern Cape Region and eventually replaced C. punctatissimus. The latter is now relictual on Islas Partida Sur and Espiritu Santo. Baja California experienced little change during the Pleistocene except for changing climate and sea level (Grismer

1994). So, Islas Partida Sur and Espiritu Santo probably existed as islands during interglacial periods and were connected to the peninsula during glacial maxima.

Gulf of California

Deep and shallow marine sediments suggest that the Gulf of California may have existed as early as 8.2 and 12 Mya, respectively (Lyle and Ness 1991). At the end of the

Miocene, the Gulf of California extended north to what is now Parker, Arizona (Schmidt

1990). Prior to this time, the Colorado River drained westward into the Pacific Ocean. 43

Since then, it has drained into the Gulf of California and deposition of sediments has gradually pushed the delta south to its current position.

Today, the overland gap between mainland and peninsular Chilomeniscus is ca.

220 km wide and corresponds to the region with a mean annual precipitation less than

75mm (data from Hastings and Humphrey, 1969a&b). I hypothesize here that extreme aridity is responsible for the absence of Chilomeniscus. Although the related genus

Chionactis is present in the gap, its larger size, longer tail and larger eye are better for traveling long distances on the surface in search of suitable microhabitats. Competitive exclusion was suggested by Grismer (1994) and this may be a factor in the more arid environment. Both genera, however, are syntopic and abundant in some other locations— e.g., the coastal dunes north of Puerto Lobos in Sonora.

Pleistocene climatic oscillations could have provided several opportunities for mainland and peninsular Chilomeniscus to come into contact although the Colorado

River may have provided another barrier. However, absence of Chilomeniscus from Isla

Angel de la Guarda supports a view that the gap is very old because this large island separated from the peninsula within the gap. Furthermore, the region between Bahia de

Los Angeles and San Felipe seems too rugged for Chilomeniscus. It is unclear if suitable terrain would appear with lowered sea level. Indeed, determining the historical corridor for dispersal between mainland and peninsula is perplexing.

Mid-Peninsular seaway

Several authors have suggested the existence of a mid-peninsular seaway. Deep divisions within the reptilian genera Uta and Pituophis have been attributed to a mid- 44

peninsular seaway that temporarily existed at least 1 Mya (Upton and Murphy 1997,

Rodriguez-Robles and de Jesus-Escobar 1999). However, Rodriguez-Robles and de

Jesus-Escobar (1999) estimated the division between northern and southern peninsular

Pituophis to be 13.2-4.7 Mya, which is too old for a Pleistocene seaway. It is more consistent with a Miocene to Pliocene Cape Island origin with subsequent northward migration of the southern form. Alternatively, a mid-peninsular seaway may simply have existed much earlier, during one or more periods of higher sea level.

The significance of a mid-peninsular seaway for Chilomeniscus is unclear. It is possible that C. punctatissimus originated in the southern peninsula and was displaced by

C. fasciatus invading from the north. More likely, northern and southern peninsular populations, being so large and insufficiently divergent, simply merged upon disappearance of the seaway, if it ever existed.

Reticulate Evolution

Chilomeniscus may have differentiated into many distinct populations with some

going extinct, some becoming endemic species, mainland lineages combining to form C.

cinctus, and the remaining peninsular lineages combining to form C. fasciatus. Some of

the constituents of C. fasciatus may have originally been more closely related to the Cape

Region endemic species and others more closely related to C. cinctus. There is much

more color pattern variation within C. fasciatus in the southern peninsula compared to the

northern peninsula. It is possible that several regions, including the Vizcaino Peninsula,

Sierra de la Giganta, Sierra de la Laguna, and some land bridge islands, provided 45

opportunities for divergence and secondary contact leading to the color pattern variation.

The distribution of some characters among Chilomeniscus species suggests the possibility of reticulate evolution. The presence of spotted specimens in the southern half of the peninsula suggests some kind of relationship between C. punctatissimus and southern C. fasciatus. The nearly unique and derived head scutellation of C. savagei also occurs on some specimens of nearby C. stramineus and C. punctatissimus, suggesting a relationship among these three species. A similar pattern exists for the absence of dark bands in C. stramineus, some C. fasciatus, and C. punctatissimus in the Cape Region.

Possible explanations include ancestral polymorphism, introgression, or convergence.

The scenario of invasion and displacement described above would provide an opportunity for some elements of the older species to be assimilated by the invading form. Hybridization could also explain why peninsular Chilomeniscus replaced the endemic form in only part but not all of its range as in a typical taxon cycle. The best explanation for persistence of endemic species, C. stramineus and C. punctatissimus, may be the existence of intermittent geographic barriers punctuated by stable zones of hybridization.

The boundary between C. fasciatus and C. stramineus is ideally suited for investigation of a possible hybrid zone. It is bisected by two paved highways, along which many Chilomeniscus specimens have been found. A decline in the proportion of female C. fasciatus, as this boundary is approached, is intriguing.

Unresolved Questions

The significance of Gulf vicariance is unclear because it cannot be described as

an absolute barrier. Either Chilomeniscus originated prior to and was fragmented by Gulf vicariance, originated on the peninsula and colonized the mainland, or originated on the mainland and colonized the peninsula. Perhaps, molecular studies would shed light on this question. It will be important to sample each of the species throughout its geographic range and especially at its type locality.

The Cape Region with its associated islands east of the Isthmus of La Paz may

have been an island or archipelago at multiple times during the Miocene and Pliocene. In

addition to vicariance, speciation in the Cape Region may also be the product of multiple

invasions. This can add greatly to the complexity of Chilomeniscus evolutionary history.

Whether a deeper historical pattern can be uncovered will depend on other research and

is outside the scope of this discussion.

Key to the Species of Chilomeniscus

1a each dorsal scale throughout the body and tail, except rows 1 & 2 with a dark dot or

streak on the posterior apex (Fig. 1) ...... C. stramineus

1b none or few scales with apical dots ...... 2

2a frontal contacts both internasals equally (Fig. 2)...... C. savagei

2b frontal not or contacting internasals unequally...... 3

3a internasals in contact or rarely narrowly separated, bands 35 or more or unbanded,

ventrals 112-120 in males and 118-124 in females, and subcaudals 25-27 in males 47

and 19-25 in females...... C. punctatissimus

3b not as above, internasals usually separated by a distinct gap ...... 4

4a (border between anterior temporal and seventh supralabial plus gap between

internasals minus border between prefrontals) divided by interorbital distance less

than 0.27 and total bands, excluding tip of tail, greater than 20...... C. fasciatus

4b (border between anterior temporal and seventh supralabial plus gap between

internasals minus border between prefrontals) divided by interorbital distance

greater than 0.27 or total bands, excluding tip of tail, less than 21 ...... C. cinctus

Acknowledgements

I am especially grateful to Humberto Wong that we were able to coordinate

access to specimens and I enjoyed the many stimulating conversations - even though we

reached different taxonomic conclusions. I am also grateful to George Bradley, Mike

Douglas, Darrel Frost, Steve Gotte, Harry Greene, Lee Grismer, Charles Lowe, John

Lundberg, and Sally Shelton for their assistance with loans and workspace. Robert

McCord, Thomas Van Devender, and Wayne Van Devender provided their osteological

collections. Dennis Cornejo, Brad Moon, Cecil Schwalbe, Thomas Van Devender, and

Wayne Van Devender provided many color slides of live specimens. Pete Mayne and

Philip Rosen collaborated on field studies yet to be written up. I thank Judie Bronstein,

Darrel Frost, David Maddison, Wayne Maddison, Robert McCord, Peter Reinthal, Cecil

Schwalbe, and Dale Turner for their comments on one or more versions of the

manuscript. I am also grateful to the late Charles Lowe for his encouragement on this 48

project and for our many conversations on the subject.

Literature Cited

Banks, R. C., and W. M. Farmer. 1962. Observations of reptiles on Cerralvo Island, Baja California, Mexico. Herpetologica 18(4):246-250.

Banta, B. H., and A. E. Leviton. 1963. Remarks on the colubrid genus Chilomeniscus (Serpentes: Colubridae). Proc. Calif. Acad. Sci. 31(11):309-327.

Bogert, C. M., and J. A. Oliver. 1945. A preliminary analysis of the herpetofauna of Sonora. Bull. Amer. Mus. Nat. Hist. 83:297-425.

Bury, R. B., F. Gress, and G. C. Gorman. 1970. Karyotypic survey of some colubrid snakes from western North America. Herpetological 26:461-466.

Cliff, F. S. 1954. Snakes of the islands of the Gulf of California, Mexico. Trans. San Diego Soc. Nat. His. 12:67-98.

Conant, R., and J. T. Collins. 1991. A field guide to the reptiles and amphibians: eastern and central North America. Houghton Mifflin, Boston. 450 Pp.

Cope, E. D. 1860. Notes and descriptions of new and little known species of American reptiles. Proc. Acad. Nat. Sci. Philadelphia. 12:339-345.

Cope, E. D. 1861. Contributions to the ophiology of Lower California, Mexico, and Central America. Proc. Acad. Nat. Sci. Philadelphia. 13:292-306.

Cope, E. D. 1867. A collection of reptiles from the Owens Valley, made and presented by Dr. Geo. H. Horn. Proc. Acad. Nat. Sci. Philadelphia. 19:85.

Cope, E. D. 1892 (1891). A critical review of the characters and variations of the snakes of North America. Proc. U.S. Nat. Mus. 14:589-694.

Cope, E. D. 1900. The crocodilians, lizards, and snakes of North America. Report of the United States National Museum for the year ending June 30, 1898. Pp. 153-1294.

Flores-Villela, O. 1993. Herpetofauna Mexicana. Carnegie Mus. Nat. Hist. Spec. Pub. (17).

Gastil, G, Minich, J., and R. P. Phillips. 1983. The geology of the islands. Pp. 13-25, In: 49

T. Case and M. Cody, (eds.), Island biogeography in the Sea of Cortez. Univ. California Press, Berkeley.

Grismer, L. L. 1989. Chilomeniscus cinctus. Geographic distribution. Herpetol. Rev. 20(3):75.

Grismer, L. L. 1994. The origin and evolution of the peninsular herpetofauna of Baja, California, Mexico. Herpetol. Nat. Hist. 2(1):51-106.

Grismer, L. L., H. Wong, and P. Galina-Tesaro. 2002. Geographic variation and taxonomy of the sand snakes, Chilomeniscus (Squamata: Colubridae). Herpetologica 58(1):18-31.

Haq, B. U., J. Hardenbol, and P. R. Vail. 1987. Chronology of fluctuating sea levels since the Triassic. Science 235(4793):1156-1167.

Hastings, J. R., and R. R. Humphrey. 1969a. Climatological data and statistics for Baja California. University of Arizona Institute of Atmospheric Physics Technical Reports on the Meteorology and Climatology of Arid Regions 18.

Hastings, J. R., and R. R. Humphrey. 1969b. Climatological data and statistics for Sonora and northern Sinaloa. University of Arizona Institute of Atmospheric Physics Technical Reports on the Meteorology and Climatology of Arid Regions 19.

Hoard, R. S. 1939. A new subspecies of snake of the genus Chilomeniscus. Jour. Entom. Zool., Pomona College 31:45-46.

Klauber, L. M. 1951. The shovel-nosed snakes, Chionactis, with descriptions of two new subspecies. Trans. San Diego Soc. Nat. Hist. 11(9):141-204.

Leviton, A. E., and B. H. Banta. 1964. Midwinter reconnaissance of the herpetofauna of the Cape Region of Baja California, Mexico. Proc. California Acad. Sci., ser. 4, 30(7):127-156.

Linsdale, J. M. 1932. Amphibians and reptiles from Lower California. Univ. California Publ. Zool. 7:1-19.

Linsdale, J. M. 1936. Variation in the dotted burrowing snake Chilomeniscus stramineus. Copeia 1936(4):232-234.

Lyle, M., and G. E. Ness. 1991. The opening of the southern Gulf of California. In: Dauphin, J. P., and B. R. T. Simoneit (eds.), The Gulf and Peninsular Province of the Californias. Amer. Assoc. Petrol. Geol. Mem. 47:403-423. 50

Mara, W. P. 1997. The guide to owning desert snakes of North America. T.H.F Publication.

McCloy, C. 1984. Stratigraphy and depositional history of the San Jose del Cabo Trough, Baja California Sur, Mexico. In: Frizzell, V. A. Jr. (ed.) Geology of the Baja California Peninsula: Pacific Section S.E.P.M. 39:267-273.

Mocquard, F. 1899. Contributions a la faune herpetologique de la Basse Californie. Nov. Arch. Mus. d'Hist. Nat., Paris, ser 4, 1:297-344.

Murphy, R. W. 1983. Paleobiogeography and genetic differentiation of the Baja California herpetofauna. Occas. Pap. Calif. Acad. Sci. (137):1-48.

Powers, A. L, and B. H. Banta. 1974. Chilomeniscus stramineus Cope Recorded from Cerralvo Island, Gulf of California, Mexico. J. Herpetol. 8(4):386-387.

Rodriguez-Robles, J. A., and J. M. De Jesus-Escobar. 1999. Molecular systematics of New World gopher, bull, and pinesnakes (Pituophis: Colubridae), a transcontinental species complex. Mol. Phylogenet. Evol. 14:35-50.

Schmidt, K. P. 1922. The amphibians and reptiles of Lower California and the neighboring islands. Bull. Amer. Mus. Nat. Hist. 46:607-707.

Schmidt, N. 1990. Plate tectonics and the Gulf of California region. Arizona Geology 20(2):1-4.

Smith, H. M., and E. H. Taylor. 1945. An annotated check list and key to the snakes of Mexico. U. S. Nat. Mus. Bull. 187:1-239.

Stebbins, R. C. 1985. A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston. 336 Pp.

Stickel, W. H. 1943. The Mexican snakes of the genera Sonora and Chionactis with notes on the status of other colubrid genera. Proc. Biol. Soc. Wash. 56:109-128.

Upton, D. E., and R. W. Murphy. 1997. Phylogeny of the sideblotched lizards (Phrynosomatidae: Uta), based on mtDNA sequences: Support for a midpeninsular seaway in Baja California. Mol. Phylogenet. Evol. 8:104-113.

Van Denburgh, J. 1895. A review of the herpetology of Lower California. Part I. Reptiles. Proc. California Acad. Sci., ser. 2, 5:77-162.

Van Denburgh, J., and J. R. Slevin. 1913. A list of the amphibians and reptiles from Arizona, with notes on the species in the collection at the Academy. Proc. California Acad. Sci., ser. 4, 3:391-454.

Van Denburgh, J., and J. R. Slevin. 1921. Preliminary diagnoses of new species of reptiles from islands in the Gulf of California, Mexico. Proc. California Acad. Sci., ser. 4, 11:96-98.

Tables, Figures, and Appendices

Table 1. Selected aspects of quantitative variation in Chilomeniscus. Mean and standard deviation given above; range followed by sample size in parentheses given below. Ventrals Subcaudals Tail Length as % Total Total Max Length Males Females Males Females Males Females Bands mm C. cinctus 114.3+3.2 120.1+3.4 25.9+1.6 22.3+1.4 13.09+0.60 10.47+0.91 23.7+3.2 282 (178) 106-120 (72) 111-126 (51) 21-29 (73) 19-26 (48) 11.6-14.4 (115) 8.8-13.4 (65) 16-35 (210)

C. fasciatus 115.5+4.8 124.3+4.0 26.4+2.0 23.2+2.0 13.90+0.97 11.12+0.75 29.5+4.5 299 (167) 104-128 (98) 116-137 (59) 22-33 (90) 19-30 (56) 11.2-17.6 (105) 9.6-13.1 (61) 21-46 (154)

C. punctatissimus 114.9+2.5 119.8+2.0 25.8+0.9 22.2+1.9 13.86+0.46 11.57+0.75 45.7+5.0 250 (20) 112-120 (10) 118-124 (9) 25-27 (10) 19-25 (9) 13.1-14.4 (10) 10.4-13.0 (10) 35-53 (19)

C. savagei 130.8 136.7 27.0 23.3 12.57 10.80 31.8+3.3 268 (11) 127-134 (4) 136-138 (7) 26-28 (4) 21-24 (6) 11.7-13.1 (4) 9.7-11.4 (6) 26-36 (10)

C. stramineus 109.4+2.5 117.6+2.6 28.5+1.7 25.6+1.9 14.53+1.03 12.33+0.78 unbanded 272 (73) 103-114 (44) 112-122 (31) 25-33 (43) 22-29 (30) 11.1-17.4 (43) 11.2-14.4 (30) 53

Table 1, continued. Selected aspects of quantitative variation in Chilomeniscus. Mean and standard deviation given above; range followed by sample size in parentheses given below. Ventrals Subcaudals Tail Length as % Total Total Max Length Males Females Males Females Males Females Bands mm unbanded 111.7+2.4 120.8+2.5 26.7+1.6 25.0 14.41+0.93 11.19+1.13 NA 262 (40) 104-116 (32) 116-123 (9) 23-30 (31) 23-28 (7) 11.5-16.6 (33) 9.9-13.1 (9) La Paz banded 111.3+3.5 120.0 26.2+2.4 24.5 14.38+1.01 11.4 31.3+4.2 288 (19) 107.5-120 (13) 116-123 (6) 23-31 (13) 23-27 (6) 13.3-17.6 (15) 10.8-12.0 (6) 26-43 (36)

unbanded 122.8 127.3+3.2 25.6 22.2+1.7 12.77 11.17+0.89 NA 265 (12) 120-128 (7) 124-134 (8) 22-28 (7) 20-24 (8) 11.2-13.6 (4) 10.0-12.3 (8) Estero banded 121.5 127.7 26.5 24.0 13.55 11.29 31.6+4.0 299 (7) 121-122 (4) 127-128 (3) 25-28 (4) 23-25 (3) 12.5-14.3 (4) 11.1-11.7 (3) 27-39 (8)

unbanded 116.7+1.8 122.5+2.2 26.3+1.1 22.9+1.1 13.03+0.52 10.62+0.61 NA 250 (17) 114-120 (18) 120-126 (9) 25-29 (18) 21-24 (8) 12.0-13.8 (19) 9.5-11.2 (8) Seri banded 115.4 120.5 24.5 20 12.72 10.5 28.1 228 (5) 111.5-117 (4) 120.5 (1) 23-26 (4) 20 (1) 12.4-13.0 (4) 10.5 (1) 21-33 (7) 54

Table 2. Variation in diagnostic characters in Chilomeniscus. Percent occurrence followed by sample size in parentheses. Rostral borders Frontal borders Infralabial 5 Prefrontals border prefrontals internasals or 6 largest supralabials

C. cinctus 100.0 (238) 0.0 (238) 31.4 (207) 61.7 (240)

C. fasciatus 97.6 (286) 0.0 (286) 89.4 (283) 98.1 (156)

C. punctatissimus 9.1 (22) 22.7 (22) 88.1 (21) 100.0 (21)

C. savagei 0.0 (10) 100.0 (10) 20.0 (10) 100.0 (9)

C. stramineus 2.9 (103) 1.9 (103) 2.0 (101) 99.4 (83)

unbanded 96.4 (56) 0.0 (55) 91.1 (56) 100.0 (51) La Paz banded 97.1 (35) 0.0 (35) 94.3 (35) 100.0 (13)

unbanded 100.0 (18) 0.0 (18) 76.7 (15) 100.0 (11) Estero banded 100.0 (8) 0.0 (8) 78.6 (7) 100.0 (7)

unbanded 100.0 (27) 0.0 (27) 35.4 (24) 94.4 (27) Seri banded 100.0 (6) 0.0 (6) 41.7 (6) 91.7 (6)

Table 3. Selected aspects of color pattern. Dark Intermediate Dark bands with Spots in Extensive Nape pinstripes Nape pinstripes Postorbital bands pattern pale centers pale bands apical dots on scale edges on scale centers dark spot C. cinctus present spots arranged absent present absent present absent absent or absent as vague bands or absent or absent

C. fasciatus present numerous present present absent present absent absent or absent faint bands or absent or absent or absent

C. punctatissimus present numerous present present absent absent absent absent or absent faint bands or absent or absent

C. savagei present NA absent absent NA NA NA NA

C. stramineus absent NA NA NA present absent present present

Figure 1. Mid-body color patterns of unbanded Chilomeniscus in the Cape Region of Baja California. Left: Pattern of extensive apical dots on C. stramineus. Right: Pattern of diffuse smudges typical of unbanded C. fasciatus. 57

R I PF

Figure 2. Dorsal camera lucida images of Chilomeniscus showing arrangement of head plates. Upper left: Separation of prefrontals by rostral plate contacting prefrontals typical of C. savagei. Upper right: Primitive arrangement typical of C. punctatissimus and C. stramineus. Lower left: asymmetrical separation of prefrontals seen in some C. punctatissimus. Lower right: Separation of internasals typical of C. cinctus and C. fasciatus. Head plates labels: R=rostral, I=internasal, PF=prefrontal, and F=frontal. 58

Figure 3. Distribution of Chilomeniscus species around the Gulf of California. 59

mainland

peninsular

endemic

Figure 4. Scatterplot of mainland = C. cinctus, peninsular = C. fasciatus, and three endemic = C. punctatissimus, C. savagei, and C. stramineus specimens. Composite head morphology = (distance between internasals plus distance between posterior temporal and sixth supralabial minus distance between preocular and nasal or loreal-if present) divided by interorbital distance. Band interval = reciprocal of number of bands; unbanded specimens are zero. Diagnostic line at morphology = 0.27 and band interval = 0.05 (20 bands).

4.0

3.5

3.0

2.5 mainland 2.0 peninsular

Rostral endemics 1.5

1.0

0.5

0.0 0.0 1.0 2.0 3.0 4.0 5.0 Frontal

1.0 0.9 0.8 0.7 0.6 mainland 0.5 peninsular 0.4 endemics 0.3

Prefrontal-supralabial contact 0.2 0.1 0.0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Anterior temporal-seventh supralabial contact

Figure 5. Individual variation in selected traits related to expansion or loss of head scales. 61

111° 110° 109°

25° 25°

Isla Espiritu Santo

# Isla Cerralvo

24° 24°

Ithsmus of La Paz

Western Cape # Eastern Cape

# # 23° San Jose del Cabo Trough 23° Sierra de la Laguna

111° 110° 109°

Figure 6. Locations of current and past barriers to gene flow discussed in the text for the Cape Region of Baja California. 62

APPENDIX A. List of Chilomeniscus specimens examined for this study

Codes for collections and personal notes used here and in the text are: American Museum of Natural History (AMNH), Arizona State University (ASU), California Academy of Sciences (CAS), Carnegie Museum (CM), Chicago Natural History Museum (CNHM), JFC (Joe F. Copp), Los Angeles County Museum of Natural History (LACM), La Sierra University (LSUHC), Museum of Vertebrate Zoology at Berkeley (MVZ), Robert D. McCord (RDM), San Diego Natural History Museum (SDSNH), Thomas R. Van Devender (TRV), University of Arizona (UAZ), University of Michigan (UMMZ), and US National Museum (USNM) collections.

Chilomeniscus cinctus Sinaloa: LACM 121310; Southeastern Sonora: AMNH 64245, 66338, 102190-1; ASU 8526-7; CAS 138869; LACM 2183, 9042-3, 103473-5, 125323; MCZ 24; MVZ 71365; TRV 2860; UAZ 39526, 42847, 42856, 42912-3, 45017, 50560; UMMZ 134106; USNM 146443, 214111, 248208. Northwestern Sonoran Coast: CAS 181940-6; CNHM 74962; LACM 138471; UAZ 24083, 32331, 45015, 45294, 49103, 49335, 50331, 50630-6; USNM 214110, 238284-7. Isla Tiburon: UAZ 23194-5; USNM 222051-3. Gila Co., AZ: ASU 14024. Maricopa Co., AZ: ASU 1210, 1212-3, 1220-1, 1887, 1906, 2212, 2255, 2273, 2275, 2283, 2406, 2891, 2904, 3378, 3395, 3578, 3579, 4385, 4669-70, 9161, 10232, 13206, 13879, 13897, 13903, 15472, 26367-8; CAS 17551; SDSNH 27003; UAZ 24104, 35444, 35465, 35795, 35818, 39529, 50569, 50665- 6; UMMZ 137137; USNM 246447-8, 246451. Pima Co., AZ: ASU 01231, 15391, 28400-1; CAS 33834, 34172; RDM 94-89; TRV 36, 86, 379, 1346; UAZ 10350, 24086-96, 24098, 24100-3, 24106-9, 30241, 33815, 34681-2, 34707, 34911, 35166, 36108, 37819-21, 39522-5, 39527, 40908-19, 42197, 44547, 44937, 44944, 45016, 48181, 48304, 48630, 49091-3, 50322, 50328-30, 50664; USNM 118570, 15789, 193014, 307453, 60975, 62545. Pinal Co, AZ: ASU 1519, 3006, 14023, 15375-9, 23573-4, 26408, 26409, 26411, 26413, 28614, 29495; UAZ 24084-5, 24097, 24105, 32723, 39528, 43150, 50663. Yavapai Co., AZ: ASU 1339; USNM 252997. Northern Sonora: CM 40358; LACM 103472; USNM 146465. Exact locality unknown: CAS 33839-40; UAZ uncataloged (N=26); USNM 8897, 62566. Chilomeniscus fasciatus Western Baja California del Norte: AMNH 64512; MVZ 161411-2, 170764; SDSNH 30371, 42324-5, 42737, 43378, 45973, 48150-2, 62226-7; USNM 21539, 37520. Eastern Baja California del Norte: AMNH 94163; LSUHC 3013; MVZ 117303, 117449, 161396, 161402, 161404, 161406-8, 161413-4, 170761, 170763, 176048, 189956; SDSNH 17390, 38663, 42054; UAZ 23197, 42416. Ballenas Bay: USNM 15158; UAZ 23198. MCZ 19731. Eastern Baja California del Sur: CAS 143426; LSUHC 1826, 2633, 3003-4; MVZ 161398; SDSNH 30373, 3828-30, 44384, 61289; UAZ 23199, 45292-3, 45295; USNM 65825, 67376-7. Isla Monserrate: SDSNH 50173. Isla San Marcos: SDSNH 50174. Isla San Jose: SU 14035. Western Baja California del Sur: LACM 128275, 138141; LSUHC 3006, SDSNH 30364-7, 30369-70, 30372; UAZ 23196, 34569, 37859-60, 45296-9, 50332, 50334; USNM 240350, 257311-3. Isla Magdalena: USNM 37521. Northwestern Cape Region: CAS 45981, 63

91244, 91401; LACM 103476-7, 107910, 128276-7, 138475-7, 51631; LSUHC 1103, 1754-8, 1775, 1841, 2361, 2406, 2434; MVZ 100475, 117329, 142051, 161400-1, 161416, 170778-9, 170844-5, 182172, 182247, 190035, 190059, 190067, 190070; SDSNH 45218; TRV 1347; UAZ 35729-32, 37858, 37861, 46552-4; USNM 12630, 240223-4, 240268-9, 240351. Chilomeniscus punctatissimus Isla Espiritu Santo: CAS 143413-4, 144594-5; LSUHC 2998-3002, 3027-30, LSUHC uncataloged (later cleared and stained); MVZ 170773-6. Isla Partida Sur: CAS 49156; UAZ 50333. Chilomeniscus stramineus Southeastern Cape Region: AMNH 87586; CAS 4116, 91461; LACM 2182, 51630, 74028; LSUHC 1656, 1759-60, 1842, 2409; MVZ 11853, 11856, 11867-8, 11870, 11881-2, 11885-6, 11888, 11891, 11894-5, 11900, 104251, 104329, 182224, 182232-3; SDSNH 3831, 61291; UAZ 42343; USNM 4674, 16406-9, 64579. Chilomeniscus savagei Isla Cerralvo: CAS 88626, 92994, 101600; SU 14034, 16062; LSUHC 2997; MVZ 117356-7; SDSNH 44394. 64

APPENDIX B. PART TWO: PHYLOGENETIC SYSTEMATICS OF THE BURROWING SNAKE TRIBE SONORINI (COLUBRIDAE)

Abstract

The Sonorini is a tribe of mostly cryptozoic and fossorial snakes in the family

Colubridae. I used morphological data to estimate phylogenetic relationships within the tribe and molecular data to estimate phylogenetic relationships of the Sonorini to other snakes. Morphological analysis, using Coluber constrictor and Liochlorophis vernalis as outgroups, indicates that the genera Conopsis, Ficimia, Gyalopion, Pseudoficimia,

Stenorrhina, and Sympholis form the sister group to Chilomeniscus, Chionactis, and

Sonora. This clade, in turn, is sister to Scolecophis and Tantilla. The putative genera

Geagras and Tantillita are nested within the Tantilla calamarina and T. taeniata species groups, respectively. Tantilla alticola, T. bairdi, T. moesta, T. schistosa, and T. semicincta are also added to the T. taeniata group and T. petersi is added to the T. melanocephala group. Species with many unique character states, including T. albiceps,

T. nigra, T. shawi, and T. supracincta, remain difficult to classify.

Molecular analyses using parsimony, distance, and Bayesian criteria placed one or more outgroup species between two clades of sonorinines. Some analyses placed

Scolecophis away from Tantilla. Results suggest that sonorinines may consist of two monophyletic groups that are closely related to Phyllorhynchus, Trimorphodon, and New

World racers. An osteological examination of 28 outgroup taxa revealed that Carphophis amoenus possesses the trait that may be otherwise unique to sonorinines. However, molecular analyses clearly placed Carphophis with North American xenodontines.

Synthesis of the current study with recent literature suggests that the Sonorini is nested within a clade that includes all New World colubrines exclusive of the Lampropeltini. 66

This clade is one of seven extant colubroid lineages that are endemic to the New World and independently derived from Old World groups.

Introduction

Colubrid snakes belonging to the tribe Sonorini are very small to less than medium for snakes in general. None reaches one meter in length and many are less than

25 centimeters. Some sonorinines are very capable burrowers and exhibit peculiar adaptations for life below the surface. Their diet consists of invertebrates and they are found only in the New World.

The Sonorini originally included nine genera (Dowling 1975, and Dowling and

Duellman 1978). These were Chilomeniscus, Chionactis, Conopsis, Ficimia, Gyalopion,

Pseudoficimia, Sonora, Stenorrhina, and Toluca. Savitzky (1983) provided a

morphological definition and basis for an expanded content. His definition of the

Sonorini centered on the presence of a modified septomaxilla, which completely

encircles the innervation of the vomeronasal organ. Savitzky’s (1983) definition

suggested the inclusion of Geagras and Tantilla, and, presumably their allies, Scolecophis

and Tantillita.

Boulenger (1893-6) included all prospective Sonorini in his subfamily

Calamarinae, along with some other fossorial colubrids. At nearly the same time, Cope

(1895) used hemipenal morphology to propose a radical new taxonomy of ophidians,

scattering the genera that would later constitute the Sonorini. Although Stickel (1943) 67

mentioned most genera in a context that could be viewed as a taxonomic assemblage, he did not assign a name to it. Later Dowling (1975) and Dowling and Duellman (1978) explicitly recognized the tribe and used the name Sonorini. Goyenechea and Flores-

Villela (2002) recently combined Conopsis and Toluca. Currently recognized genera in

the Sonorini include sand snakes (Chilomeniscus), shovelnose snakes (Chionactis), ground snakes (Sonora), hooknose snakes and their allies (Conopsis, Ficimia, Gyalopion,

Pseudoficimia, Stenorrhina, and Sympholis), and centipede snakes and their allies

(Geagras, Scolecophis, Tantilla, and Tantillita).

Systematic relationships among colubrid snakes are gradually being resolved and

the taxonomy of subfamilies has been revised to reflect this knowledge. Morphological

and molecular evidence suggest placement of the Sonorini in the subfamily Colubrinae

(Dowling and Duellman 1978, Dowling et al 1983, Cadle 1984b, Schätti 1987, Kraus and

Brown 1998, Creer 2001, Lawson et al. 2005). However, the Colubrinae is a relatively

diverse subfamily and the phylogenetic results obtained so far have been mixed, with

monophyly of some groups being supported and others not, depending on the genes or

characters examined, species included, and search algorithm employed.

In this investigation, I used new and published mtDNA sequence data to test the

monophyly of the Sonorini and determine its phylogenetic position within colubrids. I

used morphological data to further resolve the relationships among constituent species of

Sonorini. The phylogenetic reconstruction was also intended to provide a working

hypothesis for a study of morphological and ecological diversification in the Sonorini.

Additional specific questions included the following: 68

My preliminary examination of osteology revealed that the fossorial xenodontine,

Carphophis amoenus, possesses the character that defines the Sonorini. What is the phylogenetic position of this species?

Stickel (1943) considered Scolecophis and Tantilla to form a group that is only distantly related to the group containing Chilomeniscus, Chionactis, Conopsis, Ficimia,

Procinura, Sonora, Stenorrhina, and Toluca. Are these two clades supported by the data?

My preliminary review also suggested that Chilomeniscus, Chionactis, and

Sonora formed a clade sister to Conopsis, Ficimia, Gyalopion, Pseudoficimia,

Stenorrhina, and Sympholis. Is each of these clades supported by the data?

Wilson and Meyer (1981) suggested that Geagras redimitus is related to the

Tantilla calamarina species group. Is Geagras nested within Tantilla?

Finally, each genus or species group represents a testable phylogenetic hypothesis. Are these entities monophyletic groups according to the data? Also, there have been other published suggestions of affinity or relationship involving members of the Sonorini. Where practical, I will discuss these hypotheses in the context of my results.

Materials and Methods

Characters may be selected for many reasons, including for reconstructing phylogenies, comparing the performance of different types of data, testing hypotheses of evolution, or describing the distribution of variation. Any shared property of organisms that is believed to be the result of common ancestry can be used to reconstruct 69

phylogenetic relationships, including morphological, molecular, behavioral, ecological, geographical, and temporal data. The present study used molecular and morphological data for constructing phylogenies. Part Two included diet and geographic distribution to explore diversification.

Molecular data set

The molecular data matrix provided an opportunity to determine the position of sonorinines among colubrid snakes, test the monophyly of the group, and evaluate some divisions obtained with the mainly morphological analysis. My initial goal was to sample exemplar species from all genera of the Sonorini and a wide array of outgroups. I obtained DNA sequences for 16 specimens, representing 15 species and seven genera.

Taxa include at least two species from each of the three major clades of Sonorini. For outgroups, I obtained sequences for 78 specimens, representing 67 snake species and 54 genera. I downloaded many sequences from GenBank, including the material studied by

Kraus and Brown (1998) and Rodriguez-Robles and Jesus-Escobar (1999). The remaining material was prepared from tissue samples as described below. The list of molecular specimens appears in Appendix A.

DNA extraction, amplification, and sequencing.-I obtained tissue samples for 24

snake species. Tissues included 15 biopsies preserved in 95% ethanol, six frozen snakes,

two skeletons, and one shed skin. I performed all laboratory work at the Laboratory of

Molecular Systematics and Evolution at the University of Arizona where I used a generic 70

protocol with the following modifications. I homogenized the tissue samples in lysis buffer using a mechanical homogenizer and incubated them overnight at 55oC to digest in proteinase-K. I extracted total genomic DNA twice with 25:24:1 phenol/chloroform/isoamyl alcohol and once with 24:1 chloroform/isoamyl alcohol.

I amplified an approximately 878 base-pair (bp) section of mitochondrial DNA

(mtDNA) spanning approximately 697 bp of the 3’ end of the nicotinamide adenine

dinucleotide dehydrogenase subunit 4 (ND4) gene, and approximately181 bp of transfer

ribonucleic acid (tRNA) genes for histidine, serine, and leucine. I used primers ND4 and

LEU of Arévalo, Davis, and Sites (1994) for the polymerase chain reaction. Thermal

cycle parameters included initial denature at 94oC for 5 min, followed by 32 cycles of

denature at 94oC for 1 min, anneal at 54-56oC for 1 min, and extend at 72oC for 1 min 30

sec, followed by final extension at 72oC for 5 min.

I sent purified aliquots of each sample to the University of Arizona DNA

Sequencing Service which provided the sequences. I edited sequences with Faktory and

aligned them in GCG. Gaps (indels) spanning positions 698-701 and 769-771 varied in

size among taxa. I elected to exclude these gaps from all analyses. Gaps spanning a

single position were treated as missing and included in the analysis. A list of sequences is

provided in Appendix B.

Morphological data set

My effort to reconstruct relationships within the Sonorini is based mainly on

morphological evidence because tissue samples were available for few taxa. I examined 71

specimens from 2 outgroup taxa and 66 out of 84 sonorinine species, including all 13 genera. From the literature, I obtained morphological data for some but not all characters for the 18 species that I did not examine. Three species, Tantilla sertula (Wilson and

Campbell 2000), T. triseriata (Smith, Chizar, and Van Breukelen 1998), and T. tritaeniata

(Smith and Williams 1966) were recently described or resurrected and not included in my analysis. However, I confirmed that no data representing these taxa were included in any species I sampled. A list of morphological specimens is provided in Appendix C. The list of primarily osteological specimens is provided in Appendix D.

Morphological characters.- Most of the material I worked with included museum

specimens that were fixed in formalin and preserved in alcohol. A limited number of

articulated and disarticulated osteological specimens were also available. In total, I

evaluated 74 morphological characters. When appropriate, I supplemented or verified

my data with published information in both taxonomic and regional monographs as well

as selected ecological studies. Literature accounts were often useful for color pattern,

scutellation, body and tail length, and dentition. Sources included Campbell (1998),

Campbell, Camarillo and Ustach (1995), Campbell and Smith (1997), Clark (1970), Cole

and Hardy (1981), Cross (1979), Echternacht (1973), Frost (1983a and 1983b), Greer

(1966), Hardy (1970, 1972, 1975a, 1975b, 1975c, 1976, 1980a, and 1980b), Hardy and

Cole (1967 and 1968), Hartweg (1944), Hensley (1966), Mertens (1952), Savitzky and

Smith (1971), Smith (1941 and 1942), Smith and Laufe (1945), Stickel (1938 and 1943),

Taylor and Smith (1942) Telford (1966), Van Devender and Cole (1977), Wilson (1970,

1976, 1982, 1983, 1984, 1985, 1987, 1988, and 1990), Wilson and Mena (1980), Wilson 72

and Meyer (1971, 1981, and 1985), and Wilson et al. (1999).

I used a dissecting scope to examine many small features on specimens. I produced camera lucida drawings of cephalic scutellation, bones, and soft anatomy to aid in comparative viewing. I discovered many potential phylogenetic characters by examining a variety of specimens or images side-by-side. The literature, especially group monographs, also provided potential characters for phylogenetic analysis.

Tantilla species groups are mostly based on a few color pattern similarities.

Several species are not included in any group, either because they represent monotypic

groups or no similarities have been identified to link them to any group. I made a

conscious effort to identify new characters linking difficult Tantilla species to other

Tantilla.

My initial review of morphological variation in the Sonorini revealed that

characters vary in position, shape, size, number, and/or frequency of occurrence within

and between species. Which of these attributes I judged to be phylogenetically

informative determined the type of character. I recognize two general categories of

morphological data, quantitative, including mensural and meristic characters, and

qualitative, including binary, multistate, and polymorphic characters. For some species,

only a single specimen was known or available for examination.

The ability to assess a given character in every species is important but not always

possible. Many characters exhibit multiple states among the taxa in which they are

present but are absent in other taxa. For example, a vertebral stripe may be present or

absent, it may be dark or pale, it may be wide or narrow, and it may be continuous or a 73

series of dots. Under basic color pattern I assign a state to each taxon and this is where the presence of stripes and other patterns is captured. However, to capture the various properties of vertebral stripes, I created several characters in the matrix and I did not wish to code unstriped taxa as absent repeatedly so I coded them as missing. Maddison

(1993) noted that coding characters as missing data where inapplicable sometimes causes errors in phylogenetic reconstruction, depending on the distribution of taxa with missing data. However, I did not want the analysis to force taxa with different unique color patterns into a common clade based on uniqueness as a shared condition.

Finally, I weighted each character so that the maximum cost for transition between any two states is unity. All unordered characters have a weight of unity. Note that this differs from the scale to equal weight option in PAUP, where characters are assigned a weight equal to the number of states minus one.

Quantitative characters, 1-22.

Quantitative characters include those that are measured (continuous) or counted

(meristic). They have a long but controversial history in systematics due to logical objections to the converting of continuous characters into discrete ones (Felsenstein

1988) and to the arbitrary or inconsistent procedures for extracting and coding quantitative characters (Stevens 1991, Rae 1998). However, Theile (1993) and Rae

(1998) have indicated that quantitative characters are phylogenetically informative and there is no logical basis for their exclusion.

I used the method of gap-weighting, as described by Thiele (1993), to code 74

quantitative characters. It is some aspect of central tendency, such as the mean, median, or midpoint, that represents the character state for a given taxon. The maximum and minimum means among species are the endpoints of an ordered multistate character with as many states as is desired and that the algorithm can accommodate. I prefer to assign means to 26 bins (a to z). For taxa with means in between the endpoints, I assigned states according to the formula 26(mean – min)/(max – min), where mean is the current species mean, max is the largest species mean, and min is the smallest. I truncated the resulting scores and assigned state a to 0, b to 1, c to 2, and so on. State z covers scores from 25 to

26. I treated each quantitative character as an ordered type with a weight of 1/26 or 0.04, so that a change from a to z would have a cost of unity and be equivalent to the cost of transformation between fixed present and fixed absent in a qualitative character.

Continuous characters, 1-11.

I obtained landmark distances from camera lucida drawings of preserved, frozen and thawed, or freshly-killed specimens. I selected adult representatives of each species whenever possible and I divided each distance by the total head length in order to remove size as a factor. Here, I define head length as the distance from the tip of the snout to the posterior tips of the parietal scales measured along the midline of a dorsal image.

Although morphometricians prefer not to remove size as a factor (Bookstein et al. 1985), my goal was to identify and code independent morphometric characters for phylogenetic analysis. I am willing to accept the error in shape information that is generated by using ratios. 75

1. Snout-naris length: The distance from the tip of the shout to a line drawn between both nares, measured along the midline of a dorsal projection.

2. Naris-eye length: The distance from the line drawn between both nares to a line drawn between the centers of both eyes, measured along the midline of a dorsal projection.

3. Eye-parietal length: The distance from the line drawn between both eyes to a line drawn between the posterior tips of the parietal scales, measured along the midline of a dorsal projection.

4. Anterior frontal length: The height of the anterior triangle, measured along the longitudinal axis of a dorsal projection, given a hexagonal frontal shape.

5. Middle frontal length: The length of the central quadrilateral, measured along the longitudinal axis of a dorsal projection, given a hexagonal frontal shape.

6. Posterior frontal length: The height of the posterior triangle, measured along the longitudinal axis of a dorsal projection, given a hexagonal frontal shape.

7. Anterior frontal width: The base of the anterior triangle described for character 5.

8. Interorbital distance: The distance between the lateral edges of supraocular scales along the line draw between both eyes on a dorsal projection.

9. Eye diameter: The horizontal diameter of the eye measured on a lateral projection.

10. Head depth: The vertical distance from the top of the head to the edge of the upper lip, measured through the center of the eye on a lateral projection. I would have preferred to extend this measurement to include the lower jaw. However, most specimens were fixed with the mouth open to varying degrees.

11. Relative tail length: The tail length measured from the posterior edge of the vent to the tip of the complete tail divided by the total length measured from the tip of the snout to the tip of the tail. Scores were first computed for males and females separately and then averaged.

Meristic characters, 12-22.

12. Log of mean number of ventral scales: I scored males and females separately and then took the average of the two scores. Minimum male and female means were 106.0 and 111.2, both for Tantillita canula. Maximum male and female means were 213.1 and 227.2, both for Sympholis lippiens. I took the log here because intervals between species 76

increased with the mean value. Scores were first computed for males and females separately and then averaged.

13. Mean number of subcaudal scales. Minimum male and female means were 21.3 and 16.4, both for Sympholis lippiens. Maximum male and female means were 92.4 and 90.5, both for the outgroup taxon Coluber constrictor.

14. Mean number of gular scales (Hardy 1975a): This ranges from 12.2 in Liochlorophis vernalis to 44.2 in Chionactis palarostris. In some specimens of Chilomeniscus, Chionactis, and Sonora the outer-most row of gulars extended somewhat more laterally than the ventrals and one could argue that it is the lower-most dorsal scale row.

15. Dorsal scale rows at mid-body: (a) 13; (b) 15; (c) 17; (d) 19. I used modal values for each species because one species, Sonora semiannulata, exhibits considerable variation whereas other species do so rarely.

16. Mean number of vertebral scale row reductions: This ranges from zero in most species to 3.03 in Chilomeniscus stramineus. I consider any longitudinal series of at least two scales to be a row, not counting head plates.

17. Mean number of lateral scale row reductions: This ranges from zero in most Tantilla to 5.85 in Gyalopion canum to 6.4 in Coluber constrictor. I consider any longitudinal series of at least two scales to be a row, not counting head plates.

18. Mean number of postoculars: This ranges from 0.79 per side in Sympholis lippiens to 2.01 in Chionactis occipitalis.

19. Mean position of the largest infralabial: Among the ingroup it is usually the fourth infralabial that is largest. The mean position ranges from 3.50 in Tantilla cascadae to 4.89 in Chilomeniscus fasciatus to 5.20 in Liochlorophis vernalis.

20. Mean number of maxillary teeth: Including enlarged posterior fangs, species means range from 10.5 in Chilomeniscus cinctus to 24.0 in Tantillita lintoni.

21. Mean number of palatine teeth: Species means range from 5.1 in Chilomeniscus cinctus to 17.5 in Tantilla melanocephala.

22. Mean number of dentary teeth: Species means range from 11.4 in Chilomeniscus cinctus to 29.8 in Tantilla supracincta.

Qualitative characters, 23-73. 77

Many qualitative characters are of the binary, absent/present type. Others are multistate and are either ordered or unordered. Few are really quantitative in nature, and I have subjectively recognized discrete states.

Polymorphic characters, 23-33.

Many otherwise binary characters are variable within species or even within individuals. A given condition may occur on one side of the head but not the other.

Weins and Servedio (1997) compared eight methods for coding polymorphic data and found the unweighted frequency method to be best. They recommended that five or more individuals per species should be sampled, but this was not always possible. I used the same coding procedure as for quantitative characters (above) except that the percent of presence of the described condition in a species is used instead of the mean, and max and min are 100 and zero respectively. I treated each polymorphic character as an ordered multistate type with a weight of 0.04 as with quantitative characters.

23. Rostral borders prefrontals: The rostral usually terminates in broad contact with the internasals (e.g., Sonora). In some taxa, it extends posteriorly between the internasals, if present, and either terminates in broad contact with the prefrontals (e.g., Chilomeniscus and Gyalopion) or continues between the prefrontals to end in contact with the frontal (e.g., Ficimia).

24. Rostral borders frontal: In some taxa, the rostral extends posteriorly to end in broad contact with the frontal (e.g., Ficimia). Note that in order for this condition to be met, the rostral must also make contact with the prefrontals by passing between them as described for character 22 above.

25. Internasals absent: When the internasals are absent, the rostral invariably extends posteriorly to end in broad contact with the frontal (e.g., Ficimia). Absence of the internasal should not be confused with internasals being fused to either the prefrontals or nasals (see below). When internasals are present in polymorphic taxa, they are reduced in 78

size and not in contact at the midline.

26. Internasal and prefrontal fused: (e.g., Sympholis and some Conopsis). When internasals and prefrontals are distinct in polymorphic taxa, the internasals are normal in size and in contact at the midline.

27. Frontal borders internasals: In some taxa the frontal extends anteriorly, between the prefrontals, to end in broad contact with the internasals. (e.g., Chilomeniscus savagei and some Conopsis). In a few specimens, the frontal may extend even further to end in contact with the rostral, but I do not consider that to be important in this analysis.

28. Internasal and nasal fused: This condition is quite similar in Chilomeniscus and Stenorrhina. Although it appears to be fixed in most species, I observed two specimens of C. cinctus with a complete vertical suture just anterior to the naris.

29. Loreal absent: The loreal may appear to be fused to the nasal when the latter contacts the preocular, but is scored as absent.

30. Prefrontal contacts supralabial: With few exceptions, this condition occurs only when the loreal is absent and may represent a continuation of that trend. I prefer not to state that contact between the preocular and nasal is absent, because this is ambiguous with respect to absence of the loreal.

31. Primary temporal and sixth supralabial fused: This condition is only variably present in three species, Tantilla vermiformis, Tantillita canula, and T. lintoni.

32. First pair of infralabials separated: This occurs when the mental contacts one or both anterior chin shields.

33. Nasal and primary supralabial fused: This character is present in Sympholis, Gyalopion, and Ficimia. I found one specimen of G. canum where it was lacking on both sides, otherwise it was fixed in all other taxa where present.

Binary and multistate characters, 34-74.

These characters are either monomorphic within species or they presented

difficulties for assessing frequency. If I was reasonably confident that species exhibited a

prevalent state, then I coded according to the most prevalent state; otherwise, I coded

variable taxa as polymorphic. Other exceptions are described for individual characters. 79

Scalation and head morphology 34-42.

34. Largest supralabial: Among sonorinines this is either the (a) sixth; or (b) seventh.

35. Temporal scales: (a) two primary and a variable number of secondary and tertiary temporals; (b) one primary and two secondary temporals; (c) one primary and one secondary temporal; (d) one primary, one secondary, and two tertiary temporals; (e) one long primary and one or two secondary temporals; (f) one primary, one short secondary, and sometimes two tertiary temporals. I could not justify any assumptions about transformation, so I chose to treat this as a multistate, unordered character with a weight of unity for all transformations. Some species are variable, especially with respect to state (f). I coded taxa according to the most prevalent state in the samples I examined. A long primary temporal is one that almost or completely overlaps the ultimate supralabial. It may not appear relatively long compared to width if the parietal contacts the supralabial and pinches out the anterior portion of the primary temporal. The number of secondary temporals often appears to be two (or zero) when the number of supralabials is reduced. Smith (1942) apparently referred to this condition as a scale-like secondary temporal, for his groups 8 and 10. A short secondary temporal is bordered posteriorly by two scales, not counting the parietal or supralabial. It is probably the result of the secondary temporal being divided in two by a vertical suture. Wilson and Mena (1980) noted this condition in some members of the Tantilla melanocephala group.

36. Naris: (a) closer to internasal; (b) closer to supralabial. Initially, I found species of Tantilla to be clearly one state or the other. Later, I found some that were nearly intermediate or intraspecifically variable. In these cases, I used the lateral camera lucida images to take measurements, determine the average, and assign a state.

37. Nasal encroaches on lip: (a) anterior ventral corner of nasal well separated from lower edge of upper lip by broad contact between rostral and first supralabial; (b) nasal encroaches on lower edge of upper lip. The latter condition appears as the anterior ventral corner of the nasal forms a wedge between the primary supralabial and the rostral but not quite separating the two. It is clearly present in Geagras, Scolecophis, Tantilla, and Tantillita. It cannot be assessed in Sympholis, Gyalopion, and Ficimia because the nasal and supralabial are fused.

38. Nasal valves (Stickel 1943) and mental valve: (a) absent; (b) present. The nasal and mental valves invariably occur together and probably serve a similar function in preventing the intake of sand.

39. Apical pits on dorsal scales of body: (a) absent; (b) present. When present in the 80

ingroup, there is one pit per scale. In Coluber constrictor there may be one pit or two pits per scale. Taylor (1951) reported minute pits on some specimens of T. supracincta and other Tantilla species. I did not observe anything that resembled an apical pit.

40. Angular ventrals (Stickel 1943): (a) absent; (b) present. Angular ventrals are present in Chilomeniscus, Chionactis, Scolecophis, and some specimens of Sonora michoacanensis. The condition is sometimes difficult to see and may have been overlooked in some taxa.

41. Rostrum, dorsal profile: (a) rostrum truncate to rounded; (b) rostrum pointed. It is best to compare adult specimens when evaluating this character.

42. Rostrum, lateral profile: (a) rostrum truncate to rounded; (b) rostrum depressed and pointed; (c) rostrum upturned (recurved) and sharply pointed. State (c) may not be obvious in neonates. It is best to compare adult specimens when evaluating this character.

Color pattern, 43-60.

43. Basic color pattern on body: (a) multiple longitudinal rows of spots or blotches; (b) a single row of symmetrical blotches, bands, or complete rings; (c) longitudinal stripes; (d) uniform pale brown; (e) uniform dark brown. I treated this as a multistate, unordered character with a weight of unity for all transitions. I coded variable taxa as polymorphic. Color pattern states for several taxa are unique and uninformative: Tantilla albiceps, T. nigra, T. petersi, T. semicincta, T. shawi, and T. supracincta. I coded them as (?) for missing data. The distinction between uniform pale and uniform dark may seem arbitrary. I base it on the fact that species of Tantilla with a uniform pale dorsum have a conspicuous black head cap whereas those with a uniform dark dorsum have no discernable head cap.

44: Vertebral stripe: (a) dark when present; (b) pale when present. The dark vertebral line is absent in some specimens of T. capistrata and T. melanocephala (Wilson and Mena 1980). A dark vertebral line is present anteriorly on at least one specimen of T. bocourti (USNM 346651) and one of T. relicta (UMMZ 56600). Some specimens of Chilomeniscus stramineus, Sonora semiannulata, T. supracincta, and T. yaquia had a dark longitudinal streak on the center of most dorsal scales but I did consider this to be striping. Several species of Tantilla have a variably present and/or poorly developed pale vertebral stripe (Wilson 1982 and 1983, Campbell 1998). I coded T. moesta as having a pale vertebral stripe even though it only extends a few scales past its large, pale nuchal collar.

45. Pale vertebral stripe: (a) narrow; (b) wide. A narrow stripe is confined to the vertebral row, whereas a wide stripe includes adjacent halves of the paravertebral rows. 81

46. Pale vertebral stripe: (a) continuous when present; (b) reduced to a series of dots when present.

47. Pale lateral stripe: (a) absent; (b) poorly developed and/or sometimes absent; (c) well developed and always present. Here, a poorly developed stripe is one that does not extend all the way to the tail, appears intermittently along the length of the body, or is slight.

48. Paraventral scale row: (a) not divided into pale lower and dark upper halves; (b) divided into pale lower and dark upper halves. The latter does not include a dark line down the center of the paravertebral row. The condition was variable in Tantilla melanocephala, so I coded it as polymorphic.

49. Dark dorsal ground color: (a) does not extend onto venter; (b) extends onto lateral edges of ventrals. Tantilla melanocephala is variable. I coded this taxon with state (b) because it was the most prevalent condition.

50. Dark interorbital oval or crescent: (a) absent; (b) present. This appears to be the first band in most species that have a regular, banded color pattern. It is present in Chilomeniscus, Chionactis, and Sonora species. Other banded or blotched species have a more complex pattern on the head.

51. Dark head cap: (a) confined to the head anterior to the posterior tips of the parietal scales; (b) extends posterior to the parietal scales. I assessed this character only for Geagras, Scolecophis, Tantilla, and Tantillita. It may or may not be homologous with dark head markings on other taxa. The cap is usually followed by a pale collar or pair of nuchal spots involving the posterior tips of the parietals. Among the four genera listed, I coded the character only for those taxa that have a dark head cap, a pale collar, or a pair of nuchal spots present in at least some individuals. The dark cap may be nearly black and contrast sharply with a pale dorsal ground color on the body, or it may be brownish and indistinguishable from the dorsal ground color except for the presence of pale nuchal markings. In Geagras redimitus, the pale nuchal markings are little more than a slight widening of the pale dorsolateral fields between dark lines.

52. Dark head cap: (a) not extending posteriorly to the third vertebral; (b) extending posteriorly to the third vertebral or beyond. The latter does not include a dark nape band that is connected to the dark cap.

53. Spatulate extension of the dark vertebral line onto the head (Wilson and Meyer 1981): (a) absent; (b) present. This character is found only in members of the Tantilla calamarina group as well as Geagras redimitus; however, some specimens of T. melanocephala have pale markings on the head that come close to outlining a spatulate 82

extension of the dark vertebral line.

54. Dark nape band posterior to pale collar or nuchal spots: (a) absent; (b) less than three vertebral scales long: (c) three or more vertebral scales long. In the cases where intraspecific variation was evident, I used the most prevalent condition for assigning a state. In some species (e.g., Tantilla planiceps and T. yaquia), the nape band is reduced to a few dots posterior to the pale collar and even this may be absent in some populations (McDiarmid 1968).

55. Pale collar: (a) pale collar complete; (b) divided mid-dorsally; (c) reduced to a pair of nuchal spots. Variable taxa coded as polymorphic.

56. A pale collar posterior to the dark nape band (=pale neck band of Wilson and Mena, 1980): (a) absent; (b) present. This is a second pale band, not to be confused with the pale collar or pair of nuchal spots between the dark head cap and nape band. It appears in some members of the Tantilla melanocephala group. A similar feature appears in some T. supracincta when the first dark-edged pale band immediately follows the short nape band giving the appearance of a long nape band and second collar. A similar but less convincing problem arises with T. shawi and Scolecophis atricinctus. Given the uncertainty, I chose to code this character as missing for these three taxa.

57. Dark bands: (a) arranged in a regular sequence; (b) forming clusters with pale bands. A regular sequence may be alternating dark and pale bands or dark, pale, red, pale, and so on. This is commonly seen in Chilomeniscus, Chionactis, Sonora semiannulata, Scolecophis, and Sympholis. A band cluster may be black/white/black, black/white/black/white/black, or other more complex pattern on a reddish background. Band complexes are only seen in Sonora aemula and S. michoacanensis.

58. Dark bands: (a) not expanded on venter; (b) expanded on venter. When dark bands are expanded on the venter, the appearance is of a series of dark rhomboids on a pale background. Ventrally expanded dark bands only appear in Chionactis. Although the number of dark bands expanding on the venter is geographically variable, I coded it as present for the two species in which the condition appears.

59. Red saddles surrounded by pale background: (a) absent; (b) present. Red saddles on a yellowish background appear only in Chionactis. The condition is fixed in C. palarostris but geographically variable in C. occipitalis. I coded it as present in both species. The red saddles may be homologous with the orange to red ground color characteristic of Chilomeniscus and Sonora.

60. Venter solid black or dark brown: (a) absent; (b) present. A uniform dark venter is present only in Tantilla albiceps, T. moesta, and T. nigra.

Osteology 61-70.

61. Horizontal plane of the septomaxilla: (a) terminates anterior to the innervation of the vomeronasal organ; (b) completely encircles the innervation of the vomeronasal organ (Savitzky 1983).

62. Lateral vertical process of the septomaxilla: (a) does not articulate with the prefrontal; (b) articulates with the prefrontal (Savitzky 1983).

63. Prefrontal: (a) does not articulate with the nasal; (b) forms a medially tapering wedge between the frontal and nasal (Savitzky 1983); (c) forms an anteriorly tapering articulation with the nasal.

64. Anterior, dorsal edge of frontals: (a) not with a deep medial notch; (b) with a deep medial notch.

65. Premaxilla: (a) without dorsolateral processes; (b) with dorsolateral processes. Hardy (1975c) used shape of the dorsolateral processes to distinguish Ficimia from Pseudoficimia and Gyalopion.

66. Premaxilla: (a) ventrolateral processes confluent with anterior edge; (b) ventrolateral processes set back from anterior edge.

67. Postdental maxillary process (Stickel 1943): (a) absent; (b) present.

68. Medial process of ectopterygoid: (a) well developed; (b) reduced or absent.

69. Pterygoid (Stickel 1943): (a) broad; (b) very narrow, blade-like.

70. Grooves on enlarged posterior fangs of maxilla: (a) absent; (b) present. This difficult character varies continuously. I coded it as present only if both enlarged fangs and grooves were clearly present.

Soft anatomy 71-74.

71. Left oviduct (Clark 1970): (a) absent; (b) present. The oviducts are difficult to assess in small species. In larger forms it is necessary to make a long ventral incision and trace all components of the urogenital system and large intestine. Even blood vessels need to be followed. Species without the left oviduct may still have a well-developed left ovary.

72. Mature females: (a) without hemipenes or associated retractor muscles; (b) with 84

hemipenes and/or associated retractor muscles. Hardy (1970) reported intersexuality in Pseudoficimia where both well-developed hemipenes and associated retractor muscles were present in females. He (Hardy 1972) stated that small, poorly developed hemipenes were present in females of Gyalopion canum, Ficimia olivacea, and F. publia, whereas hemipenes were absent but retractor muscles present in females of G. quadrangulare and F. streckeri. Hardy (1976) later stated that neither hemipenes nor the associated retractor muscles were present in G. quadrangulare. I found both well-developed hemipenes and associated retractor muscles in all adult females of Sympholis lippiens dissected (N=7). I found these structures in females of Conopsis nasus (UAZ 28505) and Stenorrhina degenhardtii (AMNH 7568) but not in S. freminvillei (UAZ 38774). My examination of Conopsis and Stenorrhina was not exhaustive so it is possible that the condition may be intraspecifically variable.

73. Reproductive mode (Greer 1966): (a) oviparous: (b) viviparous. Viviparity is only known in the species of Conopsis that have been investigated.

74. Mature females (Greer 1966): (a) without a black peritoneum; (b) with a black peritoneum. The density of black pigment in the peritoneum varies but is quite noticeably greater in the genus Conopsis. Although this character is clearly associated with viviparity (character 71), it was assessable in more species of Conopsis and, therefore included here.

Phylogenetic analysis

I constructed a taxon-character matrix using MacClade (Maddison and Maddison

1992). The morphological taxon-character matrix is provided as Appendix E; the

molecular matrix is provided in Appendix C. Trachyboa boulengeri served as the

outgroup in all molecular analyses, whereas Coluber constrictor and Liochlorophis

vernalis served as the outgroups in all morphological analyses. I used three procedures to

produce phylogenetic hypotheses (trees). I used PAUP* (Swofford 1999) to employ both

neighbor-joining and maximum parsimony procedures and MrBayes (Huelsenbeck and

Ronquist 2001) to employ Bayesian analyses.

I used PAUP* to search for optimal trees using both neighbor-joining and 85

maximum parsimony procedures with the molecular dataset. For the morphological dataset, I used only maximum parsimony procedures, which search for the phylogenetic hypothesis (tree) requiring the fewest evolutionary steps. A heuristic search was employed for the parsimony analyses using 1000 random addition sequence replicates. I used the bootstrap to evaluate results of parsimony analyses. To evaluate support for traditional taxa not found to be monophyletic, I created constraint trees and repeated the analysis with topological constraints enforced. I also employed variations of the heuristic search with various characters or taxa excluded. I was especially interested in the effects on the outcome of characters with high homoplasy and taxa with many unique states.

Finally, I used Bayesian analyses with the molecular dataset. This program employs a Metropolis-coupled Markov chain Monte Carlo algorithm to sample trees in proportion to their probabilities. I ran the analysis for 300,000 generations, sampling every 10 generations. Otherwise, all other options were set to the default in the mcmc command. A plot of log likelihood scores vs. generation indicated stationarity was reached at about 90,000 generations. I generated the consensus tree with posterior probability scores using the last 20,000 trees (200,000 generations) by setting the burn-in to 1,000 in the sumt command.

Results

Molecular analysis

Of the 871 base positions, 475 were parsimony informative and 316 were constant. For the ingroup, minimum and maximum genetic differences (HKY 85) 86

between each of the three major sonorinine clades were as follows: 16.3% between

Chionactis palarostris and Gyalopion canum, 21.5% between Chilomeniscus cinctus and

Sympholis lippiens; 17.1% between Chionactis occipitalis and Scolecophis atrocinctus,

26.0% between C. cinctus and T. semicincta; 18.2% between G. canum and T. cucullata, and 22.4% between S. lippiens and T. relicta.

Variability of the molecular results

Three species, Coluber constrictor, Salvadora hexalepis, and Sympholis lippiens,

are represented by two specimens each, which failed to pair with each other in all three

analyses. The situation with Sympholis is suspect because one specimen, MVZ FC11327, has a stated locality of Costa Rica, which is well outside of the otherwise known range of this species (northwestern Mexico). Although the voucher specimen is indeed a

Sympholis, it likely got switched with a xenodontine specimen from Costa Rica. There is

probably a Costa Rican xenodontine specimen with a stated locality in Mexico and a

tissue sample of Sympholis. Beware!

A number of species and groupings appear in different parts of the phylogeny in

different analyses. Among the taxa that move around are Dendralaphis and Oreocalamus

(Colubrinae), Cerberus and Enhydris (Homalopsidae), and Alsophis and Helicops

(Xenodontinae). Nagy et al. (2004) and others are providing valuable information about the relative ability of different genes and combinations of genes to recover various clades. Indeed, ND4 may not be the best choice for resolving some colubrid groups, especially when used alone. Nevertheless, my analyses did recover many recognized 87

clades and the Bayesian analysis yielded the most consistent result (Table 1).

Status of Carphophis amoenus

My examination of osteological specimens representing 30 colubrid species

outside the Sonorini revealed one outgroup taxon, Carphophis amoenus, that possesses

the key character used by Savitzky (1983) to define the Sonorini. The bifurcate sulcus

spermaticus suggested placement of Carphophis among the Xenodontinae.

Vidal et al. (2000), Pinou et al. (2004), and Lawson et al. (2005) have provided

recent evidence that Carphophis belongs with the Xenodontinae. The molecular results

obtained here (Figs. 1-3) also suggest that Carphophis belongs with the Xenodontinae. It

remains unclear where Carphophis and other northern xenodontines including Contia,

Diadophis, Farancia, and Heterodon belong with respect to the xenodontine clades

described by Cadle (1984a, 1984b).

Nearest relatives of the Sonorini

Despite variable results for the molecular phylogeny, I am willing to infer that the

nearest relatives of the Sonorini include Phyllorhynchus, Trimorphodon, and members of

the Colubrini sensu Dowling and Duellman (1978). Inclusion of the Old World taxon

Lycodon seems unlikely for reasons discussed below.

Many of the phylogenetic results are interesting. In particular, the North

American green snakes, Liochlorophis and Opheodrys, appear as a clade in all analyses.

These, in turn, are sister to the Mesoamerican green snake, Symphimus, in the neighbor- 88

joining tree but not the others.

Monophyly of the Sonorini

None of the molecular phylogenetic analyses yielded a monophyletic Sonorini

(Figs. 1-3). All analyses yielded two separate but monophyletic sonorinine clades.

Neighbor-joining placed Gyalopion and Sympholis in a clade next to Chilomeniscus,

Chionactis, and Sonora and placed Scolecophis with Tantilla. This agrees with the

arrangement offered by Stickel (1943). The parsimony analysis was similar but placed

Scolecophis next to Chilomeniscus, Chionactis, and Sonora. The Bayesian analysis

placed Gyalopion and Sympholis in a clade next to Scolecophis and Tantilla.

Outgroups falling within the ingroup in one or more analyses included green

snakes (Liochlorophis, Opheodrys, and Symphimus), leaf-nosed snakes

(Phyllorhynchus), lyre snakes (Trimorphodon), patch-nosed snakes (Salvadora), and

racers (Coluber and Masticophis). Several Old World taxa were variably mixed in with

the New World colubrines as well as some xenodontines. This may indicate the

limitations of selected mtDNA sequences to correctly place all taxa.

Relationships within the Sonorini

All three analyses placed Chilomeniscus, Chionactis, and Sonora together as a

clade (Figs. 1-3). The neighbor-joining tree placed Gyalopion and Sympholis in a clade

sister to Chilomeniscus, Chionactis, and Sonora, whereas the Bayesian analysis placed

them next to Scolecophis and Tantilla. Maximum parsimony produced an odd, 89

intermediate result, with Scolecophis next to the Chilomeniscus, Chionactis, and Sonora

clade and this larger group sister to the Gyalopion and Sympholis clade. Both the

neighbor-joining and Bayesian analyses placed Chionactis and Sonora together, whereas

maximum parsimony place Chilomeniscus and Sonora together.

Posterior probabilities for ingroup clades in the Bayesian analysis are provided in

Table 2. Groupings with lower probabilities generally reflect their tendency to vary

among the three analyses. Interestingly, the Bayesian posterior probability for placing

Chionactis and Sonora together was 1.000 and this result differed from that obtained with

morphological data as described below.

Morphological analysis

The heuristic search with 1000 replicates produced 3 maximum parsimony trees

with a length of 257.08 and consistency index of 0.352. Consistency indices varied from

0.145 to 0.225 for mensural characters, 0.122 to 0.735 for meristic characters, 0.069 to

1.000 for frequency-coded characters, and 0.143 to 1.000 for binary and multistate

characters. According to the bootstrap consensus tree (Fig. 4), the genera Conopsis,

Ficimia, Gyalopion, Pseudoficimia, Stenorrhina, and Sympholis form a clade (herein

Ficimia clade) that is the sister group to Chilomeniscus, Chionactis, and Sonora (herein

Sonora clade). These 2 clades are sister to Scolecophis and Tantilla (herein Tantilla clade). Two genera, Geagras and Tantillita, are nested within Tantilla. Two other genera,

Gyalopion and Sonora variably so, appear to be paraphyletic.

Two trends in character performance are noteworthy. Continuous and meristic 90

characters performed better (i.e., had a higher consistency index) if the average standard deviation was smaller relative to the range among species. Similarly, frequency coded characters performed better if the average deviation from fixation was smaller. The worst performing characters included 12 (ventrals), 13 (subcaudals), 30 (prefrontal-supralabial contact), and 32 (separation of 1st pair of infralabials). Ironically, these are among the

most commonly provided characters in the sonorinine taxonomic literature.

Variability of the morphological results

To gain additional insight into the properties of the morphological dataset, I

repeated the heuristic searches using only the 68 taxa that I examined. This was mainly to

see what effects inclusion of 18 taxa for which I could only obtain limited data from the

literature were having on the results. I also repeated both all taxa and examined-only

analyses with characters 30 and 32 excluded because they had the lowest consistency

index. Analyses using all informative characters failed to support the monophyly of

Sonora. When characters 30 and 32 were excluded, Sonora was monophyletic except for

the analysis with 68 examined taxa where it was ambiguous. Stenorrhina appeared as

sister taxon to Pseudoficimia, Sympholis, Gyalopion, and Ficimia when all informative

characters were used and as sister taxon to Pseudoficimia when characters 32 were

excluded, except for the analysis with 68 examined taxa where it was ambiguous. The

position of Tantilla bocourti varies among being sister taxon to all other Tantilla,

Tantillita, and Geagras to being sister to the T. calamarina group and Geagras.

A final analysis included only 37 species and all informative characters. It 91

included 2 representatives from each genus and species group and the results are presented in Figure 5 along with bootstrap values. Groups with less than 50% bootstrap support were collapsed to provide a more conservative view of relationships within the

Sonorini, otherwise the arrangement is very similar to Figure 4.

Comparison of morphological and molecular results

The morphological and molecular results are largely consistent, with the following exceptions. Morphological data provide consistent support for a sister taxon relationship of the Sonora and Ficimia clades, whereas Bayesian analysis placed the

Ficimia and Tantilla clades together. Morphological analyses placed Chilomeniscus and

Chionactis together, whereas the molecular data placed Chionactis and Sonora together.

Molecular data with Bayesian and neighbor-joining analyses supported monophyly of

Sonora and the maximum parsimony analysis was ambiguous. Morphological data

produced variable results for Sonora as noted above.

Discussion

Systematics of New World Colubroidea

Molecular analyses produced a variable core clade containing Sonorini, New

World (NW) Colubrini, Phyllorhynchus, Trimorphodon, and two to five Old World (OW)

taxa: Dispholidus and Lycodon in the parsimony and Bayesian analyses, plus Alsophis,

Helicops, and Oligodon in the neighbor-joining analysis. These variable results can be better understood by comparing the common elements of other published studies, some 92

of which included one or two species of Sonorini. The three analyses presented by

Lawson et al. (2005) placed their two sonorinine species among NW Colubrini and

Phyllorhynchus. Their parsimony analysis also included three OW taxa in the clade:

Gonyosoma, Oligodon, and Ptyas. It is fairly evident that Alsophis and Helicops are xenodontines whereas the other core clade species are colubrines. Lawson et al. (2005) included Lycodon in their investigation, although a different species, and found it to

belong to an OW clade related to Bioga. In another molecular study of snakes, Pinou et

al. (2004) obtained a clade with Tantilla, Coluber, Mastigodryas, and Rhinobothyum.

However, Oxybelis fell into a clade with Elaphe (Pantherophis) and Gastropyxis. The latter is an OW taxon.

Thus, among the various investigations, there is some evidence for a NW clade containing Sonorini. The results of Nagy et al. (2004) and Lawson et al. (2005) suggest that Ptyas and Oligodon may be among the OW taxa closest to this NW clade. I also

suggest that NW Colubrinae may consist of two clades, one the NW Lampropeltini and

the other the NW Colubrini expanded to include the remaining NW colubrines. I base this

conclusion on the common elements of this and published studies and I provide a list of

NW colubrine genera exclusive of the Lampropeltini (Table 3).

The distributions of older snake taxa with both Old and New World

representatives, such as Scolecophidia and Boidae, might be explained by a combination

of vicariance and dispersal. Vidal et al. (2007) suggested that the Caenophidia

(equivalent to the Colubroidea as used here) have an OW origin. The number of extant

colubroid snake lineages to have entered the NW is apparently seven. This assumes NW 93

Xenodermatidae listed by Dowling and Pinou (2003) are belong with the Xenodontinae as suggested by Lawson et al. (2005). So far, evidence for monophyletic NW groups with an OW origin, includes NW Elapinae (Slowinski 1995), NW Crotalinae (Kraus et al.

1996), Xenodontinae (Vidal et al. 2000), Thamnophiini (Alfaro and Arnold 2001), NW

Lampropeltini (Burbrink and Lawson 2007), and the NW Colubrinae exclusive of

Lampropeltini as proposed here. The Hydrophiinae are barely represented in the NW by one trans-Pacific Ocean species (Pelamis). It would be interesting to see how much the extent to which these lineages have penetrated the NW and their diversification is based on time since arrival, ancestral biology, and subsequent innovations.

Below is the current working hypothesis for colubroid taxonomy down to the

subfamily level. It is based mostly on Lawson et al. (2005), but places Xenodermatidae

outside of Elapidae and excludes taxa incertae sedis. The number of NW lineages

appears in parentheses.

Colubroidea Acrochordidae Colubridae Calamariinae Colubrinae (2) Natricinae (1) Xenodontinae (1) Elapidae Atractaspidinae Boodontinae Elapinae (1) Hydrophiinae (1) Psammophiinae Pseudoxyrhophiinae Homalopsidae Pareatidae Viperidae 94

Azemiopinae Crotalinae (1) Viperinae Xenodermatidae

Monophyly of the Sonorini

Molecular analyses produced mixed results with respect to the monophyly of

Sonorini. Sometimes a particular outgroup taxon fell within the Sonorini and sometimes it did not. The Bayesian analysis yielded a monophyletic Sonorini except for the inclusion of Lycodon capucinus as sister taxon to a clade with Chilomeniscus,

Chionactis, and Sonora. The Bayesian analysis reported by Lawson et al. (2005 Fig. 2)

placed Lycodon aulicus next to Dinodon rufozonatum in a clade of OW Colubrinae, and

placed their two representatives of the Sonorini, Sonora semiannulata and Tantilla relicta,

together in a clade of NW Colubrinae. My results may be inaccurate with respect to the

placement of OW taxa within clades of NW Colubrinae. Among NW Colubrinae, the

condition of the septomaxilla, described by Savitzky (1983), appears to be unique to the

Sonorini. Certainly, the status of this character should be examined among the OW

colubrines, especially the taxa that fall among NW colubrines in some analyses. I

recommend continued recognition of Sonorini as a valid taxonomic entity and with

monophyly as a working hypothesis until further research can shed more light on this

question. This systematics of various sonorinine clades is discussed below. 95

Tantilla Clade

Results from morphological data indicate that Geagras and Tantillita are nested within Tantilla (Fig. 4). Bootstrap analysis did not place either Geagras or Tantillita

outside of Tantilla in any of the resulting partitions with a frequency of > 5%. Heuristic

searches constrained with Geagras or Tantillita or both outside of Tantilla increased tree

length by 4.54, 4.20, and 8.96 steps respectively.

Two characters support monophyly of the expanded Tantilla with respect to its

sister taxon Scolecophis. These are absence of apical pits on dorsal scales and absence or

near absence of the loreals. I observed loreals in 5 out of 303 specimens of Tantilla

(including Geagras and Tantillita) compared to all 16 specimens of Scolecophis.

Despite much homoplasy, there is some morphological basis for partially

resolving relationships within Tantilla. Most important for detecting deep divisions are

loss of the left oviduct, loss of scale row reductions, and the arrangement of temporal

scales. A primitive condition for all three characters places T. bocourti and the T.

calamarina group at the base of Tantilla with all other species and Tantillita forming a

large clade. Other evidence places Geagras close to T. calamarina, as suggested by

Wilson and Meyer (1981).

It is not surprising that scale row reductions have been overlooked in these taxa,

because the reductions occur at only a few scales posterior to the temporals or labials.

Among Scolecophis and primitive Tantilla, it is usually rows 2+3 undergoing fusion, occasionally 3+4, and rarely 1+2. All Scolecophis and Tantilla bocourti have reductions, 96

whereas 88% of T. deppei, 67% of T. calamarina, and 0% of Geagras do. The complete

absence of any reduction in Geagras may be related to its highly fossorial morphology.

Geagras redimitus presents a problem. In my examination of two female

specimens at AMNH, I observed only the right oviduct. In one specimen the oviduct

appeared to originate on the right and then cross over to the left anteriorly. Both

specimens were small and their oviducts appeared threadlike. It is possible that I made an

error in anatomical identification. At my request, Phil Rosen (Assistant Research

Scientist, University of Arizona) examined two specimens at USNM and confirmed the

absence of a left oviduct. The condition of the left oviduct should be investigated

throughout Tantilla.

Given the homoplasy in loss of the left oviduct, I reran the analysis enforcing a

single loss. The result increased tree length by only one step. It places T. bocourti at the base, followed by members of the T. calamarina group in a phyletic sequence of

increasingly fossorial taxa, then Geagras, then T. vermiformis and the remaining Tantilla.

Such an arrangement is intriguing because it suggests that Tantilla experienced a highly fossorial revolution just prior to a major radiation. It seems unlikely that time would preserve a basal phyletic sequence of T. calamarina group taxa that otherwise appear to

be recently formed sibling species. The question of a single versus dual origin for loss of

the left oviduct in Tantilla should be a high priority for future research.

Both molecular and morphological data support a close relationship among

northern species of the T. coronata, T. planiceps, and T. rubra groups, and their more

distant relationship to T. semicincta, a southern species. Morphological data indicates 97

that the T. coronata and T. planiceps groups are monophyletic, whereas the T.

calamarina, T. melanocephala, and T. taeniata groups are paraphyletic (Fig. 4). These

latter groups can be redefined and expanded in content to conform to a tentative

phylogenetic taxonomy.

Limitations on computing time precluded any bootstrap analysis with all taxa. I

performed several analyses excluding the taxa I did not examine because of missing data

and variably excluding characters 12, 13, 30, and 32 because they had the lowest

consistency indices in the complete analysis. Maximum support for the Tantilla species

groups were as follows: T. calamarina group 48%, T. coronata group 90%, T.

melanocephala group (includes T. petersi) 61%, T. planiceps group 53%, T. rubra group

77%, and T. taeniata group 34%. A much more taxonomically reduced analysis,

including all characters, produces somewhat stronger support (Fig. 5). Adding species

generally lowers bootstrap support at many nodes. I stress here that there is little basis for

discussing the relationships between species groups of Tantilla because of low bootstrap

support for many clades. Insert comment on support for clade including all Tantilla

exclusive of T. bocourti and T. calamarina group (including Geagras).

Geagras and the T. calamarina group.--Wilson and Meyer (1981) defined the T.

calamarina group by the presence of dark lines and a spatulate extension of the vertebral

dark line onto the top of the head. They also noted the similarity and probable

relationship to the highly fossorial species Geagras redimitus. Wilson and Meyer (1981)

also noted that the degree of fossoriality increased from T. deppei to T. calamarina, 98

culminating with Geagras.

The phylogenetic hypothesis here confirms the inclusion of Geagras within the T.

calamarina group. Characters uniting Geagras with T. calamarina include absence of

contact between the prefrontal and nasal bones, a single postocular, and traits associated

with small size and fossoriality. Geagras deviates from the group by its complete absence

of scale row reductions and absence of the left oviduct.

Contact between the prefrontal and nasal bones is present in all other Tantilla and

Scolecophis for which skeletons were examined. The peculiar absence of contact

between the prefrontal and nasal bones in T. calamarina and Geagras is probably

indicative of further modification associated with fossoriality. Savitzky (1983) reported

secondary contacts between the septomaxilla and both the prefrontal and frontal in

Geagras.

My results do not include T. vermiformis in the T. calamarina group as suggested

by Wilson et al. (1999) and Wilson and Campbell (2000). Similarities between these taxa

may be due to convergent adaptations for fossoriality and the dark vertebral line is a

shared primitive trait. Tantilla vermiformis has a temporal scale configuration resembling other higher Tantilla.

Tantilla coronata group.—Telford (1966) reviewed variation in T. coronata and described two new species. Although I did not use hemipenal morphology in my phylogenetic analysis, group monophyly is supported by a hemipenis with a naked basal half and spinose distal half. The three species are similar in other ways. They have a 99

black cap contrasting with a paler gray to brown dorsum. At least some individuals of all three species have a black nape band, and the common border of the two parietals is shortened by posterior extension of the frontal as well as a more anterior first vertebral.

Tantilla melanocephala group.—Wilson and Mena (1980) justified recognition of

this group based on the presence of a black head cap with varying development of pale

preocular and postocular spots, dark nape band followed by a second pale band, a dark

vertebral line, and contact between the prefrontals and supralabials, although some

specimens lack one or more of these attributes. Figure 4 suggests that the South

American species, T. petersi, also belongs in this group.

Tantilla petersi has a somewhat unique color pattern that has obscured its

relationships until now. It lacks all of the color pattern attributes of the group. However,

the species does share a number of traits common to the group and its inclusion makes

sense geographically. Morphological similarities include large naris-eye length, a vertical

division of the secondary (posterior) temporal, and a dorsal scale color pattern similar to

T. capistrata except for absence of the vertebral line.

Tantilla planiceps group.—Cole and Hardy (1981) revised the systematics of

snakes related to T. planiceps; however, they provided no explicit definition for the

species group. Nonetheless, my results support the monophyly of their species and are

similar to their phylogenetic hypothesis except for the placement of T. atriceps. Both

molecular and morphological phylogenies agree in yielding a monophyletic group and in 100

placing T. gracilis and T. hobartsmithi close together with T. yaquia further out (Figs. 1-

4). I herein define the T. planiceps group by the presence of a dark cap extending beyond

the posterior tips of the parietals, high gular count (within species mean 18.4 or greater),

and a narrow head. A dark cap is usually not visible in T. gracilis, but when it is, it

extends beyond the parietals. The definition does not include T. wilcoxi and it may not

have been the intention of Cole and Hardy (1981) either. I found gular count to be the

only reliable character for distinguishing T. nigriceps (23 or more) from T. atriceps and

T. hobartsmithi (22 or less), in the absence of hemipenal morphology.

Tantillita and the T. taeniata group.--Wilson and Meyer (1971) defined the T.

taeniata group by the presence of a pale vertebral stripe. The original six member species

were T. flavilineata, T. jani, T. oaxacae, T. reticulata, T. striata, and T. taeniata.

Subsequent additions to the group were made by Savitzky and Smith and 1971), Wilson

(1982 and 1983), Perez-Higareda et al. (1985), Campbell and Smith (1997), Campbell

(1998), and Wilson et al. (1999). These taxa were T. cuniculator, T. briggsi, T. cuesta, T.

tayrae, T. slavensi, T. tecta, T. impensa, T. vulcani, T. brevicauda, and T. johnsoni.

Campbell (1998) also placed T. cuesta in synonymy with T. jani. My results suggest nine

additional members including T. alticola, T. bairdi, T. moesta, T. schistosa, T.

semicincta, and the species formerly allocated to Tantillita including T. brevissima, T.

canula, and T. lintoni.

I define the T. taeniata group by the absence of a dark vertebral stripe and by the

presence of either pale stripes or a uniform dark brown dorsum encroaching on the 101

venter. Pale stripes may be obscured or poorly developed in darker species that inhabit more humid environments. There is also tendency for the naris to occupy the center to lower half of the nasal. In other Tantilla groups the naris tends to occupy the upper half to

upper margin of the nasal.

Wilson and Meyer (1971) used the pale lateral stripe on row 4 and adjacent halves

of rows 3 and 5 to distinguish the T. reticulata section from the T. taeniata section. This

condition is also present in some members of the T. melanocephala group. The common

alternative states include a pale stripe on adjacent halves of rows 3 and 4 and no lateral

stripes at all. These conditions are also present outside of the T. taeniata group. No new

taxa have been added to the T. reticulata section. The T. reticulata section is nested in the

T. taeniata section.

Smith (1941) used several characters to distinguish Tantillita from Tantilla,

including a high maxillary tooth number, the teeth being equal in size, in line, without a

diastema, without grooves, and not flattened at the tips. The original member species

were T. brevissima and T. lintoni.

Smith et al. (1993) proposed the allocation of T. canula to Tantillita, stating that

none of the maxillary teeth were enlarged or grooved. They also stated that an earlier

report (Smith 1941) of enlarged, grooved fangs was in error. Smith et al. (1993) also

suggested that aspects of dentition, other aspects related to small body size, and the

variable color pattern were pleisiomorphic relative to Tantilla. If this were true, it would

serve to unite the species of Tantilla but leave the remaining pleisiomorphs unresolved. 102

The nested position of former Tantillita in the Tantilla taeniata group (Fig. 4) suggests that a high number of maxillary teeth and aspects of small body size are derived. The color pattern variation within the putative Tantillita is homoplasious. Absence of the pale

collar would tend to unite T. canula and T. lintoni, whereas absence of stripes would tend to unite T. brevissima and T. lintoni.

Other aspects of dentition among the putative Tantillita are also derived as

explained below. Enlarged and grooved fangs are present in all sonorinines except for

some Conopsis, Sympholis, some Ficimia, and some Tantilla noted below. I examined

one specimen of T. canula and determined that the fangs were slightly enlarged, faintly

grooved, and slightly offset. I interpret this condition as being intermediate. Other taxa

with intermediate expression of some or all of these traits are Geagras redimitus, T.

calamarina, T. gracilis, and T. vermiformis. These taxa are more fossorial than typical

Tantilla and appear to specialize on vermiform beetle larvae rather than centipedes. It is

clear that absence of enlarged, grooved fangs is derived within the Sonorini and probably

related to dietary specializations.

An interpretation that the defining characteristics for Tantillita are derived rather

than pleisiomorphic does well to unite the group. However, the clade was nested within

Tantilla rather than an outgroup. My analysis also placed a number of Tantilla close to

the former Tantillita. They tend to be dark-colored inhabitants of high elevations or the

Atlantic coastal plain. Tantilla bairdi formed a clade with T. brevicauda and T. schistosa.

Tantilla vulcani, T. jani, and T. tayrae formed a phyletic sequence; in some bootstrap analyses they formed a clade. 103

Ficimia Clade

Either one of two characters will serve to distinguish the Ficimia clade from all

other sonorinines. First, they have 17-19 dorsal scale rows at mid body. Second,

dorsolateral processes are present on the premaxilla. Other features are peculiar to the

Ficimia clade.

All species except for Sympholis lippiens have a somewhat pointed snout; all

species except for Stenorrhina freminvillei, Sympholis lippiens, and Ficimia olivacea have a color pattern with more than one longitudinal series of spots or blotches; at least some female specimens in each genus show signs of intersexuality.

The genera comprising this clade have been previously associated with each other, although not all at once. Cope (1861) believed that Sympholis bore some affinity

to Stenorrhina and Conopsis; he also made reference to the nasal being confluent with the

first supralabial, a key character that unites Gyalopion and Ficimia (Hardy 1975c).

Duellman (1961) suggested that Pseudoficimia was intermediate between

Conopsis+Toluca and Gyalopion+Ficimia.

Conopsis.--Bogert (Hardy 1975c) considered Toluca to be congeneric with

Conopsis. This idea is supported by both morphological and molecular studies

(Goyenechea 1995 and Goyenechea and Flores Villela 2000). Monophyly of Conopsis is supported in my study only by viviparity and associated black peritoneum. Extreme sexual dimorphism is also noted (Part 3). Members of this genus also share a montane 104

distribution that is otherwise rare among members of the Ficimia clade.

Ficimia.—Several characters support the monophyly of the genus Ficimia. The rostral extends posteriorly to contact the frontal; the frontal width and interorbital distance, relative to head length, are greater than for any other sharpnosed snake; and the relative eye diameter is smaller than any other sharpnosed snake except for Sympholis.

Within Ficimia, F. variegata, F. olivacea, and F. streckeri form a clade supported by loss

of internasals and a tendency to lose postoculars.

Gyalopion.—Figure 4 does not show Gyalopion to be monophyletic and Figure 5

is ambiguous. The key feature separating Gyalopion from Ficimia is contact between the

rostral and frontal in Ficimia. Absence of this derived condition does not unite the two

species of Gyalopion. Among the Ficimia clade and excluding Conopsis, only a low

ventral count unites the two species of Gyalopion. The majority of other quantitative

characters tend to place G. canum closer to Ficimia. Bootstrap analysis placed the two

species of Gyalopion together in 35.71% of the time. I recommend retaining Gyalopion.

Both species of Gyalopion are dietary specialists on arachnids, especially spiders.

Unfortunately, I had insufficient data to conclude with confidence whether the species of

the sister genus, Ficimia, are spider specialists or not.

Stenorrhina.--Monophyly of Stenorrhina is supported in part by two characters.

First, although shared with Chilomeniscus, confluence of the internasals and nasals is 105

unique to Stenorrhina within the Ficimia clade. Second, absence of apical pits on dorsal

scales is shared with Sympholis and Tantilla but reconstructs unambiguously as a

synapomorphy for Stenorrhina. Stickel (1943) noted that Stenorrhina exhibited greater

development of the opistoglyph condition, similar to Trimorphodon, and more than in

any other sonorinine he examined.

Sonora Clade

Few morphological characters unite the genera Sonora, Chionactis, and

Chilomeniscus. All species except for C. stramineus have at least some specimens that

are banded with the head pattern being the first band. All species except for S.

michoacanensis have a high number of gular scales, although Gyalopion canum and

Sympholis lippiens do also. They all have 15 or fewer dorsal scale rows at midbody but

so do Scolecophis and Tantilla.

Klauber (1951) and Bury et al. (1970) suggested a close relationship of

Chilomeniscus and Chionactis, whereas Stickel (1943) considered Chionactis and Sonora

to be close. The genera Sonora, Chionactis, and Chilomeniscus do seem to form a

morphocline of increasing fossorial specialization (Part 3). A corresponding phyletic

sequence seemed likely but had never been tested by phylogenetic analysis.

Unfortunately my results are ambiguous with respect to relationships among the three

genera. Whereas morphological data support a close relationship of Chilomeniscus and

Chionactis, molecular data indicate that Chionactis is closer to Sonora.

106

Chilomeniscus.—Sand snakes differ from other sonorinines in many ways. They

usually have 13 dorsal scale rows at midbody, although C. stramineus may have fewer

due to additional scale row reductions and C. fasciatus may have more due to reductions

occurring more posteriorly. All sand snakes have the internasal encroaching on the nasal

and contacting the supralabials, but so do many Chionactis occipitalis. Most

Chilomeniscus have the internasal and nasal fused, but so does Stenorrhina. Sand snakes

have a unique secondary contact between the septomaxilla and prefrontal (Savitzky

1983). However, I examined only one or few specimens of each species and none of C.

savagei.

Chionactis.--The two species are similar in many ways, although C. occipitalis shows greater trends towards a fossorial morphology (Part 3). Characters uniting these species include the presence of red saddles on a pale background and dark rings that expand on the venter. One aspect of scutellation that I did not include in the analysis is the relatively small size of the lower post-ocular compared to the upper one.

Sonora.--Results of the morphological and molecular analyses differ with respect

to the monophyly of Sonora. Morphological data suggest that S. semiannulata is closer to

Chilomeniscus and Chionactis. However, this arrangement is poorly supported. The characters responsible include reduced numbers of maxillary and dentary teeth and a greater number of gulars. The molecular phylogeny shifts the root of the Sonora clade to the branch between Chilomeniscus and Chionactis, yielding a monophyletic Sonora. 107

The future of sonorinine Systematics

This investigation found phylogenetic support for several taxonomic groups and recommended that two genera, Geagras and Tantillita, be placed in synonymy with

Tantilla. Monophyletic status of the tribe Sonorini and the genus Gyalopion requires further investigation. Resolving the deeper divisions in the genus Tantilla should provide an especially exciting avenue for research. Specific goals might be the determination of whether the left oviduct was lost once or twice, the position of T. vermiformis and

various species with unique color patterns, and options for partitioning Tantilla into formal taxonomic groups. The question of whether the Sonorini are monophyly will likely benefit from sampling additional New World and Asian colubrine genera.

I expect new investigations to further revise the sonorinine phylogeny, especially

within each of the three major clades. This investigation has provided the first picture of

the evolutionary diversification of a very interesting group. It is my hope that anyone

with an interest in colubrid systematics will use any of my morphological characters,

sequences, and ideas they see fit to clarify that picture. Despite the ease and dominance

of molecular investigations, I anticipate an important role for both molecular and

morphological data.

Acknowledgements

I am grateful to the many people who helped make this project fun. Among those

assisting with specimen loans, tissue samples, and collection visits were Kent Beaman, 108

George Bradley, Carla Cicero, Mike Douglas, Linda Ford, Darrel Frost, Steve Gotte, Lee

Grismer, Michelle Koo, Charles Lowe, Roy McDiarmid, Robert McCord, Brad Moon,

Charlie Painter, Philip Rosen, Greg Schneider, Sally Shelton, John Simmons, Barbara

Stein, Thomas Van Devender, and Wayne Van Devender. I thank Judie Bronstein,

Wayne Maddison, Peter Reinthal, Cecil Schwalbe for their comments on the manuscript.

I also thank Al Agellon for assistance and patience with my molecular work. The molecular component of this investigation was funded by a grant from the Research

Training Group in the Department of Ecology and Evolutionary Biology, University of

Arizona.

Literature Cited

Alfaro, M. E., and S. J. Arnold. 2001. Molecular systematics and evolution of Regina and the thamnophiine snakes. Mol. Phylogenet. Evol. 21:408-423.

Arévalo, E., S. K. Davis, and J. W. Sites, Jr. 1994. Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Sys. Biol. 43:387-418.

Bookstein, F, B., Chernoff, R. Elder, J. Humphries, G. Smith, and R. Strauss. 1985. Morphometrics in evolutionary biology. Acad. Nat. Sci. Philadelphia, Spec. Pub. 15:1-277.

Boulenger, G. A. 1893-6. Catalogue of the snakes in the British Museum (Natural History). 3 Vol. Taylor and Francis, London.

Burbrink, F. T., and R. Lawson. 2007. How and when did Old World ratsnakes disperse into the New World? Mol. Phylogenet. Evol.43:173-189.

Bury, R. B., F. Gress, and G. C. Gorman. 1970. Karyotypic survey of some colubrid snakes from western North America. Herpetological 26:461-466. 109

Cadle, J. E. 1984a. Molecular systematics of xenodontine snakes. II. Central American xenodontines. Herpetologica 40(1):21-30.

Cadle, J. E. 1984b. Molecular systematics of xenodontine snakes. III. Overview of xenodontine phylogeny and the natural history of New World snakes. Copeia 1984(3):641-652.

Campbell, J. A. 1998. Comments on the identities of certain Tantilla (Squamata: Colubridae) from Guatemala, with the description of two new species. Sci. Pap. Nat. His. Mus. Univ. Kansas. 7:1-14.

Campbell, J. A., J. L. Camarillo, and P. C. Ustach. 1995. Redescription and rediagnosis of Tantilla shawi (Serpentes: Colubridae) from the Sierra Madre Oriental of Mexico. Southwest. Nat. 40:120-123.

Campbell, J. A., and E. N. Smith. 1997. A new species of Tantilla (Serpentes: Colubridae) from northeastern Guatemala. Proc. Biol. Soc. Wash. 110:332-337.

Clark, D. R., Jr., 1970. Loss of the left oviduct in the colubrid snake genus Tantilla. Herpetologica 26(1):130-133.

Cole, C. J., and L. M. Hardy. 1981. Systematics of North American colubrid snakes related to Tantilla planiceps (Blainville). Bull. Am. Mus. Nat. Hist. 171(3):199-284.

Cope, E. D. 1861. Contributions to the ophiology of Lower California, Mexico, and Central America. Proc. Acad. Nat. Sci. Philadelphia. 13:292-306.

Cope, E. D. 1876. On the Batrachia and Reptilia of Costa Rica. J. Acad. Nat. Sci. Philadelphia (2)8:93-154.

Cope, E. D. 1895. The classification of the ophidia. Trans. Amer. Phil. Soc. 18(2):186- 219.

Cross, J. K. 1979. Multivariate and univariate character geography in Chionactis (Reptilia: Serpentes). Unpublished PhD. Dissertation. University of Arizona, Tucson.

Dowling. H. G. 1975. A provisional classification of snakes. Yearb. Herpetol. 1:167- 170.

Dowling, H. G., and W. E. Duellman. 1978. Systematic herpetology: a synopsis of families and higher categories. Hiss Publications, New York.

110

Dowling, H. G., R. Highton, G. C. Maha, and L. R. Maxon. 1983. Biochemical evaluation of colubrid snake phylogeny. J. Zool. London 201:309-329.

Duellman, W. E. 1961. The amphibians and reptiles of Michoacán, México. Univ. Kansas Pub. Mus. Nat. Hist. 15:1-148.

Duellman, W. E. 1963. Amphibians and reptiles of the rainforests of southern El Petén, Guatemala. Univ. Kansas Pub. Mus. Nat. Hist. 15:205-249.

Dunn, E. R. 1928. New Central American snakes in the American Museum of Natural History. Amer. Mus. Nov. 314:1-4.

Echternacht, A. C. 1973. The color pattern of Sonora michoacanensis (Dugès) (Serpentes, Colubridae) and its bearing on the origin of the species. Brevioria 410:1-18.

Felsenstein, J. 1988. Phylogenies and quantitative characters. Ann. Rev. Ecol. Syst. 19:445-471.

Frost, D. R. 1983a. Relationships of the Baja California ground snakes, genus Sonora. Trans. Kansas Acad. Sci. 86(1):31-37.

Frost, D. R. 1983b. Sonora semiannulata. Cat. Amer. Amph. Rept. 333.1.

Fulger, C. M., and J. R. Dixon. 1961. Notes on the herpetofauna of the El Dorado area of Sinaloa, Mexico. Pub. Mus. Michigan State Univ. Biol. Ser. 2:1-23.

Funk, R. S. 1964. Fifth Ficimia desertorum Taylor in United States. Southwestern Nat. 9:105.

Goyenechea, I., and O. Flores-Villela. 2002. Taxonomic status of the snake genera Conopsis and Toluca (Colubridae). J. Herpetol. 36:92-95.

Grant, C. 1945. Notes on a herpetological collection from Oaxaca. Herpetologica 3:1-32.

Greer, A. E. 1966. Viviparity and oviparity in the snake genera Conopsis, Toluca, Gyalopion, and Ficimia with comments on Tomodon and Helicops. Copeia 1966:371-373.

Hall, C. W. 1951. Notes on a small herpetological collection from Guerrero. Univ. Kansas Sci. Bull. 34(Pt. 1):201-212.

Hardy, L. M. 1970. Intersexuality in a Mexican colubrid snake (Pseudoficimia). Herpetologica 26:336-343. 111

Hardy, L. M. 1972. A systematic revision of the genus Pseudoficimia (Serpentes: Colubridae). J. Herp. 6(1):53-69.

Hardy, L. M. 1975a. A systematic revision of the colubrid snake genus Gyalopion. J. Herp. 9(1):107-132.

Hardy, L. M. 1975b. A systematic revision of the colubrid snake genus Ficimia. J. Herp. 9(2):133-168.

Hardy, L. M. 1975c. Comparative morphology and evolutionary relationships of the colubrid snake genera Pseudoficimia, Ficimia, and Gyalopion. J. Herp. 9(4):323-336.

Hardy, L. M. 1980a. Ficimia publia. Cat. Amer. Amphib. Rept. 254:1-2.

Hardy, L. M. 1980b. Ficimia variegata. Cat. Amer. Amphib. Rept. 296:1-2.

Hardy, L. M., and C. J. Cole. 1967. The colubrid snake Tantilla armillata Cope in Nicaragua. J. Arizona Acad. Sci. 4:194-196.

Hardy, L. M., and C. J. Cole. 1968. Morphological variation in a population of the snake, Tantilla gracilis Baird and Girard. Univ. Kansas Pub. Mus. Nat. Hist. 17:613-629.

Hartweg, N. 1944. Remarks on some Mexican snakes of the genus Tantilla. Occ. Pap. Mus. Zool. Univ. Michigan. 486:1-9.

Hensley, M. M. 1966. A new subspecies of the Mexican snake, Sympholis lippiens Cope. Herpetologica 22(1):48-55.

Kauffeld, C. F. 1948. Notes on a hook-nosed snake from Texas. Copeia 1948(4):301.

Klauber, L. M. 1951. The shovel-nosed snakes, Chionactis, with descriptions of two new subspecies. Trans. San Diego Soc. Nat. Hist. 11(9):141-204.

Kraus, F., and W. M. Brown. 1998. Phylogenetic relationships of colubroid snakes. Zool. Jour. Linn. Soc. 122:455-487.

Kraus, F., D. G. Mink, W. M. Brown. 1996. Crotaline intergeneric relationships based on mitochondrial DNA sequence data. Copeia 1996(4): 763-773.

Lawson, R., J. B. Slowinski, B. I. Crother, and F. T. Burbrink. 2005. Phylogeny of the Colubroidea (Serpentes): New evidence from mitochondrial and nuclear genes. Mol. Phylogenet. Evol. 37: 581-601. 112

Liner, E. A. 1964. Notes on four small herpetological collections from Mexico. I Introduction, turtles and snakes. Southwestern Nat. 8:221-227.

Little, E. L. 1940. Amphibians and reptiles of the Roosevelt Reservoir area, Arizona. Copeia 1940:260-265.

Loomis, R. B. 1951. Distribution and variation of the black-headed snake in Nebraska. Copeia 1951:242.

Loomis, R. B., and R. C. Stephens. 1967. Additional notes on snakes taken in and near Joshua Tree National Monument, California. Bull. So. Calif. Acad. Sci. 66:1-22.

Maddison, W. P. 1993. Missing data versus missing characters in phylogenetic analysis. Syst. Biol. 42:576-581.

Maddison, W. P., and D. R. Maddison. 1992. MacClade: Analysis of phylogeny and character evolution, version 3. Sinauer Associates. Sunderland, Mass.

McDiarmid, R. W. 1968. Variation, distribution and systematic status of the black-headed snake Tantilla yaquia Smith. Bull. So. Calif. Acad. Sci. 67:159-177.

McDiarmid, R. W. 1992. Systematic status of the San Luis Potosi black-headed snake, Tantilla deviatrix Barbour (Colubridae). Southwest. Nat. 37:303-307.

McDowell, S. B. 1987. Systematics. Pp. 3-50 in Seigel, R. A., J. T. Collins and S. S. Novak (eds.) Snakes: Ecology and evolutionary biology. MacMillan Pub. Co., New York.

Mertens, R. 1952. Die amphibien und reptilien von El Salvador. Zilch. Abh. Senckenb. Naturf. Ges. 487:1-120.

Minton, S. A. 1956. A new snake of the genus Tantilla from west Texas. Fieldiana Zool. 34:449-452.

Nagy, Z. T., R. Lawson, U. Joger, and M. Wink. 2004. Molecular systematics of racers, whipsnakes and relatives (Reptilia: Colubridae) using mitochondrial and nuclear markers. J. Zool. Syst. Evol. Res. 42, 223–233.

Perez-Higareda, G., H. M. Smith, and R. B. Smith. 1985. A new species of Tantilla from Veracruz, Mexico. J. Herp. 19:290-292.

Pinou, T., S. Vicario, M. Marschner, and A. Caccone. 2004. Relict snakes of North 113

America and their relationships within Caenophidia, using likelihood-based Bayesian methods on mitochondrial sequences. Mol. Phylogenet. Evol. 32: 563-574.

Rae, T. C. 1998. The logical basis for the use of continuous characters in phylogenetic systematics. Cladistics. 14:221-228.

Richards, J. J. 1961. Variation and biogeography of the western groundsnake, Sonora semiannulata Baird and Girard, 1853. M. S. Thesis. Arizona State Univ.

Rodríguez-Robles, J. A., and J. M. de Jesús-Escobar. 1999. Molecular systematics of New World lampropeltinine snakes (Colubridae): Implications for biogeography and evolution of food habits. Biol. J. Lin. Soc. 68:355-385.

Savitzky, A. H. 1983. Coadapted character complexes among snakes: Fossoriality, piscivory, and durophagy. Amer. Zool. 23:397-409.

Savitzky, A. H., and H. M. Smith. 1971. A new snake from Mexico of the taeniata group of Tantilla. J. Herpetol. 5:167-171.

Schätti, B. 1987. The phylogenetic significance of morphological characters in the Holarctic racers of the genus Coluber Linnaeus, 1758 (Reptilia, Serpentes). Amphibia-Rept. 8:401-418.

Slowinski, J. B. 1995. A phylogenetic analysis of the New World coral snakes (Elapidae: Leptomicrurus, Micruroides, and Micrurus) based on allozyme and morphological characters. J. Herpetol. 29: 325-338.

Smith, H. M 1941. A new genus of Central American snakes related to Tantilla. J. Wash. Acad. Sci. 31:115-117.

Smith, H. M 1942. A resume of Mexican snakes of the genus Tantilla. Zool. 27:33-42.

Smith, H. M 1943. Summary of the collections of snakes and crocodilians made in Mexico under the Walter Rathbone Bacon Traveling Scholarship. Proc. U.S. Nat. Mus. 93:393-504.

Smith, H. M., and L. Burger. 1950. A new snake (Tantilla) from Mexico. Herpetologica 6:117-119.

Smith, H. M., D. Chizar, and F. Van Breukelen. 1998. Resurrection of Tantilla triseriata (Reptilia: Serpentes) of Mexico. Southwest. Nat. 43:374-375.

114

Smith, H. M., O. Flores-Villela and D. Chizar. 1993. The generic allocation of Tantilla canula (Reptilia: Serpentes). Bull. Maryland Herp. Soc. 29:126-129.

Smith, H. M., and L. E. Laufe. 1945. Mexican amphibians and reptiles in the Texas Cooperative Wildlife collections. Trans. Kansas Acad. Sci. 48:325-354.

Smith, H. M., and E. H. Taylor. 1941. A review of the snakes of the genus Ficimia. J. Wash. Acad. Sci. 31:356-368.

Smith, H. M., and K. L. Williams. 1966. A new snake (Tantilla) from las Islas de la Bahia, Honduras. Southwest. Nat. 11:483-487.

Stevens, P. F. 1991. Character states, morphological variation, and phylogenetic analysis, a review. Syst. Bot. 16:553-583.

Stickel, W. H. 1938. The snakes of the genus Sonora in the United States and Lower California. Copeia 1938(4):182-190.

Stickel, W. H. 1943. The Mexican snakes of the genera Sonora and Chionactis with notes on the status of other colubrid genera. Proc. Biol. Soc. Wash. 56:109-128.

Stuart, L. C. 1935. A contribution to a knowledge of the herpetology of a portion of the Savanna Region of central Petén, Guatemala. Misc. Pub. Mus. Zool. Univ. Mich. 29:1-56.

Stuart, L. C. 1948. The amphibians and reptiles of Alta Verapaz Guatemala. Misc. Pub. Mus. Zoll. Univ. Mich. 69:1-109. Sumichrast, F. 1880. Contribution a l'histoire naturelle du Mexique. I. Notes sur une collection de reptiles et de batraciens de la partie occidentale de l'ithme de Tehuantepec. Bull. Soc. Zool. France 5:162-190.

Swofford, D. L. 1999. PAUP*:Phylogenetic analysis using parsimony, version 4. Sinauer Associates, Sunderland, Massachusetts.

Tanner, W. W. 1961. A new subspecies of Conopsis nasus from Chihuahua, Mexico. Herpetologica 17:13-18.

Tanner, W. W. 1966. A re-evaluation of the genus Tantilla in the southwestern United States. Herpetologica 22:134-152.

Taylor, E. H. 1931. Notes on two specimens of the rare snake Ficimia cana. Copeia 1931(1):4-7.

115

Taylor, E. H. 1936. Description of a new Sonoran snake of the genus Ficimia, with notes on other Mexican species. Proc. Biol. Soc. Wash. 49:51-54.

Taylor, E. H. 1936. Notes on the herpetological fauna of the Mexican state of Sonora. Univ. Kansas Sci. Bull. 37:475-503.

Taylor, E. H. 1936. Notes and comments on certain American and Mexican snakes of the genus Tantilla, with descriptions of new species. Trans. Kansas Acad. Sci. 39:335- 348.

Taylor, E. H. 1940. Some Mexican serpents. Univ. Kansas Sci. Bull. 26:445-487.

Taylor, E. H. 1941. Herpetological miscellany, No. II. Univ. Kansas Sci. Bull. 27(Pt. 1):105-139.

Taylor, E. H., and H. M. Smith. 1942. The snake genera Conopsis and Toluca. Univ. Kansas Sci. Bull. 28:325-363.

Taylor, E. H., and H. M. Smith. 1942. Concerning the snake genus Pseudoficimia Bocourt. Univ. Kansas Sci. Bull. 28(II):241-251.

Taylor, E. H. 1949. A preliminary account of the herpetology of San Luis Potosi. Univ. Kansas Sci. Bull. 33(Pt. 2):169-215.

Taylor, E. H. 1951. A review of the snakes of Costa Rica. Univ. Kansas Sci. Bull. 34(Pt. 1):3-188.

Taylor, E. H. 1960. A second contribution to the herpetology of the state of San Luis Potosi, Mexico. Univ. Kansas Sci. Bull. 33(Pt. 1):441-457.

Telford, S. R. 1966. Variation among the southeastern crowned snakes, genus Tantilla. Bull. Florida State Mus. 10:261-304.

Thiele, K. 1993. The holy grail of the perfect character: The cladistic treatment of morphometric data. Cladistics 9:275-304.

Van Denburgh, J. 1895. A review of the herpetology of Lower California. Part I. Reptiles. Proc. California Acad. Sci., ser. 2, 5:77-162.

Van Devender, R. W., and C. J. Cole. 1977. Notes on a colubrid snake, Tantilla vermiformis, from Central America. Amer. Mus. Nov. 2625:1-12.

Vidal, N., S. G. Kindl, A. Wong, and S. B. Hedges. 2000. Phylogenetic relationships of 116

xenodontine snakes inferred from 12s and 16s ribosomal RNA sequences. Mol. Phylogenet. Evol. 15, 389–402.

Wiens, J. J., and M. R. Servedio. 1997. Accuracy of phylogenetic analyses including and excluding polymorphic characters. Syst. Biol. 46:332-345.

Williams, K. L., P. S. Chrapliwy, and H. M. Smith. 1961. Snakes from northern Mexico. Chicago Acad. Sci. Nat. Hist. Misc. No. 177:1-8.

Wilson, L. D. 1970. Tantilla brevicauda: an addition to the snake fauna of Guatemala, with comments on its relationships. Bull. So. Calif. Acad. Sci. 69:118-120.

Wilson, L. D. 1976. Variation in the South American colubrid snake Tantilla semicincta (Dumeril, Bibron, and Dumeril), with comments on pattern dimorphism. Bull. So. Calif. Acad. Sci. 75:42-48.

Wilson, L. D. 1982. A review of the colubrid snakes of the genus Tantilla of Central America. Milwaukee Pub. Mus. Contrib. Biol. Geol. 52:1-77.

Wilson, L. D. 1983. A new species of Tantilla of the taeniata group from Chiapas, Mexico. J. Herp. 17:54-59.

Wilson, L. D. 1984. Additional notes on colubrid snakes of the genus Tantilla from tropical America. Herp. Review 15:8-10.

Wilson, L. D. 1985. Rediscovery of Tantilla bairdi Stuart and a definite Guatemalan locality for Tantilla taeniata (Bocourt). Herp. Review 16:105.

Wilson, L. D. 1987. A resume of the colubrid snakes of the genus Tantilla of South America. Milwaukee Pub. Mus. Contrib. Biol. Geol. 68:1-35.

Wilson, L. D. 1988. The status of Tantilla excubitor Wilson. J. Herpetol. 22:469-470.

Wilson, L. D. 1990. Tantillita, T. brevissima, T. lintoni. Cat. Amer. Amph. Rept.

Wilson, L. D., and J. A. Campbell. 2000. A new species of the calamarina group of the colubrid snake genus Tantilla (Reptilia: Squamata) from Guerrero, Mexico, with a review and key to members of the group. Proc. Biol. Soc. Wash. 113:820-827.

Wilson, L. D., and C. E. Mena. 1980. Systematics of the melanocephala group of the colubrid snake genus Tantilla. San Diego Nat. Hist. Soc. Mem. 11:1-58.

Wilson, L. D., and J. R. Meyer. 1971. A revision of the taeniata group of the colubrid snake 117

genus Tantilla. Herpetologica 27(1):11-40.

Wilson, L. D., and J. R. Meyer. 1981. Systematics of the calamarina group of the colubrid snake genus Tantilla. Milwaukee Pub. Mus. Contrib. Biol. Geol., 42:1-25.

Wilson, L. D., and J. R. Meyer. 1985. The Snakes of Honduras. 2nd ed. Milwaukee Pub. Mus. Contrib. Biol. Geol. 6:1-50.

Wilson, L. D., R. K. Vaughan, and J. R. Dixon. 1999. Another new species of Tantilla of the taeniata group from Chiapas, Mexico. J. Herpetol. 33:1-5.

118

Tables, Figures, and Appendices

Table 1. Colubroid clades recovered in different analyses. Number of operational taxonomic units in parentheses. Neighbor- joining Parsimony Bayesian Viperidae (3) yes yes yes Elapidae (7) yes yes yes Pareatidae (2) yes yes yes Homalopsidae (2) yes yes yes Natricinae (6) no yes yes NW Natricinae (3) yes yes yes OW Natricinae (3) yes yes yes Xenodontinae (8) no yes yes Colubrinae (60) no no yes NW Lampropeltini (28) yes yes yes Sonorini (16) no no no Chilomeniscus + yes yes yes Chionactis + Sonora (6) Gyalopion + Sympholis (2) yes yes yes Scolecophis + Tantilla (8) yes no yes Tantilla (7) yes yes yes 119

Table 2. Posterior probabilities for ingroup clades obtained with the Bayesian analysis. Clade Posterior probability Lycodon + Sonorini 0.99 Lycodon + Sonora clade 0.77 Sonora clade 1.00 Chionactis + Sonora 1.00 Chilomeniscus cinctus 1.00 Chionactis 1.00 Sonora 0.92 Ficimia clade + Tantilla clade 0.82 Gyalopion + Sympholis 1.00 Scolecophis + Tantilla 0.78 Tantilla 1.00 Tantilla - T. semicincta 0.99 Tantilla - T. semicincta - T. cucullata 0.93 T. relicta + T. wilcoxi 0.83 T. gracilis + T. hobartsmithi + T. yaquia 1.00 T. gracilis + T. hobartsmithi 1.00

Table 3. New World Colubrinae excluding Lampropeltini and Sonorini. Chironius Mastigodryas Coluber Opheodrys Dendrophidion Oxybelis Dryadophis Phyllorhynchus Drymarchon Pseustes Drymobius Rhinobothryum Drymoluber Salvadora Leptodrymus Scaphiodontophis Leptophis Spilotes Liochlorophis Symphimus Masticophis Trimorphodon

120

Trachyboa boulengeri Acrochordus granulatus Achalinus rufescens Xenodermus javanicus Calloselasma rhodostoma Azemiops feae Causus rhombeatus Aplopeltura boa Pareas nuchalis Aparallactus werneri Leioheterodon madagascariensis Madagascarophis colubrina Atractaspis bibroni Micrurus fulvius Bungarus fasciata Pelamis platurus Cerberus rhynchops Enhydris plumbea Storeria occipitomaculata Nerodia taxispilota Thamnophis butleri Rhabdophis subminiata Macropisthodon rudis Sinonatrix trianguligera Hypsiglena torquata MVZFC FC11327 Geophis hoffmanni Contia tenuis Carphophis amoenus Farancia abacura Lycodon capucinus Salvadora hexalepis Coluber constrictor B Dispholidus typus Oligodon octolineata Alsophis portoricensis Helicops pictiventris Sympholis lippiens Gyalopion canum Chilomeniscus cinctus B Chilomeniscus cinctus A Chionactis occipitalis Chionactis palarostris Sonora aemula Sonora semiannulata Symphimus leucostomus Liochlorophis vernalis Opheodrys aestivus Phyllorhynchus browni Phyllorhynchus decurtatus Salvadora hexalepis A Trimorphodon biscutatus Masticophis flagellum Coluber constrictor A Scolecophis atrocinctus Tantilla semicincta Tantilla cucullata Tantilla relicta Tantilla wilcoxi Tantilla yaquia Tantilla gracilis Tantilla hobartsmithi Elaphe flavolineata Dendrelaphis pictus Oreocalamus hanistschi Senticolis triaspis Boiga dendrophilia Bogertophis subocularis A Bogertophis subocularis B Bogertophis rosaliae Arizona elegans A Arizona elegans B Stilosoma extenuatum Lampropeltis getula Cemophora coccinea Lampropeltis mexicana Lampropeltis pyromelana Lampropeltis zonata Rhinocheilus lecontei A Rhinocheilus lecontei B Elaphe guttata Elaphe vulpina Elaphe bairdi Elaphe obsoleta Pituophis lineaticollis A Pituophis lineaticollis B Pituophis melanoleucus A Pituophis melanoleucus B Pituophis deppei A Pituophis deppei B Pituophis catenifer B Pituophis catenifer A Pituophis ruthveni A Pituophis ruthveni B Figure 1. Phylogenetic tree based on mtDNA sequence data using neighbor-joining analysis with HKY85 model. Ingroup indicated by brackets. 121

Trachyboa boulengeri Xenodermus javanicus Acrochordus granulatus Achalinus rufescens Calloselasma rhodostoma Azemiops feae Causus rhombeatus Aparallactus werneri Leioheterodon madagascariensis Madagascarophis colubrina Atractaspis bibroni Bungarus fasciata Micrurus fulvius Pelamis platurus Oreocalamus hanistschi Dendrelaphis pictus Aplopeltura boa Pareas nuchalis Sinonatrix trianguligera Macropisthodon rudis Rhabdophis subminiata Nerodia taxispilota Storeria occipitomaculata Thamnophis butleri Hypsiglena torquata MVZFC FC11327 Geophis hoffmanni Carphophis amoenus Farancia abacura Contia tenuis Alsophis portoricensis Helicops pictiventris Lycodon capucinus Salvadora hexalepis Coluber constrictor B Phyllorhynchus browni Phyllorhynchus decurtatus Salvadora hexalepis A Trimorphodon biscutatus Symphimus leucostomus Dispholidus typus Liochlorophis vernalis Opheodrys aestivus Sympholis lippiens Gyalopion canum Scolecophis atrocinctus Chionactis occipitalis Chionactis palarostris Sonora aemula Sonora semiannulata Chilomeniscus cinctus A Chilomeniscus cinctus B Masticophis flagellum Coluber constrictor A Tantilla semicincta Tantilla relicta Tantilla cucullata Tantilla wilcoxi Tantilla yaquia Tantilla gracilis Tantilla hobartsmithi Oligodon octolineata Cerberus rhynchops Enhydris plumbea Senticolis triaspis Elaphe flavolineata Boiga dendrophilia Bogertophis rosaliae Arizona elegans A Arizona elegans B Stilosoma extenuatum Lampropeltis getula Lampropeltis mexicana Lampropeltis pyromelana Lampropeltis zonata Cemophora coccinea Bogertophis subocularis A Bogertophis subocularis B Rhinocheilus lecontei A Rhinocheilus lecontei B Elaphe bairdi Elaphe obsoleta Elaphe guttata Elaphe vulpina Pituophis melanoleucus A Pituophis melanoleucus B Pituophis lineaticollis A Pituophis lineaticollis B Pituophis ruthveni A Pituophis ruthveni B Pituophis catenifer A Pituophis catenifer B Pituophis deppei A Pituophis deppei B Figure 2. Phylogenetic tree based on mtDNA sequence data using maximum parsimony criterion. 122

Trachyboa boulengeri Acrochordus granulatus Achalinus rufescens Xenodermus javanicus Calloselasma rhodostoma Azemiops feae Causus rhombeatus Aplopeltura boa Pareas nuchalis Cerberus rhynchops Enhydris plumbea Aparallactus werneri Atractaspis bibroni Leioheterodon madagascariens Madagascarophis colubrina Micrurus fulvius Bungarus fasciata Pelamis platurus Storeria occipitomaculata Nerodia taxispilota Thamnophis butleri Macropisthodon rudis Rhabdophis subminiata Sinonatrix trianguligera Hypsiglena torquata MVZFC FC11327 Geophis hoffmanni Carphophis amoenus Farancia abacura Contia tenuis Alsophis portoricensis Helicops pictiventris Dendrelaphis pictus Oreocalamus hanistschi Boiga dendrophilia Oligodon octolineata Bogertophis subocularis A Bogertophis subocularis B Senticolis triaspis Bogertophis rosaliae Arizona elegans A Arizona elegans B Cemophora coccinea Stilosoma extenuatum Lampropeltis getula Lampropeltis zonata Lampropeltis mexicana Lampropeltis pyromelana Rhinocheilus lecontei A Rhinocheilus lecontei B Elaphe bairdi Elaphe obsoleta Elaphe guttata Elaphe vulpina Pituophis melanoleucus A Pituophis melanoleucus B Pituophis catenifer B Pituophis catenifer A Pituophis ruthveni A Pituophis ruthveni B Pituophis deppei A Pituophis deppei B Pituophis lineaticollis A Pituophis lineaticollis B Elaphe flavolineata Liochlorophis vernalis Opheodrys aestivus Symphimus leucostomus Dispholidus typus Phyllorhynchus browni Phyllorhynchus decurtatus Salvadora hexalepis A Trimorphodon biscutatus Salvadora hexalepis B Coluber constrictor B Masticophis flagellum Coluber constrictor A Lycodon capucinus Chilomeniscus cinctus A Chilomeniscus cinctus B Chionactis occipitalis Chionactis palarostris Sonora aemula Sonora semiannulata Sympholis lippiens Gyalopion canum Scolecophis atrocinctus Tantilla semicincta Tantilla cucullata Tantilla relicta Tantilla wilcoxi Tantilla yaquia Tantilla gracilis Tantilla hobartsmithi Figure 3. Phylogenetic tree based on Bayesian analysis of mtDNA sequence data. 123

66 57 Chilomeniscus cintus 37 Chilomeniscus fasciatus 100 Chilomeniscus punctatissimus Chilomeniscus stramineus Sonora clade 75 Chilomeniscus savagei 98 Chionactis occipitalis 46 Chionactis palarostris 59 Sonora aemula 32 Sonora michoacanensis Sonora semiannulata Conopsis amphistichia 53 37 Conopsis biserialis 19 Conopsis lineata 55 Conopsis conica 40 36 Conopsis megalodon Conopsis nasus Ficimia hardyi 13 60 51 Ficimia olivacea 43 51 Ficimia streckeri 34 Ficimia variegata 79 Ficimia publia Ficimia ruspator 57 93 Ficimia ramirezi 59 35 Gyalopion canum Gyalopion quadrangulare Ficimia clade Sympholis lippiens 20 Pseudoficimia frontalis 50 Stenorrhina degenhardtii Stenorrhina freminvillei 60 31 Geagras redimitus 23 Tantilla calamarina 33 Tantilla cascadae Tantilla coronadoi Tantilla deppei 83 Tantilla albiceps 23 Tantilla nigra Tantilla moesta 26 Tantilla alticola 1 Tantilla tecta 29 Tantilla bairdi 17 Tantilla brevicauda 1 Tantilla schistosa 1 12 Tantilla striata 60 Tantillita brevissima 84 1 46 Tantillita lintoni 1 Tantillita canula 17 Tantilla jani 1 16 Tantilla tayrae Tantilla vulcani 35 23 Tantilla flavilineata 3 Tantilla oaxacae 23 Tantilla reticulata Tantilla cuniculator 21 Tantilla briggsi 9 Tantilla impensa 22 Tantilla slavensi 16 24 Tantilla johnsoni Tantilla taeniata Tantilla semicincta 21 Tantilla andinista 12 Tantilla petersi 19 32 Tantilla capistrata 42 Tantilla lempira 24 Tantilla melanocephala 29 Tantilla equatoriana 12 36 Tantilla insulamontana 64 Tantilla miyatai Tantilla supracincta 39 Tantilla atriceps 43 Tantilla gracilis 62 Tantilla hobartsmithi 31 0 39 Tantilla nigriceps 20 68 Tantilla planiceps Tantilla yaquia 88 18 63 Tantilla cucullata Tantilla rubra 10 Tantilla wilcoxi Tantilla clade 52 Tantilla coronata 5 33 Tantilla oolitica Tantilla relicta Tantilla shawi Tantilla vermiformis Tantilla bocourti Scolecophis atrocinctus Coluber constrictor Liochlorophis vernalis

Figure 4. Phylogenetic tree based on morphological data using maximum parsimony. Numbers above branches indicate support from 100 bootstrap replicates with 20 random addition sequence replicates. 124

Figure 5. Phylogenetic tree based on morphological data using maximum parsimony and a reduced number of taxa. Numbers above branches indicate support from 100 bootstrap replicates with 20 random addition sequence replicates. 125

APPENDIX A. List of molecular specimens. Group Operational Taxonomic Unit Specimen ID* Acrochordidae Acrochordus granulatus U49296 Calamarinae Oreocalamus hanistschi U49306 Colubrinae Arizona elegans A AF138749 Colubrinae Arizona elegans B AF138750 Colubrinae Bogertophis rosaliae AF138751 Colubrinae Bogertophis subocularis A AF138752 Colubrinae Bogertophis subocularis B AF138753 Colubrinae Boiga dendrophilia U49303 Colubrinae Cemophora coccinea AF138754 Colubrinae Chilomeniscus cinctus A U49305 Colubrinae Chilomeniscus cinctus B PAH 2D Colubrinae Chionactis occipitalis PAH 3D Colubrinae Chionactis palarostris PAH 4D Colubrinae Coluber constrictor A U49300 Colubrinae Coluber constrictor B AF138746 Colubrinae Dendrelaphis pictus U49304 Colubrinae Dispholidus typus U49302 Colubrinae Elaphe bairdi AF138755 Colubrinae Elaphe flavolineata U49301 Colubrinae Elaphe guttata AF138756 Colubrinae Elaphe obsoleta AF138757 Colubrinae Elaphe vulpina AF138758 Colubrinae Gyalopion canum ASU 22891 Colubrinae Lampropeltis getula AF138759 Colubrinae Lampropeltis mexicana AF138760 Colubrinae Lampropeltis pyromelana AF138761 Colubrinae Lampropeltis zonata AF138762 Colubrinae Liochlorophis vernalis PAH 6D Colubrinae Lycodon capucinus U49317 Colubrinae Masticophis flagellum AF138747 Colubrinae Oligodon octolineata U49316 Colubrinae Opheodrys aestivus MVZ 150192 FC 11703 Colubrinae Phyllorhynchus browni PAH 7D Colubrinae Phyllorhynchus decurtatus PAH 8D Colubrinae Pituophis catenifer A AF138763 Colubrinae Pituophis catenifer B AF138764 126

APPENDIX A, continued. List of molecular specimens. Group Operational Taxonomic Unit Specimen ID Colubrinae Pituophis deppei A AF138765 Colubrinae Pituophis deppei B AF138766 Colubrinae Pituophis lineaticollis A AF138767 Colubrinae Pituophis lineaticollis B AF138768 Colubrinae Pituophis melanoleucus A AF138769 Colubrinae Pituophis melanoleucus B AF138770 Colubrinae Pituophis ruthveni A AF138771 Colubrinae Pituophis ruthveni B AF138772 Colubrinae Rhinocheilus lecontei A AF138773 Colubrinae Rhinocheilus lecontei B AF138774 Colubrinae Salvadora hexalepis A AF138748 Colubrinae Salvadora hexalepis B PAH 9D Colubrinae Scolecophis atrocinctus MVZ 207370 FC 14198 Colubrinae Senticolis triaspis AF138775 Colubrinae Sonora aemula ASDM 21449 Colubrinae Sonora semiannulata PAH 10D Colubrinae Stilosoma extenuatum AF138776 Colubrinae Symphimus leucostomus MVZ 175960 FC 11465 Colubrinae Sympholis lippiens A PAH 11D Colubrinae Sympholis lippiens B MVZ 187736 FC 11327 Colubrinae Tantilla cucullata ASU 15484 Colubrinae Tantilla gracilis PAH 12D Colubrinae Tantilla hobartsmithi PAH 13D Colubrinae Tantilla relicta MVZ 164969 FC 11003 Colubrinae Tantilla semicincta ASU 15136 Colubrinae Tantilla wilcoxi PAH 15D Colubrinae Tantilla yaquia PAH 16D Colubrinae Trimorphodon biscutatus PAH 17D Elapidae Aparallactus werneri U49315 Elapidae Atractaspis bibroni U49314 Elapidae Bungarus fasciata U49297 Elapidae Leioheterodon madagascariensis U49318 Elapidae Madagascarophis colubrina U49313 Elapidae Micrurus fulvius U49298 Elapidae Pelamis platurus U49299 Homalopsidae Cerberus rhynchops U49327 127

APPENDIX A, continued. List of molecular specimens. Group Operational Taxonomic Unit Specimen ID Homalopsidae Enhydris plumbea U49328 Natricinae Macropisthodon rudis U49326 Natricinae Nerodia taxispilota U49322 Natricinae Rhabdophis subminiata U49325 Natricinae Sinonatrix trianguligera U49321 Natricinae Storeria occipitomaculata U49323 Natricinae Thamnophis butleri U49324 Outgroup Trachyboa boulengeri U49295 Pareatidae Aplopeltura boa U49312 Pareatidae Pareas nuchalis U49311 Viperidae Azemiops feae U41865 Viperidae Calloselasma rhodostoma U41878 Viperidae Causus rhombeatus U41866 Xenodermatidae Achalinus rufescens U49319 Xenodermatidae Xenodermus javanicus U49320 Xenodontinae Alsophis portoricensis U49308 Xenodontinae Carphophis amoenus PAH 1D Xenodontinae Contia tenuis PAH 5D Xenodontinae Farancia abacura U49307 Xenodontinae Geophis hoffmanni MVZ FC14122 Xenodontinae Helicops pictiventris U49310 Xenodontinae Hypsiglena torquata U49309

*Specimen IDs beginning with AF and U are GenBank accession numbers; MVZ is the Museum of Vertebrate Zoology; and PAH includes material compiled by the author from various sources.

128

APPENDIX B. MtDNA sequences for phylogenetic analysis.

To copy into Nexus file, replace “$” with “-“ to indicate gap.

Chilomeniscus cinctus A TCCAATCGCAGGGTCCATAGTCCTAGCCGCCATTCTACTAAAACTGGGTGGCT ATGGTATTATTCGAATAACACAAACCCTGCCAACAATAAAAACAGACTTGTT TATACCATTTATTGTACTTGCTCTCTGAGGGGCAACACTAGCCAATTTAACAT GCCTCCAACAAACAGACCTAAAAGCCTTAATCGCATACTCATCAGTTAGCCA CATAGGTCTAGTAATCGCTGCAATTATAATTCAGACACAATGAAGCATCTCG GGGGCTATAATACTAATAATCGCCCACGGATTTACCTCATCAGCACTATTCTG CCTAGCTAACACTACCTACGAACGAACTAAAACTCGAATTATAATTTTAACAC GTGGGTTTCATAACATTATACCCATACTTACAACTTGATGGCTTCTAACAAAC TTAATAAACATCGCAACCCCACCAAGCATAAATTTCACTGGAGAACTATTAA TCGCATCATCCCTATTTAACTGATGCCCCACAACAATTATCATATTTGGCCTA TCAATACTTATCACGGCATCATACTCATTACATATATTCCTATCTACCCAAAT AAACACACAAATAATAAATGCAACAGCACCCCCAACACACTCACGAGAACAT CTAATTATAACACTCCACATTATCCCACTAATATTAATCTCCCTAAAACCAGA ATTAGTCATA????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????

Chilomeniscus cinctus B TCCAATCGCAGGGTCCATAGTCCTAGCCGCCATTCTACTAAAACTGGGTGGCT ATGGTATTATTCGAATAACACAAACCCTGCCAACAATAAAAACAGACTTGTT TATACCATTTATTGTACTTGCTCTCTGAGGGGCAACACTAGCCAATTTAACAT GCCTCCAACAAACAGACCTAAAAGCCTTAATCGCATACTCATCAGTTAGCCA CATAGGTCTAGTAATCGCTGCAATTATAATTCAGACACAATGAAGCATCTCG GGGGCTATAATACTAATAATCGCCCACGGATTTACCTCATCAGCACTATTCTG CCTAGCTAACACTACCTACGAACGAACTAAAACTCGAATTATAATTTTAACAC GTGGGTTTCATAACATTATACCCATACTTACAACTTGATGGCTTCTAACAAAC TTAATAAACATCGCAACCCCACCAAGCATAAATTTCACTGGAGAACTATTAA TCGCATCATCCCTATTTAACTGATGCCCCACAACAATTATCATATTTGGCCTA TCAATACTTATCACGGCATCATACTCATTACATATATTCCTATCTACCCAAAT AAACACACAAATAATAAATGCAACAGCGCCCCCAACACACTCACGAGAACAT CTAATTATAACACTCCACATTATCCCACTAATATTAATCTCCCTAAAACCAGA ATTAGTCATATAATT$$GTGCGTGTAATTTAAAAAAAA$TATCAAACTGTGAA TGTGATCATGGGAAC$CA$ACCCCGCGCACC$A$GAGGGTGCC$ACAAGAACT GCTAATTCTTT$CTTCTGG$AAATAACAA$CCAGCCCCCTCTATCAAAGGATAA TAGTATTCCACTGGTCTTAG$GCACCAAAATTTT

Chionactis occipitalis CCCAATCGCAGGGTCAATAGTACTAGCCGCAATTTTACTAAAACTTGGGGGA 129

TATGGAATCATTCGAATAACACAAATCCTACCAACAATAAAAACAGACCTGT TTATACCATTTATCGTACTAGCCCTTTGGGGGGCAACACTAGCCAACCTAACA TGTCTACAACAAACAGACCTGAAATCACTCATCGCATATTCATCAATCAGCCA CATGGGACTAGTCATCGCTGCAATCATAATTCAAACACAATGAAGCATCTCA GGAGCCATAGCACTAATAGTCGCACACGGATTTACATCATCAGCACTATTCTG CCTAGCCAACACAACCTATGAACGAACTAAAACACGAATTATAATCCTAACA CGCGGATTCCACAACATTATACCAATACTCACCACCTGATGACTGCTGGCCAA CCTAATAAATATCGCAACTCCACCAAGCATAAACTTCACAGGAGAACTACTA ATTGCATCATCACTATTTAACTGATGTCCAACAACAATCATTATATTCGGACT ATCAATACTAATCACAGCATCATACTCACTCCATATATTTCTATCAACACAAA TAAATACACCAATAACAAATACAACAACACCACCAACACACACACGAGAGC ACCTCCTTATAATACTACACATTATCCCATTAATCCTAATCTCCTTAAAACCA GAACTAGTTATTTAA$CAAGTGCGCGTAATTTAATAAAAA$TATCAAGCTGTG ACCGTGATTATAGGGAT$CT$CCCTCACGCACC$A$GAGGGTGCCCT$AAGAAC TGCTAACTCTTT$AATCTGG$AAATAAAGA$CCAGCCCCCTCTACCAAAGGAT AATAGTATTCCACTGGTCTTAG$GCACCAAAATCCT

Chionactis palarostris CCCAATCGCAGGATCAATAGTGCTAGCCGCAATTCTACTAAAACTTGGAGGA TACGGAATTATTCGAATAATACAAATCCTACCAACAATAAAAACAGACCTGT TTATACCATTTATCGTACTAGCCCTTTGAGGGGCAACACTAGCCAACCTAACA TGTCTACAACAAACAGACCTAAAATCACTCATCGCATACTCATCAATCAGCC ACATAGGACTAGTCATTGCTGCAATTATAATTCAAACACAATGAAGCATCTC AGGAGCCATAGCACTAATAGTCGCACACGGGTTTACATCATCAGCACTATTCT GCCTAGCTAACACAACCTATGAACGAACTAAAACCCGAATCATAATCCTAAC ACGCGGATTCCACAACATCATACCAATACTCACCACTTGATGGTTACTAGCCA ACCTAATAAACATCGCAACCCCACCAAGCATAAACTTCACAGGAGAACTACT CATTGCATCATCACTATTTAACTGATGCCCAACAACAATCATTATATTCGGAC TGTCAATATTAATCACCGCATCATACTCACTACACATATTTCTATCAACACAA ATAAATACACCAATAATAAACACAATAATACCACCAACACACACACGAGAAC ACCTTCTTATAATACTTCATATTACCCCATTAATTCTAATCTCCTTAAAACCAG AACTAGTAATTTAA$CAAGTGCGCGTAATTTAATAAAAA$TGTCAAGCTGTGA CCGTGATTATAGGGATCCT$CCCTCACGCACC$A$GAGGGTGCCCT$AAGAAC TGCTAACTCTTT$AATCTGG$AAATAAAGA$CCAGCCCCCTCTACCAAAGGAT AATAGTATTCCACTGGTCTTAG$GCACCAAAATCCT

Sonora aemula CCCAATCGCGGGGTCAATAGTACTAGCCGCAATTCTACTAAAGCTCGGAGGA TATGGAATTATTCGAATAGCACAAACCCTACCAACAATAAAAACTGACTTGT TCATCCCATTCATTGTGCTAGCCATGTGGGGAGCAACATTAGCCAACCTAACA TGCCTACAACAAACAGACCTAAAATCCCTAATTGCTTACTCCTCAGTCAGCCA CATAGGCCTAGTAATCGCCGCAATCATAATCCAAACACAATGAAGCATATCG GGGGCCATGGCACTAATAGTTGCACACGGGTTCACTTCATCAGCACTCTTCTG 130

CCTGGCCAACACCACCTACGAACGAACTAAAACTCGAATTATAATCCTAACA CGGGGATTCCACAACACAATACCAATACTTACAACCTGGTGACTTCTAGCCA ACCTAATAAATATTGCAACCCCACCGAGCATAAACTTCACAGGAGAGTTATT AATTGCATCGTCCTTATTTAACTGGTGTCCTACAACAATCATCATATTTGGAC TATCAATACTCATCACAGCATCATATTCACTCCACATATTCCTATCAACACAA ATAAATACACCAATAACAAATATAACAACACCCCCGACACACACACGAGAAC ACCTCCTTATAACACTCCACATCCTTCCACTAGCATTAATCTCACTAAAACCA GAACTAGTCATCTAAGC$GGTGCGCGTAATTTAAAAAAAA$TATCAAGCTGTG ACCGTGATTTTAGGAAG$GACTCCTCACGCACCCA$GAGGGCGACCT$AAGAA CTGCTAACTCTTT$AACCTGG$AAATAACAA$CCAGCCCCCTCTACCAAAGGA TAATAGTATTCCACTGGTCTTAG$GCACCAAATT$CT

Sonora semiannulata CCCAATTGCCGGCTCGATAGTACTAGCCGCAATCCTACTAAAACTGGGGGGG TATGGAATAATTCGAATAACACAACTACTACCAACAATAAAAACAGACCTAT TTATCCCATTTATTGTACTTGCCCTCTGAGGGGCAACACTAGCCAACCTGACA TGCCTACAACAAACAGACCTAAAATCCCTAATCGCATACTCCTCAATCAGCC ACATAGGCCTAGTTATTGCTGCAATCATAATCCAAACACAATGAAGCACCTC AGGTGCCATAGCATTAATAATCGCACATGGATTCACCTCATCAGCGCTATTCT GCCTAGCCAATACCACCTACGAACGAACTAAAACCCGGATTATAATTCTAAC ACGGGGATTCCACAACATCATACCAATACTCACCACCTGGTGACTTCTAGCCA ACTTAATAAACATCGCAATCCCACCAAGTATAAACTTCACAGGTGAACTATT AATCGCATCATCCTTATTTAACTGATGTCCAACAACAATCATCATATTTGGAT TATCCATACTCATCACGGCATCATACTCTCTTCATATATTTCTATCAACACAA ATAAATACGCCAATAATAAATACAGCAACACCTCCAACACATACGCGAGAAC ATCTTCTAATAACACTCCATATTATTCCACTAATACTAATCTCACTAAAACCA GAACTCGTTATTTAA$CGGGTGCGCGTAATTTAAAAAAAA$TATCAAGCTGTG ACCGTGACTTTAGGGGC$TC$CCCTCACGCACCC$$GGGGGTGATCT$AAGAAC TGCTAACTCTTT$AATCTGG$TAATAACAA$CCAGCTCCCTCTACCAAAGGATA ATAGTATTCCACTGGTCTTAG$GCACCAAAATCCT

Sympholis lippiens CCCAATTGCAGGTTCAATAGTATTAGCTGCAATTCTATTAAAACTGGGGGGAT ACGGCATTATTCGAATAACACAAGTTTTACCAACAATAAAAACAGATTTATTC CTACCATTCATTGTACTAGCCCTCTGAGGGGCAGTACTAGCTAATCTAACATG CCTTCAACAAACAGACTTAAAATCTCTCATCGCATATTCCTCAATTAGCCATA TAGGACTAGTTATTGCTGCAATCATAATTCAAACACAATGAAGTTTTTCAGGA GCTATAGCCCTAATAATTGCCCATGGCTTTACCTCATCAGCATTATTCTGTTTA GCTAATACCACCTACGAACGAACTAAAACCCGTATTTTAGTATTAACACGAG GATTCCATAACATTCTACCAATATTCACTACTTGGTGGCTTCTAACCAATCTA ATAAATATTGCAACTCCTCCAACCATTAACTTTACAGGCGAACTACTAATTAC AGCATCACTATTTAACTGATGTCCAACAACAATCATTATAATTGGATTATCAA TACTTATCACAGCATCATACTCACTACATGTATTCTTATCAACACAAATAGGT 131

GTACCCCAATTAAACTCAACAACGCCCCCAACACACTCACGAGAACACCTTC TTATAACACTCCACATAATTCCACTAATCCTTATCTCAATAAAACCAGAACTA ATTATCTA$$$$$GTGTGTGTAATTTAAAAAAAA$TATCAAGCTGTGACCCTGA TTATAGGTAATAACTCCTCACGCACC$$CGAGGGAGCCCT$AAGAATTGCTAA CTCTTT$ACTCTTG$AAATAACCA$CCAGCCCCCTCTACTAAAGGATAATAGTC TTCCACTGGTCTTAG$GCACCAA$ATTCT

Gyalopion canum CCCAATCGCAGGCTCCATAGTATTAGCTGCAATTCTACTTAAGCTGGGCGGAT ATGGCATCATCCGAATAACTCAAGTTCTACCAACAATAAAAACAGACCTCTT CCTCCCATTTATTGTTCTCGCCCTCTGAGGGGCAACACTAGCTAACTTAACAT GCCTTCAACAAACAGACCTAAAATCGCTCATCGCATACTCCTCAATTAGCCAC ATAGGCCTAGTCATCGCTGCAATTATAATTCAAACACAATGAAGCCTCTCAG GAGCAATAGCCCTAATAATCGCCCACGGCTTCACTTCATCAGCACTATTCTGC CTAGCCAACACCACCTACGAACGAACTAAAACCCGAATTATAATCCTAACAC GAGGGTTCCATAACATACTACCAATATTTACCACCTGGTGGCTGGTAACCAAC CTAATAAATATTGCAACCCCACCCACTATAAACTTCACAGGTGAACTAATAAT TACATCATCACTATTCAACTGGTGCCCAACAACAATCATTTTAGTCGGATTAT CTATACTTATCACCGCATCATACTCCCTACATATGTTTTTATCAACACAAATA GGCACATCTCCCCTAAACTCAACA$$$CCACCAACACATTCACGAGAACACCT TCTCATAACACTCCATATCCTCCCACTGATGTTAATCTCCCTAAAACCAGAAT TAGTAATTTAAT$$$GTGTGTGTAATTTAAAAAAAA$TATCAAGCTGTGACCCT GACAATAGGAAC$AA$CCCTCACGCACC$$CGAGGGTGCCCT$AAGAACTGCT AACTCTTT$ACTCTGG$AAATAACCC$CCAGCTCCCTCTACTAAAGGATAATAG TATTCCACTGGTCTTAG$GCACCAACAT$CT

Tantilla gracilis CCCAATTGCAGGCTCAATAGTACTAGCCGCAATCCTGCTAAAACTGGGCGGA TACGGCATTATTCGAATAATACAAATCCTGCCAATAATAAAGACCGATCTATT CCTACCACTCATTGTTCTCGCCCTCTGGGGGGCAACACTAGCCAACCTGACCT GCCTCCAACAAACAGACCTAAAATCCCTTATCGCTTACTCTTCAGTAAGCCAC ATAGGCCTAGTCATCGCAGCAATCATAATCCAAACACAATGAAGCCTATCCG GAGCCATAGCCCTAATAATCGCCCACGGTTTTACTTCATCAGCACTATTCTGC TTAGCCAATATAACCTATGAACGAACCAAAACACGAATTATAATCCTTACAC GAGGATTTCACAACATCCTACCTATAATAACAACCTGATGACTAGCGACTAA TATAATAAACATTGCCATTCCCCCTAGCATAAACTTCACAGGCGAACTGTTAA TTGCCTCTTCACTATTTAACTGATGCCCAGCAACAATCATTATATTCGGACTA TCTATGCTTATCACAGCATCATACTCACTGCACATATTCCTATCAACACAAAT GGGACTACCTCAATTAAACACGGAAACACCTCCCACTCACTCACGAGAACAC CTTCTTATAACACTACATATCATCCCCCTCATACTAATCTCCCTAAAACCAGA ATTAGTTATTTAAA$GGGTGTGCGTAATTTAAAAAAAA$TATCAAGCCGTGAC CCTGATTTTAGGGGCCAACCCCTCACACACC$$CGAGGGCGACTATAAGATCT GCTAACTCTTT$ATCCTGG$AAATAACCACCCAGCACCCTCTACCAAAGGATA 132

ATAGTATTCCACTGGTCTTAG$GCACCAAAATCTT

Tantilla hobartsmithi CCCAATTGCGGGCTCAATAGTACTAGCCGCAATCCTACTAAAACTAGGCGGA TACGGTATTATTCGAATAATACAAACCCTACCGATAATAAAGACCGATCTGTT CCTACCACTCATTGTCCTTGCTATCTGAGGAGCAACACTAGCCAACCTAACCT GCCTCCAACAAACAGACCTAAAATCCCTTATCGCTTACTCTTCAGTAAGCCAT ATAGGCCTAGTCATCGCAGCAATCATAATCCAAACGCAATGAAGCCTATCCG GAGCCATAGCCCTAATAATCGCCCACGGTTTTACTTCATCAGCACTATTTTGC CTAGCCAATATAACTTATGAACGAACCAAAACACGAATTATAATCCTTACGC GGGGGTTTCACAACACTCTACCTATACTCACAACCTGATGACTAATGACTAAT CTAATAAACATTGCCATTCCCCCTAGCATAAACTTCACAGGCGAACTATTAAT TGCCTCCTCACTATTTAACTGATGCCCAACAACAATCATTATATTTGGACTAT CTATGCTTATCACAGCATCATACTCACTACATATATTCCTATCAACACAAATA GGACTCCCCCAATTAAACACGGAAACACAACCTACTCACTCACGAGAACACC TTCTTATAACACTTCATATCATTCCGCTCATACTAATCTCCCTGAAACCAGAA TTGGTTATTTAA$$GGGTGTGCGTAATTTAAAAAAAA$TATCAAGCCGKGACC CTGATTTTAGGGGK$AACCCCTCACACACC$$$GAGGGCGACTACAAGATCTG CTAACTCTTT$ATCCTGG$GAATAACCACCCAGCACCCTCTACCAAAGGATAA TAGTATTCCACTGGTCTTAG$GCACCAAAATTTT

Tantilla relicta CCCAATCGCGGGCTCAATAGTACTAGCCGCAATCCTGCTAAAACTGGGCGGA TACGGCATCATTCGAATAATACAAATTTTACCTATAATAAAGACCGACCTATT TATACCGCTCATTGTAGTCGCTCTTTGAGGGGCAACACTAGCCAACCTTACCT GTCTACAACAAACAGACTTAAAATCACTCATCGCTTACTCATCAGTAAGCCAC ATAGGCCTGGTTATTGCTGCAATTATAATCCAAACACAATGAAGTCTCTCAGG GGCCATAGCCCTGATAATCGCCCATGGTTTTACCTCCTCAGCATTATTCTGCTT AGCCAATATAACCTATGAACGAATCAAAACACGAATTATGGTTCTTACGCGG GGATTCCACAATATTTTACCAATACTAACAACCTGATGACTACTGACCAACCT AATAAACATTGCCATCCCCCCCAGTATAAACTTCACAGGCGAACTATTAATTG CCTCCTCTTTATTTAATTGATGCCCAACAACAATTATCATATTTGGACTATCCA TGCTTATCACAGCATCATACTCACTACACATATTTCTATCAACACAGATGGGC TCACCCCGATTAAACACGGAAACACCCCCCACTTACACACGAGAACACCTTC TTATAACGCTACACGTCATCCCACTTATGCTAGTCTCACTAAAACCAGAATTA GTCATTTAA$C$$GTGTGTGTAATTTAAAAAAAA$TATCAAGCCGTGACCCTGA TCTTAGGGCC$AGCCCCTCACACACC$$CGAGGGGGATCA$AAGACCTGCTAA CTCTTT$ATCCTGG$GAATAATCACCCGGCCCCCTCTACCAAAGGATAATAGT ATTCCACTGGTCTTAG$GCACCA$AAT$CT

Tantilla semicincta CCCAATCGCCGGCTCTATAGTACTATCCGCAATCCTACTAAAGCTGGGAGGCT ACGGCATCATCCGAATAATACAAATTCTACCCACAACAAACACAGACCTATT 133

TTTACCCCTAATTGTAGTAGCTCTCTGGGGGGCAACCCTGGCTAATCTAACCT GCCTACAACAAACCGACCTAAAATCCCTCATTGCTTATTCTTCAGTGAGCCAC ATAGGCCTGGTCATTGCTGCAATTATAATCCAAACACAATGAAGCCTCTCAG GCACCATAGCTTTAATAATTGCCCATGGTTTTACCTCATCAACACTATTCTGTC TAGCCAATATATCCTATGAACGAACCAACACACGAATTATAGCCCTTACACG AGGGTTCCACAACATCCTACCAATACTAACAGCCTGATGATTACTAACCAAC CTAATAAATATTGCTATCCCACCTAGTATGAACTTTACAGGAGAATTACTAAT TGCATCCTCACTACTCAACTGATGTCCAATAACAATCATTATATTCGGACTAT CCATACTTATCACAGCATCATACTCACTACACATATTTCTCTCAACACAAATA GGCTCCCCCCAGTTAAACATAAAAACCCCCCCAACCCACTCACGAGAACACC TTCTTATGGCACTACACATCATTCCACTAATGCTGATCTCACTTAAGCCAGAA CTAGTTATATA$GC$GGTGTGTGTAATTTAAAAAAAA$TACCAGGCCGTGACC CTGATCATAGGGGC$AA$CCCTCACGCACC$$$GAGGGTGAC$ATAAGATCTGC TAACTCTTT$ACCCTGG$AAATAACCACCCAGCCCCCTCTACCAAAGGATAAT AGTATTCCACTGGTCTTAG$GCACCAAAATCCT

Scolecophis atrocinctus CCCAATCGCAGGCTCAATAGTATTAGCCGCCATTCTACTGAAACTAGGGGGA TACGGCATCATTCGAACAACACAAATCCTACCAACAATAAAAACTGACCTAT TTATACCATTCATCGTACTCGCCCTTTGGGGGGCAACACTAGCCAACCTTACC TGCCTCCAACAAACAGACCTAAAATCCCTTATTGCATATTCATCAATCAGCCA CATAGGTTTAGTTATTGCCGCAATTATTATTCAAACACAATGAAGCATTTCAG GAGCTATAGCCTTAATAATCGCACATGGCTTCACCTCATCAGCACTGTTTTGT CTAGCCAACACCACCTATGAACGAACCAAAACCCGCACTATAATCCTAACAC GGGGGTTTCACAACATCCTCCCAATGCTCTCAGTCTGATGGCTGCTGGTTAAC CTTATAAACATTGCAACCCCGCCCAGCATGAACTTCACAGGCGAGCTGCTAA TCGCCTCATCACTATTTAATTGATGCCCAATAACAATCATTATATTTGGATTAT CAATACTCATTACAGCATCATACTCACTACACATATTCCTATCAACACAAACA GGTACCCCCCCGTTAAATACAATTACACCACCAACTCACTCACGAGAACACC TCCTTATAACACTCCATGTTGTCCCGCTTCTACTAATCTCTTTAAAACCAGAAC TAGTTACCTAATCAAGTGTGTGTAATTTAAAAAAAA$TGTCAAGCCGTGACCC TGACTATAGGGCTAAA$CCCTCGCACATC$$CGAGGGCGCCC$TAAGAACTGC TAACTCTTT$ACCCTGG$AAATAATCA$CCAGCTCCCTCTACCAAAGGATAATA GTATTCCACTGGTCTTAG$GCACCAAAAT$CT

Tantilla cucullata CCCAATTGCGGGCTCCATAGTACTAGCTGCAATCCTACTAAAACTGGGAGGA TACGGCATTATTCGAATAATACAAATCCTGCCAACAATAAAAACTGACCTATT TCTACCACTTATTGTAGTCGCACTCTGAGGGGCAACACTAGCCAATCTAACCT GCCTCCAACAAACAGACCTAAAATCCCTTATCGCTTACTCTTCAGTAAGCCAC ATAGGCTTAGTTATTGCCGCAACCATAATCCAAACACAATGAAGTCTATCGG GGACAATAGCCTTAATAATCGCCCACGGCTTTACCTCATCAGCATTATTCTGC TTAGCCAATATAACCTATGAACGAACAAAAACCCGAATTATAATTCTCACAC 134

GAGGATTTCACAACATCCTACCAATACTCACAACCTGGTGGCTACTGGCCAA CCTAATAAATATTGCCACTCCCCCCAGCATAAACTTTACAAGTGAACTATTAA TTGCCTCCTCACTATTTAACTGATGCCCAACAACAATCATTATATTTGGACTA TCCATGCTTATCACAGCATCATATTCACTTCACATATTCCTATCAACACAAAT AGGCTCACCACAGCTAAACGCCAAAACACACCCAACCCACTCACGAGAACAC CTTCTTATAACACTACATATCATCCCACTCATACTAATCTCACTAAAACCAGA ATTAGTCATCTAA$CAGGTGTATGTAATTTAAAAAAAAATATCAAGCTGTGAC CCTGAATTTAGGAGCCAA$CCCTCATACACC$$CGAGGGCGGCCATAAGACCT GCTAACTCTTT$ATCCTGG$GAATAATAC$CCAGCCCCCTCTACCAAAGGATA ATAGTATTCCACTGGTCTTAG$GCACCAATAT???

Tantilla wilcoxi CCCTATTGCGGGCTCAATAGTACTAGCCGCAATCTTACTTAAGTTGGGCGGAT ACGGTATTATTCGAATAATACAAATCCTACCAACAATAAAGACCGACATTTTT TTACCACTAATTGTAGTCGCCCTTTGAGGGGCAACACTAGCTAACCTAACCTG TCTCCAACAAACAGACTTAAAATCCCTCATCGCTTACTCTTCAGTAAGCCACA TAGGATTAGTAATTGCCGCCATCATAATCCAAACACAATGAAGCCTTTCAGG AACCATAGCCCTAATAATCGCCCATGGTTTTACCTCATCAGCACTATTCTGCT TAGCCAATATAACCTATGAACGAACTAAAACACGAATTATAATTCTTACACG AGGATTCCACAACATCCTACCAATACTTACAACCTGGTGACTCTTAGCCAATC TGATAAATATTGCCATCCCCCCCAGCATAAACTTCACAGGCGAACTATTAATT GCTTCCTCACTATTTAACTGATGCCCAACAACAATTATTATATTCGGACTATC CATACTTATTACAGCATCATACTCACTACACATATTCCTATCAACACAAATAA ACTCACCAGGACTAAACACGGAAACACCACCCACTCACACACGAGAACACCT TCTTATAACATTACACATTATCCCACTTATACTAATCTCACTAAAACCAGAAT TAGTTATCTAA$CAGGTGTATGTAATTTAAAAAAAA$TATCAAGTCGTGACCC TGACCTTAGGGGCCAA$CCCTCATACACC$A$GAGGGTGACCA$AAGACCTGC TAACTCTTT$ATCCTGG$AAATAACCA$CCAGCCCCCTCTACTAAAGGATAATA GTATTCCACTGGTCTTAG$GCACCAAAATCCT

Tantilla yaquia CCCAATTGCGGGCTCAATAGTACTAGCTGCAATTCTGCTAAAACTAGGCGGA TACGGAATTATCCGAATAATACAAATTTTGCCAATAACAAAGACCGATCTATT CCTACCACTAATTGTCCTTGCTCTCTGAGGAGCAACACTAGCCAACCTGACCT GCCTTCAACAAACAGACCTAAAATCCCTCATCGCTTACTCTTCAGTAAGCCAC ATAGGCCTAGTTATTGCTGCAATCATAATCCAAACACAATGAAGCCTTTCCGG GGCCATAGCCCTTATAATCGCCCACGGCTTTACCTCATCAGCACTATTCTGCT TAGCCAATATAACCTATGAACGAACCAAAACACGAATTATAGTCCTAACACG AGGATTTCATAACATCCTGCCTATACTCACAACCTGATGACTAATTATCAACC TAATAAATATTGCCATCCCCCCAAGTATAAACTTTACAGGCGAACTATTAATT GCCTCCTCCCTCTTTAACTGATGTCCAACAACAATCATTATATTTGGACTATCC ATGCTCATCACAGCATCATACTCACTACACATATTCTTATCAACACAAATAGG TCAACCACAACTAAACATAAAAACATCACCCACCCACTCACGTGAACACCTT 135

CTTATAATCCTACACATTATCCCAATTATACTTATCTCCCTAAAACCAGAATT AGTCATTTAA$CAGGTGTGTGTAATTTAAAAAAAA$TATCAAGCCGTGACCCT GATTTTAGGGGC$AACCCCTCACACACC$A$GAGGGTGACTACAAGATCTGCT AATTCTTT$ATCCTGG$GAATAATCA$CCAGCCCCCTCTACCAAAGGATAGTA GTATTCCGCTGGTCTTAG$GCACCAAAATCTT

MVZFC FC11327 TCCTATTGCAGGTTCAATAGTACTAGCCGCCATTCTCCTTAAATTAGGGGGGT ACGGAGTTATCCGAATAATACAAATTCTTCCTATAACAAAAACAGACCTATTC TTACCATTCATTGTCCTTGCCCTATGAGGGGCAACTCTAGCCAACCTAACTTG CCTACAACAAACGGACCTCAAATCCTTAATCGCATACTCATCTATTAGCCACA TGGGCCTAGTAATCGCTGCAACTATAATCCAAACGCAATGAAGCCTATCAGG CGCCATAACCTTAATAATCGCCCACGGCTTCACCTCCTCAGCACTTTTCTGCC TAGCTAATACCACCTACGAACGAACAAAAACCCGAATTATAATCCTCACACG AGGATTTCATAACATTCTACCAATAACCACAACCTGGTGACTCCTTACCAACC TAATAAACATCGCAACACCTCCCACCATAAACTTCACAGGAGAACTACTAAT TGCATCATCCCTATTCAACTGATGTCCAACAACAATCATCATCTTCGGAATAT CCATACTAATTACAGCCTCCTACTCACTACATATATTTTTATCAACACAAATA GGCACATCAATACTTAATTCCCACACACCACCAACACACTCACGAGAACACC TCGTTATAGTATTACACATCCTACCATTAATTCTCATCTCCTTAAAACCAGAA CTCGTAATCTA$$$$$GTGTCTGTAATTTAAAAAAAA$TATCAAGCTGTGACCTT GACAATAGAAAT$TA$TTCTCGCACACCCACGAGGGCGTTAT$AAGACCTGCT AACTCTTT$AATCTGA$AATTAATAC$TCAGCCCCCTCTACTAAAGGATAGTAG TATTCCACTGGTCTTAG$GCACCAAATTCT?

Carphophis amoenus CCCAATTGCAGGATCAATAGTATTAGCAGCAGTTCTACTAAAACTCGGCGGTT ACGGTATCATCCGAATAATACAAATCCTCCCAATAATAAAAACGGATATATT TCTACCATTTATCGTCCTCGCCCTATGGGGGGCAACCCTGGCCAATCTTACCT GCCTACAGCAAACAGACCTAAAATCCCTCATTGCATACTCATCCATTAGTCAC ATGGGCCTAGTTATTGCCGCAATCATAATTCAAACACAATGAAGCCTATCCG GGGCCATAGCCCTAATAATTGCCCACGGTTTTACCTCCTCAGCACTATTCTGC CTAGCTAACACCACCTATGAGCGAACTAAAACCCGAATTATAATCCTTACAC GCGGCTTCCACAACATCTTGCCAATAGCTACAACTTGATGGCTTTTAACTAAC CTAATAAATATTGCAACTCCACCGAGCATAAACTTTACAGGAGAACTACTGA TCGCATCATCCCTATTCAACTGATGCCCAACAACAATCATTATTTTTGGGTTA TCAATATTAATCACAGCATCATATTCCCTTCATATGTTCCTATCAACACAAAT AAACACATCCCTACTAAATACGCCAACTATACCAACACACTCACGAGAACAC CTCCTCTTAACACTACACACCATTCCTCTAATTCTTATCTCTCTAAAACCAGAA CTAGTAATCTA$$?GGGTGTGCGTAATTTAAAAAAAA$TATCAAGCTGTGACCC TGACAATAGGAGT$TCCTCCTCACACACCC$CGAGGGCGTTAT$AAGACCTGC TAAGTCTTT$AATCTGA$GATTAACCC$CCAGCCCCCTCTACCAAAGGATAATA GTATTCCGCTGGTCTTAG$GCACCAAAATACT 136

Contia tenuis CCCAATTGCAGGCTCCATAGTCCTAGCTGCAATTCTACTAAAACTTGGAGGTT ACGGCATTATCCGAATAATACAAACCCTCCCAACAATAAAAACAGACATATT TCTACCATTTATTATTCTCGCCCTTTGGGGGGCAACCCTGGCTAACCTAACCT GTCTACAACAAACAGATTTAAAATCCCTAATTGCATACTCATCCATCAGCCAC ATAGGCTTAGTCATTGCCGCAATCATTATTCAAACACAATGAAGCCTATCAGG GGCCATAGCCCTTATAATCGCTCACGGCTTCACCTCCTCAGCACTCTTCTGCTT AGCCAACACCACCTACGAACGAACCACAACCCGAATTATAATTCTCACACGA GGTTTCCACAATATTCTACCAATAACTACAGCTTGATGACTCCTAACCAGCCT AATAAACATCGCAACCCCGCCTAGTATAAATTTCACAGGCGAACTACTAATC GCATCCTCCCTCTTCAACTGATGCCCAACAACAATCATTATCTTTGGATTATC AATACTAATCACAGCATCCTACTCTCTACACATATTCCTATCAACACAAGCAG GCGTACCCGTATTAAACACCCAAACTCCACCAACACACTCACGAGAACACCT TCTCATAACACTACACACTATTCCACTAATTCTCCTCTCACTAAAACCAGAAC TAGTAATATAA$C$$GTGTGCGTAATTTAAAAAAAA$TGTCAAGCTGTGACCCT GATAATAGGAATTGC$TCCTCACACACC$ACGAGGGTGTCAT$AAGACCTGCT AACTCTTT$AACCTGG$GACTAACCC$CCAGCCCCCTCTACTAAAGGATAATA GTATTCCACTGGTCTTAG$GCACCAAAGTCCT

Geophis hoffmanni CCCAATTGCAGGTTCCATGGTATTAGCTGCCATCCTTCTCAAGTTAGGTGGGT ACGGGATTATCCGAATAATACAAATTCTTCCCATAATAAAAACAGACATATT CTTACCATTCATTGTGCTCGCCCTATGGGGGGCAACTCTTGCCAACCTGACTT GTCTACAACAAACAGACCTCAAATCCCTAATCGCATACTCATCTATCAGCCAC ATAAGCTTAGTAATTGCCGCAATCATAATTCAAACACAATGAAGCTTATCTGG GGCCATAGCCCTAATAATCGCCCACGGATTTACCTCCTCAGCACTTTTCTGCC TAGCCAATATCACCTATGAACGAACAAAAACACGTATTATAATCCTTACACG AGGTCTCCACAATATCTTACCAATAATCACAACCTGATGACTTCTCACTAATC TAATAAATATTGCAATACCCCCCACCATAAACTTCACAGGCGAACTTTTAATT GCATCCTCCATATTCAACTGATGCCCAACAACAATTATCATATTCGGATTATC CATGCTAATCACAGCCTCATATTCCTTACATATATTCCTATCAACACAAATAG GTACAACATCACTAAACACCCACACAACACCAACCCACACACGAGAGCACTT ACTTATAACACTACACACCCTACCACTAATTCTTGTCTCACTAAAACCAGAGC TTGTAATCTAA$$$$GTGTTTGTAATTTAAAAAAAA$TATCAAGCTGTGACCCT GACAATAGGAGC$TACTCCTCATACACCAACGAGGGTGCAAT$AAGACCTGCT AACTCTTT$AATCTTG$GACTAACAC$CCAGCCCCCTCTATCAAAGGATAGTAG TATTCCACTGGTCTTAGAGCACCAACATCTT

Liochlorophis vernalis CCCAATTGCAGGTTCAATAGTACTAGCCGCAATTCTATTAAAACTTGGCGGTT ATGGTATCATTCGAACAACACAAATCATACCAACTATAAATACAGACCTATT CTTACCATTCATTATCCTTGCTCTCTGAGGAGCGACACTAGCCAACCTTACTT 137

GCCTCCAACAAACAGATCTAAAATCATTAATCGCATACTCATCAATTAGCCAC ATGGGATTAGTCATTGCCGCAATTATAATCCAAACACAATGAAGCCTATCAG GAGCCATGGCCCTAATAATCGCCCACGGGTTTACCTCATCAGCACTGTTCTGC CTAGCCAACACCACCTACGAACGTACAAAAACCCGAATTATAATCCTTACAC GGGGATTCCACAATATTCTACCAATACTAACAGCCTGATGACTACTAGCCAA CCTAATAAATATTGCAATCCCGCCAAGTATAAACTTTACAGGGGAATTACTA ATCGCATCCTCCCTGTTTAATTGATGCCCAATAACGATTATCATGTTTGGTCTA TCAATACTTATCACAGCATCATACTCCCTACACATATTTTTATCAACACAAAT AGGCACACCCCTATTAAATATTACAACACCTCCCACACACTCACGAGAACAC CTCCTTATAACACTCCACATTATCCCACTAATACTAATCTCATTAAAACCAGA ATTAGTCATCTAAA$$$ATGTGTGTAATTTAAAAAAAA$TATCAAGCTGTGACC CTGAAAATGGGGGTTTA$CTCCCACACATC$$$GAGGGTGCCAT$AAGACCTGC TAACTCTTT$AATCTGG$AACTAAACA$CCAGCCCCCTCTACCAAAGGATAAT AGTATTCCACTGGTCTTAG$GCACCAATATTCT

Opheodrys aestivus CCCAATTGCGGGTTCAATAGTACTAGCCGCAATCCTGTTAAAACTCGGCGGTT ATGGTATCATTCGAACAACACAAATCATACCAACTATAAAAACAGACTTGTT CTTACCATTCATTATCCTTGCCCTCTGAGGAGCAACACTAGCCAACCTAACTT GCCTCCAACAAACGGACTTAAAATCCTTAATCGCATACTCATCAATTAGCCAC ATAGGCCTAGTCATTGCCGCAATTATAATCCAAACACAATGAAGCCTATCAG GAGCCATAGCCTTAATAATTGCCCACGGGTTTACCTCATCAGCACTATTCTGC CTAGCTAACACCACCTACGAACGCACCAAAACTCGAATTATGATCCTTACAC GGGGGTTCCACAATATTCTACCAATACTTACAACCTGGTGATTGCTGGCCAAT CTAATAAATATTGCAGTCCCACCAAGCATTAACTTTACAGGAGAACTACTAAT CGCATCCTCTCTATTTAACTGGTGCCCAATAACAATTATTATATTTGGACTATC TATACTTATCACAGCATCATACTCCCTACATATATTTCTATCAACACAAATAG GCACACCCCTATTAAACACCACAACACCCCCAACACACTCACGAGAACACCT CCTTATAACACTCCACATTATCCCACTAATACTAGTCTCATTAAAACCAGAAT TAGTCATCTAA$$$GATGTGTGTAATTTAAAAAAAA$TATCAAGCCGTGATCCT GAAAATGGGGGT$TA$CTCCCGCACATC$$$GAGGGTGCCAT$AAGACCTGCTA ACTCTTT$AATCTGG$AACTAACCA$CCAGCCCCCTCTACCAAAGGATAATAG TATTCCACTGGTCTTAG$GCACCAATATT??

Phyllorhynchus browni CCCAATCGCCGGATCAATAGTACTGGCCGCAATCCTATTGAAACTAGGCGGA TACGGTATTATTCGGATAACACAAATCCTACCAACAACTAAAACAGACTTGTT CCTACCATTCATGGTCCTAGCCCTATGGGGGGCAACATTAGCTAATCTAACTT GTCTACAACAAACAGACTTAAAATCACTAATCGCATATTCATCTATTAGCCAT ATAGGCCTGGTCATCGCCGCAATTATAATCCAAACAGAATGAAGTCTTTCAG GGGCCATAGCCCTAATAGTTGCCCACGGGTTTACCTCATCAGCACTATTCTGC CTAGCTAATTCCACCTATGAACGAACCAAGACCCGGATTATAGTACTCACAC GGGGACTTCATAATACCCTACCAATATTTACAACCTGATGACTATTAGCAAAC 138

CTAATAAACATTGCAACCCCACCAAGTATAAACTTCACAGGCGAACTCATAA TTGCATCCTCACTATTTAACTGATGCCCAACAACAATTATCCTATTTGGAGTA TCCATGCTTATCACAGCAACTTACTCCCTACATATGTTTCTATCAACACAAAC GGGCTCCCAACAAACAAACACAATCATACCCCCAACACACACACGAGAACAC CTTCTTATAATACTACATATCGTCCCCCTTCTCCTTGTCTCACTAAAACCAGAA TTAGTCATCTA$$$$$$TGTGTGTAATTTAAAAAAAA$TATTAGGCCGTGACCCT AACCATAGGGAT$ATGCCCTCGCACATC$A$GAGGGTGCTAT$AAGACCTGCT AACTCTTT$ACTCTGG$AGATAGCCT$CCAGCTCCCTCTACCAAAGGATAATAG TATTCCACTGGTCTTAG$GCACCAAAATCCT

Phyllorhynchus decurtatus CCCAATTGCTGGATCAATAGTACTAGCCGCAATCCTATTAAAACTGGGAGGG TATGGCATTATTCGAATAACACAAATTCTACCAACAACAAAAACAGACTTAT TCCTACCATTCATAGTCTTAGCCCTTTGGGGGGCAACACTAGCCAATCTTACT TGCCTACAACAAACAGACTTAAAATCATTAATCGCATACTCGTCCATTAGCCA CATGGGCCTAGTTATCGCCGCAATTATAATCCAAACAGAATGAAGTCTCTCA GGAGCCATGGCCCTAATAATTGCCCACGGGTTTACATCATCAGCACTATTCTG CCTAGCTAACACCACTTATGAGCGAACCAAAACCCGAATTATAGTACTCACA CGAGGACTTCATAACACCCTACCAATATTTACAACCTGATGACTACTAGCGA ATCTAATAAACATCGCAACCCCACCAAGTATAAACTTTACAGGAGAACTCAT AATTGCATCCTCACTATTTAATTGATGTCCAACAACAATTATCATATTCGGAA TATCTATGCTTATCACAGCAACCTACTCACTACATATATTTCTATCAACACAA ATAGGCTACCAACAGATAAACTCAATTATACCCCCAACACACACACGAGAAC ACCTTCTTATAACCCTACATATCATCCCCCTCCTCCTTATCTCACTAAAACCAG AACTAGTCATCTAA$$$$GTGTGCGTAATTTAAAAAAAA$TATTAGGCCCGGAC CCTGACTATAGGAAT$ATGCCCTCGCACATC$A$GAGGGTGTCAT$AAGACCT GCTAATTCTTT$ACTCTGG$AAATAACCC$CCAGCCCCCTCTACCAAAGGATAA TAGTATTCCACTGGTCTTAG$GCACCAAAATCCT

Salvadora hexalepis B CCCAATTGCCGGATCCATAGTACTGGCCGCAATCCTATTAAAACTAGGGGGG TATGGTATACTTCGTATAATACAAATCCTACCACCAATAAAAACAGACATGTT CCTACCATTCCTTGTACTCGCTCTCTGAGGAGCAACACTAGCTAATCTAACCT GCCTTCAACAAACAGACCTTAAATCCCTCATCGCATACTCATCTGTTAGCCAT ATGGGACTAGTCATCGCCGCAATCATAATCCAAACACAATGAAGCTTCTCAG GGGCTATAGCCCTAATAATTGCCCACGGCTTTACCTCATCAGCCTTATTTTGTT TAGCTAACACAACCTACGAACGAACTAAAACCCGAATTATAATCCTAACACG AGGGTTCCACAACATCTTACCAATATTAACAGCCTGATGACTACTTGCTAGCC TAATAAATATTGCAACCCCACCAAGCATAAATTTTACAGGAGAACTTCTAATT GCATCATCCCTATTCAACTGATGTCCAACAACAATCATCTTATTTGGACTATC CATACTTATTACAGCATCATACTCACTCCACATACTTCTATCCACACAGATAG GCACACCAACCCTAAACACCCAAACACCCCCAACACACACACGAGAACACCT TCTCATAGCACTCCATATTATCCCATTAATAATAATCTCTATAAAACCAGAAC 139

TAGTCATCTAAAC$$GTGCGCGTAATTTAAAAAAAA$TATCAGGATGTGACCC TGACATTAGGGGTTAACCCCTCACTCACC$$CGAGGGTGACAG$AAGACCTGC TAACTCTTC$ATCCTGG$AAATAACCC$CCAGCCCCCTCTACCAAAGGATAAT AGTATTCCACTGGTCTTAG$GCACCAAAATCCT

Salvadora hexalepis A ???????????????????????????????ATCGTATTAAAATTAGGAGGGTATGGCATCAT CCGAATAACACAAACCCTACCAACAATAAAAACAGACCTATTCCTACCATTT ATCGTACTCTCCCTATGGGGAGCAACACTAGCCAACCTAACCTGCCTACAAC AAACAGATTTAAAAGCCCTAATCGCATACTCATCTATTAGCCACATAGGCCTA GTTATCGCCGCAACTATAATCCAAACACAATGAAGTTTTTCAGGAGCCATAG CCCTAATAATCGCCCACGGATTTACCTCATCAACATTATTCTGCCTAGCCAAC ACCACATATGAACGAACCAAAACTCGCATTATAATTCTCACACGAGGATTCC ACAACATCTTACCAATATTCACAACCTGATGATTACTGGCAAACCTAATAAAT ATCGCTATCCCCCCAAGCATTAACTTCACAGGAGAACTTCTAATCACAACATC ACTATTCAACTGATGCCCAACAACTATAATCATACTTGGACTATCCATACTTA TTACCACAACATACTCACTTCATATGTTCCTATCAACACAAATAGGCACCCCA CAATTAAATACAACAACACCACCAACACACTCACGAGAACACCTCCTCATAA CACTTCACATTATACCATTAATTCTAATCTCACTAAAACCAGAACTAGTCATC TA$$$$$GTGTACGTAATTTAAAAAAAA$TATCAAGCTGTGACCATGACAATAG GAGC$CA$CTCTCGCACACC$$$GAGGGGGCCAT$AAGACCTGCTAACTCTTT$ TTCCTGGTAAATAATTAACCAGCCCCCTCTACCAAAGGATA$$AG$ATTCC$$T G$$CTTAG$GCACC????????

Symphimus leucostomus CCCAATCGCCGGCTCAATAGTACTAGCCGCAATCCTACTAAAACTGGGGGGT TATGGGATTATCCGAACCACACAAGTATTACCAACAATAAAAACAGACTTAT TCCTACCATTCATCGTACTTGCCCTCTGAGGGGCAACACTAGCTAACCTGACC TGTCTCCAACAAACAGACCTAAAATCCCTAATCGCATACTCATCTATCAGCCA CATGGGCTTAGTTATTGCGGCTATTATAATTCAAACACAGTGAAGCCTATCAG GCGCCATAGCCTTAATAATCGCCCACGGATTCACCTCATCAGCACTATTTTGT CTAGCCAACACCACCTACGAACGAACTAAAACACGTATTATAATTCTCACAC GAGGGTTTCACAACACTCTACCTATACTTACAACTTGATGATTATTAGCCAAT CTAATAAATATTGCAACCCCACCCAGCATTAACTTCACAGGAGAACTAATAA TCACATCATCCCTGTTCAACTGATGTCCAACAACAATAATTATACTAGGACTT TCAATACTCATCACAACATCCTACTCCCTACACATATTTTTATCAACACAAAC AGGAACCCCACTTCTAAACACAATAACACCCCCCACACACTCACGAGAACAC CTTATCATAACCCTCCACATCATCCCACTAATATTAATCTCATTAAAACCAGA ATTGGTTATATA$$$$$GTGTGTGTAATTTAAAAAAAA$TATCAAGCTGTGACC TTGACATTAGGAAC$$$$CCCTCACACACC$$$GAGGGTGTAAT$AAGACCTGC TAACTCTTTTAATCTGG$AAWTAGACC$CCAGCCCCCTCTACCAAAGGATWAT AGTATTCCACTGGTCTTAG$GCACCAAAMCCYT

140

Trimorphodon biscutatus CCCTGTAGCCGGATCAATAGTGCTAGCCGCAATCCTATTAAAATTAGGGGGG TACGGTATCATTCGAATAGCACAAACCCTGCCAACAATAAAAACAGACCTAT TCCTGCCATTTATCGTACTCGCCCTATGGGGAGCAACATTAGCCAACTTAACC TGCCTACAACAAACAGATTTAAAAGCCCTAATCGCATACTCATCTATTAGCCA CATAGGCCTAGTTATCGCCGCAACCATAATCCAAACACAATGAAGTCTTTCA GGAGCCATAGCCCTTATAATTGCCCACGGATTCACCTCATCAGCATTATTCTG CCTAGCTAATACCACATATGAACGAAACAAAACTCGAATTATAATCCTCACA CGAGGATTCCACAACATCTTACCAATATTTACAACCTGATGATTACTGGCAAA CCTAATAAATATCGCCACCCCCCCCAGCATTAACTTCACAGGAGAACTACTA ATTACAACATCACTATTCAACTGATGTCCAACAACTATAATCATACTTGGGTT GTCTATACTCATTACCACAACATACTCACTTCATATATTTCTATCAACACAAA TAGGCACCCCACAGTTAAACACAACAACACCACCCACACACTCACGAGAACA CCTCCTTATAACACTTCACATCATACCATTAGTTATAATCTCACTAAAACCAG AACTAGTCATCTA$$$$$GTGTTCGTAATTTAAAAAAAA$TATCAAGCTGTGAC CATGACAATAGGAGCCGC$TCCTCGCACACC$$$GAGGGAGTTAT$AAGACCT GCTAACTCTTC$TTCCTGG$$AATAACTA$CCAGCTCCCTCTACCAAAGGATAA TAGTATTCCACTGGTCTTAG$GCACCAAAACCCT

Masticophis flagellum CCCAATCGCAGGATCAATAGTACTAGCCGCAATCCTCCTAAAACTTGGAGGA TACGGAATAATTCGAATAACACAAACCCTACCAACAATAAAAACAGACCTAT TCCTCCCATTCATCGTACTTGCCATATGGGGAGCAACATTAGCCAACCTAACC TGCCTTCAACAAACCGATCTAAAATCCCTCATTGCCTACTCTTCCATCAGTCA TATAGGCCTGGTTATTGCCGCAATTATAATCCAAACACAATGAAGCATCTCAG GGGCCATAGCCCTAATAATTGCCCATGGATTCACCTCATCAGCATTATTCTGC CTAGCTAATACAACCTATGAACGAACCAAAACCCGTATTATAATCCTCACAC GAGGATTCCACAACATTCTACCAATAATAACAGCTTGATGACTACTAACCAA CCTAATAAACATTGCAATCCCCCCAAGTATAAACTTCACAGGAGAGTTACTA ATCGCGTCCTCACTATTTAACTGGTGCCCAACAACTATTATTATATTCGGATT ATCAATACTTATTACAGCATCATACTCACTTCACATATTTATCTCAACACAAA TAGGATCACCCATACTTAACATAACAACACCACCAACACACTCACGAGAACA CCCTCTCATAACACTCCATATCATCCCACTAATACTAATTTCACTAAAACCAG AGCTAGTCCTATAGAC$$GTGCGCGTAA$TTAAAAAAAA$TATCAAGCTGTGA CCCTGAAAATAGGGTTCTA$CCCTCACGCACC$A$GAGGGTGCCAC$AAGACC TGCTAACTCTTA$CTCCTGG$AACTAACCA$CCAGCTCCCTCTACCAAAGGATA ACAGTATTCCACTGGTCTTAG$GCACCACAGCTCT

Coluber constrictor B ??????????GGATCCATAATACTAGCCGCAATC$TATTAAAACTCGGAGGGTATG GTATAATTCGTATAATACAAATCCTACCACCAATAAAAACAGACATGTTCCTA CCATTCCTTGTACTCGCTATCTGGGGGGCAACACTAGCCAACCTAACCTGCCT TCAACAAACAGACCTTAAATCCCTAATCGCATACTCCTCTGTCAGCCACATGG 141

GACTAGTCATCGCTGCAATCTTAATCCAAACACAATGAAGCATCTCGGGAGC TATAGCCCTAATAATTGCCCACGGCTTCACCTCATCAGCCCTGTTTTGTCTAG CTAACACAACCTACGAACGAACTAAAACCCGAATTATAATCCTAACACGAGG ATTCCACAACATCCTACCAATACTAACAACCTGATGACTACTTACTAACCTAA TAAATATCGCAACCCCACCAAGCATGAACTTTACAGGAGAACTTCTAATTGC ATCATCACTATTCAACTGATGCCCAACAACAATCATCTTATTCGGACTATCAA TACTTATCACAGCATCATACTCGCTCCACATACTTCTTTCCACACAAATAGGT ACACCAACCCTAAACACCACAACACCACCAACACACACACGAGAACACCTCC TCATAGCACTCCACATCACCCCACTAATAATAATCTCCTTAAAACCAGAACTA GTCATCTAAAC$$$TGCGCGTAATTTAAAAAAAA$TATCAGGATGTGACCCTG ACATTAGGGGTTAA$CCCTCAATCAAC$$CGAGGGTGTCAT$AAGATCCGCTA ACTCCTC$ATCCCGG$GAATAACCA$$CAAGCCCCTCTACCAAAGGATAATAG TATTCCACTGG$CTTAG$GCACC????????

Coluber constrictor A CCCAATCGCAGGCTCAATAGTACTAGCCGCAATCCTATTAAAACTTGGGGGA TATGGAATAATTCGAATAATACAAATCCTACCAACAATAAAAACAGATTTGT TCCTTCCATTTATTGTACTAGCCCTATGAGGGGCAACACTAGCTAATCTAACC TGCCTTCAACAAACTGACCTAAAATCCCTCATTGCTTACTCCTCCATCAGCCA CATGGGTTTAGTAATTGCCGCAATCATAATTCAAACACAATGAAGCATTTCAG GAGCTATAGCCCTAATAATCGCCCACGGGTTCACCTCATCAGCACTATTCTGC CTAGCCAACACAACCTATGAACGAACCAATACCCGTATTTTAATCCTCACACG AGGGTTTCACAACATCCTACCAATAATAACAGCTTGATGGTTATTAACCAACC TAATAAATATTGCAATCCCCCCAAGCATAAACTTCACAGGAGAATTAATAAT CGCATCCTCACTTTTTAACTGATGTCCAACAACCATTATCATATTTGGACTGTC AATACTTATCACGGCATCATACTCACTCCACATGTTTATCTCAACACAAATGG GATCACCTATATTAAATTCAACAACACCCCCAACACACTCACGAGAACACCT TCTTATAACACTCCATATCATCCCCCTAATATTAATTTCACTAAAGCCAGAAC TAGTTATA???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Dispholidus typus ?CCAATCGCAGGCTCAATGGTATTAGCAGCAATCCTGCTTAAACTGGGCGGAT ACGGGATTATCCGCATAACACAAATTATACCACCAACAAAAACCGACATGTT CCTACCATTTATTGTCCTCTCTCTTTGAGGGGCAACCCTAGCCAACCTAACCT GCCTCCAACAAACAGATTTAAAATCCCTCATCGCATACTCCTCTGTCAGCCAT ATAGGTTTAGTCATCGCAGCTATCATAATCCAAACACAATGAAGCCTATCAG GAGCCATAGCCCTCATAATTGCCCACGGGTTTACCTCCTCAGCCCTGTTTTGT CTAGCTAACATAACCTATGAACGAACCAAAACCCGAATTATAGCCCTCACAC GAGGATTTCACAACATCCTCCCCATGCTCACAACCTGATGATTGTTAACCAAC CTAATAAACATCGCAACCCCACCAAGCATGAACTTCACTGGAGAGCTCTTAA TCGCATCATCGCTATTTAACTGATGCCCAACAACAATAATTATACTAGGTCTG 142

TCAATACTCATTACAGCATCATACTCCCTGCATATATTTTTATCAACACAAAC AGGCACACCCACACTAAACACCGTAACTACCCCAACCCACTCACGAGAACAT CTCTTAATAATACTCCACATCACCCCTCTTGTATTAACCTCCCTCAAACCAGA GCTGGTCATC????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????

Lycodon capucinus CCCAATTGCTGGCTCCATAGTACTAGCCGCAATTTTGTTAAAACTCGGGGGCT ACGGCATTATTCGAATAATACAAATCATGCCAACGGCGAAAACGGACCTGTT TCTCCCATTTATCGTGCTCTCGCTCTGAGGGGCAACCCTTGCCAACCTCACAT GCCTTCAACAAACAGACCTAAAGTCTCTAATCGCATACTCTTCAGTTAGCCAC ATGGGCCTAGTTATCGCCGCAACCATAATACAAACTCAATGGGGCCTCTCCG GAGCAATAGCGATGATGGTTGCCCACGGGTTCACCTCATCGGCACTATTCTGC TTAGCCAACACCACCTACGAACGGACCAAAACCCGGATCATAATCCTAACAC GGGGGTTCCACAACATCCTACCGATACTAACAACCTGGTGGCTGCTGACCAA CCTAATAAACATCGCAACCCCACCAAGCCTAAACTTCACAGGAGAACTATTA ATCGCATCTTCCCTATTCAACTGATGCCCAACGACAATGGTTTTATTCGGACT ACTAATGCTTATCACAGCCTCATACTCACTACACATACTCCTATCCACGCAAA CGGGCACCACCACGCTAAACACAATAACGCACCCAACCCACTCCCGAGAGCA CCTACTCATAGCACTACACATTATCCCGCTTATATTGATTTCACTAAAGCCAG AATTAGTCACC??????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????

Arizona elegans A CCCAATCGCAGGATCCATGGTACTAGCCGCAATTCTACTAAAACTTGGGGGA TACGGTCTTATTCGAATAACACAAACCATGCCAACAATAAAAACAGACCTGT TCCTACCATTTATTATTCTTGCCCTCTGAGGGGCAACACTAGCTAACCTGACT TGCCTCCAACAAACAGATCTAAAATCTCTTATTGCATATTCTTCAATCAGCCA TATGGGGTTAGTAATTGCCGCTATTATAATTCAAACACAATGAAGCCTATCCG GAGCTATAGCTCTAATAATCGCCCATGGGTTTACTTCATCTGCACTTTTCTGTC TAGCCAACACCACCTATGAACGAACCAAAACCCGAATTATAATCCTTACACG TGGGTTCCACAATATCCTACCAATACTTACAACATGGTGACTACTAATTAACC TAATAAATATTGCAACTCCACCCACTATAAACTTTACCGGGGAATTACTAATT GCATCTTCACTATTTAACTGGTGTCCAACAACGATTATTATATTTGGCCTATC AATACTAATCACAGCATCATACTCCCTACATATATTCCTATCTACACAAATAG GCACACCTCTATTAAATACAATAACCCACCCAACACACTCACGAGAACACTT ACTTATAATACTACACACCGTTCCCCTTATATTAATCTCACTCAAACCAGAAT TAGTTATCTAA$$$$GTGTATGTAATTTAATAAAAA$TATCAGGCTGTGACCTT GACATTAGGATA$$G$CCCTCATACACC$$$GAGGGTGCCAT$AAGATCTGCTA ACTCTTT$AATCTGG$GACTAATAT$CCAGCCCCCTCTACTAAAGGATAATAGC ATTCCATTGGTCTTAG$GCACCATTATCCT 143

Arizona elegans B CCCAATCGCAGGATCCATGGAACTAGCCGCAATTCTACTAAAACTTGGGGGA TACGGTCTTATTCGAATAATACAAACCATGCCAACAATAAAAACAGACCTGT TCCTACCATTTATTATTCTTGCCCTCTGAGGGGCAACACTAGCTAATCTGACTT GCCTCCAACAAACAGATCTAAAATCTCTTATTGCATATTCTTCAATCAGCCAT ATGGGATTAGTAATTGCCGCTATTATAGTTCAAACACAATGAAGCCTATCCGG AGCTATAGCTCTAATAATCGCCCATGGGTTTACTTCATCTGCACTCTTCTGTCT AGCCAACACCACCTATGAACGAACCAAAACCCGAATTATAATTCTTACACGT GGGTTCCACAATATCCTACCAATACTTACAACATGGTGACTACTAATTAACCT AATAAATATTGCAACTCCACCCACCATAAACTTTACCGGGGAATTACTAATTG CATCTTCACTATTTAACTGGTGTCCAACAACGATCATTATATTTGGCCTATCA ATACTAATCTCAGCATCATACTCCCTACATATATTCCTATCTACACAAATAGG CACACCTCTATTAAATACAATAACCCACCCAACACACTCACGAGAACATTTA CTTATAATAATACACACCGTTCCCCTTATATTAATCTCACTCAAACCAGAATT AGTTATCTAA$$$$GTGTATGTAATTTAATAAAAA$TATCAGGCTGTGACCTTG ACATTAGGATA$$G$CCCTCATACACC$$$GAGGGTGCCAT$AAGATCTGCTAA CTCTTT$AATCTGG$GACTAATAT$CCAGCCCCCTCTACTAAAGGATAATAGCA TTCCATTGGTCTTAG$GCACCATTATCCT

Bogertophis rosaliae TCCAATTGCAGGATCCATAGTACTAGCCGCAATCCTATTAAAACTCGGAGGA TACGGTATTATACGAATAATACAAATTATACCAACAATAAAAACAGACCTAT TCATACCATTTATCGTTCTTGCTTTGTGGGGGGCAACACTAGCTAACCTAACC TGCCTACAACAAACAGACCTAAAATCTCTCATCGCATACTCGTCCATCAGCCA TATGGGGTTGGTAATTGCTGCAATTATAATCCAAACACAATGAAGTCTATCTG GTGCTATAGCCTTAATAATCGCCCATGGGTTTACCTCCTCTGCAATATTTTGTC TAGCCAACACTACCTATGAACGAACTAAAACTCGAATTATAATCCTCACACG CGGATTCCACAATATCCTACCAATACTTACAACCTGGTGACTAATAATTAATC TGATAAATATTGCAACCCCACCCACTATAAACTTTACAGGAGAACTGCTAATT GCATCATCACTATTCAACTGATGTCCAACAACAATCATTATATTTGGCCTATC AATACTTATTACAGCATCTTATTCTCTACACATGTTCCTATCAACACAAATGA ATACACCACTATCAAACACAATAGTAAACCCAACACACTCACGCGAACACCT ACTTATAATACTACACACCACTCCACTAATACTAATCTCTCTTAAACCAGAAC TTATTATTTAA$$$$GTATATGTAATTTAAAAAAAA$TATCAGGCTGCGATCCT GACATTAGGAATTAG$CCCTCATACACC$$$GAGGGTGCCAT$AAGACCTGCTA ACTCTTT$AACCTGG$$AATAAACA$CCAGCCCCCTCTACCAAAGGATAACAG CATTCCACTGGTCTTAG$GCACCATAATCCT

Bogertophis subocularis A CCCAATTGCGGGGTCCATAGTACTAGCCTCAATTCTACTAAAACTGGGGGGG TACGGCATCATACGAATGATACAAATTTTACCAACAACAAAAACAGACCTGT TTCTACCATTTATTATTCTTGCTCTCTGAGGGGCAACTTTAGCCAATTTAACCT 144

GCCTACAACAAACTGACCTAAAATCCCTTATTGCATACTCATCAGTCAGTCAC ATGGGGTTAGTAATTGCCGCAATCATAATTCAAACACAATGAAGTCTATCGG GGGCCATAGCCTTAATAATTGCCCACGGATTTACCTCATCTGCACTATTCTGC CTAGCTAACACCACCTATGAACGAACTAAAACCCGAATTATAATCCTTACAC GTGGATTCCACAACATTCTACCAATACTAACAGCCTGATGATTACTAATTAAC CTAATAAATATTGCAACCCCACCCACTATAAACTTTACAGGAGAACTACTAAT TGCATCATCCCTATTTAACTGATGCCCAACAACAATCATTATATTTGGCCTAT CAATACTTATCACAGCATCATATTCTTTACATATATTTCTATCAACACAAATA GGTACCCCCATATTAAATACAACAACCCACCCAACACACTCACGAGAACACC TACTTATAATACTACACAGCATCCCGTTAATACTAATCTCCCTAAAACCAGAA CTGGTTATTTAA$$$$GTGTCTGTAATTTAAAGAAAA$TATCAGGCTGTGATCC TGACATTAGGGGT$AA$CCCTCACACACC$$$GAGGGTGCCAC$AAGACCTGCT AAATCTTT$AATCTGG$AATTAAATA$CCAGCCCCCTTTACCAAAGGATAACA GCATTCCACTGGTCTTAG$GCACCACAATACT

Bogertophis subocularis B CCCAATTGCGGGGTCCATAGTACTAGCCTCAATTCTACTAAAACTGGGGGGA TACGGCATCATACGAATGATACAAATTTTACCAACAACAAAAACAGACCTGT TTCTACCATTTATTATTCTTGCTCTCTGAGGGGCAACTTTAGCCAATTTAACCT GCCTACAACAAACTGACCTAAAATCCCTTATTGCATACTCATCAGTCAGTCAC ATGGGGTTAGTAATTGCCGCAATCATAATTCAAACACAATGAAGTCTATCGG GGGCCATAGCCTTAATAATTGCCCACGGATTTACCTCATCTGCACTATTCTGC CTAGCTAACACCACCTATGAACGAACTAAAACCCGAATTATAATCCTTACAC GTGGATTCCACAACATTCTACCAATACTAACAGCCTGATGATTACTAATTAAC CTAATAAATATTGCAACCCCACCCACTATAAACTTTACAGGAGAACTACTAAT TGCATCATCCCTATTTAACTGATGCCCAACAACAATCATTATATTTGGCCTAT CAATACTTATCACAGCATCATATTCTTTACATATATTTCTATCAACACAAATA GGTACCCCCATATTAAATACAACAACCCACCCAACACACTCACGAGAACACC TACTTATAATACTACACAGCATCCCGTTAATACTAATCTCCCTAAAACCAGAA CTGGTTATTTAA$$$$GTGTCTGTAATTTAAAGAAAA$TATCAGGCTGAGATCC TGACATTAGGGGT$AA$CCCTCATACACC$$$GAGGGTGCCAC$AAGACCTGCT AAATCTTT$AATCTGG$AAATAAATA$CCAGCCCCCTCTACCAAAGGATAACA GCATTCCACTGGTCTTAG$GCACCACAATACT

Elaphe bairdi ?CCAATTGCTGGGTCTATAGTACTAGCCGCAATTCTACTAAAATTAGGAGGAT ATGGTATTATTCGAATAATACAAATCCTACCAACAATAAAAACAGATCTATTC CTACCATTTATTGTACTTGCTCTATGGGGGGCAACACTAGCCAACCTAACCTG CCTACAACAAACAGACCTAAAATCTCTTATCGCATACTCATCTATCAGCCACA TAGGGTTAGTAATTGCCGCAATTATAATCCAAACACAATGAAGTCTGTCAGG AGCCATAGCCTTAATAATTGCTCACGGATTTACTTCCTCCGCATTATTCTGTCT AGCCAACACTACTTATGAACGAACTAAAACTCGTATTATAATCCTTACACGCG GATTCCATAACATTCTACCAATACTCACAACCTGATGATTGCTAATTAACTTA 145

ATAAATATTGCAACTCCACCAACTATAAACTTTACAGGAGAACTACTAATTGC ATCCTCACTACTTAACTGATGCCCAACAACGATAATTATATTCGGACTATCAA TACTTATCACAGCCTCATACTCCTTACACATATTTCTATCAACACAAATAGGC ATACCTATATTAAACACAACAACACACCCAACACACTCACGAGAACATCTTC TTATAATACTACACATTATTCCACTAATACTAATCTCCCTTAAACCAGAACTG GTAATCTAAA$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTTTGA CATTAGGAAT$TC$TCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCTAAC TCTTT$AATCTGG$GACTAAACA$CCAGCCCCCTCTACTAAAGGATAATAGCA TTCCACTGGTCTTAG$GCACCATAATACT

Elaphe guttata CCCAATTGCTGGCTCCATAGTACTAGCCGCAATTCTACTAAAACTCGGAGGAT ACGGCATTATCCGAATAATACAAATCCTGCCAACAATAAAAACAGATCTATT CCTACCATTCATTGTCCTCGCCCTATGGGGGGCAACACTAGCAAACCTAACTT GCCTACAACAAACAGACCTAAAATCCCTCATCGCATACTCATCCATTAGCCAT ATGGGATTAGTAATTGCTGCAATCATAATTCAAACACAATGAAGCCTATCAG GAGCCATAGCCCTAATAATTGCCCATGGTTTTACCTCCTCCGCACTATTCTGT CTAGCCAACACCACATATGAACGAACTAAAACCCGAATTATAGTCCTCACAC GTGGGTTTCATAATATCCTACCAATACTTACAACCTGATGATTACTAATTAAC CTAATAAACATTGCAACCCCGCCAACTATGAATTTCACAGGAGAACTGCTAA TTGCATCCTCATTATTCAATTGATGCCCAACAACAATCATTATATTTGGGTTAT CAATACTTATCACAGCATCATACTCCCTGCATATATTTCTATCAACACAAACA GGCACACCACTATTAAATACATCAACACATCCAACACACACACGAGAACACC TCCTTATAATTCTTCACATCATCCCACTAATACTAATCTCCCTTAAACCAGAA CTGGTTATTTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTT TGACATTAGGAAC$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCT AACTCTTT$AATCTGG$AACTAAACA$CCAGCCCCCTCTACCAAAGGATAATA GCATTCCACTGGTCTTAG$GCACCAAAATCCT

Elaphe obsoleta CCCAATTGCTGGATCTATAGTACTAGCCGCTATTCTACTAAAATTAGGGGGAT ACGGGATTATCCGAATAATACAAATCCTACCAACAATAAAAACAGATCTATT CCTACCATTTATTGTACTTGCCCTATGGGGAGCAACACTGGCCAATCTAACCT GCCTACAACAAACAGACCTAAAATCTCTCATCGCATACTCATCTATCAGCCAC ATGGGGTTAGTAATTGCCGCAATTATAATCCAAACACAATGAAGTCTGTCAG GAGCTATAGCCTTAATAATTGCCCACGGATTTACTTCCTCCGCATTATTCTGTC TAGCCAACACTACTTATGAACGAACTAAAACCCGAATTATAATCCTTACACG CGGATTCCACAACATCCTACCAATACTCACAACCTGGTGATTACTAATTAACT TAATAAATATTGCAACCCCGCCAACTATAAACTTTACAGGAGAACTACTAATT GCATCCTCGCTACTTAACTGATGCCCAACAACAATAATTATATTCGGACTATC AATACTTATTACAGCCTCATACTCCCTACACATATTCCTATCAACACAAACAG GCACACCTATATTAAACACAACAACACACCCAACACACTCACGAGAACATCT TCTTATAATATTACACACCATTCCACTAATACTAATTTCCTTTAAACCAGAAC 146

TGGTCATTTAA$$$$ATGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTTT GACATTAGGAAT$AC$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCTA ACTCTTT$AATCTGG$AACTAAACA$CCAGCCCCCTCTACTAAAGGATAATAG CATTCCACTGGTCTTAG$GCACCATAGTACT

Elaphe vulpina TCCAATTGCTGGGTCCATAGTACTAGCCGCAATCCTACTAAAACTAGGAGGA TACGGTATTATTCGAATAATACAAATTATACCAACAATAAAAACAGATCTATT CCTACCATTTATTGTCCTAGCTTTGTGGGGGGCAACACTAGCAAATCTAACTT GCTTACAACAAACGGATCTGAAATCTCTTATTGCATACTCATCTGTTAGTCAC ATAGGACTAGTCATTGCTGCAATTATAATCCAAACAGAATGAAGTCTATCGG GAGCCATAGCCTTAATAATTGCCCACGGATTTACTTCCTCCGCACTATTCTGC CTAGCCAACACCACTTATGAACGAACTAAAACCCGAATTATAATCCTTACAC GAGGATTCCACAACATCCTGCCGATACTAACAACCTGATGGTTGCTGATTAAC CTAATAAATATTGCAATCCCGCCCACTATAAACTTTACAGGAGAACTACTAAT TGCATCCTCACTATTTAATTGGTGTCCAACAACAATTATTATATTCGGATTATC AATACTTATTACAGCATCATACTCCCTACATATATTTCTATCAACACAAACAG GCACCCCCCTATTAAATACAATAACATATCCAACACACTCACGAGAACACCT CCTTATAATACTTCACATTATTCCACTAATACTTATCTCTCTTAAACCTGAACT GATTATTTAA$$$$GTGTATGTAATTTAAATAAAA$TATCAAACTGTGACTTTG ACATTAGGAAT$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCTAA CTCTTT$AATCTGG$GACTAAACA$CCAGCATCCTCTACTAAAGGATAATAGC ATTCCACTGGTCTTAG$GCACCACAATCCT

Rhinocheilus lecontei A CCCAATTGCTGGGTCTATAGTACTAGCCGCAATTCTACTAAAACTAGGGGGGT ACGGGATAATCCGAATAATACAAATCCTGCCAACAATAAAAACAGATCTATT CCTACCATTCATTGTTCTAGCTCTTTGAGGAGCAACACTGGCCAATCTAACTT GTCTTCAACAAACAGACCTAAAATCTCTTATTGCTTATTCATCTATTAGCCAC ATAGGGTTAGTAATCGCAGCAATTATAATTCAAACACAATGAAGTCTATCTG GAGCCATAGCTTTAATAATTGCCCACGGGTTCACCTCCTCTGCATTATTCTGT CTAGCTAACTCTACCTACGAACGAACTAAAACCCGAATTATAATCCTTACACG AGGATTCCACAATATTTTACCAATACTCACAATCTGATGACTACTAATCAACT TAATAAACATTGCAACCCCACCAACTATAAACTTCACAGGAGAACTGATAAT TGCAACCTCATTATTTAACTGATGCCCAACAACAATAATTATATTTGGATTAT CAATACTTATCACAGCATCATACTCTCTACATATGTTTCTATCAACACAAACA GGCACACCCATATTAAACACAATAACCCACCCAACACACTCACGAGAACATC TCATTATAATACTACACGTCATTCCGCTAATACTAATCTCCCTCAAACCAGAA CTAATCATATAA$$$$GTGTGTGTAATTTAAAAAAAA$TATCAAGCTGTGACCC TGACATTAGGAGC$AA$$CCTCATACACC$$$GAGGGTGCTAC$AAGATCTGCT AACTCTTT$AATCTGG$AAATAAACA$CCAGCTCCCTCTACTAAAGGATAATA GTATTCCACTGGTCTTAG$GCACCACAATCCT

147

Rhinocheilus lecontei B CCCAATTGCTGGGTCTATAGTACTAGCTGCAATTCTACTAAAACTAGGGGGGT ACGGGATAATCCGAATAATACAAATCCTGCCAACAATAAAAACAGATCTATT CCTACCATTCATTGTTCTTGCTCTTTGAGGAGCAACACTGGCCAATCTAACTT GTCTTCAACAAACAGACCCAAAATCTCTTATTGCATATTCATCTATTAGCCAC ATAGGGTTAGTAATCGCAGCAATTATAATTCAAACACAATGAAGTCTATCTG GAGCCATAGCTTTAATAATTGCCCACGGATTCACCTCCTCTGCATTATTCTGT CTAGCTAACTCTACCTACGAACGAACTAAAACCCGAATTATAATCCTTACACG AGGATTCCACAATATTTTACCAATACTCACAATCTGATGACTACTAATCAACC TAATAAACATTGCAACCCCACCAACTATAAACTTCACAGGAGAACTGATAAT TGCAACCTCATTATTTAACTGATGCCCAACAACAATAATTATATTTGGATTAT CAATACTTATCACAGCATCATACTCTCTACATATGTTTCTATCAACACAAACA GGCACACCCATATTAAACACAATAACCCACCCAACACACTCACGAGAACATC TCATTATAATACTACACGTCATTCCGCTAATACTAATCTCCCTCAAACCAGAA CTAATCATATAA$$$$GTGTGTGTAATTTAAAAAAAA$TATCAAGCTGTGACCC TGACATTAGGAAC$AA$$CCTCATACACC$$$GAGGGTGCTAC$AAGATCTGCT AACTCTTT$AATCTGG$AAATAAACA$CCAGCTCCCTCTACTAAAGGATAATA GTATTCCACTGGTCTTAG$GCACCACAATCCT

Stilosoma extenuatum ?CCAATTGCAGGGTCTATAGTACTAGCSGCAATCCTACTAAAACTGGGGGGAT ACGGCATTATCCGAATAATACAAATTATACCAMCAATAAAAACAGACCTATT CCTACCATTTATTATTCTAGCTCTTTGAGGGGCAACACTAGCTAACCTAACCT GCCTCCAACAAACGGACCTAAAATCCCTTATTGCATACTCATCCATCAGCCAC ATAGGCTTAGTAATTGCTGCAATTATAATCCAAACACAATGAAGTCTATCAG GAGCCATAGCTTTAATAATCGCCCATGGGTTTACCTCCTCTGCACTGTTCTGT CTAGCTAATACTACCTATGAACGAACTAAAACCCGAATTATGATCCTTACACG AGGATTCCACAATATCCTACCAATGTCCACAAGTTGATGATTACTAATTAACT TAATAAATATTGCAACCCCACCAACTATAAACTTTACAGGAGAACTATTAATT GCATCTTCCCTATTCAACTGATGCCCAGCAACAATCATTATATTTGGATTATC AATACTCATCACAGCATCATACTCCCTACATATATTCCTATCAACACAAATAG GCACACCCCTATTAAACATTATAACTCAACCAACACACTCACGAGAACACCT ACTTATAGTACTACACATTATCCCATTAATACTAATCTCCTTAAAACCAGAGC TAGTTATCTAAA$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCCGTGACCCT GACATTAGGAAT$AA$ACCTCATACACC$$$GAGGGCGCCAT$AAGAACTGCT AACTCTTC$AATCTGG$GACTAATAAACCAGCCCCCTCTACTAAAGGATAATA GTATTCCACTGGTCTWAG$GCACCACAATCCT

Lampropeltis getula CCCAATTGCAGGGTCTATAGTACTAGCCGCAATCCTACTAAAACTAGGAGGA TACGGCATTATCCGAACAATACAAATTATACCAACAATAAAAACAGACTTAT TCCTACCATTTATTATCCTCGCTCTTTGAGGAGCAACACTAGCTAATCTAACC TGCCTCCAACAAACAGATCTAAAATCACTAATCGCATACTCATCTATCAGCCA 148

CATAGGCTTGGTAATTGCAGCAATTATAATTCAAACACAATGAAGCCTATCA GGAGCCATAGCCTTAATAATCGCCCATGGGTTTACCTCCTCTGCACTATTTTG CTTAGCCAATACTACCTATGAACGAACTAAAACCCGACTTATAATCCTTACAC GGGGGTTCCACAATATCCTGCCAATACTCACAACCTGATGGCTATTAACTAAC TTAATAAATATTGCAACCCCACCAACTATAAACTTTACAGGAGAACTACTAAT TGCATCCTCTTTATTCAGCTGATGCCCAGCAACAATCATTATATTTGGATTATC AATACTCATCACAGCGTCATATTCTCTACATATATTTCTATCAACACAAATAG GCACACCTCTATTAAACACTATAACTCAACCAACACACTCACGAGAACACCT ACTTATAGTACTACACACCATTCCATTAATACTAATCTCTCTAAAACCAGAAC TAGTTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCTGTGACCCT GACATTAGGAGTTAA$ACCTCATACACC$$$GAGGGCGCCAT$AAGAACTGCT AACTCTTT$AATCTGG$AACTAATAAACCAGCCCCCTCTACTAAAGGATAATA GCATTCCACTGGTCTTAG$GCACCATAATCCT

Lampropeltis mexicana CCCAATTGCAGGATCCATAGTACTAGCTGCAATCCTGCTAAAACTAGGGGGA TACGGCATTATCCGTATGATACAAATTATACCAGTAATAAAAACAGACTTATT TTTACCATTTATTATTCTTGCCCTTTGAGGAGCAACACTAGCTAATTTAACCTG TCTACAACAAACGGACCTAAAATCTCTTATCGCATACTCATCCATTAGCCATA TAGGCCTAGTAATTGCCGCAATTATAATTCAAACACAATGAAGTCTATCAGG AGCTATAGCCTTAATAATCGCCCATGGGTTTACTTCCTCCGGACTATTTTGCTT AGCCAATACTACCTATGAACGAACTAAGACCCGAATCATAATCCTTACACGG GGGTTCCACAACATCCTGCCAATGCTCACAACCTGGTGATTACTAATTAACCT AATAAATATTGCAACCCCACCAACTATAAACTTTACAGGAGAACTATTAATT GCATCCTCACTATTCAACTGATGTCCTACAACAATCATTATATTCGGACTATC AATACTCATTACAGCATCCTATTCTCTTCATATATTCCTATCAACGCAAATAA GCACACCTCTATTAAACACTAAAACTCAACCAACACACTCACGAGAACATCT ACTTATAGTACTACATGTCATCCCACTAATACTAATCTCCCTCAAACCAGAAC TGATTATTTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCCGTGACCCT GACATTAGGATA$AA$CCCTCATACACC$$$GAGGGTGTTAT$AAGAATTGCTA ACTCTTT$AACCTGG$AACTAACATACCAGCTCCCTCTACCAAAGGATAATAG CATTCCACTGGTCTTAG$GCACCACAATCCT

Lampropeltis pyromelana TCCAATTGCAGGATCTATAGTACTAGCTGCAATCCTGCTAAAACTAGGCGGAT ACGGCATTATCCGAATAATACAAATTATACCAATAATAAAAACAGACTTATT CCTGCCATTCATTGTCCTTGCTCTTTGAGGGGCGACACTAGCCAATTTAACCT GCCTACAACAAACAGACCTAAAATCCCTTATCGCATACTCATCTATCAGCCAT ATGGGCCTAGTAATTGCCGCAATTATAATTCAAACACAATGAAGTTTATCGG GGGCCATAGCCTTAATAATCGCCCACGGATTTACCTCCTCTGCACTATTCTGT CTAGCCAATACTACCTATGAACGAACTAAAACCCGAATCATAGTCCTTACAC GAGGATTTCACAATATCCTGCCAATACTCACAACCTGATGATTACTGATTAAC CTAATAAATATTGCAACTCCACCAACTATAAACTTTACAGGAGAACTACTAAT 149

TGCATCCTCCCTATTTAACTGATGCCCAACAACAATCATTATATTTGGACTAT CAATACTTATCACAGCCTCATATTCTCTTCATATATTTCTATCAACACAAATA GGCACGCCCCTATTAAACACCACAACCCAGCCAACACACTCACGAGAACACC TACTTATAATACTACATATTATTCCGCTAATACTAATCTCCCTTAAACCAGAA CTGATCATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCCGCGACCC TGACATTAGGAAT$AA$CCCTCATACACC$$$GAGGGCGCCAT$AAGACCTGCT AACTCTTT$AATCTGG$AACTAACATACCAGCCCCCTCTACCAAAGGATAATA GCATTCCGCTGGTCTTAG$GCACCTCAATCCT

Lampropeltis zonata CCCAATTGCAGGGTCCATAGTACTAGCTGCAATCCTACTAAAACTCGGAGGA TACGGCACTATCCGAATAATACAAATTATACCAACAATAAAAACAGATCTGT TCCTACCATTTATTGTCCTAGCCCTTTGAGGGGCAACACTAGCTAACTTAACC TGCCTACAACAAACGGACCTAAAATCCCTTATCGCATACTCATCTGTCAGTCA CATGGGCCTAGTAATTGCCGCAGTTATAATTCAAACACAATGAAGTTTATCAG GGGCCATAGCCTTAATAATCGCCCATGGGTTTACTTCCTCTGCACTATTCTGT CTAGCCAACACTACCTACGAACGAACTAAAACCCGAATCATAATCCTTACAC GAGGATTCCACAATATTCTGCCAATACTTACAACCTGGTGGCTACTAATTATT CTGATAAATATTGCAACCCCACCAACTATAAACTTTACAGGAGAACTACTAA TTGCATCCTCACTATTCAACTGGTGTCCAACAACAATCATTATATTCGGACTA TCAATACTTATCACAACATCATATTCTCTTCATATATTCCTATCAACACAAAC AGGCACACCCCTATTAAACACCACAACCCAACCAACACACTCACGAGAACAC CTACTCATAGTATTACATATTATTCCGCTAATTTTAATCTCCCTTAAACCAGAA CTAATTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCCGTGACCC TGACATTAGGAAT$AA$ACCTCATACACC$$$GGGGGTGCCAT$AAGACCTGCT AACTCTTT$AATCTGG$AACTAACACACCAGCTCCCTCTACCAAAGGATAATA GCATTCCACTGGTCTTAG$GCACCACCATCCT

Cemophora coccinea CCCAATTGCCGGATCTATAGTACTAGCCGCAATCCTACTAAAACTGGGCGGA TATGGCATTATTCGAATAATACAAATTATACCAACAATAAAAACAGACTTGTT TCTACCATTTATTGTTCTTGCTCTATGAGGAGCAACACTGGCTAATCTTACCTG CCTACAACAAACCGACCTAAAATCCCTTATCGCATACTCATCTATCAGCCACA TAGGGCTAGTAATTGCTGCAATTATAATCCAAACACAATGAAGTTTATCGGG GGCCATAGCCTTAATAATTGCCCACGGATTTACCTCCTCCGCATTATTCTGTCT AGCTAACACTACCTATGAACGAACTAAGACCCGAATTATGATTCTTACACGG GGGTTTCATAACATCCTACCAATACTCACAACCTGATGACTGCTAATTAACTT AATAAATATTGCAACTCCACCAACTATAAACTTTACAGGAGAACTATTAATTG CATCCTCATTATTTAACTGATGTCCAACAACAATCATTATATTCGGACTATCA ATACTCATCACAGCATCATATTCACTACACATATTCCTATCAACACAAACAGG GACACCTCTATTAAACACAATAACCCAGCCAACACACTCACGAGAACACCTA CTTATAACATTACACGCCATTCCACTAGTACTAATCTCCCTAAAACCGGAACT GATTATTTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCTGTGACCCTG 150

ACATTAGGAAC$AA$CCCTCATACACC$$$GAGGGTGCCAT$AAGACCTGCTAA CTCTTT$AATCTGG$AACTAACACACCAGCCCCCTCTACTAAAGGATAATAGC ATTCCACTGGTCTTAG$GCACCATAATCCT

Pituophis catenifer A TCCAATTGCTGGCTCCATAGTACTAGCTGCAATTTTACTAAAACTAGGGGGAT ACGGTATTATTCGAATAATACAAATTCTACCAACAATAAAAACAGATTTATTC CTACCATTCATTGTCCTCGCTCTGTGGGGGGCAACATTGGCCAATCTAACCTG CCTACAACAAACAGATCTAAAATCTCTTATTGCATACTCATCTATCAGCCACA TGGGGTTAGTAATTGCCGCAATCATAATCCAAACACAATGAAGCCTATCAGG AGCCATAGCCCTAATAATCGCCCACGGGTTCACTTCATCTGCACTATTCTGTC TGGCTAACACCACCTATGAACGAACTAAAACCCGAATCATAATCCTCACACG AGGATTCCACAACATCCTACCAATACTCACAACCTGGTGGTTACTGGTCAACC CAATAAACATCGCAACCCCACCTACTATAAACTTTACAGGAGAACTACTAAT TGCATCCTCACTATTCAACTGATGCCCAACAACAATTATTATATTCGGACTAT CAATACTTATCACAGCATCATATTCCCTACACATATTTCTATCCACACAAACA GGCATACCTATATTAAACACAACAACACACCCAACACACTCACGAGAACACC TTCTTATAGTACTACACATTATTCCACTAATACTAATCTCCTTAAAACCAGAA CTATTTACCTAA$$$$ATGTGTGTAATTTAAAAAAAA$TATCAAACTGTGACTT TGACATTAGGAAT$AA$CCCTCACACATC$$$GAGGGTGCCAT$AAGACCTGCT AACTCTTT$AATCTGG$AACTAACACACCAGCTCCCTCTACTAAAGGATAATA GCATTCCACTGGTCTTAG$GCACCACAATCCT

Pituophis catenifer B TCCAATTGCTGGCTCCATAGTACTAGCTGCAATTTTACTAAAACTGGGGGGAT ACGGAATTATTCGAATAATGCAAATTCTACCAACAATAAAAACAGATTTATT CCTACCATTCATCGTCCTCGCCCTGTGGGGAGCAACACTGGCCAATCTAACCT GCCTACAACAAACAGATCTAAAATCTCTTATTGCATATTCCTCCATCAGCCAC ATGGGGTTAGTAATTGCCGCAATCATAATCCAAACACAATGAAGTCTATCAG GAGCTATGGCCCTAATAATCGCCCACGGGTTTACCTCATCTGCACTATTCTGT CTAGCCAACACCACCTATGAACGAACTAAAACCCGAATCATAATCCTCACAC GAGGATTCCACAACATCCTGCCAACACTCACAACCTGGTGATTATTGATCGAC CTAATAAACATCGCAACCCCACCCACTATAAATTTTACAGGAGAACTACTAA TTGCATCCTCACTATTCAACTGATGTCCAACAACAATTATCATATTTGGACTA TCAATACTTATCACGGCATCATATTCCCTACACATACTCCTATCCACACAAAC AGGCATACCAATATTAAACACAACAACACACCCAACACACTCACGAGAACAC CTTCTTATAGTACTACACATTATCCCACTAATACTAATCTCCCTTAAACCAGA ACTAATCATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGCTGTGACT TTGACATTAGGAAT$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGC TAACTCTTT$AACCTGG$AACTAAGATACCAGCTCCCTCTACTAAAGGATAAT AGCATTCCATTGGTCTTAG$GCACCACAATCCT

Pituophis deppei A 151

CCCAATTGCTGGTTCCATGGTACTAGCTGCAATTTTATTAAAATTGGGGGGGT ACGGTATTATTCGAATAATGCAGATTATACCAACAATAAAAACAGACCTATT CCTACCATTTATTGTTCTCGCCATGTGGGGGGCAACATTAGCCAATCTAGCCT GCCTACAACAAACAAATTTAAAATCTCTTATTGCATATTCATCTATCAGCCAC ATATGATTAGTAATTGCCGCAATCATAATCCAAACACAATGAATTCTATCAGG GGCAATAGCTCTAATAATCGCCCACGGATTCACTTCATCTGCACTGTTCTGTC TAGCTAACACCACCTATGAACGAACTAAAACCCGAATCATAATCCTTACACT ATGATTTCACAACATCCTACCAATACTCACAACCTGGTGATTGCTAATCAACC TAATAAACATCGCAACCCCACCCACTATAAACTTTACAGGGGAACTGCTTATT GCATCCTCACTATTCAACTGATGTCCAACAACAATTATTATATTTGGACTATT AATACTTATTACAGCATCATATTCCCTACACATATTCTTATCCACACAAATAG GCACACCCACATTGAACACAACAACACACCCAACACACTCACGAGAACACCT TCTTATAGTACTACACATTATTCCATTAATACTAATCTCCCTTAAACCAGAAC TAATTATCTAA$$$$GTGTATGTAATTTAAAAAAA$$TATCAAACTGTGACTTTG ACATTAGGAAC$AA$TCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCTAA CTCTTT$AATCTGG$AACTAATATACCAGCTCCCTCTACTAAAGGATAATAGC ATTCCACTGGTCTTAG$GCACCATAATCCT

Pituophis deppei B CCCAATTGCTGGTTCCATGGTACTAGCTGCAATTTTATTAAAATTGGGGGGGT ACGGTATTATTCGAATATTGCAAATTATACCAACAATAAAAACAGACCTATTC CTACCATTTATTGTTCTTGCCATGTGGGGGGCAACATTAGCCAATCTAACCTG CCTACAACAGACAGATTTAAAATCTCTTATTGCATATTCATCTATCAGCCACA TAGGATTAGTAATTGCCGCAATCATAATCCAAACACAATGAAGTCTATCAGG AGCAATAGCTCTAATAATCGCCCACGGATTCACTTCATCTGCACTGTTCTGTC TAGCTAATACCACCTATGAACGAACTAAAACCCGAATCATAATCCTTACACG AGGATTTCACAACATCCTACCAATACTCACAACCTGTTGGTTGCTAATCAACC TAATAAACTTCGCAACCCCACCTACTATAAACTTTACAGGAGAACTGCTAATT GCATCCTCACTATTCAACTGATGTCCAACAACAATTATTATATTTGGACTATC AATACTTATTACAGCATCATATTCCCTACACATATTCTTATCCACACAAATAG GCACACCCACATTAAACACAACAACACACCCAACACACTCACGAGAACACCT TCTTATAGTACTACACATTATTCCATTAATACTAATCTCCCTTAAACCAGAAC TAATTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTTT GACATTAGGAAC$AA$TCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCTA ACTCTTT$AATCTGG$AACTAATATACCAGCTCCCTCTACTAAAGGATAATAG CATTCCACTGGTCTTAG$GCACCACAATCCT

Pituophis lineaticollis A CCCAATTGCTGGCTCCATAGTACTAGCTGCAATTTTACTAAAACTAGGAGGAT ACGGCATTATTCGAATAATACAAATCCTACCAACAATGAAAACAGATCTATT CTTACCATTCATTGTACTTGCTCTATGAGGAGCAACATTAGCCAACCTGACCT GCCTACAACAAACAGACCTGAAATCTCTTATTGCATATTCATCTATCAGCCAC ATAGGGTTAGTAACTGCCGCAATTATAATCCAAACACAATGAAGTCTATCAG 152

GAGCCATAGCCCTAATAATCGCCCATGGGTTCACTTCATCCGCACTATTTTGC CTAGCTAACACTACCTATGAACGAACTAAAACCCGAATCATAATTCTCACAC GAGGATTCCACAACATCCTACCAATACTCACAACCTGGTGATTACTGATCAAC CTAATAAACATCGCAACTCCACCCACCATAAACTTTACAGGAGAACTACTAA TTGCATCATCACTATTCAACTGATGCCCAACAACAATCATTATATTCGGACTA TCAATGCTTATCACAGCATCATATTCCCTACACATATTCTTATCTACACAAAT AGGCATACCTATATTAAACACAACAACACACCCAACACACTCACGTGAACAC CTTCTTATAGTACTACACATTATTCCATTAGTACTAATCTCCCTTAAACCAGA ACTAATCATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACT TTGACATTAGGAAC$AA$CCCTCATACATC$$$GAGGGTGTCAT$AAGACCTGC TAACTCTTT$AATCTGG$GACTAACATACCAGCTCCCTCTACTAAAGGATAAT AGCATTCCACTGGTCTTAG$GCACCACAATCCT

Pituophis lineaticollis B CCCAATTGCTGGCTCCATAGTACTAGCTGCAATTTTACTAAAACTAGGAGGAT ACGGCATTATTCGAATAATACAAATTCTACCAACAATGAAAACAGACCTATT CTTACCATTCATTGTACTTGCTCTATGAGGAGCAACATTAGCCAACCCGACCT GCCTACAACAAACAGACCTGAAATCTCTTATTGCATATTCATCTATCAGCCAC ATAGGGTTAGTAACTGCCGCAATTATAATCCAAACACAATGAAGTCTATCAG GAGCCATAGCCCTAATAATCGCCCATGGGTTCACTTCATCCGCACTATTCTGC CTAGCTAACACTACCTATGAACGAACTAAAACCCGAATCATAATTCTCACAC GAGGATTCCACAACATCCTACCAATACTCACAACCTGGTGATTACTGATCAAC CTAATAAACATCGCAACTCCACCCACCATAAACTTTACAGGAGAACTACTAA TCGCATCATCACTATTCAACTGATGCCCAACAACAATCATTATATTCGGACTA TCAATACTTATCACAGCATCATATTCCCTACATATATTCTTATCTACACAAAT AGGCATACCTATATTAAACACAACAACACACCCAACACACTCACGTGAACAC CTTCTTATAGTACTACACATTATTCCATTAGTACTAATCTCCCTTAAACCAGA ACTAATCATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACT TTGACATTAGGAAC$AA$CCCTCATACATC$$$GAGGGTGTCAT$AAGACCTGC TAACTCTTT$AATCTGG$AACTAACATACCAGCTCCCTCTACTAAAGGATAAT AGCATTCCACTGGTCTTAG$GCACCACAATCCT

Pituophis melanoleucus A CCCAATTGCTGGCTCCATAGTACTAGCCTCAATTTTACTAAAACTGGGAGGAT ACGGCATTATTCGAATAATACAGATTCTACCAACAATAAAAACAGATCTATT CCTACCATTCATTGTCCTCGCTCTCTGGGGAGCAACACTAGCCAACCTGACCT GCCTACAACAGACAGACCTAAAATCTCTTATTGCATACTCATCTATCAGCCAC ATAGGCTTAGTAATTGCCGCAATCATAATCCAAACACAATGAAGTCTATCAG GGGCCATAGCACTAATAATCGCTCACGGATTTACTTCATCTGCACTATTCTGC CTAGCTAACACCACCTATGAACGAACTAAAACCCGAATCATAATCCTCACAC GGGGGTTCCACAACATCCTACCAATGCTCACAACCTGATGATTGCTGATCAAC CTAATAAATATCGCAACCCCCCCCACTATAAATTTTACAGGAGAACTACTAAT TGCATCCTCACTATTCAACTGATGCCCAACAACAATTATTATATTCGGATTAT 153

CAATACTTATCACAGCATCATATTCCCTACACATATTCCTATCCACACAAATA GGCATACCCATATTAAACACAACAACACACCCAACACACTCACGAGAACACC TTCTTATAGTACTACATATTATTCCGCTAATACTAATCTCCCTTAAACCAGAA CTGATTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTT TGACATTAGGAAT$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCT AACTCTTT$AATCTGG$AACTAACACACCAGCCCCCTCTACTAAAGGATAATA GCATTCCATTGGTCTTAG$GCACCACAATCCT

Pituophis melanoleucus B CCCAATTGCTGGCTCCATAGTACTAGCCTCAATTTTACTAAAACTGGGAGGAT ACGGCATTATTCGAATAATACAGATTCTACCAACAATAAAAACAGATCTATT CCTACCATTCATTGTCCTCGCTCTCTGGGGAGCAACACTAGCCAACCTGACCT GCCTACAACAGACAGACCTAAAATCTCTTATTGCATTCTCATCTATCAGCCAC ATAGGCTTAGTAATTGCCGCAATCATAATCCAAACACAATGAAGTCTATCAG GGGCCATAGCACTAATAATCGCTCACGGATTTACTTCATCTGCACTATTCTGC CTAGCTAACACCACCTATGAACGAACTAAAACCCGAATCATAATCCTCACAC GGGGGTTCCACAACATCCTACCAATGCTCACAACCTGGTGATTGCTGATCAAC CTAATAAATATCGCAACCCCCCCCACTATAAATTTTACAGGAGAACTACTAAT TGCATCCTCACTATTCAACTGATGCCCAACAACAATTATTATATTCGGATTAT CAATACTTATCACAGCATCATATTCCCTACACATATTCCTATCCACACAAATA GGCATACCCATATTAAACACAACAACACACCCAACGCACTCACGAGAACACC TTCTTATAGTAGTACATATTATTCCGCTAATACTAATGTCCCTTAAACCAGAA CTGATTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTT TGACATTAGGAAT$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCT AACTCTTT$AATTTGG$AAGTAACACACCAGCCCCCTCTACTAAAGGATAATA GCATTCCATTGGCCTTAG$GCACCACAATCCT

Pituophis ruthveni A CCCAATTGCAGGCTCCATAGTACTAGCCGCAATTTTACTAAAACTGGGAGGA TACGGTATTATTCGAATAATACAAATTCTACCAACAATAAAAACAGATTTATT CCTACCATTCATTGTCCTTGCTCTATGGGGGGCAACATTGGCCAATCTAACCT GCCTACAACAAACAGATCTAAAATCTCTCATTGCATATTCGTCTATCAGCCAC ATGGGCTTAGTAATTGCCGCAATTATAATCCAAACACAGTGAAGTCTATCAG GGGCCATAGCCCTAATAATCGCCCATGGGTTCACTTCATCTGCACTATTCTGT CTGGCTAACACCACCTATGAACGAACTAAAACTCGAATCATAATCCTCACAC GTGGATTCCACAACATCCTACCAATACTCACAACCTGGTGATTACTAATCAAC CTAATAAACATCGCAACCCCACCTACTATGAACTTTACAGGAGAACTACTAA TTGCATCCTCACTGTTCAACTGGTGCCCAACAACAATTATTATATTTGGACTA TCAATACTTATCACAGCATCATATTCCCTACACATATTCCTATCCACACAAAC AGGCATACCTGCATTAAACACAACAACACACCCAACACACTCACGAGAGCAC CTTCTTATAGTACTTCACATTATTCCACTAATACTGATCTCCCTTAAACCAGAA CTAATTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTT TGACATTAGGAAC$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCT 154

AACTCTTT$AATCTGG$AACTAACACACCAGCCCCCTCTACTAAAGGATAACA GCATTCCACTGGTCTTAG$GCACCACAATCCT

Pituophis ruthveni B CCCAATTGCTGGCTCCATAGTACTAGCCGCAATTTTACTAAAACTGGGAGGAT ACGGTATTATTCGAATAATACAAATTCTACCAACAATAAAAACAGATTTATTC CTACCATTCATTGTCCTTGCTCTATGGGGGGCAACATTGGCCAATCTAACCTG CCTACAACAAACAGATCTAAAATCTCTCATTGCATATTCGTCTATCAGCCACA TGGGCTTAGTAATTGCCGCAATTATAATCCAAACACAGTGAAGTCTATCAGG GGCCATAGCCCTAATAATCGCCCATGGGTTCACTTCATCTGCACTATTCTGTC TGGCTAACACCACCTATGAACGAACTAAAACTCGAATCATAATCCTCACACG TGGATTCCACAACATCCTACCAATACTCACAACCTGGTGATTACTAATCAACC TAATAAACATCGCAACCCCACCTACTATGAACTTTACAGGAGAACTACTAATT GCATCCTCACTGTTCAACTGGTGCCCAACAACAATTATTATATTTGGACTATC AATACTTATCACAGCATCATATTCCCTACACATATTCCTATCCACACAAACAG GCATACCTGCATTAAACACAACAACACACCCAACACACTCACGAGAACACCT TCTTATAGTACTTCACATTATTCCACTAATACTGATCTCCCTTAAACCAGAACT AATTATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAACTGTGACTTTG ACATTAGGAAC$AA$CCCTCATACATC$$$GAGGGTGCCAT$AAGACCTGCTAA CTCTTT$AATCTGG$AACTAACACACCAGCCCCCTCTACTAAAGGATAACAGC ATTCCACTGGTCTTAG$GCACCACAATCCT

Senticolis triaspis TCCAATCGCAGGCTCCATAGTATTAGCCGCAATCTTATTAAAACTTGGCGGAT ACGGCATAATTCGAATAATACAAACACTACCAACAATAAAAACAGACCTATT CTTACCATTTATCATTCTTGCTCTCTGAGGGGCAACACTAGCTAATCTTACAT GCCTACAACAAACTGATTTAAAATCTCTAATTGCATACTCATCCATTAGTCAC ATAGGGTTAGTAACCGCCGCAGTAATAATCCAAACACAATGAAGCCTATCAG GAGCTATAGCCTTAATAATTGCCCACGGCTTTACCTCATCAGCACTTTTCTGT CTTGCCAACTTCACCTATGAACGAACTAAAACTCGAATTATAATTCTCACACG TGGATTTCACAACATCCTACCTATACTCACAACTTGGTGATTACTAGTAAACC TAATAAACATTGCAACACCACCAACAATAAATTTTACTGGGGAACTACTAAT CGCATCATCATTGTTCAATTGATGCCCTACAACAATTATCTTATTCGGATTATC AATATTAATTACAGCATCCTACTCCCTACACATATTCTTATCAACACAAATAG GCACACACCTTATAAATATAACAACAGACTCAACACACTCACGAGAACACCT ACTTATAACACTACATATTATACCATTAATCTTAATCTCCTTTAAACCTGAACT AATCATCTAA$$$$GTGTATGTAATTTAAAAAAAA$TATCAAGTTGTGACCCTG ACATTAGGAAT$AC$ACCTCATACACC$$$GAGGGTGTTAT$AAGACTTGCTAA CTCTTT$AACCTGG$AACCAACAATCCGGCACCCTCTACTAAAGGATAGTAGC ATTCCACTGGTCTTAG$GCACCACAACTCT

Acrochordus granulatus TCCTATTGCAGGTTCCATAATCCTAGCAGCCATTTTATTAAAACTTGGGGGTT 155

ATGGCATTATTCGAATAATACAAGTCCTACCAACAACAAAAACAGATATATT TATACCTCTCCTAATTTTATCAATATGAGGAGCCATTTTAGCAAACCTAACAT GTCTTCAACAAACAGACCTAAAATCTCTCATTGCCTATTCATCTGTGAGCCAT ATAAGTCTTGTAGTAGCAGCCACCCTAATCCAAACACAATGAAGCCTATCAG GCGCTATAACCCTAATAATCGCTCACGGTTTCACCTCCTCAATACTATTCTGTT TAGCTAACATCTCCTACGAACGTACACATACACGAATTATAATCCTTACACGA GGACTACACAACATTCTACCACTAACTACAATATGGTGACTAATAGCAAACT TAATAAACATCGCAATCCCACCAAGTATTAACTTTACCGGAGAACTTCTAATT ATAACCTCACTATTTAACTGATGCCCAACAACAATCATTTTATTAGGTCTATC TTTACTTATCACAACCTCCTACTCCCTACACATATACCTTTCGACACAAACTG GTAAACCATCATATAACTCAACTATTCAACCAACTCATACACGAGAACACCT CCTTATGACCATACACATACTACCAATCATCCTTATATCATTTAAACCTGAAT TAATTATA???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Achalinus rufescens CCCCATCGCAGGCTCAATAATCCTAGCCGCCATTTTATTAAAACTTGGCGGCT ACGGCATCATCCGCATAATACAAACCCTCCCCCCCACAAAAACAGACATTTTT CTACCCCTCCTAGTCCTCTCACTCTGAGGCGCAATCCTGGCCAATCTAACATG CCTACAACAAACAGACCTAAAATCCCTTATTGCATACTCATCCATTAGTCATA TGGCTCTGGTGATTGCCGCAATCATGATCCAAACAAAATGAGGGCTATCAGG GGCCATAGCCTTAATAATCGCCCACGGCTTCACCTCCTCAGCACTCTTCTGTC TCGCTAATACCACCTATGAACGAACCAATACCCGCACTATAATACTCACCCG AGGCATACACAACATCCTCCCACTAATAACCCTATGATGACTAACCGCCAAT CTAACTAACATCGCCATCCCACCAAGTATTAACTTCACCGCAGAACTCCTCAT TATAACATCCCTATTTAACTGATGCCCAACAACAATCCTTCTCCTTGGCCTAT CAATACTAATCACAGCTTCCTACTCCCTACACATATTCTTATCTACACAAATA GGTAAGCCCCTTCTAAACACAACCACCCAGCCTACACACACCCGAGAACACC TTATTATATTCCTTCATATAACCCCACTGCTACTACTCTCTATGAAAACTGAAC TAGTCATA???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Alsophis portoricensis CCCAATCGCAGGCTCTATAGTACTAGCCGCCATCCTACTCAAGCTAGGGGGG TATGGCATTATCCGAATAACACAAGTCCTTCCAACAATAAAAACGGACATGT TACTACCATTTATTGTACTCCCGCTCTGAGGGGCAACCCTGGCAAACCTTACC TGTTTACAACAAACAGACCTCAAATCCCTCATCGCATACTCATCCATCAGTCA TATAGGCCTAGTAATCGCAGCAATCACAATTCAAACACAATGAAGCCTATCA GGAGCTATAGCCCTAATCATCGCCCACGGCTTTACCTCCTCAGCACTTTTCTG CTTAGCTAACACCTCCTACGAACGAACCAAAACCCGAATCCTGACTCTCACG CGGGGGTTCCACAACATCCTACCCATAGCTACTACCTGATGACTCCTAACAAA 156

CCTCATAAACATCGCAACACCACCCAGCCTCAACTTCACAGGCGAACTTCTA ATCGCATCCTCCTTATTCAACTGATGTCCTATGACAATAATCATTTTCGGCCTC TCCATGCTAACCACAGCGCTTTACTCCCTACACATATTTTTATCAACACAAAT AGGCACACCCACGCTTAACACTCAAATTACACCAACACACTCACGAGAGCAC CTCCTTATTACACTACACACACTCCCCCTTATACTAATTTCCTTAAAACCAGA ACTTGTAATC????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????

Aplopeltura boa ACCCATCGCAGGATCTATGGTCCTAGCAGCAATCCTTCTCAAACTAGGAGGA TATGGCATAATACGGATAACACAAATCTTGCCCACCATAAAAACAGACTTAT TCATCCCACTTATTATCCTCGCCCTATGAGGAGCCATTCTGGCCAACTTAACC TGCCTTCAACAAACCGACCTAAAATCCCTAATCGCATACTCCTCTATTAGTCA CATAGGACTAGTAATCGCATCCATCATGCTACAAACCCAATGAAGTGTATCT GGCGCTATATCCCTAATAATCGCCCACGGGTTCACCTCATCAGCATTATTCTG TCTAGCTAACTCCACCTATGAACGAACAAACACTCGAATCCTAATCCTAACCC GCGGATTCCACAATATCCTACCAATAACCACCGCCTGATGGTTAATTACTAAC CTCATAAATATTGCTATTCCCCCCAGCCTTAATTTTACAGGAGAACTACTAAT TGCATCCTCACTATTCAACTGGTGTCCAACAACAATCATTATATTCGGGTTCT TAATACTAGTTACTGCCTCATACTCCCTACACATATTCCTGTCTACTCAAATA GGAACACCACTAACTAATCTACCAACACAACCCACACACTCACGAGAACACT TACTATTATCCCTCCATATTACCCCGCTCATTCTGGCTTCAATAAAGCCAGAA CTTGTATTT??????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????

Aparallactus werneri ACCAATTGCCGGGTCCATAGTACTAGCCGCCATCCTCCTTAAATTAGGGGGAT ACGGCATTGTTCGAATATCCCAAACACTACCAACACTAAAAACAGACATGTT CTTACCATTTGTGGTATTAGCCCTCTGAGGAGCCACACTAGCCAGCCTAACCT GCCTACAACAAACAGACCTAAAATCACTAATCGCTTACTCTTCAGTAAGCCAT ATAGGATTAATTATCGCAGCAATATCCACCCAAACACAATGGGGCCTCTCAG GCACTATGGCTCTAATAATCGCCCACGGATTTACCTCATCAGCCATATTCTGC CTAGCAAACATCACCTACGAACGAACCCAAACCCGCATTTTAATCCTAACCC GAGGATTCCACAACATCCTACCCATAGCCACCACCTGATGACTCCTCTCGAAT CTAATAAATATTGCAACCCCACCAAGTATGAACTTCACAGGAGAACTATTAA TCGCATTATCCCTTTTTAACTGATGCCCAACTACAATAATTATATTTGGATTGT TAATACTAGCCACAGCCTCATACTCCCTACACGTATTCCTATCAACACAAATA GGCACCCCCCTACTAAACAACCCCACACAACCATCCCACTCACGAGAACACC TTTTAATAACCCTACACATAATCCCTTTAATTTTATTATCTATAAAACCAGAA CTAGTAATC?????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? 157

??????????????????????????????????????

Atractaspis bibroni ACCAATTGCTGGGTCAATAGTCCTAGCCGCAATTCTACTTAAACTAGGAGGGT ATGGCATCATCCGAATATCACAAACCTTACCAACCCTAAAAACTGATATATTC TTACCATTCATTGTACTAGCCTTATGGGGGGCGACTTTAGCAAGTCTTACTTG CTTACAACAAACAGACCTAAAGTCTCTAATTGCGTACTCTTCAATTAGTCATA TAGGGTTAGTAATCGCAGCCATCTCTACACAAACACAATGAGGATTATCAGG GGCTATAGCTATAATAATCGCACACGGATTTACGTCATCAGCCCTATTCTGCC TAGCAAATACAATATATGAACGCACTAATACACGAATCCTCATTTTAACACG AGGGTTCCATAACATTCTACCAATAGCCACTACCTGATGACTACTAACTAACC TGTTAAATATTGCAACCCCACCAAGCATAAACTTTACAGGAGAACTCCTAATC GCATCATCCCTATTTAACTGATGCCCAATCACAATAATCATATTTGGACTACT CATACTAATTACAGCCTCATATTCTCTGCATATATTTATATCTACACAAATAA CAACTACAACACTCAATATCTATACACAACCTACCCATTCACGAGAACATCTA ATTTTAACCTTACACACAATCCCACTAATACTTATTTCACTAAAACCGGAACT AGTAATT????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????

Azemiops feae CCCTATCGCCGGCTCCATAGTACTAGCAGCAATCCTACTAAAATTAGGCGGAT ACGGCATCATTCGAATTATACAAACTCTCCCCACAACTAAAACAGACCTATTC ATCCCATTTATTACACTAGCCCTTTGAGGAGCAACCTTAGCCAACCTAACATG CCTACAACAAACAGACCTTAAATCCCTAATTGCTTACTCTTCTATCAGCCATA TAGGCCTAGTAGTTGCCGCAATCACTATCCAAACACCATGAGGCCTCTCGGG AGCCATAGCCCTAATAATCGCCCATGGGTTCACCTCCTCAGCACTTTTTTGTC TAGCCAACACAACCTATGAACGTACACACACCCGAGTTCTAATCCTCACACG AGGACTCCACAACATCCTTCCTATAGCCACCACTTGATGACTTCTAACTAACC TTATAAACATTGCCACACCCCCAACCCTAAACTTCACAAGCGAATTACTAATC ATATCCTCATTATTTAACTGATGTCCCACAACAATCATCCTACTAGGACTGTC AATACTAATCACTGCCTCTTACTCCCTACACATATTCCTATCAACACAAGCAG GACCAACCCTACTTAATAATCAAACAGAGCCAACACACTCACGAGAACACCT CCTTATAGCCCTCCACCTTATTCCACTAATATTAATCTCCATAAAACCAGAAC TAATCATT???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Boiga dendrophilia TCCAATTGCAGGATCCATAGTACTAGCCGCAATCCTACTAAAATTAGGAGGA TACGGAATTATTCGAATAGTACAAATCTTACCAGTTATAAAAACAGACCTATT CCTACCATTTATTGTACTATCTCTTTGAGGGGCAACACTAGCTAACCTTACTT GCCTACAACAAACAGATCTTAAAGCCCTTATTGCATACTCTTCTATTAGTCAC 158

ATGGGGCTAGTTATTGCCGCGATTATAATTCAAACACAATGAAGCCTTTCAGG AGCTATAGCTCTAATAATTGCCCATGGATTCACCTCCTCAGCACTATTCTGCC TAGCCAACACCACCTATGAACGAACTAAAACTCGTATTATAATCCTTACACG AGGATTCCACAACATCCTCCCAATACTTACAATCTGATGGTTATTAACTAACC TAATAAATATTGCAATTCCACCAAGTATAAATTTTACAGGAGAACTACTAATT GCATCGTCACTGTTCAACTGATGTCCAACAACAATCATTATATTTGGACTATC AATACTTATTACAGCATCATATTCTCTTCATATGTTTCTCTCAACACAAATAA ATACACCTATATTAAACACAGTAATTTACCCAACACACTCACGAGAACATCTT CTTATAATACTACATATAATTCCTCTAATATTAATCTCACTAAAACCAGAACT AATCATC????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????

Bungarus fasciata CCCTATCGCTGGGTCAATAGTATTAGCTGCAATCCTGTTAAAACTAGGAGGAT ATGGTATTATCCGAATATCCCAAATTTTGCCTCTACTAAAAACAGATATATTC CTTCCATTTATTGTACTATCCTTGTGAGGTGCTATCTTAGCAAGCCTAACCTGC TTACAACAAACAGACTTAAAATCACTCATTGCATACTCATCAATTAGCCACAT AGGTTTAGTAATCGCTGCAATTTCTATCCAAACACAATGAGGCTTAACAGGA GCTATAATAATAATAATTGCCCATGGTTTCACCTCATCAGCACTTTTCTGCCT AGCAAATACTACCTATGAACGCACCCAAACCCGCATTATAATCCTTACACGA GGATTCCACAATATTTTACCATTAACTACCACTTGATGACTACTAGCAAACCT TATAAATATTGCCACTCCACCAAGCATTAATTTCACAAGCGAACTATTAATCG CATCCTCTCTTTTTAATTGATGTCCTATATCAATTATCCTTTTTGGACTACTCA TATTAATCACAGCCTCATATTCCCTACATATATTTCTATCAACACAAATAAAC ACTCAAATGCTCAACTCCCCCATTCAACCCACCCACTCACGAGAACACCTGAT TATAACAATACACATTATCCCACTCATACTAATCTCTCTAAAACCAGAATTAG TAACC???????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????

Calloselasma rhodostoma CCCAATTGCCGGCTCCATAGTACTAGCAGCCATCCTACTAAAATTAGGAGGA TACGGCATCATCCGCATAATACAAATTATACCAACAACCAAAACAGATATAT TTCTACCACTCGTAGTGCTCGCACTATGAGGGGCAGTTTTAGCCAATCTGACA TGTCTACAACAAACAGACCTAAAATCCCTAATCGCCTATTCATCTATCAGCCA CATAGGCCTTGTAGCAGCCGCAATCATCATCCAAACCCCCTGAGGCCTATCA GGGGGCATAACCCTAATAATTGCCCATGGGTTTACCTCATCAGCACTCTTCTG CCTCGCAAATACAACCTACGAACGCACACACACACGAATCCTAATTCTCACC CGAGGATTCCACAATATTCTTCCAATAGCCACAACTTGATGACTTCTGACCAA TCTCATAAACATCGCCACCCCCCCAACCACAAATTTCACAAGCGAACTCTTAA TCATATCAGCCCTATTCAACTGATGCCCTACAACCATTATCATACTAGGCCTA TCAATACTAATTACAGCCTCCTACTCACTACACATGTTTTTATCAACACAAAT 159

AGGGCCCCCCCCATCAAATAACCTAACCGAACCTTCCCACTCACGAGAACAC CTACTAATAATCCTTCACATTATACCCCTACTAATAATTTCCTTAAAATCAGA GTTAATCATC????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????

Causus rhombeatus CCCTATCGCTGGCTCCATAGTCCTAGCAGCAATTCTATTAAAATTAGGGGGTT ACGGCATAATCCGCATCATCCAAATCCTACCTTCCTCTAAAACAGATATATTC ATTCCATTCATCACTCTATCTCTATGGGGGGCAGTCTTAGCTAACCTCACCTG CCTCCAACAAACAGACCTAAAATCCCTAATTGCCTACTCATCCATTAGCCATA TAGGTTTAGTAGTAGCCGCAATCTCTATTCAAACCCAATGAAGCCTATCAGGA GCCATAGCCCTAATAATCGCCCATGGCTTTACTTCTTCAGCACTTTTCTGTTTA GCTAATACCTCCTATGAACGCACACATACCCGCATCCTAATCCTCACACGAGG ATTCCACAATATCCTTCCTATAACCACCACTTGATGACTCCTTTCTAACCTCAT AAACATTGCAACCCCTCCCATAATAAACTTCACAAGCGAATTCCTAATCCTGT CCTCCTTATTCAACTGATGCCCAACAACTATTATCCTACTAAGCCTATCCATC CTAATCACCTCCATTTACTCCCTTCATATTTTCTTATCTACCCAAATAGGACCT ACCTTATTAAACACCCAAACTGAACCAGCACACTCCCGAGAACACCTTCTTAT AACCCTTCACATCATCCCCCTAATCTTACTCTCCATAAAACCTGAACTAGTCA TA????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????

Cerberus rhynchops CCCCATTGCAGGCTCCATGGTACTAGCCGCAGTACTCCTAAAACTAGGAGGA TACGGTGCTATTCGAATACTACAAACCCTCCCAAACACTAAAACAGACACAT TCCTCCCATTTCTAGTACTCGCCCTATGAGGGGCAACCCTTGCCAACCTAACC TGCCTCCAACAAACAGACCTAAAATCCCTCATTGCCTACTCCTCAATTAGTCA CATAGGCCTCGTAATCGCCGCAATCTTAATCCAAACAGAATGAAGCATCTCA GGGGCAATAGCCCTCATAATCGCCCACGGCTTCACTTCATCAGCACTATTCTG CCTAGCCAACATCTCCTACGAACGAACTAAAACACGAATTATAGTCCTAACA CGAGGATTTCACAACATCCTACCAATAATCACAACTTGATGAATACTCATCAG CCTAATAAACATTGCAACACCACCAACCCTAAACTTCACCGGCGAACTACTA ATTGCCTCATCACTCTTCAACTGATGTCCAACAACCATCATCATATTCGGACT ACTTATATTAATCACAGCCTCATACTCCCTCCATGTCCTCCTATCAACACAAA TAGGCACACCCACACTCAACTCACCTGTCCAACCAGCACACTCACGAGAACA CCTACTTATAACTTTACACACCCTACCACTAATCCTAGTATCCCTAAAGCCAG AGCTGGTATTT??????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????

Dendrelaphis pictus 160

CCCAATTGCAGGGTCTATAGTTCTAGCCGCCATCCTATTAAAACTGGGCGGGT ACGGAGTTATCCGAATAATACAAACACTACCCCCAATAAAAACAGACCTATT CCTACCATTCATTATCCTAGCCCTGTGGGGGGCAACACTTGCCAACCTAACCT GCCTACAACAAACAGACCTAAAATCACTAATCGCATACTCCTCTATCAGCCA CATGGGTCTAGTTATCTCAGCAACAATAATCCAAACACAATGAAGCCTTTCTG GGGCCATATATTTAATAATTGCCCACGGGTTTACTTCATCAGCACTCTTCTGC CTGGCCAATACAACCTATGAACGAACTAAAACTCGCATTATAATACTAACTC GAGGATTCCACAATATTCTACCCATGGCTACAACATGGTGACTAACAATAAA CCTTATAAATATCGCCATACCACCAAGTATAAACTTTACAGGCGAACTACTTA TTACATCATCTCTATTTAACTGATGTCCAACAACAATAATTATATTGGGCCTA TCAATATTAATTACCGCATCATACTCACTACATATATTCCTCTCAACACAAAC AGGCAAACCAATACTAAACAACCCAACGCACCCGACCCACTCACGAGAACAC CTACTTATAACACTACACGCAATTCCGCTTATACTTGCTTCACTTAAACCAGA ATTAGTAATA???????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????

Elaphe flavolineata CCCAATTGCAGGGTCAATGGTACTAGCCGCAATTCTATTAAAACTTGGAGGA TATGGAATTATCCGAATCATACAAATCCTACCAACAACCAAAACAGACCTAT TCATACCATTTATCGTACTCGCCCTTTGAGGGGCAACACTAGCCAATCTAACC TGTCTCCAACAAACAGACTTAAAATCCTTAATCGCATACTCCTCCATTAGCCA CATGGGGTTAGTAATCGCAGCAATTATAATTCAAACACAATGAAGCCTATCA GGCACTATAGCCTTAATAATCGCCCACGGATTTACCTCATCAGCCCTATTCTG CCTAGCCAATTCAACCTATGAACGAACCAAAACTCGTATTTTAATTCTAACAC GGGGATTCCACAATATCCTACCAATATTCACAACTTGATGGTTGCTGGCAAAT CTAATAAATATCGCAACACCACCAAGTATAAACTTTACAGGAGAATTATTAA TCGCATCATCTCTCTTTAACTGATGTCCAATAACAATCATCATATTCGGACTA TCAATGCTTATTACAGCATCATACTCCTTGCACGTATTCTTATCAACACAAAT AAGCACCACGACACTTAATATAACAACACAACCAACGCACTCACGAGAACAC CTTATTATAGCACTACACATTATCCCACTTATACTAATCTCACTAAAACCAGA ATTAATTATA????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????

Enhydris plumbea CCCAATTGCAGGATCCATAGTCTTAGCCGCAATTTTACTAAAACTAGGAGGCT ACGGCGCTATCCGAATAATACAAACCCTTCCAAGTACTAAAACAGACACATT CCTCCCATTCATCGTACTCGCTCTATGAGGAGCAACCCTAGCCAATCTTACTT GCCTTCAACAAACTGACCTAAAATCACTAATTGCCTATTCTTCAATTAGCCAC ATAGGTCTTGTAATCGCCGCAATTCTAATTCAAACAGAATGAAGCATCTCAG GGGCAATAGCCCTCATAATCGCCCACGGCTTCACTTCGTCAGCACTATTCTGC CTAGCTAATATCTCCTATGAACGAACTAAAACACGAATTATAATCCTAACAC 161

GAGGGTTTCACAATATTCTACCAATAACCACAACCTGATGAATACTCGCTAGC CTGATGAACATTGCAACACCACCAGCCCTTAACTTCACTGGCGAGCTACTAAT TGCCTCATCACTCTTCAACTGATGTCCGACAACCATCATCATATTTGGATTAC TAATATTAATCACTGCTTCATACTCCCTCCACATCTTCCTATCAACACAAATA AATACACCTCCGATAAACACCCCAGTTCAACCGGCACATTCACGGGAACACT TACTTATAACATTACACATCATCCCATTAATCCTAATCTCCATAAAACCAGAA CTGGTATTC?????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????

Farancia abacura CCCAATTGCAGGATCCATGGTACTAGCTGCTATCCTGCTAAAACTCGGGGGGT ACGGTATTATCCGAATAATACAAATCCTCCCAACAATAAAAACAGACATATT CCTACCATTTATCATTCTGGCCCTCTGAGGGGCAACCCTGGCCAACCTCACCT GCCTACAACAAACAGACCTGAAATCCCTCATCGCATACTCATCCATTAGCCAC ATAGGCTTAGTAATTGCCGCAATCATAATTCAAACACAGTGAAGCCTCTCAG GGGCCATAGCCCTAATAATCGCCCACGGCTTTACCTCCTCAGCACTTTTCTGC CTGGCCAACACCACCTACGAACGAACTAAAACCCGAATTATAATTCTCACGC GCGGCTTCCACAATATCCTACCAATAGCTACAACCTGATGACTCCTGACTAAC CTTATAAACATTGCAACTCCCCCCAGCATAAACTTTACGGGCGAACTACTAAT TGCATCATCCCTGTTCAACTGATGTCCAACAACAATCATTATTTTTGGACTAT CCATATTAATTACAGCATCATACTCCCTACACATATTCCTATCAACACAAATA GGCACACCGATACTAAACATACCAACTACACCAACACACTCACGAGAACACC TACTTATAACACTACACATCATCCCCCTAATACTCATCTCACTGAAACCAGAA CTAGTAATC?????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????

Helicops pictiventris CCCCATTACAGGCTCAATAATCCTAGCCGCAATCCTATTAAAACTGGGTGGAT ATGGTATCATCCGAATAATACAAACCCTCCCAACAATAAAAACAGACCTCTT TTTACCATTCATCGTACTTGCACTATGGGGAGCAACCCTGGCCAACTTAACCT GCCTCCAACAAACCGACCTTAAATCCCTCATCGCATACTCATCCATCAGCCAC ATGGGTCTAGTAATCGCAGCAATTACTATCCAAGCACAATGAGGATTATCCG GAGCCCTAGCCCTAATAATCGCACACGGCTTTACCTCCTCAGCACTCTTTTGT TTAGCCAACACTACCTACGAGCGCACTAAAACTCGCATCATAATCCTTACGCG TGGGTTCCACAATGTCCTACCCATAGATACAACCTGATGACTATTAACAAACC TACTAAACATCGCAACCCCACCAAGCCTTAACTTTACAGGCGAACTCTTAATC GCCTCCTCCATATTCAACTGATGTCCCACAACAATCATCATCTTTGGCCTCTCC ATATTAATCACAGCATCTTACTCCCTCCATATATTTCTATCAACACAAAAGGG TACACCACTATTCAACACCCAAACCACACCAACACACTCACGAGAACACCTC CTCTTTCTACTCCACATTAACCCCCTCCTACTAATCTCTATAAAACCAGAACTT GTAATT??????????????????????????????????????????????????????????????????????? 162

???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????

Hypsiglena torquata TCCAATCGCAGGCTCCATAGTATTAGCCGCCATCTTACTTAAACTTGGCGGCT ATGGAATTATCCGAATAATACAAGTCCTCCCAACAACAAATACAGACATATT CCTACCATTCATCGTCCTTGCCTTATGAGGAGCAACCCTAGCCAATCTTACCT GCCTACAACAAACAGACCTAAAATCTTTAATCGCATACTCATCAATCAGCCA CATGGGCTTAGTCATTGCCGCAATCATAATCCAAACACAATGAAGTCTATCTG GCGCCATAGCCCTAATAATCGCTCACGGCTTCACATCGTCTGCACTATTCTGC CTAGCCAACTCCACCTATGAACGAACAAAAACCCGAATTATAATTCTTACAC GAGGATTTCACAACATTCTACCTATGCTTACAACCTGGTGACTCCTAAGCAAC CTAATAAATATCGCAACCCCACCCACCATAAACTTCACAGGAGAACTACTAA TTGCATCATCCTTATTCAACTGATGCCCAGCCACAATCATTACCTTCGGCCTA TCTATACTAATCACAGCCTCATACTCATTACATATATTCCTATCAACACAAAC AGGCACATCCATACTAAACACACACACAATACCAACACATTCACGAGAACAC CTCCTTATAACACTACACATCATTCCCTTGATACTCATCTCACTAAAACCAGA ACTAGTAATA???????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????

Leioheterodon madagascariensis CCCAATTGCCGGATCAATAATCCTAGCTGCAGTACTCCTAAAACTAGGAGGA TACGGCATCATACGAACATGCCAAACTCTACCAACCATAAAAACAGACATAT TCCTACCATTTATTGTCTTATCTGTATGAGGGGCAACCCTAGCAAGCCTAACT TGCTTACAACAAACAGACCTTAAATCTCTAATCGCATACTCTTCAATTAGCCA CATAGGTTTAGTAATTGCCTCAACCCTCATCCAAACACAATGAAGTCTATCTG GAGCCCTGGCCTTAATAATTGCACATGGGTTTACCTCATCAGCACTCTTCTGC CTAGCAAACACTACCTATGAACGCACCCAAACCCGAATCCTCATTCTTACACG AGGATTCCACAACATCCTACCAATAATTACAACATGGTGACTACTCACTAATT TAATAAATATTGCCACTCCACCAAGCATAAATTTCACAAGCGAACTTTTAATT ACCTCATCTATATTTAACTGATGCCCAACTACAATCATTATACTAGGACTGCT AATATTAACCACTACCTCATACTCATTACACATGTTCCTATCAACCCAAATAA ACCCCACCACACTAAATTCTCCAACCCAACCCACACACTCACGAGAACATCT CATTATAACCCTACATATTATACCGCTCATACTAATCTCATTAAAACCAGAAC TAGTAATA??????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????

Madagascarophis colubrina CCCAATCGCCGGATCCATAGTTCTAGCCGCAGTACTGTTAAAATTGGGAGGG TATGGCATCATCCGGATATGCCAAACACTCCCCACCTTAAAAACAGACACAC TCATACCCTTTATTGTACTATCTTTGTGGGGAGCCGCACTAGCAAGCTTAACT 163

TGCCTACAACAAACAGACCTTAAATCACTAATCGCCTACTCATCAGTCAGCCA TATGGGTTTAGTAGTGGCTGCAATCTCCATCCAAACACAATGAAGCCTTTCAG GGGCCATAGCCCTTATAATCGCCCACGGGTTCACCTCGTCTATATTATTTTGC CTAGCAAACACCACTTATGAACGCACACAAACTCGCATTCTAATCCTAACCC GAGGGTTCCACAACATCTTACCAATAACCACCACGTGATGATTATTAGCTAAC CTAACAAACATAGCCACCCCACCAAGCATAAACTTCACAGGGGAACTATTGA TTGCCTCATCCTTATTTAACTGATGCCCAACCACAATTGCCCTGTTTGGTTTAT TAATACTTATTACAGCCACCTATTCACTACACATGTTCTTATCAACACAAATA AACTCCACCACTATAAACACCCAAACTCAGCCAACCCACTCACGAGAACACC TACTCATAACCATACACATAATCCCCCTCATGCTAATTTCACTAAAACCAGAA CTGGTAATT?????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????

Macropisthodon rudis CCCTATCGCAGGTTCAATGGTACTAGCCGCCATCCTACTTAAATTAGGCGGCT ACGGAATTATTCGAATAATGCAAACACTACCCCTAATAAAAACGGATATATT CCTTCCATTCATTATCCTCTCTCTATGAGGAGCTACCTTGGCTAATTTAACATG CCTTCAACAAACAGACCTAAAATCCCTAATTGCATACTCATCTATTAGCCATA TAGGATTAGTAATTGCCGCAACTATAATCCAAACACAATGAAGCTTATCTGG GGCCATAGCACTAATAGTCGCCCATGGATTTACATCATCAGCACTATTCTGCC TCGCTAATGCCTCTTATGAACGAACTAAAACACGAATTATAATTCTTACACGA GGAATACACAATGTTTTACCAATAATAACAACATGATGACTTACAACTAACC TAATAAATATTGCCACCCCACCAAGCATTAACTTCACAGGAGAACTACTTATC ACTTCTTCCCTTTTCAACTGATGTCCACTTACAATTATTATACTTGGTCTATCC ATGATAATTACAGCATCATACTCTTTACACGTGTTCTTATCAACACAAATAAA CGTGTCTTCATTTAATACTAAAACTCAACCAACACACTCACGAGAACACCTCT TAATAACTATTCATACAATACCAATCATTCTCATTTCACTTAAACCAGAGCTA ATAATT??????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????

Micrurus fulvius CCCAATCGCCGGATCTATGGTTCTAGCTGCAATCCTACTAAAACTAGGCGGAT ATGGCATCATCCGTATAACCCAAACCCTTCCTACCCTAAAAACAGACATGTTT CTTCCATTTATTGTTCTATCTCTCTGAGGGGCCACCTTAGCAAGCTTGACCTGC CTGCAACAAACAGACCTAAAATCCCTAATTGCATACTCTTCTATTAGCCATAT GGGCTTAGTTATCGCAGCAATCTCTATCCAAACACAGTGGGGCCTAGCAGGA GCAATAGCCATAATAGTCGCCCACGGCTTTACATCATCAGCACTTTTCTGCCT AGCAAATACCACCTACGAACGTACCCAAACCCGAATTCTAATCCTCACACGA GGATTCCACAACATTATACCTATAACCACAACCTGGTGACTCCTAACTAGTCT TATAAATATAGCCACCCCGCCAAGCATAAACTTTACAGGTGAGCTCCTTATCG CAGCTTCTCTCTTCAACTGATGTCCAACTATCATCATCTTATTTGGATTATTAA 164

TACTAATTACAGCATCATATTCCCTACATGTATTTCTATCAACACAAATAGGC GCTCCTGCCCTAAATACCCCCATCCAGCCGGCACACACACGAGAACACCTTCT CATAACACTCCATGTTGTCCCCCTTATAATAATTTCCCTAAAACCAGAATTAA TCATA???????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????

Nerodia taxispilota CCCAATCGCCGGATCAATAGTTCTAGCAGCAATTCTTTTAAAACTGGGGGGTT ACGGTATTATCCGAATAACACAAACCCTCCCAACAATAAAAACGGACACATT CCTGCCATTTATCATTCTTGCCCTCTGAGGGGCAACACTAGCCAACCTTACCT GCTTACAACAAACAGATCTAAAATCCTTAATCGCATATTCATCTATCAGCCAC ATAGGCCTGGTTATTTCCGCCATTATAATCCAAACACAATGAAGCCTATCAGG AACCATAGCCCTAATAATCGCCCATGGGTTTACCTCATCAGCACTCTTCTGCC TAGCTAATACTACCTATGAACGAACAAAAACCCGAATTATAATCCTCACACG AGGACTACACAATATCCTTCCCATAATAACCGCCTGATGATTACTAACTAACC TAATAAATATTGCCACCCCCCCAAGCATAAACTTCACAGGCGAATTATTAATC GCCTCCTCAATATTCAACTGATGTCCCACAACAATCATTATGTTTGGACTATC AATACTAATCACAGCATCCTATTCCCTTCACATATTCCTATCAACACAAATAA ACCCCCCACTATCAAATACTCCTATTCAACCCACACACTCACGAGAACACCTA CTCATGCTACTACACACCCTACCACTTATACTAATCTCATTAAAACCCGAGCT GGTAATC????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????

Oligodon octolineata CCCAATCGCAGGCTCCATAGTATTAGCCGCCATTCTACTAAAACTGGGGGGA TATGGAATTATACGAATAATACAAATCATACCAACAATGAAAACAGACCTAT TCTTACCATTCATCGTACTCTCTCTATGAGGGGCAACACTTGCAAACCTTACA TGCCTGCAACAAACAGACCTAAAATCCCTCATCGCCTACTCCTCTATTAGTCA CATAGGCCTCGTAATTGCCGCAATCATAATCCAAACACAATGAAGCCTATCA GGAGCCATAACCCTAATAATCGCTCACGGATTTTCTTCCTCAGCACTCTTCTG CTTAGCTAACACCTCCTATGAGCGAACTAAAACCCGCATCATAATCCTCACAC GAGGTTTCCACAATATCCTTCCAATACTCACAACCTGATGATTACTAACCAAC CTAATAAACATTGCAACCCCACCCAGCATCAACTTCACAGGAGAACTGCTAA TTGCATCATCCCTGTTCAACTGATGTCCAATAACGATCACCCTATTCGGAATT TCCATATTAATTACAGCCACATACTCCCTACACATATTCCTATCAACACAAAT GGGAACACCCACACTTAACTCAACAACTTACCCAACACACTCACGAGAACAC CTCTTATTAATTCTACACATCACACCCCTTATACTAATCTCACTAAAACCAGA ACTAATCATT????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????

165

Oreocalamus hanistschi TCCAATTGCCGGATCCATAGTATTAGCCGCAATCCTACTAAAACTTGGCGGAT ACGGCATTATCCGAATAATACAAATTTTGCCAACAATAAAAACAAACTTATT CCTACCATTCATCATTCTTGCCCTATGAGGGGCCACACTTGCCAATCTAACCT GTCTCCAACAAACAGACCTAAAATCCTTAATCGCATACTCCTCTATCAGCCAC ATAGGCCTTGTCATCGCTGCTATTTTTATTCAAACACAATGAAGCCTATCAGG AGCTATAGCCCTAATAATCGCCCACGGATTTACCTCATCAACATTATTCTGCC TAGCCAACACCATATATGAACGATCTAAAACACGCATTATAGCCCTTACCCG CGGATTTCACAATATTTTACCAATAGTCACCATTTGATGACTAACAGCCAATT TATTAAATATTGGAACACCACCAAGTATGAACTTTACAGGAGAACTTCTAATT ATTTCATCCATATTTAATTGGTCCCCAATAACAATTATTATATCTGGGCTCTCA ATACTAATTACAACAACATACTCGTTACATATATTCCTATCAACACAAATAGG CACACCACAACTAAACTCAACAACACAACCAACACATTCACGAGAACACCTT CTCATAACACTCCATATTATCCCACTAATCCTTGTTTCAATAAAACCAGAATT AGTAATC????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????

Pareas nuchalis ACCAATTGCAGGATCAATGGTGTTAGCAGCCGTTCTTCTAAAACTAGGCGGTT ACGGCCTAATTCGAATAATACAAATCATACCCGCCCCAAAGCCAGATATATT TATCCCCCTTCTTGTATTAGCCCTTTGAGGGGCGATTTTAGCTAATCTAACCTG CCTACAACAAACTGACCTAAAATCTCTAATCGCATACTCCTCTATTAGCCACA TAGGCCTAGTAATCGCATCCGTTCTGCTAAAGACCCAGTGAGGCTTATCAGG GGCTATGTCTTTAATAATCGCCCACGGGTTCACATCATCAATACTGTTCTGTC TTGCTAATACCACCTATGAACGAACAAACACCCGCATTTTAATTCTAACACGC GGATTTCACAACATTCTACCAATAACTACAGCCTGATGACTACTAGCCAACTT AATAAATATTGCTATTCCACCAAGCCTAAATTTTACTGGCGAATTAATAATCG CATCATCTTTGTTCAACTGATGTCCAACTACAATAATTATATTCGGTCTCTCTA TACTAATTACCGCCTCTTACTCTTTACATATATTTTTATCAACCCAAATAGGCA CACCCCTATTAAATAAACCAACACAACCAACGCACTCACGAGAGCATTTACT CATAGCCCTTCACATCGCTCCGCTTATCCTGGTTTCATTAAAACCAGAGCTAG TCTTC???????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????

Pelamis platurus CCCTATTGCCGGGTCTATGGTCTTAGCCGCAATCCTGCTAAAACTCGGAGGGT ATGGGGTAATTCGAATAGCCCAAACCCTCCCCACCATAAAAACAGACTTATT TCTCCCATTTATTATTCTATCTTTATGGGGGGCCATCTTGGCAAGCCTAACCTG CCTTCAACAAACAGACCTTAAATCATTAATTGCATACTCCTCAGTTAGCCACA TAGGCCTAGTAATTGCCGCAGTATCCATTCAAACACAATGAGCCCTAGCAGG GGCTATAACTATAATAATTGCCCACGGCTTCACATCATCAGCCCTTTTCTGCC 166

TAGCAAATACTACCTATGAGCGCACCCAAACCCGTATTATAATCCTCTCCCGC GGATTCCACAATATTCTACCAATAACCACAGCCTGATGGTTATTAACCTCACT TATAAACATCGCTACCCCACCAAGCATAAACTTCACAAGTGAACTTCTAATA GCATCCGCCCTATTCAACTGATGTCCGACAACAATTATCCTGTTCGGATTAAT CATACTTATCACAGCCTCGTACACACTACATATGTTTCTATCAACACAAACAG GAACGTACACAATTAACACCCATATCCAACCCATACACTCACGAGAACATCT ACTACTACTTCTCCACATCGTCCCACTGATGTTAATATCGTTTAAACCGGAAC TAATTATA???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Rhabdophis subminiata CCCTGTTGCCGGATCCATAGTACTAGCCGCTATCCTACTTAAACTTGGGGGTT ATGGCATTATCCGAATAATACAAACACTACCCCTTATAAAAACAGATATATTC CTACCATTTATTGTTCTATCTATGTGGGGGGCAATTCTGGCAAATCTTACTTGC CTCCAACAAACAGACTTAAAATCCTTAATCGCATACTCATCCATTAGCCACAT AGGTCTGGTAATTGCTGCAATCATAATTCAAACTCAATGAAGCCTATCGGGC GCCATAGCCTTAATAATTGCCCACGGTTTCACATCATCAGCACTTTTCTGCTT AGCTAATACCTCCTACGAACGAACCAAAACACGTATCCTAATTCTGACACGA GGGTTTCACAATATCTTACCTATAATGACAATTTGATGACTCTTAACTAACCT AATAAATATTGCTACACCCCCAAGCATAAACTTCACAGGAGAATTATTAATT GCATCCTCTATATTTAATTGATGCCCAACAACAATTATTATATTCGGACTCTCT ATACTTATTACAGCATCCTACTCACTCCACATATTTCTATCAACACAAATATA CACATCTTTGTCAAATACCCCAATACAACCAACACACTCACGAGAACATCTTT TAATTTTACTCCATATTTCGCCACTTATAATAATTTCACTAAAACCTGAATTAG TAATC???????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????

Sinonatrix trianguligera CCCAATCGCTGGATCAATAGTACTAGCCGCCATTTTACTAAAACTAGGAGGA TACGGTATTATACGAATAATACAAATCTTACCAATCACAAAAACAGATGTAT TCTTACCCCTTATTATTCTTTCCATATGGGGAGCAACCCTAGCAAACCTCACC TGCCTTCAACAAACAGACCTAAAATCCCTCATTGCATACTCATCCATCAGCCA CATAGGCTTAGTTATTGCCGCAATTTTAATTCAAACACAATGAAGCTTATCAG GAGCCATAGCTTTAATAATTGCCCATGGCTTCACCTCATCAGCATTATTCTGC CTAGCTAATACCTCATACGAACGAACCAAAACTCGAATTATAATTCTTACACG AGGTTTCCATAACATTCTTCCCCTAATAACCACCTGATGACTTGCAATCAACC TAATAAACATTGCTACCCCCCCCAGCTTAAACTTCACAGGAGAACTACTAATT GCATCTTCCCTATTCAGCTGATGTCCAATAACAATCATTATATTTGGTTTATCC ATATTAATCACAGCATCATACTCACTCCACATATTTTTATCAACACAAACACA AACAACGCTACTTAATTCCCCAACACAGCCAACACATTCACGAGAACATCTC CTAATTCTCCTCCACACTATACCACTTATATTCATCTCTCTCAAGCCAGAATTA 167

GTAATC??????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????

Storeria occipitomaculata CCCAATCGCCGGATCTATAGTACTAGCAGCAATCCTTCTAAAACTAGGAGGA TATGGCATTATCCGAATAATACAAACCCTCCCAATAATAAAAACAGACACAT TCCTACCGTTTATCATCCTTGCCCTTTGAGGAGCAACATTAGCTAATCTTACCT GCTTACAACAAACAGACCTGAAATCTTTAATCGCATATTCCTCTATCAGCCAC ATAGGCCTAGTTATCTCTGCCATTATAATCCAAACACAATGAAGCCTATCAGG AACTATAGCCCTAATAATCGCCCACGGATTCACCTCATCAGCTCTCTTCTGTC TAGCCAACACTTCCTATGAACGAACAAAGACTCGAATTATAATTCTTACACG AGGACTACACAATATCCTCCCAATGATAACCACATGATGATTACTGGTCAAC CTAATAAACATTGCCACCCCCCCGAGCATAAACTTCACAGGCGAATTATTAAT TGCCTCCTCTCTGTTTAACTGATGCCCCACAACAATCATTATATTTGGATTATC AATACTAATCACAGCATCCTACTCCCTCCACATATTCTTATCAACACAAATAA ACCCCCCACTACCAAATACCCCAATCCAACCTACACACACGCGAGAACACCT ACTTATACTACTCCACACCCTTCCACTTATACTAATCTCATTAAAACCAGAAC TGGTAATT???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Thamnophis butleri CCCGATCGCTGGATCAATAGTACTAGCAGCAATCCTTTTAAAACTGGGGGGTT ATGGCATTATCCGAATAATACAAACCCTCCCAACAATAAAAACAGACGCGTT CCTACCATTTATCGTCCTCGCCCTTTGAGGAGCAACATTGGCTAATCTTACCT GCTTACAACAAACAGACCTAAAATCCTTAATCGCATATTCATCTGTCAGTCAT ATAGGCCTAGTCATTTCTGCCATTATAATCCAAACACAATGAAGTCTGTCAGG AACCATAGCCCTAATAATTGCCCACGGGTTTACCTCATCAGCACTTTTCTGCT TAGCTAACACCTCCTATGAACGAACAAAAACCCGAATTATAATCCTCACCCG AGGACTACACAACATCCTTCCTATAATAACCACCTGATGATTATTAATCAATT TAATAAACATTGCTACCCCCCCCACCATAAACTTCACAGGCGAGTTATTAATC GCCTCATCACTATTCAACTGATGTCCCACAACAATTATTATATTCGGACTATC TATACTAATCACAGCATCCTACTCTCTTCACATATTCCTATCAACACAAATAA ACCTCACACCATCAAACGCCCCTATTCAACCCACACACTCACGAGAACACCT ACTTATACTACTCCACACCCTACCACTTATCCTAGTCTCCTTAAAACCTGAAC TGGTAATT???????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????

Trachyboa boulengeri CCCAATCGCAGGGTCCATAGTACTAGCAGCAGTACTACTAAAGCTCGGTGGA TACGGCATTATCCGAACAATACAAGTCCTACCAACAACAAAAACAGATTTAT 168

TCCTACCATTTATGGTGCTAGCCCTTTGGGGGGCCATTTTAGCAAATTTAACA TGCCTTCAACAAACAGACCTAAAATCACTAATCGCTTACTCATCAGTAAGCCA TATAGGCCTGGTAGTGGCCGCTATTATAATTCAAACCCCATGAGCCACAAGC GGAACAATAGCCCTCATAATCGCCCACGGATTTACATCATCAATATTATTCTG CCTAGCCAACATCAGCTACGAACGAACCCACACACGCATCCTCACATTAACA CGAGGACTACACGGCATCCTCCCCCTAATAACAATGTGATGACTCACAGCGA ATCTGGCAAACATTGCAATACCACCAAGCATCAACTTCACAGGAGAGCTGCT AATTATATCATCAATATTCAACTGATGCCCAACAACCATCATCCTACTGGGAC TATCAATACTAATCACAGCAACCTACTCCCTACATATATTTTTATCCACACAA ACAGGGAAATCCTCCATAAACCTCCCAACACACCCAACCCACACACGAGAAC ACCTACTAATAACACTACACATCGCCCCACTAATCCTACTATCAATGAAACCA AACCTAGTAATA????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????

Xenodermus javanicus CCCAATTGCAGGCTCCATAATCCTAGCAGCCATCCTACTTAAACTGGGCGGCT TCGGAATTATTCGAATAATACAAATTCTTCCTACCACAAAAACAGACCTATTT CTCCCATTCCTCATTCTATCACTCTGAGGAGCAATTTTAGCCAATCTTACATGC CTCCAACAAACAGATTTAAAATCTCTCATCGCATACTCATCTATCAGCCACAT AGCCCTAGTAATCGCAGCAATTATAATTCAAACCCCATGAAGCCTATCTGGG GCTATAACCCTAATAATCGCCCATGGTTTTACCTCCTCTATACTATTCTGCCTA GCAAACACCACATATGAACGAACCAACACCCGAATTATACTCCTAAACCGCG GAATACACAACATCCTTCCCCTAGCCACCTTATGATGACTAACCGCCAACCTA ATAAACATCGCCATCCCCCCCAGCATAAATTTTACCGCAGAGCTACTAATTAT AACATCCCTATTCAACTGATGCCCAACAACAATTCTACTCCTTGGAGCCTCAA TGCTAATCACCGCCTCCTACTCCCTCCACATATTTCTATCCACACAAATAGGA AAACCCCACCTCAACTCCCCACCAAACCCCACCCATACTCGAGAACACATAT CAATACTTCTACACATAGCCCCGCTAATTCTCCTATCAATAAAAACAGAACTT GTCATG??????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????? ????????????????????????????????? 169

APPENDIX C. List of morphological specimens.

Codes for museum and personal collections are: American Museum of Natural History (AMNH), Arizona State University (ASU), California Academy of Sciences (CAS), Carnegie Museum (CM), Chicago Natural History Museum (CNHM), JFC (Joe F. Copp), Los Angeles County Museum of Natural History (LACM), La Sierra University (LSUHC), Museum of Vertebrate Zoology at Berkeley (MVZ), Robert D. McCord (RDM), San Diego Natural History Museum (SDSNH), Thomas R. Van Devender (TRV), University of Arizona (UAZ), University of Michigan (UMMZ), and US National Museum (USNM) collections.

Outgroups Coluber constrictor UAZ 24119, 24122, 24252-4, 35217, 35441, 36825, 45543, 50749. Liochlorophis vernalis UAZ 25764, 25765, 32830, 32831, 34416.

Ficimia clade Conopsis amphisticha USNM 120950-1. Conopsis biserialis LACM 65254-7; UAZ 35365. Conopsis lineata LACM 59114, 69077, 121865, 121867, 121873, 127099, 127102, 130664; UAZ 32804; USNM 2104 Conopsis nasus LACM 50835-7, 121315-8, 125320; UAZ 24127, 28505, 30156, 35233, 42222, 42253, 46334-7, 46379, 47059, 50928-9; USNM 10246, 110688, 224442. Ficimia olivacea USNM 6329, 224834-7. Ficimia publia MVZ 67807, 76354, 172390, 20735, 21334, 21336; UMMZ 82594; USNM 110295, 121452. Ficimia ruspator MVZ 45086. Ficimia streckeri UAZ 35520, 37719, 42223, 42226. Ficimia variegata USNM 30126. Gyalopion canum UAZ uncataloged, 20736-9, 34519, 35082, 35522, 37742, 37744, 39515, 42224, 42433, 42477, 43746, 43980, 44813, 45532-3, 45535, 47353, 47447, 50603. Gyalopion quadrangulare JFC 62R117; UAZ uncataloged, 16294, 20734, 24926, 36447, 36646, 37678, 37710-1, 37741, 39233-4, 39558, 39561, 42850, 45197, 46668, 47352. Pseudoficimia frontalis AMNH 63717; UAZ 16308, 21337, 21338, 48777; UMMZ 104491, 104496, 104686, 104687, 112512, 119279. Stenorrhina degenhardtii AMNH 3239, 7568, 46979-80, 59488, 67064, 109830, 110637, 119838, 119841, 119884-5; LACM 122354, 122357. Stenorrhina freminvillei AMNH 17375, 65151, 66803, 66960, 66962, 70182, 89069, 89623, 91631, 93234, 100645, 100913, 103058-60, 104385, 108998; LACM 38203, 64448, 114111; UAZ 26334, 38774. 170

Sympholis lippiens AMNH 109461; ASU 5849, 6634; CAS 132247, 140519, CAS-SU 24045, 24046; JFC 63.128; KU 56229-1, 73628, 80760, 95965; LACM 6500, 103694, 103697; MVZ 187736, 70290, 76332, 76333, 76334; UAZ 14428, 16309, 26388, 39230, 39564, 45035-40, 45914, 47355, 47462; USNM 31346.

Sonora clade Chilomeniscus cinctus Sinaloa: LACM 121310; Southeastern Sonora: AMNH 64245, 66338, 102190-1; ASU 8526-7; CAS 138869; LACM 2183, 9042-3, 103473-5, 125323; MCZ 24; MVZ 71365; TRV 2860; UAZ 39526, 42847, 42856, 42912-3, 45017, 50560; UMMZ 134106; USNM 146443, 214111, 248208. Northwestern Sonoran Coast: CAS 181940-6; CNHM 74962; LACM 138471; UAZ 24083, 32331, 45015, 45294, 49103, 49335, 50331, 50630-6; USNM 214110, 238284-7. Isla Tiburon: UAZ 23194-5; USNM 222051-3. Gila Co., AZ: ASU 14024. Maricopa Co., AZ: ASU 1210, 1212-3, 1220-1, 1887, 1906, 2212, 2255, 2273, 2275, 2283, 2406, 2891, 2904, 3378, 3395, 3578, 3579, 4385, 4669-70, 9161, 10232, 13206, 13879, 13897, 13903, 15472, 26367-8; CAS 17551; SDSNH 27003; UAZ 24104, 35444, 35465, 35795, 35818, 39529, 50569, 50665- 6; UMMZ 137137; USNM 246447-8, 246451. Pima Co., AZ: ASU 01231, 15391, 28400-1; CAS 33834, 34172; RDM 94-89; TRV 36, 86, 379, 1346; UAZ 10350, 24086-96, 24098, 24100-3, 24106-9, 30241, 33815, 34681-2, 34707, 34911, 35166, 36108, 37819-21, 39522-5, 39527, 40908-19, 42197, 44547, 44937, 44944, 45016, 48181, 48304, 48630, 49091-3, 50322, 50328-30, 50664; USNM 118570, 15789, 193014, 307453, 60975, 62545. Pinal Co, AZ: ASU 1519, 3006, 14023, 15375-9, 23573-4, 26408, 26409, 26411, 26413, 28614, 29495; UAZ 24084-5, 24097, 24105, 32723, 39528, 43150, 50663. Yavapai Co., AZ: ASU 1339; USNM 252997. Northern Sonora: CM 40358; LACM 103472; USNM 146465. Exact locality unknown: CAS 33839-40; UAZ uncataloged (N=26); USNM 8897, 62566. Chilomeniscus fasciatus Western Baja California del Norte: AMNH 64512; MVZ 161411-2, 170764; SDSNH 30371, 42324-5, 42737, 43378, 45973, 48150-2, 62226-7; USNM 21539, 37520. Eastern Baja California del Norte: AMNH 94163; LSUHC 3013; MVZ 117303, 117449, 161396, 161402, 161404, 161406-8, 161413-4, 170761, 170763, 176048, 189956; SDSNH 17390, 38663, 42054; UAZ 23197, 42416. Ballenas Bay: USNM 15158; UAZ 23198. MCZ 19731. Eastern Baja California del Sur: CAS 143426; LSUHC 1826, 2633, 3003-4; MVZ 161398; SDSNH 30373, 3828-30, 44384, 61289; UAZ 23199, 45292-3, 45295; USNM 65825, 67376-7. Isla Monserrate: SDSNH 50173. Isla San Marcos: SDSNH 50174. Isla San Jose: SU 14035. Western Baja California del Sur: LACM 128275, 138141; LSUHC 3006, SDSNH 30364-7, 30369-70, 30372; UAZ 23196, 34569, 37859-60, 45296-9, 50332, 50334; USNM 240350, 257311-3. Isla Magdalena: USNM 37521. Northwestern Cape Region: CAS 45981, 91244, 91401; LACM 103476-7, 107910, 128276-7, 138475-7, 51631; LSUHC 1103, 1754-8, 1775, 1841, 2361, 2406, 2434; MVZ 100475, 117329, 142051, 161400-1, 161416, 170778-9, 170844-5, 182172, 182247, 190035, 190059, 190067, 190070; SDSNH 45218; TRV 1347; UAZ 35729-32, 37858, 37861, 46552-4; USNM 12630, 240223-4, 240268-9, 240351. 171

Chilomeniscus punctatissimus Isla Espiritu Santo: CAS 143413-4, 144594-5; LSUHC 2998-3002, 3027-30, LSUHC uncataloged (later cleared and stained); MVZ 170773-6. Isla Partida Sur: CAS 49156; UAZ 50333. Chilomeniscus stramineus Southeastern Cape Region: AMNH 87586; CAS 4116, 91461; LACM 2182, 51630, 74028; LSUHC 1656, 1759-60, 1842, 2409; MVZ 11853, 11856, 11867-8, 11870, 11881-2, 11885-6, 11888, 11891, 11894-5, 11900, 104251, 104329, 182224, 182232-3; SDSNH 3831, 61291; UAZ 42343; USNM 4674, 16406-9, 64579. Chilomeniscus savagei Isla Cerralvo: CAS 88626, 92994, 101600; SU 14034, 16062; LSUHC 2997; MVZ 117356-7; SDSNH 44394. Chionactis occipitalis UAZ 20974, 20975, 20982, 20991, 32308, 32311-2, 39938-9, 43762, 48184, 49094-6. Chionactis palarostris UAZ 20971, 20972, 30736, 30923, 31276, 33912, 39840, 48231, 48303, 49097-102, 50103. Sonora aemula AMNH 102192, 63738, 64255; ASU 5850-1, 6458, 6611-2; JFC 65-236; LACM 51563; UAZ 16533, 26083, 27271, 31421, 37674, 42845, 42885, 42887, 42888, 42889, 43283, 45018, 45149-57, 45661, 45675, 45841, 45908, 46666-7, 46684-5, 47354, 47431, 49280. Sonora michoacanensis AMNH 19714-6, 74951; KU 106286, 23790-1; MVZ 45123, 76714, 71356; UMMZ 109904-6, 119457. Sonora semiannulata ASDM 20698; UAZ 9355, 26335-9, 26344, 26347, 26354- 6, 26361, 26367, 26371-2, 28053, 28567, 32189, 32214, 32525, 32822, 33817, 35135, 35794, 36785, 37796-7, 37879-82, 39565-7, 39569-73, 39576-78, 39872, 40398, 40516, 40518, 40520, 40636, 40687, 42145-7, 43919, 43968, 43970, 44323-4, 44465, 44605, 44777, 45008, 45031, 45662, 46226-7, 47357-8, 49339, 50744.

Tantilla clade Geagras redimitus AMNH 65121, 65868, 65869, 65870, 66793, 66972, 66974, 68886, 84232, 84233; USNM 109876-85, 109887, 109888. Scolecophis atrocinctus KU 42328, 86237, 101919, 125496-8, 174275-8, 174280- 1, 191075, 194681; USNM 56331, 9778. Tantilla alticola LACM 125561. Tantilla atriceps UAZ 23763. Tantilla bocourti AMNH 19735, 72508, 82023, 104469; LACM 64506; MVZ 45198, 72202; USNM 25032-3, 110395, 110397, 304282, 346650-1. Tantilla brevicauda AMNH 71675; MVZ 40403. Tantilla calamarina AMNH 12775-6, 19743-4, 19750, 78745, 91593, 99141; LACM 126550; UAZ 26447; USNM 32290, 150614. Tantilla sp. cf T. calamarina group AMNH 3892. Tantilla cascadae AMNH 107389. Tantilla coronata USNM 165847, 165854, 165859, 165862, 165864, 517407-9. Tantilla cucullata ApSU 15484; MVZ 229495; UAZ 39867. 172

Tantilla cuniculator CAS 154145. Tantilla deppei AMNH 94718-9, 108913; LACM 64505. Tantilla equatoriana USNM 198529-30. Tantilla flavilineata AMNH 91092, 97984; CAS 103438-40. Tantilla gracilis UAZ 26448-9, 29691-4, 31755, 35162, 35345, 35907, 46981, Oklahoma. Tantilla hobartsmithi UAZ 9362, 26416, 26427-8, 30475, 30915, 30929, 30932, 32524, 32819-20, 32948, 35042, 35044-5, 35529, 35906, 37740, 42202, 44350, 50285, 50289-90, 50743, 50798. Tantilla insulamontana CAS 94090-1; USNM 198430. Tantilla jani as T. cuesta CAS 146762-3. Tantilla melanocepha LACM 31493; MVZ 163314, 68711; USNM 198723-7, 198729-33. Tantilla moesta AMNH 140259; UMMZ 79058-9; USNM 6565, 24883, 157815. Tantilla nigriceps UAZ 26451-2, 28140, 32370, 34413-5, 34796, 35043, 37716, 40403-4, 42361, 46446, 48222. Tantilla oaxacae CAS 101424. Tantilla oolitica LACM 59058; USNM 306864. Tantilla petersi USNM 287939.

Tantilla planiceps MVZ 25331, 66213, 71918, 72257, 72492, 111210, 128491, 128794, 150314, 161440. Tantilla relicta MVZ 164966-7; UMMZ 44966, 55779, 56600, 61658, 77482. Tantilla reticulata LACM 131131. Tantilla rubra MVZ 36603; UAZ 42232, 46370, 47060-1. Tantilla schistosa AMNH 17285, 69723, 76120, 89624; CAS 143899, 98256; LACM 51799, 114080,121852; USNM 337554,337556. Tantilla semicincta AMNH 109843-4; USNM 107324, 117506. Tantilla striata AMNH 64584, 65152-3, 65867, 68032-5; USNM 110375-6, 110585. Tantilla supracincta AMNH 119886; MVZ 36454; USNM 219604-5. Tantilla taeniata AMNH 12698; USNM 337557. Tantilla tayrae CAS 159114, 159203, 167117, 169587-8; MVZ 177105-6. Tantilla vermiformis AMNH 111323-7; LACM 122002-3; UMMZ 132191, 133224, 135259-4278; USNM 75711-2. Tantilla vulcani as T. jani CAS 66891-901, 66903, 66905-9, 71912, 140961; MVZ 132936; USNM 110377-8. Tantilla wilcoxi AMNH 15066, 85262; ApSU 17174; KU 39970; UAZ 26450, 28201, 38037, 39599-600, 40402, 40533, 42233-4, 42687, 43604, 46148, 46338, 48780, 50383. Tantilla yaquia UAZ 23569-71, 30336, 35165, 39601, 39858, 42881, 45886, 46637, 46680, 46686, 48779, 50742. Tantillita brevissima MVZ 88468. 173

Tantillita canula AMNH 70963, 110055; UAZ uncataloged; USNM 24880, 194824. Tantillita lintoni AMNH 69981, 70241; UMMZ 117905-6. 174

APPENDIX D. List of primarily osteological specimens. Species ID* Portion Preparation Chilomeniscus cinctus PAH 93-1 complete disarticulated dry Chilomeniscus cinctus PAH 94-1 complete disarticulated dry Chilomeniscus cinctus PAH 18D complete disarticulated dry Chilomeniscus cinctus RDM 94-89 complete disarticulated dry Chilomeniscus cinctus TRV 36 complete disarticulated dry Chilomeniscus cinctus TRV 379 complete disarticulated dry Chilomeniscus cinctus UAZ 42912 skull cleared & stained Chilomeniscus cinctus UAZ 48181 complete cleared & stained Chilomeniscus cinctus UAZ temp 299 complete cleared & stained Chilomeniscus fasciatus TRV 1347 complete disarticulated dry Chionactis occipitalis PAH 91-1 complete disarticulated dry Chionactis occipitalis TRV 1379 complete disarticulated dry Chionactis occipitalis TRV 2168 complete articulated dry Chionactis palorostris PAH 92-1 complete disarticulated dry Chionactis palorostris PAH 94-5 complete disarticulated dry Chionactis palorostris TRV 3482 complete disarticulated dry Coluber constrictor RDM 94-75 complete disarticulated dry Coluber constrictor TRV 1522 complete disarticulated dry Conopsis nasus TRV 2753 complete disarticulated dry Conopsis nasus TRV 2754 complete disarticulated dry Conopsis lineata ASU 19915 complete disarticulated dry Conopsis lineata LACM 130663 skull articulated Dendrophidion paucicarinatum TRV 3207 complete disarticulated dry Dryadophis dorsalis PAH 93-4 complete disarticulated dry Dryadophis dorsalis PAH 93-5 complete disarticulated dry Dryadophis melanolomus TRV 1770 complete disarticulated dry Drymarchon corais TRV 1207 anterior disarticulated dry Drymarchon corais TRV no number anterior disarticulated dry Drymobius margaritifera TRV 1524 complete disarticulated dry Ficimia olivacea TRV no number complete disarticulated dry Ficimia streckeri TRV 3223 complete disarticulated dry Ficimia streckeri UAZ 37719 skull cleared & stained Gyalopion canum MVZ 229349 complete articulated dry Gyalopion canum TRV 2621 complete disarticulated dry

175

APPENDIX D, continued. List of osteological specimens. Species ID Portion Preparation Gyalopion canum TRV 2623 complete disarticulated dry Gyalopion canum UAZ 34117 skull cleared & stained Gyalopion quadrangulare ASDM 21772 complete cleared & stained Gyalopion quadrangulare TRV 2827 complete disarticulated dry Gyalopion quadrangulare TRV 3592 complete disarticulated dry Lampropeltis getula PAH 98-1 complete disarticulated dry Leptophis ahetula TRV 2024 complete disarticulated dry Leptophis depressiorostris TRV 3228 complete disarticulated dry Leptophis diplotropis TRV 452 complete disarticulated dry Leptophis mexicanus TRV 2354 complete disarticulated dry Masticophis bilineatus TRV 2153 complete disarticulated dry Masticophis bilineatus TRV 3601 complete disarticulated dry Masticophis flagellum TRV 1515 complete disarticulated dry Masticophis mentovarius TRV 1735 complete articulated dry Masticophis taeniatus ruthveni TRV 415 complete disarticulated dry Opheodrys vernalis TRV 1489 complete disarticulated dry Phyllorhynchus browni TRV 2835 complete disarticulated dry Phyllorhynchus browni TRV 3609 complete disarticulated dry Phyllorhynchus decurtatus TRV 102 complete disarticulated dry Phyllorhynchus decurtatus TRV 1802 complete disarticulated dry Pseudoficimia frontalis UAZ 48777 complete disarticulated dry Pseustes poecilonotus TRV 2443 complete disarticulated dry Rhinocheilus lecontei PAH 98-2 complete disarticulated dry Rhinocheilus lecontei PAH 98-3 complete disarticulated dry Salvadora grahamiae TRV 553 complete disarticulated dry Salvadora hexalepis TRV 480 complete disarticulated dry Salvadora lineata TRV 1288 complete disarticulated dry Scolecophis atrocinctus TRV 2104 complete articulated dry Senticolis triaspis PAH 95-1 anterior disarticulated dry Sonora aemula TRV 2814 complete disarticulated dry Sonora aemula TRV 2859 complete disarticulated dry Sonora aemula UAZ 43283 skull cleared & stained Sonora semiannulata PAH 86-1 complete disarticulated dry Sonora semiannulata PAH 94-2 complete disarticulated dry

176

APPENDIX D, continued. List of osteological specimens. Species ID Portion Preparation Sonora semiannulata PAH 94-3 complete disarticulated dry Sonora semiannulata RDM 94-72 complete disarticulated dry Sonora semiannulata RDM 94-93 complete disarticulated dry Sonora semiannulata TRV 2660 complete disarticulated dry Sonora semiannulata TRV no number complete disarticulated dry Stenorrhina freminvillei MVZ 172399 complete articulated dry Stenorrhina freminvillei MVZ 175903 complete articulated dry Stenorrhina freminvillei TRV 2358 complete disarticulated dry Stenorrhina freminvillei TRV 2393 complete articulated dry Sympholis lippiens TRV 2206 partial disarticulated dry Sympholis lippiens UAZ 39230 skull disarticulated dry Tantilla calamarina UAZ 26447 skull cleared & stained Tantilla gracilis MVZ 200487 complete articulated dry Tantilla gracilis MVZ 200488 complete articulated dry Tantilla gracilis TRV 2764 partial disarticulated dry Tantilla gracilis TRV 2825 partial disarticulated dry Tantilla gracilis UAZ 29691 skull partially articulated Tantilla hobartsmithi UAZ 50289 complete cleared & stained Tantilla hobartsmithi UAZ 50290 complete cleared & stained Tantilla melanocephala ASU 19916 partial disarticulated dry Tantilla melanocephala MVZ 163428 complete cleared & stained Tantilla nigriceps TRV 464 partial disarticulated dry Tantilla nigriceps UAZ 28140 skull cleared & stained Tantilla planiceps MVZ 173650 complete articulated dry Tantilla relicta MVZ 212084 complete articulated dry Tantilla relicta MVZ 212085 complete articulated dry Tantilla relicta PAH 14D complete articulated dry Tantilla relicta TRV 2945 partial disarticulated dry Tantilla rubra ASU 15484 complete articulated dry Tantilla rubra ASU 17383 complete articulated dry Tantilla rubra ASU 19911 partial disarticulated dry Tantilla rubra TRV 2881 partial disarticulated dry Tantilla semicincta ASU 15136 complete articulated dry Tantilla supracincta ASU 19914 complete articulated dry

177

APPENDIX D, continued. List of osteological specimens. Species ID Portion Preparation Tantilla supracincta ASU 19917 complete disarticulated dry Tantilla supracincta TRV 2247 partial disarticulated dry Tantilla vermiformis ASU 19918 partial disarticulated dry Tantilla wilcoxi ASU 17174 complete articulated dry Tantilla wilcoxi UAZ no number complete cleared & stained Tantilla yaquia MVZ 229354 complete articulated dry Tantilla yaquia PAH 93-2 skull cleared & stained Tantilla yaquia PAH 93-3 complete disarticulated dry Tantillita canula PAH 84-1 skull partially articulated Trimorphodon biscutatus TRV 3555 complete skull articulated Trimorphodon biscutatus TRV 98 complete disarticulated dry Trimorphodon tau TRV 2755 complete disarticulated dry Carphophis amoenus PAH 99-1 complete disarticulated dry Carphophis amoenus UAZ 47016 complete cleared & stained Diadophis punctatus PAH 94-4 complete disarticulated dry Tretanorhinus nigroluteus PAH 93-6 complete disarticulated dry

Codes for museum and personal collections are: Appalachian State University (ASU), Los Angeles County Museum of Natural History (LACM), Museum of Vertebrate Zoology at Berkeley (MVZ), Peter A. Holm (PAH), Robert D. McCord (RDM), Thomas R. Van Devender (TRV), and University of Arizona (UAZ).

178

Appendix E. Morphological codes for phylogenetic analysis.

There are 86 taxa and 74 characters. Character types, weights, and descriptions are provided in text. Missing data=? and ambiguous data={}. Characters are separated by spaces.

Chilomeniscus_cintus Z O A N J P R I L S F C E W A U A X M A A E Z A A A A Z V P A A A B C ? A B B B A B {BD} ? ? ? ? ? A B ? ? A ? ? ? A A A A B B A A A B A A A B B A A A Chilomeniscus_fasciatus X Q A P K P R J N W F D E V A U A Z V A B ? Z A A A A Z Z Z A A A B C ? A B B B A B {BD} ? ? ? ? ? A B ? ? A ? ? ? A A A A B ? ? ? ? ? A A ? B B A A A Chilomeniscus_punctatissimus Z P A P L P U L L X G C E X A R A Z V B C H C A A A F Z Z Z A A A B C ? A B B B A B {BD} ? ? ? ? ? A B ? ? A ? ? ? A A A A ? B A A A B A A A B B A ? A Chilomeniscus_savagei X M D Z N K U M K U F H E W A R A Z L ? ? ? A A A A Z Z Z Z A A A B C ? A B B B A B B ? ? ? ? ? ? B ? ? A ? ? ? A A A A ? ? ? ? ? ? ? ? ? ? ? A ? A Chilomeniscus_stramineus Z M B P J M Q H H S G B F V A Z A Z H C ? H A A A A J Z Z Z A A A B C ? A B B B A B D ? ? ? ? ? A ? ? ? A ? ? ? ? ? ? A ? B ? ? ? ? ? ? ? B B A ? A Chionactis_occipitalis M S I M K I J K W T L O O Y I B P Z H A B I A A A A A A B G A A A A B ? A B B B A A B ? ? ? ? ? ? B ? ? A ? ? ? A B B A B A A B A B A A A B B A A A Chionactis_palarostris L O M I N I J M U Q K L N Z I D P Z H A B J A A A A A A A A A A A A B ? A B B B A A B ? ? ? ? ? ? B ? ? A ? ? ? A B B A B A A B A B A A A B B A A A Coluber_constrictor I Z H B U A B I Z R R S Z G R C Z Z W J Q M A A A A A A A A A A A ? A ? A A B A A A A ? ? ? ? ? A A A A A A ? ? ? ? ? {AB} A A A A A A A A B A B B ? A Conopsis_amphistichia K Q K L Q L J O U Z I F H J R B M Z H E I L A A A A A A E A A A A A B ? A A B A B A A ? ? ? ? ? ? A A A A A ? ? ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? B Conopsis_biserialis M O L J Q N J I Q Q L G J G R C Q T H D G I A A A A A A E A A A A A B ? A A B A B A A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? A ? ? B B Conopsis_conica ? ? ? ? ? ? ? ? ? ? J F H G R ? ? Z H ? ? ? A A A Y A A X B A A A ? B ? A A B A B A A ? ? ? ? ? ? A A A A A ? ? ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? B Conopsis_lineata K O M G S O M H R R L F K J R D P Z H C F H A A A A H A E B A A A A B ? A A B A B A A ? ? ? ? ? ? A A A A A ? ? ? ? ? A B A A A B B B A A B ? ? B B Conopsis_megalodon ? ? ? ? ? ? ? ? ? ? J F I G R ? ? Z A C I I A A A Z A A N A A A A ? B ? ? ? B ? B A A ? ? ? ? ? ? A A A A A ? ? ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? B Conopsis_nasus J P M G Z J G K V Q J F G J R D R Z H F I I A A A Z A A D B A A A 179

A B ? A A B A B A A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A B ? ? ? B B A A A A B B B B Ficimia_hardyi ? ? ? ? ? ? ? ? ? ? N I N P R ? ? Z ? ? ? ? Z Z Z A A A Z Z A A B ? ? ? ? ? B ? B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Ficimia_olivacea M U H A N I V U M W J K K J R E R O H H G I Z Z Z A A A Z Z A A B A B ? A A B A B C E ? ? ? ? ? ? ? ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? A ? B ? A Ficimia_publia R U D H J M V V R V J K K K R B U V H F G I Z Z C A A A Z X A A B A B ? A A B A B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? A B B A A Ficimia_ramirezi ? ? ? ? ? ? ? ? ? ? J J J H R B M Z ? ? ? ? Z Z A A A A Z Z A A B ? B ? ? ? B ? B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Ficimia_ruspator P P I G I N X U L N K L K J R B Q Z H ? ? ? Z Z A A A A Z Z A A B A B ? A A B A B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Ficimia_streckeri O S G E K M Z Z O X I J J J R F R I H F E H Z Z Z A A A Z Z A A B A B ? A A B A B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A B A C A B B A B A A B B ? A Ficimia_variegata P R H H K I U U M X I M L M R B Q R H G B A Z Z Z A A A Z Z A A B A B ? A A B A B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? A ? ? ? ? Geagras_redimitus Q O H S F S S C A G G D G E I B A E H E ? ? A A A A A A Z Z A Z A B E A B A A A A B C A ? ? ? A A A A A B ? C A ? ? ? A B C A ? ? ? A ? ? B A ? ? A Gyalopion_canum R Q F C L N M T S T I H I X R E X Z I E F I Z A A A A A W W A A B A B ? A A B A B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A B A C A B B A B A B B B A A Gyalopion_quadrangulare O U F E L N Q P V U G F F L R C O V H F F I Z A A A A A N N A A B A B ? A A B A B C A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A B A C A B B A B A B B A A A Liochlorophis_vernalis E T O C S H C G Y O Z F Y B I B I Z Z N P O A A A A A A F A A A A ? B A A A B A A A L ? ? ? ? ? A A A A A A ? ? ? ? ? A A A A A A A A A A A B A ? B Pseudoficimia_frontalis K W I K Q N M J U R K M N I R H R Z H K I L A A A A A A Y Z A A A A B ? A A B A B A A ? ? ? ? ? ? A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? A A ? B B B ? A Scolecophis_atrocinctus A H Y E E P B G H B I V P G I B I Z H J P ? A A A A A A A A A A A A D A B A B B A A B ? ? ? ? ? ? A A A A ? A ? A A A A ? A B A A A B A B B B A ? A Sonora_aemula H L Q C T M F O W O I L L T I ? W Z H J G M A A A A A A A A A A A A B ? A A B A A A B ? ? ? ? ? ? B ? ? A ? ? ? B A A A B A A A A B A A A B B A A A Sonora_michoacanensis E I U C P O F J T L K P N O I B N Z J ? ? ? A A A A A A F B A A A A B ? A A B A A A B ? ? ? ? ? ? B ? ? A ? ? ? B A A A ? ? ? ? ? ? ? ? ? ? ? A ? A Sonora_semiannulata G J R C Q L B I W M N N P W I U J Z H G H I A A A A A A A A A A A A B ? A A B A A A {BD} ? ? ? ? ? A B ? ? A ? ? ? A A A A B A A A A B A A A B B A A A Stenorrhina_degenhardtii K T J L Q N L R X Z K O K G R B R Z M ? ? ? A A A A A Z Y L A A A A B ? A A A A B A A ? ? ? ? ? A A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? ? ? B 180

A A Stenorrhina_freminvillei I Q N G U K L Q U Q H Q K K R B V Z H J L M A A A A A Z M B A A A A B ? A A A A B A C A ? ? ? A A A ? ? A ? ? ? ? ? ? A B A A A B B A A A B B A A A Sympholis_lippiens M L M G L F F M D R A Z A X Z A P A H D G E A A A Z A A S Y A A B A B ? A A A A A A B ? ? ? ? ? ? A ? ? A ? ? ? A A A A B A A A B B A B A A B B A A Tantilla_albiceps D I U H A V R L F D P U T ? I B A E H I ? ? A A A A A A Z Z A Z A B C A ? ? ? ? A A I ? ? ? ? A A ? ? ? ? ? ? ? ? ? ? B ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_alticola D J U K F O L L J J Q I Q C I B A Z H ? ? ? A A A A A A Z H A X A B C B B A A A A A {CE} ? A A {AB} A B A A A A B A A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_andinista ? ? ? ? ? ? ? ? ? ? O M Q ? I ? ? Z H ? ? ? A A A A A A Z Z A A A ? F ? ? A A A A A C A ? ? B A A A A A A C B B ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_atriceps K F R J C P G C F K S H R G I B A M H F ? ? A A A A A A Z K A H A B C A B A A A A A D ? ? ? ? A A A B A A A A A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_bairdi ? ? ? ? ? ? ? ? ? ? I P K ? I B A Z H ? ? ? A A A A A A Z G A Z A ? C ? ? ? ? ? A A E ? ? ? ? A B A A A A B A A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_bocourti D A Z H C T E J H E N R R D I B I Z H E ? ? A A A A A A X B A E A B E A B A A A A A {CE} A ? ? ? A A A A A A B {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? ? B A ? A Tantilla_brevicauda E I U G E U K N N J D L D D I B A Z G K P ? A A A A A A Z G A N A B C B B A A A A A C ? A A {AB} A B A A A A B ? A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_briggsi ? ? ? ? ? ? ? ? ? ? P S U F I ? ? Z H M ? ? A A A A A A Z A A Z A ? C ? ? ? A ? A A C ? ? ? A B A A A A A C B A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_calamarina G J S H H P K B J H J F J D I B F E H D ? J A A A A A A Z M A Z A B E A B A A A A A C A ? ? ? A A A A A B B C A ? ? ? A B A A A A A B A B B B A ? A Tantilla_capistrata ? ? ? ? ? ? ? ? ? ? V K S ? I ? ? W H ? ? ? A A A A A A Z Z A D A ? ? ? ? ? ? ? A A {CD} A ? ? ? A A A A A A C {AB} B ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_cascadae D N S E K R F E ? ? H I M A I B I Z A ? ? ? A A A A A A Z A A Z A B E A B A A A A A C A ? ? ? A A A A A B ? C A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_coronadoi D B Z F F O D G O K K O N ? I B I U H ? ? ? A A A A A A Z A A N A B E ? ? ? ? ? A A C A ? ? ? A A A A A B ? C A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_coronata F E W H E Z K N I G N I O D I B A Z G J ? ? A A A A A A Y A A T A B C A B A A A A A D ? ? ? ? A A A A A A C {AB} A ? ? ? A ? A B A A A B A ? B A A A A Tantilla_cucullata D L T G G Q E L G F T Q W F I B A Z H J P S A A A A A A Z P A H A B C B B A A A A A D ? ? ? ? A A A B A A C {AB} A ? ? ? A ? A B A A A B A B B A A A A Tantilla_cuniculator D H V G B R G F M F P K Q D I B A Z H ? ? ? A A A A A A Z A A A A B C B B A A A A A C B A A A A A A A A A B A A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? 181

? ? ? Tantilla_deppei F H U H L M F G N K P M Q C I B H Z H ? ? ? A A A A A A Z A A C A B E A B A A A A A C A ? ? {AB} A A A A A B B B A ? ? ? A ? ? ? ? ? ? ? ? ? ? B ? ? A Tantilla_equatoriana D P R G J N A C R K U L W D I B A Z H ? ? ? A A A A A A Z Z A A A B C A B A A A A A C A ? ? A C A A A A A C C A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_flavilineata C M T G I S F K J G M N P G I B A Z H G ? ? A A A A A A Z F A H A B C B B A A A A A C B B A B A B A A A A B A A ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_gracilis H E T I E V J C G G P E O H I B A E H G M O A A A A A A Z N A V A B C A B A A A A A D ? ? ? ? A A A B A A A A A ? ? ? A B A B A A A ? A B B A A A A Tantilla_hobartsmithi I E T F D T H C G E S K S G I B A W H F ? L A A A A A A Z J A V A B C A B A A A A A D ? ? ? ? A A A B A A A A A ? ? ? A B A B A A A B A B B A A A A Tantilla_impensa ? ? ? ? ? ? ? ? ? ? Q P V D I ? ? Z H K ? ? A A A A A A Z A A A A ? ? ? ? ? A ? A A C B A A A B A A A A A C {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_insulamontana G P P I H N G I K H S L T G I B A Z H M ? ? A A A A A A Z Z A Z A B C A B A A A A A C A ? ? A C B A A A A ? C A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_jani E E X J A T L N M I N K O D I B A Z H ? ? ? A A A A A A Z A A Z A B C B B A A A A A C B A B A A B A A A A B C A ? ? ? A ? ? ? ? ? ? ? ? ? ? A ? ? ? Tantilla_johnsoni ? ? ? ? ? ? ? ? ? ? O N S D I ? A Z H ? ? ? A A A A A A Z A A Z A B C ? ? ? ? ? A A C ? ? ? A B A A A A A C B A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_lempira ? ? ? ? ? ? ? ? ? ? N K O ? I ? ? Z H ? ? ? A A A A A A Z A A A A ? F ? ? ? ? ? A A C A ? ? A A B A A A A C C B ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_melanocephala E O R M J P E D R H R L S D I B A Z H O Z T A A A A A A Z R A F A B F A B A A A A A C A ? ? A {AB} B A A A A C {BC} B ? ? ? A B A B A A A B A B B A A A A Tantilla_miyatai ? ? ? ? ? ? ? ? ? ? U Q Y ? I ? ? Z H ? ? ? A A A A A A Z Z A A A ? C ? ? ? ? ? A A C A ? ? B C B A A A A C B ? ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_moesta D J U K D R L L H G O L R D I B A Z H O ? ? A A A A A A Z C A Z A B C B B A A A A A C B A A ? ? ? A A A A ? ? ? ? ? ? B ? ? ? ? ? ? ? ? ? ? A ? ? A Tantilla_nigra B N U A B Y P M H H U J T ? I ? ? E H ? ? ? A A A A A A Z A A A A B C A ? ? ? ? A A J ? ? ? ? ? ? A A A A ? C ? ? ? ? B ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_nigriceps F J S F E T H D H I N L N L I B A Z H I O L A A A A A A Z S A N A B C A B A A A A A D ? ? ? ? A A A B A A A A A ? ? ? A B A B A A A B A B B A A A A Tantilla_oaxacae B M T J D D I K ? ? M L P D I B A Z H ? ? ? A A A A A A Z G A A A B C B B A A A A A C B B A B A B A A A A B {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_oolitica G E V K D U K G J J O J Q D I B A Z D I ? ? A A A A A A Z F A I A 182

B ? A B A A A A A D ? ? ? ? A A A A A A C B A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_petersi D Q Q H F R E I M J Q P T G I B A Z H ? ? ? A A A A A A Z A A Z A B F A B A A A A A H ? ? ? ? ? A ? ? ? ? ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_planiceps F D W F F O C A G A Q R T G I B A Y H G ? ? A A A A A A Z E A W A B C B B A A A A A D ? ? ? ? A A A B B A B A A ? ? ? A ? A B A A A B A B B ? A ? A Tantilla_relicta H G T J E X L H F E Q G R E I B A Z H J R M A A A A A A Z N A J A B C A B A A A A A {CD} A ? ? ? A A A A A A C {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_reticulata A H Y B J S E M L F Q O T F I B A Z H ? ? ? A A A A A A Z K A R A B C B B A A A A A C B B A B A B A A A A B B A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_rubra D L T G G M G K K F Q N T E I B A Z H J ? ? A A A A A A Z J A H A B C B B A A A A A D ? ? ? ? A A A {AB} A A C {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_schistosa D H V E B X L N Q J K H K B I B A Z G M ? ? A A A A A A Z A A Z A B C B B A A A A A {CE} B A A A A B A A A A B {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? ? Tantilla_semicincta E I U J B S E J H H Q Q TT H I B A Z H O ? S A A A A A A Z Z A A A B C B B A A A A A {CF} B B A ? ? A A A A A ? B ? ? ? ? A ? A B A A A B A B B ? ? ? ? Tantilla_shawi ? ? ? ? ? ? ? ? F ? M S P ? I B A Z H K ? ? A A A A A A Z Z A A A B C ? ? ? A ? A A K ? ? ? ? ? ? A A A A C A ? ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_slavensi ? ? ? ? ? ? ? ? ? ? P M S F I ? A Z H ? ? ? A A A A A A Z Z A A A B C ? ? ? A ? A A C B A A A B A A A A A C B A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? A ? Tantilla_striata C C Z B F N G I R J I N K D I B A Y H ? ? ? A A A A A A Z A A A A B C B B A A A A A C B B A A A A A A A A B C A ? ? ? A ? ? ? ? ? ? ? ? ? ? A ? ? A Tantilla_supracincta C N T H H O J K Q G O K S D I B A Z H V X Z A A A A A A Z D A Q A B C A B A A A A A G ? ? ? ? ? ? A A A A B {AB} ? ? ? ? A B A B A A A B A B B A ? ? A Tantilla_taeniata B H X F H N E G N E Q N U D I B A Z H ? ? ? A A A A A A Z N A Q A B C B B A A A A A C B B A A B A A A A A C {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? ? ? ? ? A Tantilla_tayrae D K T J I P O Q O K N K P D I B A Z H I ? ? A A A A A A Z A A F A B C B B A A A A A {CE} B A B A A B A A A A B {AB} A ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_tecta ? ? ? ? ? ? ? ? ? ? S K S D I ? ? Z H E ? ? A A A A A A Z Z A Z A ? C ? ? ? A ? A A C B A A A A B A A A A B A A ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? ? ? Tantilla_vermiformis H J R M F N I C H G F E D F I B A Z H G ? H A A A A A A Z A P Z A B C A B A A A A A C A ? ? ? A A A A A A B ? A ? ? ? A B ? B A A A B A B B A ? ? A Tantilla_vulcani C J V F D Q J E L E N L N D I B A Z H M ? ? A A A A A A Z Z A A A B C B B A A A A A C B A B A A B A A A A B A A ? ? ? A ? ? ? ? ? ? ? ? ? B ? ? A A 183

Tantilla_wilcoxi D I U F I P G H M H R N T H I B A Z H G ? N A A A A A A Y C A K A B C A B A A A A A D ? ? ? ? A A A A A A B A A ? ? ? A B A B A A A B A B B A A A A Tantilla_yaquia F H U H D P A A H C S L T H I B A Z H F O L A A A A A A Z E A D A B C A B A A A A A D ? ? ? ? A A A B B A B A A ? ? ? A B A B A A A B A B B A A ? A Tantillita_brevissima C D Y G C V H E R E L D H F I B A Z H U ? ? A A A A A A Z A A A A B C B B A A A A A E ? ? ? ? A B A A A A B C A ? ? ? A ? ? ? ? ? ? ? ? ? A ? ? ? ? Tantillita_canula I G S K G Q L F K I P A L F I B A Z H J M L A A A A A A Z D F A A B C B B A A A A A {CE} B {AB} {AB} ? A B A ? ? A ? ? ? ? ? ? A B A B A A A B A B A A ? ? A Tantillita_lintoni D A Z F J P G F Q G T C P F I B A Z H Z ? ? A A A A A A Z E G D A B C B B A A A A A E ? ? ? ? A B A ? ? A ? ? ? ? ? ? A ? ? ? ? ? ? ? ? ? A A ? ? ?

184

APPENDIX C. PART THREE: MORPHOLOGICAL AND ECOLOGICAL DIVERSIFICATION OF THE BURROWING SNAKE TRIBE SONORINI (COLUBRIDAE) 185

Abstract

The colubrid snake tribe Sonorini is a remarkably diverse assemblage of over

eighty species that ranges from desert to rainforest and is centered in the tropical

deciduous forest of west central Mexico. I used morphological characters and

mitochondrial DNA sequences to reconstruct phylogenetic relationships, providing a

framework to explore morphological and ecological diversification. Morphometric and natural history data from museum specimens, field studies, and the literature indicate that taxa with highly fossorial morphologies specialize on buried prey. Sympholis is at least a

part-time commensal of leaf-cutting ants that feeds on beetle larvae; Chilomeniscus is a soil burrower that feeds on burrowing roaches and vermiform beetle larvae, whereas other members of the Ficimia and Sonora clades feed on various combinations of

arachnids, orthopterans, and beetle larvae. Geagras redimitus, presumably a detritus

burrower, feeds on vermiform beetle larvae, whereas Scolecophis and most Tantilla feed on centipedes. At least three other Tantilla species, including T. gracilis, T. relicta, and T.

vermiformis, show parallel trends towards miniaturization, fossorial morphology, and

diet of insect larvae. With a maximum known length of 171mm, T. vermiformis may be the smallest snale species outside of the Typhlopoidea.

186

Introduction

Snakes are found on every continent except Antarctica, and inhabit forests, grasslands, deserts, and oceans. Despite their superficially simple body plan, they exhibit remarkable variation in body form associated with locomotion in different habitats, prey capture and handling, defense, and reproduction (Gans 1974, Savitzky 1983, Greene

1997). Although much research has focused on ecology, behavior, functional morphology, and taxonomy, there have been relatively few major investigations into the process of evolutionary diversification of snakes as a whole or of a particular group of snakes (Seigel et al. 1987, Seigel and Collins 1993).

Examination of morphological, ecological, and biogeographic data in light of the phylogenetic relationships among organisms can expand our understanding of evolutionary processes. Contemporary phylogenetic methods provide the means to both resolve relationships among organisms and to test hypotheses about evolutionary diversification (Harvey and Pagel 1991, Maddison and Maddison 1992). Specific questions may include: What was the ancestral configuration for a group of related organisms? How many times did a specific trait evolve? How are changes among traits correlated with each other or with changes in the environment?

Studies of snake diversification should seek to identify the morphological, ecological, and behavioral shifts associated with the origin and radiation of lineages.

Ecological diversification and geographic distribution should be examined in light of opportunities and constraints created by evolutionary innovations and changing landscapes (Greene 1992, Cadle and Greene 1993). For some lineages (e.g., xenodontines 187

and lampropeltinines), variation in body size, morphology, diet, habitat and distribution is beginning to be understood in the context of phylogeny and biogeographic history

(Cadle and Greene 1993, Rodriguez-Robles and de Jesus-Escobar 1999).

The Sonorini is a tribe of cryptozoic and fossorial snakes in the subfamily

Colubrinae. Currently recognized genera in the Sonorini include ground snakes (Sonora), shovelnose snakes (Chionactis), sand snakes (Chilomeniscus), sharpnose snakes

(Stenorrhina), hooknose snakes (Conopsis, Pseudoficimia, Sympholis, Ficimia, and

Gyalopion), and flathead snakes (Scolecophis and Tantilla). The Sonorini exhibit various

morphological and ecological specializations for fossoriality. Some inhabit desert sand dunes and can travel by lateral undulations below the sand surface (i.e., sand swim), and one is a commensal with leaf-cutting ants in tropical forest; all sonorinines appear to feed exclusively on invertebrates.

Here I will use a previous phylogenetic hypothesis to examine general patterns in

the evolution of morphology, diet, and distribution to shed light on the origin and

diversification of the Sonorini. Aspects of reproduction will also be reviewed to provide a

broader ecological context for understanding constraints on the evolution of fossoriality. I

will discuss a scenario for the origin of and diversification of Sonorini based on

phylogenetic, morphological, ecological, geographic, and temporal evidence. Specific

questions include the following: When and where did they originate and why are they

distributed where they are? In what environment(s) did the group evolve? I will also

consider historical contingencies, including major morphological innovations, changing

distributions of favorable environments, and major barriers to dispersal. In particular, I 188

will consider whether the nearest relatives of sonorinines were fossorial, if they preyed on arthropods, and if they were found in the New World.

Methods

Assessment of fossoriality

Many snakes are primarily ground-dwelling, and even more spend at least some time on the ground where they may seek shelter. They utilize various subterranean spaces without much active burrowing or need for morphological adaptations for burrowing.

Cryptozoic species often have a small and slender body that may facilitate the utilization of subterranean spaces. Here I use the term “semi-fossorial” for snakes that clearly engage in some active burrowing and have morphological adaptations for it, but are otherwise very competent at surface activity. On the other hand, truly fossorial snakes are those species that have gone a step further in the loss of competence at surface activity.

The distinction between these categories is arbitrary, and many intermediate forms could be placed in one or the other. My purpose is to make relative comparisons of the degree of fossoriality amoung various lineages of sonorinines.

Highly fossorial or burrowing species exhibit special adaptations for life underground (Pough et al. 1998). Although we may want to identify such species by observing their fossorial habits, morphology is often the only information available to make such a determination. Previous work on highly fossorial snakes indicates common morphological attributes, including small size, smooth scales, a reduced number of head 189

scales, reduced eye diameter, reduced tail length, elongation and attenuation of the snout, and secondary contacts between skull bones (Gans 1974, Savitzky 1983, Cadle and

Greene 1993).

I generated an index of fossoriality by combining some of these traits. I did not use smooth scales, because all sonorinines have them. I also did not use secondary contacts in the skull, because cleared-and-stained or articulated dry skeletons were available for too few of the species. Proper assessment of size requires an adequate sample and age distribution. I used the count of ventrals plus subcaudals as a substitute for size. I standardized each trait according to the formula (mean – min)/(max – min) using species means. I then generated the index by averaging all five standardized traits.

Using this index for comparison, I describe taxa as being highly, moderately, or less fossorial. Whether these taxa are cryptozoic, semifossorial, or truly fossorial will depend on additional justification.

Ecology

I compiled data on diet, reproduction, habitat, activity time, behavior, and predation. The literature provided data on many species, although much of it was anecdotal. Whenever possible, I recorded diet and reproductive data from museum specimens. I obtained most new data from dissection of UAZ specimens.

Diet.--Most specimens with prey contained one food item in the stomach and intestine. Few contained more, usually two or three items. I recorded the direction of prey 190

ingestion, head first or tail first whenever possible, because this behavior may distinguish

Sonorini from other colubrines.

I used all unambiguous literature records stating that one or more specimens contained a specified number or proportion of each kind of prey. I also used ambiguous records as follows. One specimen contained spiders = 2 spiders, and five specimens contained spiders = 5 spiders. The former may really be 2+ because the record used a plural term, and the latter may be 5+. I accept the uncertainty because I know that most specimens have one item, fewer have two, and so on. On the other hand, I did not use the following type of record because it provided no information on prey proportions. Fifty specimens contained spiders, scorpions, centipedes, etc. I did not accept this type of record because I don’t know if there were 1 to 50+ spiders. This was clearly too much uncertainty for estimating proportons of diet components.

I offered a variety of prey items to captive specimens to observe prey capture and handling behavior. I observed the capture and handling of prey by Chilomeniscus cinctus,

Chionactis occipitalis, C. palarostris, Gyalopion quadrangulare, Sonora aemula, S.

semiannulata, and Tantilla gracilis, T. hobartsmithi, T. wilcoxi, and T. yaquia.

Reproduction. —I recorded clutch size and egg dimensions from eggs laid in

captivity and oviducal eggs in specimens. I also estimated clutch sizes from counts of

ovarian follicles > 3mm in length. Follicles > 3mm were reported for Stenorrhina

freminvillei, a large species (Censky and McCoy 1988), and Chionactis occipitalis, a small species (Goldberg 1997). I observed courtship and other behavior in Chilomeniscus 191

cinctus and Tantilla hobartsmithi by placing various combinations of two males and one female in terrariums. Sexual size dimorphism is described as the percent difference for the ratio between larger and small sexes for a given parameter. For example, the average ventral scale count may be 120 for males and 140 for females. Sexual dimorphism is 100

× (140/120 - 1) or 16.7%.

Environment. —To assess the relationship between macroclimate and other species attributes, I used the precipitation intervals of Holdridge (1967). Intervals of mean annual precipitation (MAPPT), in millimeters, are as follows: 1=62.5-125, 2=125-

250, 3=250-500, 4=500-1000, 5=1000-2000, 6=2000-4000, 7=4000-8000, and 8=8000+.

For each species, I estimated the precipitation interval that contained the midpoint of the species, ecological distribution based on published monographic studies, species accounts, and anecdotal information.

Analysis of character evolution

To gain insight into evolutionary diversification, I mapped morphological, ecological, and geographic characters onto the phylogeny (see below). Character descriptions and codes appear in Part Two along with the phylogenetic reconstruction. I used the reconstructions for historical narration, to identify general patterns of evolutionary process, and to examine selected taxa in detail.

192

Phylogenetic hypothesis

In Part One, I revised the taxonomy of sand snakes (Chilomeniscus). In Part Two,

I determined that Geagras and Tantillita are nested within Tantilla and I developed a

working phylogeny for the Sonorini. I sometimes refer to the Tantilla clade as centipede-

eating snakes and the Ficimia and Sonora clades, collectively as arachnid-eating snakes.

The phylogenetic hypothesis is used to map characters and serves as the basis for my

analysis and discussion of phylogenetic biology. In brief, sonorinine taxonomy is

arranged as follows:

Ficimia clade (19 species)

Conopsis (6 species)

Ficimia (7 species)

Gyalopion (2 species)

Pseudoficimia frontalis

Stenorrhina (2 species)

Sympholis lippiens

Sonora clade (10 species)

Chilomeniscus (5 species)

Chionactis (2 species)

Sonora (3 species)

Tantilla clade (58 species)

Scolecophis atrocinctus

Tantilla (57 species; includes former Geagras and Tantillita) 193

Results

Morphology Maximum adult total length among three clades of sonorinine species ranges from

161mm in smaller Tantilla species to 722mm in T. cucullata, 250mm in Chilomeniscus

punctatissimus to 456mm in Sonora semiannulata, and 300mm in Conopsis biserialis to

800mm in Stenorrhina degenhardtii. Maximum length increases with the count of

ventrals plus subcaudals, although species known only from few specimens tend to be

shorter because sometimes adults are not represented among the available specimens.

Species of the Ficimia and Sonora clades tend to be longer for a given scale count than

species of the Tantilla clade.

Specimens of the Ficimia and Sonora clades generally have wider body diameters

(3.596+0.625%SVL, 2.36-4.98, N=90) than specimens of the Tantilla clade

(2.707+0.478%SVL, 1.72-3.97, N=99). An increase in body diameter of 1/3 would

translate to an increase in mass of 78% assuming a cylindrical shape. Such a mass

difference is visible in a comparison of Tantilla hobartsmithi and Chilomeniscus cinctus

(Fig. 1). Within each of the three clades, body diameters range from 1.98% for Tantilla

striata to 3.64% for T. vermiformis, from 2.46% for Sonora michoacanensis to 4.40% for

Chilomeniscus cinctus, and from 2.99% for Sympholis lippiens to 4.33% for Conopsis

nasus.

Specimens of the Ficimia and Sonora clades tend to have wide and deep heads,

whereas specimens of the Tantilla clade tend to have narrower and flatter (less deep) 194

heads (Fig. 2a). Snakes of the Ficimia and Sonora clades also tend to have a longer snout

and shorter parietal region of the head than do snakes of the Tantilla clade (Fig. 2b).

Shape allometry is apparent in some characters. Relative head length decreases

with increasing total length. Relative eye diameter decreases whereas relative snout

length increases with increasing head length (Fig. 3).

Six of the nine largest species of the Tantilla clade have unique color patterns.

These species are Scolecophis atrocinctus, Tantilla moesta, T. petersi, T. semicincta, T.

shawi, and T. supracincta. Only two other species, T. albiceps and T. nigra, have unique

color patterns but they are known only from single specimens. Tantilla albiceps has the

highest scale count of any congener and may prove to be a large species. One of the large

species, T. supracincta, is known to have ontogenetic color variation (Greene pers.

comm.).

Degree of fossoriality, indicated by the index, can be arbitrarily divided into three

categories for the Sonorini, low (G-M), moderate (N-S), and high (T-Z). Highly fossorial

forms appear three times, once in each of the major clades (Fig. 4). These taxa are

Chilomeniscus (5 species), Geagras redimitus, and Sympholis lippiens.

Moderately fossorial taxa appear five or six times in Tantilla, including T.

brevicauda, T. calamarina, T. canula, T. gracilis, T. relicta, and T. vermiformis. I

question the status of T. brevicauda as a moderately fossorial form because, except for its

short tail, it resembles many less fossorial Tantilla species. In terms of the index used, the

sand-swimming genus Chionactis is less fossorial form than Chilomeniscus and more 195

fossorial than Sonora. It is ambiguous whether the Ficimia clade is generally moderately

fossorial with larger taxa, Pseudoficimia and Stenorrhina, reverting back to a less

fossorial form, or if moderately fossorial lineages arose independently in Conopsis and the Ficimia-Gyalopion-Sympholis subclade. There does appear to be a trend of increasing

fossoriality within Ficimia, culminating with F. streckeri. The deeper pattern is for primitive sonorinines to have a low degree of fossoriality.

Savitzky (1983) reported on secondary contacts between bones of the nasal

complex in several fossorial taxa including the Sonorini. These features would

presumably reinforce the nasal complex and permit more force to be employed in

burrowing. Some of these secondary contacts are peculiar to the smallest and most

fossorial forms, such as those between the septomaxilla and prefrontal in Chilomeniscus and between the septomaxilla and both the prefrontal and frontal in Geagras redimitus.

Scolecophis atrocinctus and other Tantilla-clade species except T. calamarina and G.

redimitus have a prefrontal that forms a medially tapering wedge between the frontal and

nasal, whereas Gyalopion and Ficimia have a prefrontal that forms an anteriorly tapering articulation with the nasal.

Among sonorinines, size of the frontal plate and diameter of the body are also

correlated with degree of fossoriality. A large frontal may reduce friction, whereas a wide

body may be necessary to produce forces for active burrowing.

Diet and feeding behavior The diet of sonorinines consists almost entirely of arthropods (Table 1). 196

Gastropods comprise a small percentage of the diet for Tantilla gracilis and T. relicta.

Common types of prey include centipedes, spiders, beetle larvae, burrowing roaches,

scorpions, and orthopterans. Beetle larvae fall into two distinct classes. Beetle grubs are

fat, often C-form, and taken exclusively by larger sonorinines such as Conopsis and

Sympholis, whereas vermiform beetle larvae, are taken exclusively by smaller or more

slender sonorinines, such as Tantilla.

The diets of the two major groups are strikingly different. Whereas Scolecophis and Tantilla take predominantly centipedes and vermiform beetle larvae, the remaining

taxa take arachnids, beetle grubs, burrowing roaches, and orthopterans. Mapping diet on

the phylogeny indicates that specialization on centipedes is primitive for the Tantilla clade, whereas specialization on arachnids is primitive for the Ficimia and Sonora clades.

The slender taxa, Scolecophis and Tantilla, tend to take slender prey, centipedes and

vermiform beetle larvae.

I did not record a single scolapender from any member of the Ficimia and Sonora clades, although three specimens of Chilomeniscus fasciatus contained stouter

centipedes, either scutigeromorph or lithobiomorph. I did observe captive Sonora

semiannulata and Gyalopion quadrangulare eating scolapenders. Scolapendra is also

reported in the diet of S. semiannulata by (Anderson 1965). Nevertheless, scolapenders

probably constitute a negligible part of the diet of this clade. I also recorded feeding by

Chilomeniscus cinctus, Chionactis occipitalis, and S. semiannulata on hatchling

Urosaurus ornatus.

Overall, taxa with fossorial morphologies take a high proportion of buried prey 197

(Fig. 5). Buried prey includes insect larvae and burrowing roaches (Arenivaga). The preference for buried prey was derived independently multiple times (Fig. 6) and generally corresponds with the evolution of a relatively more fossorial morphology (Fig.

4). Taxa without deeply grooved fangs tend not to take scorpions or centipedes. Taxa that prefer insects (e.g., Chilomeniscus, Conopsis, Tantilla gracilis) are often more abundant,

locally, than are those that prefer arachnids or centipedes.

It is unknown if most sonorinines are widely-foraging or sit-and-wait predators. I

recorded tracks of Chilomeniscus and Chionactis on sand dunes indicating that

individuals can travel several tens of meters, from shrub to shrub or other areas where

detritus accumulates, occasionally interrupted by a bout of localized frenzied activity as

if feeding. On the other hand, I observed captive specimens, in terrariums with several

centimeters of sand, to lie beneath the surface with only the snout and eyes protruding.

They would dart out and capture a cricket or other prey if it passed within a few

centimeters. Pursuit on the surface would end abruptly if the prey managed to escape

beyond a few cm or if it stopped moving. Snakes would occasionally corner prey under

surface objects. Chionactis sometimes appeared to corral prey on the surface with the

posterior portion of its body. Buried Chilomeniscus appeared to respond to vibrations of

moving prey.

Although no sonorinines are constrictors, I observed some to occasionally wrap

one to two loops around their prey by grasping it and twisting to one side or the other.

Snakes would sometimes push prey into the ground as if to obtain a better grip. Often 198

when handling difficult prey, such as centipedes, snakes will drag them backwards. I have also observed gartersnakes do this regularly with amphibian prey. All Sonorini appear to grasp their prey at or near the posterior end and almost invariably ingest their prey tail-first. Most prey items in the digestive tracts of preserved specimens were also backwards. This is probably an artifact of pursuit but indicates that sonorinines have lost any fixed behavior of manipulating their prey to ingest it from the anterior, which thamnophiines, lampropeltinines, and other colubrines seem to do almost invariably.

Snakes appeared to ingest prey as soon as a firm grip was achieved. Prey would struggle throughout ingestion, although the intensity of struggling appeared to diminish with time. Average prey handling time was 18.04 minutes for arachnids and centipedes compared to 3.26 minutes for insects.

Reproduction

Mean clutch or brood size (CS) among sonorinine species ranges from 1.0 in several Tantilla species to 29.2 in Pseudoficimia frontalis (Table 2). Fecundity increases with female size where CS = 0.0061SVL + 1.5029, R2=0.090, across all individuals. Both

mean CS and mean female SVL are generally higher for the Ficimia and Sonora clades than for the Tantilla clade. Residual CS averages 0.94 ova higher for the Ficimia and

Sonora clades than for the Tantilla clade (P=0.000117, T=3.853, df=80, N=45+49).

The mean egg width to length ratio is greater for the Ficimia and Sonora clades

(0.345+0.074, 0.21-0.54, N=32) than the Tantilla clade (0.269+0.045, 0.19-0.36, N=20).

This appears to correspond to the greater body width of the former and may explain the 199

greater residual CS.

Oviducal eggs are present and oviposition generally occurs from March to August in the Nearctic (northern Mexico and USA) and from October to April in the Neotropics.

Exceptions include the Nearctic, viviparous species (Conopsis), which exhibit well-

developed embryos from October to April. Possibly, embryos are held overwinter.

Viviparity is only known in the montane genus Conopsis. Several species of

Tantilla are montane but have an unknown reproductive mode except for T. vulcani, which is oviparous. Conopsis species also have a black or very dark peritoneum (Greer

1966). The amount of dark pigment in other taxa varied but was never as much as in

Conopsis. One outgroup species Liochlorophis vernalis also exhibits a dark peritoneum.

Although oviparous, this species is known to retain eggs in the body resulting in incubation periods as short as 4 days (Blanchard 1933).

In most species for which my sample sizes were adequate, females averaged more

ventrals than males, whereas males averaged more subcaudals and greater tail/total length

ratio than females. Average sexual dimorphism involving ventrals, subcaudals, and

tail/total length for five Conopsis species is 20% compared to 9% for 59 other sonorinine

species. Sexual dimorphism in ventral count was absent in Geagras redimitus and

Scolecophis. Chilomeniscus cinctus exhibited sexual dimorphism in the number of

vertebral scale row reductions. Three reductions occurred in 41.7% of male C. cinctus

compared to 22.7% of females. Sexual dichromatism in the form of band count was 200

present in Scolecophis, Sonora aemula, and S. michoacanensis.

Among many snake genera, maximum size is generally exhibited by one sex;

exceptions tend to involve the largest or smallest species in the group (Holm, unpubl.).

Sexual size dimorphism with males larger than females is often associated with male

combat behavior. Among sonorinines, male combat was reported for Sonora

semiannulata by Kroll (1971) and for Chionactis occipitalis by Goode and Schuett

(1994). Females attain larger body size than males in Chilomeniscus, Sympholis, and

Tantilla. I tested various combinations of male and female for two species,

Chilomeniscus cinctus and Tantilla hobartsmithi. Although I observed courtship several

times, there was never any hint of aggression.

Predation and antipredator behavior

Most records of predation on sonorinines are by other predatory snakes (Van

Denburgh 1922, Ruick 1948, Stuart 1948, Klauber 1951, Martin 1958, Funk 1965,

Greene 1984, Seib 1985, Martins and Gordo 1993, Palmer and Braswell 1995, Greene

1997, and Holm unpublished data). This sample is undoubtedly biased because I was

more likely to encounter records of predatory amphibians and reptiles than other

taxonomic groups in the herpetological literature. Nevertheless, there are some records of

bird, arthropod, frog, lizard, and mammal predation on sonorinines (Burt and Hoyle

1934, Zweifel 195x, Telford 1966, Best and Pfaffenberger 1987, Mahrdt and Banta 1996,

Ely 1997, and Holm unpublished data).

Tail breaks may provide some indication of predation. The incidence of tail 201

breaks is greater for Tantilla canula and T. lintoni (5 of 14) compared to T. calamarina and G. redimitus (0 of 36). The relative tail length of undamaged specimens varies

widely in T. taeniata group, suggesting conflicting selection pressures on tail length.

Antipredator adaptations include various morphological and behavioral traits.

Only color pattern could be assessed for all taxa. Among sonorinines, dorsal color

patterns can be divided into three categories for considering antipredator significance

including cryptic, boldly striped, and aposematic. Whereas Sonora aemula, S.

michoacanensis, Chionactis palarostris resemble coral snake mimics, other banded taxa

such as Chilomeniscus, S. semiannulata, and Scolecophis appear to be mimics of noxious

myriopods—e.g., Scolapendra bicolor. The conspicuous black head of many Tantilla species may similarly serve to mimic other myriopods—e.g., Scolapendra heros.

Conopsis species appear to have the most cryptic pattern and this may be related to their live-bearing reproductive mode.

Most Tantilla species have a colored venter, but its significance is unclear. I

observed one captive Tantilla yaquia that ingested prey while elevating its tail in a loose

ball, exposing the red venter. In one instance, it was writhing upside down, exposing its

entire red venter. I did not observe similar behavior in any captive T. hobartsmithi or T.

wilcoxi.

Sonorinines also exhibit a variety of apparent antipredator behaviors, although the

group remains largely unexamined. In the field and in glass terreria, I observed

Chilomeniscus and Chionactis to quickly burrow in sand when I approached. When 202

captured, they also exhibited a closed-mouth strike and lateral tail lash. Chionactis will

also exhibit an exaggerated serpentine locomotion and may elevate the forebody and tail

(Greene 1973). A captive individual of Sympholis lippiens would also elevate the fore

body when harassed. I observed Chionactis occipitalis expand the neck laterally while elevating the forebody. Sonora semiannulata and some Tantilla species will not burrow in

sand but will often flee down a narrow hole.

Among sonorinines, cloacal popping appears to be unique to Gyalopion canum.

Both sexes possess well-developed hemipenes and associated retractor muscles. It’s

unclear if they play a role in the aposematic sound production. A newly captured

Stenorrhina degenhardtii assumed a writhing posture where the backbone appeared to be

kinked every 2cm or so. This snake appeared normal an hour later.

Environment and activity

All genera except for Scolecophis are represented in western Mexico.

Reconstruction of the geographic distributions of species on the phylogeny suggests that this is the ancestral area (Fig. 7).

The ecological distribution of most sonorinine species is centered in the

500-1000mm MAPPT zone, corresponding to tropical very dry forest and subtropical or

lower montane dry forest formations of Holdridge (1967). Reconstruction of humidity

zones mapped on the phylogeny also indicates that this zone is the ancestral condition for

the Sonorini (Fig. 8). Few species (e.g., Chilomeniscus fasciatus and Chionactis

occipitalis) are centered in desert (<250mm MAPPT), and few (e.g., Tantilla equatoriana 203

and T. nigra) are centered in rainforest (>4000mm MAPPT).

It is common, although not universal, for snakes in more humid environments to

be darker, perhaps to facilitate crypsis or thermoregulation. In multilineate forms of

Tantilla there may be an ecomorphological continuum from uniform pale; pale with dark

lines; a combination of light, intermediate, and dark stripes; dark with light lines; and

uniform dark. Similarly, Chilomeniscus cinctus from the more humid southeastern part of

their range have longer black bands than those from the more arid desert regions.

The majority of sonorinine species have been found on the surface or beneath

large surface debris including rocks and logs. It is not uncommon to find aquatic,

terrestrial, and arboreal snakes in similar situations, so being secretive alone says little

about the habits of sonorinines. However, several other microhabitats appear to be

peculiar to the more fossorial taxa, including rotting wood (Geagras redimitus and some

Tantilla), sand (Chilomeniscus and Chionactis), and leaf-cutting ant nests (Sympholis).

Microhabitats common to both fossorial and cryptozoic taxa include cavities beneath

rocks, logs, stumps, leaf litter, and other detritus. There are few records of sonorinines in

non-terrestrial situations such as in water or up in trees or shrubs.

Sonorinines exhibit diurnal, crepuscular, and nocturnal activity. Most of the

preserved specimens I examined appeared to have a slightly elliptical pupil, but I found

this difficult to see in live animals. Many of the species for which some diurnal activity is

known tend to have bolder color patterns. No evidence suggests that any sonorinine

species is obligately diurnal or nocturnal. 204

Although the degree of fossoriality is correlated with habitat aridity (Fig. 9a), this trend would not be significant if Chilomeniscus were eliminated. However, there is a more robust correlation between snout length and habitat aridity (Fig. 9b). Trends within species are not necessarily consistent with trends among species. The number of ventral scales increases as MAPPT decreases within species groups of the Sonora clade (Fig.

10).

Chionactis occipitalis, which is generally restricted to fine soils, does not range south of the Sierra Julio but is replaced by C. palarostris, which is also found on gravelly

soils. The morphology of Chionactis occipitalis, especially specimens from around

Laguna Salada, is slightly more fossorial than that of C. palarostris. It has a smaller eye,

longer snout, and the internasals encroach on the nasals in a manner that approaches the

condition in Chilomeniscus.

Highly fossorial sonorinines

Geagras redimitus

Wilson and Meyer (1981) hypothesized that Geagras was related to the T.

calamarina group. They also observed that, among these species, the degree of

fossoriality increased from T. deppei to T. calamarina and culminated with Geagras. My phylogenetic analysis placed Geagras and T. calamarina together at the end of a

phylogenetic sequence that corresponded with Wilson and Meyer’s (1981) fossorial

morphocline. 205

Unfortunately, little information is available about the natural history of this species. Hartweg and Oliver (1940) described a specimen of Geagras, taken from a dry,

rotten log on Quiengola Mountain, which contained several partially digested Coleoptera

larvae in its digestive tract. A series of Geagras from Oaxaca in January 1940 also

contained numerous vermiform beetle larvae (Tenebrionidae). Tenebrionids are generally

associated with detritus and feed on decaying vegetation (Borror and White 1970).

One specimen of the closely related species T. calamarina was dug up beneath a

forest tree in earth consisting of rotting leaves and bark (Taylor 1936); others were found

beneath rocks (Oliver 1937), and beneath a pile of palm fronds (Peters 1954). Another

specimen of T. calamarina, UAZ 26447, contained a tenebrionid larva. Although not closely related to Geagras, another fossorial species is T. vermiformis. Van Devender and

Cole (1977) reported that 24 T. vermiformis were found in or under rotting logs and one

was under a stone.

Sympholis lippiens Sympholis appears to be most closely related to the hooknosed snakes, Gyalopion

and Ficimia. However, some aspects of morphology (e.g., fused prefrontal-internasal)

and diet of grubs are similar to Conopsis. Whereas Sympholis is oviparous and inhabits

tropical deciduous forest, Conopsis is viviparous and inhabits montane environments.

Ecological and morphological specialization in Sympholis is especially

interesting. Sympholis is apparently a commensal with the leaf-cutting ant Atta

mexicana, and the relationship may have affected morphological evolution of the snake 206

as described below. Unfortunately, direct observations of the snake in the ant colonies are few. Merv Larson dug one out of a chamber in one colony (Schwalbe and Lowe, pers. com.) and I found one shed skin in a colony detritus mound. I showed a road-killed

Sympholis to two farmers near Alamos, Sonora and asked if they knew where to find

them. Both referred to the snakes as “corralillos”, a common term for coral and other

banded snakes, and both said that they were found with “mochomos”, a local term for

Atta mexicana.

Additional indirect evidence includes the presence of Atta as well as Coleoptera

larvae in the digestive tract of Sympholis. The Coleoptera larvae are cetoniines, Cotinus and/or Euphoria (Lawler and Van Devender, 1996). I found these grubs to be abundant in the detritus mounds of all Atta colonies, examined even during the dry season when

searches under rocks, logs, and leaf litter produced no other larvae. Atta in the digestive tracts of Sympholis may be incidental but I found two specimens with many ants each,

suggesting that snakes could occasionally gorge themselves on Atta. A foraging strategy

that periodically exposes the snake to large quantities of small prey might favor a longer

body. Indeed, Sympholis has a higher ventral scale count and is more massive than any

other sonorinine.

Sympholis is unique among sonorinines in its combination of large size and

highly fossorial morphology. Although the fossorial morphology would facilitate penetration of the detritus mounds in search of beetle larvae, it may also help to repel attacks by ants. The tiny eye, rounded snout, and blunt tail could prevent ants from biting the snake. Sympholis have a tough skin that is difficult to puncture with a needle and may 207

protect it from bites or stings by ants. Finally, live Sympholis have an oily skin that may

repel ants, as well as an abundance of lipid reserves that produce unusual blobs in jars of

preserved specimens.

Other squamates known to be associated with ants include Leptotyphlops spp.,

Typhlops spp., and Amphisbaena alba. Watkins et al. (1967) found Leptotyphlops dulcis to follow the pheromone trails of army ants. Leptotyphlops dulcis is associated with ant

and termite colonies; it feeds on ant brood and termites, and its cloacal secretions repel

ants (Watkins et al. 1969). Like Sympholis, Leptotyphlops has a rounded head and blunt

tail. The eye is reduced even further and is vestigial. Curiously, Typhlops means “blind”,

whereas the specific epithet of Sympholis lippiens means “dim sighted”. Unlike

Sympholis, Leptotyphlops is very slender and is probably more dependent on existing

tunnels rather than active burrowing.

Riley et al. (1986) described Amphisbaena alba as a facultative inquiline of nests

of Atta cephalotes in Trinidad. They found specimens in Atta nests and Atta in the

digestive tract, and demonstrated that A. alba can follow Atta pheromones. Although A.

alba feeds primarily on beetle larvae, it will take alate pupae of Atta when available but is

not immune to attacks by workers (Riley et al. 1986). It would be interesting to see if

Sympholis can follow ant pheromone trails like Leptotyphlops dulcis and Amphisbaena

alba.

It is likely that Sympholis not only exploits the abundant prey in the detritus

mounds but also utilizes the stable microclimate and protection in underground chambers

of the ant colony. Snakes, including Zamenis and Naja, and lizards use termite mounds as 208

refuge from flood, drought, and wildfire in savanna forests of Cambodia (Wharton 1966).

Seven species of snakes and one lizard use the fungal chambers of Acromyrmex in

Uruguay as nest sites (Vaz-Ferreira et al. 1970).

Chilomeniscus In terms of increasing degree of fossoriality, there is a morphocline from Sonora,

through Chionactis, culminating with Chilomeniscus. Whereas morphological evidence

suggests that Chilomeniscus and Chionactis are sister taxa, molecular data place

Chionactis and Sonora together (Part Two). If the molecular interpretation were accepted,

then either the morphological similarity between Chilomeniscus and Chionactis would be

the result of convergence, or the condition of Sonora the result of reversal to a less

fossorial condition.

Chilomeniscus and Chionactis share a number of adaptations for burrowing in

sand. A depressed, wedge-shaped snout facilitates burrowing in the fluid-like under sand

environment (Mosauer 1936). Angular ventrals help prevent slippage during locomotion

(Mosauer 1936) and/or facilitate under-sand respiration (Norris and Kavanau 1966). A

countersunk lower jaw as well as mental and nasal valves helps prevent sand from

entering the mouth and nostrils.

Whereas Chionactis occipitalis is generally restricted to desert, Chilomeniscus

cinctus also ranges into coastal scrub, desert grassland, thornscrub, and tropical

deciduous forest. Anecdotal information and my own experience from field studies

indicate that Chionactis engages in much more surface travel than does Chilomeniscus. 209

The ability to travel between habitat patches may be key to the presence of Chionactis in the hyper-arid region at the head of the Gulf of California where mean annual precipitation falls below 50mm. Although Chilomeniscus occupies a wider range of

environments than does Chionactis, it is clearly much more of a specialist in its vertical

distribution.

Chilomeniscus has a much more fossorial morphology than Chionactis, yet both

are sand swimmers. Chilomeniscus is more sedentary and more often buried, whereas

Chionactis engages in much surface travel. The morphology of Chionactis appears to be

an adaptive compromise between two modes of locomotion.

Equally interesting are the patterns of variation within Chilomeniscus. There is a

negative correlation in degree of development of some fossorial traits as if there were

alternative solutions to achieve a minimum degree of fossorial morphology among sand

snakes. In C. cinctus and C. fasciatus, the rostral is greatly expanded posteriorly.

Similarly, in C. savagei, the frontal is greatly expanded anteriorly. These two modifications may be separate solutions to the problem of reducing friction when burrowing in sand. In C. punctatissumus and C. stramineus, the primitive, unmodified

condition predominates, although the two derived conditions appear in very low

frequency (perhaps due to many heterozygous genotypes). Chilomeniscus stramineus

also has a longer tail; this and its primitive arrangement of head scales would make it less

fossorial, but it apparently compensates by having a much smaller eye, longer snout, and

greatly reduced axial scalation. 210

Among C. cinctus, there is some variation between environments. Snakes in the

vast sand dunes of the Central Gulf Coast are mostly unbanded, have a smaller eye, and

have a snout that is longer, wider, and flatter than the entirely banded snakes from

interior thornscrub and tropical deciduous forests. The interior forms also have a shorter

tail and greatly reduced axial scalation.

Different species of Chilomeniscus may show different solutions to the same problem. Here, the functional morphology is convergent even though it is recognizably different. The difference is also an indication of phylogenetic constraint (e.g., barrier to gene flow or different genetic environments).

Individual specimens of Chilomeniscus show wide variation in traits related to a

fossorial morphology. However, there is little variation in the overall degree of

fossoriality. Where individuals show a lower than average degree of fossoriality in some

traits, they apparently compensate with a higher than average degree in other traits.

A more fossorial snake would be smaller, have a smaller eye, and have a longer

snout. Small and presumably younger specimens of Chilomeniscus tend to have a

proportionately larger eye and shorter snout. This may be common for snakes in general.

It is relevant here because in order to evolve a more fossorial form, the development of

body size and eye size would have to be slowed or turned off early, whereas the

development of snout (elongation) would have to be accelerated or turned off later.

211

Discussion

The diversification of snakes is characterized by a series of key morphological innovations. First, fossorial, insectivorous scolecophidians were followed by larger, basal alenthophidians that today mimic noxious invertebrates and prey on elongate vertebrates.

These were, in turn, followed by heavy-bodied macrostomatans that use constriction or venom to subdue large vertebrates, which can then be consumed by virtue of flexible jaws. In some respects, sonorinines have reversed the trend toward larger snakes. They are small, cryptozoic to fossorial, feed on small or elongate invertebrates, have lost some skull flexibility, and some even mimic noxious invertebrates. The opportunity for colubroids to diversify into myriad small forms and reach new adaptive zones may relate to the evolution of venom, removing the need for a large body to subdue prey by constriction.

Phylogenetic context

Sonorinines are nested within the Colubrinae and are endemic to the New World

(see Part 2). The Sonorini appear to be related to various North American colubrids for which basic natural history information is available in the literature (Shaw and Campbell

1974, Ernst 1989). Green snakes (Liochlorophis and Opheodrys) are diurnal, terrestrial to

arboreal insectivores. They are distributed in North America, although an Asian genus

(Entechinus) may be related. The smooth green snake, Liochlorophis vernalis, is a

secretive terrestrial inhabitant of grasslands that superficially resembles Sonora

semiannulata. Leaf-nosed snakes (Phyllorhynchus) are nocturnal, highly fossorial, feed 212

on reptile eggs, and are distributed in western North America. Lyre snakes

(Trimorphodon) are nocturnal, cryptozoic inhabitants of rock crevices, prey on small vertebrates, and are distributed in western North and Central America. Patch-nosed snakes (Salvadora) are diurnal, terrestrial, feed on small vertebrates, and are distributed

in western North America. They also excavate reptile nests and prey on their eggs.

Racers (including Coluber and Masticophis) are diurnal, terrestrial to arboreal, feed on

small vertebrates and occasionally insects, and are distributed throughout North America

with putative relatives in South America and the Old World.

Three scenarios for the origin of sonorinines seem likely, although others are

conceivable. First, the nearest relatives may be insectivores such as some diurnal racers

and green snakes. An insectivorous ancester would suggest a shift in diet followed by a

shift in microhabitat and morphology. Alternatively, the nearest relatives may be lyre and

leaf-nosed snakes, which are nocturnal and cryptozoic to fossorial. In this case there

would have been a shift in morphology and microhabitat followed by a shift in diet. A

third scenario would be the derivation of sonorinines from a racer-like, diurnal

vertebrate-eater. This scenario would require shifts in microhabitat, morphology, and

diet. In order to gain insight into which scenario is more likely, it may be necessary to

produce a phylogeny of most if not all colubrines.

Biogeography

Important events affecting opportunities for dispersal and vicariance for Cenozoic

North America include: a connection with Europe ending in the early Eocene; a 213

connection with Asia ending in the Miocene and resuming in the Pleistocene; and an island arc connection with South America ending in the late Eocene, reappearing briefly in the mid-Miocene, and forming a continuous connection in the Pliocene (Pittmann et al.

1993). As dispersal corridors, these connections were probably on and off in response to fluctuating sea level and terrestrial environments. New World caenophidians apparently arrived from the Old World by dispersal. Despite an intermittent connection between Old and New Worlds, many New World colubroid assemblages are monophyletic, including crotalines, micrurines, xenodontines, thamnophiines, and lampropeltinines. This suggests that either few lineages migrated to the new world or that many died-out in a form of macroevolutionary lineage sorting.

One region where sonorinines are absent is the West Indies. Here, viperids, elapids, colubrines, and natricines are clearly recent arrivals, with only a peripheral distribution. On the other hand, leptotyphlopids, typhlopids, boids, and xenodontines are diverse throughout the Antillies, although considerable controversy remains as to whether West Indian taxa originated by vicariance or dispersal. More importantly, it would seem that xenodontines arrived in the New World prior to other colubrids, including sonorinines (Cadle 1985, Vidal et al. 2000).

Somewhat like sonorinines, a number of xenodontine groups also specialize on invertebrate prey—the goo-eaters of Cadle and Greene (1993). Both sonorinine and xenodontine invertebrate specialists occur mostly in environments that are conducive to the accumulation of detritus. These tend to include warm-dry, cool-wet environments, or 214

seasonally variable environments. Detritus generally does not accumulate in equable, warm-wet environments—i.e., rain forests.

The center of diversity for xenodontines is more southerly in the humid tropics of

Central and South America, compared to the less humid tropics of Mexico for sonorinines. Xenodontine invertebrate specialists are more successful in cool-wet environments, especially the mountains of Central America.

Sonorinines probably radiated during the drying trend of the mid-Cenozoic. They have been more successful than xenodontines at exploiting the drier and more seasonal environments and associated arthropod prey. The sonorinine center of diversity lies in western Mexico.

Six genera, represented by Chilomeniscus cinctus, Gyalopion quadrangulare,

Pseudoficimia frontalis, Sonora aemula, Sympholis lippiens, and Tantilla yaquia, occur together near Alamos, Sonora, Mexico. Syntopic assemblages of sonorinines could provide for some interesting research. Whereas syntopy exists between Chilomeniscus,

Chionactis or Sonora, there are no instances of syntopy involving any two congeric

species of these three genera. Coexistence may be precluded in part by competition for

key resources and by incomplete reproductive isolating mechanisms.

Slenderization and miniaturization Scolecophis and Tantilla generally have more slender bodies than other

sonorinines. Slender form may be associated with loss of the left oviduct in Tantilla,

relatively slender eggs and relatively smaller clutches, and their diet of long, slender 215

prey.

Loss of the left oviduct is seen in some scolecophidians including Leptotyphlops,

Typhlops, and some Anomalepididae, but not in any other colubrid. Loss is associated

with reduced function of the left ovary in some but not all species (Marques and Puorto

1998). The slender body form may constrain clutch size if eggs are longer to compensate

for reduced diameter, thus reducing the number that can fit, single file, in a given length.

Increasing body length just to accommodate more eggs would also increase the relative

clutch mass, and this may be constrained by energy allocation. Some species of the

Tantilla clade, including Scolecophis atrocinctus and Geagras redimitus, do not exhibit

the usual pattern of sexual dimorphism involving ventrals, subcaudals, and relative tail

length. This may be indicative of conflicting demands on space or energy allocation.

An energetic constraint on small size or slender form may favor modification of

the tail for energy storage. Tantilla species in general have relatively longer tails than

other sonorinines. Those with the shortest tails are more fossorial and feed at a lower

trophic level where prey may be more abundant and reliable. Enulius flavitorques

(spelling), a small xenodontine that feeds on reptile eggs, has a relatively long tail (28-

30% of total). Leptotyphlops humilis, which feeds on colonial insects, has a relatively short tail (3-5% of total).

A diet including long, slender-bodied prey is certainly not unique to the Tantilla

clade or even to narrow-bodied snakes. Pit vipers occasionally eat large centipedes

(Greene 1992) and many snakes prey on other snakes (ophiophagous), including some

constrictors, which are generally heavy-bodied. However, many ophiophagous taxa are 216

slender-bodied including Micrurus and Stilosoma. Other slender snakes, such as

Leptotyphlops and Enulius, feed on small colonial insects and reptile eggs, which may

not be particularly slender but are abundant in one location. A long and slender body can

accommodate few, long and slender prey or many small prey. Thus, we see a similar

morphological solution for two widely divergent prey categories.

For locomotion in subterranean microhabitats, the advantage of a slender body as

opposed to a stout one, is less obvious. Slender snakes would have access to narrow

spaces that they may not have sufficient strength to enlarge.

To be slender in an absolute sense, a snake must not only be proportionally

slender but it must also be small. Generally, fossors are proportionally stouter than

cryptozoic snakes—e.g., Geagras redimitus is stouter than Scolecophis atrocinctus.

However, G. redimitus is so much smaller that it is also much more slender in actual

diameter. Loss of the left oviduct may be associated more with miniaturization than with

proportional slenderization. Some Tantilla species are perhaps the smallest snakes

known--.e.g., T. vermiformis has a maximum known length of 170mm out of a sample of

30 specimens. Four other species, T. brevicauda, Tantillita. brevissima, T. canula, and T.

lintoni, have maximum total lengths from 161 to 200mm.

Tantilla species may be the smallest alenthophidians. Only some some

scolecophidians are as small as the smallest Tantilla species. Evolution of small size should favor simplification and loss of body parts. Loss of structures would then permit further reductions in size although increases would also be possible.

217

Fossoriality There are several traits that I would expect to evolve in a fossorial ancestor (e.g., secondary contacts in the skull), while others I would expect to evolve in either a small or fossorial ancestor (e.g., loss of left oviduct). One trait, the modified septomaxilla, characterizes all sonorinines and some others appear deep in the phylogeny. This may suggest that ancestral sonorinines were fossorial. However, the traits I used as indicators of fossoriality suggest that moderately to highly fossorial forms are derived independently among several groups of sonorinines and that ancestral sonorinines were not particularly fossorial. It is possible, although not the most parsimonious explanation, that early sonorinines went through several fossorial revolutions, followed by reversal of superficial traits and perhaps this iterative evolution has helped to perfect the more successful groups.

Sonorinines occupy many points along a continuum from cryptozoic to fossorial.

In some cases a more fossorial species appears at the end of a morphocline that is approximately matched by a phyletic sequence (e.g., Ficimia streckeri, Tantilla gracilis,

Geagras redimitus). In other cases the fossorial taxon does not appear at the end of any

obvious trend (e.g., Sympholis lippiens and T. vermiformis). Indeed, the persistence of

intermediate forms may only indicate that the trend is relatively recent.

It may be possible to associate the two ecomorphological groups (i.e., cryptozoic

and fossorial) of sonorinines with different soil strata. Whereas the gracile cryptozoic

forms appear to be adapted for life in leaf litter and other coarse grained detritus, the

fusiform fossorial taxa are relatively more at home in deeper layers including the 218

fermentation layer, humus, and mineral soil. Rotting logs and stumps may be considered as aboveground extensions of the fossorial realm. Conversely, dens, hibernacula, crevices, and animal burrows may represent belowground extensions of the cryptozoic realm. Rodent burrows may have played an important role in the success of snakes and other commensal animals in regions with seasonally harsh climates.

It remains unclear whether the evolution of fossoriality is driven by the spatial distribution of prey and intraspecific competition or by the need for refuge from predators or extreme climate. Sonorinines represent one or two radiations that have produced numerous species as well as some ecological and morphological diversity. However, the more fossorial forms are not numerically diverse despite multiple origins. Indeed, the three most fossorial taxa appear to be habitat specialists.

Acknowledgements

I thank the many people who helped make this project possible and enjoyable.

Among those assisting with specimen loans and museum visits were Kent Beaman,

George Bradley, Carla Cicero, Mike Douglas, Linda Ford, Darrel Frost, Steve Gotte, Lee

Grismer, Michelle Koo, Charles Lowe, Roy McDiarmid, Robert McCord, Brad Moon,

Charlie Painter, Philip Rosen, Greg Schneider, Sally Shelton, John Simmons, Barbara

Stein, Thomas Van Devender, and Wayne Van Devender. I thank Judie Bronstein,

Wayne Maddison, and Cecil Schwalbe for their comments on the manuscript.

219

Literature Cited

Aldridge, R. D., and R. D. Semlitsch. 1992. Female reproductive biology of the southeastern crowned snake (Tantilla coronata). Amph.-Rept. 13:209-218.

Alvarez del Toro, M. 1982. Los reptiles de Chiapas. 3d ed. Tuxtla Gutierrez, Mexico, 248 pp.

Anderson, P. 1965. The reptiles of Missouri. Univ. Missouri Press, Columbia, 330 pp.

Banks, R. C., and W. M. Farmer. 1962. Observations of reptiles on Cerralvo Island, Baja California, Mexico. Herpetologica 18(4):246-250.

Best, T. L., and G. S. Pfaffenberger. 1987. Age and sexual variation in the diet of collared lizards Crotaphytus collaris. Southwest. Nat. 32:415-426.

Blanchard, F. N. 1933. Eggs and young of the smooth green snake, Liopeltis vernalis (Harlan). Pap. Michigan Acad. Sci., Arst and Lett. 17:493-508.

Bogert, C. M., and J. A. Oliver. 1945. A preliminary analysis of the herpetofauna of Sonora. Bull. Amer. Mus. Nat. Hist. 83:297-425.

Borror, D. J., and R. E. White. 1970. A field guide to the insects of America north of Mexico. Houghton Mifflin Co., Boston.

Burt, C. E., and W. L. Hoyle. 1934. Additional records of the reptiles of the central prairie region of the United States. Trans. Kansas Acad. Sci. 37:193-216.

Cadle, J. E. 1985. The Neotropical colubrid snake fauna: Lineage components and biogeography. Syst. Zoll. 34:1-20.

Cadle, J. E., and H. W. Greene. 1993. Phylogenetic patterns, biogeography, and the composition of Neotropical snake assemblages. Pp. 281-293 in Ricklefs, R. E., and D. Schluter (eds.) Species diversity in ecological communities: historical and geographic perspectives. Univ. Chicago Press, Chicago.

Campbell, J. A. 1998. Comments on the identities of certain Tantilla (Squamata: Colubridae) from Guatemala, with the description of two new species. Sci. Pap. Nat. His. Mus. Univ. Kansas. 7:1-14.

Campbell, J. A., J. L. Camarillo, and P. C. Ustach. 1995. Redescription and rediagnosis of Tantilla shawi (Serpentes: Colubridae) from the Sierra Madre Oriental of Mexico. Southwest. Nat. 40:120-123. 220

Carpenter, C. C. 1958. Reproduction, young, eggs and food of Oklahoma snakes. Herpetologica 14(2):113-115.

Censky, E. J., and C. J. McCoy. 1988. Female reproductive cycles of five species of snakes (Reptilia: Colubridae) from the Yucatan Peninsula, Mexico. Biotropica 20(4):326-333.

Clark, D. R., Jr., 1970. Loss of the left oviduct in the colubrid snake genus Tantilla. Herpetologica 26(1):130-133.

Cobb, V. A. 1989. The foraging ecology and prey relationships of the flathead snake, Tantilla gracilis. MS Thesis. Univ. Texas, Tyler.

Cobb, V. A. 1990. Reproductive notes on the eggs and offspring of Tantilla gracilis, (Serpentes: Colubridae) with evidence of communal nesting. Southwest. Nat. 35:222-224.

Cook, F. A. 1954. Snakes of Mississippi. Surv. Bull. Mississippi Game and Fish. Comm. Jackson.

Duellman, W. E. 1963. Amphibians and reptiles of the rainforests of southern El Petén, Guatemala. Univ. Kansas Pub. Mus. Nat. Hist. 15:205-249.

Easterla, D. A. 1975. Reproductive and ecological observations of Tantilla rubra cucullata from Big Bend National Park, Texas (Serpentes: Colubridae). Herpetologica. 31:234-236.

Echternacht, A. C. 1973. The color pattern of Sonora michoacanensis (Dugès) (Serpentes, Colubridae) and its bearing on the origin of the species. Brevioria 410:1-18.

Edgar, B. 1990. Chance encounter with a mimic. Pacific Disc. 43:45.

Ely, E. 1997. Tantilla planiceps (California black-headed snake). Predation. Herpetol. Rev. 28:154-155.

Ernst, C. H. 1989. Snakes of eastern North America. George Mason Univ. Press. Fairfax, VA.

Etheridge, R. 1961. Additions to the herpetological fauna of Isla Cerralvo in the Gulf of California, Mexico. Herpetologica. 17:57-60.

Fisher, C. B. 1973. Status of the flat-headed snake, Tantilla gracilis Baird and Giriard, in 221

Louisiana. J. Herpetol. 7:136-137.

Force, E. R. 1930. The amphibians and reptiles of Tulsa County, Oklahoma. Copeia 1930(2):25-39.

Force, E. R. 1935. A local study of the opisthoglyph snake, Tantilla gracillis Baird and Girard. Pap. Michigan Acad. Sci., Arts and Let. 20:645-659.

Funk, R. S. 1965. Food of Crotalus cerastes laterorepens in Yuma County, Arizona. Herpetologica. 21:15-17.

Funk, R. S. 1967. A new colubrid snake of the genus Chionactis from Arizona. Southwestern Nat. 12:180-188.

Gans, C. 1974. Biomechanics: An approach to vertebrate biology. Lippincott. Philadelphia.

Glass, J. K. 1972. Feeding behavior of the western shovel-nosed snake, Chionactis occipitalis klauberi, with special reference to scorpions. Southwestern Nat. 16(3- 4):445-447.

Goldberg, S. R. 1995. Reproduction in the banded sand snake, Chilomeniscus cinctus (Colubridae), from Arizona. Great Basin Nat. 55:372-373.

Goldberg, S. R. 1997. Reproduction in the western shovelnose snake, Chionactis occipitalis (Colubridae), from California. Great Basin. Nat. 57:85-87.

Goldberg, S. R., and P. C. Rosen. 1999. Reproduction in the Sonoran shovelnose snake (Chionactis palarostris) and the western shovelnose snake (Chionactis occipitalis) (Serpentes: Colubridae). Texas J. Sci. 51:153-158.

Goode, M. J., and G. W. Schuett. 1994. Male combat in the western shovelnose snake (Chionactis occipitalis). Herpet. Nat. Hist. 2(1):115-117.

Greene, H. W. 1983. Dietary correlates of the origin and radiation of snakes. Amer. Zool. 23:431-441.

Greene, H. W. 1984. Feeding behavior and diet of the eastern coral snake, Micrurus fulvius. Univ. Kansas Mus. Nat. His. Spec. Pub. 10:147-162.

Greene, H. W. 1992. The ecological and behavioral context for pitviper evolution. Pp. 107-117 in Campbell, J. A., and E. D. Brodie Jr. (eds.) Biology of pitvipers. Selva Nat. Hist. Book Pub. Tyler, TX.

222

Greene, H. W. 1997. Snakes: the evolution of mystery in nature. University of California Press. Berkeley. 351 pp.

Greer, A. E. 1966. Viviparity and oviparity in the snake genera Conopsis, Toluca, Gyalopion, and Ficimia with comments on Tomodon and Helicops. Copeia 1966:371-373.

Hardy, L. M. 1972. A systematic revision of the genus Pseudoficimia (Serpentes: Colubridae). J. Herp. 6(1):53-69.

Hardy, L. M. 1975. Comparative morphology and evolutionary relationships of the colubrid snake genera Pseudoficimia, Ficimia, and Gyalopion. J. Herp. 9(4):323-336.

Hartweg, N, and J. A. Oliver. 1940. A contribution to the herpetology of the Isthmus of Tehuantepec. IV. Misc. Pub. Mus. Zool. Univ. Michigan No. 47.

Harvey, P. H., and M. D. Pagel. 1991. The comparative method in evolutionary biology. Oxford University Press.

Hernández-Ibarra, X., A. Ramírez-Bautista, and R. Torres-Cervantes. 2000. Ficimia hardyi (hooknose snake). Reproduction. Herpetol. Rev. 31:178.

Holdridge, L. R. 1967. Life zone ecology, 2nd edition. Trop. Sci. Center. San Jose, Costa Rica.

Kassing, E. F. 1961. A life history study of the Great Plains ground snake, Sonora episcopa episcopa (Kennicott). Texas J. Sci. 13:185-203.

Klauber, L. M. 1951. The shovel-nosed snakes, Chionactis, with descriptions of two new subspecies. Trans. San Diego Soc. Nat. Hist. 11(9):141-204.

Kroll, J. C. 1971. Combat behavior in male Great Plains ground snakes. Texas J. Sci. 33(2):306.

Lawler, H. E., and T. R. Van Devender. 1996. Sympholis lippiens (banded burrowing snake): Diet. Herpetol. Rev. 27:205.

Licht, P., and F. R. Gehlbach. 1961. Ficimia cana and Tropidodipsas fascata (Reptilia: Serpentes) in San Luis Potosi, Mexico. Southwestern Nat. 6:3-4.

Maddison, W. P., and D. R. Maddison. 1992. MacClade: Analysis of phylogeny and character evolution, version 3. Sinauer Associates. Sunderland, Mass.

223

Mardt, C. R., and B. B. Banta. 1996. Chionactis occipitalis annulata (Colorado Desert shovelnose snake). Predation and diurnal activity. Herpetol. Rev. 27:81.

Marques, O. A. V., and G. Puorto. 1998. Feeding, reproduction and growth in the crowned snake Tantilla melanocephala (Colubridae), from southeastern Brazil. Amphibia- Reptilia 19:311-318.

Martin, P. S. 1958. A biogeography of reptiles and amphibians in the Gomez Farias Region, Tamaulipas, Mexico. Misc. Pub. Mus. Zoll. Univ. Mich. 101:1-102.

Martins, M., and M. Gordo. 1993. Bothrops atrox (common lancehead): Diet. Herpetol. Rev. 24:151-152.

McDiarmid, R. W., J. F. Copp, and D. E. Breedlove. 1976. Notes on the herpetofauna of western Mexico: new records from Sinaloa and the Tres Marias Islands. Cntrib. Sci., Nat. Hist. Mus. Los Angeles Co., 275:1-17.

Minton, S. A. 1959. Observations on amphibians and reptiles of the Big Bend region of Texas. Southwest. Nat. 3:28-54.

Mosauer, W. 1932. Adaptive convergence in the sand reptiles of the Sahara and of California: a study in structure and behavior. Copeia 1932:72-78.

Mosauer, W. 1933. Locomotion and diurnal range of Sonora occipitalis, Crotalus cerastes, and Crotalus atrox, as seen from their tracks. Copeia 1933:14-16.

Mushinsky, H. R., and B. W. Witz. 1993. Notes on the peninsula crowned snake Tantilla relicta, in periodically burned habitat. J. Herpetol. 27:468-470.

Neill, W. T. 1951. Notes on the natural history of certain North American snakes. Pub. Res. Div. Ross Allen’s Rept. Inst. 1:47-60.

Neill, W. T., and J. M. Boyles. 1957. The eggs of the crowned snake, Tantilla coronata. Herpetologica 13:77-78.

Norris, K. S., and J. L. Kavanau. 1966. The burrowing of the western shovel-nosed snake, Chionactis occipitalis Hallowell, and the undersand environment. Copeia 1966(4):650-664.

Oliver, J. A. 1937. Notes on a collection of amphibians and reptiles from the State of Colima, México. Occ. Pap. Mus. Zool. Univ. Mich. 360:1-28.

Palmer, W. M., and A. L. Braswell. 1995. Reptiles of North Carolina. Univ. North Carolina 224

Press, Chapel Hill. 412 pp.

Perez-Higareda, G., H. M. Smith, and R. B. Smith. 1985. A new species of Tantilla from Veracruz, Mexico. J. Herp. 19:290-292.

Peters, J. A. 1954. The amphibians and reptiles of the coast and coastal sierra of Michoacan, Mexico. Occ. Pap. Mus. Zool. Univ. Michigan 554:1-37.

Pittmann III, W. C., S. Cande, J. LaBrecque, and J. Pindell. 1993. Fragmentation of Gondwana: The separation of Africa from South America. In Goldblatt, P. (ed.) Biological relationships between Africa and South America. Yale University Press. New Haven, Connecticut.

Pough, F. H., R. M. Andrews, J. E. Cadle, M. L. Crump, A. H. Savitzky, and K. D. Wells. 1998. Herpetology. Prentice Hall. Upper Saddle River, New Jersey. 577 pp.

Ramirez-Bautista, A., G. Gutiérrez-Mayen, and A. Gonzales-Romero. 1995. Clutch sizes in a community of snakes from the mountains of the Valley of Mexico. Herpetol. Rev. 26:12-13.

Riley, J., J. M. Winch, A. F. Stimson, and R. D. Pope. 1986. The association of Amphisbaena alba (Reptilia: Amphisbaenia) with the leaf-cutting ant Atta cephalotes in Trinidad. J. Nat. Hist. London. 20:459-470.

Ruick, J. D. 1948. Collecting coral snakes, Micrurus fulvius tenere in Texas. Herpetologica. 4:215-216.

Savitzky, A. H. 1983. Coadapted character complexes among snakes: Fossoriality, piscivory, and durophagy. Amer. Zool. 23:397-409.

Seib, R. L. 1985. Feeding ecology and organization of Neotropical snake faunas. PhD. Dissertation. Berkeley.

Seigel, R. A., and J. T. Collins (eds.). 1993. Snakes: Ecology and behavior. McGraw Hill. New York.

Seigel, R. A., J. T. Collins, and S. S. Novak (eds.). 1987. Snakes: Ecology and evolutionary biology. MacMillan Co. New York. 225

Sexton, O. J., and H. Heatwole. 1965. Life history notes on some Panamanian snakes. Carib. J. Sci. 5:39-43.

Shaw, C. E., and S. Campbell. 1974. Snakes of the American West. A. A. Knopf. New York.

Smith, C. R. 1982. Food resource partitioning in fossorial reptiles. Pp. 173-178 in N. J. Scott, Jr. (ed.) Herpetological communities. U. S. Fish and Wild. Serv. Wild. Res. Rep. 13.

Stebbins, R. C. 1954. Amphibians and reptiles of western North America. McGraw-Hill. New York.

Stuart, L. C. 1935. A contribution to a knowledge of the herpetology of a portion of the Savanna Region of central Petén, Guatemala. Misc. Pub. Mus. Zool. Univ. Mich. 29:1-56.

Stuart, L. C. 1948. The amphibians and reptiles of Alta Verapaz Guatemala. Misc. Pub. Mus. Zoll. Univ. Mich. 69:1-109.

Taylor, E. H. 1936. Notes and comments on certain American and Mexican snakes of the genus Tantilla, with descriptions of new species. Trans. Kansas Acad. Sci. 39:335- 348.

Telford, S. R. 1966. Variation among the southeastern crowned snakes, genus Tantilla. Bull. Florida State Mus. 10:261-304.

Van Denburgh, J. 1922. The reptiles of western North America. Vol. II. Snakes and turtles. Occas. Pap. Calif. Acad. Sci. 10:615-1028.

Van Devender, R. W., and C. J. Cole. 1977. Notes on a colubrid snake, Tantilla vermiformis, from Central America. Amer. Mus. Nov. 2625:1-12.

Vaz-Ferreira, R., L. Covelo de Zolessi, and F. Achaval. 1970. Oviposicion y desarrollo de ofidios y lacertilios en hormigueros de Acromyrmex. Physis 29:431-459.

Vidal, N., G. K. Shannon, A. Wong, and S. B. Hedges. 2000. Phylogenetic relationships of xenodontine snakes inferred from 12S and 16S ribosomal RNA sequences. Mol. Phyl. And Evol. 14:389-402.

Vorhies, C. T. 1926. Notes on some uncommon snakes of southern Arizona. Copeia 1926:158-160. 226

Watkins, J. F., II, Gehlbach, F. R., and R. S. Badridge. 1967. Ability of the blind snake, Leptotyphlops dulcis, to follow pheromone trails of army ants. Southwestern Nat. 12(4):455-462.

Watkins, J. F., II, Gehlbach, F. R., and J. C. Kroll. 1969. Attractant-repellent secretions of blind snakes (Leptotyphlops dulcis) and their army ant prey (Neivamyrmex nigrescens). Ecology 50(6):1098-1102.

Webb, R. G. 1970. Reptiles of Oklahoma. Univ. Oklahoma Press, Norman. 370 pp.

Wharton, C. H. 1966. Man, Fire and wild cattle in north Cambodia. Proc. Tall Timbers Fire Ecol. Conf. 5:23-65.

Wilson, L. D. 1976. Variation in the South American colubrid snake Tantilla semicincta (Dumeril, Bibron, and Dumeril), with comments on pattern dimorphism. Bull. So. Calif. Acad. Sci. 75:42-48.

Wilson, L. D., and J. R. Meyer. 1981. Systematics of the calamarina group of the colubrid snake genus Tantilla. Milwaukee Pub. Mus. Contrib. Biol. Geol., 42:1-25.

Wright, A. H., and A. A. Wright. 1957. Handbook of snakes of the United States and Canada. 2 vols. Comstock. Ithaca, New York.

Zweifel, R. G., and K. S. Norris. 1955. Contribution to the herpetology of Sonora, Mexico: descriptions of new subspecies of snakes (Micruroides euryxanthus and Lampropeltis getulus) and miscellaneous collecting notes. Amer. Mid. Nat. 54:230- 249.

227

Tables, Figures, and Appendices

228

Table 1. Diet of sonorinine species. Number of items per class above and percent below. a

Species spiders and and spiders solpugids scorpions centipedes larvae beetle insect other larvae burrowing roaches orthopterans other invertebrates prey total Source

Chilomeniscus cinctus 100992200411, 22 2.4 0.0 0.0 22.0 22.0 53.7 0.0 0.0 6 0 31502100 454, 22 Chilomeniscus fasciatus 13.3 0.0 6.7 33.3 0.0 46.7 0.0 0.0 00010000 1 22 Chilomeniscus punctatissimus 0.0 0.0 0.0 100.0 0.0 0.0 0.0 0.0 02020000 4 7, 9 Chilomeniscus savagei 0.0 50.0 0.0 50.0 0.0 0.0 0.0 0.0 00010100 2 22 Chilomeniscus stramineus 0.0 0.0 0.0 50.0 0.0 50.0 0.0 0.0 34002820194, 22 Chionactis occipitalis 15.8 21.1 0.0 0.0 10.5 42.1 10.5 0.0 920205101922 Chionactis palarostris 47.4 10.5 0.0 10.5 0.0 26.3 5.3 0.0 74021030173, 22 Sonora aemula 41.2 23.5 0.0 11.8 5.9 0.0 17.6 0.0 01000000 1 22 Sonora michoacanensis 0.0 100.0 0.0 0.0 0.0 0.0 0.0 0.0 1130300842922 Sonora semiannulata 37.9 10.3 0.0 10.3 0.0 0.0 27.6 13.8 10021010 5 22 Conopsis lineata 20.0 0.0 0.0 40.0 20.0 0.0 20.0 0.0 229

Table 1, continued. Diet of sonorinine species. Number of items per class above and percent below. a

Species spidersand solpugids scorpions cen tiped es larvae beetle insect other larvae burrowing roaches orthopterans other invertebrates prey total Source 310700301422 Conopsis nasus 21.4 7.1 0.0 50.0 0.0 0.0 21.4 0.0

Ficimia publia 10010020 4 22 25.0 0.0 0.0 25.0 0.0 0.0 50.0 0.0 00000010 1 22 Ficimia streckeri 0.0 0.0 0.0 0.0 0.0 0.0 100.0 0.0 Gyalopion canum 111000010133, 8, 22 84.6 7.7 0.0 0.0 0.0 0.0 7.7 0.0 120010010143, 22 Gyalopion quadrangulare 85.7 0.0 0.0 7.1 0.0 0.0 7.1 0.0 Pseudoficimia frontalis 43022011133, 22 30.8 23.1 0.0 15.4 15.4 0.0 7.7 7.7 2 0 0 0 0 0 1 1 4 10, 11, 22 Stenorrhina degenhardti 50.0 0.0 0.0 0.0 0.0 0.0 25.0 25.0 31020020 8 22 Stenorrhina freminvillei 37.5 12.5 0.0 25.0 0.0 0.0 25.0 0.0 0 0 01200 0 0 1219, 22 Sympholis lippiens 0.0 0.0 0.0 100.0 0.0 0.0 0.0 0.0 00300000 317, 22 Scolecophis atrocinctus 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 Tantilla bocourti 00110000 2 22 0.0 0.0 50.0 50.0 0.0 0.0 0.0 0.0 230

Table 1, continued. Diet of sonorinine species. Number of items per class above and percent below. a

Species spiders and solpugids scorpions centipedes beetle larvae insect other larvae burrowing roaches orthopterans other invertebrates prey total Source

Tantilla calamarina 00010000 1 22 0.0 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0033700024218, 22 Tantilla coronata 0.0 0.0 78.6 16.7 0.0 0.0 0.0 4.8 Tantilla cucullata 00200000 2 22 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 00100000 1 22 Tantilla cuniculator 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 00100000 1 22 Tantilla flavilineata 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 Tantilla gracilis 0 0 17 137 1 0 0 11 166 5, 16 0.0 0.0 10.2 82.5 0.6 0.0 0.0 6.6 00182000116, 22 Tantilla hobartsmithi 0.0 0.0 9.1 72.7 18.2 0.0 0.0 0.0 Tantilla impensa 00100000 1 20 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 008020001015, 22 Tantilla jani 0.0 0.0 80.0 0.0 20.0 0.0 0.0 0.0

Tantilla melanocephala 0 0 127 0 0 0 0 4 131 21, 22 0.0 0.0 96.9 0.0 0.0 0.0 0.0 3.1 10420000 7 4, 22 Tantilla nigriceps 14.3 0.0 57.1 28.6 0.0 0.0 0.0 0.0 231

Table 1, continued. Diet of sonorinine species. Number of items per class above and percent below. a

Species spiders and solpugids scorpions centipedes beetle larvae insect other larvae burrowing roaches orthopterans other invertebrates prey total Source 00100000 1 4 Tantilla planiceps 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 0 0 01800 0 0 182, 22 Tantilla redimita 0.0 0.0 0.0 100.0 0.0 0.0 0.0 0.0 na na na na na na na na na 14 Tantilla relicta 0.0 0.0 0.0 89.6 0.0 0.0 0.0 10.4 00210000 315, 22 Tantilla schistosa 0.0 0.0 66.7 33.3 0.0 0.0 0.0 0.0 00200000 2 22 Tantilla supracincta 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 00600000 615, 22 Tantilla tayrae 0.0 0.0 100.0 0.0 0.0 0.0 0.0 0.0 00023000 5 13 Tantilla vermiformis 0.0 0.0 0.0 40.0 60.0 0.0 0.0 0.0

Tantilla wilcoxi 00410000 5 22 0.0 0.0 80.0 20.0 0.0 0.0 0.0 0.0 10240001 8 22 Tantilla yaquia 12.5 0.0 25.0 50.0 0.0 0.0 0.0 12.5 1=Vorhies, 1926; 2=Hartweg and Oliver, 1940; 3=Bogert and Oliver, 1945; 4=Stebbins, 1954; 5=Carpenter, 1958; 6=Minton, 1959; 7=Etheridge, 1961; 8=Licht and Gehlbach, 1961; 9=Banks and Farmer, 1962; 10=Duellman, 1963; 11=Sexton and Heatwole, 1965; 12=Webb, 1970; 13=Van Devender and Cole, 1977; 14=Smith, 1982; 15=Seib, 1985; 16=Cobb, 1989; 17=Edgar, 1990; 18=Palmer and Braswell, 1995; 19=Lawler and Van Devender, 1996; 20=Campbell, 1998; 21=Marques and Puorto, 1998; 22=P. A. Holm, unpublished data. 232

Table 2. Summary of reproductive data for sonorinie species. Female SVL Clutch or Brood Size Season Species Meana Range N Meana Range N Gravidb Sourcec Chilomeniscus cinctus 209.0 188-255 4 3.0 2-4 6 May-Jul 6, 27, 34 Chilomeniscus fasciatus 227.0 216-237 5 3.0 2-4 6 May-Jul 6, 34 Chionactis occipitalis 276.8 247-302 6 3.1 2-6 12 Mar-Jun 3, 16, 30, 33, 34 Chionactis palarostris 240.0 248-309 4 4.2 4-5 5 3, 33 Conopsis biserialis 196.0 183-205 4 4.5 2-8 4 Jul-Sep 28 Conopsis lineata 3.2 2-5 6 Jan 15 Conopsis nasus 225.0 200-238 3 3.6 1-6 21 Apr; Oct-Nov 15, 29, 34 Ficimia olivacea 308.7 267-344 3 3.0 2-4 3 34 Ficimia publia 343 1 2.5 2-3 2 15, 34 Gyalopion canum 285.0 285 2 3.5 3-4 2 Jul 34 Gyalopion quadrangulare 268 1 4.0 3-6 4 Jul-Aug 15, 34 Pseudoficimia frontalis 29.2 7-47 13 17 Sonora aemula 287.0 260-336 5 4.2 3-7 5 spring-Oct 7, 34 Sonora semiannulata 258.6 218-335 9 4.2 3-6 52 Apr-Aug 10, 12, 13, 14, 9, 34 Stenorrhina degenhardti 5.0 4-6 Apr 2 Stenorrhina freminvillei 564.5 448-681 11.5 5-19 58 Oct-Apr 23, 34 Sympholis lippiens 480.5 413-510 4 4.5 2-7 2 Jun 34 Tantilla bocourti 274 1 61 21 Tantilla calamarina 152 1 2 1 34 Tantilla coronata 206.9 170-240 20 2.5 1-4 26 May-Jul 4, 5, 8, 25, 28, 34 Tantilla cucullata 400.0 396-404 2 2.0 2 May-Jul 19, 34 Tantilla gracilis 148.6 127-180 7 2.3 1-4 20 Jun-Jul 1, 10, 13, 18, 24, 34 Tantilla hobartsmithi 192.5 168-217 2 1.3 1-2 8 May-Aug 6, 11, 19, 34 Tantilla jani 188 1 2 1 34 Tantilla melanocephala 272.7 200-328 7 2.3 1-3 7 Oct-Jan 32, 34 Tantilla nigriceps 298 1 51 34 Tantilla redimita 144 1 11 34 Tantilla relicta 150- 33 26 Tantilla schistosa 188.5 166-211 1 2.0 2 34 Tantilla slavensi 277 1 41Nov22 Tantilla supracincta 333 1 21Oct34 Tantilla vermiformis 1 1 summer 20 Tantilla vulcani 183 1 21Mar-Apr31 Tantilla wilcoxi 294 1 1.5 1-2 2 Jun-Sep 34 Tantillita lintoni 165 1 1 1 34 a Italics indicate that midpoint is given instead of mean. b References include oviducal; whitish; shelled; well-developed; almost full term; oviposition. c 1=Force, 1935; 2=Stuart, 1935; 3=Klauber, 1951; 4=Neill, 1951; 5=Cook, 1954; 6=Stebbins, 1954; 7=Zweifel and Norris, 1955; 8=Neill and Boyles, 1957; 9=Wright and Wright, 1957; 10=Carpenter, 1958; 11=Minton, 1959; 12=Kassing, 1961; 13=Anderson, 1965; 14=Staedeli, 1965; 15=Greer, 1966; 16=Funk, 1967; 17=Hardy, 1972; 18=Fisher, 1973; 19=Easterla, 1975; 20=Van Devender and Cole, 1977; 21=McDiarmid et al., 1976; 22=Perez-Higareda et al., 1985; 23=Censky and McCoy, 1988; 24=Cobb, 1990; 25=Aldridge and Semlitsch, 1992; 26=Mushinsky and Witz, 1993; 27=Goldberg, 1995; 28=Palmer and Braswell, 1995; 29=Ramirez-Bautista et al, 1995; 30=Goldberg, 1997; 31=Campbell, 1998; 32=Marques and Puorto, 1998; 33=Goldberg and Rosen, 1999; 34=P. A. Holm, unpublished data.

233

100.0

Chilomeniscus cinctus

Tantilla hobartsmithi

10.0 Mass (g)

1.0

0.1 10 100 1000 Snout-Vent Length (mm)

Figure 1. Relationship between mass and length in two species. Data from field studies.

234

Figure 2. Selected aspects of head shape contrasting the Ficimia, Sonora, and Tantilla clades. 235

Figure 3. Relative snout and eye lengths plotted against head length for 187 Chilomeniscus specimens.

236

Coluber constrictor Liochlorophis vernalis Sonora semiannulata Sonora aemula Sonora michoacanensis Chionactis occipitalis Chionactis palarostris Chilomeniscus savagei Chilomeniscus stramineus Chilomeniscus punctatissimus Chilomeniscus cintus Chilomeniscus fasciatus Conopsis biserialis Conopsis lineata Conopsis amphistichia Conopsis nasus Conopsis conica Conopsis megalodon Pseudoficimia frontalis Stenorrhina degenhardtii Stenorrhina freminvillei Sympholis lippiens Gyalopion quadrangulare Gyalopion canum Ficimia ramirezi Ficimia publia Ficimia ruspator Ficimia hardyi Ficimia variegata Ficimia olivacea Ficimia streckeri Scolecophis atrocinctus Tantilla bocourti Tantilla deppei Tantilla coronadoi Tantilla cascadae Geagras redimitus Tantilla calamarina Tantilla vermiformis Tantilla albiceps Tantilla nigra Tantilla relicta Tantilla coronata Tantilla oolitica Tantilla wilcoxi Tantilla cucullata Tantilla rubra Tantilla planiceps Tantilla yaquia Tantilla nigriceps Tantilla hobartsmithi Tantilla atriceps Tantilla gracilis Tantilla supracincta Tantilla equatoriana Tantilla insulamontana Tantilla miyatai Tantilla andinista Tantilla petersi Tantilla capistrata Tantilla lempira Tantilla melanocephala form Tantilla striata Tantilla briggsi ordered Tantilla impensa Tantilla johnsoni A-G Terrestrial Tantilla slavensi Tantilla taeniata Tantilla semicincta H-M Slightly fossorial Tantilla reticulata Tantilla shawi N-T Moderately fossorial Tantilla flavilineata Tantilla oaxacae Tantilla cuniculator U-Z Highly fossorial Tantilla alticola Tantilla moesta equivocal Tantilla tecta Tantilla brevicauda Tantilla schistosa Tantilla jani Tantilla tayrae Tantilla vulcani Tantilla bairdi Tantillita canula Tantillita brevissima Tantillita lintoni

Figure 4. Degree of fossoriality mapped on the phylogenetic hypothesis. 237

1.0

0.9

0.8

0.7

0.6

0.5

0.4

0.3 Proportion of Buried Prey 0.2

0.1

0.0 0 0.2 0.4 0.6 0.8 1 Index of Fossorial Morphology

Figure 5. Scatterplot of proportion of buried prey vs degree of fossoriality. 238

Coluber constrictor Liochlorophis vernalis Sonora semiannulata Sonora aemula Sonora michoacanensis Chionactis occipitalis Chionactis palarostris Chilomeniscus savagei Chilomeniscus stramineus Chilomeniscus punctatissimus Chilomeniscus cintus Chilomeniscus fasciatus Conopsis biserialis Conopsis lineata Conopsis amphistichia Conopsis nasus Conopsis conica Conopsis megalodon Pseudoficimia frontalis Stenorrhina degenhardtii Stenorrhina freminvillei Sympholis lippiens Gyalopion quadrangulare Gyalopion canum Ficimia ramirezi Ficimia publia Ficimia ruspator Ficimia hardyi Ficimia variegata Ficimia olivacea Ficimia streckeri Scolecophis atrocinctus Tantilla bocourti Tantilla deppei Tantilla coronadoi Tantilla cascadae Geagras redimitus Tantilla calamarina Tantilla vermiformis Tantilla albiceps Tantilla nigra Tantilla relicta Tantilla coronata Tantilla oolitica Tantilla wilcoxi Tantilla cucullata Tantilla rubra Tantilla planiceps Tantilla yaquia Tantilla nigriceps Tantilla hobartsmithi Tantilla atriceps Tantilla gracilis Tantilla supracincta Tantilla equatoriana Tantilla insulamontana Tantilla miyatai Tantilla andinista Tantilla petersi Tantilla capistrata Tantilla lempira Tantilla melanocephala Tantilla striata Tantilla briggsi Tantilla impensa ordered diet2 Tantilla johnsoni % buried prey Tantilla slavensi Tantilla taeniata ordered Tantilla semicincta Tantilla reticulata A 0-25% equivocal D C B A Tantilla shawi Tantilla flavilineata B 26-50% Tantilla oaxacae Tantilla cuniculator C 51-75% Tantilla alticola Tantilla moesta D 76-100% Tantilla tecta Tantilla brevicauda Tantilla schistosa equivocal Tantilla jani Tantilla tayrae Tantilla vulcani Tantilla bairdi Tantillita canula Tantillita brevissima Tantillita lintoni

Figure 6. Percent of buried prey in the diet of sonorinine snakes mapped on the phylogenetic hypothesis. 239

Coluber constrictor Liochlorophis vernalis Sonora semiannulata Sonora aemula Sonora michoacanensis Chionactis occipitalis Chionactis palarostris Chilomeniscus savagei Chilomeniscus stramineus Chilomeniscus punctatissimus Chilomeniscus cintus Chilomeniscus fasciatus Conopsis biserialis Conopsis lineata Conopsis amphistichia Conopsis nasus Conopsis conica Conopsis megalodon Pseudoficimia frontalis Stenorrhina degenhardtii Stenorrhina freminvillei Sympholis lippiens Gyalopion quadrangulare Gyalopion canum Ficimia ramirezi Ficimia publia Ficimia ruspator Ficimia hardyi Ficimia variegata Ficimia olivacea Ficimia streckeri Scolecophis atrocinctus Tantilla bocourti Tantilla deppei Tantilla coronadoi Tantilla cascadae Geagras redimitus Tantilla calamarina Tantilla vermiformis Tantilla albiceps Tantilla nigra Tantilla relicta Tantilla coronata Tantilla oolitica Tantilla wilcoxi Tantilla cucullata Tantilla rubra Tantilla planiceps Tantilla yaquia Tantilla nigriceps Tantilla hobartsmithi Tantilla atriceps Tantilla gracilis Tantilla supracincta Tantilla equatoriana Tantilla insulamontana Tantilla miyatai Tantilla andinista Tantilla petersi Tantilla capistrata Tantilla lempira Tantilla melanocephala Tantilla striata Tantilla briggsi Tantilla impensa Tantilla johnsoni Tantilla slavensi Tantilla taeniata Tantilla semicincta Tantilla reticulata Tantilla shawi geog region Tantilla flavilineata Tantilla oaxacae Tantilla cuniculator ordered Tantilla alticola Tantilla moesta E North America Tantilla tecta Tantilla brevicauda Tantilla schistosa

ordered reg W NA & Mexico Tantilla jani Tantilla tayrae Tantilla vulcani Central America Tantilla bairdi Tantillita canula equivocal polymorphic D C B A South America Tantillita brevissima Tantillita lintoni polymorphic equivocal

Figure 7. Geographic distribution mapped on the phylogenetic hypothesis. 240

Coluber constrictor Liochlorophis vernalis Sonora semiannulata Sonora aemula Sonora michoacanensis Chionactis occipitalis Chionactis palarostris Chilomeniscus savagei Chilomeniscus stramineus Chilomeniscus punctatissimus Chilomeniscus cintus Chilomeniscus fasciatus Conopsis biserialis Conopsis lineata Conopsis amphistichia Conopsis nasus Conopsis conica Conopsis megalodon Pseudoficimia frontalis Stenorrhina degenhardtii Stenorrhina freminvillei Sympholis lippiens Gyalopion quadrangulare Gyalopion canum Ficimia ramirezi Ficimia publia Ficimia ruspator Ficimia hardyi Ficimia variegata Ficimia olivacea Ficimia streckeri Scolecophis atrocinctus Tantilla bocourti Tantilla deppei Tantilla coronadoi Tantilla cascadae Geagras redimitus Tantilla calamarina Tantilla vermiformis Tantilla albiceps Tantilla nigra Tantilla relicta Tantilla coronata Tantilla oolitica Tantilla wilcoxi Tantilla cucullata Tantilla rubra Tantilla planiceps Tantilla yaquia Tantilla nigriceps Tantilla hobartsmithi Tantilla atriceps Tantilla gracilis Tantilla supracincta Tantilla equatoriana Tantilla insulamontana Tantilla miyatai Tantilla andinista Tantilla petersi Tantilla capistrata macroclimate Tantilla lempira Tantilla melanocephala ordered Tantilla striata Tantilla briggsi Tantilla impensa A 62.5-125 ordered humid Tantilla johnsoni Tantilla slavensi B 125-250 Tantilla taeniata Tantilla semicincta Tantilla reticulata

equivocal H 8 G 4000-8000 F 2000-4000 E 1000-2000 D 500-1000 C C 250-500 B 125-250 A 62.5-125 Tantilla shawi Tantilla flavilineata

000 D 500-1000 Tantilla oaxacae Tantilla cuniculator Tantilla alticola

+ m E 1000-2000 Tantilla moesta Tantilla tecta m F 2000-4000 Tantilla brevicauda Tantilla schistosa MAP Tantilla jani G 4000-8000 Tantilla tayrae Tantilla vulcani PT H 8000+ mm MAPPT Tantilla bairdi Tantillita canula Tantillita brevissima equivocal Tantillita lintoni

Figure 8. Macroclimate mapped on the phylogenetic hypothesis. 241

Figure 9. Relationship between fossorial morphology and macroclimate. 242

S. semiannulata Chionactis Chilomeniscus

180

170

160

150

140

Male Ventrals 130

120

110

100 0 200 400 600 800 1000 MAPPT (mm)

Figure 10. Relationship between male mean ventral scale count and mean annual precipitation for populations of three species groups. The Chilomeniscus outlier is the island endemic C. savagei.