Phylogeny and Taxonomy of Carex (Cyperaceae) in Japan I. C. Sect

ISSN 1346-7565 Acta Phytotax. Geobot. 70 (2): 69–85 (2019) doi: 10.18942/apg.201821

Phylogeny and Taxonomy of Carex (Cyperaceae) in Japan I. C. sect. Rarae

1,* 2 3 2 Jiro Oda , Shizuka Fuse , Jun Yamashita and Minoru N. Tamura

1Sekiya-kita 5-5-21, Kashiba, Nara 639-0254, Japan. * [email protected] (author for correspondence); 2Department of Botany, Graduate School of Science, Kyoto University, Kitashirakawa-oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan; 3Institute of Plant Science and Resources, Okayama University, Chuo 2-20-1, Kurashiki, Okayama 710-0046, Japan

To understand the relationships among species of Carex sect. Rarae in Japan, we conducted molecular phylogenetic analyses based on a combined dataset of DNA sequences of plastid (atpB–rbcL, rpl16– rpl16–rps3, rps16, trnT–trnL, trnL–trnL–trnF) and nuclear (ITS) regions. All species and varieties of C. sect. Rarae in Japan were included. The resulting phylogenetic tree consisted of two major clades: Clade I with distinctly veined perigynia, and Clade II with indistinctly veined perigynia. Clade I further consisted of two subclades A and B. Subclade A comprised C. biwensis and C. capillacea, while subclade B included the Japanese endemics C. fulta, C. koyaensis, C. noguchii, and C. ruralis. Clade II comprised C. hakonensis, C. onoei, C. semihyalofructa, and C. uda. Clade II and subclade A corresponded to Carex subsect. Capitellatae (excluding C. fulta) and Carex subsect. Rarae circumscribed by Egorova, respectively. We propose a new subsection, Fultae, for subclade B, which is characterized by distinctly veined perigynia that lack rusty dots. We suggest that Carex koyaensis var. yakushimensis be treated as C. yakushimensis. Carex inagawaensis is described as a new species from Hyogo Prefecture. A diagnostic key to subsections and species of Carex sect. Rarae in Japan is presented.

Key words: achene micromorphology, Carex, Carex inagawaensis, Carex sect. Rarae, Carex subsect. Fultae, Carex yakushimensis, ITS, phylogeny, plastid DNA, taxonomy

Carex L., with over 2000 species, is the larg- from Japan (Table 1) (Katsuyama 2015). Carex est genus in the Cyperaceae Juss. and one of the sect. Rarae is characterized by androgynous most widespread genera in the world. The genus spikes and ovoid, glabrous, membranaceous pe- is characterized by unisexual flowers and a gy- rigynia with an emarginate beak (Ohwi 1936). noecium enclosed by a flask-like prophyll called a Egorova (1985, 1999) subdivided Carex sect. perigynium (Reznicek 1990, Starr et al. 2004). Rarae into three subsections based primarily on Kükenthal (1909) recognized four subgenera, perigynium and culm characteristics (Fig. 1A– Carex (subg. Eucarex Peterm.), Indocarex (Baill.) D): Capitellatae (Meinsh.) Kük., Rarae T. V. Ego- Kük., Primocarex Kük. [subg. Psyllophora rova, and Erostratae T. V. Egorova. Carex sub- (Degl.) Peterm.], and Vignea P. Beauv ex T. sect. Capitellatae is characterized by sharply tri- Lestib. angular culms (Fig. 1D) and inflated perigynia Carex sect. Rarae C. B. Clarke, which is in- that lack rusty dots (Fig. 1B). The perigynium has cluded in the unispicate subgenus Primocarex, 8–10 indistinct (or almost invisible) veins on the consists of approximately 20 species distributed dorsal surface and a short to medium apical beak in Asia and Oceania (Kükenthal 1909, Kern & (Fig. 1B). Carex fulta, C. hakonensis, C. onoei, Nooteboom 1979, Egorova 1985, 1999, Tang et al. and C. uda are included in this subsection, al- 2010). Ten species and two varieties are reported though C. fulta has 2–4 exceptionally distinct 70 Acta Phytotax. Geobot. Vol. 70 veins on the dorsal surface of the perigynia (Ta- We tentatively identified the specimen as C. cf. ble 1). Carex subsect. Rarae is characterized by biwensis, pending further study. inflated, frequently rusty dotted, perigynia with Uncertain subsection-level taxonomy, the 2–5 distinct dorsal veins and a typically short lack of species descriptions based on achene mi- beak (Fig. 1A). Subsection Rarae has obscurely cromorphology, and the existence of undeter- 3–5 angled culms (Fig. 1C), and includes C. biw- mined specimens highlight knowledge gaps in ensis and C. capillacea (Table 1). Carex subsect. our understanding of Carex sect. Rarae in Japan. Erostratae is monotypic, composed of C. capitel- A molecular phylogeny has not been established lata, which occurs in Turkey and the Caucasus. for C. sect. Rarae, thus the relationships remain Carex capitellata is characterized by a non-in- unclear. To determine these relationships, to un- flated, "veinless" (Egorova 1999) and beakless derstand the evolution of achene ornamentation perigynia. Since the subsection classification by and to evaluate its diagnostic value in sect. Ra- Egorova (1999), four species have been added to rae, we undertook a detailed molecular phyloge- C. sect. Rarae in Japan: C. koyaensis, C. nogu- netic study of the group. We addressed four taxo- chii, C. ruralis, and C. semihyalofructa (Table 1). nomic objectives: to determine the circumscrip- Based on morphology, C. semihyalofructa should tion of species and varieties of C. sect. Rarae in be included in C. subsect. Capitellatae. The re- Japan, to determine the taxonomic status of C. maining three species cannot be assigned to any aff. fulta from Hyogo Prefecture, to determine subsection. the identity of C. cf. biwensis from Okinawa Pre- Ornamentation of the achene surface has of- fecture, and to reevaluate the subsections sensu ten been used in circumscribing sections, subsec- Egorova (1985, 1999) of Carex sect. Rarae. tions, and species in Carex (Toivonen & Timonen 1976, Hoshino 1984, Wujek & Menapace 1988, Waterway 1989, Rettig 1990, Dan & Hoshino Materials and Methods 1994, Olgun & Beyazoglu 1997, Starr & Ford 2001, Oda et al. 2003, Jin & Zheng 2013). Carex Plant materials for phylogenetic analyses koyaensis, C. noguchii, and C. ruralis usually DNA sequences of the plastid regions of lack satellite bodies on the platform margin and atpB–rbcL, rpl16–rpl16–rps3, rps16, trnT–trnL, are truncate at the apex of the central body (for and trnL–trnL–trnF, and the nuclear internal explanation of positions and terms see Fig. 2). transcribed spacer (ITS) region were determined Carex biwensis and C. capillacea always have for 38 samples (Table 2). Of these, 35 were mem- satellite bodies and usually have a more or less bers of Carex sect. Rarae (the ingroup), including roundish apex (Oda & Nagamasu 2008, 2011, 10 species, 2 varieties, and the 2 unknown or un- Katsuyama & Oda 2009). The achene micromor- certain specimens (C. aff. fulta and C. cf. biwen- phology of the remaining Japanese species of C. sis). The remaining three samples were of unispi- sect. Rarae has not yet been reported. cate species from sections Circinatae, Leucoglo- Recently, an unidentified species that is likely chin, and Rhizopodae (the outgroup). All se- part of Carex sect. Rarae was discovered in Hyo- quence data obtained in this study were deposited go Prefecture. The specimen is similar to C. fulta in the DNA Data Bank of Japan (DDBJ). All (Table 1) but differs in having creeping rhizomes voucher specimens were deposited in the Kyoto (Fig. 3A). We considered it to be an undescribed University Herbarium (KYO) (Kyoto, Japan), ex- species requiring confirmation by molecular cluding C. pauciflora, which was deposited in the analyses. We also received a specimen from Oki- Gifu Prefectural Museum (GPM) (Gifu, Japan). nawa Prefecture that appears to be C. biwensis, based on its morphology (Table 1, Fig. 3B), but DNA extraction, PCR amplification, and DNA se- there are no reports of C. biwensis, or of other quencing members of Carex sect. Rarae, from that area. Total genomic DNA was extracted from June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 71

Fig. 1. Representative morphology of Carex sect. Rarae. A, dorsal surface of perigynium of C. capillacea (C. subsect. Rarae), J. Oda 587 (KYO); B, dorsal surface of perigynium of C. onoei (C. subsect. Capitellatae), J. Oda 8446 (KYO); C, cross section of culm of C. biwensis (C. subsect. Rarae), J. Oda 4498 (KYO); D, cross section of culm of C. uda (C. subsect. Capitellatae), J. Oda & K. Oda 9063 (KYO). Bar = 1 mm for A and B; 0.5 mm for C and D. leaves dried in silica gel or from herbarium spec- region (Table 3) and the following PCR profile: a imens using the modified cetyltrimethylammoni- 35 cycle reaction with denaturation at 94 °C for um bromide (CTAB) method of Stewart & Via 30 s, annealing at 52 °C (65 °C in ITS) for 30 s, (1993). Each DNA region was amplified by poly- and extension at 72 °C for 60 s, in addition to an merase chain reaction (PCR) using a GeneAmp initial denaturation at 94 °C for 5 min and a final PCR System 9600 or a TaKaRa PCR Thermal extension at 72 °C for 7 min. The PCR products Cycler Dice. The amplification reaction mixture were purified using Exonuclease I (TaKaRa Bio) was prepared using TaKaRa Ex Taq DNA poly- and Calf Intestine Alkaline Phosphatase (Toyo- merase following the manufacturer’s recommen- bo, Osaka, Japan) or QIAquick PCR Purification dations (TaKaRa Bio, Kusatsu, Japan). We used (Qiagen, Hilden, Germany). Direct sequencing two primers for the amplification of each DNA for each DNA region was conducted with 2–4 72 Acta Phytotax. Geobot. Vol. 70

Table 1. Morphological characters of Carex sect. Rarae in Japan. Taxon Rhizome Cross Width Inflorescence Scale Perigynium section of of culm leaves stami- Number Apex of Color Shape Length Veins Number Rusty (mm) nate part/ of pistillate (mm) of veins dots pistillate pistillate scale on dorsal part flowers surface Carex biwensis short obscurely 1−1.5 nearly 10−30 obtuse rusty broadly 1.8−2 distinct (2−)3−4 often Franch. 3−5 angled equal brown ovate (−5) present C. cf. biwensis short obscurely ca. 1 nearly 7−15 obtuse rusty broadly 1.8−2 distinct (2−)3−4 absent from Pref. 3−5 angled equal brown ovate (−5) Okinawa C. capillacea Boott var. capillacea short obscurely 1−1.5 nearly 7−15 obtuse rusty ovate 2−2.8 distinct (2−)3−4 often 3−5 angled equal brown (−5) present var. sachalin- short obscurely 1−1.5 nearly 7−15 obtuse rusty ovate 2.8−3.5 distinct (2−)3−4 often ensis 3−5 angled equal brown (−4) (−5) pres- (F. Schmidt) ent Ohwi C. fulta Franch. short triangled 2−3 stami- 5−15 obtuse pale broadly 2−2.5 distinct 2−4 absent nate part to acute green ovate shorter C. aff. fulta from long, sharply 1.5−2 stami- 5−10 btuse to pale broadly 1.8−2.2 distinct 2−4 absent Pref. Hyogo creeping triangled nate part acute green ovate shorter C. hakonensis short sharply ca. 1 stami- 5−10 obtuse rusty eliptic 2−2.5 invisible − absent Franch. & Sav. triangled nate part to acute brown (rarely visible (2) shorter only near both ends) C. koyaensis J. Oda & Nagam. var. koyaensis long, obscurely 1.2−1.8 nearly 5−10 obtuse rusty broadly 2−2.3 distinct 3−5 absent creeping 3−5 angled equal brown ovate var. yakushime- some- obscurely ca. 0.5 nearly 3−5 obtuse rusty ovate ca. 2 distinct 2−4 absent nsis Katsuy. & what 3−5 angled equal brown J. Oda creeping C. noguchii J. short obscurely 2−4 nearly 15−23 obtuse rusty broadly 1.8−2 distinct (2−)3−4 absent Oda & Nagam. 3−5 angled equal brown ovate (−5) C. onoei Franch. short sharply 1−3 stami- 7−15 acute usty ovate 2.5−3 8–10 & Sav. triangled nate part brown indistinct absent shorter C. ruralis J. Oda short obscurely 0.4−0.8 nearly 3−5 obtuse rusty ovate 2−2.5 distinct 3−5 absent & Nagam. 3−5 angled equal brown C. semihyalo- creeping sharply 1.7−2.8 stami- 7−15 acute rusty ovate 2.4−3.1 indistinct 8–10 fructa Tak. triangled nate part brown absent Shimizu shorter C. uda Maxim. short sharply 2−3 stami- 10−20 acute rusty lanceo- 3.5−4 indistinct 8–10 absent triangled nate part brown late shorter primers (Table 3) using an ABI PRISM 310 Ge- DNA data set was determined with an incongru- netic Analyzer (Applied Biosystems, Foster City, ence length difference (ILD) test (Farris et al. the United States) and a BigDye Terminator Cy- 1994), implemented in PAUP*, as a partition ho- cle Sequencing Kit (Applied Biosystems), ac- mogeneity test. cording to manufacturer instructions. Obtained In the MP analyses, we used a heuristic search DNA sequences were manually aligned. option of random addition sequences (10,000 replications), a tree bisection and reconnection Phylogenetic analyses (TBR) swapping algorithm, and multiple parsi- Maximum parsimony (MP) and maximum monious trees (MULPARS) to determine the likelihood (ML) analyses were used for phyloge- most parsimonious trees. Only base substitutions ny reconstruction, implemented in PAUP* v.4.0 were treated as character states for phylogenetic beta 10 (Swofford 2002). Congruence between reconstruction. All base substitutions were equal- the plastid DNA data set and the nuclear (ITS) ly weighted and gaps were treated as missing val- June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 73

using a heuristic search (200 replicates) with a simple addition sequence option, TBR swapping, and MULPARS, and a P value of 0.11. Using an incongruence threshold of 0.05, we concluded that the plastid and nuclear ITS datasets were combinable. The ML analyses were conducted on the combined plastid and ITS data set. The best model of nucleotide evolution was estimated using Modelt- est 3.7 (Posada & Crandall 1998). The model selected by the hierarchical likelihood ratio test (hLRT) was GTR+I+G for the combined plastid and ITS data set. A heuristic search option of as- is addition sequence and the TBR swapping algorithm were used according to the parameters specified by the model. Maximum likelihood bootstrap analyses with 100 replications (heuris- Fig. 2. Schematic explanation of terminology concerning tic; as-is; TBR) was performed using PAUP*. achene micromorphology. a, apex of a central body (sharply truncate in this case); b, central body (concave in this case); c, platform; d, anticlinal wall; e, apex of an Observation of morphological characters anticlinal wall; f, satellite bodies. Morphological characters of Carex sect. Ra- rae in Japan (Tables 1 & 4, Figs. 1, 3, 5 & 6) were ues. The consistency index (CI), retention index measured on herbarium specimens from KYO or (RI), and rescaled consistency index (RC) were from fresh materials. Observations of silica-de- calculated using PAUP*, including uninformative posit ornamentation on achene epidermal cells characters. Bootstrap analyses with 10,000 repli- were made with a scanning electron microscope cations (heuristic; 10,000 random; TBR) were (SEM) using the acetolysis method of Oda and performed using PAUP*. Nagamasu (2008), a modification of Wujek and A partition-homogeneity test was performed Menapace’s procedure (1988). Cross sections of

Fig. 3. Morphology characterizing undetermined / unclear plants of Carex sect. Rarae. A, rhizomes of C. aff. fulta from Hyo- go Pref., J. Oda et al. 1833 (KYO); B, dorsal surface of perigynium of C. cf. biwensis from Okinawa Pref., T. Watanabe s.n. (herb. J. Oda 8711) (KYO). Bar = 5 cm for A; 1 mm for B. 74 Acta Phytotax. Geobot. Vol. 70

Table 2. Sources of materials used for DNA analysis. All materials were collected from Japan. Taxon Locality Voucher* Acc. No. atpB-rbcL rpl16- rps16 trnT-trnL trnL-trnL- ITS rpl16-rps3 trnF Carex sect. Rarae C. B. Clarke C. biwensis Pref. Mie: Ikenodaira, Tsu-shi J. Oda 4498 LC486119 LC486157 LC486321 LC486775 LC487489 LC487451 Pref. Nara: Tsuge-Shiraishi, Nara-shi J. Oda 8998 LC486120 LC486158 LC486322 LC486776 LC487490 LC487452 Pref. Osaka: Hachigamine, Sakai-shi K. Hirano s.n. LC486121 LC486159 LC486323 LC486777 LC487491 LC487453 (herb. J. Oda 1827) C. cf. biwensis Pref. Okinawa: Higashi-son, T. Watanabe s.n. LC486122 LC486160 LC486324 LC486778 LC487492 LC487454 Kunigami-gun (herb. J. Oda 8711) C. capillacea var. Hokkaido: Betsukai-cho, Y. Kato s.n. LC486123 LC486161 LC486325 LC486779 LC487493 LC487455 capillacea Notsuki-gun (herb. J. Oda 9041) Pref. Tochigi: Senjogahara, T. Noguchi s.n. LC486124 LC486162 LC486326 LC486780 LC487494 LC487456 Nikko-shi Pref. Tochigi: Noguchi, T. Noguchi s.n. LC486125 LC486163 LC486327 LC486781 LC487495 LC487457 Nikko-shi (herb. J. Oda 8783) Pref. Nagano: Himekidaira J. Oda 4230 LC486126 LC486164 LC486328 LC486782 LC487496 LC487458 Pref. Mie: Rhogaike, Inabe-shi J. Oda 587 LC486127 LC486165 LC486329 LC486783 LC487497 LC487459 Pref. Hyogo: Sanda-shi T. Fujii 32839 LC486128 LC486166 LC486330 LC486784 LC487498 LC487460 C. capillacea var. Pref. Tochigi: Senjogahara, T. Noguchi s.n. LC486129 LC486167 LC486331 LC486785 LC487499 LC487461 sachalinensis Nikko-shi (herb. J. Oda 7877) C. fulta Pref. Iwate: Morioka-shi N. Numakunai s.n. LC486130 LC486168 LC486332 LC486786 LC487500 LC487462 (herb. J. Oda789) Pref. Tochigi: Nasu-cho, Nasu-gun J. Oda 3044 LC486131 LC486169 LC486333 LC486787 LC487501 LC487463 Pref. Ibaragi: Takahagi-shi T. Noguchi s.n. LC486132 LC486170 LC486334 LC486788 LC487502 LC487464 (herb. J. Oda 9194) C. aff. fulta Pref. Hyogo: Inagawa-cho, J. Oda et al. 1833 LC486133 LC486171 LC486335 LC486789 LC487503 LC487465 Kawabe-gun C. hakonensis Pref. Tochigi: Mt. Nantai-san, T. Noguchi s.n. LC486134 LC486172 LC486336 LC486790 LC487504 LC487466 Nikko-shi (herb J. Oda 8857) Pref. Nara: Mt. Inamuragatake, J. Oda 9039 LC486135 LC486173 LC486337 LC486791 LC487505 LC487467 Yoshino-gun Pref. Tokushima: Mt. Tsurugi, J. Oda 8879 LC486136 LC486174 LC486338 LC486792 LC487506 LC487468 Miyoshi-shi Pref .Kochi: Mt. Kamegamori, J. Oda 3018 LC486137 LC486175 LC486339 LC486793 LC487507 LC487469 Agawa-gun C. koyaensis var. Pref. Shiga: Mt. Mikuni, J. Oda 9196 LC486138 LC486176 LC486340 LC486794 LC487508 LC487470 koyaensis Takashima-shi Pref. Mie: Mt. Gozaisho, Mie-gun J. Oda 1657 LC486139 LC486177 LC486341 LC486795 LC487509 LC487471 Pref. Wakayama: Mt. Koya, Ito-gun J. Oda 1639 LC486140 LC486178 LC486342 LC486796 LC487510 LC487472 C. koyaensis var. Pref. Kagoshima: Isl. Yakushima, W. Shinohara s.n. LC486141 LC486179 LC486343 LC486797 LC487511 LC487473 yakushimensis Kumage-gun (herb. J. Oda 9197) C. noguchii Pref. Tochigi: Ohnuma, Nasushioba- J. Oda & T. Noguchi LC486142 LC486180 LC486344 LC486798 LC487512 LC487474 ra-shi 4181 C. onoei Hokkaido: Tsuruimura, Akan-gun J. Oda & K. Oda 9051 LC486143 LC486181 LC486345 LC486799 LC487513 LC487475 Pref. Tochigi: Dorobu, Nikko-shi J. Oda & T. Noguchi LC486144 LC486182 LC486346 LC486800 LC487514 LC487476 4208 Pref. Yamanashi: Otome-kogen, J. Oda 8446 LC486145 LC486183 LC486347 LC486801 LC487515 LC487477 Yamanashi-shi Pref. Nara: Dorogawa, Yoshino-gun J. Oda 7439 LC486146 LC486184 LC486348 LC486802 LC487516 LC487478 C. ruralis Pref. Gifu: Nenoue-kogen, Nakatsug- J. Oda 1561 LC486147 LC486185 LC486349 LC486803 LC487517 LC487479 awa-shi Pref. Mie: Mt. Reizan, Iga-shi J. Oda 170 LC486148 LC486186 LC486350 LC486804 LC487518 LC487480 Pref. Nara: Ninnikusen-cho, Nara-shi J. Oda 9380 LC486149 LC486187 LC486351 LC486805 LC487519 LC487481 C. semihyalofructa Pref. Niigata: near Renge-onsen, J. Oda 525 LC486150 LC486188 LC486352 LC486806 LC487520 LC487482 Itoigawa-shi Pref. Fukui: Mt. Akausagi, Kat- J. Oda 2817 LC486151 LC486189 LC486353 LC486807 LC487521 LC487483 suyama-shi C. uda Hokkaido: Harusaiko, Kushiro-shi J. Oda & K. Oda 9063 LC486152 LC486190 LC486354 LC486808 LC487522 LC487484 Pref. Aomori: Hichinohe-shi N. Numakunai s.n. LC486153 LC486191 LC486355 LC486809 LC487523 LC487485 (herb. J. Oda 1656) < Out group > Carex sect. Circinatae Meinsh. C. hakkodensis Franch. Pref. Aomori: Mt. Hakkoda, J. Oda & K. Yonekura LC486154 LC486192 LC486356 LC486810 LC487524 LC487486 Aomori-shi 8015 Carex sect. Leucoglochin Tuckerm. C. paucifloraLightf. Hokkaido: Kamikawa-cho, kamika- H. Shimizu 751 LC486155 LC486193 LC486357 LC486811 LC487525 LC487487 wa-gun Carex sect. Rhizopodae Ohwi C. rhizopoda Maxim. Pref. Shizuoka: Manjonotaki, Izu-shi J. Oda 8986 LC486156 LC486194 LC486358 LC486812 LC487526 LC487488 * All specimens except for H. Shimizu 751 (GPM) are preserved in KYO. June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 75

Fig. 4. Maximum likelihood (ML) tree of Carex sect. Rarae and its outgroup in Japan, using GTR + I + G model selected by hierarchical likelihood ratio test (hLRT), based on combined data set of plastid regions of atpB-rbcL, rpl16-rpl16-rps3, rps16, trnT-trnL and trnL-trnL-trnF and nuclear ITS region (p = 0.11 in ILD test). Topology of strict consensus of 48 equally most parsimonious (MP) trees is identical to topology of this figure, except the two arrowed branches that are not present in the MP strict consensus tree. Numbers above and below branches indicate MP and ML (hLRT) bootstrap val- ues, respectively. 76 Acta Phytotax. Geobot. Vol. 70

Fig. 5. Achene micromorphology (A—G) and cross section of leaves (H & I) of Carex sect. Rarae. A, C. uda, N. Numakunai s.n. (herb. J. Oda 1656) (KYO); B, C. onoei, J. Oda & T. Noguchi 4208 (KYO); C, C. hakonensis, M. N. Tamura & J. H. Pak 75 (KYO); D, C. semihyalofructa, J. Oda 2817 (KYO); E, C. fulta, N. Numakunai s.n. (herb. J. Oda 789) (KYO); F, C. aff. fulta from Hyogo Pref., J. Oda et al. 1833 (KYO); G, C. cf. biwensis from Okinawa Pref., T. Watanabe s.n. (herb. J. Oda 8711) (KYO); H, C. koyaensis var. yakushimensis, W. Shinohara s.n. (herb. J. Oda 9197) (KYO); I, C. ruralis, S. Amano 1841 (KYO). Bar in white for A—G = 10 μm. Bar for H and I = 0.5 mm. June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 77

Table 3. Name, direction, nucleotide sequence and source of primers used in this study. The primers with an astersk were used for both PCR amplification and DNA sequencing, and the other primers only for DNA sequencing. Primer name Direction Sequence (5'—3') Source [atpB-rbcL] f1* sense GTACTGGGCCAATAATTTGA Yano et al. (2010) r* antisense CAACACTTGCTTAGTCTCTG Xu et al. (2000) [rpl16-rpl16-rps3] rpl16F71* sense GCTATGCTTAGTGTGTGACTCGTTG Shaw et al. (2005) rpl16R1516* antisense CCCTTCATTCTTCCTCTATGTTG Shaw et al.(2005) rpl-03F sense CCAACCTATTGCTTCGTATTATC newly designed rpl-04R antisense CATAGCTTCTCTATTCATGATTAGG newly designed [rps16] rpS16F* sense AAACGATGTGGTARAAAGCAAC Shaw et al. (2005) rps16R* antisense AACATCWATTGCAASGATTCGAT Shaw et al. (2005) [trnT-trnL] a* sense CATTACAAATGCGATGCTCT Taberlet et al. (1991) cr* antisense CTTTGGTATAGACGGCTATC Yano et al. (2010) trnT_trnL-440F-mHari sense GATAGAACTTTAGACTGTTAAAAATC newly designed trnT_trnL-620R-mHari antisense CTACCAATTTCGCCATATCC newly designed [trnL-trnL-trnF] trnL-c* sense CGAAATCGGTAGACGCTACG Taberlet et al. (1991) trnF-f* antisense ATTTGAACTGGTGACACGAG Taberlet et al. (1991) trnL-e sense GGTTCAAGTCCCTCTATCCC Taberlet et al. (1991) trnL-d antisense GGGGATAGAGGGACTTGAAC Taberlet et al. (1991) [ITS] ITS5i* sense AGGTGACCTGCGGAAGGATCATT Roalson et al. (2001) ITS4i* antisense GGTAGTCCCGCCTGACCTGG Roalson et al. (2001) leaves made by hand using a razor blade were strict consensus tree (Fig. 4, arrows). In the ML subsequently stained with 1% crystal violet and tree, C. sect. Rarae was monophyletic with 100% observed with a light microscope. bootstrap support and comprised two clades: Clade I (100%; C. biwensis, C. cf. biwensis, C. capillacea, C. fulta, C. aff. fulta, C. koyaensis, C. Results noguchii, and C. ruralis) and Clade II (58%; C. hakonensis, C. onoei, C. semihyalofructa, and C. Phylogenetic analyses uda). Clade I included two subclades: A (100%; MP analyses based on the combined plastid C. biwensis, C. cf. biwensis, and C. capillacea) and ITS data set were performed. Of the aligned and B (95%; C. fulta, C. aff. fulta, C. koyaensis, length of 5,122 bp, 372 bp were variable and 168 C. noguchii, and C. ruralis). Clade II also includ- bp were phylogenetically informative. Sequence ed two subclades: one of C. onoei and C. uda data of Carex biwensis from Mie and Nara Pre- (92%) and a second of C. hakonensis and C. semi- fectures were identical. Sequence data of two hyalofructa (57%). samples of C. capillacea, both from Senjogahara In subclade A, seven samples of C. capillacea (Tochigi Prefecture) were also identical, although were monophyletic (89%), as were three samples one was identified as var.capillacea , and the oth- of C. biwensis, along with the tentatively identi- er as var. sachalinensis. This analysis yielded 48 fied C. cf. biwensis (93%). In subclade B, three equally parsimonious trees of 450 steps (CI = samples of C. ruralis were monophyletic (84%), 0.88, RI = 0.92, RC = 0.81). but C. koyaensis was polyphyletic, i.e., a sample ML tree topologies were identical to the MP of C. koyaensis var. yakushimensis formed a strict consensus tree, with a few exceptions. clade with C. ruralis (100%), but three samples of Clade II and a clade of two samples of Carex on- C. koyaensis var. koyaensis formed a clade with oei from Hokkaido and Tochigi Prefecture were C. fulta (61%). The specimen identified as C. aff. formed in the ML tree but collapsed in the MP fulta was not included in a clade with any of the 78 Acta Phytotax. Geobot. Vol. 70

Table 4. Micromorphological characters on achene surface of Carex sect. Rarae in Japan (for terminology, see Fig. 2). Taxon Anticlinal wall Platform Satellite bodies Central body surface shape apex Carex biwensis flat and smooth smooth regularly arranged along anticlinal walls concave dully truncate C. cf. biwensis from flat and smooth smooth regularly arranged along anticlinal walls concave dully Pref. Okinawa truncate C. capillacea flat and smooth smooth regularly arranged along anticlinal walls concave dully var. capillacea truncate var. sachalinensis flat and smooth smooth regularly arranged along anticlinal walls concave dully truncate C. fulta flat and smooth smooth usually absent, rarely only a few irregularly concave sharply arranged along anticlinal walls truncate C. aff. fulta from flat and smooth smooth absent concave sharply Pref. Hyogo truncate C. hakonensis highly sinuate and smooth absent slightly roundish honeycombed convex C. koyaensis flat and smooth smooth usually absent, rarely only a few irregularly concave sharply var. koyaensis arranged along anticlinal walls truncate var. yakushimensis flat and smooth smooth usually absent, rarely only a few irregularly concave sharply arranged along anticlinal walls truncate C. noguchii flat and smooth smooth usually absent, rarely only a few irregularly concave sharply arranged along anticlinal walls truncate C. onoei highly sinuate and rough absent slightly roundish honeycombed convex C. ruralis flat and smooth smooth usually absent, rarely regularly arranged concave sharply along anticlinal walls truncate C. semihyalofructa sinuate and solid smooth absent slightly roundish convex C. uda sinuate and solid rough regularly arranged around a central body slightly dully convex truncate

other species. Another monophyletic clade, Clade (not honeycombed) anticlinal walls with moder- II, was formed by two samples of C. uda, four ately sized achene surface cells (Fig. 5D). There- samples of C. onoei, two samples of C. semihya- fore, these four species of Clade II can be distin- lofructa, and four samples of C. hakonensis (97– guished from one another based on achene micro- 100%). morphology. Carex fulta had flat, smooth anticlinal walls, Achene micromorphological characters concave central bodies sharply truncated at the Results from SEM observations of achene mi- apex and lacked regularly arranged satellite bod- cromorphological characters (Table 4) revealed ies (Fig. 5E). These achene surface characters that Carex uda, C. onoei, C. hakonensis, and C. were also seen in C. koyaensis, C. noguchii, and semihyalofructa shared sinuate anticlinal walls C. ruralis (Oda & Nagamasu 2008, 2011), al- and large, slightly convex central bodies (Fig. though regularly arranged satellite bodies are 5A–D). Carex uda had regularly arranged satel- rarely observed in C. ruralis (Oda & Nagamasu lite bodies surrounding the central body with a 2008). The achene surface of the specimen identi- rough platform surface (Fig. 5A). Carex onoei fied asC. aff. fulta (Fig. 5F) and C. fulta (Fig. 5E) also had a rough platform surface and low, honey- were similar. We recorded flat, smooth anticlinal combed anticlinal achene walls (Fig. 5B). By con- walls and concave central bodies in the specimen trast, C. hakonensis and C. semihyalofructa had identified as C. cf. biwensis but observed that the smooth platform surfaces (Fig. 5C and D), and C. satellite bodies were regularly arranged along the hakonensis had thick, high, honeycombed anti- anticlinal walls (on the margin of the platform) clinal walls with relatively small achene surface (Fig. 5G). These characteristics are identical to cells (Fig. 5C). Carex semihyalofructa had solid those in C. capillacea and C. biwensis. June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 79

ation given by Egorova (1985, 1999) Carex sub- Discussion sect. Rarae corresponds to subclade A. Carex subsect. Capitellatae (excluding C. fulta) corre- Morphological characters supporting Carex sponds to Clade II, including C. uda, the type sect. Rarae clades and infrasectional classifica- species of the subsection. Because the species tion represented in subclade B have never been recog- Clade I is supported by perigynia with 2–5 nized as forming an infrageneric taxon, we pro- distinct dorsal veins (Table 1, Fig. 1A), and flat pose Carex subsect. Fultae J. Oda & M. N. Tamu- and smooth anticlinal walls with concave central ra, subsect. nov. for this complex (Fig. 4). bodies on the achene surface (Table 4, Fig. 5E & G). Clade II is supported by perigynia with 8–10 Reexamination of species and varieties of Carex indistinct (or almost invisible) dorsal veins (Table sect. Rarae in Japan 1, Fig. 1B) and sinuate anticlinal walls with more Because Carex koyaensis var. yakushimensis or less convex central bodies (Table 4, Fig. 5A– formed a robust clade (BP 100%) with C. ruralis D). but not with C. koyaensis var. koyaensis, it should Species in subclade A often have rusty dots be treated as C. ruralis var. yakushimensis or C. on the perigynia (Table 1, Fig. 1A) when they are yakushimensis. We prefer the latter, because it mature and/or dried. The achene surface of sub- clearly differs from C. ruralis in the shape of the clade A is characterized by satellite bodies that adaxial leaf surface, which is concave in C. koy- are regularly arranged along the anticlinal wall aensis var. yakushimensis and convex or flat inC. on a smooth platform margin and a dull (not ruralis, although both taxa have very narrow sharp) truncate apex of the central body (Table 4, leaves (<1 mm) (Fig. 5H & I). Fig. 5G). Species of Sublcade B share perigynia Previous studies have suggested that the nar- lacking rusty dots (Table 1) and flat, smooth anti- row leaves of C. yakushimensis are a result of clinal walls. Satellite bodies are lacking (or if dwarfism (Katsuyama & Oda 2009), which is of- present, mostly a few and irregularly arranged), ten observed in plants from Yakushima (Makino and the achene surface has concave central bod- 1913, Sugimoto 1957, Hatusima 1991). Our analy- ies that are sharply truncate at the apex in this ses revealed that narrow leaves are a synapomor- sublcade (Table 4, Fig. 5E). phy of C. ruralis and C. yakushimensis. We have found that morphological characters The undetermined specimen of Carex aff. ful- of both the perigynia and achenes are useful for ta from Inagawa-cho, Hyogo Prefecture, differed identifying the clades determined by our phylo- from C. fulta, in having creeping rhizomes (Fig. genetic tree [based on combined plastid and nu- 3A). It grows on the margins of rice fields at low clear (ITS) DNA regions] for Carex sect. Rarae elevation (ca. 180 m) in warm temperate regions, (Fig. 4). but C. fulta occurs in the cool temperate region of Culm shape, used to identify species com- Honshu (Chubu District and northward). Our mo- plexes (subsections) of Carex sect. Rarae by Ego- lecular phylogenetic analyses revealed it to be sis- rova (1985, 1999), was proven to be of less diag- ter to the clade of C. fulta and C. koyaensis var. nostic value because it does not show synapomor- koyaensis (Fig. 4). Thus, we conclude that these phy with Clade I (Fig. 4). Although most species plants represents a species distinct from C. fulta of Clade I share 3–5 angled culms with dull edges for which we propose the name C. inagawaensis. (Table 1, Fig. 1C) and species of Clade II share The specimen of Carex cf. biwensis collected triangular, sharp-edged culms (Table 1, Fig. 1D), in Okinawa Prefecture and three individuals of C. fulta has Clade II culm characteristics, yet is C. biwensis from Kinki District formed the same embedded in Clade I in our phylogenetic tree clade in our molecular phylogenetic tree (Fig. 4). (Fig. 4). Further, C. cf. biwensis has perigynia less than 2 Based on the description and species enumer- mm long (Fig. 3B), which is a diagnostic feature 80 Acta Phytotax. Geobot. Vol. 70 of C. biwensis (Table 1). Thus, the specimen of C. southernmost edge of its range being in Miyazaki cf. biwensis was confirmed to beC. biwensis. The City (Miyazaki Prefecture). The population on distribution of C. biwensis was previously known Okinawa Island represents a southern range ex- to span Hokkaido, Honshu, Shikoku, Kyushu, tension. Korea, China, and Ussuri (Russia), with the

Taxonomy

Carex sect. Rarae C. B. Clarke in Fl. Brit. Ind. 6: (1999); Y. C. Tang et al. in Fl. China 23: 440 711 (1894); T. V. Egorova in Novit. Syst. Pl. Vasc. (2010); Katsuy., Carex Jap., enl. & rev. ed.: 33 22: 55 (1985), Sedges Russ. Adj. States: 585 (2015). ― Typus: Carex rara Boott.

Key to the subsections, species and varieties of Carex sect. Rarae in Japan

1a. Veins of perigynia distinct; culms usually obscurely 3−5 angled, rarely sharply triangular (C. fulta and C. inagawaensis); silica deposits on achene surface with flat, smooth anticlinal walls and clearly concave central body ...... 2 1b. Veins of perigynia indistinct (or almost invisible); culms always sharply triangular; silica deposit on achene surface with sinuate anticlinal walls and slightly convex central body (C. subsect. Capitellatae) ...... 10 2a. Perigynia usually rusty dotted at maturity or when dried, rarely lacking rusty dots; silica deposits on achene surface always with satellite bodies and central body with dull truncate apex (C. subsect. Rarae) ...... 3 2b. Perigynia always without rusty dots; silica deposits on achene surface usually lacking satellite bodies, central body with sharply truncate apex (C. subsect. Fultae) ...... 5 3a. Perigynia ovoid, 2−3.5(−4) mm long (1. C. capillacea) ...... 4 3b. Perigynia broadly ovoid, 1.8−2 mm long ...... 2. C. biwensis 4a. Perigynia 2−2.8 mm long ...... 1a. C. capillacea var. capillacea 4b. Perigynia 2.8−3.5(−4) mm long ...... 1b. C. capillacea var. sachalinensis 5a. Culms sharply triangular; scales pale green ...... 6 5b. Culms obscurely 3−5 angled; scales rusty brown ...... 7 6a. Culms tufted (at intervals of less than 5 mm), with short rhizomes; leaves 2−3 mm wide ...... 3. C. fulta 6b. Culms widely spaced (at intervals of ca. 2−5 cm), with long, creeping rhizomes; leaves 1.5−2 mm wide ...... 4. C. inagawaensis 7a. Perigynia ovoid; leaves 0.4−0.8 mm wide; pistillate flowers usually 3−5...... 8 7b. Perigynia broadly ovoid; leaves 1.2−4 mm wide; pistillate flowers 5−23 ...... 9 8a. Culms tufted (at intervals of less than 5 mm), with short rhizomes; leaf blade obtusely three angled in cross section ...... 5. C. ruralis 8b. Culms more or less spaced (at intervals of ca. 1 cm), with somewhat creeping rhizomes; leaf blade weakly v-shaped in cross section ...... 6. C. yakushimensis 9a. Culms widely spaced (at intervals of ca. 2.5 cm), with long, creeping rhizomes; leaves 1.2−1.8 mm wide; pistillate flowers 5−10 ...... 7. C. koyaensis 9b. Culms tufted (at intervals of less than 5 mm), with short rhizomes; leaves 2−4 mm wide; pistillate flowers 15−23 ...... 8. C. noguchii 10a. Platform of silica deposits on achene surface rough ...... 11 10b. Platform of silica deposits on achene surface smooth ...... 12 11a. Perigynia lanceolate, 3.5−4 mm long; silica deposits on achene surface with satellite bodies regularly arranged around a central body, with sinuate and solid anticlinal walls ...... 10. C. uda 11b. Perigynia ovoid, 2.5−3 mm long; silica deposits on achene surface lacking satellite bodies, with highly sinuate and honeycombed anticlinal walls ...... 11. C. onoei 12a. Culms tufted (at intervals of less than 5 mm), with short rhizomes; leaves ca. 1 mm wide; perigynia ellipsoid; silica deposits on achene surface with highly sinuate and honeycombed anticlinal walls ...... 9. C. hakonensis 12b. Culms more or less spaced (at intervals of ca. 1−3 cm), with creeping rhizomes; leaves 1.7−2.8 mm wide; perigynia ovoid; silica deposits on achene surface with sinuate and solid anticlinal walls ...... 12. C. semihyalofructa June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 81

Carex subsect. Rarae T. V. Egorova in Novit. low fields, and does not occur in forests. Syst. Pl. Vasc. 22: 56 (1985), Sedges Russ. Adj. States: 587 (1999). ― Typus: Carex rara Boott. Carex subsect. Fultae J. Oda & M. N. Tamura, 1. Carex capillacea Boott, Illust. Carex 1: 44, subsect. nov. tab. 110 (1858). ― Lectotypus: INDIA, Sikkim, Regio temp., 10,000−12,000 ft. alt., J. D. Hooker Carex subsect. Fultae is similar to C. subsect. Rarae, but differs in having the apex of the central bodies of the sili- (LE, n.v.) (Nguyen 1979). ca deposits on the achene surface sharply truncate.

1a. var. capillacea Typus. Carex fulta Franch.

Distribution. Australia, China, India, Indone- Culms sharply triangle or obscurely 3−5 an- sia, Japan (Hokkaido, Honshu, Kyushu), Korea, gled. Perigynia with distinct veins, not dotted at Malaysia, Nepal, New Guinea, New Zealand, the maturity or when dried. Silica deposits on achene Philippines, Russia, Taiwan and Vietnam. surface with smooth platform, flat, smooth anticlinal walls, and a concave central body with a 1b. var. sachalinensis (F. Schmidt) Ohwi in sharply truncate apex, usually lacking satellite Mem. Coll. Sci. Kyoto Imp. Univ., Ser. B, Biol. bodies that are regularly arranged along anticli- 11: 442 (1936). ― Carex uda Maxim. var. sachal- nal walls. inensis F. Schmidt, Reis. Amurl u. Sachal.: 191 (1868). ― Syntypus: RUSSIA, Sakhalin, Im Sumpf am Kussunaibach, Ende Aug, 1860, F. Schmidt 3. Carex fulta Franch. in Bull. Soc. Philom. Par- (LE, n.v.); Kussunai, 4 Jun. 1861, Brylkin (LE, is, ser. 8, 7: 28 (1895). ― Typus: JAPAN, Honshu, n.v.); 20 Juni 1861, Glehn (LE, n.v.). Shiobara, 28 Jun. 1889, U. Faurie 4098 (holo- P!; Carex aomorensis Franch. in Nouv. Arch. iso- KYO!). Mus. Hist. Nat., ser. 3, 8: 198 (1896). ― Carex cap- Distribution. Endemic to Japan (Honshu). illacea Boott var. aomorensis (Franch.) Ohwi in Acta Phytotax. Geobot. 2: 272 (1933). ― Lectotypus: JAPAN, Aomori Pref., environs d'Aomori, 31 4. Carex inagawaensis J. Oda & M. N. Tamura, May 1886, U. Faurie 486 (P, n.v.; iso- KYO!) sp. nov.―Figs. 3A, 5F & 6. (Egorova 1985). Carex inagawaensis is similar to C. fulta, but differs from Distribution. Japan (Hokkaido, N. and C. it in having long, creeping rhizomes. Honshu), Korea, Malaysia and Russia. Typus. JAPAN: Hyogo Pref., Kawabe-gun, Inagawa- cho, Sasao, 19 May 2007, J. Oda, K. Ushijima & T. Ushi- 2. Carex biwensis Franch. in Bull. Soc. Philom. jima 1833 (holo- KYO). Paris, ser. 8, 7: 28 (1895). ― Typus: JAPAN, Shi- ga Pref., Lake Biwa, 30 Apr. 1892, U. Faurie 7835 Herbs perennial (Fig. 6A). Rhizomes long, (holo- P!; iso- KYO!). creeping (Fig. 3A). Culms erect, 10−20 cm long, sharply triangle, with bristles. Basal sheaths light Distribution. Japan (Honshu, Shikoku, Ky- brown. Leaves shorter than culms at anthesis, lat- ushu, Okinawa Isl.) and Korea. er growing to 20 cm long, 1.5−2 mm broad, v- shaped in cross section. Spike (Fig. 6B and C) Notes. Although Tang et al. (2010) merged C. solitary, 5−10 mm long, 5−7 mm broad, upper biwensis with C. rara, we consider them to be part staminate, lower part pistillate (longer than distinct species. Carex biwensis has shorter pe- staminate part). Staminate flowers 3−5, stamens rigynia (1.8–2 mm long) than C. rara. Further, C. 3, scales (Fig. 6D) narrowly ovate, pale green, biwensis is a species of open places, such as fal- 1.8−2.2 mm long, 0.4−0.6 mm wide. Pistillate 82 Acta Phytotax. Geobot. Vol. 70

Fig. 6. Carex inagawaensis J. Oda & M. N. Tamura. A, habit; B and C, spike; D, staminate scale in dorsal view; E, pistillate scale in dorsal view; F, perigynium in dorsal view; G, perigynium in ventral view; H, achene in dorsal view. Bar = 5 cm for A; 5 mm for B and C; 1 mm for D−H (J. Oda, K. Ushijima & T. Ushijima 1833, KYO). June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 83 flowers 5−10, stigmas 3, scales (Fig. 6E) ovate, 7. Carex koyaensis J. Oda & Nagam. in Acta pale green, 1.6−1.8 mm long, 1−1.2 mm wide. Pe- Phytotax. Geobot. 59: 59 (2008). ― Typus: JA- rigynia (Fig. 6F and G) broadly ovoid, light PAN, Wakayama Pref., Ito-gun, Mt. Koya, 830 m green, without rusty dots, 1.8−2.2 mm long, alt., 20 May 2006, J. Oda & S. Yamamoto 1639 1.4−1.6 mm broad, with 2−4 distinct veins, grad- (holo- KYO!). ually tapering to beak, beak to ca. 0.5 mm long, with slightly concave mouth. Achenes (Fig. 6H) Distribution. Endemic to Japan (C. and W. ovoid, trigonous in cross section, light brown, Honshu). 1.2−1.3 mm long, 0.7−0.8 mm broad, stipe 0.1−0.2 mm long. 8. Carex noguchii J. Oda & Nagam. in Acta Phy- Japanese name. Inagawa-harisuge (nov.). totax. Geobot. 61: 148 (2011). ― Typus: JAPAN, Tochigi Pref., Nasushiobara-shi, Ohnuma, ca. Habitats. On ridges of rice fields at ca. 180 m 1,000 m alt., 12 Jun. 2010, J. Oda & T. Noguchi alt. in warm temperate regions. 4181 (holo- KYO!).

Distribution. Known only from the type lo- Distribution. Endemic to Japan (Honshu, cality. Tochigi Pref.).

Other specimens examined. Same as type locality, 14 May 2002, K. Ushijima 8083 (HYO, KYO), 28 Apr. 2004, T. Ushijima 17537 (HYO, KYO). Carex subsect. Capitellatae (Meinsh.) Kük., Pflanzenr. 38: 100 (1909); T. V. Egorova in Novit. Notes. Identified as Carex fulta by Yanai Syst. Pl. Vasc. 22: 59 (1985), Sedges Russ. Adj. (2013). States: 590 (1999). ― Carex sect. Capitellatae Meinsh. in Acta Horti Petrop. 18: 309 (1901); Ohwi in Mem. Coll. Sci. Kyoto Imp. Univ., Ser. 5. Carex ruralis J. Oda & Nagam. in Acta Phyto- B, Biol. 11: 437 (1936); J. Kern & Noot., Fl. Males. tax. Geobot. 59: 57 (2008). ― Typus: JAPAN, 9: 158 (1979). ― Lectotypus: Carex uda Maxim. Shiga Pref., Ohtsu-shi, Mt. Tanokami, May 24 (Egorova 1985). 2003, J. Oda & A. Tominaga 1300 (holo- KYO !).

Distribution. Endemic to Japan (C. Honshu). 9. Carex hakonensis Franch. & Sav., Enum. Pl. Jap. 2: 123 (1877) et 550 (1878). ― Typus: JA- PAN, Kanagawa Pref., in montibus Hakone, L. 6. Carex yakushimensis (Katsuy. & J. Oda) J. Savatier 1409 (holo-P!). Oda & M. N. Tamura, stat. nov. Carex krameri Franch. & Sav., Enum. Pl. Jap. 2: 124 (1877) et 551 (1878). ―Typus: JAPAN, Basionym: Carex koyaensis var. yakushimen- Kanagawa Pref., in montibus Hakone, L. Savatier sis Katsuy. & J. Oda in J. Jap. Bot. 84(3): 192 3492 (holo-P!). (2009). ― Typus: JAPAN, Kagoshima Pref., Yakushima, Hananoego, 1620 m alt., 8 Jun. 2005, Distribution. Japan (Hokkaido, Honshu, Shi- H. Ikeda & N. Yamamoto 05060806 (holo- koku, Kyushu) and Korea. KPM!).

Distribution. Endemic to Japan (Kagoshima 10. Carex uda Maxim. in Mem. Acad. Imp. Sci. Pref., Yakushima). St.-Petersbourg, Divers Savans 9: 303 (1858). ― Typus: RUSSIA, In Laubwalden, am Fusse des 84 Acta Phytotax. Geobot. Vol. 70

Geong-Gebirge, gegenuber Zjanka, am schattin- of the herbaria P, KPM, and KYO. This study was sup- gen moorigen Stellen, 25 May 1855, Maximowicz ported in part by JSPS KAKENHI (Grants-in-Aid for Scientific Research) Grant Number JP25440207 (to M. N. s.n. (LE, n.v.). Tamura).

Distribution. China, Japan (Hokkaido, N. Honshu), Korea and Russia. References

11. Carex onoei Franch. & Sav., Enum. Pl. Jap. 2: Dan, K. & T. Hoshino. 1994. Achene micromorphology of 551 (1878). ― Typus: JAPAN, Honshu, peaty 43 taxa of Carex (Cyperaceae) using scanning electron microscope. Bull. Res. Inst. Nat. Sci. Okayama place, accepted from Japanese botanist Ono, Sa- Univ. Sci, no. 20: 93−111. vatier s.n. (holo?- P!). Egorova, T. V. 1985. Obzor osok (Carex L., Cyperaceae) sekcij Rarae C. B. Clarke. Novit. Syst. Pl. Vasc. 22: Distribution. China, Japan (Hokkaido, N. and 55−61 (in Russian). C. Honshu), Korea and Russia. Egorova, T. V. 1999. The sedges (Carex L.) of Russia and adjacent states. Missouri Botanical Garden Press, St. Louis (in Russian). Notes. Although Egorova (1999) notes that the Farris, J. S., M. Källersjö, A. G. Kluge & C. Bult. 1994. type specimen of C. onoei was absent in P, we Testing significance of incongruence. Cladistics 10: found a specimen labeled “accepted from Ono” 315−319. in P. Hatusima, S. 1991. Flora of the northern Ryukyus. Asahi Printing, Kagoshima (in Japanese). Hoshino, T. 1984. Scanning electron microscopic observation of the surface pattern of achenes in Carex. 12. Carex semihyalofructa Tak. Shimizu in Bull. Hiruzen Res. Inst., no. 10: 59−71 (in Japanese). Acta Phytotax. Geobot. 56: 33 (2005). ― Typus: Jin, X-F & C-Z. Zheng. 2013. Taxonomy of Carex sect. JAPAN, Akita Pref., Ogachi-gun, near Mt. Kurikoma, Rhomboidales (Cyperaceae). Science Press, Beijing. Katsuyama, T. 2015. Carex of Japan, enlarged and revised 1,050 m alt., 7 Jul. 2003, Tak. Shimizu 03-381 ed. Bun-ichi Sogo Shuppan, Tokyo (in Japanese). (holo- KYO!). Katsuyama, T & J. Oda. 2009. Carex koyaensis var. yakushimensis (Cyperaceae), a new variety from Distribution. Endemic to Japan (Akita Pref. to Yakushima Island, Japan. J. Jap. Bot. 84: 191−193. Fukui Pref., in subalpine regions facing the Japan Kern, J. H. & H. P. Nooteboom. 1979. Cyperaceae II. In: C. G. G. J. van Steenis (ed.), Flora Malesiana 9: pp. Sea, Honshu). 107−187. Sijthoff & Noordhoff, Alphen aan den Rijn. Kükenthal, G. 1909. Cyperaceae−Caricoideae. In: Engler, H. G. A. (ed.), Das Pflanzenreich 38: 1−824. Makino, T. 1913. Dwarf plants on uplands of Yakushima We express our sincere gratitude to Prof. Hidetoshi Na- Isl., Bot. Mag. (Tokyo) 27: 220-221 (in Japanese). gamasu for assistance with the micromorphological ob- Nguyen, K. K. 1979. Conspectus Specierum Generis Car- servations and nomenclatural discussion. We extend our ex L. Florae Vietnam. Novit. Syst. Pl. Vasc. 16: 61−82 warm thanks to Mr. Teruo Katsuyama for discussing Car- (in Russian). ex sect. Rarae with the first author (J. Oda). We are in- Oda, J. & H. Nagamasu. 2008. Two new species of sect. debted to Dr. Wataru Shinohara, Dr. Yukie Kato, Dr. No- Capitellatae (Cyperaceae) from Japan. Acta Phyto- buyuki Numakunai, Mr. Tatsunari Noguchi, Mr. Yoshi- tax. Geobot. 59: 55−66. taka Hayashi, Mr. Kazuya Yamawaki, Mr. Kiyoharu Ush- Oda, J. & H. Nagamasu. 2011. Carex noguchii (sect. Ra- ijima, Ms. Tomiko Ushijima, and Ms. Tazuko Watanabe rae, Cyperaceae), a new species from Japan. Acta for providing us with plant materials. We are grateful to Phytotax. Geobot. 61: 145−150. Dr. Koji Yonekura, Dr. Tomoko Fukuda, Dr. Atsuko Oda, J., A. Tanaka, A. Naiki & H. Nagamasu. 2003. Car- Takano, Dr. Nobuko Yamamoto, and Mr. Hiroshi Noda ex jubozanensis (Cyperaceae), a new species from Ja- for the valuable information from the literature, speci- pan. Acta Phytotax. Geobot. 54: 127−135. mens, and DNA experiments. Our thanks are due to Dr. Ohwi, J. 1936. Cyperaceae Japonicae I. Mem. Coll. Sci. Hiroshi Tobe for the critical reading of the manuscript. Kyoto Imp. Univ., Ser. B, Biol. 11: 229−530. Thanks are also given to the directors and staff members Olgun, A. & O. Beyazoglu. 1997. Micromorphological June 2019 Oda & al. – Phylogeny and Taxonomy of Carex in Japan I. C. sect. Rarae 85

studies of Carex section Mitratae (Cyperaceae) in Swofford, D. L. 2002. PAUP*: Phylogenetic Analysis Us- Turkey. Rhodora 99: 368−375. ing Parsimony (*and Other Methods). Version 4 beta Posada, D., & K. A. Crandall. 1998. Modeltest: testing the 10. Sinauer, Sunderland. model of DNA substitution. Bioinformatics 14: Taberlet, P., L. Gielly, G. Pautou & J. Bouvet. 1991. Uni- 817−818. versal primers for amplification of three non-coding Rettig, J. H. 1990. Achene Micromorphology of the Carex regions of chloroplast DNA. Plant Molec. Biol. 17: nigromarginata complex. Rhodora 92: 70−79. 1105−1109. Reznicek, A. A. 1990. Evolution in sedges (Carex, Cy- Tang, Y.-C., S. Zhang & T. Koyama. 2010. Carex sect. peraceae). Can. J. Bot. 68: 1409−1432. Rarae. In: Wu, Z. Y., P. H. Raven & D. Y. Hong (eds.), Roalson, E. H., J. T. Columbus & E. A. Friar. 2001. Phylo- Flora of China 23: 440−442. Science Press, Beijing, genetic relationships in Cariceae (Cyperaceae) based and Missouri Botanical Garden Press, St. Louis. on ITS (nrDNA) and trnT-L-F (cpDNA) region se- Toivonen, H. & T. Timonen. 1976. Perigynium and achene quences: Assessment of subgeneric and sectional re- epidermis in some species of Carex, subg. Vignea lationships in Carex with emphasis on section Acro- (Cyperaceae), studied by scanning electron micros- cystis. Syst. Bot. 26: 318−341. copy. Ann. Bot. Fennici 13: 49−59. Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Waterway, M. J. 1989. Systematic implications of achene Miller, K. C. Siripun, C. T. Winder, E. E. Schilling & micromorphology in Carex section Hymenochlaenae R. L. Small. 2005. The tortoise and the hare II: rela- (Cyperaceae). Can. J. Bot. 68: 630−639. tive utility of 21 noncoding chloroplast DNA se- Wujek, D. E. & F. J. Menapace. 1988. Taxonomy of Carex quences for phylogenetic analysis. Amer. J. Bot. 92: section Folliculatae using achene morphology. Rho- 142−166. dora 88: 399−403. Starr, J. R. & B. A. Ford. 2001. The taxonomic and phylo- Xu, D. H., J. Abe, M. Sakai, A. Kanazawa & Y. Shimam- genetic utility of vegetative anatomy and fruit epider- oto. 2000. Sequence variation of non-coding regions mal silica bodies in Carex section Phyllostachys (Cy- of chloroplast DNA of soybean and related wild spe- peraceae). Can. J. Bot. 79: 362−379. cies and its implications for the evolution of different Starr, J. R., S. A. Harris & D. A. Simpson. 2004. Phylog- chloroplast haplotypes. Theor. Appl. Genet. 101: eny of the unispicate taxa in Cyperaceae tribe Cari- 724–732. ceae I: genetic relationship and evolutionary Scenari- Yanai, M. 2013. Hyogoken san Shokubutsu Zufu (II). os. Syst. Bot. 29: 528−544. Self-publishing, Himeji (in Japanese). Stewart, C. N. Jr. & L. E. Via. 1993. A rapid CTAB DNA Yano, O., H. Ikeda & T. Hoshino. 2010. Phylogeography isolation technique useful for RAPD fingerprinting of the Japanese common sedge, Carex conica com- and other PCR applications. BioTechniques 14: plex (Cyperaceae), based on chloroplast DNA se- 748−750. quence data and chromosomal variation. Amer. J. Sugimoto, J. 1957. On the pygmy plants of Yakusima Is- Bot. 97: 1365–1376. land. Shokubutsu-Shumi 18: 2−10 (in Japanese).

Received May 25, 2018; accepted November 6, 2018