Intravenous Injection of Sirna Directed Against Hypoxia-Inducible

ORIGINAL ARTICLE Intravenous injection of siRNA directed against hypoxia-inducible factors prolongs survival in a Lewis lung carcinoma cancer model F Kamlah1, BG Eul1,SLi1, N Lang1, LM Marsh1, W Seeger1, F Grimminger1, F Rose2 and JHa¨nze1 1Department of Internal Medicine II/V, Justus Liebig University, Giessen, Germany and 2Department of Radiotherapy and Radiooncology, Philipps University Marburg, Marburg, Germany

Different routes for the in vivo administration of synthetic siRNA complexes targeting lung tumors were compared, and siRNA complexes were administered for the inhibition of hypoxia-inducible factor (HIF-1a and HIF-2a). Intravenous jugular vein injection of siRNA proved to be the most effective means of targeting lung tumor tissue in the Lewis lung carcinoma (LLC1) model. In comparison, intraperitoneal injection of siRNA was not suitable for targeting of lung tumor and intratracheal administration of siRNA exclusively targeted macrophages. Inhibition of HIF-1a and HIF-2a by siRNA injected intravenously was validated by immunohistofluorescent analysis for glucose-transporter-1 (GLUT-1), a well-established HIF target protein. The GLUT-1 signal was strongly attenuated in the lung tumors of mice treated with siRNA-targeting HIF-1a and HIF-2a, compared with mice treated with control siRNA. Interestingly, injection of siRNA directed against HIF-1a and HIF-2a into LLC1 lung tumor-bearing mice resulted in prolonged survival. Immunohistological analysis of the lung tumors from mice treated with siRNA directed against HIF-1a and HIF- 2a displayed reduced proliferation, angiogenesis and apoptosis, cellular responses, which are known to be affected by HIF. In conclusion, intravenous jugular vein injection of siRNA strongly targets the lung tumor and is effective in gene inhibition as demonstrated for HIF-1a and HIF-2a. Cancer Gene Therapy (2009) 16, 195–205; doi:10.1038/cgt.2008.71; published online 26 September 2008 Keywords: RNA interference; polyethylenimine; orthotopic; lung cancer; mouse model

Introduction from the pulmonary artery. This model has now been employed to compare different routes of in vivo siRNA Inhibition of gene expression by RNA interference has administration for targeting lung tumors. We analyzed become a well-established tool for functional gene the administration through the jugular vein catheter and analysis in cell culture studies. Its application for in vivo compared it with intratracheal and intraperitoneal admin- studies in tumor biology and for a possible therapeutic istration. Fluorescent-labeled siRNA was employed for intervention is a challenging and promising research field. histological analysis by fluorescence microscopy of Successful transfection of subcutaneous tumor models has cryosections from tumor and organ tissue. been described for synthetic siRNAs complexed with In particular, hypoxia-inducible factors (HIF-1a and polyethylenimine (PEI) that were administered intraper- HIF-2a) were targeted by siRNA in this model. Hypoxia- itoneally.1 The feasibility of this and other routes of inducible factors are dimeric transcription factors con- 3–5 administration for targeting lung tumors by siRNA has sisting of an a- and b-subunit. The a-subunit is not been investigated. stabilized and activated under hypoxic conditions, thus In an earlier study, we described a lung-specific tumor HIF mediates adaptive responses of cells to a hypoxic 6 model employing Lewis lung carcinoma cells (LLC1), environment and improves cell survival. In solid tumors, which were instilled into the trachea.2 In this model, we hypoxic areas with limited nutrient supply are caused by demonstrated that tumor vascularization arises primarily aberrant angiogenesis which is out of balance with the concomitantly growing tumor, resulting in inadequate tumor perfusion. Anemia may also be observed in cancer, Correspondence: Dr J Ha¨ nze, Department of Internal Medicine II, or may be induced by cancer therapy and can further University of Giessen, Klinikstrasse 36, Giessen, D-35392 Hessen, 7 Germany. promote hypoxic areas. Activation of HIF also occurs E-mail: [email protected] through growth factors and genetic alterations to 8 Received 8 January 2008; revised 22 July 2008; accepted 24 August oncogenes and tumor suppressor genes. Both HIF-1 2008; published online 26 September 2008 and HIF-2 induce a heterogeneous group of approxi- siRNA-targeting lung cancer in vivo F Kamlah et al 196 mately 100 target genes identified to date. Most of these addition, siRNA-control was employed as a negative genes can be activated by a common conserved hypoxia- control in comparison to siHIF-1a and siHIF-2a.The responsive DNA element recognized by both HIF-1 and sequence of siRNA-control does not target any gene in the HIF-2.9 Some target genes have also been described that mouse genome and has been tested by micro-array analysis are differentially regulated by HIF-1 and HIF-2. Further- (Dharmacon Inc., Chicago, IL). In cultured LLC1 cells, more, HIF-2a is highly expressed in the lung and in siRNA (final concentration 100 nM) was transfected with endothelial cells.10–12 The in vivo knockdown of HIF-1a Lipofectamine 2000 (lipofectamine) (Invitrogen, Karlsruhe, and HIF-2a in experimental tumor models is of interest Germany) according to the manufacturer’s protocol. After and importance for the analysis of their role in tumor incubation for 24 h in 21% O2,5%CO2 at 37 1C, cells were progression, and may represent a potential therapeutic used for the various experiments. For siRNA transfection option. in vivo, siRNA complexed with the cationic polymer in vivo In this study, different routes of in vivo siRNA jetPEI (PEI) (BIOMOL GmbH, Hamburg, Germany) was administration were assessed for targeting the lung tumor administered by various routes. The nitrogen/phosphate tissue, employing fluorescent-labeled siRNA. Downregu- ratio was adjusted to 1:10. In some experiments, siRNA lation of HIF-1a and HIF-2a by specific siRNAs was complexed with lipofectamine was employed. In animal achieved by intravenous injection of siRNA. Inhibition of experiments, siRNA was administered at a concentration of HIF-1a and HIF-2a in the LLC1 lung tumor resulted in 25 mg per mouse. The siRNA mixture was injected prolonged survival and was related to reduced angiogen- intratracheally, or intravenously through an implanted esis and tumor cell proliferation. jugular vein catheter. The implantation of the jugular vein catheter has been described earlier.13

Animal experiments Materials and methods C57BL/6N mice (5–7 weeks old) were purchased from Cell culture Charles River, Germany. They were maintained under The C57BL/6-derived Lewis lung carcinoma cell line pathogen-free conditions and handled in accordance with (LLC1) was obtained from the American Type Culture the European Communities recommendations for animal Collection (Manassas, VA). Cells were cultured in RPMI- experimentation. 1640 medium (PAN GmbH, Nu¨ rnberg, Germany) sup- plemented with 5% fetal bovine serum (Greiner BioOne, Tumor models Frickenhausen, Germany), penicillin (100 U mlÀ1) and The LLC1 lung tumor model: Tumorigenicity was streptomycin (0.1 mg mlÀ1) (Greiner BioOne) at 37 1Cin assessed by intratracheal instillation of LLC1 cells 6 2 humidified atmosphere containing 5% CO2 in air. A (1 Â 10 cells per 100 ml saline) as described earlier. The hypoxia environment was prepared in a chamber equili- experiments were started 6–10 days later. Subcutaneous brated with a humid gas mixture of 1% oxygen, 5% LLC1 tumor model: Tumorigenicity was assessed by carbon dioxide and 94% nitrogen at 37 1C. Oxygen levels subcutaneous injection of LLC1 cells (5 Â 106 cells per were controlled using a ProOx system (BioSpherix, Ltd., 200 ml saline) into mice. The experiments were started Redfield, NY). when the tumors reached a volume of 100 mm3.

siRNA transfection of cultured cells and in vivo Survival curves The siRNAs were synthesized commercially (Biomers.net LLC1 lung tumor-bearing mice were treated 9 days after GmbH, Ulm, Germany): siHIF-1a-forward: GUCACC tumor initiation by two jugular vein catheter injections of ACAGGACAGUACAdTdT; siHIF-1a-reverse: UGUA siRNAs complexed with PEI with an interval of 2 days. CUGUCCUGUGGUGACdTdT, siHIF-2a-forward: GU Subsequently, survival was monitored. Mice were eu- CACCAGAACUUGUGCACdTdT, siHIF-2a-reverse: thanized when they suffered severely from the lung tumor, GUGCACAAGUUCUGGUGACdTdT; si-Cy3-forward: and were close to death. Survival curves that plot percent UCACCGUCAUCACCACCAUdTdT; si-Cy3-reverse: survival as a function of time were established using the AUGGUGGUGAUGACGGUGAdTdT; si-control-for- Kaplan–Meier algorithm (GraphPad Software Inc., San ward: UAGCGACUAAACACAUCAAdTdT; si-control- Diego, CA). The survival curves were compared employ- reverse: UUGAUGUGUUUAGUCGCUAdTdT. Forward ing the Mantel–Haenszel log-rank test (GraphPad Soft- and reverse strands were annealed at a final concentration ware Inc., San Diego, CA). of 40 mM each by incubation at 95 1C for 1 min and at 37 1C for 1 h in annealing buffer (20 mM potassium Bronchoalveolar lavage acetate, 6 mM HEPES-KOH pH 7.4, 0.4 mM magnesium Bronchoalveolar lavage (BAL) was employed for cell acetate). Cy3 is a fluorescent dye of the cyanine dye analysis by flow cytometry, as described earlier.14 family and was chemically linked to both siRNA strands (si-Cy3-forward and si-Cy3-reverse). Cy3 possesses red Flow cytometry fluorescence with a maximum absorption of 550 nm and The total BAL fluid was centrifuged, washed with PBS a maximum emission of 570 nm. siRNA-Cy3 was and resuspended in 500 ml 1% BSA in PBS. Cells were employed for histological analysis in comparison with directly analyzed using a FACSCanto flow cytometer the siRNA-control that was not labeled by Cy3. In with the FACSDiVa software package (both from BD

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 197 Biosciences). A minimum of 10 000 cells were analyzed of cryosections (5 mm). Cryosections of the lung from the per sample. Gates based on forward and side scatter were LLC1 tumor cancer model were stained with hematox- set to detect the macrophage population. The negative ylin–eosin. The cryosections of Cy3-transfected organs control (siRNA-control transfected animal) were used to and tumors were fixed and stained with 40,6-diamidino-2- set the auto fluorescence of macrophages and compared phenylindole (DAPI) as described below. For immuno- with the macrophages of the siRNA-Cy3 transfected fluorescent staining, the slides were fixed with methanol animal. and acetone (1:1) for 10 min, and washed 3 Â with PBS containing 0.1% BSA and 0.2% Triton X-100. The RNA extraction and reverse-transcription PCR unspecific binding sites were blocked with 3% BSA in Total RNA was extracted by the NucleoSpin procedure PBS for 1 h. The primary antibodies were applied to the (NucleoSpin RNA/Protein, Macherey–Nagel, Germany). sections or chamber slides at a concentration of 1:100 and Total RNA (1 mg) was denatured at 65 1C for 5 min. After incubated for 2 h. After washing, secondary antibodies cooling on ice, the following components were added to were incubated for 1 h at a concentration of 1:1000 at the samples: 4 mlof5Â first strand buffer, 2 mlof40mM room temperature. Counterstaining of the nuclei was deoxynucleotide mixture, 1 ml of random-hexamer primer, performed with 1 mM DAPI (Sigma-Aldrich Chemie 1 ml of 0.1 M dithiothreitol, 1 ml RNase inhibitor (Peqlab, GmbH, Munich, Germany) for 10 min. The following Erlangen, Germany), 1 ml moloney murine leukemia virus primary antibodies were employed: rabbit anti-caspase-3 reverse transcriptase (MMLV) (Invitrogen). After 60 min (Promega Corporation, Madison, WI); rat anti-mouse at 39 1C, reverse transcriptase was inactivated by heating Ki67 (DAKO Deutschland GmbH, Hamburg, Germany); the mixture at 96 1C for 2 min. For the negative control, rat anti-mouse CD31 (Becton Dickinson Labware, Becton MMLV-RT was omitted. Real-time PCR was performed Dickinson and Company, Franklin Lakes); rabbit using the ABI Prism 7300 Detection System (Applied anti-glucose-transporter-1 (GLUT-1) (Abcam Ltd. Biosystems, CA, USA) with SYBR-Green as fluorescent Cambridge, UK). Goat anti-rabbit-Alexa 555 and goat dye, enabling real-time detection of PCR products anti-rat-Alexa 555 (Molecular Probes, Eugene) were according to the manufacturer’s protocol. The cDNA employed as fluorescent-conjugated secondary antibodies. was submitted to real-time PCR using the primer pairs Immunofluorescent microscopy was performed with the listed below. Cycling conditions were 50 1C for 2 min, Leica DMLA Q550/W microscope (Leica Microsysteme 95 1C for 10 min, followed by 45 cycles of 94 1C for 10 s, Vertrieb GmbH, Bensheim, Germany) and Leica Q-Win 54 1C for 10 s, 72 1C for 30 s. For quantification, the target standard software for quantification of the signal. The gene was normalized to porphobilinogen deaminase respective signals were measured and related to the DAPI (PBGD) mRNA as a reference. Real-time data are signal from the respective areas. Five representative presented as DCt (DCt ¼ CtT À CtR ; CtT : threshold cycle sections were evaluated for each condition. of target gene, CtR : threshold cycle of PBGD). The following primer sets ( þ , forward; À, reverse) were employed: PBGD þ : TGTCTGGTAACGGCAATGCG, PBGDÀ: CCCACGCGAATCACTCTCAT; HIF-1a þ : Results TGGTCTAGACAGTGAAGATGAGATG; HIF-1aÀ: TGTGTGTAAGCATTTCTCTCATTTC; HIF-2a þ :GA The aim of our study was to target lung tumor tissue by CGGTGACATGATCTTTCTGTC; HIF-2aÀ: CACTT synthetic siRNA. We compared different routes of siRNA CATCCTCATGAAGAAGTCAC. administration employing fluorescent-labeled siRNA (siRNA-Cy3) for in situ detection by histological fluor- Western blot analysis escent microscopy. We compared injection of siRNA into Cells were lysed in Laemmli sample buffer including 10% the trachea, or administered intraperitoneally or intrave- dithiothreitol. For electrophoretic separation, samples nously into the jugular vein by an implanted catheter. were heated at 100 1C for 5 min and then loaded onto a Initially, siRNA was injected as a complex with PEI, into 7.5% polyacrylamide gel. Western blot analysis of HIF- the trachea of healthy mice. This approach resulted in the 1a and b-actin was performed with a monoclonal HIF-1a rapid death of the mice. Therefore, intratracheal admin- antibody diluted 1:1000 (Novus Biologicals, Littleton) istration of siRNA complexed with lipofectamine was and monoclonal b-actin antibody diluted 1:20 000 (Sigma- attempted. Using this methodology, mice survived and Aldrich Chemie GmbH, Steinheim, Germany) as de- fluorescent siRNA was recovered primarily from the air- scribed earlier.15 Immunoreactive signals were detected by filled areas of the alveoli, within isolated cells (Figure 1a, chemiluminescence (ECL, Amersham, Buckinghamshire, left). A similar observation was obtained by intratracheal England) using a secondary antibody coupled to horse- injection of siRNA as a complex with lipofectamine into radish-peroxidase (Pierce Biotechnology, Rockford). mice with LLC1 lung tumors (Figure 1a, right), where no staining of tumor tissue was observed, but rather of Histological and cytological analysis isolated cells. Analysis of BAL fluid cell populations by Lungs were inflated with Tissue-Tek (Sakura, Tokyo, flow cytometry revealed that these cells were macro- Japan) in 0.9% NaCl (1:1). Other organs and the phages, and were transfected by siRNA-Cy3 with an subcutaneous tumors were embedded in Tissue-Tek. The efficiency of about 40% (Figure 1b). We then assessed the tissues were frozen in liquid nitrogen for the preparation intraperitoneal administration of fluorescent-labeled

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 198 lung LLC1 lung tumor

200µm 100µm

50µm 50µm lipofectamine si Cy3

50µm 100µm si-con H&E

si Cy3 si-con

250 250 450 400 200 200 350 300 150 150 250 Count Count SSC-A (x 1,000) 200 100 100 150

50 50 100 50 0

50 100 150 200 250 102 103 104 105 102 103 104 105 FSC-H (x 1,000) Figure 1 Analyses of lungs and LLC1 lung tumors after intratracheal injection of siRNA-Cy3 (si Cy3) or si RNA-control (si-con) (25 mg) complexed with lipofectamine. (a) Histological analysis from cryosections of lung (left) and LLC1 lung tumor tissue (right) at 42 h are presented. Displayed are the hematoxylin–eosin staining (top) and the merged histofluorescent images from red filter (Cy3) and blue filter (DAPI) exposures (medium and bottom). Representative images from six independent experiments are illustrated. (b) Flow cytometric analysis of bronchoalveolar lavage (BAL) fluid from mice treated as described in (a). Left, typical forward and sideward scatter of macrophages obtained from (BAL) (red). Cy3 detection by flow cytometry from BAL of mice injected with si Cy3, (middle) or si-con (right).

siRNA-complexed with PEI in the subcutaneous LLC1 tissue, which displayed only weak fluorescent signals tumor model and in the LLC1 lung tumor model. This (Figure 2). In the next approach, siRNA-Cy3 was injected route resulted in strong fluorescent signals in the intravenously through an implanted jugular vein catheter subcutaneous tumor tissue compared with the lung tumor as a complex with PEI (Figure 3). Positive fluorescent

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 199 sc LLC1 tumor LLC1 lung tumor

200µm 50µm

50µm 100µm PEI si Cy3 H&E

50µm 50µm si-con

Figure 2 Histological analysis of subcutaneous LLC1 tumor tissue (left) and LLC1 lung tumor tissue (right) 42 h after intraperitoneal injection of siRNA-Cy3 (si Cy3) or siRNA-control (si-con) (25 mg) complexed with PEI. Displayed are the hematoxylin–eosin staining (top) and the merged histofluorescent images from red filter (Cy3) and blue filter (DAPI) exposures (medium and bottom). Representative images from six independent experiments are illustrated. signals were observed in different structures of the healthy HIF-2a were expressed in LLC1 cells at mRNA levels. lung such as vessels, bronchi and cells from the alveolar The HIF-1a mRNA was predominantly expressed com- septum, most likely pneumocytes (Figure 3, left). A strong pared with HIF-2a mRNA, as reflected by the lower DCt siRNA-Cy3 signal was particularly observed in LLC1 lung determined by real-time RT-PCR (Figure 4a, left). tumors. Tumor areas adjacent to vessels, as well as small Furthermore, HIF-1a was strongly induced under hy- tumors, displayed particularly strong signals (Figure 3, poxic conditions at the protein level (Figure 4a, right). right). The other organs analyzed (brain, liver, spleen, The inhibition of HIF-1a and HIF-2a in cultured LLC1 kidney and muscle) displayed no signal. A five-fold cells was then validated by real-time RT-PCR. A single enhanced concentration of siRNA-Cy3 complexed with transfection of siHIF-1a specifically downregulated HIF- PEI did not further improve the transfection efficiency in 1a, and siHIF-2a specifically downregulated HIF-2a. the lung or in the lung tumor tissue. However, under these Simultaneous transfection of LLC1 cells with siHIF-1a conditions, siRNA-Cy3-positive signals were detected in and siHIF-2a downregulated both HIF-1a and HIF-2a some cells of the spleen (data not shown). Similar results (Figure 4b). were obtained by intravenous injection of siRNA-Cy3 For verification of the inhibition of HIF-1a and HIF- complexed with lipofectamine. However, the fluorescent 2a in the in vivo experiments, GLUT-1 was selected, as signal intensity was reduced when compared with siRNA- GLUT-1 is a hypoxia-dependent marker that is depen- Cy3 complexed with PEI (data not shown). In sum, dent upon both HIF-1 and HIF-2 for regulation. intravenous (jugular vein) injection of siRNA as a Furthermore, GLUT-1 can be reliably detected by complex with PEI appeared to be appropriate for targeting immunocytofluorescent or immunohistofluorescent mi- the lung and in particular, lung tumor tissue; whereas croscopy. In the cell culture experiments, combined intraperitoneal injection was limited to the siRNA transfection of LLC1 cells with siHIF-1a and siHIF-2a transfection of subcutaneous tumors. strongly reduced the GLUT-1 signal when compared with As our aim was to inhibit hypoxia-inducible factors by cells treated with the si-control (Figure 5a). The inhibition siRNA in lung tumor tissue, we next analyzed the of GLUT-1 by siHIF-1a and siHIF-2a was observed expression of HIF-1a and HIF-2a. Both, HIF-1a and under normoxic conditions and hypoxic conditions. The

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 200 lung LLC1 lung tumor

100µm 50µm

50µm 50µm PEI si Cy3

50µm 50µm si-con H&E

Figure 3 Histological analysis of lung tissue (left) and LLC1 lung tumor tissue (right) 42 h after intravenous jugular vein catheter injection of siRNA-Cy3 (si Cy3) or siRNA-control (si-con) (25 mg) complexed with PEI. Displayed are the hematoxylin–eosin staining (top) and the merged histofluorescent images from red filter (Cy3) and blue filter (DAPI) exposures (medium and bottom). Representative images from six independent experiments are illustrated.

induction of GLUT-1 under hypoxic conditions was Discussion clearly evident. Next, GLUT-1 staining was assessed after in vivo In this study, different routes of in vivo siRNA adminis- jugular vein catheter injection of siHIF-1a and siHIF-2a. tration were assessed, with the primary aim being to Strongly reduced GLUT-1 signals were observed in attain transfection of lung tumor tissue in an LLC1 tumor cryosections from LLC1 lung tumors, when compared model. We compared intratracheal, intraperitoneal and with those treated with si-control (Figures 5b and c). intravenous injection of fluorescent-labeled siRNA and These results demonstrate that intravenous injection of analyzed its distribution within the healthy lung, the lung siRNA worked efficiently when applied for inhibition of tumor tissue and other organs. HIF-1a and HIF-2a in LLC1 lung tumors. The results revealed that (1) intravenous injection of The progression of LLC1 lung tumors in mice after siRNA complexed with PEI by jugular vein catheter was in vivo treatment with siHIF-1a and siHIF-2a was then appropriate for targeting the lung tumor tissue. Other assessed, and compared with mice treated with si-control. organs and tissues studied were not affected by this route. Nine days after tumor initiation, siHIF-1a and siHIF-2a (2) Intratracheal injection of siRNA in complex with or si-control were injected intravenously, two times with lipofectamine primarily targeted lung macrophages, an interval of 2 days. Subsequently, mice survival was whereas siRNA in complex with PEI was lethal for the monitored. Interestingly, survival was significantly pro- mice. In addition, (3) jugular vein catheter administration longed in the siHIF-1a- and siHIF-2a-treated mice of siHIF-1a and siHIF-2a strongly suppressed the HIF-1- (Figure 6a). For further characterization of the effects and HIF-2-dependent GLUT-1 in the lung tumor tissue, of siHIF-1a and siHIF-2a treatment, angiogenesis, as assessed by immunohistofluorescent microscopy. proliferation and apoptosis were assessed. The CD31 Furthermore, the consequence of HIF-1a and HIF-2a staining of endothelial cells indicating angiogenesis was inhibition with regard to tumor progression in the LLC1 reduced in the LLC1 lung tumors from the siHIF-1a- and lung tumor model was assessed. It was evident that siHIF-2a-treated mice. A reduction in staining for (4) proliferation and angiogenesis were significantly in- caspase-3 indicating apoptosis and Ki67 indicating pro- hibited in siHIF-1a- and siHIF-2a-transfected lung tumors. liferation was observed (Figures 6b and c). This was accompanied by prolonged survival of the mice.

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 201 12 lished DNA and RNA transfection techniques in cultured HIF-1α 10 HIF-2α cells. Therefore, our studies were performed with complexes of siRNA and cationic polymers (PEI) or cationic 8 HIF-1α 6 lipids (lipofectamine) for stabilization of siRNA, and enhancement of cellular siRNA uptake. However, in our Ct 4 β-actin ∆ experiments, intratracheal injection of PEI-complexed 2 N H siRNA was lethal for mice. Toxic effects of PEI in lung 0 have been described.1 Therefore, we also tested intra- -2 tracheal administration of siRNA complexed with lipo- -4 fectamine. In this case, mice survived, however, siRNA uptake was observed almost exclusively in macrophages, HIF-1α HIF-2α 15 as determined by flow cytometry of cells from bronch- * oalveolar lavages. 13 5 * Our approach targeting the lung by intravenous 3 * * Ct 11 1 ∆ (jugular vein) injection with siRNA in a complex with Ct ∆ -1 9 either PEI was the most successful in achieving distribu- -3 tion to all parts of the lung. Vessels, bronchi and cells of -5 7 the alveolar septum, most likely presenting pneumocytes, si-con si 1 si 2 si 1+2 si-con si 1 si 2 si 1+2 were all targeted (Figure 3). This approach appeared to Figure 4 Expression of HIF-1a and HIF-2a in LLC1 cells. (a) Left: specifically target the lung tumor, as all other organs Real-time RT-PCR analysis of HIF-1a and HIF-2a mRNA levels. The investigated did not exhibit fluorescent signals, with the DCt values for HIF-1a and HIF-2a are displayed relative to exception of some spleen cells when a five-fold higher porphobilinogen deaminase (PBGD) mRNA. HIF-1a mRNA ap- dose of siRNA complexed with PEI was injected. peared to be expressed at much higher levels than was HIF-2a. Interestingly, fluorescent siRNA signals were stronger in Right: western blot analysis of HIF-1a and b-actin from LCC1 cells lung tumor tissue when compared with the healthy lung under normoxic (N) and hypoxic (H) conditions. (b) Real-time RT- PCR analysis of HIF-1a and HIF-2a mRNA levels after transfection tissue. Particularly, tumor areas adjacent to vessels as well of cultured LLC1 cells with either control siRNA (si-con) or siRNA as small tumors displayed strong signals (Figure 3). In this targeted against HIF-1a (si 1), or HIF-2a (si 2), or both together regard, an earlier study of our group has shown that the (si 1 þ 2). HIF-1a is specifically reduced by (si 1) as well as by the pulmonary artery plays a major role in delivering blood 2 mixture of both (si 1 þ 2). HIF-2a is specifically reduced by (si 2) as supply to LLC1 lung tumors. This finding is in well as by the mixture of both (si 1 þ 2). Data reflect the mean± accordance with the observation that jugular vein catheter s.e.m. (n ¼ 4; *Po0.05, paired t-test). injection of PEI-complexed siRNA is particularly appropriate for targeting of lung tumor tissue through the pulmonary artery. The finding that LLC1 lung cancer tissue was transfected by siRNA with a higher efficiency Several administration routes for targeting different than healthy lung tissue is most likely because of tissues and organs by siRNA have been described (for anatomical and functional changes to the tumor vessels.7 review, see Aigner16). Administration of naked siRNA These vessels exhibit structural deficiencies, with fenestra- has been performed by high pressure tail vein injection. tions resulting in leakiness which may facilitate the escape This has been performed both in the context of Fas- of siRNA to tumor cells. In comparison, the intraper- mediated apoptosis in acute liver failure, and to inhibit itoneal injection of siRNA in a complex with PEI for gene hepatitis virus B replication.17–19 This approach primarily inhibition in subcutaneous tumor models has been targeted the liver. Other organs investigated, particularly described.1 Intraperitoneal administration was included the lung, were less affected by siRNA employing this in this study as a reference technique. However, it approach. A disadvantage of this procedure is that it is appeared unsuitable for targeting of the lung tumor accompanied by strong volume loading, and it is not tissue. Intraperitoneal injection of siRNA may have the suitable for therapeutic approaches. Further approaches disadvantage that not all siRNA is taken up by the with naked siRNA comprise local administration, for circulation and thus a considerable amount of injected example, intradermal, intranasal, subretinal, intraocular siRNA is lost. However, intravenous injection of siRNA and intratumoral injection or direct injection into the by jugular vein catheter may have the advantage that the liver. Intratracheal injection for directly targeting the lung injected siRNA is passing the lung circulation much more with naked siRNA in a model of septic acute lung injury concentrated because of limited dilution when compared has been performed.20 This study used high amounts of with intraperitoneal injection. A second advantage may siRNA (75 mg) compared with our study (25 mg). One be the diminished possibility for siRNA to adhere to major disadvantage of applying naked siRNA is that the blood vessel walls prior to entering the pulmonary artery. siRNA is not protected from nuclease degradation by Jugular vein catheter injection of siRNA was applied RNase and nucleases within the blood. Furthermore, the for the inhibition of HIF-1a and HIF-2a in the LLC1 cellular uptake of siRNA occurs spontaneously only at lung tumor model. Both HIF subtypes were simulta- low levels, and can be facilitated by chemical transfection neously inhibited, as HIF-1 and HIF-2 share common procedures, a principle that is well known from estab- target genes6 including GLUT-1,21,22 which was employed

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 202 as a marker for HIF-1a and HIF-2a downregulation. The growth arrest, which promotes tumor cell survival.6,23 simultaneous knockdown of both HIF-1a and HIF-2a Furthermore, HIF-dependent induction of ATP-generat- has the advantage that potential compensatory upregula- ing metabolic pathways adapts cells to the limited oxygen tion of common targets by the other subtype is avoided. and nutrient supply. In this respect, various levels are Hypoxia-inducible factors are known to affect tumor affected, such as glucose uptake (by GLUT-1),21,22 growth at intracellular and paracrine levels. Under enhancement of expression or activity of glycolytic hypoxic conditions, HIF favors apoptosis and induces enzymes that convert glucose to pyruvate, and further

si-con si 1+2 si-con si 1+2 GLUT-1 DAPI

normoxia hypoxia

GLUT-1 DAPI

LLC1 lung tumor 35

30 si-con 25

15 GLUT-1/DAPI 10 *

si 1+2 5

0 si-con si 1+2 Figure 5 Immunocyto- and immunohistofluorescent analyses of GLUT-1 after inhibition of HIF-1a and HIF-2a by siRNA. (a) Immunocyto- fluorescence of GLUT-1 in LLC1 cells cultured under normoxic and hypoxic conditions after transfection with siRNA-control (si-con) or a mixture of siRNA against HIF-1a and HIF-2a (si 1 þ 2) (the scale bar corresponds to 50 mm. Representative images from three independent experiments have been selected). (b) Immunohistofluorescent analysis of GLUT-1 in cryosections from LLC1-derived lung tumors after injection of siRNA- control (si-con) or a mixture of siRNA against HIF-1a and HIF-2a (si 1 þ 2) The scale bar corresponds to 50 mm. Representative images from five independent experiments have been selected. (c) Quantitative analysis of GLUT-1 relative to DAPI from the experiments described in (b). Data reflect the mean±s.e.m. (n ¼ 5; *Po0.05, unpaired t-test).

Figure 6 Analysis of LLC1 lung tumors after intravenous injection of siRNA directed against both HIF-1a and HIF-2a (si 1 þ 2) or control siRNA (si-con), by jugular vein catheter. (a) Survival curves of LLC1 lung tumor-bearing mice that were treated with si 1 þ 2 or si-con. The siRNAs were injected at the ninth and eleventh days after tumor initiation, as indicated by the arrows. Survival was significantly prolonged in the si 1 þ 2-treated group (significant differences P ¼ 0.027, n ¼ 7, log-rank test). (b) Immunohistofluorescent analysis of cryosections from LLC1 lung tumors treated with si 1 þ 2 or si-con. Microscopic fluorescent detection was performed with an antibody against CD31 (indicating angiogenesis), caspase-3 (indicating apoptosis) or Ki67 (indicating proliferation). The scale bar corresponds to 50 mm. Representative images from four independent experiments are illustrated. (c) Quantitative analysis of cryosections from LLC1 lung tumors treated with si 1 þ 2 or si-con as described in (b). The intensity of the fluorescent signal was determined relative to DAPI in the LLC1 lung tumor area (see Materials and methods). Data reflect the mean±s.e.m. (n ¼ 4; *Po0.05, unpaired t-test).

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 203 to lactate by LDH-A.24–26 At the mitochondrial level, tions.24,25,27 The overall increase in ATP generation by pyruvate uptake is attenuated and mitochondrial respira- glycolysis directs metabolism in favor of tumor cell tion at complex IV is optimized for hypoxic condi- proliferation. At the paracrine level, HIF induces various

100 si-con

si 1+2

50 Survival (%)

0 0 5 10 15 20 25 Days after inoculation

si-con si 1 +2 CD31 Caspase-3 Ki67

red filterDAPI red filter DAPI

60 60 60

50 50 50

40 40 40

30 30 30 * Ki67/DAPI CD31/DAPI 20 20 20 Caspase-3/DAPI * 10 10 10 * 0 0 0 si-con si 1+2 si-con si 1+2 si-con si 1+2

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 204 growth factor and receptor systems (for example, VEGF, and imaging with micro- and flat-panel computed tomo- VEGFR2, angiopoetins and ephrins), which initiate and graphy. Am J Pathol 2005; 167: 937–946. maintain angiogenesis.28 3 Wang GL, Jiang BH, Rue EA. Hypoxia-inducible-factor 1 is After inhibition of HIF-1a and HIF-2a by siRNA a basic-helix-loop-helix-PAS heterodimer regulated by in vivo, a strong downregulation of GLUT-1 in the tumor cellular O2 tension. Proc Natl Acad Sci USA 1995; 92: tissue was observed, as well as in the cell culture 5510–5514. 4 Wang GL, Semenza GL. Characterization of hypoxia- experiments. Interestingly, mice with LLC1 lung tumors inducible factor 1 and regulation of DNA binding activity treated with siHIF-1a and siHIF-2a displayed signifi- by hypoxia. J Biol Chem 1993; 268: 21513–21518. cantly prolonged survival. Histological analysis of the 5 Wang GL, Semenza GL. General involvement of hypoxia- tumors revealed attenuated proliferation and angiogenesis inducible factor 1 in transcriptional response to hypoxia. as possible causes for prolonged survival. Proc Natl Acad Sci USA 1993; 90: 4304–4308. Differential effects exerted by either HIF-1a or HIF-2a 6 Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev in tumor growth have not been addressed in this study Cancer 2003; 3: 721–732. (for review see Gordan et al.29). Also, effects which were 7 Vaupel P, Kallinowski F, Okunieff P. Blood flow, oxygen mediated by downregulation of HIF-1a and HIF-2a in and nutrient supply, and metabolic microenvironment of either endothelial cells or tumor cells cannot be distin- human tumors: a review. Cancer Res 1989; 49: 6449–6465. guished by this study, as both cell types were targeted by 8 Blancher C, Moore JW, Robertson N, Harris AL. Effects of siRNA. In this respect, two other studies warrant ras and von Hippel-Lindau (VHL) gene mutations on hypoxia-inducible factor (HIF)-1alpha, HIF-2alpha, and mention. The specific disruption of HIF-1a in endothelial vascular endothelial growth factor expression and their cells generated mice which exhibited normal vascular 0 30 regulation by the phosphatidylinositol 3 -kinase/Akt signal- development. However, angiogenesis of solid tumors ing pathway. Cancer Res 2001; 61: 7349–7355. was strongly inhibited, most likely because of down- 9 Wenger RH, Stiehl DP, Camenisch G. Integration of oxygen regulation of VEGF and VEGFR2. In another study, a signaling at the consensus HRE. Sci STKE 2005; 2005: re12. dominant-negative HIF-2a was employed for the inhibi- 10 Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y, tion of both HIF-1 and HIF-2 in endothelial cells.31 These Fujii-Kuriyama Y. A novel bHLH-PAS factor with close mice exhibited lethal cardiovascular defects during sequence similarity to hypoxia-inducible factor 1alpha embryogenesis. Thus, both studies demonstrated that regulates the VEGF expression and is potentially involved HIF-1a and HIF-2a expressed in endothelial cells are in lung and vascular development. Proc Natl Acad Sci USA essential for induction of angiogenesis during develop- 1997; 94: 4273–4278. ment and for tumor angiogenesis. 11 Flamme I, Frohlich T, von Reutern M, Kappel A, Damert A, Risau W. HRF, a putative basic helix-loop-helix-PAS- Taken together, our study revealed that jugular vein domain transcription factor is closely related to hypoxia- catheter injection of siRNA in complex with PEI was a inducible factor-1 alpha and developmentally expressed in successful route for targeting lung tumor tissue by blood vessels. Mech Dev 1997; 63: 51–60. synthetic siRNA. To our knowledge, this is the first 12 Warnecke C, Zaborowska Z, Kurreck J, Erdmann VA, Frei study that reports in vivo transfection of synthetic siRNA U, Wiesener M et al. Differentiating the functional role of for gene inhibition in a lung tumor. This strategy was hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha applied for the inhibition of both HIF-1a and HIF-2a, (EPAS-1) by the use of RNA interference: erythropoietin is which resulted in prolonged survival of the tumor-bearing a HIF-2alpha target gene in Hep3B and Kelly cells. FASEB J mice, an effect attributed to decreased cell proliferation 2004; 18: 1462–1464. and angiogenesis. 13 Schaefer MB, Ott J, Mohr A, Bi MH, Grosz A, Weissmann N et al. Immunomodulation by n-3- versus n-6-rich lipid emulsions in murine acute lung injury—role of platelet- Acknowledgements activating factor receptor. Crit Care Med 2007; 35: 544–554. 14 Maus UA, Koay MA, Delbeck T, Mack M, Ermert M, We thank Christiane Hild and Gabriele Dahlem for Ermert L et al. Role of resident alveolar macrophages excellent technical assistance. We thank Dr Rory Morty in leukocyte traffic into the alveolar air space of intact for proofreading of the paper. This work was supported mice. Am J Physiol Lung Cell Mol Physiol 2002; 282: by a Research Grant of the University Medical Center L1245–L1252. Giessen and Marburg and by the Excellence Cluster 15 Eul B, Rose F, Krick S, Savai R, Goyal P, Klepetko W et al. Cardiopulmonary System (DFG). Impact of HIF-1alpha and HIF-2alpha on proliferation and migration of human pulmonary artery fibroblasts in hypoxia. FASEB J 2006; 20: 163–165. 16 Aigner A. Gene silencing through RNA interference (RNAi) References in vivo: strategies based on the direct application of siRNAs. J Biotechnol 2006; 124: 12–25. 1 Urban-Klein B, Werth S, Abuharbeid S, Czubayko F, 17 Giladi H, Ketzinel-Gilad M, Rivkin L, Felig Y, Nussbaum Aigner A. RNAi-mediated gene-targeting through systemic O, Galun E. Small interfering RNA inhibits hepatitis B virus application of polyethylenimine (PEI)-complexed siRNA in replication in mice. Mol Ther 2003; 8: 769–776. vivo. Gene Therapy 2005; 12: 461–466. 18 Klein C, Bock CT, Wedemeyer H, Wustefeld T, Locarnini S, 2 Savai R, Wolf JC, Greschus S, Eul BG, Schermuly RT, Dienes HP et al. Inhibition of hepatitis B virus replication in Ha¨ nze J et al. Analysis of tumor vessel supply in Lewis lung vivo by nucleoside analogues and siRNA. Gastroenterology carcinoma in mice by fluorescent microsphere distribution 2003; 125: 9–18.

Cancer Gene Therapy siRNA-targeting lung cancer in vivo F Kamlah et al 205 19 Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J et al. regulating mitochondrial oxygen consumption. Cell Metab RNA interference targeting Fas protects mice from fulmi- 2006; 3: 187–197. nant hepatitis. Nat Med 2003; 9: 347–351. 26 Fantin VR, St-Pierre J, Leder P. Attenuation of LDH-A 20 Lomas-Neira JL, Chung CS, Wesche DE, Perl M, Ayala A. expression uncovers a link between glycolysis, mitochondrial In vivo gene silencing (with siRNA) of pulmonary expression physiology, and tumor maintenance. Cancer Cell 2006; 9: of MIP-2 versus KC results in divergent effects on 425–434. hemorrhage-induced, neutrophil-mediated septic acute lung 27 Fukuda R, Zhang H, Kim JW, Shimoda L, Dang CV, injury. J Leukoc Biol 2005; 77: 846–853. Semenza GL. HIF-1 regulates cytochrome oxidase subunits 21 Raval RR, Lau KW, Tran MG, Sowter HM, Mandriota SJ, to optimize efficiency of respiration in hypoxic cells. Cell Li JL et al. Contrasting properties of hypoxia-inducible 2007; 129: 111–122. factor 1 (HIF-1) and HIF-2 in von Hippel-Lindau-associated 28 Ha¨ nze J, Weissmann N, Grimminger F, Seeger W, Rose F. renal cell carcinoma. Mol Cell Biol 2005; 25: 5675–5686. Cellular and molecular mechanisms of hypoxia-inducible 22 Ebert BL, Firth JD, Ratcliffe PJ. Hypoxia and mitochondrial factor driven vascular remodeling. Thromb Haemost 2007; inhibitors regulate expression of glucose transporter-1 via distinct 97: 774–787. Cis-acting sequences. JBiolChem1995; 270: 29083–29089. 29 Gordan JD, Thompson CB, Simon MC. HIF and c-Myc: 23 Carmeliet P, Dor Y, Herbert JM, Fukumura D, Brusselmans sibling rivals for control of cancer cell metabolism and K, Dewerchin M et al. Role of HIF-1alpha in hypoxia- proliferation. Cancer Cell 2007; 12: 108–113. mediated apoptosis, cell proliferation and tumour angiogen- 30 Tang N, Wang L, Esko J, Giordano FJ, Huang Y, Gerber esis. Nature 1998; 394: 485–490. HP et al. Loss of HIF-1alpha in endothelial cells disrupts a 24 Kim JW, Tchernyshyov I, Semenza GL, Dang CV. HIF-1- hypoxia-driven VEGF autocrine loop necessary for tumor- mediated expression of pyruvate dehydrogenase kinase: a igenesis. Cancer Cell 2004; 6: 485–495. metabolic switch required for cellular adaptation to hypoxia. 31 Licht AH, Muller-Holtkamp F, Flamme I, Breier G. Cell Metab 2006; 3: 177–185. Inhibition of hypoxia-inducible factor activity in endothelial 25 Papandreou I, Cairns RA, Fontana L, Lim AL, Denko NC. cells disrupts embryonic cardiovascular development. Blood HIF-1 mediates adaptation to hypoxia by actively down- 2006; 107: 584–590.

Cancer Gene Therapy