Activation of a Subset of Human NK Cells upon Contact with Plasmodium falciparum -Infected Erythrocytes

This information is current as Katerina Artavanis-Tsakonas, Konstantina Eleme, Karina L. of October 1, 2021. McQueen, Nathalie W. Cheng, Peter Parham, Daniel M. Davis and Eleanor M. Riley J Immunol 2003; 171:5396-5405; ; doi: 10.4049/jimmunol.171.10.5396 http://www.jimmunol.org/content/171/10/5396 Downloaded from

References This article cites 37 articles, 12 of which you can access for free at: http://www.jimmunol.org/content/171/10/5396.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on October 1, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Activation of a Subset of Human NK Cells upon Contact with Plasmodium falciparum-Infected Erythrocytes1

Katerina Artavanis-Tsakonas,2* Konstantina Eleme,† Karina L. McQueen,‡ Nathalie W. Cheng,‡ Peter Parham,‡ Daniel M. Davis,† and Eleanor M. Riley3*

Human NK cells are the earliest source of the protective cytokine IFN-␥ when PBMC from nonimmune donors are exposed to Plasmodium falciparum-infected RBC (iRBC) in vitro. In this study, we show that human NK cells form stable conjugates with iRBC but not with uninfected RBC and that induction of IFN-␥ synthesis is dependent on direct contact between the NK cell and the iRBC. NK cells respond to iRBC only in the presence of a source of IL-12/IL-18 and the subset of NK cells that preferentially respond to iRBC express high levels of the lectin-like receptor CD94/NKG2A. There is heterogeneity between donors in their ability to respond to iRBC. DNA analysis has revealed considerable heterogeneity of killer Ig-like receptor (KIR) genotype among the donor population and has identified 21 new KIR allelic variants in the donors of African and Asian descent. Importantly, we Downloaded from find evidence for significant associations between KIR genotype and NK responsiveness to iRBC. This emphasizes the need for large-scale population-based studies to address associations between KIR genotype and susceptibility to malaria. The Journal of Immunology, 2003, 171: 5396–5405.

epeated or prolonged exposure to malaria infection in Activation of NK cells, measured as enhanced lytic activity against humans eventually leads to the development of clinical the NK-sensitive cell line K562, has been reported in children with R immunity such that, despite remaining susceptible to in- acute Plasmodium falciparum infections (7) and NK cells derived http://www.jimmunol.org/ fection, parasite replication is controlled and the infection is elim- from Kenyan adults are reportedly able to lyse P. falciparum iRBC inated without the development of clinical signs and symptoms. It (8). We have previously shown (3) that NK cells are the earliest is now generally accepted that acute infections are controlled by producers of IFN-␥, with numbers of IFN-␥ϩ NK cells peaking cellular immune mechanisms, possibly augmented by cytophilic between 15 and 24 h after stimulation of human PBMC with live Abs, which are absolutely dependent on the macrophage-activating P. falciparum-infected erythrocytes. cytokine IFN-␥ (reviewed in Ref. 1). Cells of the adaptive immune In many infections, NK activation appears to occur principally response, primed either by previous malaria infection or by expo- in a bystander fashion, i.e., in response to production of cytokines ␥ sure to cross-reacting Ags, constitute an important source of IFN- such as IL-12 and IL-18 from monocyte-macrophages and den- by guest on October 1, 2021 ␥ (reviewed in Ref. 2). In addition, IFN- is also produced by cells dritic cells (9). Although activation of human NK cells by P. fal- of the innate immune system, notably NK cells, following expo- ciparum iRBC (as assessed by IFN-␥ production) is partially de- 4 sure to malaria-infected RBC (iRBC) (3). Importantly, evidence pendent on IL-12 and IL-18, heterogeneity in the magnitude of the from experimental infections shows that parasite growth can be mod- NK response among different donors cannot be explained by a lack ulated very early during primary human malaria infections (4), sug- of either IL-12 or IL-18 (3). Taking these observations together gesting that innate immune responses may contribute to their control. with previous reports of direct lysis of iRBC by human NK cells NK cells represent an important early source of IFN-␥ during (8), we hypothesized that signaling via specific NK receptors primary murine malaria infections and NK depletion leads to a might also be required for optimal activation of NK cells to pro- more rapid increase in parasitemia and higher mortality (5, 6). duce IFN-␥. NK cells express both activating and inhibitory receptors. Non- polymorphic NK receptors include the inhibitory C-type lectin *Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, United Kingdom; †Department of Biological Sciences, CD94:NKG2 heterodimers which recognize HLA-E (10), activat- Imperial College London, London, United Kingdom; and ‡Departments of Structural ing NKG2D homodimers which bind stress-inducible ligands (11, Biology and Microbiology and Immunology, Stanford University Medical School, Stanford, CA 94305 12), and activating Ig-like natural cytotoxicity receptors (NCRs) Received for publication April 25, 2003. Accepted for publication August 13, 2003. NKp30, NKp44, and NKp46 (13). The natural ligands for NCRs The costs of publication of this article were defrayed in part by the payment of page are not well defined, although recent research suggests that NKp30 charges. This article must therefore be hereby marked advertisement in accordance may interact with ligands on dendritic cells and that NKp46 binds with 18 U.S.C. Section 1734 solely to indicate this fact. viral hemagglutinins (14, 15). The known ligands for the highly 1 This work was supported by grants from the Wellcome Trust, the National Institutes polymorphic killer Ig-like receptors (KIR) are all HLA class I of Health, and the U.K. Medical Research Council. K.L.M. is supported by a fellow- ship from the Cancer Research Institute. molecules; however, it has been suggested that activating KIR, 2 Current address: Department of Pathology, Harvard Medical School, 200 Longwood which interact with the immune tyrosine-based activating motif- Avenue, Boston, MA 02115. containing adaptor signaling molecule DAP12 rather than carrying 3 Address correspondence and reprint requests to Dr. Eleanor M. Riley, Department of the inhibitory immune tyrosine-based inhibitory motif in their in- Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, tracellular domain, may have evolved to recognize pathogen-spe- Keppel Street, London WC1E 7HT, U.K. E-mail address: [email protected] cific ligands (16, 17). 4 Abbreviations used in this paper: iRBC, infected RBC; uRBC, uninfected RBC; NCR, natural cytotoxicity receptor; KIR, killer cell Ig-like receptor; MFI, mean flu- In this study, we show that direct contact between NK cells and orescence intensity; UPM, universal primer mix. parasitized erythrocytes does occur and that it is necessary for

Copyright © 2003 by The American Association of Immunologists, Inc. 0022-1767/03/$02.00 The Journal of Immunology 5397

induction of IFN-␥ synthesis. NK activation is accompanied by mented with recombinant human IL-12 and IL-18 (PeproTech, Rocky Hill, enhanced expression of specific regulatory receptors, indicating NJ) at concentrations ranging from 0.1 to 10 ng/ml. All cultures were direct recognition of the iRBC by NK cell receptors. Furthermore, incubated for 24 h before analysis by flow cytometry. the cell donors were extremely heterogeneous both with respect to Generation of human NK cell clones their NK response to malaria and their KIR repertoire, and a sig- nificant association was observed between the NK-iRBC response PBMC, from which NK cells were to be derived, were cultured for 1 wk with irradiated 721.221 cells (20,000 rad) in a 4:3 ratio in RPMI 1640 and KIR genotype. These findings emphasize the need for more medium containing 10% human serum (AB; Sigma-Aldrich), 2 mM L- extensive examination of KIR genotypes in malaria-exposed pop- glutamine, 1ϫ nonessential amino acids, 1 mM sodium pyruvate, 50 U/ml ulations to explore associations among KIR genotype, NK re- penicillin-streptomycin, and 50 ␮M 2-ME (all from Invitrogen). The cul- sponses to malaria, and susceptibility to malaria. tured PBMC were stained with FITC-conjugated anti-CD3 mAb (HIT3a; BD PharMingen, Cowley, U.K.) and CD3Ϫ cells were sorted by FACS to be one cell per well of a 96-well plate containing irradiated 105 allogeneic Materials and Methods PBMC (6,000 rad) and 5 ϫ 103 irradiated RPMI8866 cells (12,000 rad) in P. falciparum DMEM supplemented with 10% human serum, 30% Nutrient Mixture F-12 (Ham’s),2mML-glutamine, 1ϫ nonessential amino acids, 1 mM sodium P. falciparum parasites of the 3D7 strain were cultured in vitro as described pyruvate, 50 U/ml penicillin-streptomycin, 50 ␮M 2-ME, 100 U/ml human previously (3). Cultures were routinely screened for Mycoplasma contam- rIL-2 (Roche, Basel, Switzerland) (referred to hereafter as DMEM plus ination by PCR (BioWhittaker, Wokingham, U.K.) and shown to be My- supplements), and 1 ␮g/ml PHA (Sigma-Aldrich). Ninety-six-well plates coplasma free. Mature schizont-infected erythrocytes (iRBC) were har- containing the irradiated cells had been prepared on the previous day and vested by centrifugation through 60% Percoll (Sigma-Aldrich, Poole, incubated overnight at 37oCin5%CO. U.K.), washed, and resuspended in culture medium. Washed uninfected 2 NK clones that had undergone expansion were split every 4Ð5 days in

erythrocytes (uRBC) were used as controls. Downloaded from a 1:1 ratio in DMEM plus supplements and were periodically monitored to Ϫ ϩ PBMC be CD3 and CD56 by flow cytometry. Several NK clones from the same donor were mixed together to achieve a polyclonal line of pure NK cells Adult blood donors were recruited at the London School of Hygiene and that retained the ability to respond to iRBC and to ensure that sufficient Tropical Medicine through a volunteer blood donation system. The study numbers of cells from the same population were available for assay. Assays was approved by the London School of Hygiene and Tropical Medicine for responsiveness to iRBC were performed at least 4 days after restimu- Ethical Review Committee, and informed consent was obtained from all lation with fresh IL-2, i.e., on “resting” NK cells. volunteers. PBMC were separated from heparinized venous blood on a http://www.jimmunol.org/ Histopaque (Sigma-Aldrich) density gradient, washed twice in RPMI 1640, Testing the response of purified NK cells to iRBC and resuspended at a concentration of 1 ϫ 106 cells/ml in complete culture medium (RPMI 1640, 10% autologous plasma, 100 U/ml penicillin, 100 NK lines were stained with the fluorescent cytoplasmic dye Cell Tracker o ␮g/ml streptomycin, and 2 mM L-glutamine (Invitrogen, San Diego, CA)). Green (0.5 ␮M; Molecular Probes, Eugene, OR) for1hat37C and then Schizont-infected (iRBC) or uninfected (uRBC) erythrocytes were added incubated in 10% autologous plasma to absorb any unbound reagent. Sub- to PBMC at a 3:1 ratio. PHA (1 ␮g/ml) was used as a positive control, as sequently, the NK cell lines were incubated for 24 h with autologous o described previously (3). Cultures were incubated at 37 Cin5%CO2 for PBMC and iRBC or uRBC at a 1:3 ratio. Cells were then stained with 24 h. Brefeldin A (10 ␮g/ml; Sigma-Aldrich) was added to cells for the last CD56-FITC, CD3-Tricolor, and IFN-␥-PE and analyzed by flow cytometry 3 h of the incubation. as described.

Cell surface and intracellular staining for flow cytometry Detecting erythrocyte:NK cell conjugates by guest on October 1, 2021 ϫ 5 Cells (5 10 /well) were stained for surface markers and intracellular PBMC (1 ϫ 106 cells/ml) were incubated with 3 ϫ 106/ml iRBC or uRBC ␥ IFN- as described previously (3), except that for unconjugated Abs (anti- for up to 3 h. Cultures were centrifuged for 1 min at 500 ϫ g to bring cells NKp30, NKp44, NKp46, and NKG2D) where cells were stained first with into contact and assayed at 30-min intervals to assess conjugate formation. ␮ ␮ unconjugated Ab (1 g/100 l of cell suspension), then with rabbit anti- Cells were fixed in 4% paraformaldehyde to retain cell attachment and ␮ ␮ mouse PE-labeled IgG1 (1 g/100 l of cell suspension; Sigma-Aldrich) stained with anti-CD56-FITC and anti-CD3-Tricolor, to identify NK cells, and then stained with fluorochrome-conjugated Abs for surface CD56 and and PE-labeled anti-human glycophorin A (BD PharMingen), which stains ␥ CD3 and intracellular IFN- as described. Isotype-matched control Abs only erythrocytes. NK:RBC conjugates were scored as flow cytometry were used for all fluorochrome-isotype combinations. The Abs used were: events that were CD3Ϫ but positive for CD56 and glycophorin A. The CD3-Tricolor, IgG1-PE, IgG2a-PE, IgG2b-PE (all from Caltag Laborato- formation of NK cell-RBC conjugates was confirmed by microscopic ex- ries, Towcester, U.K.); CD3-PerCP, CD56-FITC, CD56-allophycocyanin, amination of cytospin preparations. IFN-␥-FITC, IFN-␥-PE, NKB1-PE, KIR-NKAT2-PE, IgG1-FITC, IgG1- allophycocyanin, IgG1-PerCP (all from BD Biosciences, Oxford, U.K.); Transwell experiments CD94-PE, NKG2A-PE, KARp50.3-PE, CD158b-PE, KIRp70-PE (all from Coulter Immunotech, Marseille, France); NKG2D (R&D Systems, Abing- To assess the need for iRBC-NK contact for the induction of IFN-␥ syn- don, U.K.); and NKp30, NKp44, and NKp46 (kind gifts from A. Moretta, thesis, NK IFN-␥ production was compared between PBMC cultured in Genoa, Italy). Stained cells were analyzed by flow cytometry (FACSCali- direct contact with iRBC or uRBC and PBMC separated from the eryth- bur; BD Biosciences) collecting a total of 100,000 events. Data were an- rocytes by a semipermeable membrane. The 0.4-␮m polycarbonate mem- alyzed with CellQuest software (BD Biosciences). brane (Corning, Buckinghamshire, U.K.) prevented intact RBC or free merozoites from passing from one chamber to the other but allowed free Cytokine ELISA passage of soluble parasite products and monokines. PBMC (106 cells/ml) IFN-␥ was detected in cell supernatants by sandwich ELISA using com- were placed into both the inner and outer chambers of each well of a mercially available Abs and standards (BD Biosciences). All samples were flat-bottom 24-well tissue culture plate containing the Transwell insert. ϫ 6 ϫ 6 ␮ tested in duplicate according to the manufacturer’s recommendations. Stimulants (3 10 iRBC, 3 10 uRBC, or 1 g/ml PHA) were added Where samples gave values above the top of the standard curve, superna- only to the outer (lower) chamber of the Transwell plate. After a 24-h incubation, PBMC were harvested separately from the inner and outer tants were retested at 1/10 or 1/100 dilutions in RPMI 1640 and cytokine ␥ levels were recalculated. chambers, stained with anti-CD3, anti-CD56, and anti-IFN- Abs, and an- alyzed by flow cytometry. Neutralization and supplementation of IL-12 and IL-18 Genomic DNA preparation and KIR genotyping Neutralizing goat anti-human IL-12 polyclonal Ab and mouse anti-human IL-18 polyclonal Ab (both from R&D Systems) were added in combination Genomic DNA was prepared from 1 ϫ 105 to 2 ϫ 106 PBMC using a to PBMC stimulated with iRBC or uRBC at 0.5 and 5.0 ␮g/ml, respectively QIAamp DNA Blood Mini kit (Qiagen, Valencia, CA), or from the RBC/ (optimal cytokine concentrations were determined by titration) (3). Iso- granulocyte pellet following Ficoll-Paque Plus gradient separation (Amer- type-matched control Abs (goat IgG (Sigma-Aldrich) and mouse IgG1 sham Biosciences, Piscataway, NJ) of 50 ml of anticoagulated whole (R&D Systems)) were used in parallel at the same concentrations. Subse- blood. Generic KIR typing of genomic DNA was performed by PCR am- quently, PBMC cultures stimulated with iRBC or uRBC were supple- plification with primers based on conserved regions specific to each KIR 5398 NK CELL ACTIVATION BY P. falciparum locus (18). For KIR allele typing, primers designed to discriminate allele- specific polymorphisms were paired with KIR2DL1, 2DL3, 3DL1, or 3DL2 locus-specific primers, as previously described (19, 20). RNA and cDNA preparation Total cellular RNA was prepared from PBMC using RNA-Bee (Tel-Test, Friendswood, TX) according to the manufacturer’s guidelines, and 1 ␮g was used to synthesize 5ЈRACE cDNA using oligo(dT)16 primer and SMART II oligonucleotide primer (SMART-RACE kit; Clontech Labora- tories, Palo Alto, CA). Cloning and sequencing of new KIR alleles The 5ЈRACE cDNA was amplified with the Advantage 2 PCR kit (Clon- tech Laboratories) using 100 ␮M of the universal primer mix (UPM) from the SMART-RACE kit (Clontech Laboratories) as the forward primer, and 100 ␮M of one of the following reverse primers: KIRc (21); R2/3DS,5Ј- CCTGACTGTGGTGCTCGTGGACAG A-3Ј; KIR2DS3/5-specific, 5Ј- TGTCTTGGGCCTCTGAGAAGGGG-3Ј; KIR2DS1/2/4 specific, 5Ј-TG GTCTTGTTCATCAGAATCCTCG-3Ј;orKIR2DL5 specific, 5ЈCCAGC TGCTGGTACATGGGAGCTA-3Ј. The reverse primer KIRc anneals with a segment of the sequence in the 3Ј untranslated region that is conserved in all known KIR sequences, while R2/3DS anneals to a sequence conserved only in the activating KIR. The remaining reverse primers are specific for Downloaded from different combinations of KIR genes, e.g., the KIR2DS3/5-specific primer anneals to a segment of the sequence that is conserved in only KIR2DS3 and 2DS5. To amplify specific activating KIR genes from the cDNA, in FIGURE 1. Interleukins 12 and 18 are necessary but not sufficient for several instances the forward UPM primer was replaced with the primers activation of human NK cells by P. falciparum-infected erythrocytes 6 6 6 KIR2DS3/4/5/2DL5-specific5Ј-CAGCACCAT GTCGCTCATGGT CA-3Ј (iRBC). PBMC (10 /ml) were cultured with 3 ϫ 10 iRBC or 3 ϫ 10 or KIR2DS2-specific5Ј-ATGTCGCTCATGGTCGTCAGCATG-3Ј. The uRBC for 24 h in the presence of (A) neutralizing Ab to human IL-12 (0.5 UPM-NKRc primers were expected to give a KIR product of 1.6 or 1.9 kb ␮g/ml) and IL-18 (5.0 ␮g/ml) or (B and C) varying concentrations of http://www.jimmunol.org/ for either 2-domain (2D) or 3-domain (3D) KIR, respectively, while rIL-12 and IL-18. Isotype- matched irrelevant Abs were used as a negative theUPM-R2/3DS primers produced either 1.3-kb (2D) or 1.6-kb (3D) KIR control for experiments in A. A and B, The proportion of CD3ϪCD56ϩ products. KIR products generated using combinations of the other KIR- cells that were positive for IFN-␥; data are based on collection of 100,000 specific primers were ϳ1.3 kb in size. The PCR protocol included an initial events. C, The concentration of IFN-␥ in culture supernatants detected by denaturation of 95¡C for 60 s, followed by 5 cycles of 94¡C for 20 s, 70¡C for 45 s, 72¡C for 210 s, and by 30 cycles of 94¡C for 20 s, 65¡C for 30 s, ELISA. Values for uRBC-stimulated cultures have been subtracted from 72¡C for 210 s. A final 10-min incubation at 72¡C was performed to com- values for iRBC-stimulated cultures. plete DNA synthesis. In the cases where two KIR-specific primers were used for the cDNA amplification, PCR conditions were as follows: 95¡C for 60 s, followed by 35 cycles of 94¡C for 20 s, 70¡C for 30 s, 72¡C for of IFN-␥ in culture supernatants, as determined by ELISA, Fig. 210 s, followed by a final 10-min extension at 72¡C. by guest on October 1, 2021 PCR products were gel purified using the Bio-Rad Quantum Prep Freeze 1C). Thus, other factors must contribute to NK activation by iRBC. and Squeeze Gel Extraction Spin Columns (Bio-Rad, Hercules, CA) and subcloned using a TOPO-TA Cloning kit according to the manufacturer’s NK cells can form stable conjugates with parasitized instructions (Invitrogen). The resulting products were partially sequenced erythrocytes using the primer NKRds, 5Ј-GGA AGT TCT ATG TAC ATG CTG-3Ј or NKR-2ds, 5ЈCTG TTC ACT GTT CTG TTC CC-3Ј and dye terminator Having shown that monokines are necessary but not sufficient for automated sequencing (Applied Biosystems, Foster City, CA). Based on NK activation by iRBC, we hypothesized that a second, contact- partial sequences, three to four representatives of each allele were selected dependent signal was required. To determine whether NK cells can and sequenced completely on both strands to obtain a consensus sequence. bind to parasitized erythrocytes and form stable conjugates, PBMC The sequence of each new allele was confirmed in genomic DNA by PCR amplification or by sequencing. Each allele (see Table II) has been named were incubated with iRBC or uRBC, fixed, and then stained with according to the conventions recently proposed by the KIR Nomenclature anti-CD56, anti-CD3, and anti-glycophorin A. The mean fluores- Committee (22). cence intensity for all glycophorin Aϩ cells (i.e., all RBC) was 445 (Fig. 2C). A gate was set around all CD56ϩ cells and the number Results of events that were CD3Ϫ (i.e., NK cells) and glycophorin Aϩ (i.e., IL-12 and IL-18 are necessary but not sufficient for NK cell had bound RBC) was counted (Fig. 2, D and E); the MFI for RBC ␥ IFN- responses to P. falciparum bound to NK cells was also 445 (Fig. 2F), indicating that NK cells To determine the roles of IL-12 and IL-18 in NK cell activation by had bound intact RBC. The formation of NK cell-RBC conjugates P. falciparum, both cytokines were simultaneously neutralized in was confirmed by cytospin analysis and light microscopy; individ- PBMC/iRBC cultures from two known high responding donors ual conjugates typically contained a single RBC attached to one and two known low responding donors (Fig. 1A). In the low re- NK cell but occasionally up to four or five RBC were seen attached sponders (KAT and TH), the few NK cells that produced IFN-␥ in to one NK cell. response to iRBC were inhibited in the presence of anti-IL-12 and The kinetics of conjugate formation were investigated for sev- anti-IL-18, indicating that this response is likely due to bystander eral donors (an example is shown in Fig. 2G) by calculating the activation. For the two high responders (FMO and JET), NK percentage of all NK cells that were conjugated to erythrocytes at IFN-␥ responses were markedly reduced, although not entirely each time point. Conjugates could be detected as early as 30 min eliminated, in the presence of anti-IL-12 and anti-IL-18. However, after coincubation with iRBC and persisted for up to 120 min; the rIL-12 and IL-18 added in combination at concentrations from 0.1 optimal time for detection of conjugates was 90 min (Fig. 2G). A to 10 ng/ml are not sufficient for induction or enhancement of NK low level of conjugate formation was detected with uRBC and this IFN-␥ responses among PBMC from high (JET) or low/nonre- was consistent over time, suggesting ongoing transient interactions sponding donors (BdS, TH, and CS, in Fig. 1B) and did not induce between NK cells and uRBC which does not lead to activation or IFN-␥ secretion from other cell populations (as shown by the lack IFN-␥ production. The Journal of Immunology 5399

FIGURE 2. Human NK cells form stable conjugates with P. falciparum- infected erythrocytes (iRBC). PBMC (106/ml) were cultured with 3 ϫ 106 iRBC for 30-min intervals up to a maximum of 3 h, stained with anti- CD56-FITC, anti-CD3-Tricolor, and anti-glycophorin A-PE, and analyzed by flow cytometry; a total of 100,000 events was counted for each sample. Cells stained with FITC-conjugated isotype control Ab (A) were used to set the gate for analysis of CD56ϩ cells (D). Side scatter PE plots of all events (B) were used to generate his- tograms of glycopshorin A staining

(C) and to set gates (M1) for detection Downloaded from of RBC (C and F). NK-RBC conju- gates were counted as CD56ϩ cells (D) that were glycophorin Aϩ and CD3Ϫ (E). An example of the kinetics of conjugate formation is shown for one representative donor (G). The percentage of NK cells forming con- http://www.jimmunol.org/ jugates was determined for seven do- nors after 90 min (h); values for par- asitized (iRBC) and unparasitized (uRBC) erythrocytes are shown. by guest on October 1, 2021

Conjugate formation with iRBC and uRBC at 90 min was de- the PBMC preparation. Cells from six donors were tested (Fig. 3); termined for cells from seven donors (Fig. 2H). Although there cells from the inner (no contact) and the outer (contact) wells were was heterogeneity among donors in the percentage of NK cells that harvested and stained for CD56, CD3, and IFN-␥. PHA was used formed conjugates, NK cells consistently formed more conjugates as a positive control; uRBC and unstimulated cultures were used as with iRBC than with uRBC and this difference was highly statis- negative controls. tically significant (Wilcoxon signed rank test, z ϭ 2.66, n ϭ 9, p ϭ Cells from one of the six donors did not respond to iRBC but 0.007). made a strong response to the positive control stimulus PHA (Fig. In view of reports of differing function between CD56bright and 3C). Cells from the other five donors responded to PHA and iRBC CD56dim NK cell subsets, we analyzed the two populations sepa- but the percentage of NK cells staining for intracellular IFN-␥ was rately. The majority of the NK cells were CD56dim but a distinct significantly lower among PBMC cultured without direct contact subpopulation was CD56bright (see Fig. 2D). The percentage of with iRBC (inner wells) than among PBMC in the outer well (di- CD56bright NK cells forming conjugates was consistently higher rect contact with iRBC; Wilcoxon signed rank test, z ϭ 2.2, n ϭ than the percentage of CD56dim NK cells forming conjugates 6, p ϭ 0.03). Importantly, no difference in response was observed (mean 18.9% vs 14.9%) and this difference was statistically sig- between inner wells and outer wells for PHA-stimulated cells, in- nificant (paired t test, t ϭ 2.45, p ϭ 0.03); however, the difference dicating free circulation of soluble stimuli within the cultures (Wil- is small and unlikely to be biologically relevant. coxon signed rank test, z ϭ 1.2, n ϭ 6, p ϭ 0.2). Having shown that both IL-12/IL-18 and contact between NK Contact between NK cells and iRBC is necessary but not cells and iRBC are essential for optimal NK activation, we hy- ␥ sufficient for NK cell IFN- responses to P. falciparum pothesized that purified NK cells, cultured with iRBC in the ab- Having shown that IL-12 and IL-18 are not sufficient for optimal sence of monokine-producing cells, would fail to make IFN-␥ but NK cell activation and that NK cells form stable conjugates with that addition of monokine-producing cells to NK lines would re- iRBC, we hypothesized that contact between NK cells and iRBC store their responsiveness. Thus, oligoclonal NK cell lines (made was essential for full activation to IFN-␥ production. Thus, PBMC by combining several NK cell clones from a single donor) were were incubated with iRBC or uRBC using a Transwell system incubated with iRBC or uRBC in the presence or absence of au- which allowed for the simultaneous assaying of IFN-␥ production tologous PBMC (in a 1:1 ratio) for 24 h before staining for IFN-␥. by NK cells exposed to all parasite-derived or parasite-induced The cloned NK cells were stained with Cell Tracker Green to products, including intact iRBC, and NK cells exposed only to allow them to be differentiated from NK cells in the added PBMC. soluble parasite components and cytokines derived from cells in An example of the data obtained for one donor is shown in Fig. 4, 5400 NK CELL ACTIVATION BY P. falciparum

not shown); however, this does not preclude variable expression of individual KIR genes or of specific alleles of individual KIR genes, between responding and nonresponding cells, as the Abs used do not distinguish between KIR alleles and only two of the available anti-KIR Abs detect the product of a single gene (the other Abs recognize epitopes that are common to a number of different KIR). Similarly, no consistent differences were observed between IFN-␥ϩ and IFN-␥Ϫ NK cells in expression of the nonpolymor- phic NCR, NKp30, NKp44, or NKp46 or the activating C-type lectin receptor NKG2D. By contrast, consistent differences were observed between IFN-␥ϩ and IFN-␥Ϫ NK cells in expression of both components of the regulatory CD94:NKG2A receptor (Table I). In the five donors whose NK cells are able to respond to iRBC, high levels of both NKG2A and CD94 were expressed more commonly on iRBC-stimulated NK cells than on uRBC-stimulated controls; little difference in CD94 or NKG2A expression was observed in the two nonresponding donors (CS and TH). Taking all seven donors to- gether, the increased expression of CD94:NKG2A on iRBC-stim- FIGURE 3. Contact between NK cells and P. falciparum iRBC is nec- ulated cells was statistically significant (Table I). Importantly, Downloaded from ␥ 6 essary for induction of IFN- synthesis in human NK cells. PBMC (10 among the responding donors, CD94 and NKG2A expression was cells/ml) were incubated in both inner and outer wells of Transwell plates higher in IFN-␥ϩ NK cells than in IFN-␥Ϫ NK cells; again, this for 24 h. Three ϫ 106 iRBC or 3 ϫ 106 uRBC were added to outer wells difference was statistically significant, suggesting either that cells only. PHA (1 ␮g/ml) and growth medium (GM) were used as a positive and negative controls, respectively. Cells in inner and outer wells were expressing high levels of CD94/NKG2A preferentially respond to harvested separately and analyzed for intracellular IFN-␥ production and iRBC or that CD94/NKG2A is up-regulated on activated cells. NK cell surface phenotype (CD56ϩCD3Ϫ). A total of 100,000 events was http://www.jimmunol.org/ KIR genotype collected for each sample. Each plot represents data for one donor. KIR genotype, including high resolution allele typing for the genes KIR2DL1, 2DL3, 3DL1, and 3DL2, was determined for 27 donors AÐF); a summary of the data from three different donors is shown of European, Asian, and African descent for whom the IFN-␥ NK in Fig. 4G. As expected, IFN-␥-producing NK cells were detected cell response to iRBC had been measured (Fig. 5). At the locus among PBMC cultured with iRBC but not uRBC (Fig. 4, A and B). level, 15 distinct KIR genotypes were identified among the donors. However, in the absence of monokine-producing cells, cloned NK Although all of the genotypes had been described previously in ϩ cells (Cell Tracker ) were unable to make IFN-␥ (Fig. 4, C and various ethnic groups, three had not been observed previously in by guest on October 1, 2021 D). When unlabeled PBMC were added back to the NK line, individuals of African descent (23, 24). The number of distinct ϩ cloned NK cells were now able to make IFN-␥ (Cell Tracker , genotypes was much greater when allelic polymorphisms were ϩ IFN-␥ ; Fig. 4, E and F). Similar results were observed for all cell also considered. For example, 9 of the 27 donors were homozy- lines tested (Fig. 4G). Although the percentage of NK cells making gous for the simplest arrangement of KIR genes and hence were IFN-␥ was lower in the NK cell lines than in the comparable identical at the locus level. However, each of these nine donors had PBMC population, cloned NK cells consistently produced IFN-␥ a distinct KIR genotype when allelic polymorphisms at several of only in the presence of PBMC. the loci were examined. Therefore, this analysis revealed marked KIR diversity in the donors at both the locus and allelic level. Association between IFN-␥ production and NK receptor expression Identification and characterization of new KIR alleles The requirement for cell-cell contact for NK activation by iRBC Novel patterns of reactivity with primers designed to identify dis- indicates the existence of a specific receptor-ligand interaction be- tinct allelic variants suggested that several individuals carried tween the NK cell and iRBC. We hypothesized that the differences novel KIR alleles. Sequence analysis of cDNA clones from 11 between donors in their ability to form conjugates with iRBC (Fig. donors of African and Asian descent identified 21 new KIR alleles, 3) or to mount an NK-derived IFN-␥ response to P. falciparum representing 8 different KIR genes (Fig. 5). These comprised five (Fig. 4) hinged on the differential expression of specificNKre- variants of KIR2DL1, one of 2DL2, two of 2DS2, two of 2DS4, ceptors. We therefore compared the levels of NK receptor expres- two of 2DS5, five of 3DL1, one of 3DL2, and three new variants sion by IFN-␥-producing and nonproducing NK cells (both within of a chimeric 3DL1/2 gene (Table II). Seven of the new variants a single donor and between donors) using four-color flow cytom- differed from known KIR alleles by synonymous nucleotide etry. PBMC were cultured with iRBC or uRBC for 24 h and NK changes in the coding regions or by nucleotide differences in the cells (CD56ϩ, CD3Ϫ) were analyzed for expression of IFN-␥ and noncoding 5Ј and 3Ј untranslated regions. The remaining 14 alleles a panel of KIR and lectin-like receptors. Receptor expression lev- differed by nonsynonymous nucleotide changes in the coding re- els (calculated as MFI) on IFN-␥ϩ and IFN-␥Ϫ NK cells were gions and encoded novel proteins. The majority of the nucleotide compared to determine whether receptor expression was associ- changes were at known polymorphic sites and were identified in ated with activation, and receptor expression on all NK cells (tak- several donors, others were confirmed in genomic DNA by PCR ing IFN-␥ϩ and IFN-␥Ϫ together) was compared to determine the amplification or sequencing. Each of the novel allele sequences has overall effect of Ag stimulation, regardless of cytokine production. been submitted to the KIR Nomenclature Committee, and 16 have Cells from seven donors (five responders and two low/nonre- received official names (Table II). The remaining five are awaiting sponders) were tested. No consistent differences in expression of assignment of official allele names pending further sequence anal- KIR were observed between IFN-␥ϩ and IFN-␥Ϫ NK cells (data ysis (22). The Journal of Immunology 5401

FIGURE 4. Contact between NK cells and P. falciparum iRBC is not suf- ficient for induction of IFN-␥ synthesis in human NK cells. Oligoclonal NK cell lines (106 cells in 1 ml) were stained with Cell Tracker Green and incubated for 24 h with 3 ϫ 106 iRBC (A, C, and E)or 3 ϫ 106 uRBC (B, D, and F) in the pres- ence (E and F) or absence (C and D)of autologous PBMC. Baseline levels of NK activation were also determined in PBMC alone (A and B); CD56ϩ cells were gated and examined for CD3 and Downloaded from IFN-␥ expression. Isotype controls are shown in the upper plots of each trio (A and B). A and B, The number in the upper left quadrant represents the percentage of NK cells producing IFN-␥. For cultured NK cell lines (CÐF), cells were gated for

Cell Tracker Green staining and analyzed http://www.jimmunol.org/ for IFN-␥ production; 10,000 cloned cells were analyzed for each sample. Numbers in the upper right quadrants represent the percentage of cloned NK cells positive for IFN-␥. PBMC and NK cell lines from three donors were tested (G); data for iRBC-stimulated cultures are shown after subtraction of uRBC no IFN-␥ϩ NK cells ,ء .control values by guest on October 1, 2021 detectable.

Several new variants of a previously described chimera contain- tween KIR genotype and NK responsiveness to iRBC in this rel- ing the extracellular D0-D1-D2 domains of KIR3DL1 and the atively small study. However, the data are sufficient to discount stem-transmembrane-cytoplasmic tail of 3DL2, so-called KIR3DL1/2v some relatively simple hypotheses. For example, since KIR hap- (19), were identified (Table II). Each variant had the same chi- lotypes can be broadly divided into two subtypes— group A that meric structure as the original KIR3DL1/2v, but differed by several carries either one (2DS4) short-tailed, activating KIR and group B nucleotide substitutions, primarily in the region encoding the cy- that carries two or more activating KIR—it was possible to test for Ј toplasmic tail and in the 3 untranslated region. In addition, several an association between NK-iRBC responses and the number of new variants of the activating receptor KIR2DS4 were discovered. activating KIR. There was no significant difference in the propor- KIR2DS4 is unique in that alleles either encode a membrane-as- tion of individuals carrying B haplotypes among the three levels of sociated form of the protein or a deletion variant that potentially NK-iRBC responders (28.5, 33.3, and 25.0% in high, low, and encodes a secreted protein lacking the D2, stem, transmembrane, and nonresponders, respectively) and no correlation between the num- cytoplasmic regions (25, 26). We have identified new variants of both ber of activating KIR expressed by any donor and the magnitude types of 2DS4 alleles, demonstrating that more than one allele encod- of the NK-iRBC response (r2 ϭ 0.03). ing the deletion variant exists in the human population (Table II). However, rather to our surprise, a significant association was Association between KIR genotype and NK responsiveness to iRBC observed between NK-iRBC responses and an allele of 3DL2.Of NK responses to iRBC were arbitrarily categorized as high the 23 donors for whom 3DL2 alleles have been typed, 8 donors (Ն10%), low (1.0Ð9.9%), or absent (Ͻ1.0%) (Fig. 5). Given the carried at least one copy of the *002 allele; of these, 5 of 7 high known levels of KIR diversity within human populations, we did responders, but only 3 of 16 low/nonresponders, carried *002 at not anticipate that any robust associations would be observed be- this locus (␹2 ϭ 6.36, df ϭ 1, p ϭ 0.025). 5402 NK CELL ACTIVATION BY P. falciparum

Table I. Up-regulation of NKG2A and CD94 on iRBC-stimulated NK cellsa

% Positive NK Cells MFI of NK Cells

iRBC iRBC uRBC uRBC IFN␥ϩ IFN␥Ϫ All All IFN␥ϩ IFN␥Ϫ All All

NKG2A CS ——62.5 60.8 ——105.8 89.8 TH ——37.3 36.4 ——38.5 36.5 FMO 82.9 53.9 62.5 47.1 119.6 76.9 119.6 72.8 JR 56.5 48.5 47.5 41.2 74.5 57.1 56.9 43.5 073F 77.5 68.0 68.1 49.7 177.0 112.9 120.5 53.7 093F 88.4 68.8 72.1 45.9 243.8 105.5 125.4 47.8 053M 87.7 72.4 74.5 61.1 320.5 157.6 117.5 98.9 z ϭ 2.02 2.37 2.02 2.37 p ϭ 0.04 0.02 0.04 0.02 CD94 CS ——64.8 68.0 ——71.1 74.0 TH ——55.9 50.5 ——53.9 46.8 FMO 88.3 56.8 63.6 49.5 159.6 49.6 62.8 45.6 JR 76.2 60.9 58.4 49.2 94.0 53.8 54.0 44.4 073F 89.0 76.7 77.3 54.3 152.6 95.7 102.0 49.6

093F 92.3 79.7 81.1 64.0 191.4 107.5 120.9 63.3 Downloaded from 053M 90.3 89.1 88.5 82.7 216.0 139.9 148.6 107.5 z ϭ 2.02 2.20 2.02 2.20 p ϭ 0.04 0.03 0.04 0.03

a Numbers represent the percentage of NK cells expressing NKG2A (top) or CD94 (bottom) and the corresponding MFI values. For iRBC-stimulated cells, values are shown for IFN-␥ϩ and IFN-␥Ϫ NK cells separately and for all NK cells. For uRBC-stimulated cells (where numbers of IFN-␥ϩ cells were extremely low), values are shown for all NK cells only. Initials indicate cell donor. http://www.jimmunol.org/

Discussion The requirement for IL-12 and IL-18 for optimal NK activation Taken together, the data reported here demonstrate that two sep- is not surprising because these cytokines have been shown to me- arate signals are required for optimal NK cell activation by P. diate bystander activation of NK cells in response to a number of falciparum iRBC; one signal is cytokine mediated and the other is different infectious organisms (9). Less predictable, however, was delivered following direct contact between the NK cell and iRBC. that the nonresponsiveness of cells from some donors could not be Furthermore, our data suggest that contact leads to formation of overcome by adding exogenous cytokines, indicating that differ- stable NK-iRBC conjugates and that interactions between ligands ential responsiveness of NK cells from different donors is not due by guest on October 1, 2021 on the iRBC and specific cell surface receptors of the NK cell lead to differences in their propensity to produce monokines in response to activation and IFN-␥ production. to malaria Ags. In support of this conclusion, we have shown that

FIGURE 5. KIR genotype and higher resolution allele typing for 27 donors. Donors have been divided into three groups based on the level of their NK response to iRBC (percentage of IFN-␥ϩ NK cells after 24-h iRBC stimulation, uRBC values have been subtracted). An open box indicates the presence of a KIR gene, whereas a shaded box indicates its absence. Allelic subtypes, where known, are indicated by open boxes with text. Open boxes without text indicate that the KIR allele was not determined. In heterozygous individuals, allele names are separated by a semicolon. Alleles not discriminated by subtyping are listed together, e.g., KIR2DL3*002/6. New alleles identified in this study are shown in bold italics. New alleles for which cDNA clones have been identified have been named according to recommendations of the KIR Nomenclature Committee (22). New alleles identified by producing novel reactivities with the allelic subtyping primers but whose products were not cloned are indicated by the words “new allele.” The Journal of Immunology 5403

Table II. New KIR alleles identified in 11 donors of African and Asian descent

Location of Change from Known Alleles Allele Synonymous vs Gene Designation nt Positiona Domainb aa Positionc Nonsynonymous Accession Number

2DL1 *00302d 1157 3ЈUTR — AY366237 1250 3ЈUTR — *00302d 1157 3ЈUTR — AY366238 *00303 144 D1 — S AY366239 813 TM — S *0040102 1081 3ЈUTR — AY366240 *006 549 D2 — S AY366241 796 TM 245 NS 847 CYT 312 NS 2DL2 *005 997 CYT 312 NS AY366242 2DS2 *00102 732 TM — S AY366243 *00103 501 D2 — S AY366244 2DS4 *0010103 953 3ЈUTR — AY366245 *004 283 D1 74 NS AY366246 2DS5 *004 Ϫ12 5ЈUTR — AY366247 Ϫ55ЈUTR — 6 Leader — S 535 D2 158 NS

*005 Ϫ12 5ЈUTR — AY366248 Downloaded from Ϫ55ЈUTR — 6 Leader — S 535 D2 158 NS 608 D2 182 NS 973 3ЈUTR — 3DL1 *01501 155 D0 31 NS AY366249 *01502 155 D0 31 NS AY366236

732 D2 — S http://www.jimmunol.org/ *016 5 Leader Ϫ20 NS AY366250 *017 67 D0 2 NS AY366251 155 D0 31 NS *018 5 Leader Ϫ20 NS AY366252 155 D0 31 NS 3DL2 *013 12 Leader — S AY366256 100 D0 13 NS 3DL1/2v be 1244 CYT 394 NS AY366254 1266 CYT — S 1340 CYT 426 NS ce 1244 CYT 394 NS AY366253 de 797 D2 245 NS AY366255 by guest on October 1, 2021 1244 CYT 394 NS 1266 CYT — S 1340 CYT 426 NS 1376 3ЈUTR — 1477 3ЈUTR —

a Nucleotide (nt) positions start at the ATG. b 3ЈUTR, 3Ј untranslated region; D1, Ig-like domain 1; TM, transmembrane domain; D2, Ig-like domain 2; 5ЈUTR 5Ј untranslated region; D0, Ig-like domain 0; CYT, cytoplasmic tail; S, synonymous; NS, nonsynonymous. c Amino acid (aa) positions start at the end of the leader peptide. d Official naming of the allele is pending further sequence analysis. e New 3DL1/2v alleles have been named bÐd, respectively, pending such a time as the gene is officially named and allele designations can be assigned.

iRBC induce IL-12 production within 18 h from PBMC of all tend to support our argument that close physical interactions occur donors tested to date (M. Walther and E. M. Riley, unpublished between the NK cell and the RBC. data). Studies are underway to identify the source of this IL-12 and Although NK:iRBC conjugate formation is transient (peaking the molecular basis for its induction. within 30 min and being lost between 90 and 120 min), it consis- Direct contact between the NK cell and iRBC was demonstrated tently occurs in all donors whose cells respond to iRBC by IFN-␥ microscopically and by detection of glycophorin A-stained production; lysis of iRBC by NK cells (8) may explain the disap- RBC-NK conjugates by flow cytometry. Although it is possible pearance of conjugates. The need for direct contact between the that NK cells could have taken up glycophorin A at the synapse NK cell and iRBC for NK cell activation explains our previous (27), we think this is unlikely as, in that case, the amount of gly- observation that intact iRBC but not freshly lysed iRBC are able to cophorin A per NK cell would be expected to be very low, giving activate NK cells and offers an alternative explanation for the dif- only weakly positive events by flow cytometry. In fact, glycoph- orin Aϩ NK cell conjugates gave MFI for glycophorin A that were ferential responsiveness observed between donors (3), namely, that essentially identical to the MFI of free RBC, indicating that NK NK cells from different donors may vary in their expression of cells had bound as much glycophorin A as a whole RBC. Together activating or inhibitory NK cell receptors. with the microscopic evidence of conjugate formation, thus the Our working hypothesis is that inhibitory ligands for NK cells most parsimonious interpretation is that the NK cells had formed may exist on normal RBC but that neoantigens expressed on the conjugates with whole RBC. On the other hand, if glycophorin A surface of iRBC provide an activating signal. The nature of the was being taken up from RBC at the synapse, this would in fact activating ligand(s) is still obscure, but obvious candidates include 5404 NK CELL ACTIVATION BY P. falciparum normal RBC components that are abnormally exposed on the sur- acterize KIR in both the African and Asian populations, as such in- face of parasitized erythrocytes (28) or various parasite-encoded formation will be necessary for studies to correlate KIR genotype with ligands (belonging to the clonally variant families of P. falciparum malaria and other diseases. erythrocyte membrane protein 1, Rifin, and subtelomeric open Rather to our surprise, given the relatively small numbers of reading frame proteins) (29) that are inserted into the erythrocyte donors studied, we have found a significant association between a surface membrane. To date, the only pathogen-derived ligands 3DL2 allele expressed by individual donors and the likelihood of known to be recognized by NK cells are influenza hemagglutinin making a strong NK response to P. falciparum iRBC. Although it (15) and CMV-encoded MHC homologues, the UL18 gene product is hard to envisage a mechanism by which an inhibitory receptor of human CMV (30) and m144 and m157 from murine CMV. might be causally associated with NK activation, it is possible that Differential binding of m157 to activating lectin-like Ly49H NK this 3DL2 allele might be in linkage disequilibrium with a specific cell receptors is causally linked to CMV resistance and suscepti- allele at an activating gene locus. High-resolution genotyping of a bility in mice (31, 32). much larger population is required to determine the significance of Although no consistent differences in expression levels of KIR these observations. or activating C-type lectin receptors were observed between re- In summary, we have shown that activation of human NK cells sponding and nonresponding NK cells, expression of both CD94 by P. falciparum iRBC to produce an early burst of IFN-␥ requires and NKG2A was higher on activated (i.e., IFN-␥ϩ) NK cells than two signals, one dependent upon contact between the NK cell and on nonactivated (IFN-␥Ϫ) cells following stimulation with iRBC, iRBC and the other cytokine mediated (and likely dependent upon and higher on cells stimulated with iRBC than on resting cells or interactions between iRBC and dendritic cells or monocyte-mac- cells cultured with uRBC. As NKG2A forms heterodimers with rophages). NK cell activation by iRBC correlates with high levels CD94, the parallel increased expression of NKG2A and CD94 of expression of the regulatory CD94:NKG2A lectin-like receptor. Downloaded from suggests that the CD94:NKG2A lectin-type receptor is expressed Studies are underway to identify both the NK receptor and the at higher levels on responding NK cells than on nonresponding NK ligand on the iRBC that mediates NK activation. Importantly, cells. CD94:NKG2A has been identified as an inhibitory receptor, however, the study provides evidence for an association between rescuing target cells from lysis by binding of nonclassical MHC KIR genotype and NK-iRBC responses. Given that NK cells act class I molecules (17, 33). CD94/NKG2A expression on NK cells very early during the immune response to infection, our data raise can be induced by cytokines, particularly IL-15 (34), and, in T the intriguing possibility that KIR genotype may influence the sus- http://www.jimmunol.org/ cells, cross-linking of TCR by interaction with peptide-MHC is ceptibility to infections such as malaria. required for CD94/NKG2A expression (35). In this case, NK ac- tivation by iRBC, CD94/NKG2A is expressed at higher levels on Acknowledgments IFN-␥ϩ cells than on IFN-␥Ϫ cells and thus it is likely that inter- We thank Carolynne Stanley for collection of blood samples, Elizabeth actions between NK receptors and target cell ligands does in some King and Daniel Korbel for assistance with flow cytometry, Claire Swales way modify CD94/NKG2A expression. Expression of an inhibi- for assistance with P. falciparum culture and Mycoplasma testing, and Dr tory receptor on IFN-␥ϩ NK cells suggests that CD94:NKG2A Alessandro Moretta (University of Genova, Genova, Italy) for providing may serve a homeostatic regulatory function, preventing the po- Abs to NKp30, p44, and p46. by guest on October 1, 2021 tentially pathological effects of persistent NK activation, as has References been described for other leukocyte populations (reviewed in Ref. 1. Artavanis-Tsakonas, K., E. Tongren, and E. Riley. 2003. The war between the 36). In accordance with this hypothesis, preliminary data indicate malaria parasite and the immune system: immunity, immunoregulation and im- that blocking of CD94:NKG2A with Ab enhances the NK re- munopathology. Clin. Exp. Immunol. 133:145. 2. Riley, E. M. 1999. Is T-cell priming required for initiation of pathology in malaria sponse to both iRBC and PHA (D. Korbel and E. M. Riley, un- infections? Immunol. Today 20:228. published data). 3. Artavanis-Tsakonas, K., and E. M. Riley. 2002. Innate immune response to ma- Our experiments give some indication of heterogeneity of the laria: rapid induction of IFN-␥ from human NK cells by live Plasmodium falci- parum-infected erythrocytes. J. Immunol. 169:2956. iRBC response among clones within a donor. In the presence of 4. Molineaux, L., M. Trauble, W. Collins, G. Jeffery, and K. Dietz. 2002. Malaria autologous PBMC, oligoclonal NK cell lines (derived from indi- therapy reinoculation data suggest individual variation of an innate immune re- viduals previously categorized as high responders) were able to sponse and independent acquisition of antiparasitic and antitoxic immunities. ϩ Trans. R. Soc. Trop. Med. Hyg. 96:205. respond to iRBC, but the percentage of IFN-␥ NK cells was 5. Mohan, K., P. Moulin, and M. M. Stevenson. 1997. Natural killer cell cytokine always lower in the oligoclonal line than in the parent PBMC production, not cytotoxicity, contributes to resistance against blood-stage Plas- modium chabaudi AS infection. J. Immunol. 159:4990. population. One explanation for this finding is that the oligoclonal 6. Choudhury, H. R., N. A. Sheikh, G. J. Bancroft, D. R. Katz, and J. B. De Souza. cell lines lack one or more of the dominant IFN-␥-producing NK 2000. Early nonspecific immune responses and immunity to blood-stage nonle- clones present in the PBMC population. Since individual NK thal Plasmodium yoelii malaria. Infect. Immun. 68:6127. 7. Theander, T. G., B. K. Pedersen, I. C. Bygbjerg, S. Jepsen, P. B. Larsen, and clones may vary in their expression of inhibitory and activating A. Kharazmi. 1987. Enhancement of human natural cytotoxicity by Plasmodium receptors (37), the balance of receptor expression among NK falciparum antigen activated lymphocytes. Acta Trop. 44:415. clones may influence their response to iRBC. 8. Orago, A. S., and C. A. Facer. 1991. Cytotoxicity of human natural killer (NK) cell subsets for Plasmodium falciparum erythrocytic schizonts: stimulation by Consistent with our hypothesis that variation in NK receptor ex- cytokines and inhibition by neomycin. Clin. Exp. Immunol. 86:22. pression might be associated with NK-iRBC responses, analysis of 9. Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, and T. P. Salazar-Mather. 1999. Natural killer cells in antiviral defense: function and regulation by innate KIR genotypes in our panel of donors revealed marked diversity in the cytokines. Annu. Rev. Immunol. 17:189. presence or absence of genes for certain inhibitory and activating re- 10. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea, ceptors; all 27 donors had distinct KIR genotypes and a number of G. S. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al. 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795. new KIR alleles was identified. The majority of the KIR allelic vari- 11. Bauer, S., V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, and T. Spies. ants described to date have been identified in individuals of European 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress- descent. Previous analysis of single African-American and Asian-In- inducible MICA. Science 285:727. 12. Sutherland, C. L., N. J. Chalupny, and D. Cosman. 2001. The UL16-binding dian individuals indicated that novel alleles remained to be found in proteins, a novel family of MHC class I-related ligands for NKG2D, activate these populations (21). This prediction was borne out in this study, natural killer cell functions. Immunol. Rev. 181:185. 13. Moretta, A., C. Bottino, M. Vitale, D. Pende, C. Cantoni, M. C. Mingari, where we identified 21 new alleles from only 8 donors of African and R. Biassoni, and L. Moretta. 2001. Activating receptors and coreceptors involved 3 of Asian descent. These results emphasize the need to further char- in human natural killer cell-mediated cytolysis. Annu. Rev. Immunol. 19:197. The Journal of Immunology 5405

14. Ferlazzo, G., M. Tsang, L. Moretta, G. Melioli, R. Steinman, and C. Munz. 2002. 26. Maxwell, L., A. Wallace, D. Middleton, and M. Curran. 2002. A common KIR2DS4 Human dendritic cells activate resting natural killer (NK) cells and are recognized deletion variant in the human that predicts a soluble KIR molecule analogous to the via the NKp30 receptor by activated NK cells. J. Exp. Med. 195:343. KIR1D molecule observed in the rhesus monkey. Tissue Antigens 60:254. 15. Mandelboim, O., N. Lieberman, M. Lev, L. Paul, T. Arnon, Y. Bushkin, 27. Carlin, L., K. Eleme, F. McCann, and D. Davis. 2001. Intercellular transfer and D. Davis, J. Strominger, J. Yewdell, and A. Porgador. 2001. Recognition of supramolecular organization of human leukocyte antigen C at inhibitory natural haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK killer cell immune synapses. J. Exp. Med. 194:1507. cells. Nature 409:1055. 28. Oh, S. S., A. H. Chishti, J. Palek, and S. C. Liu. 1997. Erythrocyte membrane alter- 16. Khakoo, S., R. Rajalingam, B. Shum, K. Weidenbach, L. Flodin, D. Muir, ations in Plasmodium falciparum malaria sequestration. Curr. Opin. Hematol. 4:148. F. Canavez, S. Cooper, N. Valiante, L. Lanier, and P. Parham. 2000. Rapid 29. Craig, A., and A. Scherf. 2001. Molecules on the surface of the Plasmodium evolution of NK cell receptor systems demonstrated by comparison of chimpan- falciparum infected erythrocyte and their role in malaria pathogenesis and im- zees and humans. Immunity 12:687. mune evasion. Mol. Biochem. Parasitol. 115:129. 17. Raulet, D. H., R. E. Vance, and C. W. McMahon. 2001. Regulation of the natural killer cell receptor repertoire. Annu. Rev. Immunol. 19:291. 30. Farrell, H. E., H. Vally, D. M. Lynch, P. Fleming, G. R. Shellam, A. A. Scalzo, 18. Gomez-Lozano, N., and C. Vilches. 2002. Genotyping of human killer-cell im- and N. J. Davis-Poynter. 1997. Inhibition of natural killer cells by a cytomega- munoglobulin-like receptor gene by polymerase chain reaction with sequence- lovirus MHC class I homologue in vivo. Nature 386:510. specific primers: an update. Tissue Antigens 59:184. 31. Arase, H., E. S. Mocarski, A. E. Campbell, A. B. Hill, and L. L. Lanier. 2002. 19. Shilling, H., L. Guethlein, N. Cheng, C. Gardiner, R. Rodriguez, D. Tyan, and Direct recognition of cytomegalovirus by activating and inhibitory NK cell re- P. Parham. 2002. Allelic polymorphism synergizes with variable gene content to ceptors. Science 296:1323. individualize human KIR genotype. J. Immunol. 168:2307. 32. Smith, H. R., J. W. Heusel, I. K. Mehta, S. Kim, B. G. Dorner, O. V. Naidenko, 20. Gardiner, C., L. Guethlein, H. Shilling, M. Pando, W. Carr, R. Rajalingam, K. Iizuka, H. Furukawa, D. L. Beckman, J. T. Pingel, et al. 2002. Recognition of C. Vilches, and P. Parham. 2001. Different NK cell surface phenotypes defined by the a virus-encoded ligand by a natural killer cell activation receptor. Proc. Natl. DX9 antibody are due to KIR3DL1 gene polymorphism. J. Immunol. 166:2992. Acad. Sci. USA 99:8826. 21. Rajalingam, R., C. Gardiner, F. Canavez, C. Vilches, and P. Parham. 2001. Iden- 33. Vance, R. E., J. R. Kraft, J. D. Altman, P. E. Jensen, and D. H. Raulet. 1998. Mouse tification of seventeen novel KIR variants: fourteen of them from two non-Cau- CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocom- casian donors. Tissue Antigens 57:22. patibility complex (MHC) class I molecule Qa-1b. J. Exp. Med. 188:1841. 22. Marsh, S., P. Parham, B. Dupont, D. Geraghty, J. Trowsdale, D. Middleton, 34. Mingari, M., C. Vitale, C. Cantoni, R. Bellomo, M. Ponte, F. Schiavetti, Downloaded from C. Vilches, M. Carrington, C. Witt, G. L. A., H. Shilling, et al. 2003. Killer-cell S. Bertone, A. Moretta, and L. Moretta. 1997. Interleukin-15-induced maturation immunoglobulin-like receptor (KIR) nomenclature report, 2002. Eur. J. Immu- of human natural killer cells from early thymic precursors: selective expression nogenet. 30:229. of CD94/NKG2-A as the only HLA class I-specific inhibitory receptor. Eur. 23. Yawata, M., N. Yawata, L. Abi-Rached, and P. Parham. 2002. Variation within J. Immunol. 27:1374. the human killer cell immunoglobulin-like receptor (KIR) gene family. Crit. Rev. 35. Braud, V., H. Aldemir, B. Breart, and W. Ferlin. 2003. Expression of CD94- Immunol. 22:463. ϩ 24. Norman, P., C. Carrington, M. Byng, L. Maxwell, M. Curran, H. Stephens, NKG2A inhibitory receptor is restricted to a subset of CD8 T cells. Trends D. Chandanayingyong, D. Verity, K. Hameed, D. Ramdath, and R. Vaughan. Immunol. 24:162.

2002. Natural killer cell immunoglobulin-like receptor (KIR) locus profiles in 36. Greenwald, R. J., Y. E. Latchman, and A. H. Sharpe. 2002. Negative co-receptors http://www.jimmunol.org/ African and South Asian populations. Genes Immun. 3:86. on lymphocytes. Curr. Opin. Immunol. 14:391. 25. Hsu, K., X. Liu, A. Selvakumar, E. Mickelson, R. O’Reilly, and B. Dupont. 2002. 37. Valiante, N. M., M. Uhrberg, H. G. Shilling, K. Lienert-Weidenbach, Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic K. L. Arnett, A. D’Andrea, J. H. Phillips, L. L. Lanier, and P. Parham. 1997. diversity with a minimum of six basic framework haplotypes, each with multiple Functionally and structurally distinct NK cell receptor repertoires in the periph- subsets. J. Immunol. 169:5118. eral blood of two human donors. Immunity 7:739. by guest on October 1, 2021