This article isThis article by protected copyright. All rights reserved. 10.1111/1440doi: differences to lead between the of this version and Version copyediting, paginationbeen throughthe andproofreadingtypesetting, process,may which This article acceptedhas been for publication andundergone fullpeer review buthasnot ‡ title: Short UGT2B7cancer andbreast tagSNPs 4 3 2 1 Wen Bao in Chinesefemales Association between UDP Article type : ID 0000 (Orcid HE DR. BAOXIA These authors contributed equallywork. tothis Department ofPharmacy, Affiliated Hospital Cancer ofZhengzhouUniversity/Henan Department ofBreastSurgery, Cancer Affiliated Hospitalof Zhengzhou University/Henan MolecularCancer Pathology,ofMedicineandMenzies HealthInstituteQueensland, School Department ofStomatology, Affiliated TheFirst of Hospital Zhengzhou University,

Accepted Hospital,Cancer Zhengzhou, China GoldGriffith University, Coast, Zhengzhou, China ArticleCanc - - Xia He,PhD Zhou Zhang,MD er Hospital,er Zhengzhou, China

‡ : Original Article : Original - , 1681.12908 1,

*

, Bin Qiao,PhD , Bin 1 , HuiLiu,PhD - glucuronosyltransferase 2B7tagSNPsglucuronosyltransferase -

0002

QLD, Australia - 2640 ‡ ,

4 2,

, AlfredKing - 2775)

- Yin Lam,PhD

Record. Please citethisarticle asRecord. Please

and breast cancer breast risk and

3 , Xiu , - Li Zhao, MD 1 , This article isThis article by protected copyright. All hormones K andoccurrence gene. rs7441774 withassociated breastcancer (OR=1.22, 95%CI=1.04 OR the ( statistically of D spectrometry (MALDI controls females. tagSNP T S * OR Author for ummary h ual EY WORDS UGT2B7 Accepted Articleis retrospective

= GG had genotype ) - 1.63, 95% = luciferase reporter assays This study indicates 1.27, 95% s

for Blood samples collectedfrom were 672 ( , rs12233719, rs4356975,rs7435335andrs7441774

s G allele couldsignificantlyG allele decrease the transcriptional activity of

significant correspondence: Tel.: +86 37165587775;[email protected] usceptibility DNA extraction. DNA extraction. tagSNPs. CI=1.18 : development cancer ofbreast CI=1.08 UDP

study study was performedevalua to - a The frequency of ly - glucuronosyltransferase (UGT)glucuronosyltransferase 2B7 - TOF MS) was used to analyze to TOF used MS)was higher breast cancer risk than withtheAAgenotype(adjusted those 2.26;

- higher higher than

1.48). Afteradjust that that Matrix P

UGT2B7 =0.008). TheGCGG of haplotype were performedfurther the regulatory investigate to function -

in assisted laserassisted desorption/ionization time

the the

rs7441774 polymorphismsmay rights reserved. controls vs (0.412 ing

in the HanChinesepopulation.

for conventional risfor conventional te theassociation between the patients

G allele UGT2B7 - 1.45;

with breast with breast cancer and670 healthy ,

in p ) P . olymorphism play a play

the the and breast and breast cancer in Chinese 0.358, =0.027). =0.027).

polymorphisms.

UGT2B7 breast cancer k factors, individuals with crucial rolein P =0.006 Meanwhile, Meanwhile, the ,

was also was also

b

- reast the ; of

odds ratio odds ratio cases was UGT2B7 -

flight massflight UGT2B7

cancer the

,

s

ex

This article isThis article by protected copyright. All progression of pharmacodynamics Polymorphisms inthe chromosome 4andhassix with exons, overall an acid,tamoxifenmycophenolic andoxcarbazepine widely acidsand as bile retinoids, as well human highlevelsinthe at liver. isoform inhumans UGT2B10,UGT2B11,UGT2B15 majorsubfamilies; UGT2Bseven active members:UGT2B4, UGT includes UGT2B7, similarity:sequence UGT1, UGT3UGT8. andUGT2B the UGT2, andUGT1A are two urinthrough which produces more compounds canbesecretedfrom hydrophilic that human the body transformed can be compounds inactive to byglucuronidation However, the (bottom 20 approximately 2 breast cancer been reportedcumulative that life cancer themostBreast is malignancy commonlydiagnosed among womenworldwide.Ithas 1 I It iswellIt ofUGT2B7 avariety endogenouscompounds glucuronidates mainly is Glucuronidation catalyzed by UDP

Accepted Article NTRODUCTION - - 25%). Sexhormones25%). may promotevia anumber cancer ofmechanisms. recognized that hormonalrecognized factors risk contribute to development the and e or bilee or . 1 way , breast cancer breast 2

Individuals high with estrogen levels(inthe top 20 - fold higher riskof breast cancer compared levels individuals to withlow s bywhich , 7

of drugs

. plays animportant role insteroid hormone metabolism expressed andis 4

- UGT2B7 6

Human UGTs are classifiedHuman are four basedonamino UGTs into families acid

. through 8 the - 11

gene have been reported beenreported to affect gene have

sex hormones -

, UGT2B17 UGT2B28., UGT2B7, and amajor UGT2B time contributes exposure to thedevelopment estrogen of

an individual’s cumulativean individual’s exposure to estrogen, rights reserved. used drugs - can be eliminatedarelimitedcan be glucuronosyltransferase (UGT)glucuronosyltransferase enzymes, . length of length 5,8 - 11,12 ,

such aszidovudinemorphine, (AZT),

The

approximately UGT2B7 . 3 - , 5

including steroid hormones,including steroid the the - 25%) 25%) ha pharmacokinetics and gene is located is on gene

16 ve an . Sexhormones k b . 13

This article isThis article by protected copyright. All 1. Table to the Additional clinic frequencyhigher ofafamilial statusweremenopausal of observed the and between cases controls. However, cases hada No38.8%, respectively. significant frequencydifferences inage,bodymass or (BMI) index Thecontrols. frequenc UGT2B7 The characteristics ofcohort aresummarized study the inTable 1.Fourpolymorphisms inthe 2.1 2 cancer in females Hanethnicity. ofChinese major in role (rs12233719, survivaloverall patients carrying UGT2B7 positive cancer withassociated estrogen metabolismmay help to estimate data important provide breast study Therefore, including agemenarche,menopause at age andageatfirstfull R

Accepted ArticleThe expression enzyme of higherwas significantly inestrogenreceptor UGT2B7 ESULTS Clinical of Clinical characteristics the tumor node metastasis tumor nodemetastasis

susceptibility

breast cancer comparedbreast cancer to E

gene were genotyped in 672 weregenotyped in female withgene cancer patients and breast 670female

the the rs4356975, rs7435335andrs7441774) . ing al al This aimedresearch to ex elimination of bioactive sex hormones body,andthe risk from the ofbreast pathological characteristics of cases,includingclinical the stage according

single nucleotide .

ies

of s postmenopausal

gene expression experienced astatisticallygene expression significant (

TNM history of than vs. controls cancer (26.0% 23.9%, breast cancer andcontrolscases )

R system status, andhormone receptor summarizedare in polymorphisms

negative breast breast cancer. negative rights reserved. plore

tatus in the tatus inthe casesandcontrols w

the association four between in the

(SNPs)

UGT2B7

encodingin genes enzymes And - term pregnancy

ER gene, which playgene, which a

negative tagSNPs ere

breast cancer breast cancer P

. decrease in

14 < 40.1% and 0.05).

(ER) 2.2 This article isThis article by protected copyright. All 95%CI= progesterone receptor patients(PR) expressionwith breast inthe cancer( However, thecancer. TTGA associated wassignificantly with haplotype positive the between cancer.analyzed in thepatients Asshownwith breast in Table3,noassociation w between fourThe relationship the 2.3 was noassociationof increase assessing after rs4356975 in as shown 2.There differenceTable wasnosignificant in the frequency of the and controls ( significant difference of higher than the with Hardy are controls 2. shown inTable The frequency distributions ofthefour breast cancerbreast

Accepted Article Association between UGT2B7 polymorphisms andbreast UGT2B7cancer Association between polymorphisms frequency of Association between Association between d 1.04

odds

or - in the Weinberg equilibrium andcontrols. cases inboth UGT2B7 -

2.40 P rs7435335

the =0.008; =0.008; OR=1.63, 95%CI=1.18 ratio

rs7441774 ). controls adjusted oddsratios.Furthermore

in

genotypes with genotypes tagSNP breast cancer

the the polymorphisms/ UGT2B7

(0.412 vs. (0.412 vs. 0.358,

G GG between wasalsothe observed genotype s allele allele All and estrogen receptor (ER) expression receptor (ER)expression in patientsand estrogen breast with UGT2B7 of

tagSNP

in the cases the genotype frequencies observed genotype observed the frequencies breast breast cancer UGT2B7

genotypes rights reserved. ( breast cancer

P tagSNP s P =0.027; OR=1.22,95%CI=

=0.006; OR=1.27,=0.006; 95%CI= and hormone receptor hormonereceptor statusin and - 2.26) after assessing assessing 2.26) after

polymorphisms/genotypes and incases

s grades

, the GCGG, the an showed haplotype

between between and hormone receptorstatuswasand hormone cases cases

as shownin breast breast cancer Of four the was statistically the the

supplement Table1

risk adjusted oddsadjusted ratios 1.04 w 1.08 P UGT2B7 breast cancer as in as in =0.017; OR=1.58,=0.017; cases andcontrolscases

- - 1.45).

1.48). A significant

consistent consistent patients with rs12233719, as

tagSNP

There

observed cases ly . s,

This article isThis article by protected copyright. All biomarker tamoxifen for goodresponse to a therapy breast cancer associatedwithhas been metabolism, the toxicity ofchemothera and efficacy epirubicin has cancer alsobeen investigated. For example, the inChinaworkers that rs7662029 population allele different populations and ethnicities differences inthedistribution of R 3 Fig G construct showedlowerluciferase activity than the standardized against internal control Renilla activity. T pGL3 the To determineeffect the of 2.4 he l ecently D

AcceptedThe impact of Article ure ure ISCUSSION UGT2B7 enzyme, allele Identification UGT2B7 uciferase activity in cell extracts wasanalyzed48hoursafter transfection andwas

- is much in higher promoter G(variantpromoter allele) 1). ,

a

A>G

(0.463) number of SNPs have been reported inthe number reported ofSNPshavebeen

patients rs7439366

and UGT2B7

. 19

, of 1

5

,1 rs7441774 . the activity ofthe 2 7 0

in complete link - a 2

C>T was associated with bladder C>T waswithbladder cancer risk associated in benzidine 1 healthy healthy

Moreover, the the polymorphismsmetabolism used onthe ofdrugs - specific constructs, pGL3 rs7441774

A>G UGT2B7 , Japanese

were generated andtransientlyexpressed HepG2 in cells. . 15 UGT2B7 polymorphisms , 1 6 age disequilibrium withthe rs7668258

rs7441774

For e A>G polymorphism in intron 2A>G polymorphismactivity of inintron onthe rights reserved. polymorphisms population xample, frequency the of rs7439366 the

802Tyr has been has asacandidate suggested 802Tyr

UGT2B7

A>G polymorphism A>G polymorphism in patients with breastin patientswith cancer . T rs7441774 1 - (0.756) than 5 UGT2B7 he r promoter A(wild promoter , 1 6

,1 have been esults indicated t 8

Moreover, Lin al.observedMoreover, et

rs7668258

gene. Moreover, large gene. Moreover, A construct ( A construct in

observed between

a matched

C>T polymorphism - type allele)type and

hat hat the

to P

treat T>C =

Caucasian 0.005, . 11 - rs7441774

, exposed breast

C py in

This article isThis article by protected copyright. All br expression ofdecreased UGT2B7 moreare easilyeliminated inbileand Importantly, urine. patients breast with cancerhave UGT2B7 estradiol and estriol) and catecholestrogens (e.g. 16 functional cancer of colorectal al.Scherer et an observed associationa between UGT2B4 benzidine showed al. Firstcancer. 1.22, 95%CI=1.04 oddsadjusted and breast ratio associatedwith was significantly cancer( 1.63, 95%CI=1.18 higher in 0.341)(0.358 vs. whichwasthe controls, same as population. showedtheOur results that frequencyof rs7435335 UGT2B7 attempt evaluate between theassociation to the rs12233719, rs4356975and rs7435335 werecancer assessed in females theChineseHanThis population. from east In the presenttheIn the study, association between Accepted isbiologically plausibleIt that Article . 2 5

Finally, the

. breast cancer polymorphisms andbreast cancer. polymorphisms was significantly associated cancerafter for withbreast adjusting ethnicity - 4 exposed in workers - UGT2B15 G>A polymorphisms were notsignificantly withG>A polymorphismsassociated cancer were in breast this 6 that

, UGT2B7 glucuronidat UGT2B the the . 18

UGT2B7 . Interestingly, the frequency of 2316 the 2 - - UGT2B7

3 1.45). 2.26). GCGG Additionally, the of haplotype

gene have have gene polymorphisms areassociated withthe polymorphisms ofvarious risk cancers. Lin et

Vidal etal.reported African American wildmen the who carry

cases than incontrols after adjust

C802T polymorphism was associated withpolymorphismC802T was bladdercancer in associated

rs7441774 China

an that that in

UGT

mRNA es sexhormonesproduceless to elevated riskofcancer prostate . 19 2B7

Moreover, the rs13129471 A>G our previous study

A>G rights reserved. in the affected breast in the

SNP

The rs12233719

polymorphism, which was in complete which in polymorphism, was s have animpact onsuscepti s have UGT2B7 UGT2B15 - OH the -

ing the estrone) aresubstratesestrone) of

rs7441774

tagSNPs

of

polymorphism polymorphism GG wassignificantly genotype

G> a healthy Chinese

compared the to odds ratios ( T, rs4356975

UGT2B7 . and the riskand the ofbreast 2

4 active compounds G allelewas0.358 in

Second

P study polymorphism

= 0.027; = 0.027; OR = and increased risk and increased

had ahigher bility tobreastbility P , estrogens (e.g. , estrogens(e.g.

C>T

is = 0.008; = 0.008; OR =

population unaffected the firstthe

and . 2 - 2 6 type type

that that of a

This article isThis article by protected copyright. All of ER womenAfrican American polymorphism receptor wasstrongly ofassociated with progesterone the ER associatedare with assess associationfurther between the populations and other ethnic groups fact the and genotypes the noMoreover, significant associations wereobserved between between thebreast cancer in Chineseal.reported Hanpopulation.However,Sunet noassociation metabolization gene may ina reduced reflect activity oftheenzyme vivoandthis in could impact hormone decrea polymorphism, AtoGsubstitution andfoundthat atthe CCwith the genotype CTand the withassociated altered lamotrigine pharmacokinetics inpatients epilepsy; patients with with in acid polymorphisms affect enzymatic the ofUGT2B7. activity The link

Accepted receptorEstrogen indicatesThis study Article age disequilibrium withthe rs7668258 - sed transcription of

breast cancer breast Chinese that UGT2B7 TT genotypes hadsignificantlyTT genotypes the distributionthe frequenciesof .

patients with epilepsy have been reported to reported have been

polymorphisms populationscancer risk andbreast of in ancestry African plasma a - . negative (ER 29 poor prognosis .

2

that 7 However, t

Moreover, potentialMoreover, we examinedthe functional ofthis role . estradiol concentration the the 3

UGT2B7 2

Moreover, UGT2B7 - he present he present study indicates ) and progesterone receptor . . 1

3 tagSNP 5 0 .

- ( 2 UGT2B7 , 1

删 6 3 8 gene. UGT1A1

1

The A

除 Haddad et al.reportedHaddad et rights reserved.

dditional studiesarerequired to confirm and T>C andrs7439366 UGT2B7 lower ) s

UGT2B7 affect plasma the ofvalproic concentrations And d

may individualinfluence susceptibility to UGT2B7

polymorphisms and the risk of breast cancer. cancer. polymorphisms ofbreast risk andthe

. polymorphisms are 29 lamotrigine clearance ratesthanpatients

ecreased ecreased transcription ofthe These differences could explained be by polymorphisms Asian between vary

- 161C>T polymorphism was

- the the 161

2316 may allele generate a that

C>T and802 UGT2B4 -

negative (PR C>T that that there is no association

the rs11571215 the variants associated withtheriskassociated

or UGT2B7

C>T - - , ) breast cancer ) breast

1 breast 5 ,1 6 UGT2B7 ,1 8

may cancer in

. 2 8

This article isThis article by protected copyright. All datereference undergone orhad abilateral oophorectomy. Tumorsas categorized were assumed bepostmenopausal to if they hadnoperiodsforat least 12months before the ofcancer w history factorsreproductive (agefirst atmenarche, age birth, age at menopause) andfamilial examinationsphysical atthesame andhadnoknown hospital malignancy.on Data wereoutpatients rec six andcontrols, hundred non seventy CancerHospital2015 atthe Affiliated ofZhengzhou were Aspopulation University enrolled. with pathologically Six hundred and seventy 4.1 4 population. ofhaplotype and UGT2B7 activity 21 inpatients withbreaststatus cancerin study. this Ithasbeensu tissues that between METHODS - Accepted ArticleT hydroxyprogesterone beused selective could as “probes” for microsomal human liver Study population

his study indicateshis study the the there there is a . 2 expression ofthe 4 UGT2B7

However

UGT2B7 decreased decreased ofexpression UGT2B7

,

3 polymorphisms cancer, consist inbreast andERstatus , 3 ere obtained ere through aquestionnaire

confirmed breast cancerbetween primary January2012andOctober the ruited the over same controls these receiving were period; regular which may the relationship explain between

are associated associated breastcancerrisk with increased are that UGT2B7 - two non PR the GGthe of genotype

in breast cancer. in breast

TTGA haplotype was significantly associated wassignificantly with haplotype TTGA - smoking and - smoking non and rights reserved.

non

mRNA

UGT2B7 - alcohol consumingfemale

- - in both ER+in both andER based interview. based interview. Womenwere alcohol consuming female

rs7441774 ggested ggested that 6α UGT2B7 in the Chinese Han

A>G andGCGG ent

polymorphisms

- with the

breast breast cancer - s diagnosed s diagnosed

and PR

report

This article isThis article by protected copyright. All SNPs r tobe attempted to definethe rs74353rs4356975, 0.8. Finally fourcandidateS offrequency) Chinese Handatabase (CHB) by followingresearched the cr downloaded literature review. TagSNPs inthe ofSNPsa subset Many SNPsshowlinkage disequilibrium suggesting correlated genotypes, that only (LD),or 4.2 Helsinki. University, wasperformedZhengzhou, Chinaand accordance in withthe Declaration of was approvedEthics bythe Committee Cancer oftheAffiliated Hospital of Zhengzhou fromexcluded thisstudy. Allsubjectsfrom were Hanethnic group the in China. This diabetesand/or mellitusmay (allof whichtometabolicenzyme berelated activity) were calcificat Tumor ER

Accepted Article Individuals with non - Haplotypes frequenciesHaplotypes and their Tag positive and PR

size, size, histological andgradetype from wereobtained e SNPs selection, ion, etc.), otherion, benignormalignant etc.), tumors, hepaticdiseases, chronic kidney or Written informed consent includedin was obtainedfrom participants all

s from (http://www.hapmap.org). HapMapdatabase the 2 > 0.8. UGT2B7 ,

The ChineseHan known as tagSNPs known as

- 35 andrs7441774. p ositive if nuclearstaining was observed inat least 10% ofnuclei.

- correlation coefficient between SNP each andahaplotype malignant lesions breasttumors, (benign benign breast mastitis, haplotype and

gene were selectedofthe onthebasis gene were HapMapda NPs according selected were tothese criteria: rs12233719, iteria: 1)Detectedby Haploview 4.2;2)MAF (minorallele

population’s SNPpopulation’s of data

, were estimated thePHASE byusing program.

need to begenotyped forneed to disease association studies.

genotyping rights reserved. ≥

0.05; 3) Alinkage0.05; 3) disequilibrium ofr2 value

ach patient’s patient’s report.pathology ach UGT2B7

Then t

gene were gene he tagSNPswere tabase and

of tagging the study.

We study study ≥

This article isThis article by protected copyright. All GmbH, (Qiagen, kit e r mega e w s r e using prepared m was DNA i Plasmid r sequencing. direct p by verified were constructs l a m r o n e h T AATACCA . R C P n o i s n e t x T e p a l r e v o 5’ y b d e r a p e r p AAAACGCGTACCTGTGTTTTGTG 5’ for allele AA homozygous carrying samples WI, Madison, (Promega, plasmid gene activity. UGT2B7 A 4.3 Sequenomusing real San Diego,CA, previously described. USA),as supplement Sa spectrometry (MALDI UGT2B7 TIANGEN the using (Tiangen DNACo.,Biotech Bloodkit L TTTGTG

- n Diego,CA, USA).Themanually

Accepteddual Article AAACTCGAGTGGGAAATGG Peripheral Peripheral venous bloodfrom wasdrawn subject andgenomic each was extracted DNA Detecting thefunctiono Detecting - - G G T A A A G G G T G A G C T C A A A synthesized and then cloned into XhoI and MluI restrictive sites of sites restrictive MluI and XhoI into cloned then and synthesized - uieae eotr sa ws sd o eet h efc of effect the detect to used was assay reporter luciferase

was performedmatrixwas by

- - Table Table ’ rvre. h mtgnss rmr wr 5’ were primers mutagenesis The (reverse). 3’ 3’ (forward) and 5’ and (forward) 3’ 2

35 . Genotyping was

- time software(TYPER4.0 detection software). h sqecs f agt intron target of sequences The - TOF Sequenom a MS)using (SequenomInc., MassARRAY system f the - TGGTATTAACGTGTACATGAGTT rs7441774 -

assisted laserassisted desorption/ionization time idn Gray fr ute transfection. further for Germany) Hilden, USA)

performed designed primersdesigned forgenotypingwere used - ’ frad ad 5’ and (forward) 3’ - ’ (reverse). 3’ rights reserved. . W pGL3 promoter pGL3 A>G e amplified sequence by PCR from human human from PCR by sequence amplified e 34

using the the using iPLEX (Sequenom system Inc.,

Genotype dataanalysiswasperformed

allele in

s -

h pL promoter pGL3 The ’ 5 d n a ) d r a w r o f ( ’ 3 ih rs7441774A with

the - A plasmid A td, Beijing,China).Genotyping - AAAACGCGTACCTGTG AAAACGCGTACCTGTG UGT2B7 gene - AACTCATGTACACGTT

the the

- and the the and 3’ (reverse). 3’ s417 all on allele rs7441774

the the r alls were alleles G or - of - A plasmid was was plasmid A pGL3 promoter pGL3 - flight massflight

primers were primers listed in a

Plasmid Plasmid plasmid plasmid

-

This article isThis article by protected copyright. All 95% confidence were intervals (95% CI) calculated toevaluateassociations the between Hardy transformation) examined were Mann the using t ± SD)between USA).in continuousvariables Differences witha normal(presented distribution as York, NY,USA) andS was analysis Statistical performed (SPSS; SPSS23.0software package New using IBM, 4.4 BioscienceSpring monoclonal rabbit ER immunohistochemical assessed was ER byimmunohistochemistry andPRstatus Immunohistochemistry transfection experiments wereperformed times three independently. protocols ofPromega (Madi activitiesweremeasuredluciferase withGlomax luminometers 20/20 using standard the Aftercontrol. wasperformed incubation for 48h,cell lysis and USA HepG2 cells - test. Differences in continuous variables with a non

Accepted Article Statistical analysis Statistical ). The pGL3 ). The These recombinant plasmids cotransfectedwith pRL were - Weinberg equilibrium using Pearson wereassessed the χ2

( hepatoma carcinoma cells breast cancer breast - promoter plasmidpromoter was

(Pleasanton, CA,(Pleasanton, USA).

( analysis was conducted analysis TATA

SP1

) son, WI, wasUSA). in Eachconstruct and tested triplicate the and cases and controls were assessed the using independent sample

ver. 8.0 software package (STATA, Station, 8.0 softwarepackage College TX, ver. PR

(1E2) )

also co also by Lipofectamine 2000(Invitrogen, Carlsbad,CA rights reserved.

antibody used

following the instructions inside kit.the The - - Whitney U transfected transfected with pRL - normal distribution after(even

in this study werein thisstudy p (IHC) assay. - test. Allelicfrequencie - f SV40 (inte irefly luciferase irefly and Renilla - test. (OR) Oddsratio and

- SV40 as a negative SV40 asanegative

The rnal control) into

urchased from s and the the mean

, This article isThis article by protected copyright. All The authors have nofinancial DISCLOSURE 162102310157 81302796 This A statistically significant. usingevaluated independent an cancer the was examinedusing χ2 Pearson the between firstfullterm age at via multiple regressi pregnancy logistic andhistory reproductivelifestyle, factors ofcancer,ageatmenarche, age menopauseat and developmenton the ofbreast cancer, we forrisk adjusted conventional factorsincluding UGT2B7

Accepted CKNOWLEDGMENTS Article work w as

tagSNPs and breast cancer. To explore cancer.To explore the andbreast effecttagSNPs independent of ) andthe

was supported by

assessed using Pearson the χ2 UGT2B7 ). S

Thank youforAmericanExperts the language Journal editing.for English

Department

tagSNPs and hormone receptor status andhormoneintagSNPs patients receptor withbreast cancer

the or - of

sampl

National Natural Foundation Science of China (No. commercial conflictsofinterest. Science and Science - test. e t e t Twotest. T - rights reserved. test. he associationof with genotypes ofbreast grade

The Technology - luciferase luciferase assayreporter were data tailed P tailed

-

of HenanProvince values< on analysis. The association

0.05 w ere UGT2

considered , China B7

tagSNPs tagSNPs

(No.

This article isThis article by protected copyright. All 7. 6. 5. 4. 3. 2. 1. R EFERENCES Accepted Article Radominska K,Mackenzie PI,S, Itäaho The Ikushiro Miners JO, FinelM. co Kallionpää RA, E,M. Järvinen Finel ofestrone Glucuronidation and16α J N,VahermoMosorin Sneitz M, Raftogianis R, Creveling C,Weinshilboum J.Estrogen R,Weisz metabolism by Eliassen AH,Missmer SA,Tworoger SS ovarian cancers. Brown SB,Hankinson SE.Endogenousestrogens risk andthe ofbreast, endometrial, and Mol Biol.Mol by human enzymes: ThekeyrolesofUGT1A10 UGT andUGT2B7. 17 UDP conjugation. Inst concentrations ofcancer andrisk breast among premenopausal women. families. tobe target revealed: the significance for human from 1Aand UGTs the 2B both human UDP 2307 epiestradiol by human UDP 17 - - hydroxy group variably glucuronidation influences the ofbeta epiestriol, and13 .

- - 2006; 98:1406 glucuronosyltransferases in theglucuronosyltransferases glucuronidationof estriol, 16 23 15.

Drug Rev Metab 2015; 154:

-

-

Pandya A, Bratton SM, MJ Pandya A,Bratton RedinboMR,Miley J Natl CancerJ Natl Monogr Inst glucuronosyltransferase 2B7 C Steroid - 14 -

104 epiestradiol. 15.

2015; 99:8 - .

1 2010; 11. - glucuronosyltransferases. glucuronosyltransferases.

, 42:

et al Drug Dispos Metab - 10. rights reserved. 133 .

Regiospecificity and stereospecificity ofhuman .

,

-

2000 et al et 1 44. - terminal end mammalianis thefirst terminal UGT . ; 27:113

Endogenous steroid hormone

. - Drug DisposMetab

1 2013; 24.

. The crystal structure of . Thecrystal structure

41: nfiguration of the

- 582 estradiol and - epiestriol, - J Steroid BiochemJ Steroid 5 91. J Natl CancerJ Natl - hydroxyestrone .

2008;

36:

This article isThis article by protected copyright. All 14. 13. 12. 11. 10. 9. 8.

Accepted Article

Park SK,KangDY D,Noh Ma WuMa CL, XY, Z Jiao Romero E,Lévesque R,Benoit Delage Bas Yuan L,Qian S,XiaoY, Tamoxifen Metabolism Cancer Patients. inBreast Glucuronthe 2007; acidafterasingleoralmycophenolic healthy dosein volunteers. UGT1A9, UGT2B7 and Toxicol. gene polymorphisms morphine onpostoperative consumption. zidovudine glucuronidation activity. UDP 89 polymorphism T1 genetic cancer andbreast risk. 677 UDP (UGT) glycosyltransferase genesuperfamily. 347 association with individualized oxcarbazepine - ckenzie PI, BockKW, Burchell B 96. tami S, Gupta A, Zackrisson AL tamiGupta A,Zackrisson S, - - 6 3 -

glucuronosyltransferase 2B7(UGT2B7) typeand glucuronosyltransferase allelicvariantsits wild affect 85. 60. 81:392

-

Lorca A,Novillo Lorca A,GaibarM,Bandrés F, Fernández 2014; 115:423

idase Genotypesidase UGT1A4, UGT2B15 UGT2B7, andUGT2B17on - 400.

- ,

4

et al et genetic polymorphismsgenetic pharmacokinetic onthe profileof Sun H, Zeng S.HomoSun H,Zeng 31. ,

et al et

. SCN1A,and UGT2B7polymorphisms ABCC2 gene in - Biancamano MO .

Reproductive factors, S glutathione ,

, Biochem PharmacolBiochem et al et rights reserved.

et al et .

. Influence ofUGT2B7, OPRM1andABCB1

Nomenclature forthemammalianupdate

therapy. - ,

and hetero et al et Breast CancerBreast Treat Res PLoS One Pharmacogenet Genomics

.

The impact ofUGT1A8, Pharmacogenomics .

2015; 95: - dimerization of human

2015; 10: - Santander A. Impacts of Basic ClinPharmacol Clin Pharmacol Ther.

58 - transferase M1transferase and

- e0132269. 70.

2003; 78:

2015;

2005;

16:

15:

This article isThis article by protected copyright. All Accepted21. 20. 19. 18. Article17. 16. 15.

Parmar S,S E, Sawyer MB,Pituskin WC,Lin GF,Guo Chen JG W,W. WangHe B,Zhang X,Linpolymorphisms Zhao Genetic of Bhasker Lee SJ,JeongHwang HE MS, K,MoriyaSaito H,SawaguchiT C8 Pharmacol. UGT potential and alleles clinical significance. UDP 398 2B7 gene(UGT2B7) Koreanpopulation. ina subjects. UDP Cancer Res polymorphism ontheoutcome epirubicin adjuvant treatment of inbreast cancer. Clin Breast Cancer polymorphism epirubicin predicts clearance and outcomes China. 02T (His268Tyr) polymorphism02T (His268Tyr) with bladder cancer inbenzidine - 402. - - - glucuronosyltransferase 2B7(UGT2B7)glucuronosyltransferase amino 268:ethnic at of acid diversity 2B7gene (UGT2B7)glucuronocyltransferase poly Glucurono Toxicol Sci

CR, McKinnonW,StoneA

Clin Biochem tingl JC,Huber tingl .

2014; 30: 2011; - syltransferase 2B7 in Chinese healthy Hanpopulation.syltransferase 2B7inChinesehealthy .

13:

2005; 85: 2016; 16:

6 . R57.

- 2006; 39: Damaraju S 8.

- ,

Wechselberger A

et al.Anet association ofUDP

502 , 139

et al et ,

-

et et Haplotype of al. analysis - 50 303 1 . variations inUDPGenetic 44. , ,

6. rights reserved. et al.Geneticet polymorphism of et al.Auridineet glucuronosyltransferase 2B7 -

30

8. Pharmacogenetics

,

Drug Metab PharmacokinetDrug Metab et al .

Impact ofUGT2B7His268Tyr

morphisms Japanese inhealthy - glucuronosyltransferase 2B7glucuronosyltransferase in early

2000; - glucuronosyltransferase glucuronosyltransferase -

stage br 10: - exposed in workers

679 Chin JofClin .

- east cancer. east 2010; 25: 2010; 25: 6 85.

Breast This article isThis article by protected copyright. All Accepted28. 27. 26. 25. Article24. 23. 22.

Sun C, HuoD,Nemesure B S,Lertkachatarn SingkhamN, Towanabut WangChu XM,LF, GJ Zhang D,HolkoWang M J,Scholtens Vid D, Scherer Koepl LM,PooleEM Sun C, C HuoD,Southard polymorphisms acidpharmacokinetics inChineseepilepsypatients. onvalproic 321 breast and estrogen statusofcancer.receptor breast study. UDP Genes Chromosomes Cancer associations of with risk cancer: ofcolorectal familycolon NSAIDs cancer registry. Genet upstream human UGT2B4 tothe andimplications forbreast cancer risk. gene African ancestry. nonsynon patients. - Clin Pharmacol 161C>T polymorphism populationpharmacokinetics ofon the inThai lamotrigine al AC,al C,Schildkraut JM Tucker - 3 - glucuronosyltransferase 2B glucuronosyltransferase 30. .

BMC Cancer 2011; 130:

Eur Pharmacol JClin ymous single . 2012; 68:1395 Int J Int Cancer

767

2013; - - 7 nucleotide nucleotide polymorphisms in cancer populations andbreast of 75.

, 13:

,

et al et

et al et

2014; 53:

,

556.

, 2012; 130: 2740 2012; 130: . et al et

- . et et al. metabolismLipid incontralateral unaffected genes 2013; 69:1285

1 , . A signatureofbalancing selection in the region

gene variants with prostate cancer risk multiethnic ina 401. et al Lack between ofassociation common UGT2B . Influence of. Influence UDP

, rights reserved. et alet .

Genetic in variation UGT 568

. S, Punyawudho oftheUGT2B7 B.Influence

Novel associations of - 5 78. - - 12 274

91. 2. Cancer PrevCancer Res(Phila

-

glucuronosyltransferase glucuronosyltransferase genes modifygenes the ).

2013; 6: Hum Eur J

This article isThis article by protected copyright. All Accepted 34. 33. 32. Article31. 30. 29.

593: Chinese toAlzheimer'sthe Hanpopulation. susceptibility in disease Yan H,Kong Y,He B DJ,Bowalgaha K,Elliot Mackenzie PI, Kn 145 breast KL,Haddad SA,Lunetta Ruiz positive of predictor long Norden F,KhramtsovHuo D, Ikpatt A Sp Delta4 negative in patients. polymorphisms, concentrations hormone sex 2007; 21 recombinant UDP

arks R,UlrichCM,J arks Bigler - indigenous hydroxyprogesterone selective are substrates forUGT2B7. -

1 56 54.

cancer 35: - skjöld A, - 3

60. breast cancer. breast cancer.

- Breast Cancer Res breast

Keto C19 363

subtypes subtypes in

- African 3

cancer. 70.

- Fohlin H, Fohlin term from adjuvant benefit tamoxifen treatment ofestrogen - glucuronosyltransferases (UGTs): 6alpha (UGTs): glucuronosyltransferases

-

and C21

, women

Breast

et al et J ClinOncol

African

Fornander T Fornander . CYP2J2 polymorphism rs890293 with isassociated .

2004; 6:R488 - Cancer

hydroxysteroids by hydroxysteroids human microsomal liver and , - , reveals

Narváez EA, al.Hormoneet et al et al. et

American . UDP .

Population rights reserved. 2009; Res Treat over ,

et alet - glucuronosyltransferase and sulfotransferaseglucuronosyltransferase - - ights of JO.ights KM, Miners Theglucuronidation

representation

R4 27: 4515 women. , and status tumorin breast cancer receptor . Progesterone 98. .

differences 2016; 160:

- Breast CancerBreast ResTreat 45 21.

of -

313 receptor positivityis a related in -

triple

and

breast Drug Metab Dispos Drug Metab - 3 22. -

pathways and Neurosci LettNeurosci

cancer:

survey receptor

2015;

. risk

. 2015;

154:

of

This article isThis article by protected copyright. All TABLE 1 ER ER ( ER (+) PR ( ER (+) PR (+) Hormone receptor status I I I I Grade of breast cancer, HRT use OC use A A A Family of history Postmenopausal BMI(kg/m Age (years) Characteristic

V II I

Accepted Articlege ge of ge atfirst birth (years)

( - - of ) PR ) PR (+)

, menarche menopause n ,

Demographic features ofthe breast cancercases

n (%) ( 2 -

- (%) ) ) )

,

n (years) cancer,

(years) (%)

n ,

(%) n n

(%) (%)

C ase 1 55 181 (26.9) 405 (60.3) 184 (27.4) 364 (54.2) 175 270 45.4 2 23. 86 (12.8) 2.9 ± 34 (5.1) 52 (7.7) 38 (5.6) 4.8 ± .0 s 1

5 4.6

(

5 (26.0) (40.1) ± 6.53 n ± ± 3.5

.5 = 1. rights reserved. 6 3

5 .6 .9 672

0

)

andcontrols. Controls 13 54.0 ± 6.89 160 (23.9) 260 47.5 25 2 3 .4 ± .2 ± .9 ± 2.6 15.9 3.

(

± ( 38

9 n 1

5 4.3

. .40 =

8 .9 ) 670

)

P <0.05 < - NS NS NS NS NS NS NS value 0.05

This article isThis article by protected copyright. All GG AG AA G AA A GA rs7441774 A>G GG A TT G CT rs7435335 CC T TT C GT rs4356975C>T GG T G rs12233719 Polymorphism/Genotype regression TABLE 2 usingthe χ analyzed using Student's Mann menarche (expressedas contraceptive; HRT, hormone replacement therapy BMI, body mass index;

Accepted Article

– Whitney

2 analysis T G>A -

G>T test. he association between U

-

. test. BMI (expressed as

NS, non the

t - test. Other dataare expressed as frequencies and percentages and were evaluated mean standard± deviation) were abnormally distributed and analyzed using the - significant; ER: estrogen receptor; Case

UGT2B7 1308 (97.3) 1164 (86.6) 121 (17.9) 314 (46.8) 237 (35.3) 556 (41.2) 788 (58.8) 636 (94.7) 224 (33.3) 310 (46.1) 138 (20.6) 758 (56.4) 586 (43.6) 164 (24.4) 500 (74.4) 180 (13.4) 36 (2.7) 36 (5.3) s n 8 (1.2) 0 (0)

( (%) n

the

=

67 t

agSNPs and breast cancer mean standard ± deviation) was normallydistributed and

2)

rights reserved.

. A ge, ge, Controls ageat first birth, age of 1129 (84.3) 1293 (96.5) 306 (45.7) 277 (41.3) 480 (35.8) 860 (64.2) 625 (93.3) 247 (36.9) 311 (46.4) 112 805 (60.1) 535 (39.9) 175 (26.1) 477 (71.2) 211 (15.7) 87 (13.0) 43 (6.4) 47 (3.5) 18 (2.7)

2 (0.3) n (16.7)

(%) (

n

=

PR:

670

progesterone receptor ) was e was

P 0.008 0.145 0.006 0.263 0.449 0.353 0.078 0.193 0.071 0.055 0.366 0.091 - stimated value

menopause and

via 1.63 (1.18 0.85 1.27 0.49 0.83 0.76 0.45 0.91 0.83 0.76(0.54 0.81(0.60 0.88(0.74 aOR (

multiple logistic

(0.66 (1.08 (0.26 (0.52 (0.49 (0.18 (0.68 (0.67 ; 95% OC, oral

a ------ge 1.12) 1.09) 1.02) 2.26) 1.06) 1.48) 1.02) 1.30) 1.18) 1.03) 1.16) 1.03)

CI) of

This article isThis article by protected copyright. All Accepted ArticleTABLE 3 Abbreviations: OR TTGA GCAA GCGG GTGA GG AG AA G AA A GA rs7441774 A>G GG A TT G CT rs7435335 CC T TT C GT rs4356975 GG T G rs12233719 Polymorphism/Genotype

Association between

G>A C>T

G>T

= odds ratio

;

UGT2B7 CI =confidence interval

178 (13.3) 550 (41.1) 575 (42.9) ER(+)/ER( 34 (2.6) 210/101 354/149 560/281 416/196 870/411 523/258 391/172 331/145 777/353 153/80 217/98 115/63 137/77 175/90

42/19 87/37 72/24 38/19 t 11/7 n/n 2/0 agSNPs and hormone receptor status inpatients with breast cancer.

- ), rights reserved.

1.06 (0.96

1.27 (0.81 0.68 0.95 (0.66 0.85 (0.66 1.05 (0.58 0.96 (0.55 1.24 (0.78 1.06 (0.68 1.13 (0.78 1.46 (0.56 1.24 (0.76 OR ( ; 199 (14.8) 472 (35.5) 603 (45.1) a 50 (3.8) OR: (0.38 95%

- a ------10.77) djusted for

1.98) 1.10) 1.34) 1.08) 1.87) 1.67) 1.97) 1.67) 1.54) 3.83) 1.80) CI)

PR (+)/PR(

conventional riskfactors 746/132 203/107 303/163 537/341 398/214 207/107 185/281 381/497 317/159 0.695 0.149 0.027 385/81 167/98 447/19 145/87 834/42 112/67 69/28 38/19 87/39 10/7 n/n 2/0

- 0.94 0.73 1.22 ),

(0.74 (0.45 (1.04 0.95 (0.08 1.20 (0.89 0.69 (0.42 0.90 (0.64 0.85 (0.67 0.93 (0.53 0.84 (0.48 1.34 (0.84 1.15 (0.74 1.16 (0.92 1.40 (0.52 1.18 (0.80 OR ( - - - 1.19) 1.13) 1.45) 95% .

------10.30)

1.68) 1.15) 1.27) 1.07) 1.65) 1.49) 2.12) 1.80) 1.46) 3.74) 1.70) CI)

This article isThis article by protected copyright. All Aallele. the * the F ER =estrogen receptor

Accepted ArticleIGURE TTGG TTGA GTGG GTGA GCGG GCGA UGT2B7 The gene. plasmid with

1

The effect of P <0.05 compared with each ofthe <0.05 comparedwith each constructs. ; PR = progesterone receptor; the the rs7441774 231/124 154/65 127/49 224/99 50/27 82/42 the the

A> G allele showedlower transcriptional activitythan rights reserved. G polymorphism on the transcriptional transcriptional G polymorphismonthe activity of

* 1.23 1.17 (0.75 0.96 (0.66 1.20 (0.89 0.86 (0.60 P <

0.05. (0.73

- - - - - 2.08) 1.82) 1.39) 1.68) 1.31)

231/126 213/108 134/84 128/51 57/16 69/55

0.55 (0.30 1.24 (0.86 1.08 (0.78 0.79 (0.53 1.58 (1.04

- - - - - 1.01) 1.77) 1.50) 1.17) 2.40)

*