US 20140373197A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0373.197 A1 Raemaekers et al. (43) Pub. Date: Dec. 18, 2014
(54) DSRNAAS INSECT CONTROL AGENT Publication Classification (71) Applicant: DEVGEN N.V., Zwijnaarde (BE) (51) Int. Cl. CI2N 5/82 (2006.01) (72) Inventors: Romaan Raemaekers, De Pinte (BE); AOIN57/6 (2006.01) Laurent Kubler, Beynost (FR); Els CI2N IS/II3 (2006.01) Vanbleu, Berlare (BE); Thierry Andre (52) U.S. Cl. Olivier Eddy Bogaert, Kortrijk (BE) CPC ...... CI2N 15/8286 (2013.01); C12N 15/I 13 (2013.01); A0IN 57/16 (2013.01); C12N (21) Appl. No.: 14/470,868 23 10/14 (2013.01) USPC ...... 800/279; 536/24.5; 435/418; 800/302: (22) Filed: Aug. 27, 2014 530/370; 127/29: 514/44 A: 426/594; 426/597; Related U.S. Application Data 426/615; 426/635; 162/100; 554/1 (62) Division of application No. 12/087.536, filed on Jan. 13, 2009, now abandoned, filed as application No. (57) ABSTRACT PCT/EP2007/000286 on Jan. 12, 2007. The present invention relates to methods for controlling pest (60) Provisional application No. 60/875,356, filed on Dec. infestation using double stranded RNA molecules. The inven 18, 2006, provisional application No. 60/837,910, tion provides methods for making transgenic plants that filed on Aug. 16, 2006, provisional application No. express the double stranded RNA molecules, as well as pes 60/771,160, filed on Feb. 7, 2006, provisional applica ticidal agents and commodity products produced by the tion No. 60/758,191, filed on Jan. 12, 2006. inventive plants. Patent Application Publication Dec. 18, 2014 Sheet 1 of 16 US 2014/03.73197 A1
did s s s -- target 6 A. s aara8- target 7 o ------, target 10 2 e ad o:... target 11 c s .x.target 14 O Cs -(e-gfp dsRNA o -&- diet Only so c s ha s O.
days on diet
FIGURE 1-LD
ow. target 1 o&o target 2 ork-target 3
- - - - -: target 15 x-target 16 -o-gfp dsRNA ~ x- diet only
days on diet
FIGURE 2-D Patent Application Publication Dec. 18, 2014 Sheet 2 of 16 US 2014/03.73197 A1
es
saE s 2.
ha O. -- target 2 waf so s s d o s ha D
days on diet
FGURE 3-D
-- untreated Control & D014 -- LD014 F1 - wwww.3:... LD014 C1 ck. LD014 F2 --LD014 C2
3 days on diet
FGURE 4-LD Patent Application Publication Dec. 18, 2014 Sheet 3 of 16 US 2014/03.73197 A1
8 -0-0 ugful A. s ...8- ugful wa O -&- 0,1 ugful e -- 0, 01 ugful O -x-0,001 ugful S (s -- 0,0001 uglul s ~:- 0, 00001 uglul
9 s c O O. O 1 2 3 4 5 6 7 8 9 O 12 13 4 5 days on diet
FIGURE 5-LD (a)
-- 0 ugful 80 ~&o. 1 ugful -k- 0,1 ugful 60 W i? Ž 3:... 0,0 ugful -- 0.001 ugul 40 -- 0, 0001 uglul 20 *: -e- -a-0.00001 ugful
O 0 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 days on diet
FIGURE 5-LD (b) Patent Application Publication Dec. 18, 2014 Sheet 4 of 16 US 2014/03.73197 A1
s s -0-0 ugful O -8- 1 ugful ba d --&- 0,1 ugful e :- 0,0 ugful w s e O ----.x-0,001 uglul E --8-0,0001 ugful s w we ...a... 0, 00001 ugful s s s 9. 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 15 days on diet
FIGURE 5-LD (c)
-- Ougful -8-1 ugful tox-- 0,1 ugful r :- 0,01 uglul -x-0,001 ugful -8-0,000 uglul -x-0,00001 ugful
O 1 2 3 4 5 6 7 8 9 10 1 2 13 4 15 days on diet
FIGURE 5-LD (d) Patent Application Publication Dec. 18, 2014 Sheet 5 of 16 US 2014/03.73197 A1
s c -0-0 ugful A. ~&c. 1 ugful O ork- 0, ugful s s 8- 0,0 ugful t O -x-0,001 ugful E c -8-0,000 ugful
wed ~&-0,00001 ug/ul g s C. O 1 2 3 4 5 6 7 8 9 O 1 2 3 4 15 days on diet
FIGURE 5-LD (e)
-8-0 uglul 80 ...8s. 1 ugful * * * -k- 0,1 ugful 60 ;4 - & rx 0.01 ugful # * * --0,001 ugful
40 -8-0,0001 ugful 20 -- 0, 00001 uglul
O &lara: ---. O 1 2 3 4 5 6 7 8 9 1 0 1 1 12 1314 15 days on diet
FIGURE 5-LD (f) Patent Application Publication Dec. 18, 2014 Sheet 6 of 16 US 2014/03.73197 A1
G s 2 -- 0 ugful f O ~8- 1 ugful e O -x- 0,1 ugful e s a 3- 0.01 ugful O o-ko 0,001 ugful E -- 0,0001 ugful o s w ...a... 0, 00001 ugful c sa c O.
days on diet
FIGURE 5-LD (g)
-0-0 ugful -- 0.1 ugful -a- 0.01 ugful -e- 0.001 ugui -- 0.000 ugful --- 0.0000 ugful
-O-O-O- 9 O 2 days or diet FIGURE 5-LD (h) Patent Application Publication Dec. 18, 2014 Sheet 7 of 16 US 2014/03.73197 A1
g s aw d s ad
O r Srpe go equinu. Patent Application Publication Dec. 18, 2014 Sheet 8 of 16 US 2014/03.73197 A1
Mortality
FIGURE 7-LD Patent Application Publication Dec. 18, 2014 Sheet 9 of 16 US 2014/03.73197 A1
12 - ......
-- farget C ------&rfix" -- target 3 -a-target 5 80 -- target 10 -- target 14 80 -- target 16 -A-target 27 -Q-gfp dsRNA -e- 0.35% ritor X-100 -- leaf only ...--a 5
-- target 3 -- target 5 -x-target 10 -- targst 14 -- target 18 --- larget 27 -----gi dsRNA -8-0.058 it X-f -- eat only
days or leaf
FIGURE 1-PC (b) Patent Application Publication Dec. 18, 2014 Sheet 10 of 16 US 2014/03.73197 A1
100 ------...... ;
--Gugful --O, ugful -- a-- 0.01 ug -x-0,001 tugful -x-0 0001 uglut
days on leaf
FIGURE 2-PC (a)
----- O Ugful --O, uglut -A-001 ugul --0.001 ugful --0.0001 ugful
days on leaf
FIGURE 2-PC (b) Patent Application Publication Dec. 18, 2014 Sheet 11 of 16 US 2014/03.73197 A1
20 ------
OO
8 O -- target 5 ----- target O -A-target 15 - x -target is -g-gfpcis RNA 4.8OO -- --- litreated
20
days on leaf
FIGURE 1-EW
120 --~
OO - ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' '. e-r : ves : s s -- target 10 gs -- target 15 -- target 16 -x-gip dsRNA -- untreated is 4 ------/------ys ------:
s
c. 20 ------w ------a------: --- ... ------o -- I A. S 6 f 8 9 10 12 days on leaf FIGURE 2-EV (a) Patent Application Publication Dec. 18, 2014 Sheet 12 of 16 US 2014/03.73197 A1
( i i i ) (iv)
FIGURE 2-EV (b)
Patent Application Publication Dec. 18, 2014 Sheet 14 of 16 US 2014/03.73197 A1
-- diet only -8-gfp -Mr N 002 ------. NOO3 -X- N005 --&-- NO.10
days on diet
FIGURE 1-NL (a)
-8- diet only -8-gfp arra NO09 -- NO16
days on diet
FIGURE 1-NL (b) Patent Application Publication Dec. 18, 2014 Sheet 15 of 16 US 2014/03.73197 A1
g C 2 2 s re-or diet only ts s -8-gfp dsRNA wn s ------N-014 3 ------NO18 9. s s S
days on diet
FIGURE 1-NL (c)
--- diet only -8-gfp dsRNA réir NO13 ------. NO15 -(- NO21
days on diet
FIGURE 1-NL (d) Patent Application Publication Dec. 18, 2014 Sheet 16 of 16 US 2014/03.73197 A1
C 2 -X- diet only s s -8-1 uglul o s wal -a- 0.2 ugu c d -8-0.08 uglu 9. co-o-o- 0.04 uglul s S
days on diet
FIGURE 2-NL US 2014/0373.197 A1 Dec. 18, 2014
DSRNAAS INSECT CONTROL AGENT (Solanum tuberosum), but also tomato (Solanum lycopersi cum), eggplant (Solanum melongena), capsicums (Solanum CROSS REFERENCE TO RELATED capsicum), and nightshade (for example, Solanum aculeas APPLICATIONS trum, S. bulbocastianum, S. cardiophyllum, S. douglasii, S. 0001. This application is a divisional application of, and dulcamara, S. lanceolatum, S. robustum, and S. triquetrum), claims priority to U.S. patent application Ser. No. 12/087.536 particularly the control of coleopteran pests. filed on Jan. 13, 2009 which is a national stage filing under 35 0007 Biological control using extract from neem seed has U.S.C. S371 of International Application No. PCT/EP2007/ been shown to work against coleopteran pests of vegetables. 000286, filed on Jan. 12, 2007, which claims benefit of Commercially available neem-based insecticides have aza 60/758,191, filed on Jan. 12, 2006, and claims benefit of dirachtin as the primary active ingredient. These insecticides 60/771,160, filed on Feb. 7, 2006, and claims benefit of are applicable to a broad spectrum of insects. They act as 60/837,910, filed on Aug. 16, 2006, and claims benefit of insect growth regulator, azadirachtin prevents insects from 60/875,356, filed on Dec. 18, 2006, the contents of each of molting by inhibiting production of an insect hormone, which are herein incorporated by reference in their entireties. ecdysone. 0008 Biological control using protein Cry3A from Bacil SEQUENCE LISTING lus thuringiensis varieties tenebrionis and San diego, and 0002 A Sequence Listing in ASCII text format, submitted derived insecticidal proteins are alternatives to chemical con under 37 CFRS1.821, entitled “80388.txt”, 736 kilobytes in trol. The Bt toxin protein is effective in controlling Colorado size, generated on Aug. 26, 2014 and filed via EFS-Web is potato beetle larvae either as formulations sprayed onto the provided in lieu of a paper copy. This sequence listing is foliage or expressed in the leaves of potatoes. hereby incorporated by reference into the specification for its 0009. An alternative biological agent is dsRNA. Over the disclosures. last few years, down-regulation of genes (also referred to as 'gene silencing’) in multicellular organisms by means of FIELD OF THE INVENTION RNA interference or “RNAi has become a well-established technique. 0003. The present invention relates to the field of double stranded RNA (dsRNA)-mediated gene silencing in insect (0010 RNA interference or “RNAi is a process of species. More particularly, the present invention relates to sequence-specific down-regulation of gene expression (also genetic constructs designed for the expression of dsRNA referred to as “gene silencing or “RNA-mediated gene corresponding to novel target genes. These constructs are silencing') initiated by double-stranded RNA (dsRNA) that particularly useful in RNAi-mediated plant pest control. The is complementary in sequence to a region of the target gene to invention further relates to methods for controlling insects, be down-regulated (Fire, A. Trends Genet. Vol. 15,358-363, methods for preventing insect infestation and methods for 1999: Sharp, P. A. Genes Dev. Vol. 15, 485-490, 2001). down-regulating gene expression in insects using RNAi. The 0011. Over the last few years, down-regulation of target invention also relates to transgenic plants resistant to insect genes in multicellular organisms by means of RNA interfer infestation. ence (RNAi) has become a well established technique. Ref erence may be made to International Applications WO BACKGROUND TO THE INVENTION 99/32619 (Carnegie Institution) and WO00/01846 (by Appli 0004. The environment is replete with pests and numerous cant). methods have attempted to control pests infestations of 0012 DsRNA gene silencing finds application in many plants. Commercial crops are often the targets of insect different areas, such as for example dsRNA mediated gene attack. Substantial progress has been made in the last few silencing in clinical applications (WO2004/001013) and in decades towards developing more efficient methods and com plants. In plants, dsRNA constructs useful for gene silencing positions for controlling insect infestation in plants. have also been designed to be cleaved and to be processed into 0005 Chemical pesticides have been very effective in short interfering RNAs (siRNAs). eradicating pest infestation. However, there are several dis 0013 RNAi has also been proposed as a means of protect advantages to using chemical pesticidal agents. Not only are ing plants against plant parasitic nematodes, i.e. by express they potentially detrimental to the environment, but they are ing in the plant (e.g. in the entire plant, or in a part, tissue or not selective and are harmful to various crops and non-target cell of a plant) one or more nucleotide sequences that form a fauna. Chemical pesticides persist in the environment and dsRNA fragment that corresponds to a target gene in the plant generally are slow to be metabolized, if at all. They accumu parasitic nematode that is essential for its growth, reproduc late in the food chain, and particularly in the higher predator tion and/or survival. Reference may be made to the Interna species where they can act as mutagens and/or carcinogens to tional Application WO 00/01846 (by Applicant) and U.S. Pat. cause irreversible and deleterious genetic modifications. No. 6,506,559 (based on WO99/32619). There has thus been continued controversy in the use of 0014. Although the technique of RNAi has been generally chemical insecticides to combat crop pests. They can rapidly known in the artin plants, C. elegans and mammaliancells for develop resistance against these insecticides because of some years, to date little is known about the use of RNAi to repetitive usage of the same insecticide or of insecticides down-regulate gene expression in insects. Since the filing and having the same mode of action, and because accumulation publication of the WO 00/01846 and WO99/32619 applica also results in the development of resistance to the agents in tions, only few other applications have been published that species higher up the evolutionary ladder. relate to the use of RNAi to protect plants against insects. 0006 Control of insect pests on agronomically important These include the International Applications WO 01/37654 crops is important, particularly insect pests which damage (DNA Plant Technologies), WO 2005/019408 (Bar Ilan Uni plants belonging to the Solanaceae family, especially potato versity), WO 2005/049841 (CSIRO, Bayer Cropscience), US 2014/0373.197 A1 Dec. 18, 2014
WO 05/047300 (University of Utah Research foundation), 2370, 2372,2384 to 2460, 2461, 2466, 2471, 2476,2481 or and the US application 2003/0015.0017 (Mesa et al.). 2486, or the complement thereof, 0015 The present invention provides target genes and 0021 (ii) sequences which are at least 70%, preferably at constructs useful in the RNAi-mediated insect pest control, least 75%, 80%, 85%, 90%, more preferably at least 95%, especially the control of insect plant pathogens. The present 96%, 97%, 98% or 99% identical to a sequence represented invention also provides methods for controlling insect pest by any of SEQID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, infestation by repressing, delaying, or otherwise reducing 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, target gene expression within a particular insect pest. 203, 208, 215, 220, 225, 230, 240 to 247, 249, 251, 253, 255, 257, 259,275 to 472, 473,478,483,488, 493,498, 503, 508 DESCRIPTION OF THE INVENTION to 513,515,517,519, 521,533 to 575, 576,581,586, 591, 0016. The present invention describes a novel non-com 596,601, 603, 605, 607, 609, 621 to 767, 768, 773,778,783, pound, non-protein based approach for the control of insect 788, 793, 795, 797,799,801, 813 to 862, 863, 868,873, 878, crop pests. The active ingredient is a nucleic acid, a double 883, 888,890, 892, 894, 896,908 to 1040, 1041, 1046, 1051, stranded RNA (dsRNA), which can be used as an insecticidal 1056, 1061, 1066 to 1071, 1073, 1075, 1077, 1079, 1081, formulation. In another embodiment, the dsRNA can be 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, expressed constitutively in the host plant, plant part, plant cell 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, or seed to protect the plant against chewing insects especially 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, coleopterans such as beetles. The sequence of the dsRNA 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, corresponds to part or whole of an essential insect gene and 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, causes downregulation of the insect target via RNA interfer 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, ence (RNAi). As a result of the downregulation of mRNA, the 2060,2065, 2070,2075,2080,2085, 2090, 2095, 2100,2102, dsRNA prevents expression of the target insect protein and 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, hence causes death, growth arrest or sterility of the insect. 2359, 2364, 2366, 2368, 2370, 2372,2384 to 2460, 2461, 0017. The methods of the invention can find practical 2466, 2471,2476,2481 or 2486, or the complement thereof, application in any area of technology where it is desirable to and inhibit viability, growth, development or reproduction of the 0022 (iii) sequences comprising at least 17 contiguous insect, or to decrease pathogenicity or infectivity of the insect. nucleotides of any of the sequences represented by SEQ ID The methods of the invention further find practical applica NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, tion where it is desirable to specifically down-regulate 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, expression of one or more target genes in an insect. Particu 220, 225, 230, 240 to 247, 249,251,253, 255, 257, 259,275 larly useful practical applications include, but are not limited to 472, 473,478, 483, 488, 493, 498, 503, 508 to 513, 515, to, protecting plants against insect pest infestation. 517,519,521,533 to 575, 576,581,586,591,596,601, 603, 0.018. In accordance with one embodiment the invention 605, 607, 609, 621 to 767, 768,773,778, 783,788, 793, 795, relates to a method for controlling insect growth on a celloran 797, 799,801, 813 to 862, 863, 868,873, 878,883, 888,890, organism, or for preventing insect infestation of a cell or an 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, organism susceptible to insect infection, comprising contact 1066 to 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, ing insects with a double-stranded RNA, wherein the double 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, 1103, 1105, Stranded RNA comprises annealed complementary strands, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, one of which has a nucleotide sequence which is complemen 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, tary to at least part of the nucleotide sequence of an insect 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, target gene, whereby the double-stranded RNA is taken up by 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, the insect and thereby controls growth or prevents infestation. 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 0019. The present invention therefore provides isolated 2070,2075,2080,2085, 2090, 2095, 2100,2102,2104, 2106, novel nucleotide sequences of insect target genes, said iso 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, lated nucleotide sequences comprising at least one nucleic 2366, 2368, 2370, 2372,2384 to 2460, 2461, 2466, 2471, acid sequence selected from the group comprising: 2476,2481 or 2486, or the complement thereof, 0020 (i) sequences represented by any of SEQID NOS 1. 0023 or wherein said nucleic acid sequence is an ortho 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, logue of a gene comprising at least 17 contiguous nucleotides 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, of any of SEQID NOs 49 to 158,275 to 472,533 to 575, 621 230, 240 to 247, 249, 251, 253, 255, 257, 259, 275 to 472, to 767,813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 473,478,483,488, 493,498, 503, 508 to 513,515,517,519, 2120 to 2338, 2384 to 2460, or a complement thereof, 521,533 to 575, 576,581,586,591,596,601, 603, 605, 607, 0024 said nucleic acid sequences being useful for prepar 609, 621 to 767, 768,773,778,783,788, 793, 795, 797, 799, ing the double stranded RNAs of the invention for controlling 801, 813 to 862, 863, 868,873, 878, 883, 888,890, 892, 894, insect growth. 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1066 to 0025 “Controlling pests' as used in the present invention 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, means killing pests, or preventing pests to develop, or to grow 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105,1107, 1109, or preventing pests to infect or infest. Controlling pests as 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, used herein also encompasses controlling pest progeny (de 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, velopment of eggs). Controlling pests as used herein also 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, encompasses inhibiting viability, growth, development or 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 reproduction of the pest, or to decrease pathogenicity or to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, infectivity of the pest. The compounds and/or compositions 2080, 2085, 2090, 2095, 2100,2102, 2104, 2106,2108, 2120 described herein, may be used to keep an organism healthy to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, and may be used curatively, preventively or systematically to US 2014/0373.197 A1 Dec. 18, 2014 control pests or to avoid pest growth or development or infec plant cell or seed to the target organism which plant, plant tion or infestation. Particular pests envisaged in the present part, plant cell or seed expresses double-stranded RNA. invention are plant pathogenic insect pests. “Controlling 0031. In a more preferred aspect, the invention provides a insects' as used herein thus also encompasses controlling method for down-regulating expression of at least one target insect progeny (such as development of eggs). Controlling gene in a target organism (which is capable of ingesting a host insects as used herein also encompasses inhibiting viability, cell, or extracts thereof) comprising feeding a hostplant, plant growth, development or reproduction of the insect, or part, plant cell or seed to the target organism which hostplant, decreasing pathogenicity or infectivity of the insect. In the plant part, plant cellor seed expresses a double-stranded RNA present invention, controlling insects may inhibit a biological molecule comprising a nucleotide sequence complementary activity in a insect, resulting in one or more of the following to or representing the RNA equivalent of at least part of the attributes: reduction in feeding by the insect, reduction in nucleotide sequence of the at least one target gene, whereby viability of the insect, death of the insect, inhibition of differ the ingestion of the host cell, host plant, plant part, plant cell entiation and development of the insect, absence of or or seed by the target organism causes and/or leads to down reduced capacity for sexual reproduction by the insect, regulation of expression of the at least one target gene. muscle formation, juvenile hormone formation, juvenile hor 0032. The invention provides for use of a plant, plant part, mone regulation, ion regulation and transport, maintenance plant cell or seed as defined herein for down regulation of of cell membrane potential, amino acid biosynthesis, amino expression of an insect target gene. In more detailed terms, acid degradation, sperm formation, pheromone synthesis, the invention provides for use of a host cell as defined herein pheromone sensing, antennae formation, wing formation, leg and/or an RNA molecule comprising a nucleotide sequence formation, development and differentiation, egg formation, that is the RNA complement of or that represents the RNA larval maturation, digestive enzyme formation, haemolymph equivalent of at least part of the nucleotide sequence of a synthesis, haemolymph maintenance, neurotransmission, target gene from a target organism, as produced by transcrip cell division, energy metabolism, respiration, apoptosis, and tion of a nucleic acid molecule in a plant, plant part, plant cell any component of a eukaryotic cells cytoskeletal structure, or seed, for instance in the manufacture of a commodity Such as, for example, actins and tubulins. The compounds product, for down regulation of expression of a target gene. and/or compositions described herein, may be used to keep an Suitable target genes and target organisms in respect of the organism healthy and may be used curatively, preventively or invention are discussed below in further detail. systematically to controla insect or to avoid insect growth or 0033 According to one embodiment, the methods of the development or infection or infestation. Thus, the invention invention rely on a GMO approach wherein the double may allow previously susceptible organisms to develop resis stranded RNA is expressed by a cell or an organism infested tance against infestation by the insect organism. with or susceptible to infestation by insects. Preferably, said 0026. The expression “complementary to at least part of cell is a plant cell or said organism is a plant. as used herein means that the nucleotide sequence is fully 0034. The present invention thus also relates to a method complementary to the nucleotide sequence of the target over for producing a plant resistant to a plant pathogenic insect, more than two nucleotides, for instance over at least 15, 16, comprising: 17, 18, 19, 20, 21, 22, 23, 24 or more contiguous nucleotides. 0035 transforming a plant cell with a recombinant con 0027. According to a further embodiment, the invention struct comprising at least one regulatory sequence oper relates to a method for down-regulating expression of a target ably linked to a sequence complementary to at least part gene in an insect, comprising contacting said insect with a of (a) a nucleotide sequence of a target insect gene double-stranded RNA, wherein the double-stranded RNA Selected from the group consisting of: comprises annealed complementary Strands, one of which 0036 (i) sequences which are at least 75% identical has a nucleotide sequence which is complementary to at least to a sequence represented by any of SEQID NOS 1, 3, part of the nucleotide sequence of the insect target gene to be 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, down-regulated, whereby the double-stranded RNA is taken 160-163, 168, 173, 178, 183, 188, 193, 198,203,208, up into the insect and thereby down-regulates expression of 215, 220, 225,230, 247,249,251,253,255,257,259, the insect target gene. 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 0028. Whenever the term “a” is used within the context of 515, 517,519, 521,533 to 575, 576,581,586, 591, “a target gene', this means “at least one' target gene. The 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, same applies for 'a' target organism meaning “at least one' 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, target organism, and “a” RNA molecule or host cell meaning 863, 868,873, 878,883,888,890, 892,894, 896,908 “at least one' RNA molecule or host cell. This is also detailed to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, further below. 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 0029. According to one embodiment, the methods of the 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, invention rely on uptake by the insect of double-stranded 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, RNA present outside of the insect (e.g. by feeding) and does 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, not require expression of double-stranded RNA within cells 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, of the insect. In addition, the present invention also encom 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, passes methods as described above wherein the insect is 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, contacted with a composition comprising the double 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, stranded RNA. 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 0030 The invention further provides a method for down 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, regulating expression of at least one target gene in a target 2354, 2359, 2364, 2366, 2368, 2370, 2372,2384 to organism (which is capable of ingesting a plant, plant part, 2460,2461,2466,2471,2476 or 2481, or the comple plant cell or seeds) comprising feeding a plant, plant part, ment thereof, US 2014/0373.197 A1 Dec. 18, 2014
0037 (ii) sequences comprising at least 17 contigu ptera, Homoptera, Hymenoptera, Isoptera, Lepidoptera, Mal ous nucleotides of any of SEQID Nos 1, 3, 5, 7, 9, 11, lophaga, Mecoptera, Neuroptera, Odonata, Orthoptera, Phas 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, mida, Plecoptera, Protura, Psocoptera, Siphonaptera, 173, 178,183,188, 193, 198,203,208,215, 220, 225, Siphunculata, Thysanura, Strepsiptera, Thysanoptera, Tri 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, choptera, and Zoraptera. 473,478,483,488, 493,498,503,513,515,517,519, 0044. In preferred, but non-limiting, embodiments and 521,533 to 575, 576, 581,586, 591, 596,601, 603, methods of the invention the insect is chosen from the group 605, 607, 609, 621 to 767, 768, 773,778, 783, 788, consisting of an insect which is a plant pest, such as but not 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, limited to Nilaparvata spp. (e.g. N. lugens (brown planthop 878,883, 888,890, 892, 894, 896,908 to 1040, 1041, per)); Laodelphax spp. (e.g. L. striatellus (Small brown plan 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, thopper)); Nephotettix spp. (e.g. N. virescens or N. cincticeps 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, (green leafhopper), or N. nigropictus (rice leafhopper)); 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, Sogatella spp. (e.g. S. fircifera (white-backed planthopper)); 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, Blissus spp. (e.g. B. leucopterus leucopterus (chinch bug)); 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, Scotinophora spp. (e.g. S. vermidulate (rice blackbug)); 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, Acrosternum spp. (e.g. A. hilare (green Stink bug)); Parnara 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, spp. (e.g. P. guttata (rice skipper)); Chilo spp. (e.g. C. Sup 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, pressalis (rice striped stem borer), C. auricilius (gold-fringed 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, stem borer), or C. polychlysus (dark-headed stem borer)); 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, Chilotraea spp. (e.g. C. polychrysa (rice stalk borer)); Sesa 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, mia spp. (e.g. S. inferens (pink rice borer)); Tryporyza spp. 2364, 2366, 2368, 2370, 2372,2384 to 2460, 2461, (e.g. T. innotata (white rice borer), or T. incertulas (yellow 2466, 2471,2476 or 2481, or the complement thereof, rice borer)). Cnaphalocrocis spp. (e.g. C. medinalis (rice and leafroller)); Agromyza spp. (e.g. A. Oryzae (leafminer), or A. 0038 (iii) sequences comprising a sense Strand com parvicornis (corn blot leafminer)); Diatraea spp. (e.g. D. prising a nucleotide sequence of (i) and an antisense saccharalis (Sugarcane borer), or D. grandiosella (South Strand comprising the complement of said nucleotide western corn borer)), Narnaga spp. (e.g. N. aenescens (green sequence of (i), wherein the transcript encoded by rice caterpillar)); Xanthodes spp. (e.g. X. transverse (green said nucleotide sequence is capable of forming a caterpillar)); Spodoptera spp. (e.g. S. frugiperda (fall army double-stranded RNA, worm), S. exigua (beet armyworm), S. littoralis (climbing 0039 or (b) a nucleotide sequence which is an insect cutworm) or S. praefica (western yellowstriped armyworm)); orthologue of a gene comprising at least 17 contiguous nucle Mythinna spp. (e.g. Mythinna (Pseudaletia) seperata (army otides of any of SEQID Nos 49 to 158,275 to 472,533 to 575, worm)); Helicoverpa spp. (e.g. H. Zea (corn earworm)); 621 to 767, 813 to 862, 908 to 1040, 1161 to 1571, 1730 to Colaspis spp. (e.g. C. brunnea (grape colaspis)): Lissorhop 2039,2120 to 2338,2384 to 2460, or the complement thereof; trus spp. (e.g. L. Oryzophilus (rice water weevil)); Echinoc 0040 regenerating a plant from the transformed plant nemus spp. (e.g. E. squamos (rice plant weevil)); Diclodispa cell; and spp. (e.g. D. armigera (rice hispa)); Oulema spp. (e.g. O. 0041 growing the transformed plant under conditions Oryzae (leaf beetle); Sitophilus spp. (e.g. S. oryzae (rice wee suitable for the expression of the recombinant construct, vil)); Pachydiplosis spp. (e.g. P. Oryzae (rice gall midge)); said grown transformed plant resistant to plant patho Hydrellia spp. (e.g. H. griseola (Small rice leafminer), or H. genic insects compared to an untransformed plant. Sasakii (rice stem maggot)); Chlorops spp. (e.g. C. Oryzae 0042. The insect can be any insect, meaning any organism (stem maggot)); Diabrotica spp. (e.g. D. virgifera virgifera belonging to the Kingdom Animals, more specific to the (western corn rootworm), D. barberi (northern corn root Phylum Arthropoda, and to the Class Insecta or the Class worm), D. undecimpunctata howardi (Southern corn root Arachnida. The methods of the invention are applicable to all worm), D. virgifera zeae (Mexican corn rootworm); D. bal insects and that are susceptible to gene silencing by RNA teata (banded cucumber beetle)); Ostrinia spp. (e.g. O. interference and that are capable of internalising double nubilalis (European corn borer)); Agrotis spp. (e.g. A. ipsilon stranded RNA from their immediate environment. The inven (black cutworm)); Elasmopalpus spp. (e.g. E. lignosellus tion is also applicable to the insect at any stage in its devel (lesser cornstalk borer)); Melanotus spp. (wireworms); opment. Because insects have a non-living exoskeleton, they Cyclocephala spp. (e.g. C. borealis (northern masked chafer), cannot grow at a uniform rate and rather grow in stages by or C. immaculate (Southern masked chafer)); Popillia spp. periodically shedding their exoskeleton. This process is (e.g. P. japonica (Japanese beetle)); Chaetocnema spp. (e.g. referred to as moulting or ecdysis. The stages between moults C. pullicaria (corn flea beetle)); Sphenophorus spp. (e.g. S. are referred to as “instars' and these stages may be targeted maidis (maize billbug)); Rhopalosiphum spp. (e.g. R. maidis according to the invention. Also, insect eggs or live young (corn leaf aphid)); Anuraphis spp. (e.g. A. maidiradicis (corn may also be targeted according to the present invention. All root aphid)); Melanoplus spp. (e.g. M. femurrubrum stages in the developmental cycle, which includes metamor (redlegged grasshopper) M. differentialis (differential grass phosis in the pterygotes, may be targeted according to the hopper) or M. Sanguinipes (migratory grasshopper)); Hyl present invention. Thus, individual stages Such as larvae, emya spp. (e.g. H. platura (seedcorn maggot)); Anaphothrips pupae, nymph etc stages of development may all be targeted. spp. (e.g. A. Obscrurus (grass thrips)); Solenopsis spp. (e.g. S. 0043. In one embodiment of the invention, the insect may milesta (thief ant)); or spp. (e.g. Turticae (two spotted Spider belong to the following orders: Acari, Araneae, Anoplura, mite), T. cinnabarinus (carmine spider mite); Helicoverpa Coleoptera, Collembola, Dermaptera, Dictyoptera, Diplura, spp. (e.g. H. Zea (cotton bollworm), or H. armigera (Ameri Diptera, Embioptera, Ephemeroptera, Grylloblatodea, Hemi can bollworm)); Pectinophora spp. (e.g. P. gossypiella (pink US 2014/0373.197 A1 Dec. 18, 2014
bollworm)); Earias spp. (e.g. E. vittella (spotted bollworm)); planthopper)); Laodelphax spp. (e.g. L. striatellus (Small Heliothis spp. (e.g. H. virescens (tobacco budworm)); brown planthopper)); Nephotettix spp. (e.g. N. virescens or N. Anthonomus spp. (e.g. A. grandis (boll weevil)); Pseudato cincticeps (green leafhopper), or N. nigropictus (rice leafhop moscelis spp. (e.g. P. seriatus (cotton fleahopper)); Trialeu per)); Sogatella spp. (e.g. S. furcifera (white-backed plantho rodes spp. (e.g. T. abutiloneus (banded-winged whitefly) T. pper)); Chilo spp. (e.g. C. suppressalis (rice striped stem vaporariorum (greenhouse whitefly)); Bemisia spp. (e.g. B. borer), C. auricilius (gold-fringed stem borer), or C. poly argentifolii (silverleaf whitefly)); Aphis spp. (e.g. A. gossypii chrysus (dark-headed stem borer)); Sesamia spp. (e.g. S. infe (cotton aphid)); Lygus spp. (e.g. L. lineolaris (tarnished plant rens (pink rice borer)); Tryporyza spp. (e.g.T. innotata (white bug) or L. hesperus (western tarnished plant bug)); Euschistus spp. (e.g. E. conspersus (consperse Stink bug)); Chlorochroa rice borer), or T incertulas (yellow rice borer)); Anthonomus spp. (e.g. C. sayi (Say Stinkbug)); Nezara spp. (e.g. N. viri spp. (e.g. A. grandis (boll weevil)); Phaedon spp. (e.g. P dula (Southern green Stinkbug)); Thrips spp. (e.g. T. tabaci cochleariae (mustard leaf beetle)); Epilachna spp. (e.g. E. (onion thrips)); Frankliniella spp. (e.g. F. fisca (tobacco varivetis (mexican bean beetle)); Tribolium spp. (e.g. T. cas thrips), or F. Occidentalis (western flower thrips)); Leptino taneum (red floor beetle)); Diabrotica spp. (e.g. D. virgifera tarsa spp. (e.g. L. decemlineata (Colorado potato beetle), L. virgifera (western corn rootworm), D. barberi (northern corn juncta (false potato beetle), or L. texana (Texan false potato rootworm), D. undecimpunctata howardi (Southern corn beetle)); Lema spp. (e.g. L. trilineata (three-lined potato rootworm), D. virgifera zeae (Mexican corn rootworm): beetle)); Epitrix spp. (e.g. E. cucumeris (potato fleabeetle), E. Ostrinia spp. (e.g. O. nubilalis (European corn borer); Ana hirtipennis (flea beetle), or E. tuberis (tuber flea beetle)); phothrips spp. (e.g. A. Obscrurus (grass thrips)); Pectino Epicauta spp. (e.g. E. vittata (striped blister beetle)); Phae phora spp. (e.g. P. gossypiella (pink bollworm)); Heliothis don spp. (e.g. P. cochleariae (mustard leaf beetle)): Epil spp. (e.g. H. virescens (tobacco budworm)); Trialeurodes achina spp. (e.g. E. varivetis (mexican bean beetle)); Acheta spp. (e.g. T. abutiloneus (banded-winged whitefly) T vapo spp. (e.g. A. domesticus (house cricket)); Empoasca spp. (e.g. rariorum (greenhouse whitefly)); Bemisia spp. (e.g. B. argen E. fabae (potato leafhopper)); Myzus spp. (e.g. M. persicae tifolii (silverleaf whitefly)); Aphis spp. (e.g. A. gossypii (cot (greenpeach aphid)); Paratrioza spp. (e.g. P. Cockerelli (psyl ton aphid)); Lygus spp. (e.g. L. lineolaris (tarnished plant lid)); Conoderus spp. (e.g. C. falli (Southern potato wire bug) or L. hesperus (western tarnished plant bug)); Euschistus worm), or C. vespertinus (tobacco wireworm)); Phthorimaea spp. (e.g. E. conspersus (consperse Stink bug)); Chlorochroa spp. (e.g. P. Operculella (potato tuberworm)); Macrosiphum spp. (e.g. C. sayi (Say Stinkbug)); Nezara spp. (e.g. N. viri spp. (e.g. M. euphorbiae (potato aphid)); Thyanta spp. (e.g. T. dula (southern green Stinkbug)); Thrips spp. (e.g. T. tabaci pallidovirens (redshouldered Stinkbug)); Phthorimaea spp. (onion thrips)); Frankliniella spp. (e.g. F. fisca (tobacco (e.g. P. operculella (potato tuberworm)); Helicoverpa spp. thrips), or F. Occidentalis (western flower thrips)): Acheta (e.g. H. Zea (tomato fruitworm); Keiferia spp. (e.g. K. lyco spp. (e.g. A. domesticus (house cricket)); Myzus spp. (e.g. M. persicella (tomato pinworm)); Limonius spp. (wireworms); persicae (green peach aphid)); Macrosiphum spp. (e.g. M. Manduca spp. (e.g. M. sexta (tobacco hornworm), or M. euphorbiae (potato aphid)); Blissus spp. (e.g. B. leucopterus quinquemaculata (tomato hornworm)); Liriomyza spp. (e.g. leucopterus (chinch bug)); Acrosternum spp. (e.g. A. hilare L. sativae, L. trifoli or L. huidobrensis (leafminer)); Droso (green Stink bug)); Chilotraea spp. (e.g. C. polychrysa (rice phila spp. (e.g. D. melanogaster, D. vakuba, D. pseudoob stalk borer)); Lissorhoptrus spp. (e.g. L. Oryzophilus (rice scura or D. Simulans); Carabus spp. (e.g. C. granulatus); water weevil)); Rhopalosiphum spp. (e.g. R. maidis (corn leaf Chironomus spp. (e.g. C. tentanus); Ctenocephalides spp. aphid)); and Anuraphis spp. (e.g. A. maidiradicis (corn root (e.g. C. felis (cat flea)); Diaprepes spp. (e.g. D. abbreviatus aphid)). (root weevil)); Ips spp. (e.g. I. pini (pine engraver)); Tribo lium spp. (e.g. T. castaneum (red floorbeetle)); Glossina spp. 0046 According to a more specific embodiment, the (e.g. G. morsitans (tsetse fly)); Anopheles spp. (e.g. A. gam methods of the invention are applicable for Leptinotarsa spe biae (malaria mosquito)); Helicoverpa spp. (e.g. H. armigera cies. Leptinotarsa belong to the family of Chrysomelidae or (African Bollworm)); Acyrthosiphon spp. (e.g. A. pisum (pea leaf beetles. Chrysomelid beetles such as Flea Beetles and aphid)); Apis spp. (e.g. A. melifera (honey bee)); Homalo Corn Rootworms and Curculionids such as Alfalfa Weevils disca spp. (e.g. H. coagulate (glassy-winged sharpshooter)); are particularly important pests. Flea Beetles include a large number of small leaf feeding beetles that feed on the leaves of Aedes spp. (e.g. Ae. aegypti (yellow fever mosquito)); Bon a number of grasses, cereals and herbs. Flea Beetles include a byx spp. (e.g. B. mori (silkworm)); Locusta spp. (e.g. L. large number of genera (e.g., Attica, Apphthona, Argopistes, migratoria (migratory locust)); Boophilus spp. (e.g. B. Disonycha, Epitrix, Longitarsus, Prodagricomela, Systema, microplus (cattle tick)); Acanthoscurria spp. (e.g. A. gonesi and Phyllotreta). The Flea Beetle, Phyllotreta Cruciferae, ana (red-haired chololate bird eater); Diploptera spp. (e.g. also known as the Rape Flea Beetle, is a particularly impor D. punctata (pacific beetle cockroach)); Heliconius spp. (e.g. tant pest. Corn rootworms include species found in the genus H. erato (red passion flowerbutterfly) or H. melpomene (post Diabrotica (e.g., D. undecimpunctata undecimpunctata, D. man butterfly)); Curculio spp. (e.g. C. glandium (acorn wee undecimpunctata howardii, D. longicornis, D. virgifera and vil)); Plutella spp. (e.g. P. xylostella (diamondback moth)); D. balteata). Cornrootworms cause extensive damage to corn Amblyomma spp. (e.g. A. variegatum (cattle tick)); Anteraea and curcubits. The Western Spotted Cucumber Beetle, D. spp. (e.g. A. yamamai (silkmoth)); and Armigeres spp. (e.g. A. undecimpunctata undecimpunctata, is a pest of curcubits in subalbatus); the western U.S. Alfalfa weevils (also known as clover wee 0045 Preferred plant pathogenic insects according to the vils) belong to the genus, Hypera (H. postica, H. brunneipen invention are plant pest are selected from the group consisting nis, H. nigrirostris, H. punctata and H. meles), and are con of Leptinotarsa spp. (e.g. L. decemlineata (Colorado potato sidered an important pest of legumes. The Egyptian alfalfa beetle), L. juncta (false potato beetle), or L. texana (Texan weevil, H. brunneipennis, is an important pest of alfalfa in the false potato beetle)); Nilaparvata spp. (e.g. N. lugens (brown western U.S. US 2014/0373.197 A1 Dec. 18, 2014
0047. There are more than 30 Leptinotarsa species. The 0059. The present invention extends to methods as present invention thus encompasses methods for controlling described herein, wherein the insect is Nilaparvata lugens Leptinotarsa species, more specific methods for killing and the plant is a rice plant. insects, or preventing Leptinotarsa insects to develop or to 0060. The present invention extends to methods as grow, or preventing insects to infect or infest. Specific Lepti described herein, wherein the insect is Chilo suppressalis notarsa species to control according to the invention include (rice Striped stem borer) and the plant is a rice plant, bareley, Colorado Potato Beetle (Leptinotarsa decemlineata (Say) Sorghum, maize, wheat or a grass. and False Potato Beetle (Leptinotarsa juncta (Say). 0061 The present invention extends to methods as 0048 CPB is a (serious) pest on our domestic potato described herein, wherein the insect is Plutella xylostella (Solanum tuberosum), other cultivated and wild tuber bearing (Diamondback moth) and the plant is a Brassica species Such and non-tuber bearing potato species (e.g. S. demissium, S. as, but not limited to cabbage, chinese cabbage, Brussels phureja a.o.) and other Solanaceous (nightshades) plant spe sprouts, kale, rapeseed, broccoli, cauliflower, turnip, mustard cies including: or radish. 0049 (a) the crop species tomato (several Lycopersicon 0062. The present invention extends to methods as species), eggplant (Solanum melongena), peppers (several described herein, wherein the insect is Acheta domesticus Capsicum species), tobacco (several Nicotiana species (house cricket) and the plant is any plant as described herein including ornamentals) and ground cherry (Physalis species); or any organic matter. 0050 (b) the weed/herb species, horse nettle (S. carolin 0063. In terms of “susceptible organisms”, which benefit ense), common nightshade (S. dulcamara), belladonna (At from the present invention, any organism which is Susceptible ropa species), thorn apple (datura species), henbane (Hyos to pest infestation is included. Preferably plants may benefit cyamus species) and buffalo burr (S. rostratum). from the present invention by protection from infestation by 0051 FPB is primarily found on horse nettle, but also plant pest organisms. occurs on common nightshade, ground cherry, and husk 0064. In a preferred embodiment the susceptible organism tomato (Physalis species). is a plant and the pest is a plant pathogenic insect. In this 0052. The term “insect’ encompasses insects of all types embodiment the insect is contacted with the RNA molecule and at all stages of development, including egg, larval or by expressing the dsRNA molecule in a plant, plant part, plant nymphal, pupal and adult stages. cell or plant seed that is infested with or susceptible to infes 0053. The present invention extends to methods as tation with the plant pathogenic pest. described herein, wherein the insect is Leptinotarsa decem 0065. In this context the term “plant encompasses any lineata (Colorado potato beetle) and the plant is potato, egg plant material that it is desired to treat to prevent or reduce plant, tomato, pepper, tobacco, ground cherry or rice, corn or insect growth and/or insect infestation. This includes, inter COtton. alia, whole plants, seedlings, propagation or reproductive 0054 The present invention extends to methods as material Such as seeds, cuttings, grafts, explants, etc. and also described herein, wherein the insect is Phaedon cochleariae plant cell and tissue cultures. The plant material should (mustard leaf beetle) and the plant is mustard, chinese cab express, or have the capability to express, the RNA molecule bage, turnip greens, collard greens or bok choy. comprising at least one nucleotide sequence that is the RNA 0055. The present invention extends to methods as complement of or that represents the RNA equivalent of at described herein, wherein the insect is Epilachna varivetis least part of the nucleotide sequence of the sense Strand of at (Mexican bean beetle) and the plants are beans, field beans, least one target gene of the pest organism, such that the RNA garden beans, Snap beans, lima beans, mung beans, string molecule is taken up by a pest upon plant-pest interaction, beans, black-eyed beans, velvet beans, soybeans, cowpeas, said RNA molecule being capable of inhibiting the target pigeon peas, clover or alfalfa. gene or down-regulating expression of the target gene by 0056. The present invention extends to methods as RNA interference. described herein, wherein the insect is Anthonomus grandis 0066. The target gene may be any of the target genes (cotton boll weevil) and the plant is cotton. herein described, for instance a target gene that is essential for 0057 The present invention extends to methods as the viability, growth, development or reproduction of the pest. described herein, wherein the insect is Tribolium castaneum The present invention relates to any gene of interest in the (red flour beetle) and the plant is in the form of stored grain insect (which may be referred to herein as the “target gene') products such as flour, cereals, meal, crackers, beans, spices, that can be down-regulated. pasta, cake mix, dried pet food, dried flowers, chocolate, nuts, 0067. The terms “down-regulation of gene expression' seeds, and even dried museum specimens. and “inhibition of gene expression” are used interchangeably 0058. The present invention extends to methods as and refer to a measurable or observable reduction in gene described herein, wherein the insect is Myzus persicae (green expression or a complete abolition of detectable gene expres peach aphid) and the plant is a tree Such as Prunus, particu sion, at the level of protein product and/or mRNA product larly peach, apricot and plum; a vegetable crop of the families from the target gene. Preferably the down-regulation does not Solanaceae, Chenopodiaceae, Compositae, Cruciferae, and substantially directly inhibit the expression of other genes of Cucurbitaceae, including but not limited to, artichoke, the insect. The down-regulation effect of the dsRNA on gene asparagus, bean, beets, broccoli, Brussels sprouts, cabbage, expression may be calculated as being at least 30%, 40%, carrot, cauliflower, cantaloupe, celery, corn, cucumber, fen 50%. 60%, preferably 70%, 80% or even more preferably nel, kale, kohlrabi, turnip, eggplant, lettuce, mustard, okra, 90% or 95% when compared with normal gene expression. parsley, parsnip, pea, pepper, potato, radish, spinach, Squash, Depending on the nature of the target gene, down-regulation tomato, turnip, watercress, and watermelon; a field crops such or inhibition of gene expression in cells of an insect can be as, but not limited to, tobacco, Sugar beet, and Sunflower, a confirmed by phenotypic analysis of the cell or the whole flower crop or other ornamental plant. insect or by measurement of mRNA or protein expression US 2014/0373.197 A1 Dec. 18, 2014
using molecular techniques such as RNA solution hybridiza eata, Phaedon cochleariae, Epilachna varivestis, Anthono tion, PCR, nuclease protection, Northern hybridization, mus grandis, Tribolium castaneum, Myzus persicae, Nilapar reverse transcription, gene expression monitoring with a vata lugens, Chilo suppressalis, Plutella xylostella and microarray, antibody binding, enzyme-linked immunosor Acheta domesticus. bent assay (ELISA), Western blotting, radioimmunoassay 0074. Other target genes for use in the present invention (RIA), other immunoassays, or fluorescence-activated cell may include, for example, those that play important roles in analysis (FACS). viability, growth, development, reproduction, and infectivity. 0068. The “target gene' may be essentially any gene that is These target genes include, for example, house keeping desirable to be inhibited because it interferes with growth or genes, transcription factors, and pest specific genes or lethal pathogenicity or infectivity of the insect. For instance, if the knockout mutations in Caenorhabditis or Drosophila. The method of the invention is to be used to prevent insect growth target genes for use in the present invention may also be those and/or infestation then it is preferred to select a target gene that are from other organisms, e.g., from insects or arachnidae which is essential for viability, growth, development or repro (e.g. Leptinotarsa spp., Phaedon spp., Epilachna spp., duction of the insect, or any gene that is involved with patho Anthonomus spp., Tribolium spp., Myzus spp., Nilaparvata genicity or infectivity of the insect, such that specific inhibi spp., Chilo spp., Plutella spp., or Acheta spp.). tion of the target gene leads to a lethal phenotype or decreases 0075 Preferred target genes include those specified in or stops insect infestation. Table 1A and orthologous genes from other target organisms, 0069. According to one non-limiting embodiment, the tar Such as from other pest organisms. get gene is such that when its expression is down-regulated or 0076. In the methods of the present invention, dsRNA is inhibited using the method of the invention, the insect is used to inhibitgrowth or to interfere with the pathogenicity or killed, or the reproduction or growth of the insect is stopped or infectivity of the insect. retarded. This type of target genes is considered to be essen 0077. The invention thus relates to isolated double tial for the viability of the insect and is referred to as essential Stranded RNA comprising annealed complementary strands, genes. Therefore, the present invention encompasses a one of which has a nucleotide sequence which is complemen method as described herein, wherein the target gene is an tary to at least part of a target nucleotide sequence of a target essential gene. gene of an insect. The target gene may be any of the target 0070 According to a further non-limiting embodiment, genes described herein, or a part thereof that exerts the same the target gene is such that when it is down-regulated using function. the method of the invention, the infestation or infection by the 0078. According to one embodiment of the present inven insect, the damage caused by the insect, and/or the ability of tion, an isolated double-stranded RNA is provided compris the insect to infest or infect host organisms and/or cause Such ing annealed complementary strands, one of which has a damage, is reduced. The terms “infest” and “infect” or “infes nucleotide sequence which is complementary to at least part tation' and “infection' are generally used interchangeably of a nucleotide sequence of an insect target gene, wherein said throughout. This type of target genes is considered to be target gene comprises a sequence which is selected from the involved in the pathogenicity or infectivity of the insect. group comprising: Therefore, the present invention extends to methods as 0079 (i) sequences which are at least 75% identical to a described herein, wherein the target gene is involved in the sequence represented by any of SEQID NOs 1, 3, 5, 7, pathogenicity or infectivity of the insect. The advantage of 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, choosing the latter type of target gene is that the insect is 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, blocked to infect further plants or plant parts and is inhibited 225, 230, 247, 249,251,253,255, 257, 259,275 to 472, to form further generations. 473, 478,483, 488, 493, 498, 503, 513,515, 517,519, 0071 According to one embodiment, target genes are con 521,533 to 575, 576,581,586,591,596,601, 603,605, served genes or insect-specific genes. 607, 609, 621 to 767, 768, 773,778,783,788,793, 795, 0072. In addition, any suitable double-stranded RNA frag 797, 799,801, 813 to 862, 863, 868,873, 878,883,888, ment capable of directing RNAi or RNA-mediated gene 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, silencing or inhibition of an insect target gene may be used in 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, the methods of the invention. 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, 0073. In another embodiment, a gene is selected that is 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, essentially involved in the growth, development, and repro 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, duction of a pest, (Such as an insect). Exemplary genes 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, include but are not limited to the structural subunits of ribo 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, Somal proteins and a beta-coatamer gene. Such as the CHD3 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to gene. Ribosomal proteins such as S4 (RpS4) and S9 (RpS9) 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070,2075, are structural constituents of the ribosome involved in protein 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106,2108, biosynthesis and which are components of the cytosolic Small 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, ribosomal subunit, the ribosomal proteins such as L9 and L19 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, are structural constituent of ribosome involved in protein 2471,2476 or 2481, or the complement thereof, and biosynthesis which is localised to the ribosome. The beta 0080 (ii) sequences comprising at least 17 contiguous coatamer gene in C. elegans encodes a protein which is a nucleotides of any of SEQID NOs 1, 3, 5, 7, 9, 11, 13, Subunit of a multimeric complex that forms a membrane 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, vesicle coat. Similar sequences have been found in diverse 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, organisms such as Arabidopsis thaliana, Drosophila melano 247, 249,251,253,255,257, 259,275 to 472, 473,478, gaster, and Saccharomyces cerevisiae. Related sequences are 483,488, 493,498, 503,513,515,517,519,521,533 to found in diverse organisms such as Leptinotarsa decemlin 575, 576,581,586,591, 596,601, 603, 605, 607, 609, US 2014/0373.197 A1 Dec. 18, 2014
621 to 767, 768,773,778,783,788,793,795, 797, 799, sequence data is available for the host organism one may 801, 813 to 862, 863, 868,873, 878,883, 888,890, 892, cross-check sequence identity with the double-stranded RNA 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, using standard bioinformatics tools. In one embodiment, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, there is no sequence identity between the dsRNA and a host 1089, 1091, 1093, 1095, 1097,1099, 1101, 1103, 1105, sequences over 21 contiguous nucleotides, meaning that in 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, this context, it is preferred that 21 contiguous base pairs of the 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, dsRNA do not occur in the genome of the host organism. In 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, another embodiment, there is less than about 10% or less than 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, about 12.5% sequence identity over 24 contiguous nucle 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, otides of the dsRNA with any nucleotide sequence from a host 2045, 2050, 2055, 2060, 2065, 2070,2075, 2080, 2085, species. 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to I0084. The double-stranded RNA comprises annealed 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, complementary strands, one of which has a nucleotide 2370, 2372,2384 to 2460, 2461, 2466, 2471, 2476 or sequence which corresponds to a target nucleotide sequence 2481, or the complement thereof, of the target gene to be down-regulated. The other strand of or wherein said insect target gene is an insect orthologue of a the double-stranded RNA is able to base-pair with the first gene comprising at least 17 contiguous nucleotides of any of Strand. SEQID NOs 49 to 158,275 to 472,533 to 575, 621 to 767, I0085. The expression “target region' or “target nucleotide 813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 2120 to sequence' of the targetinsect gene may be any Suitable region 2338, 2384 to 2460, or the complement thereof. or nucleotide sequence of the gene. The target region should 0081. Depending on the assay used to measure gene comprise at least 17, at least 18 or at least 19 consecutive silencing, the growth inhibition can be quantified as being nucleotides of the target gene, more preferably at least 20 or greater than about 5%, 10%, more preferably about 20%, at least 21 nucleotide and still more preferably at least 22, 23 25%, 33%, 50%, 60%, 75%, 80%, most preferably about or 24 nucleotides of the target gene. 90%. 95%, or about 99% as compared to a pest organism that I0086. It is preferred that (at least part of) the double has been treated with control dsRNA. stranded RNA will share 100% sequence identity with the 0082. According to another embodiment of the present target region of the insect target gene. However, it will be invention, an isolated double-stranded RNA is provided, appreciated that 100% sequence identity over the whole wherein at least one of said annealed complementary strands length of the double stranded region is not essential for func comprises the RNA equivalent of at least one of the nucle tional RNA inhibition. RNA sequences with insertions, dele otide sequences represented by any of SEQID NOS 1, 3, 5, 7, tions, and single point mutations relative to the target 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168,173, sequence have also been found to be effective for RNA inhi 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, bition. The terms “corresponding to’ or “complementary to 249,251,253,255,257, 259,275 to 472, 473,478,483,488, are used herein interchangeable, and when these terms are 493,498, 503,513,515,517,519,521,533 to 575,576,581, used to refer to sequence correspondence between the 586,591,596,601, 603, 605, 607, 609, 621 to 767, 768, 773, double-stranded RNA and the target region of the target gene, 778, 783,788,793,795, 797, 799,801, 813 to 862, 863, 868, they are to be interpreted accordingly, i.e. as not absolutely 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, requiring 100% sequence identity. However, the % sequence 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, identity between the double-stranded RNA and the target 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, region will generally be at least 80% or 85% identical, pref 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, erably at least 90%, 95%, 96%, or more preferably at least 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 97%.98% and still more preferably at least 99%. Two nucleic 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, acid strands are “substantially complementary when at least 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 85% of their bases pair. 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, I0087. The term “complementary” as used herein relates to 2060, 2065, 2070,2075,2080,2085, 2090, 2095, 2100,2102, both DNA-DNA complementarity as to DNA-RNA comple 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, mentarity. In analogy herewith, the term “RNA equivalent 2359, 2364, 2366, 2368, 2370, 2372,2384 to 2460, 2461, substantially means that in the DNA sequence(s), the base 2466, 2471, 2476 or 2481, or wherein at least one of said “T” may be replaced by the corresponding base “U” normally annealed complementary strands comprises the RNA equiva present in ribonucleic acids. lent of a fragment of at least 17 basepairs in length thereof, I0088 Although the dsRNA contains a sequence which preferably at least 18, 19, 20 or 21, more preferably at least corresponds to the target region of the target gene it is not 22, 23 or 24 basepairs in length thereof. absolutely essential for the whole of the dsRNA to correspond 0083. If the method of the invention is used for specifically to the sequence of the target region. For example, the dsRNA controlling growth or infestation of a specific insect in or on may contain short non-target regions flanking the target-spe a host cell or host organism, it is preferred that the double cific sequence, provided that Such sequences do not affect Stranded RNA does not share any significant homology with performance of the dsRNA in RNA inhibition to a material any host gene, or at least not with any essential gene of the eXtent. host. In this context, it is preferred that the double-stranded I0089. The dsRNA may contain one or more substitute RNA shows less than 30%, more preferably less that 20%, bases in order to optimise performance in RNAi. It will be more preferably less than 10%, and even more preferably less apparent to the skilled reader how to vary each of the bases of than 5% nucleic acid sequence identity with any gene of the the dsRNA in turn and test the activity of the resulting dsR host cell.% sequence identity should be calculated across the NAS (e.g. in a suitable invitro test system) in order to optimise full length of the double-stranded RNA region. If genomic the performance of a given dsRNA. US 2014/0373.197 A1 Dec. 18, 2014
0090. The dsRNA may further contain DNA bases, non double-stranded RNAS or RNA constructs to the same insect, natural bases or non-natural backbone linkages or modifica So as to achieve down-regulation or inhibition of multiple tions of the Sugar-phosphate backbone, for example to target genes or to achieve a more potent inhibition of a single enhance Stability during storage or enhance resistance to deg target gene. radation by nucleases. 0098. Alternatively, multiple targets are hit by the provi 0091. It has been previously reported that the formation of sion of one double-stranded RNA that hits multiple target short interfering RNAs (siRNAs) of about 21 bp is desirable sequences, and a single target is more efficiently inhibited by for effective gene silencing. However, in applications of the presence of more than one copy of the double stranded applicant it has been shown that the minimum length of RNA fragment corresponding to the target gene. Thus, in one dsRNA preferably is at least about 80-100 bp in order to be embodiment of the invention, the double-stranded RNA con efficiently taken up by certain pest organisms. There are indi struct comprises multiple dsRNA regions, at least one strand cations that in invertebrates such as the free living nematode of each dsRNA region comprising a nucleotide sequence that C. elegans or the plant parasitic nematode Meloidogyne is complementary to at least part of a target nucleotide incognita, these longer fragments are more effective in gene sequence of an insect target gene. According to the invention, silencing, possibly due to a more efficient uptake of these long the dsRNA regions in the RNA construct may be complemen dsRNA by the invertebrate. tary to the same or to different target genes and/or the dsRNA 0092. It has also recently been suggested that synthetic regions may be complementary to targets from the same or RNA duplexes consisting of either 27-mer blunt or short from different insect species. hairpin (sh) RNAs with 29bp stems and 2-mt3' overhangs are (0099. The terms “hit”, “hits” and “hitting are alternative more potent inducers of RNA interference than conventional wordings to indicate that at least one of the strands of the 21-mer siRNAs. Thus, molecules based upon the targets iden dsRNA is complementary to, and as such may bind to, the tified above and being either 27-mer blunt or short hairpin target gene or nucleotide sequence. (sh) RNAs with 29-bp stems and 2-mt 3' overhangs are also 0100. In one embodiment, the double stranded RNA included within the scope of the invention. region comprises multiple copies of the nucleotide sequence 0093. Therefore, in one embodiment, the double-stranded that is complementary to the target gene. Alternatively, the RNA fragment (or region) will itself preferably be at least 17 dsRNA hits more than one target sequence of the same target bp in length, preferably 18 or 19 bp in length, more preferably gene. The invention thus encompasses isolated double at least 20 bp, more preferably at least 21 bp, or at least 22 bp. Stranded RNA constructs comprising at least two copies of or at least 23 bp, or at least 24 bp, 25bp. 26 bp or at least 27 said nucleotide sequence complementary to at least part of a bp in length. The expressions “double-stranded RNA frag nucleotide sequence of an insect target. ment” or “double-stranded RNA region” refer to a small 0101 The term “multiple” in the context of the present entity of the double-stranded RNA corresponding with (part invention means at least two, at least three, at least four, at of) the target gene. least five, at least six, etc. 0094 Generally, the double stranded RNA is preferably 0102 The expressions “a further target gene' or “at least between about 17-1500 bp, even more preferably between one other target gene' mean for instance a second, a third or about 80-1000 bp and most preferably between about 17-27 a fourth, etc. target gene. bp or between about 80-250 bp; such as double stranded RNA (0103 DsRNA that hits more than one of the above-men regions of about 17 bp, 18 bp, 19 bp, 20 bp, 21 bp. 22 bp, 23 tioned targets, or a combination of different dsRNA against bp, 24bp, 25bp, 27 bp, 50 bp, 80 bp, 100 bp, 150 bp, 200 bp, different of the above mentioned targets are developed and 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 used in the methods of the present invention. bp, 650 bp, 700 bp,900 bp, 100 bp, 1100 bp, 1200 bp, 1300 0104. Accordingly the invention relates to an isolated bp, 1400 bp or 1500 bp. double stranded RNA construct comprising at least two cop 0095. The upper limit on the length of the double-stranded ies of the RNA equivalent of at least one of the nucleotide RNA may be dependent on i) the requirement for the dsRNA sequences represented by any of SEQID NOs 1, 3, 5, 7, 9, 11, to be taken up by the insect and ii) the requirement for the 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, dsRNA to be processed within the cell into fragments that 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, direct RNAi. The chosen length may also be influenced by the 251,253,255, 257, 259,275 to 472, 473,478,483,488, 493, method of synthesis of the RNA and the mode of delivery of 498, 503,513,515,517,519,521,533 to 575, 576,581,586, the RNA to the cell. Preferably the double-stranded RNA to 591,596,601, 603, 605, 607, 609, 621 to 767, 768, 773,778, be used in the methods of the invention will be less than 783,788, 793, 795, 797, 799,801, 813 to 862, 863, 868,873, 10,000 bp in length, more preferably 1000 bp or less, more 878, 883, 888,890, 892, 894, 896,908 to 1040, 1041, 1046, preferably 500 bp or less, more preferably 300 bp or less, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, more preferably 100 bp or less. For any given target gene and 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, 1103, insect, the optimum length of the dsRNA for effective inhi 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, bition may be determined by experiment. 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 0096. The double-stranded RNA may be fully or partially 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, double-stranded. Partially double-stranded RNAs may 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, include short single-stranded overhangs at one or both ends of 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, the double-stranded portion, provided that the RNA is still 2065,2070,2075,2080,2085, 2090,2095, 2100,2102, 2104, capable of being taken up by insects and directing RNAi. The 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, double-stranded RNA may also contain internal non-comple 2364, 2366, 2368, 2370, 2372,2384 to 2460, 2461, 2466, mentary regions. 2471,2476 or 2481, or at least two copies of the RNA equiva 0097. The methods of the invention encompass the simul lent of a fragment of at least 17 basepairs in length thereof, taneous or sequential provision of two or more different preferably at least 18, 19, 20 or 21, more preferably at least US 2014/0373.197 A1 Dec. 18, 2014
22, 23 or 24 basepairs in length thereof. Preferably, said 225, 230, 247, 249,251,253,255, 257, 259,275 to 472, double-stranded RNA comprises the RNA equivalent of the 473, 478,483, 488, 493, 498, 503, 513,515, 517,519, nucleotide sequence as represented in SEQ ID NO 159 or 521,533 to 575, 576,581,586,591,596,601, 603,605, 160, or a fragment of at least 17, preferably at least 18, 19, 20 607, 609, 621 to 767, 768, 773,778,783,788,793, 795, or 21, more preferably at least 22, 23 or 24 basepairs in length 797, 799,801, 813 to 862, 863, 868,873, 878,883,888, thereof. In a further embodiment, the invention relates to an 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, isolated double stranded RNA construct comprising at least 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, two copies of the RNA equivalent of the nucleotide sequence 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, as represented by SEQID NO 159 or 160. 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 0105. Accordingly, the present invention extends to meth 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, ods as described herein, wherein the dsRNA comprises 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, annealed complementary Strands, one of which has a nucle 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, otide sequence which is complementary to at least part of a 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to target nucleotide sequence of an insect target gene, and which 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070,2075, comprises the RNA equivalents of at least wo nucleotide 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106,2108, sequences independently chosen from each other. In one 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, embodiment, the dsRNA comprises the RNA equivalents of 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, at least two, preferably at least three, four or five, nucleotide 2471,2476 or 2481, or the complement thereof, and sequences independently chosen from the sequences repre 0109 (ii) sequences comprising at least 17 contiguous sented by any of SEQID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, nucleotides of any of SEQID NOs 1, 3, 5, 7, 9, 11, 13, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183,188, 193, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 257, 259,275 to 472, 473,478,483,488, 493,498,503, 513, 247, 249,251,253,255,257, 259,275 to 472, 473,478, 515,517,519,521,533 to 575, 576,581,586,591,596,601, 483,488, 493,498, 503,513,515,517,519,521,533 to 603, 605, 607, 609, 621 to 767, 768,773,778, 783,788, 793, 575, 576,581,586,591, 596,601, 603, 605, 607, 609, 795, 797, 799,801, 813 to 862,863, 868,873, 878,883, 888, 621 to 767, 768,773,778,783,788,793, 795,797,799, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 801, 813 to 862, 863, 868,873, 878,883, 888,890, 892, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1089, 1091, 1093, 1095, 1097,1099, 1101, 1103,1105,1107, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1089, 1091, 1093, 1095, 1097,1099, 1101, 1103, 1105, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 2075,2080,2085, 2090, 2095, 2100,2102, 2104, 2106,2108, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2045, 2050, 2055, 2060, 2065, 2070,2075,2080, 2085, 2368, 2370, 2372,2384 to 2460, 2461, 2466, 2471, 2476 or 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2481, or fragments thereof of at least 17 basepairs in length, 2338, 2339, 2344, 2349, 2354, 2359, 2364,2366, 2368, preferably at least 18, 19, 20 or 21, more preferably at least 2370, 2372,2384 to 2460, 2461, 2466, 2471, 2476 or 22, 23 or 24 basepairs in length thereof. 2481, or the complement thereof, 0106 The at least two nucleotide sequences may be 0110 or wherein said insect target gene is an insect ortho derived from the target genes herein described. According to logue of a gene comprising at least 17 contiguous nucleotides one preferred embodiment the dsRNA hits at least one target gene that is essential for viability, growth, development or of any of SEQID NOs 49 to 158,275 to 472,533 to 575, 621 reproduction of the insect and hits at least one gene involved to 767,813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, in pathogenicity or infectivity as described hereinabove. 2120 to 2338, 2384 to 2460, or the complement thereof. Alternatively, the dsRNA hits multiple genes of the same 0111. The dsRNA regions (or fragments) in the double category, for example, the dsRNA hits at least 2 essential stranded RNA may be combined as follows: genes or at least 2 genes involved in the same cellular func 0112 a) when multiple dsRNA regions targeting a tion. According to a further embodiment, the dsRNA hits at single target gene are combined, they may be combined least 2 target genes, which target genes are involved in a in the original order (ie the order in which the regions different cellular function. For example the dsRNA hits two appear in the target gene) in the RNA construct, or more genes involved in protein synthesis (e.g. ribosome subunits), intracellular protein transport, nuclear mRNA 0113 b) alternatively, the original order of the frag splicing, or involved in one of the functions described in Table ments may be ignored so that they are scrambled and 1A. combined randomly or deliberately in any order into the 0107 Preferably, the present invention extends to methods double stranded RNA construct, as described herein, wherein said insect target gene comprises 0114 c) alternatively, one single fragment may be a sequence which is which is selected from the group com repeated several times, for example from 1 to 10 times, prising: e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times, in the dsRNA 0.108 (i) sequences which are at least 75% identical to a construct, or sequence represented by any of SEQID NOs 1, 3, 5, 7, 0115 d) the dsRNA regions (targeting a single or dif 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, ferent target genes) may be combined in the sense or 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, antisense orientation. US 2014/0373.197 A1 Dec. 18, 2014 11
0116. In addition, the target gene(s) to be combined may group comprising (i) a sequence facilitating large-scale pro be chosen from one or more of the following categories of duction of the dsRNA construct; (ii) a sequence effecting an genes: increase or decrease in the stability of the dsRNA; (iii) a 0117 e) “essential genes or “pathogenicity genes’ as sequence allowing the binding of proteins or other molecules described above encompass genes that are vital for one to facilitate uptake of the RNA construct by insects; (iv) a or more target insects and result in a lethal or severe (e.g. sequence which is an aptamer that binds to a receptor or to a feeding, reproduction, growth) phenotype when molecule on the Surface or in the cytoplasm of an insect to silenced. The choice of a strong lethal target gene results facilitate uptake, endocytosis and/or transcytosis by the in a potent RNAi effect. In the RNA constructs of the insect; or (V) additional sequences to catalyze processing of invention, multiple dsRNA regions targeting the same or dsRNA regions. In one embodiment, the linker is a condition different (very effective) lethal genes can be combined ally self-cleaving RNA sequence, preferably a pH sensitive to further increase the potency, efficacy or speed of the linker or a hydrophobic sensitive linker. In one embodiment, RNAi effect in insect control. the linker is an intron. 0118 “weak” genes encompass target genes with a 0.125. In one embodiment, the multiple dsRNA regions of particularly interesting function in one of the cellular the double-stranded RNA construct are connected by one or pathways described herein, but which result in a weak more linkers. In another embodiment, the linker is present at phenotypic effect when silenced independently. In the a site in the RNA construct, separating the dsRNA regions RNA constructs of the invention, multiple dsRNA from another region of interest. Different linker types for the regions targeting a single or different weak gene(s) may dsRNA constructs are provided by the present invention. be combined to obtain a stronger RNAi effect. I0126. In another embodiment, the multiple dsRNA 0119 g) “insect specific genes encompass genes that regions of the double-stranded RNA construct are connected have no Substantial homologous counterpart in non-in without linkers. sect organisms as can be determined by bioinformatics I0127. In a particular embodiment of the invention, the homology searches, for example by BLAST searches. linkers may be used to disconnect Smaller dsRNA regions in The choice of an insect specific target gene results in a the pest organism. Advantageously, in this situation the linker species specific RNAi effect, with no effect or no sub sequence may promote division of a long dsRNA into Smaller stantial (adverse) effect in non-target organisms. dsRNA regions under particular circumstances, resulting in I0120 h)"conserved genes' encompass genes that are the release of separate dsRNA regions under these circum conserved (at the amino acid level) between the target stances and leading to more efficient gene silencing by these organism and non-target organism(s). To reduce pos smaller dsRNA regions. Examples of suitable conditionally sible effects on non-target species, such effective but self-cleaving linkers are RNA sequences that are self-cleav conserved genes are analysed and target sequences from ing at high pH conditions. Suitable examples of such RNA the variable regions of these conserved genes are chosen sequences are described by Borda et al. (Nucleic Acids Res. to be targeted by the dsRNA regions in the RNA con 2003 May 15:31(10):2595-600), which document is incor struct. Here, conservation is assessed at the level of the porated herein by reference. This sequence originates from nucleic acid sequence. Such variable regions thus the catalytic core of the hammerhead ribozyme HH16. encompass the least conserved sections, at the level of the nucleic acid sequence, of the conserved target gene I0128. In another aspect of the invention, a linker is located (s). at a site in the RNA construct, separating the dsRNA regions 0121 i) “conserved pathway” genes encompass genes from another, e.g. the additional, sequence of interest, which that are involved in the same biological pathway or preferably provides some additional function to the RNA cellular process, or encompass genes that have the same COnStruct. functionality in different insect species resulting in a I0129. In one particular embodiment of the invention, the specific and potent RNAi effect and more efficient insect dsRNA constructs of the present invention are provided with control; an aptamer to facilitate uptake of the dsRNA by the insect. 0.122 j) alternatively, the RNA constructs according to The aptamer is designed to binda Substance which is taken up the present invention target multiple genes from differ by the insect. Such Substances may be from an insect or plant ent biological pathways, resulting in a broad cellular origin. One specific example of anaptamer, is anaptamer that RNAi effect and more efficient insect control. binds to a transmembrane protein, for example a transmem 0123. According to the invention, all double stranded brane protein of an insect. Alternatively, the aptamer may RNA regions comprise at least one strand that is complemen binda (plant) metabolite or nutrient which is taken up by the tary to at least part or a portion of the nucleotide sequence of insect. any of the target genes herein described. However, provided 0.130. Alternatively, the linkers are self-cleaving in the one of the double stranded RNA regions comprises at least endoSomes. This may be advantageous when the constructs one strand that is complementary to a portion of the nucle of the present invention are taken up by the insect via endocy otide sequence of any one of the target genes herein tosis or transcytosis, and are therefore compartmentalized in described, the other double stranded RNA regions may com the endosomes of the insect species. The endoSomes may prise at least one strand that is complementary to a portion of have a low pH environment, leading to cleavage of the linker. any other insect target gene (including known target genes). I0131 The above mentioned linkers that are self-cleaving 0.124. According to yet another embodiment of the present in hydrophobic conditions are particularly useful in dsRNA invention there is provided an isolated double stranded RNA constructs of the present invention when used to be trans or RNA construct as herein described, further comprising at ferred from one cell to another via the transit in a cell wall, for least one additional sequence and optionally a linker. In one example when crossing the cell wall of an insect pest organ embodiment, the additional sequence is chosen from the 1S. US 2014/0373.197 A1 Dec. 18, 2014
0132) An intron may also be used as a linker. An “intron' molecule that is partially self-complementary. RNAs having as used herein may be any non-coding RNA sequence of a this structure are convenient if the dsRNA is to be synthesised messenger RNA. Particular suitable intron sequences for the by expression in Vivo, for example in a host cell or organism constructs of the present invention are (1) U-rich (35-45%); as discussed below, or by in vitro transcription. The precise (2) have an average length of 100 bp (varying between about nature and sequence of the “loop' linking the two RNA 50 and about 500 bp) which base pairs may be randomly Strands is generally not material to the invention, except that chosen or may be based on known intron sequences; (3) start it should not impair the ability of the double-stranded part of at the 5' end with-AG:GT- or -CG:GT and/or (4) have at their the molecule to mediate RNAi. The features of “hairpin' or 3' end -AG:GC- or -AG:AA. “stem-loop RNAs for use in RNAi are generally known in 0133. A non-complementary RNA sequence, ranging the art (see for example WO99/53050, in the name of CSIRO, from about 1 base pair to about 10,000 base pairs, may also be the contents of which are incorporated herein by reference). used as a linker. In other embodiments of the invention, the loop structure may 0134. Without wishing to be bound by any particular comprise linker sequences or additional sequences as theory or mechanism, it is thought that long double-stranded described above. RNAs are taken up by the insect from their immediate envi 0.139. Another aspect of the present invention are target ronment. Double-stranded RNAs taken up into the gut and nucleotide sequences of the insect target genes herein dis transferred to the gut epithelial cells are then processed within closed. Such target nucleotide sequences are particularly the cell into short double-stranded RNAs, called small inter important to design the dsRNA constructs according to the fering RNAs (siRNAs), by the action of an endogenous endo present invention. Such target nucleotide sequences are pref nuclease. The resulting siRNAs then mediate RNAi via for erably at least 17, preferably at least 18, 19, 20 or 21, more mation of a multi-component RNase complex termed the preferably at least 22, 23 or 24 nucleotides in length. Non RISC or RNA interfering silencing complex. limiting examples of preferred target nucleotide sequences 0135) In order to achieve down-regulation of a target gene are given in the examples. within an insect cell the double-stranded RNA added to the 0140. According to one embodiment, the present inven exterior of the cell wall may be any dsRNA or dsRNA con tion provides an isolated nucleotide sequence encoding a struct that can be taken up into the cell and then processed double stranded RNA or double stranded RNA construct as within the cell into siRNAs, which then mediate RNAi, or the described herein. RNA added to the exterior of the cell could itselfbean siRNA 0.141. According to a more specific embodiment, the that can be taken up into the cell and thereby direct RNAi. present invention relates to an isolated nucleic acid sequence 0.136 siRNAs are generally short double-stranded RNAs consisting of a sequence represented by any of SEQID NOS having a length in the range of from 19 to 25 base pairs, or 49 to 158,275 to 472,533 to 575, 621 to 767,813 to 862,908 from 20 to 24 base pairs. In preferred embodiments siRNAs to 1040, 1161 to 1571, 1730 to 2039, 2120 to 2338, 2384 to having 19, 20, 21, 22, 23, 24 or 25 base pairs, and in particular 2460, or a fragment of at least 17 preferably at least 18, 19, 20 21 or 22 base pairs, corresponding to the target gene to be or 21, more preferably at least 22, 23 or 24 nucleotides down-regulated may be used. However, the invention is not thereof. intended to be limited to the use of such siRNAs. 0142. A person skilled in the art will recognize that homo 0.137 siRNAs may include single-stranded overhangs at logues of these target genes can be found and that these one or both ends, flanking the double-stranded portion. In a homologues are also useful in the methods of the present particularly preferred embodiment the siRNA may contain 3' invention. overhanging nucleotides, preferably two 3' overhanging thy 0.143 Protein, or nucleotide sequences are likely to be midines (dTdT) or uridines (UU).3'TT or UU overhangs may homologous if they show a 'significant' level of sequence be included in the siRNA if the sequence of the target gene similarity or more preferably sequence identity. Truely immediately upstream of the sequence included in double homologous sequences are related by divergence from a com stranded part of the dsRNA is AA. This allows the TT or UU mon ancestor gene. Sequence homologues can be of two overhang in the siRNA to hybridise to the target gene. types: (i) where homologues existin different species they are Although a 3TT or UU overhang may also be included at the known as orthologues. e.g. the C-globin genes in mouse and other end of the siRNA it is not essential for the target human are orthologues. (ii) paralogues are homologous genes sequence downstream of the sequence included in double in within a single species. e.g. the C- and 3-globin genes in stranded part of the siRNA to have AA. In this context, siR mouse are paralogues NAS which are RNA/DNA chimeras are also contemplated. 0144 Preferred homologues are genes comprising a These chimeras include, for example, the siRNAS comprising sequence which is at least about 85% or 87.5%, still more a double-stranded RNA with 3' overhangs of DNA bases (e.g. preferably about 90%, still more preferably at least about dTdT), as discussed above, and also double-stranded RNAs 95% and most preferably at least about 99% identical to a which are polynucleotides in which one or more of the RNA sequence selected from the group of sequences represented bases or ribonucleotides, or even all of the ribonucleotides on by SEQID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to an entire strand, are replaced with DNA bases or deoxynucle 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, otides. 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 0.138. The dsRNA may be formed from two separate 275 to 472, 473,478,483,488, 493,498, 503,513,515,517, (sense and antisense) RNA strands that are annealed together 519,521,533 to 575, 576,581,586,591,596,601, 603,605, by (non-covalent) basepairing. Alternatively, the dsRNA may 607, 609, 621 to 767, 768,773,778,783,788, 793,795, 797, have a foldback stem-loop or hairpin structure, wherein the 799,801, 813 to 862, 863, 868,873, 878,883, 888,890, 892, two annealed strands of the dsRNA are covalently linked. In 894, 896,908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, this embodiment the sense and antisense stands of the dsRNA 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, are formed from different regions of single polynucleotide 1093, 1095, 1097,1099, 1101, 1103, 1105, 1107, 1109, 1111, US 2014/0373.197 A1 Dec. 18, 2014
1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 2055, 2060, 2065,2070,2075,2080,2085, 2090,2095, 2100, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2039, 2040, 2045,2050,2055, 2060, 2065, 2070,2075,2080, 2354, 2359, 2364, 2366, 2368, 2370, 2372,2384 to 2460, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2461, 2466, 2471,2476 or 2481. 2338,2339,2344, 2349, 2354, 2359,2364,2366,2368,2370, 0146 According to another embodiment, the invention 2372,2384 to 2460, 2461, 2466, 2471,2476 or 2481, or the encompasses target genes which are insect orthologues of a complement thereof. Methods for determining sequence gene comprising a nucleotide sequence as represented in any identity are routine in the art and include use of the Blast of SEQID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to software and EMBOSS software (The European Molecular 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, Biology Open Software Suite (2000), Rice, P. Longden, I. and 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, Bleasby, A.Trends in Genetics 16, (6) pp. 276-277). The term 275 to 472, 473,478,483,488, 493,498, 503,513,515,517, “identity” as used herein refers to the relationship between 519,521,533 to 575, 576,581,586,591,596,601, 603,605, sequences at the nucleotide level. The expression “96 identi 607, 609, 621 to 767, 768,773,778,783,788, 793,795, 797, cal' is determined by comparing optimally aligned 799,801, 813 to 862, 863, 868,873, 878,883, 888,890, 892, sequences, e.g. two or more, over a comparison window 894, 896,908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, wherein the portion of the sequence in the comparison win 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, dow may comprise insertions or deletions as compared to the 1093, 1095, 1097,1099, 1101, 1103, 1105, 1107, 1109, 1111, reference sequence for optimal alignment of the sequences. 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, The reference sequence does not comprise insertions or dele 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, tions. The reference window is chosen from between at least 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 10 contiguous nucleotides to about 50, about 100 or to about 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 150 nucleotides, preferably between about 50 and 150 nucle 2039, 2040, 2045,2050,2055, 2060,2065, 2070,2075,2080, otides. “9% identity” is then calculated by determining the 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to number of nucleotides that are identical between the 2338,2339,2344, 2349, 2354, 2359,2364,2366,2368,2370, sequences in the window, dividing the number of identical 2372,2384 to 2460,2461,2466, 2471,2476 or 2481. By way nucleotides by the number of nucleotides in the window and of example, orthologues may comprise a nucleotide sequence multiplying by 100. as represented in any of SEQID NOS 49 to 123, 275 to 434, 0145. Other homologues are genes which are alleles of a 533 to 562, 621 to 738,813 to 852,908 to 1010, 1161 to 1437, gene comprising a sequence as represented by any of SEQID 1730 to 1987,2120 to 2290, and 2384 to 2438, or a fragment NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, thereof of at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, nucleotides. A non-limiting list of insect or arachnida ortho 220, 225, 230, 247, 249,251,253,255, 257, 259,275 to 472, logues genes or sequences comprising at least a fragment of 473, 478,483,488, 493, 498, 503, 513,515,517,519, 521, 17 bp of one of the sequences of the invention, is given in 533 to 575, 576,581,586,591,596,601, 603, 605, 607, 609, Tables 4. 621 to 767, 768,773,778,783,788,793, 795, 797,799,801, 0147 According to another embodiment, the invention 813 to 862, 863, 868,873, 878, 883, 888,890, 892, 894, 896, encompasses target genes which are nematode orthologues of 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, a gene comprising a nucleotide sequence as represented in 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, any of 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 1095, 1097,1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 220, 225, 230, 247, 249,251,253,255, 257, 259,275 to 472, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 473, 478,483, 488, 493, 498, 503, 513,515,517,519, 521, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 533 to 575, 576,581,586,591,596,601, 603, 605, 607, 609, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 621 to 767, 768,773,778,783,788,793, 795, 797,799,801, 2040, 2045, 2050,2055, 2060,2065, 2070,2075,2080,2085, 813 to 862, 863, 868,873, 878,883, 888,890, 892, 894, 896, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 2339,2344, 2349,2354, 2359,2364,2366,2368,2370,2372, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 2384 to 2460, 2461, 2466, 2471,2476 or 2481. Further pre 1095, 1097,1099, 1101, 1103, 1105,1107, 1109, 1111, 1113, ferred homologues are genes comprising at least one single 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, nucleotide polymorphism (SNIP) compared to a gene com 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, prising a sequence as represented by any of SEQID NO 1, 3, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 5, 7,9,11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 173, 178, 183, 188, 193, 198,203, 208, 215, 220, 225, 230, 2040,2045, 2050,2055, 2060, 2065,2070,2075,2080,2085, 247, 249,251,253,255, 257, 259,275 to 472, 473,478,483, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 488, 493,498, 503,513,515,517,519,521,533 to 575, 576, 2339,2344, 2349,2354, 2359,2364,2366,2368,2370,2372, 581,586,591,596,601, 603, 605, 607, 609, 621 to 767, 768, 2384 to 2460, 2461, 2466, 2471, 2476 or 248. By way of 773,778, 783,788,793, 795, 797, 799,801, 813 to 862, 863, example, nematode orthologues may comprise a nucleotide 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, sequence as represented in any of SEQID NOs 124 to 135, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 435 to 446,563 to 564, 739 to 751, 853, 854, 1011 to 1025, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1438 to 1473, 1988 to 2001, 2291 to 2298, 2439 or 2440, or a 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, fragment of at least 17, 18, 19, 20 or 21 nucleotides thereof. 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, According to another aspect, the invention thus encompasses 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, any of the methods described herein for controlling nematode US 2014/0373.197 A1 Dec. 18, 2014 growth in an organism, or for preventing nematode infesta any of the sequences as represented in SEQID NOS 136 to tion of an organism susceptible to nemataode infection, com 158,447 to 472,565 to 575, 752 to 767, 855 to 862, 1026 to prising contacting nematode cells with a double-stranded 1040, 1475 to 1571, 2002 to 2039, 2299 to 2338, 2441 to RNA, wherein the double-stranded RNA comprises annealed 2460. A non-limiting list of fungal orthologues genes or complementary strands, one of which has a nucleotide sequences comprising at least a fragment of 17 bp of one of sequence which is complementary to at least part of the nucle the sequences of the invention, is given in Tables 6. otide sequence of a target gene comprising a fragment of at 0149. In one preferred embodiment of the invention the least 17, 18, 19, 20 or 21 nucleotides of any of the sequences dsRNA may be expressed by (e.g. transcribed within) a host as represented in SEQID NOs 124 to 135,435 to 446,563 to cell or host organism, the host cell or organism being an 564, 739 to 751, 853, 854, 1011 to 1025, 1438 to 1473, 1988 organism susceptible or Vulnerable to infestation by an insect. to 2001, 2291 to 2298, 2439 or 2440, whereby the double In this embodiment RNAi-mediated gene silencing of one or stranded RNA is taken up by the nematode and thereby con more target genes in the insect may be used as a mechanism to trols growth or prevents infestation. The invention also relates control growth of the insect in or on the host organism and/or to nematode-resistant transgenic plants comprising a frag to prevent or reduce insect infestation of the host organism. ment of at least 17, 18, 19, 20 or 21 nucleotides of any of the Thus, expression of the double-stranded RNA within cells of sequences as represented in SEQID NOs 124 to 135,435 to the host organism may confer resistance to a particular insect 446,563 to 564, 739 to 751, 853, 854, 1011 to 1025, 1438 to or to a class of insects. In case the dsRNA hits more than one 1473, 1988 to 2001, 2291 to 2298, 2439 or 2440. A non insect target gene, expression of the double-stranded RNA limiting list of nematode orthologues genes or sequences within cells of the host organism may confer resistance to comprising at least a fragment of 17 bp of one of the more than one insect or more than one class of insects. sequences of the invention, is given in Tables 5. 0150. In a preferred embodiment the host organism is a 0148. According to another embodiment, the invention plant and the insect is a plant pathogenic insect. In this encompasses target genes which are fungal orthologues of a embodiment the insect is contacted with the double-stranded gene comprising a nucleotide sequence as represented in any RNA by expressing the double-stranded RNA in a plant or of 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, plant cell that is infested with or susceptible to infestation 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, with the plant pathogenic insect. 220, 225, 230, 247, 249,251,253,255, 257, 259,275 to 472, 0151. In this context the term “plant' encompasses any 473, 478,483,488, 493, 498, 503, 513,515,517,519, 521, plant material that it is desired to treat to prevent or reduce 533 to 575,576,581,586,591,596,601, 603, 605, 607, 609, insect growth and/or insect infestation. This includes, inter 621 to 767, 768,773,778,783,788,793, 795, 797,799,801, alia, whole plants, seedlings, propagation or reproductive 813 to 862, 863, 868,873, 878, 883, 888,890, 892, 894, 896, material Such as seeds, cuttings, grafts, explants, etc. and also 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, plant cell and tissue cultures. The plant material should 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, express, or have the capability to express, dsRNA corre 1095, 1097,1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, sponding to one or more target genes of the insect. 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 0152 Therefore, in a further aspect the invention provides 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, a plant, preferably a transgenic plant, or propagation or repro 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, ductive material fora (transgenic) plant, or a plant cell culture 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, expressing or capable of expressing at least one double 2040, 2045, 2050,2055, 2060,2065, 2070,2075,2080,2085, stranded RNA, wherein the double-stranded RNA comprises 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, annealed complementary Strands, one of which has a nucle 2339,2344, 2349,2354, 2359,2364,2366,2368,2370,2372, otide sequence which is complementary to at least part of a 2384 to 2460, 2461, 2466, 2471, 2476 or 2481. By way of target nucleotide sequence of a target gene of an insect. Such example, fungal orthologues may comprise a nucleotide that the double-stranded RNA is taken up by an insect upon sequence as represented in any of SEQID NOS 136 to 158, plant-insect interaction, said double stranded RNA being 447 to 472,565 to 575, 752 to 767, 855 to 862, 1026 to 1040, capable of inhibiting the target gene or down-regulating 1475 to 1571, 2002 to 2039,2299 to 2338, 2441 to 2460, or a expression of the target gene by RNA interference. The target fragment of at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 gene may be any of the target genes herein described, for nucleotides thereof. According to another aspect, the inven instance a target gene that is essential for the viability, growth, tion thus encompasses any of the methods described herein development or reproduction of the insect. for controlling fungal growth on a cell or an organism, or for 0153. In this embodiment the insect can be any insect, but preventing fungal infestation of a cell or an organism suscep is preferably plant pathogenic insect. Preferred plant patho tible to fungal infection, comprising contacting fungal cells genic insects include, but are not limited to, those listed with a double-stranded RNA, wherein the double-stranded above. RNA comprises annealed complementary strands, one of 0154) A plant to be used in the methods of the invention, or which has a nucleotide sequence which is complementary to a transgenic plant according to the invention encompasses at least part of the nucleotide sequence of a target gene com any plant, but is preferably a plant that is susceptible to prising a fragment of at least 17, 18, 19, 20 or 21 nucleotides infestation by a plant pathogenic insect. of any of the sequences as represented in SEQID NOS 136 to 0155 Accordingly, the present invention extends to meth 158, 447 to 472,565 to 575, 752 to 767, 855 to 862, 1026 to ods as described herein wherein the plant is chosen from the 1040, 1475 to 1571, 2002 to 2039, 2299 to 2338, 2441 to following group of plants (or crops): alfalfa, apple, apricot, 2460, whereby the double-stranded RNA is taken up by the artichoke, asparagus, avocado, banana, barley, beans, beet, fungus and thereby controls growth or prevents infestation. blackberry, blueberry, broccoli, brussel sprouts, cabbage, The invention also relates to fungal-resistant transgenic canola, carrot, cassava, cauliflower, a cereal, celery, cherry, plants comprising a fragment of at least 17, 18, 19, 20 or 21 of citrus, clemintine, coffee, corn, cotton, cucumber, eggplant, US 2014/0373.197 A1 Dec. 18, 2014
endive, eucalyptus, figes, grape, grapefruit, groundnuts, ern corn borer), or D. Saccharalis (Sugarcane borer)); Elas ground cherry, kiwifruit, lettuce, leek, lemon, lime, pine, mopalpus spp. (e.g. E. lignosellus (lesser cornstalk borer)); maize, mango, melon, millet, mushroom, nutaot, okra, onion, Melanotus spp. (wireworms); Cyclocephala spp. (e.g. C. orange, an ornamental plant or flower or tree, papaya, parsley, borealis (northern masked chafer)); Cyclocephala spp. (e.g. pea, peach, peanut, peat, pepper, persimmon, pineapple, plan C. immaculate (Southern masked chafer)); Popillia spp. (e.g. tain, plum, pomegranate, potato, pumpkin, radicchio, radish, P. japonica (Japanese beetle)); Chaetocnema spp. (e.g. C. rapeseed, raspberry, rice, rye, Sorghum, Soy, soybean, spin pullicaria (corn flea beetle)); Sphenophorus spp. (e.g. S. mai ach, Strawberry, Sugarbeet, Sugargcane, Sunflower, Sweet dis (maize billbug)); Rhopalosiphum spp. (e.g. R. maidis potato, tangerine, tea, tobacco, tomato, a vine, watermelon, (corn leaf aphid)); Anuraphis spp. (e.g. A. maidiradicis (corn wheat, yams and Zucchini. root aphid)); Blissus spp. (e.g. B. leucopterus leucopterus 0156. In one embodiment the present invention extends to (chinch bug)); Melanoplus spp. (e.g. M. femurrubrum methods as described herein, wherein the plant is potato and (redlegged grasshopper), M. Sanguinipes (migratory grass the target gene is a gene from an insect selected from the hopper)); Hyllemya spp. (e.g. H. platura (seedcorn maggot)); group consisting of Leptinotarsa spp. (e.g. L. decemlineata Agromyza spp. (e.g. A. parvicornis (corn blot leafminer)); (Colorado potato beetle), L. juncta (false potato beetle), or L. Anaphothrips spp. (e.g. A. Obscrurus (grass thrips); Solenop texana (Texan false potato beetle)); Lema spp. (e.g. L. trilin sis spp. (e.g. S. milesta (thief ant)); and Tetranychus spp. (e.g. eata (three-lined potato beetle)): Epitrix spp. (e.g. E. cucum T. urticae (two spotted spider mite)); in another embodiment eris (potato flea beetle) or E. tuberis (tuber flea beetle)); the present invention extends to methods as described herein, Epicauta spp. (e.g. E. vittata (striped blister beetle)); Phae wherein the plant is cotton and the target gene is a gene from don spp. (e.g. P. cochleariae (mustard leaf beetle)); an insect selected from the group consisting of Helicoverpa Empoasca spp. (e.g. E. fabae (potato leafhopper)); Myzus spp. (e.g. H. Zea (cotton bollworm)); Pectinophora spp. (e.g. spp. (e.g. M. persicae (green peach aphid)); Paratrioza spp. P. gossypiella (pink bollworm)); Helicoverpa spp. (e.g. H. (e.g. P. Cockerelli (potato psyllid)); Ostrinia spp. (e.g. O. armigera (American bollworm)); Earias spp. (e.g. E. vittella nubilalis (European corn borer)); Conoderus spp. (e.g. C. (spotted bollworm)); Heliothis spp. (e.g. H. virescens (to falli (Southern potato wireworm), or C. vespertinus (tobacco bacco budworm)); Spodoptera spp. (e.g. S. exigua (beet wireworm)); and Phthorinaea spp. (e.g. P. operculella (po armyworm)); Anthonomus spp. (e.g. A. grandis (boll wee tato tuberworm)); in another embodiment the present inven vil)); Pseudatomoscelis spp. (e.g. P. seriatus (cotton fleahop tion extends to methods as described herein, wherein the plant per)); Trialeurodes spp. (e.g. T. abutiloneus (banded-winged is tomato and the target gene is a gene from an insect selected whitefly) T. vaporariorum (greenhouse whitefly)); Bemisia from the group consisting of Macrosiphum spp. (e.g. M. spp. (e.g. B. argentifolii (silverleaf whitefly)); Aphis spp. (e.g. euphorbiae (potato aphid)); Myzus spp. (e.g. M. persicae A. gossypii (cotton aphid)); Lygus spp. (e.g. L. lineolaris (greenpeach aphid)); Trialeurodes spp. (e.g. T. vaporariorum (tarnished plant bug) or L. hesperus (western tarnished plant (greenhouse whitefly), or T. abutilonia (banded-winged bug)); Euschistus spp. (e.g. E. conspersus (consperse Stink whitefly)); Bemisia spp. (e.g. B. argentifolii (silverleaf white bug)); Chlorochroa spp. (e.g. C. sayi (Say Stinkbug)); Nezara fly)); Frankliniella spp. (e.g. F. Occidentalis (western flower spp. (e.g. N. viridula (green Stinkbug)); Thrips spp. (e.g. T. thrips)); Leptinotarsa spp. (e.g. L. decemlineata (Colorado tabaci (onion thrips)): Franklinkiella spp. (e.g. F. fisca (to potato beetle), L. juncta (false potato beetle), or L. texana bacco thrips), or F. Occidentalis (western flower thrips)); Mel (Texan false potato beetle)); Epitrix spp. (e.g. E. hirtipennis anoplus spp. (e.g. M. femurrubrum (redlegged grasshopper), (flea beetle)); Lygus spp. (e.g. L. lineolaris (tarnished plant or M. differentialis (differential grasshopper)); and Tetrany bug), or L. hesperus (western tarnished plant bug)); Euschis chus spp. (e.g. T. cinnabarinus (carmine spider mite), or T. tus spp. (e.g. E. conspresus (consperse Stinkbug)); Nezara urticae (twospotted spider mite)); in another embodiment the spp. (e.g. N. viridula (Southern green Stinkbug)); Thyanta spp. present invention extends to methods as described herein, (e.g. T. pallidovirens (redshouldered stinkbug)); Phthori wherein the plant is rice and the target gene is a gene from an maea spp. (e.g. P. operculella (potato tuberworm)); Helicov insect selected from the group consisting of Nilaparvata spp. erpa spp. (e.g. H. Zea (tomato fruitworm); Keiferia spp. (e.g. (e.g. N. lugens (brown planthopper)); Laodelphax spp. (e.g. K. lycopersicella (tomato pinworm)); Spodoptera spp. (e.g. S. L. Striatellus (Small brown planthopper)); Nephotettix spp. exigua (beet armyworm), or S. praefica (western yellow (e.g. N. virescens or N. cincticeps (green leafhopper), or N. striped armyworm)); Limonius spp. (wireworms); Agrotis nigropictus (rice leafhopper)); Sogatella spp. (e.g. S. furcifera spp. (e.g. A. ipsilon (black cutworm)); Manduca spp. (e.g. M. (white-backed planthopper)); Blissus spp. (e.g. B. leucop sexta (tobacco hornworm), or M. quinquemaculata (tomato terus leucopterus (chinch bug)); Scotinophora spp. (e.g. S. hornworm)); Liriomyza spp. (e.g. L. sativae, L. trifoli or L. vermidulate (rice blackbug)); Acrosternum spp. (e.g. A. hilare huidobrensis (leafminer)); and Paratrioza spp. (e.g. P. cock (green Stink bug)); Parnara spp. (e.g. P. guttata (rice skip erelli (tomato psyllid); In another embodiment the present per)); Chilo spp. (e.g. C. suppressalis (rice Striped stem invention extends to methods as described herein, wherein the borer), C. auricilius (gold-fringed stem borer), or C. poly plant is corn and the target gene is a gene from an insect chrysus (dark-headed stem borer)); Chilotraea spp. (e.g. C. selected from the group consisting of Diabrotica spp. (e.g. D. polychrysa (rice stalk borer)); Sesamia spp. (e.g. S. inferens virgifera virgifera (western corn rootworm), D. barberi (pink rice borer); TrypOryza spp. (e.g. T. innotata (white rice (northern corn rootworm). D. undecimpunctata howardi borer); Tryporyza spp. (e.g.T. incertulas (yellow rice borer)); (Southern corn rootworm), D. virgifera zeae (Mexican corn Cnaphalocrocis spp. (e.g. C. medinalis (rice leafroller)); rootworm): D. balteata (banded cucumber beetle)); Ostrinia Agromyza spp. (e.g. A. oryzae (leafminer)); Diatraea spp. spp. (e.g. O. nubilalis (European corn borer)); Agrotis spp. (e.g. D. Saccharalis (Sugarcane borer)); Narnaga spp. (e.g. N. (e.g. A. ipsilon (black cutworm)); Helicoverpa spp. (e.g. H. aenescens (green rice caterpillar)); Xanthodes spp. (e.g. X. zea (cornearworm)); Spodoptera spp. (e.g. S. frugiperda (fall transverse (green caterpillar)); Spodoptera spp. (e.g. S. fru armyworm)); Diatraea spp. (e.g. D. grandiosella (Southwest giperda (fall armyworm)); Mythimna spp. (e.g. Mythinna US 2014/0373.197 A1 Dec. 18, 2014
(Pseudaletia) seperata (armyworm)); Helicoverpa spp. (e.g. 0160 or wherein said nucleic acid is an insect orthologue H. Zea (cornearworm)); Colaspis spp. (e.g. C. brunnea (grape of a gene comprising at least 17 contiguous nucleotides of any colaspis)): Lissorhoptrus spp. (e.g. L. Oryzophilus (rice water of SEQID NOs 49 to 158,275 to 472,533 to 575,621 to 767, weevil)); Echinocnemus spp. (e.g. E. squamos (rice plant 813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 2120 to weevil)); Diclodispa spp. (e.g. D. armigera (rice hispa)); 2338,2384 to 2460, or the complement thereof. Oulema spp. (e.g. O. Oryzae (leaf beetle); Sitophilus spp. (e.g. 0.161 The present invention also encompasses plants (or S. oryzae (rice weevil)); Pachydiplosis spp. (e.g. P. Oryzae reproductive or propagation material for a transgenic plant, or (rice gall midge)); Hydrellia spp. (e.g. H. griseola (Small rice a cultured transgenic plant cell) which express or are capable leafminer)); Chlorops spp. (e.g. C. Oryzae (stem maggot)); of expressing at least one of the nucleotides of the invention, and Hydrellia spp. (e.g. H. Sasakii (rice stem maggot)); for instance at least one of the nucleotide sequences repre sented in any of SEQID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 0157 Transgenic plants according to the invention extend 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183,188, 193, to all plant species specifically described above being resis 198,203,208,215, 220, 225, 230, 240 to 247, 249,251,253, tant to the respective insect species as specifically described 255, 257, 259,275 to 472, 473,478,483,488, 493,498, 503, above. Preferred transgenic plants (or reproductive or propa 508 to 513,515,517,519, 521, 533 to 575, 576, 581,586, gation material for a transgenic plant, or a cultured transgenic 591,596,601, 603, 605, 607, 609, 621 to 767, 768, 773,778, plant cell) are plants (or reproductive or propagation material 783,788, 793, 795, 797, 799,801, 813 to 862, 863, 868,873, for a transgenic plant, or a cultured transgenic plant cell) 878, 883, 888,890, 892, 894, 896,908 to 1040, 1041, 1046, wherein said plant comprises a nucleic acid sequence which 1051, 1056, 1061, 1066 to 1071, 1073, 1075, 1077, 1079, is selected from the group comprising: 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 0158 (i) sequences which are at least 75% identical to a 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, sequence represented by any of SEQID NOs 1, 3, 5, 7, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 225, 230, 247, 249,251,253,255, 257, 259,275 to 472, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 473, 478,483,488, 493, 498, 503, 513,515, 517,519, 2055, 2060, 2065,2070,2075,2080,2085, 2090,2095, 2100, 521,533 to 575, 576,581,586,591,596,601, 603, 605, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 607, 609, 621 to 767, 768,773,778,783,788, 793, 795, 2354, 2359, 2364, 2366, 2368, 2370, 2372,2384 to 2460, 797, 799,801, 813 to 862,863,868,873, 878,883,888, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, thereof, or comprising a fragment thereof comprising at least 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 17, preferably at least 18, 19, 20 or 21, more preferably at 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, least 22, 23 or 24 nucleotides. 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 0162 The plant may be provided in a form wherein it is 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, actively expressing (transcribing) the double-stranded RNA 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, in one or more cells, cell types or tissues. Alternatively, the 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, plant may be “capable of expressing, meaning that it is 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to transformed with a transgene which encodes the desired 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070,2075, dsRNA but that the transgene is not active in the plant when 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106,2108, (and in the form in which) the plant is supplied. 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 0163 Therefore, according to another embodiment, a 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, recombinant DNA construct is provided comprising the 2471,2476 or 2481, or the complement thereof, and nucleotide sequence encoding the dsRNA or dsRNA con 0159 (ii) sequences comprising at least 17 contiguous struct according to the present invention operably linked to at nucleotides of any of SEQID NOs 1, 3, 5, 7, 9, 11, 13, least one regulatory sequence. Preferably, the regulatory 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, sequence is selected from the group comprising constitutive 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, promoters or tissue specific promoters as described below. 247, 249,251,253,255,257, 259,275 to 472, 473,478, 0164. The target gene may be any target gene herein 483,488, 493,498, 503,513,515,517,519,521,533 to described. Preferably the regulatory element is a regulatory 575, 576,581,586,591, 596, 601, 603, 605, 607, 609, element that is active in a plant cell. More preferably, the 621 to 767, 768,773,778,783,788,793,795, 797, 799, regulatory element is originating from a plant. The term 801, 813 to 862, 863, 868,873, 878,883, 888,890, 892, “regulatory sequence' is to be taken in a broad context and 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, refers to a regulatory nucleic acid capable of effecting expres 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, sion of the sequences to which it is operably linked. 1089, 1091, 1093, 1095, 1097,1099, 1101, 1103, 1105, 0.165 Encompassed by the aforementioned term are pro 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, moters and nucleic acids or synthetic fusion molecules or 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, derivatives thereof which activate or enhance expression of a 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, nucleic acid, so called activators or enhancers. The term 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, “operably linked as used herein refers to a functional linkage 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, between the promoter sequence and the gene of interest, Such 2045, 2050, 2055, 2060, 2065, 2070,2075, 2080, 2085, that the promoter sequence is able to initiate transcription of 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to the gene of interest. 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 0166 By way of example, the transgene nucleotide 2370, 2372,2384 to 2460, 2461, 2466, 2471, 2476 or sequence encoding the double-stranded RNA could be placed 2481, or the complement thereof, under the control of an inducible or growth or developmental US 2014/0373.197 A1 Dec. 18, 2014 stage-specific promoter which permits transcription of the (ST-LS1) protein (Zaidi M. A. et al., 2005 Transgenic Res. dsRNA to be turned on, by the addition of the inducer for an 14:289-98), stem-regulated, defense-inducible genes, such as inducible promoter or when the particular stage of growth or JAS promoters (patent publication no. 2005.0034.192/US development is reached. A1). An example of a flower-specific promoter is for instance, 0167 Alternatively, the transgene encoding the double the chalcone synthase promoter (Faktor O. et al. 1996 Plant stranded RNA is placed under the control of a strong consti Mol. Biol. 32: 849) and an example of a fruit-specific pro tutive promoter Such as any selected from the group compris moter is for instance RJ39 from strawberry (WO 98.31812). ing the CaMV35S promoter, doubled CaMV35S promoter, 0171 In yet other embodiments of the present invention, ubiquitin promoter, actin promoter, rubisco promoter, GOS2 other promoters useful for the expression of dsRNA are used promoter, Figwort mosaic viruse (FMV) 34S promoter, cas and include, but are not limited to, promoters from an RNA sava vein mosaic virus (CsVMV) promoter (Verdaguer B. et Poll, an RNA PolII, an RNA PolIII, T7 RNA polymerase or al, Plant Mol Biol. 199837(6):1055-67). SP6 RNA polymerase. These promoters are typically used for 0168 Alternatively, the transgene encoding the double in vitro-production of dsRNA, which dsRNA is then included stranded RNA is placed under the control of a tissue specific in an antiinsecticidal agent, for example, in an anti-insecti promoter Such as any selected from the group comprising root cidal liquid, spray or powder. specific promoters of genes encoding PsMTA Class III chiti 0172. Therefore, the present invention also encompasses a nase, photosynthetic tissue-specific promoters such as pro method for generating any of the double-stranded RNA or moters of cab1 and cab2, rbcS, gap A, gapB and ST-LS1 RNA constructs of the invention. This method comprises the proteins, JAS promoters, chalcone synthase promoter and steps of promoter of RJ39 from strawberry. 0173 a. contacting an isolated nucleic acid or a recom 0169. In another embodiment, the transgene encoding the binant DNA construct of the invention with cell-free double-stranded RNA is placed under the control of an insect components; or induced promoter, for instance the potato proteinase inhibitor 0.174 b. introducing (e.g. by transformation, transfec II (PinII) promoter (Duan X et al. Nat Biotechnol. 1996, tion or injection) an isolated nucleic acid or a recombi 14(4):494-8)); or a wounding, induced promoter, for instance nant DNA construct of the invention in a cell, the jasmonates and ethylene induced promoters, PDF1.2 pro 0.175 under conditions that allow transcription of said moter (Manners J Metal. Plant Mol Biol. 1998, 38(6):1071 nucleic acid or recombinant DNA construct to produce the 80); or under a defense related promoter, for instance the dsRNA or RNA construct. salicylic acid induced promoters and plant-pathogenesis 0176 Optionally, one or more transcription termination related protein (PR protein) promoters (PR1 promoter (Cor sequences may also be incorporated in the recombinant con nelissen B J et al., Nucleic Acids Res. 1987, 15(17):6799 struct of the invention. The term “transcription termination 811; COMT promoter (Toquin Vetal, Plant Mol Biol. 2003, sequence' encompasses a control sequence at the end of a 52(3):495-509). transcriptional unit, which signals 3' processing and poly 0170 Furthermore, when using the methods of the present adenylation of a primary transcript and termination of tran invention for developing transgenic plants resistant against Scription. Additional regulatory elements, such as transcrip insects, it might be beneficial to place the nucleic acid encod tional or translational enhancers, may be incorporated in the ing the double-stranded RNA according to the present inven expression construct. tion under the control of a tissue-specific promoter. In order to improve the transfer of the dsRNA from the plant cell to the 0177. The recombinant constructs of the invention may pest, the plants could preferably express the dsRNA in a plant further include an origin of replication which is required for part that is first accessed or damaged by the plant pest. In case maintenance and/or replication in a specific cell type. One of plant pathogenic insects, preferred tissues to express the example is when an expression construct is required to be dsRNA are the leaves, stems, roots, and seeds. Therefore, in maintained in a bacterial cell as an episomal genetic element the methods of the present invention, a plant tissue-preferred (e.g. plasmid or cosmid molecule) in a cell. Preferred origins promoter may be used, such as a leaf-specific promoter, a of replication include, but are not limited to, fl-ori and colE1 stem-specific promoter, a phloem-specific promoter, a O1 Xylem-specific promoter, a root-specific promoter, or a seed 0.178 The recombinant construct may optionally com specific promoter (Sucrose transporter gene AtSUC promoter prise a selectable marker gene. As used herein, the term (Baud Set al., Plant J. 2005, 43(6):824-36), wheat high 'selectable marker gene' includes any gene, which confers a molecular weight glutenin gene promoter (Robert L S et al., phenotype on a cell in which it is expressed to facilitate the Plant Cell. 1989, 1(6):569-78.)). Suitable examples of a root identification and/or selection of cells, which are transfected specific promoter are PsMTA (Fordam-Skelton, A. P. et al., or transformed, with an expression construct of the invention. 1997 Plant Molecular Biology 34:659-668.) and the Class III Examples of suitable selectable markers include resistance Chitinase promoter. Examples of leaf- and stem-specific or genes againstampicillin (Ampr), tetracycline (Tcr), kanamy photosynthetic tissue-specific promoters that are also photo cin (Kanr), phosphinothricin, and chloramphenicol (CAT) activated are promoters of two chlorophyll binding proteins gene. Other Suitable marker genes provide a metabolic trait, (cab1 and cab2) from sugar beet (Stahl D.J., et al., 2004 BMC for example man A. Visual marker genes may also be used and Biotechnology 2004 4:31), ribulose-bisphosphate carboxy include for example beta-glucuronidase (GUS), luciferase lase (Rubisco), encoded by rbcS (Nomura M. et al., 2000 and Green Fluorescent Protein (GFP). Plant Mol. Biol. 44:99-106), A (gapA) and B (gapB) subunits (0179 Plants that have been stably transformed with a of chloroplast glyceraldehyde-3-phosphate dehydrogenase transgene encoding the dsRNA may be supplied as seed, (Conley T. R. et al. 1994 Mol. Cell Biol. 19:2525-33; Kwon reproductive material, propagation material or cell culture H. B. et al. 1994 Plant Physiol. 105:357-67), promoter of the material which does not actively express the dsRNA but has Solanum tuberosum gene encoding the leaf and stem specific the capability to do so. US 2014/0373.197 A1 Dec. 18, 2014
0180 Accordingly, the present invention encompasses a 257, 259,275 to 472, 473,478,483,488, 493,498, 503, 508 plant (e.g. a rice plant), or a seed (e.g. a rice seed), or a cell to 513,515,517,519, 521,533 to 575, 576,581,586, 591, (e.g. a bacterial or plant cell), comprising at least one double 596,601, 603, 605, 607, 609, 621 to 767, 768, 773,778,783, stranded RNA or at least one double-stranded RNA construct 788, 793, 795, 797,799,801, 813 to 862, 863, 868,873, 878, as described herein: or at least one nucleotide sequence or at 883, 888,890, 892, 894, 896,908 to 1040, 1041, 1046, 1051, least one recombinant DNA construct as descrobed herein; or 1056, 1061, 1066 to 1071, 1073, 1075, 1077, 1079, 1081, at least one plant cell as described herein. The present inven 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097,1099, 1101, tion also encompasses a plant (e.g. an alfalfa, apple, apricot, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, artichoke, asparagus, avocado, banana, barley, beans, beet, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, blackberry, blueberry, broccoli, brussel sprouts, cabbage, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, canola, carrot, cassava, cauliflower, a cereal, celery, cherry, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, citrus, clemintine, coffee, corn, cotton, cucumber, eggplant, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, endive, eucalyptus, figes, grape, grapefruit, groundnuts, 2060,2065, 2070,2075,2080,2085, 2090, 2095, 2100,2102, ground cherry, kiwifruit, lettuce, leek, lemon, lime, pine, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, maize, mango, melon, millet, mushroom, nutaot, okra, onion, 2359, 2364, 2366, 2368, 2370, 2372,2384 to 2460, 2461, orange, an ornamental plant or flower or tree, papaya, parsley, 2466,2471,2476,2481 or 2486, or comprising at least 14, 15, pea, peach, peanut, peat, pepper, persimmon, pineapple, plan 16, 17, 18, 19, 20, 21, 22 etc. up to all nucleotides of the tain, plum, pomegranate, potato, pumpkin, radicchio, radish, sequence of an orthologous nucleic acid molecule from a rapeseed, raspberry, rice, rye, Sorghum, Soy, soybean, spin different target species. Many vectors are available for this ach, Strawberry, Sugarbeet, Sugargcane, Sunflower, Sweet purpose, and selection of the appropriate vector will depend potato, tangerine, tea, tobacco, tomato, a vine, watermelon, mainly on the size of the nucleic acid to be inserted into the wheat, yams or Zucchini plant; preferably a potato, eggplant, vector and the particular host cell to be transformed with the tomato, pepper, tobacco, ground cherry, rice corn or cotton Vector. plant), or a seed or tuber (e.g. an alfalfa, apple, apricot, arti 0183 General techniques for expression of exogenous choke, asparagus, avocado, banana, barley, beans, beet, double-stranded RNA in plants for the purposes of RNAi are blackberry, blueberry, broccoli, brussel sprouts, cabbage, known in the art (see Baulcombe D, 2004, Nature. 431(7006): canola, carrot, cassava, cauliflower, a cereal, celery, cherry, 356–63. RNA silencing in plants, the contents of which are citrus, clemintine, coffee, corn, cotton, cucumber, eggplant, incorporated herein by reference). More particularly, meth endive, eucalyptus, figes, grape, grapefruit, groundnuts, ods for expression of double-stranded RNA in plants for the ground cherry, kiwifruit, lettuce, leek, lemon, lime, pine, purposes of down-regulating gene expression in plant pests maize, mango, melon, millet, mushroom, nutaot, okra, onion, Such as nematodes or insects are also known in the art. Similar orange, an ornamental plant or flower or tree, papaya, parsley, methods can be applied in an analogous manner in order to pea, peach, peanut, peat, pepper, persimmon, pineapple, plan express double-stranded RNA in plants for the purposes of tain, plum, pomegranate, potato, pumpkin, radicchio, radish, down-regulating expression of a target gene in a plant patho rapeseed, raspberry, rice, rye, Sorghum, Soy, soybean, spin genic insect. In order to achieve this effect it is necessary only ach, Strawberry, Sugarbeet, Sugargcane, Sunflower, Sweet for the plant to express (transcribe) the double-stranded RNA potato, tangerine, tea, tobacco, tomato, a vine, watermelon, in a part of the plant which will come into direct contact with wheat, yams or Zucchini plant; preferably a potato, eggplant, the insect, such that the double-stranded RNA can be taken up tomato, pepper, tobacco, ground cherry, rice, corn or cotton by the insect. Depending on the nature of the insect and its seed or tuber), or a cell (e.g. a bacterial or plant cell), com relationship with the host plant, expression of the dsRNA prising at least one double-stranded RNA or at least one could occur within a cell or tissue of a plant within which the double-stranded RNA construct as described herein: or at insect is also present during its life cycle, or the RNA may be least one nucleotide sequence or at least one recombinant secreted into a space between cells, such as the apoplast, that DNA construct as descrobed herein. Preferably, these plants is occupied by the insect during its life cycle. Furthermore, or seeds or cells comprise a recombinant construct wherein the dsRNA may be located in the plant cell, for example in the the nucleotide sequence encoding the dsRNA or dsRNA con cytosol, or in the plant cell organelles Such as a chloroplast, struct according to the present invention is operably linked to mitochondrion, vacuole or endoplastic reticulum. at least one regulatory element as described above. 0.184 Alternatively, the dsRNA may be secreted by the 0181. The plant may be provided in a form wherein it is plant cell and by the plant to the exterior of the plant. As such, actively expressing (transcribing) the RNA molecule in one the dsRNA may form a protective layer on the surface of the or more cells, cell types or tissues. Alternatively, the plant plant. may be "capable of expressing, meaning that it is trans 0185. In a further aspect, the invention also provides com formed with a transgene which encodes the desired RNA binations of methods and compositions for preventing or molecule but that the transgene is not active in the plant when protecting plants from pest infestation. For instance, one (and in the form in which) the plant is supplied. means provides using the plant transgenic approach combin 0182. In one particular embodiment, there is provided a ing methods using expression of dsRNA molecules and meth recombinant (expression) construct for expression of an RNA ods using expression of Such Bt insecticidal proteins. molecule in a plant or in a plant cell comprising at least one 0186 Therefore the invention also relates to a method or a regulatory sequence operably linked to a nucleic acid mol plant cell or plant described herein, wherein said plant cellor ecule comprising at least 14, 15, 16, 17, 18, 19, 20, 21, 22 etc. plant expressing said RNA molecule comprises or expresses nucleotides, up to all of the nucleotides of the sequence set a pesticidal agent selected from the group consisting of a forth as SEQID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, patatin, a Bacillus thuringiensis insecticidal protein, a 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, Xenorhabdus insecticidal protein, a Photorhabdus insecti 203, 208, 215, 220, 225, 230, 240 to 247, 249, 251, 253, 255, cidal protein, a Bacillus laterosporous insecticidal protein, US 2014/0373.197 A1 Dec. 18, 2014
and a Bacillus sphearicus insecticidal protein. Preferably said 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372,2384 to Bacillus thuringiensis insecticidal protein is selected from the 2460, 2461,2466, 2471,2476,2481 or 2486, or the comple group consisting of a Cry 1, a Cry3, a TIC851, a CryET170, a ment thereof. Cry22, a binary insecticidal protein CryET33 and CryET34, 0189 According to a still further embodiment, the present a binary insecticidal protein CryET80 and CryET76, a binary invention extends to a method for increasing plant yield com insecticidal protein TIC 100 and TIC 101, and a binary insec prising introducing in a plant any of the nucleotide sequences ticidal protein PS149B1. or recombinant DNA constructs as herein described in an expressible format. Plants encompassed by this method areas 0187. In a further embodiment, the invention relates to a described earlier. composition for controlling insect growth and/or preventing 0190. The invention will be further understood with refer or reducing insect infestation, comprising at least a plant part, ence to the following non-limiting examples. plant cell, plant tissue or seed comprising at least one double stranded RNA, wherein said double-stranded RNA com BRIEF DESCRIPTION OF FIGURES AND prises annealed complementary strands, one of which has a TABLES nucleotide sequence which is complementary to at least part (0191 FIG. 1-LD: Survival of L. decemlineata on artificial of a nucleotide sequence of an insect target gene. Optionally, diet treated with dsRNA. Insects of the second larval stage the composition further comprises at least one suitable car were fed diet treated with 50 ul of topically-applied solution rier, excipient or diluent. The target gene may be any target of dsRNA (targets or gfp control). Diet was replaced with gene described herein. Preferably the insect target gene is fresh diet containing topically-applied dsRNA after 7 days. essential for the viability, growth, development or reproduc The number of Surviving insects were assessed at days 2, 5, 7, tion of the insect. 8, 9, & 13. The percentage of surviving larvae was calculated 0188 In another aspect the invention relates to a compo relative to day 0 (start of assay). Target LD006: (SEQID NO sition as described above, wherein the insect target gene 178); Target LD007 (SEQID NO 183); Target LD010 (SEQ comprises a sequence which is at least 75%, preferably at ID NO 188); Target LD011 (SEQID NO 193); Target LD014 least 80%, 85%, 90%, more preferably at least 95%, 98% or (SEQID NO 198); gfp dsRNA (SEQID NO 235). 99% identical to a sequence selected from the group of 0.192 FIG.2-LD: Survival of L. decemlineata on artificial sequences represented by any of SEQID NOs 1, 3, 5, 7, 9, 11, diet treated with dsRNA. Insects of the second larval stage 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, were fed diet treated with 50 ul of topically-applied solution 183,188, 193, 198,203,208,215, 220, 225, 230, 240 to 247, of dsRNA (targets or gfp control). Diet was replaced with 249,251,253,255,257, 259,275 to 472, 473,478,483,488, fresh diet only after 7 days. The number of surviving insects 493, 498, 503, 508 to 513,515, 517,519, 521,533 to 575, was assessed at days 2, 5, 6, 7, 8, 9, 12, & 14. The percentage 576,581,586,591,596,601, 603, 605, 607, 609, 621 to 767, of surviving larvae was calculated relative to day 0 (start of 768,773,778,783,788,793,795, 797, 799,801, 813 to 862, assay). Target LD001 (SEQID NO 163): Target LD002 (SEQ 863, 868,873, 878,883,888,890, 892,894, 896,908 to 1040, ID NO 168); Target LD003 (SEQID NO 173); Target LD015 1041, 1046, 1051, 1056, 1061, 1066 to 1071, 1073, 1075, (SEQ ID NO 215); Target LD016 (SEQ ID NO 220); gfp 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, dsRNA (SEQ ID NO 235). 1097,1099, 1101, 1103, 1105,1107, 1109, 1111, 1113, 1161 0193 FIG.3-LD: Average weight of L. decemlineata lar to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, vae on potato leaf discs treated with dsRNA. Insects of the 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, second larval stage were fed leaf discs treated with 20 ul of a 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, topically-applied solution (10 ng/ul) of dsRNA (target LD002 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, or gfp). After two days the insects were transferred on to 2045, 2050,2055, 2060, 2065,2070,2075,2080,2085, 2090, untreated leaves every day. 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 0194 FIG. 4-LD: Survival of L. decemlineata on artificial 2344, 2349, 2354, 2359, 2364,2366, 2368,2370, 2372,2384 diet treated with shorter versions of target LD014 dsRNA and to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the concatemer dsRNA. Insects of the second larval stage were complement thereof, or wherein said insect target gene is an fed diet treated with 50 ul of topically-applied solution of insect orthologue of a gene comprising at least 17 contiguous dsRNA (gfportargets). The number of surviving insects were nucleotides of any of SEQID NOs 1,3,5,7,9,11, 13, 15, 17, assessed at days 3, 4, 5, 6, & 7. The percentage of Surviving 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, larvae were calculated relative to day 0 (start of assay). 193, 198,203,208,215, 220, 225, 230, 240 to 247, 249, 251, (0195 FIG. 5-LD: Survival of L. decemlineata larvae on 253,255, 257, 259,275 to 472, 473,478,483,488, 493,498, artificial diet treated with different concentrations of dsRNA 503, 508 to 513,515, 517,519, 521, 533 to 575, 576, 581, of target LD002(a), target LD007 (b), target LD010(c), target 586,591,596,601, 603, 605, 607, 609, 621 to 767, 768, 773, LD011 (d), target LD014 (e), target LD015 (f). LD016 (g) and 778, 783,788,793,795, 797, 799,801, 813 to 862, 863, 868, target LD027 (h). Insects of the second larval stage were fed 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, diet treated with 50 ul of topically-applied solution of 1046, 1051, 1056, 1061, 1066 to 1071, 1073, 1075, 1077, dsRNA. Diet was replaced with fresh diet containing topi 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, cally-applied dsRNA after 7 days. The number of surviving 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to insects were assessed at regular intervals. The percentage of 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, surviving larvae were calculated relative to day 0 (start of 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, assay). 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 0.196 FIG. 6-LD. Survival of L. decemlineata adults on 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, potato leaf discs treated with dsRNA. Young adult insects 2050,2055, 2060,2065, 2070,2075,2080,2085,2090,2095, were fed double-stranded-RNA-treated leaf discs for the first 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, two days and were then placed on untreated potato foliage. US 2014/0373.197 A1 Dec. 18, 2014 20
The number of Surviving insects were assessed regularly; were transferred onto fresh dsRNA-treated leaf discs. After a mobile insects were recorded as insects which were alive and further 24 hours, adults from one treatment were collected appeared to move normally; moribund insects were recorded and placed in a plastic box containing potted fresh untreated as insects which were alive but appeared sick and slow mov whole bean plants. The insects were assessed for mortality at ing these insects were not able to right themselves once days 4, 5, 6, 7, 8, & 11. The percentage of Surviving adults was placed on their backs. Target LD002 (SEQ ID NO 168); calculated relative to day 0 (start of assay). Target 10: SEQID Target LD010 (SEQID NO 188); Target LD014 (SEQID NO NO 586; target 15: SEQ ID NO 591; target 16: SEQID NO 198); Target LD016 (SEQID NO 220); gfp dsRNA (SEQID 596: gfp dsRNA: SEQ ID NO 235. (b) Resistance to bean NO 235). foliar damage caused by adults of the E. varivestis by dsRNA. 0.197 FIG. 7-LD. Mortality and growth/developmental Whole plants containing insects from one treatment (see (a)) delay of larval survivors of the Colorado potato beetle, Lep were checked visually for foliar damage on day 9. (i) target tinotarsa decemlineata, on transgenic potato plants. Seven 10; (ii) target 15; (iii) target 16; (iv) gfp dsRNA; (v) untreated. CPB L1 larvae were fed on transgenic potato siblings har 0202 FIG. 1-TC: Survival of T. castaneum larvae on arti bouring LD002 construct (O), empty vector (A), or wildtype ficial diet treated with dsRNA of target 14. Neonate larvae line V plants () for seven days. Mortality is expressed in were fed diet based on a flour/milk mix with 1 mg dsRNA percentage and average larval weight in mg. target 14. Control was water (without dsRNA) in diet. Four (0198 FIG. 1-PC: Effects of ingested target dsRNAs on replicates of 10 first instar larvae per replicate were per survival and growth of P. cochleariae larvae. Neonate larvae formed for each treatment. The insects were assessed for were fed oilseed rape leaf discs treated with 25ul of topically Survival as average percentage means at days 6, 17.31, 45 and applied solution of 0.1 ug/ul dsRNA (targets orgfp control). 60. The percentage of surviving larvae was calculated relative After 2 days, the insects were transferred onto fresh dsRNA to day 0 (start of assay). Error bars represent standard devia treated leaf discs. At day 4, larvae from one replicate for every tions. Target TC014: SEQID NO 878. treatment were collected and placed in a Petridish containing (0203 FIG. 1-MP: Effect of ingested target 27 dsRNA on fresh untreated oilseed rape foliage. The insects were the Survival of Myzus persicae nymphs. First instars were assessed at days 2, 4, 7, 9 & 11. (a) Survival of E. varivestis placed in feeding chambers containing 50 ul of liquid diet larvae on oilseed rape leaf discs treated with dsRNA. The with 2 ug/ul dsRNA (target 27 or gfp dsRNA control). Per percentage of Surviving larvae was calculated relative to day treatment, 5 feeding chambers were set up with 10 instars in 0 (start of assay). (b) Average weights of P. cochleariae larvae each feeding chamber. Number of survivors were assessed at on oilseed rape leaf discs treated with dsRNA. Insects from 8 days post start of bioassay. Error bars represent standard each replicate were weighed together and the average weight deviations. Target MP027: SEQ ID NO 1061; gfp dsRNA: per larva determined. Error bars represent standard devia SEQID NO 235. tions. Target 1: SEQID NO 473; target 3: SEQID NO 478: 0204 FIG. 1-NL: Survival of Nilaparvata lugens on liquid target 5: SEQID NO 483; target 10: SEQID NO 488; target artificial diet treated with dsRNA. Nymphs of the first to 14: SEQ ID NO 493; target 16: SEQID NO 498; target 27: second larval stage were fed diet Supplemented with 2 mg/ml SEQID NO 503;gfp dsRNA: SEQID NO 235. solution of dsRNA targets in separate bioassays: (a) NL002, (0199 FIG. 2-PC: Survival of P. cochleariae on oilseed NL003, NL005, NL010; (b) NL009, NL016; (c) NL014, rape leaf discs treated with different concentrations of dsRNA NL018; (d) NL013, NL015, NL021. Insect survival on targets of (a) target PC010 and (b) target PC027. Neonate larvae were were compared to diet only and diet with gfp dsRNA control placed on leaf discs treated with 25 ul of topically-applied at same concentration. Diet was replaced with fresh diet con solution of dsRNA. Insects were transferred to fresh treated taining dsRNA every two days. The number of surviving leaf discs at day 2. At day 4 for target PC010 and day 5 for insects were assessed every day target PCO27, the insects were transferred to untreated leaves. 0205 FIG.2-NL: Survival of Nilaparvata lugens on liquid The number of Surviving insects were assessed at days 2, 4, 7. artificial diet treated with different concentrations of target 8, 9 & 11 for PC010 and 2, 5, 8, 9 & 12 for PCO27. The dsRNA NL002. Nymphs of the first to second larval stage percentage of Surviving larvae was calculated relative to day were fed diet supplemented with 1, 0.2,0.08, and 0.04 mg/ml 0 (start of assay). (final concentration) of NL002. Diet was replaced with fresh 0200 FIG. 1-EV: Survival of E. varivestis larvae on bean diet containing dsRNA every two days. The numbers of sur leaf discs treated with dsRNA. Neonate larvae were fed bean viving insects were assessed every day. leaf discs treated with 25ul of topically-applied solution of 1 ug/ul dsRNA (targets orgfp control). After 2 days, the insects EXAMPLES were transferred onto fresh dsRNA-treated leaf discs. At day 4, larvae from one treatment were collected and placed in a Example 1 plastic box containing fresh untreated bean foliage. The insects were assessed for mortality at days 2, 4, 6, 8 & 10. The Silencing C. elegans Target Genes in C. elegans in percentage of Surviving larvae was calculated relative to day High Throughput Screening 0 (start of assay). Target 5: SEQID NO 576; target 10: SEQID 0206 A. C. elegans genome wide library was prepared in NO 586; target 15: SEQ ID NO 591; target 16: SEQID NO the pGN9A vector (WO 01/88121) between two identical 596; gfp dsRNA: SEQID NO 235. T7-promoters and terminators, driving its expression in the 0201 FIG. 2-EV: Effects of ingested target dsRNAs on sense and antisense direction upon expression of the T7 poly Survival of E. varivestis adults and resistance to Snap bean merase, which was induced by IPTG. foliar insect damage. (a) Survival of E. varivestis adults on 0207. This library was transformed into the bacterial strain bean leaf treated with dsRNA. Adults were fed bean leaf discs A13301-105 (DE3) in 96 well plate format. For the genome treated with 75 ul of topically-applied solution of 0.1 ug/ul wide screening, these bacterial cells were fed to the nuclease dsRNA (targets or gfp control). After 24 hours, the insects deficient C. elegans nuc-1 (e1392) strain. US 2014/0373.197 A1 Dec. 18, 2014
0208 Feeding the dsRNA produced in the bacterial strain for 2 days. At the adult stage, 1 adult worm was singled and A13301-105 (DE3), to C. elegans nuc-1 (e1392) worms, was incubated at 25°C. for 2 days for inspection of its progeny. performed in a 96 well plate format as follows: nuc-1 eggs The other adult worms are inspected in situ on the original 24 were transferred to a separate plate and allowed to hatch well plate. These experiments were performed in quadrupli simultaneously at 20° C. for synchronization of the L1 gen Cate. eration. 96 well plates were filled with 100 uL liquid growth 0219. This detailed phenotypic screen was repeated with a medium comprising IPTG and with 10 uL bacterial cell cul second batch of worms, the only difference being that the ture of OD1 A13301-105 (DE3) of the C. elegans dsRNA worms of the second batch were incubated at 20 C for 3 days. library carrying each a vector with a C. elegans genomic 0220. The phenotype of the worms fed with C. elegans fragment for expression of the dsRNA. To each well, 4 of the dsRNA was compared to the phenotype of C. elegans nuc-1 synchronized L1 worms were added and were incubated at (e1392) worms fed with the empty vector. 25° C. for at least 4 to 5 days. These experiments were 0221 Based on this experiment, it was concluded that performed in quadruplicate. In the screen 6 controls were silencing the C. elegans target genes as represented in Table used: 1A had a fatal effect on the growth and viability of the worm (0209 pGN29-negative control, wild type and that the target gene is essential to the viability of nema 0210 pGZ1 unc-22=twitcher phenotype todes. Therefore these genes are good target genes to control 0211 pGZ18-chitin synthase-embryonic lethal (kill or prevent from growing) nematodes via dsRNA medi 0212 pGZ25-pos-1=embryonic lethal ated gene silencing. Accordingly, the present invention 0213 pGZ59=bli-4D-acute lethal encompasses the use of nematode orthologues of the above C. 0214 ACC-acetyl co-enzym A carboxylase-acute elegans target gene, to control nematode infestation, such as lethal nematode infestation of plants. 0215. After 5 days, the phenotype of the C. elegans nuc-1 (e1392) worms fed with the bacteria producing dsRNA were Example 2 compared to the phenotype of worms fed with the empty vector (pGN29) and the other controls. The worms that were Identification of D. melanogaster Ortholoques fed with the dsRNA were screened for lethality (acute or larval) lethality for the parent (Po) generation, (embryonic) 0222. As described above in Example 1, numerous C. elegans lethal sequences were identified and can be used for lethality for the first filial (F1) generation, or for growth identifying orthologues in other species and genera. For retardation of Po as follows: (i) Acute lethality of Po: L1's example, the C. elegans lethal sequences can be used to have not developed and are dead, this phenotype never gives identify orthologous D. melanogasters sequences. That is, progeny and the well looks quite empty; (ii) (Larval) lethality each C. elegans sequence can be queried against a public of Po: Po died in a later stage than L1, this phenotype also database. Such as GenBank, for orthologous sequences in D. never gives progeny. Dead larvae or dead adult worms are melanogaster. Potential D. melanogaster orthologues were found in the wells; (iii) Lethality for F1: L1s have developed selected that share a high degree of sequence homology (E until adult stage and are still alive. This phenotype has no value preferably less than or equal to 1 E-30) and the progeny. This can be due to sterility, embryonic lethality sequences are blast reciprocal best hits, the latter means that (dead eggs on the bottom of well), embryonic arrest or larval the sequences from different organisms (e.g. C. elegans and arrest (eventually ends up being lethal): (iv) Arrested in D. melanogaster) are each others top blast hits. For example, growth and growth retardation/delay: Compared to a well sequence C from C. elegans is compared against sequences in with normal development and normal # of progeny. D. melanogaster using BLAST. If sequence C has the D. 0216 For the target sequences presented in Table 1A, it melanogaster sequence Das best hit and when D is compared was concluded that dsRNA mediated silencing of the C. to all the sequences of C. elegans, also turns out to be elegans target gene in nematodes, such as C. elegans, had a sequence C, then D and C are reciprocal best hits. This crite fatal effect on the growth and viability of the worm. rium is often used to define orthology, meaning similar 0217 Subsequent to the above dsRNA silencing experi sequences of different species, having similar function. The ment, a more detailed phenotyping experiment was con D. melanogaster sequence identifiers are represented in Table ducted in C. elegans in a high throughput format on 24 well plates. The dsRNA library produced in bacterial strain 1A. AB301-105 (DE3), as described above, was fed to C. elegans Example 3 nuc-1 (e1392) worms on 24 well plates as follows: nuc-1 eggs were transferred to a separate plate and allowed to hatch simultaneously at 20 C for synchronization of the L1 genera Leptinotarsa decemlineata (Colorado Potato Beetle) tion. Subsequently 100 of the synchronized L1 worms were 0223 A. Cloning Partial Gene Sequences from Leptino soaked in a mixture of 500LL S-complete fed medium, com tarsa decemlineata prising 5 lug/mL cholesterol, 4 uL/mL PEG and 1 mM IPTG, 0224 High quality, intact RNA was isolated from 4 dif and 500 uL of bacterial cell culture of OD1 AB301-105 ferent larval stages of Leptinotarsa decemlineata (Colorado (DE3) of the C. elegans dsRNA library carrying each a vector potato beetle; source: Jeroen van Schaik, Entocare CV Biolo with a C. elegans genomic fragment for expression of the gische Gewashescherming, Postbus 162, 6700 AD Wagenin dsRNA. The soaked L1 worms were rolled for 2 hours at 25 C. gen, the Netherlands) using TRIZol Reagent (Cat. Nr. 15596 0218. After centrifugation and removal of 950 uL of the 026/15596-018, Invitrogen, Rockville, Md., USA) following Supernatant, 5 uL of the remaining and resuspended pellet the manufacturer's instructions. Genomic DNA present in the (comprising about 10 to 15 worms) was transferred in the RNA preparation was removed by DNase treatment follow middle of each well of a 24 well plate, filled with a layer of ing the manufacturers instructions (Cat. Nr. 1700, Promega). agar LB broth. The inoculated plate was incubated at 25°C. cDNA was generated using a commercially available kit (Su US 2014/0373.197 A1 Dec. 18, 2014 22 perScriptTM III Reverse Transcriptase, Cat. Nr. 18080044, and sense orientation, separated by the intron-CmR-intron, Invitrogen, Rockville, Md., USA) following the manufactur whereby CmR is the chloramphenicol resistance marker, to er's instructions. form a dsRNA hairpin construct. These hairpin constructs 0225. To isolate cDNA sequences comprising a portion of were generated using the LR recombination reaction between the LD001, LD002, LD003, LD006, LD007, LD010, LD011, an att-containing entry clone (see Example 1) and an attR LD014, LD015, LD016, LC018 and LD027 genes, a series of containing destination vector (pK7GWIWG2D(II)). The PCR reactions with degenerate primers were performed using plant vector pK7GWIWG2D(II) was obtained from the VIB/ Amplitaq Gold (Cat. Nr. N8080240, Applied Biosystems) Plant Systems Biology with a Material Transfer Agreement. following the manufacturers instructions. LR recombination reaction was performed by using LR Clo 0226. The sequences of the degenerate primers used for naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol amplification of each of the genes are given in Table 2-LD. lowing the manufacturers instructions. These cloning which displays Leptintarsa decemlineata target genes includ experiments resulted in a hairpin construct for each of the ing primer sequences and cDNA sequences obtained. These LD002, LD006, LD007, LD010, LD011, LD014 and LD016 primers were used in respective PCR reactions with the fol genes, having either the promoter—sense-intron-CmR-in lowing conditions: 10 minutes at 95° C., followed by 40 tron-antisense orientation, or promoter—antisense-intron cycles of 30 seconds at 95°C., 1 minute at 55° C. and 1 minute CmR-intron-sense orientation, and wherein the promoter is at 72°C., followed by 10 minutes at 72°C. The resulting PCR the plant operable 35S promoter. The binary vector fragments were analyzed on agarose gel, purified (QIAquick pK7GWIWG2D(II) with the 35S promoter is suitable for Gel Extraction kit, Cat. Nr. 28706, Qiagen), cloned into the transformation into A. tumefaciens. pCR8/GW/topo vector (Cat. Nr. K2500 20, Invitrogen), and 0232 For LD002 and LD010, a double digest with restric sequenced. The sequences of the resulting PCR products are tion enzymes BsoBI & PVul was done on LD002 cloned into represented by the respective SEQID NOs as given in Table pCR8/GW/topo (see Example 3A). For LD006, LD007, 2-LD and are referred to as the partial sequences. The corre LD011, LD014, LD016 and LD027, a digest with restriction sponding partial amino acid sequence are represented by the enzyme BsoBI was done on LD006 cloned into pCR8/GW/ respective SEQ ID NOs as given in Table 3-LD, where the topo (see Example 3A). The band containing the gene of start of the reading frame is indicated in brackets. interest flanked by the attl sites using Qiaquick Gel Extrac 0227 B. dsRNA Production of the Leptinotarsa decem tion Kit (Cat. Nr. 28706, Qiagen) was purified. An amount of lineata Genes 150 ng of purified fragment and 150 ng pK7GWIWG2D(II) 0228 dsRNA was synthesized in milligram amounts was added together with the LR clonase II enzyme and incu using the commercially available kit T7 RibomaxTM Express bated for at least 1 h at 25°C. After proteinase K solution RNAi System (Cat. Nr. P1700, Promega). First two separate treatment (10 min at 37° C.), the whole recombination mix single 5'T7 RNA polymerase promoter templates were gen was transformed into Top 10 chemically competent cells. erated in two separate PCR reactions, each reaction contain Positive clones were selected by restriction digest analysis. ing the target sequence in a differentorientation relative to the The complete sequence of the hairpin construct for: T7 promoter. 0233 LD002 (antisense-intron-CmR-intron-sense) is 0229. For each of the target genes, the sense T7 template set forth in SEQID NO 240; was generated using specific T7 forward and specific reverse 0234 LD006 (sense-intron-CmR-intron-antisense) is primers. The sequences of the respective primers for ampli set forth in SEQID NO 241: fying the sense template for each of the target genes are given 0235 LD007 sense-intron-CmR-intron-antisense) is in Table 8-LD. The conditions in the PCR reactions were as set forth in SEQID NO 242: follows: 4 minutes at 95° C., followed by 35 cycles of 30 0236 LD010 (antisense-intron-CmR-intron-sense) is seconds at 95°C., 30 seconds at 55° C. and 1 minute at 72°C., set forth in SEQID NO 243: followed by 10 minutes at 72°C. The anti-sense T7 template 0237 LD011 (sense-intron-CmR-intron-antisense) is was generated using specific forward and specific T7 reverse set forth in SEQID NO 244: primers in a PCR reaction with the same conditions as 0238 LD014 (sense-intron-CmR-intron-antisense) is described above. The sequences of the respective primers for set forth in SEQID NO 245; amplifying the anti-sense template for each of the target genes 0239 LD016 (antisense-intron-CmR-intron-sense) is are given in Table 8-LD. The resulting PCR products were set forth in SEQID NO 246; analyzed on agarose gel and purified by PCR purification kit 0240 LD027 (sense-intron-CmR-intron-antisense) is (Qiaquick PCR Purification Kit, Cat. Nr. 28106, Qiagen) and set forth in SEQID NO 2486. NaClO precipitation. The generated T7 forward and reverse 0241 Table 9-LD provides complete sequences for each templates were mixed to be transcribed and the resulting hairpin construct. RNA strands were annealed, DNase and RNase treated, and 0242 D. Screening dsRNA Targets Using Artificial Diet purified by Sodium acetate, following the manufacturers for Activity Against Leptinotarsa decemlineata instructions. The sense strand of the resulting dsRNA for each 0243 Artificial diet for the Colorado potato beetle was of the target genes is given in Table 8-LD. Table 8-LD dis prepared as follows (adapted from Gelman et al., 2001, J. Ins. plays sequences for preparing dsRNA fragments of Leptino Sc., Vol. 1, no. 7, 1-10): water and agar were autoclaved, and tarsa decemlineata target sequences and concatemer the remaining ingredients (shown in Table A below) were sequences, including primer sequences. added when the temperature dropped to 55° C. At this tem 0230 C. Cloning Leptinotarsa decemlineata Genes into perature, the ingredients were mixed well before the diet was Plant Vector pK7GWIWG2D(II) aliquoted into 24-well plates (Nunc) with a quantity of 1 ml of 0231 Since the mechanism of RNA interference operates diet per well. The artificial diet was allowed to solidify by through dsRNA fragments, the target nucleotide sequences of cooling at room temperature. Diet was stored at 4°C. for up the target genes, as selected above, were cloned in anti-sense to three weeks. US 2014/0373.197 A1 Dec. 18, 2014 23
TABLE A single second-larval stage CPB was placed into each well, which was then covered with tissue paper and a multiwell Ingredients for Artificial diet plastic lid. The plate containing the insects and leaf discs were Ingredients Volume for 1 L kept in an insect chamber at 28°C. with a photoperiod of 16 h light/8 h dark. The insects were allowed to feed on the leaf Water 768 mil discs for 2 days after which the insects were transferred to a agar 14 g rolled oats 40 g new plate containing fresh treated leaf discs. Thereafter, the Torula yeast 60 g insects were transferred to a plate containing untreated leaf lactalbumin hydrolysate 30 g discs every day until day 7. Insect mortality and weight scores casein 10 g were recorded. fructose 20 g Wesson salt mixture 4 g 0250 Feeding potato leaf discs with surface-applied intact tomato fruit powder 12.5g naked dsRNA of target LD002 to L. decemlineata larvae potato leaf powder 25 g resulted in a significant increase in larval mortalities (i.e. at b-sitosterol 1 g day 7 all insects were dead; 100% mortality) whereas control Sorbic acid 0.8 g. methyl paraben 0.8 g. gfp dsRNA had no effect on CPB survival. Target LD002 Vanderzant vitamin mix 12 g dsRNA severely affected the growth of the larvae after 2 to 3 neomycin Sulfate 0.2 g days whereas the larvae fed with gfp dsRNA at the same aureomycin 0.130 g concentration developed as normal (FIG.3-LD). rifampicin 0.130 g chloramphenicol 0.130 g 0251 F. Screening Shorter Versions of dsRNAs Using nystatin 0.050 g Artificial Diet for Activity Against Leptinotarsa decemlin Soybean oil 2 ml eata wheat germ oil 2 ml 0252. This example exemplifies the finding that shorter (60 or 100 bp) dsRNA fragments on their own or as concate 0244 Fifty ul of a solution of dsRNA at a concentration of mer constructs are sufficient in causing toxicity towards the 1 mg/ml was applied topically onto the Solid artificial diet in Colorado potato beetle. the wells of the multiwell plate. The diet was dried in a 0253 LD014, a target known to induce lethality in Colo laminair flow cabin. Per treatment, twenty-four Colorado rado potato beetle, was selected for this example. This gene potato beetle larvae (2" stage), with two insects per well, encodes a V-ATPase subunit E (SEQID NO 15). were tested. The plates were stored in the insect rearing cham 0254. A 100 base pair fragment, LD014 F1, at position ber at 25+2° C., 60% relative humidity, with a 16:8 hours 195-294 on SEQID NO 15 (SEQID NO 159) and a 60 base light:dark photoperiod. The beetles were assessed as live or pair fragment, LD014 F2, at position 235-294 on SEQ ID dead every 1, 2 or 3 days. After seven days, for targets LD006, NO 15 (SEQ ID NO 160) were further selected. See also LD007, LD010, LD011, and LD014, the diet was replaced Table 7-LD. with fresh diet with topically applied dsRNA at the same (0255. Two concatemers of 300 base pairs, LD014 C1 and concentration (1 mg/ml); for targets LD001, LD002, LD003, LD014 C2, were designed (SEQID NO 161 and SEQID NO LD015, and LD016, the diet was replaced with fresh diet only. 162). LD014 C1 contained 3 repeats of the 100 base pair The dsRNA targets were compared to diet only or diet with fragment described above (SEQID NO 159) and LD014 C2 topically applied dsRNA corresponding to a fragment of the contained 5 repeats of the 60 base pair fragment described GFP (green fluorescent protein) coding sequence (SEQ ID above (SEQID NO 160). See also Table 7-LD. NO 235). (0256 The fragments LD014 F1 and LD014 F2 were 0245 Feeding artificial diet containing intact naked dsR synthesized as sense and antisense primers. These primers NAS to L. decemlineata larvae resulted in significant were annealed to create the double strands DNA molecules increases in larval mortalities as indicated in two separate prior to cloning. Xbal and Xmal restrictions sites were bioassays (FIGS. 1LD-2LD). included at the 5' and 3' ends of the primers, respectively, to 0246 All dsRNAs tested resulted ultimately in 100% mor facilitate the cloning. tality after 7 to 14 days. Diet with or without GFP dsRNA 0257 The concatemers were made as 300 base pairs syn sustained the insects throughout the bioassays with very little thetic genes. Xbal and Xmal restrictions sites were included or no mortality. at the 5' and 3' ends of the synthetic DNA fragments, respec 0247 Typically, in all assays observed, CPB second-stage tively, to facilite the cloning. larvae fed normally on diet with or without dsRNA for 2 days 0258. The 4 DNA molecules, i.e. the 2 single units and molted to the third larval stage. At this new larval stage (LD014 F1 & LD014 F2) and the 2 concatemers (LD014 the CPB were observed to reduce significantly or stop alto C1 & LD014 C2), were digested with Xbal and Xmal and gether their feeding, with an increase in mortality as a result. subcloned in pRluescriptiISK+ linearised by Xbaland Xmal 0248 E. Bioassay of dsRNA Targets Using Potato Leaf digests, resulting in recombinant plasmids p1, p.2, p3, & p4. Discs for Activity Against the Leptinotarsa decemlineata respectively. 0249. An alternative bioassay method was employed (0259 Double-stranded RNA production: dsRNA was syn using potato leaf material rather than artificial diet as food thesized using the commercially available kit T7 RibomaxTM source for CPB. Discs of approximately 1.1 cm in diameter Express RNAi System (Cat. Nr. P1700, Promega). First two (or 0.95 cm) were cut out offleaves of 2 to 3-week old potato separate single 5' T7 RNA polymerase promoter templates plants using a suitably-sized cork borer. Treated leaf discs were generated in two separate PCR reactions, each reaction were prepared by applying 20 Jul of a 10 ng/ul solution of containing the target sequence in a different orientation rela target LD002 dsRNA or control gfp dsRNA on the adaxial tive to the T7 promoter. For LD014 F1, the sense T7 template leaf surface. The leaf discs were allowed to dry and placed was generated using the specific T7 forward primer individually in 24 wells of a 24-well multiplate (Nunc). A oGBM159 and the specific reverse primer oGBM164 (repre US 2014/0373.197 A1 Dec. 18, 2014 24 sented herein as SEQ ID NO 204 and SEQ ID NO 205, chamber at 25+2° C., 60% relative humidity, with a 16:8 respectively) in a PCR reaction with the following conditions: hours light:dark photoperiod. The beetles were assessed as 4 minutes at 95°C., followed by 35 cycles of 30 seconds at live or dead at regular intervals up to day 14. After seven days, 95°C., 30 seconds at 55° C. and 1 minute at 72°C., followed the diet was replaced with fresh diet with topically applied by 10 minutes at 72° C. The anti-sense T7 template was dsRNA at the same concentrations. The dsRNA targets were generated using the specific forward primer oGBM163 and compared to diet only. the specific T7 reverse primer oGBM160 (represented herein 0265 Feeding artificial diet containing intact naked dsR as SEQ ID NO 206 and SEQID NO 207, respectively) in a NAs of different targets to L. decemlineata larvae resulted in PCR reaction with the same conditions as described above. high larval mortalities at concentrations as low as between 0.1 The resulting PCR products were analyzed on agarose geland and 10 ng dsRNA/ul as shown in FIG. 5-LD. purified by PCR purification kit (Qiaquick PCR Purification Kit, Cat. Nr. 28106, Qiagen) and NaClO precipitation. The 0266. H. Adults are Extremely Susceptible to Orally generated T7 forward and reverse templates were mixed to be Ingested dsRNA Corresponding to Target Genes. transcribed and the resulting RNA strands were annealed, 0267. The example provided below highlights the finding Dnase and Rnase treated, and purified by sodium acetate, that adult insects (and not only insects of the larval stage) are following the manufacturers instructions. The sense Strand extremely susceptible to orally ingested dsRNA correspond of the resulting dsRNA is herein represented by SEQID NO ing to target genes. 2O3. 0268 Four targets were chosen for this experiment: targets 0260 For LD014 F2, the sense T7 template was gener 2, 10, 14 and 16 (SEQID NO 168, 188, 198 and 220, respec ated using the specific T7 forward primer oGBM161 and the tively). GFP fragment dsRNA (SEQID NO 235) was used as specific reverse primer oGBM166 (represented herein as a control. Young adults (2 to 3 days old) were picked at SEQID NO 209 and SEQID NO 210, respectively) in a PCR random from our laboratory-reared culture with no bias reaction with the following conditions: 4 minutes at 95°C., towards insect gender. Ten adults were chosen per treatment. followed by 35 cycles of 30 seconds at 95°C., 30 seconds at The adults were prestarved for at least 6 hours before the 55° C. and 1 minute at 72° C., followed by 10 minutes at 72° onset of the treatment. On the first day of treatment, each adult C. The anti-sense T7 template was generated using the spe was fed four potato leaf discs (diameter 1.5 cm) which were cific forward primer oGBM165 and the specific T7 reverse pretreated with a topical application of 25 Jul of 0.1 ug/ul primeroGBM162 (represented hereinas SEQID NO 211 and target dsRNA (synthesized as described in Example 3A; topi SEQ ID NO 212, respectively) in a PCR reaction with the cal application as described in Example 3E) per disc. Each same conditions as described above. The resulting PCR prod adult was confined to a small petridish (diameter 3 cm) in ucts were analyzed on agarose gel and purified by PCR puri order to make Sure that all insects have ingested equal fication kit (Qiaquick PCR Purification Kit, Cat. Nr. 28106, amounts of food and thus received equal doses of dsRNA. The Qiagen) and NaClO precipitation. The generated T7 forward following day, each adult was again fed four treated leaf discs and reverse templates were mixed to be transcribed and the as described above. On the third day, all ten adults per treat resulting RNA strands were annealed, Dnase and Rnase ment were collected and placed together in a cage consisting treated, and purified by sodium acetate, following the manu of a plastic box (dimensions 30 cmx20 cmx15 cm) with a fine facturers instructions. The sense Strand of the resulting nylon mesh built into the lid to provide good aeration. Inside dsRNA is herein represented by SEQID NO 208. the box, some moistened filter paper was placed in the base. 0261 Also for the concatemers, separate single 5'T7 RNA Some (untreated) potato foliage was placed on top of the polymerase promoter templates were generated in two sepa paper to maintain the adults during the experiment. From day rate PCR reactions, each reaction containing the target 5, regular assessments were carried out to count the number of sequence in a different orientation relative to the T7 promoter. dead, alive (mobile) and moribund insects. For insect mori The recombinant plasmids p3 and p4 containing LD014 C1 bundity, adults were laid on their backs to check whether they & LD014 02 were linearised with Xbal or Xmal, the two could right themselves within several minutes; an insect was linear fragments for each construct purified and used as tem considered moribund only if it was notable to turn onto its plate for the in vitro transcription assay, using the T7 promot front. ers flanking the cloning sites. Double-stranded RNA was 0269 Clear specific toxic effects of double-stranded RNA prepared by in vitro transcription using the T7 RiboMAXTM corresponding to different targets towards adults of the Colo Express RNAi System (Promega). The sense strands of the rado potato beetle, Leptinotarsa decemlineata, were demon resulting dsRNA for LD014 C1 and LD014 C2 are herein strated in this experiment (FIG. 6-LD). Double-stranded represented by SEQID NO 213 and 2114, respectively. RNA corresponding to a gfp fragment showed no toxicity 0262 Shorter sequences of target LD014 and concatemers towards CPB adults on the day of the final assessment (day were able to induce lethality in Leptinotarsa decemlineata, as 19). This experiment clearly showed that the survival of CPB shown in FIG. 4-LD. adults was severely reduced only after a few days of exposure 0263 G. Screening dsRNAs at Different Concentrations to dsRNA when delivered orally. For example, for target 10, Using Artificial Diet for Activity Against Leptinotarsa on day 5, 5 out of 10 adults were moribund (sick and slow decemlineata moving); on day 6, 4 out of 10 adults were dead with three of 0264 Fifty ul of a solution of dsRNA at serial ten-fold the survivors moribund; on day 9 all adults were observed concentrations from 1 ug/ul (for target LD027 from 0.1 ug/ul) dead. down to 0.01 ng/ul was applied topically onto the solid arti 0270. As a consequence of this experiment, the applica ficial diet in the wells of a 24-well plate (Nunc). The diet was tion of target double-stranded RNAS against insect pests may dried in a laminair flow cabin. Per treatment, twenty-four be broadened to include the two life stages of an insect pest Colorado potato beetle larvae (2" stage), with two insects per (i.e. larvae and adults) which could cause extensive crop well, were tested. The plates were stored in the insect rearing damage, as is the case with the Colorado potato beetle. US 2014/0373.197 A1 Dec. 18, 2014
0271 I. Laboratory Trials to TestTransgenic Potato Plants plants was very low when compared to the empty vector Against Larvae of the Colorado Potato Beetle, Leptinotarsa transgenic plants or wild type line V plants. decemlineata 0272. The example provided below is an exemplification Example 4 of the finding that transgenic potato plants expressing CPB gene-specific hairpin RNAs adversely affected Colorado Phaedon cochleariae (Mustard Leaf Beetle) potato beetles. 0279 A. Cloning of a Partial Sequence of the Phaedon cochleariae (Mustard Leaf Beetle) PC001, PC003, PC005, Potato Transformation PC010, PC014, PC016 and PC027 Genes Via Family PCR 0280 High quality, intact RNA was isolated from the third 0273 Stably transformed potato plants were obtained larval stage of Phaedon cochleariae (mustard leaf beetle: using an adapted protocol received through Julie Gilbert at source: Dr. Caroline Muller, Julius-von-Sachs-Institute for the NSF Potato Genome Project (http://www.potatogenome. Biosciences, Chemical Ecology Group, University of org/nsfS). Stem internode explants of potato Line V (ob Wuerzburg, Julius-von-Sachs-Platz 3, D-97082 Wuerzburg, tained from the Laboratory of Plant Breeding at PRI Germany) using TRIZol Reagent (Cat. Nr. 15596-026/15596 Wageningen, the Netherlands) which was derived from the 018, Invitrogen, Rockville, Md., USA) following the manu susceptible diploid Solanum tuberosum 6487-9 were used as facturer's instructions. Genomic DNA present in the RNA starting material for transformation. preparation was removed by DNase (Cat. Nr. 1700, Promega) 0274. In vitro derived explants were inoculated with Agro treatment following the manufacturers instructions. cDNA bacterium tumifaciens C58C Rif containing the hairpin was generated using a commercially available kit (Super constructs. After three days co-cultivation the explants were Script TM III Reverse Transcriptase, Cat. Nr. 18080044, Invit put onto a selective medium containing 100 mg/l Kanamycin rogen, Rockville, Md., USA) following the manufacturers and 300 mg/l Timentin. After 6 weeks post-transformation the instructions. first putative shoots were removed and rooted on selective 0281 To isolate cDNA sequences comprising a portion of medium. Shoots originating from different explants were the PC001, PC003, PC005, PC010, PC014, PC016 and treated as independent events, shoots originating from the PC027 genes, a series of PCR reactions with degenerate prim same callus were termed siblings until their clonal status can ers were performed using Amplitaq Gold (Cat. Nr. be verified by Southerns, and nodal cuttings of a shoot were N8080240, Applied Biosystems) following the manafactur referred to as 'clones. er's instructions. 0275. The transgenic status of the rooting shoots was 0282. The sequences of the degenerate primers used for checked either by GFP fluorescence or by plus/minus PCR for amplification of each of the genes are given in Table 2-PC. the target sequence. Positive shoots were then clonally propa These primers were used in respective PCR reactions with the gated in tissue culture to ensure enough replicates were avail following conditions: 10 minutes at 95°C., followed by 40 able for the Colorado potato beetle assay with the first plants cycles of 30 seconds at 95°C., 1 minute at 55° C. and 1 minute being available to test fourteen weeks post transformation. at 72°C., followed by 10 minutes at 72°C. The resulting PCR fragments were analyzed on agarose gel, purified (QIAquick Bioassay Gel Extraction kit, Cat. Nr. 28706, Qiagen), cloned into the pCR4/TOPO vector (Cat. Nr. K4530-20, Invitrogen) and 0276 Transgenic potato plants were grown to the 8-12 sequenced. The sequences of the resulting PCR products are unfolded leaf stage in a plant growth room chamber with the represented by the respective SEQID NOs as given in Table following conditions: 23+2°C., 60% relative humidity, 16:8 2-PC and are referred to as the partial sequences. hour light:dark photoperiod. The plants were caged by plac 0283 The corresponding partial amino acid sequence are ing a 500 ml bottle upside down over the plant with the neck represented by the respective SEQID NOs as given in Table of the bottle firmly placed in the soil in a pot and base cut open 3-PC. Table 3-PC provides amino acid sequences of cDNA and covered with a fine nylon mesh to permit aeration, reduce clones, and the start of the reading frame is indicated in condensation inside and prevent larval escape. brackets. 0277. In this bioassay, seven neonate CPB larvae were 0284 B. dsRNA Production of the Phaedon cochleariae placed on the foliage of each transgenic potato plant. Six Genes transgenic potato siblings per transformation event (i.e. plants 0285 dsRNA was synthesized in milligram amounts derived from one callus) of the hairpin construct LD002 using the commercially available kit T7 RibomaxTM Express (comprising SEQID NO 240) (labeled as pGBNB001/28A to RNAi System (Cat. Nr. P1700, Promega). First two separate F) and empty vector (labeled as pK7GWIWG2D(II)/11A to single 5'T7 RNA polymerase promoter templates were gen F), and two wildtype plants were tested. Temperature, humid erated in two separate PCR reactions, each reaction contain ity and lighting conditions were the same as described above. ing the target sequence in a different orientation relative to the At day 7 (7 days after the start of the bioassay), the number of T7 promoter. Survivors were counted and the average weight of larval Sur 0286 For each of the target genes, the sense T7 template vivors from each plant recorded. Data was analysed using the was generated using specific T7 forward and specific reverse Spotfire R DecisionSite R, 9.0 software (Version 17.1.779) primers. The sequences of the respective primers for ampli from Spotfire Inc. fying the sense template for each of the target genes are given 0278. In this experiment, all larvae of the Colorado potato in Table 8-PC. Table 8-PC provides details for preparing ds beetle on two sibling plants (labeled as pGENB001/28A and RNA fragments of Phaedon cochleariae target sequences, pGBNB001/28F), harbouring hairpin construct LD002, gen including primer sequences. erated from a single transformation event, were dead on day 0287. The conditions in the PCR reactions were as fol 7 (FIG. 7-LD). Feeding damage by CPB larvae on these two lows: 1 minute at 95°C., followed by 20 cycles of 30 seconds US 2014/0373.197 A1 Dec. 18, 2014 26 at 95° C., 30 seconds at 60° C. and 1 minute at 72° C., 0295 PC027 (sense-intron-CmR-intron-antisense) is followed by 15 cycles of 30 seconds at 95°C., 30 seconds at represented in SEQID NO 512: 50° C. and 1 minute at 72° C. followed by 10 minutes at 72° Table 9-PC provides sequences for each hairpin construct. C. The anti-sense T7 template was generated using specific 0296 D. Laboratory Trials to Test dsRNA Targets. Using forward and specific T7 reverse primers in a PCR reaction Oilseed Rape Leaf Discs for Activity Against Phaedon with the same conditions as described above. The sequences cochleariae Larvae of the respective primers for amplifying the anti-sense tem 0297. The example provided below is an exemplification plate for each of the target genes are given in Table 8-PC. The of the finding that the mustard leaf beetle (MLB) larvae are resulting PCR products were analyzed on agarose gel and Susceptible to orally ingested dsRNA corresponding to own purified by PCR purification kit (Qiaquick PCR Purification target genes. Kit, Cat. Nr. 28106, Qiagen) and NaClO precipitation. The 0298 To test the different double-stranded RNA samples generated T7 forward and reverse templates were mixed to be against MLB larvae, a leaf disc assay was employed using transcribed and the resulting RNA strands were annealed, oilseed rape (Brassica napus variety SW Oban; source: Nick DNase and RNase treated, and purified by sodium acetate, Balaam, Sw Seed Ltd., 49 North Road, Abington, Cambridge, following the manufacturers instructions. The sense Strand CB1 6AS, UK) leaf material as food source. The insect cul of the resulting dsRNA for each of the target genes is given in tures were maintained on the same variety of oilseed rape in Table 8-PC. the insect chamber at 25+2°C. and 60+5% relative humidity 0288 C. Recombination of the Phaedon cochleariae with a photoperiod of 16 hlight/8 h dark. Discs of approxi (Mustard Leaf Beetle) Genes into the Plant Vector mately 1.1 cm in diameter (or 0.95 cm) were cut out off pK7GWIWG2D(II) leaves of 4- to 6-week old rape plants using a suitably-sized 0289 Since the mechanism of RNA interference operates corkborer. Double-stranded RNA samples were diluted to 0.1 through dsRNA fragments, the target nucleotide sequences of ug/ul in Milli-Q water containing 0.05% Triton X-100. the target genes, as selected above, were cloned in anti-sense Treated leaf discs were prepared by applying 25 ul of the and sense orientation, separated by the intron-CmR-intron, diluted solution of target PC001, PC003, PC005, PC010, whereby CmR is the chloramphenicol resistance marker, to PC014, PC016, PC027 dsRNA and control gfp dsRNA or form a dsRNA hairpin construct. These hairpin constructs 0.05% TritonX-100 on the adaxial leaf surface. The leaf discs were generated using the LR recombination reaction between were left to dry and placed individually in each of the 24 wells an attL-containing entry clone (see Example 4A) and an of a 24-well multiplate containing 1 ml of gellified 2% agar attR-containing destination vector (pK7GWIWG2D(II)). which helps to prevent the leaf disc from drying out. Two The plant vector pK7GWIWG2D(II) was obtained from the neonate MLB larvae were placed into each well of the plate, VIB/Plant Systems Biology with a Material Transfer Agree which was then covered with a multiwell plastic lid. The plate ment. LR recombination reaction was performed by using LR (one treatment containing 48 insects) was divided into 4 rep ClonaseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) licates of 12 insects per replicate (each row). The plate con following the manufacturers instructions. These cloning taining the insects and leaf discs were kept in an insect cham experiments resulted in a hairpin construct for each of the ber at 25+2° C. and 60+5% relative humidity with a PC001, PC010, PC014, PC016 and PC027 genes, having the photoperiod of 16 hlight/8 h dark. The insects were fed leaf promoter—sense-intron-CmR-intron-antisense orientation, discs for 2 days after which they were transferred to a new and wherein the promoter is the plant operable 35S promoter. plate containing freshly treated leaf discs. Thereafter, 4 days The binary vectorpK7GWIWG2D(II) with the 35S promoter after the start of the bioassay, the insects from each replicate is suitable for transformation into A. tumefaciens. were collected and transferred to a Petri dish containing 0290 Restriction enzyme digests were carried out on untreated fresh oilseed rape leaves. Larval mortality and aver pCR8/GW/TOPO plasmids containing the different targets age weight were recorded at days 2, 47, 9 and 11. (see Example 4B): for PC001, a double digest with BsoBI & 0299 P. cochleariae larvae fed on intact naked target Pvul; for PC010, a double digest with Pvul & PvulI; for dsRNA-treated oilseed rape leaves resulted in significant PC014, a triple digest with HincII, Pvul & XhoI; for PC016, increases in larval mortalities for all targets tested, as indi a single digest with Apal I; for PC027, a double digest with cated in FIG. 1(a). Tested double-stranded RNA for target Aval & Drd I. The band containing the gene of interest flanked PC010 led to 100% larval mortality at day 9 and for target by the atti sites using Qiaquick Gel Extraction Kit (Cat. Nr. PCO27 at day 11. For all other targets, significantly high 28706, Qiagen) was purified. An amount of 150 ng of purified mortality values were reached at day 11 when compared to fragment and 150 ng pK7GWIWG2D(II) was added together control gfp dsRNA, 0.05% Trition X-100 alone or untreated with the LR clonase II enzyme and incubated for at least 1 h leaf only: (average value in percentage:Econfidence interval at 25°C. After proteinase K solution treatment (10 min at 37° with alpha 0.05) PC001 (94.4+8.2); PC003 (86.1+4.1): C.), the whole recombination mix was transformed into Top PC005 (83.3+7.8); PC014 (63.9+20.6); PC016 (75.0+16.8); 10 chemically competent cells. Positive clones were selected gfp dsRNA (11.1+8.2): 0.05%TritonX-100 (19.4+10.5); leaf by restriction digest analyses. The complete sequence of the only (8.3+10.5). hairpin construct for: 0300 Larval survivors were assessed based on their aver 0291 PC001 (sense-intron-CmR-intron-antisense) is age weight. For all targets tested, the mustard leaf beetle represented in SEQID NO 508; larvae had significantly reduced average weights after day 4 0292 PC010 (sense-intron-CmR-intron-antisense) is of the bioassay; insects fed control gfp dsRNA or 0.05% represented in SEQID NO 509; Triton X-100 alone developed normally, as for the larvae on 0293 PC014 (sense-intron-CmR-intron-antisense) is leaf only (FIG. 1(b)-PC). represented in SEQID NO 510; (0301 E. Laboratory Trials to Screen dsRNAs at Different 0294 PC016 (sense-intron-CmR-intron-antisense) is Concentrations Using Oilseed Rape Leaf Discs for Activity represented in SEQID NO 511; Against Phaedon cochleariae Larvae US 2014/0373.197 A1 Dec. 18, 2014 27
0302) Twenty-five ul of a solution of dsRNA from target Example 5 PCO)10 or PCO27 at Serial ten-fold concentrations from 0.1 ug/ul down to 0.1 ng/ul was applied topically onto the oilseed Epilachna varivetis (Mexican Bean Beetle) rape leaf disc, as described in Example 4D above. As a nega 0308 A. Cloning Epilachna varivetis Partial Gene tive control, 0.05% TritonX-100 only was administered to the Sequences leaf disc. Per treatment, twenty-four mustard leaf beetle neo 0309 High quality, intact RNA was isolated from 4 dif nate larvae, with two insects per well, were tested. The plates ferent larval stages of Epilachna varivetis (Mexican bean were stored in the insect rearing chamber at 25+2°C., 60+5% beetle; source: Thomas Dorsey, Supervising Entomologist, relative humidity, with a 16:8 hours light:dark photoperiod. New Jersey Department of Agriculture, Division of Plant At day 2, the larvae were transferred on to a new plate con Industry, Bureau of Biological Pest Control, Phillip Alampi taining fresh dsRNA-treated leaf discs. At day 4 for target Beneficial Insect Laboratory, PO Box 330, Trenton, N.J. PC010 and day 5 for target PCO27, insects from each replicate 08625-0330, USA) using TRIZol Reagent (Cat. Nr. 15596 were transferred to a Petridish containing abundant untreated 026/15596-018, Invitrogen, Rockville, Md., USA) following leaf material. The beetles were assessed as live or dead on the manufacturer's instructions. Genomic DNA present in the days 2, 4, 7, 8, 9, and 11 for target PC010, and 2, 5, 8, 9 and RNA preparation was removed by DNase treatment follow 12 for target PC027. ing the manafacturer's instructions (Cat. Nr. 1700, Promega). 0303) Feeding oilseed rape leaf discs containing intact cDNA was generated using a commercially available kit (Su naked dsRNAs of the two different targets, PC010 and perScriptTM III Reverse Transcriptase, Cat. Nr. 18080044, PCO27, to P. cochleariae larvae resulted in high mortalities at Invitrogen, Rockville, Md., USA) following the manufactur concentrations down to as low as 1 ng dsRNA/ul Solution, as er's instructions. shown in FIGS. 2 (a) and (b). Average mortality values in 0310. To isolate cDNA sequences comprising a portion of percentage-confidence interval with alpha 0.05 for different the EV005, EVO09, EVO10, EVO15 and EV016 genes, a concentrations of dsRNA for target PC010 at day 11, Oug/ul: series of PCR reactions with degenerate primers were per 8.3+9.4; 0.1 ug/ul: 100; 0.01 g/ul: 79.2+20.6; 0.001 ug/ul: formed using Amplitaq Gold (Cat. Nr. N8080240, Applied 58.3-9.4; 0.0001 ug/ul: 12.5+15.6; and for target PC027 at Biosystems) following the manufacturers instructions. day 12, Oug/ul: 8.3-9.4; 0.1 lug/ul: 95.8+8.2: 0.01 lug/ul: 0311. The sequences of the degenerate primers used for 95.8+8.2: 0.001 ug/ul: 83.3+13.3; 0.0001 ug/ul: 12.5+8.2. amplification of each of the genes are given in Table 2-EV. 0304 F. Laboratory Trials of Myzus periscae (Green which displays Epilachna varivetis target genes including Peach Aphid) Infestation on Transgenic Arabidopsis thaliana primer sequences and cDNA sequences obtained. These Plants primers were used in respective PCR reactions with the fol lowing conditions: for EV005 and EV009, 10 minutes at 95° C., followed by 40 cycles of 30 seconds at 95°C., 1 minute at Generation of Transgenic Plants 50° C. and 1 minute 30 seconds at 72° C., followed by 7 minutes at 72°C.; for EVO14, 10 minutes at 95°C., followed 0305 Arabidopsis thaliana plants were transformed using by 40 cycles of 30 seconds at 95°C., 1 minute at 53° C. and the floral dip method (Clough and Bent (1998) Plant Journal 1 minute at 72° C., followed by 7 minutes at 72° C.; for 16:735-743). Aerial parts of the plants were incubated for a EV010 and EV016, 10 minutes at 95°C., followed by 40 few seconds in a solution containing 5% Sucrose, resus cycles of 30 seconds at 95°C., 1 minute at 54°C. and 1 minute pended Agrobacterium tumefaciens strain C58C1 Rif cells 40 seconds at 72° C., followed by 7 minutes at 72° C. The from an overnight culture and 0.03% of the surfactant Silwet resulting PCR fragments were analyzed on agarose gel, puri L-77. After inoculation, plants were covered for 16 hours with fied (QIAquick Gel Extraction kit, Cat. Nr. 28706, Qiagen), a transparent plastic to maintain humidity. To increase the cloned into the pCR4/TOPO vector (Cat. Nr. K4530-20, transformation efficiency, the procedure was repeated after Invitrogen), and sequenced. The sequences of the resulting one week. Watering was stopped as seeds matured and dry PCR products are represented by the respective SEQID NOS seeds were harvested and cold-treated for two days. After as given in Table 2-EV and are referred to as the partial sterilization, seeds were plated on a kanamycin-containing sequences. The corresponding partial amino acid sequences growth medium for selection of transformed plants. are represented by the respective SEQ ID NOs as given in 0306 The selected plants are transferred to soil for opti Table 3-EV, where the start of the reading frame is indicated mal T2 seed production. in brackets. 0312 B. dsRNA Production of the Epilachna varivetis Bioassay Genes 0313 dsRNA was synthesized in milligram amounts 0307 Transgenic Arabidopsis thaliana plants are selected using the commercially available kit T7 RibomaxTM Express by allowing the segregating T2 seeds to germinate on appro RNAi System (Cat. Nr. P1700, Promega). First two separate priate selection medium. When the roots of these transgenics single 5'T7 RNA polymerase promoter templates were gen are well-established they are then transferred to fresh artifi erated in two separate PCR reactions, each reaction contain cial growth medium or soil and allowed to grow under opti ing the target sequence in a different orientation relative to the mal conditions. Whole transgenic plants are tested against T7 promoter. nymphs of the green peach aphid (Myzus persicae) to show 0314 For each of the target genes, the sense T7 template (1) a significant resistance to plant damage by the feeding was generated using specific T7 forward and specific reverse nymph, (2) increased nymphal mortality, and/or (3) decreased primers. The sequences of the respective primers for ampli weight of nymphal Survivors (or any other aberrant insect fying the sense template for each of the target genes are given development). in Table 8-EV. US 2014/0373.197 A1 Dec. 18, 2014 28
0315. The conditions in the PCR reactions were as fol insect chamber at 25+2°C. and 60+5% relative humidity with lows: 1 minute at 95°C., followed by 20 cycles of 30 seconds a photoperiod of 16 hlight/8 h dark. Discs of approximately at 95° C., 30 seconds at 60° C. and 1 minute at 72° C., 1.1 cm in diameter (or 0.95 cm) were cut out off leaves of 1 followed by 15 cycles of 30 seconds at 95°C., 30 seconds at to 2-week old bean plants using a Suitably-sized cork borer. 50° C. and 1 minute at 72° C. followed by 10 minutes at 72° Double-stranded RNA samples were diluted to 1 lug/ul in C. The anti-sense T7 template was generated using specific Milli-Q water containing 0.05% Triton X-100. Treated leaf forward and specific T7 reverse primers in a PCR reaction discs were prepared by applying 25ul of the diluted solution with the same conditions as described above. The sequences of target Ev005, Ev010, Ev015, Ev016 dsRNA and control of the respective primers for amplifying the anti-sense tem gfp dsRNA or 0.05% TritonX-100 on the adaxial leaf surface. plate for each of the target genes are given in Table 8-EV. The The leaf discs were left to dry and placed individually in each resulting PCR products were analyzed on agarose gel and of the 24 wells of a 24-well multiplate containing 1 ml of purified by PCR purification kit (Qiaquick PCR Purification gellified 2% agar which helps to prevent the leaf disc from Kit, Cat. Nr. 28106, Qiagen) and NaClO precipitation. The drying out. A single neonate MBB larva was placed into each generated T7 forward and reverse templates were mixed to be well of a plate, which was then covered with a multiwell transcribed and the resulting RNA strands were annealed, plastic lid. The plate was divided into 3 replicates of 8 insects DNase and RNase treated, and purified by sodium acetate, per replicate (row). The plate containing the insects and leaf following the manufacturers instructions. The sense Strand discs were kept in an insect chamber at 25+2°C. and 60+5% of the resulting dsRNA for each of the target genes is given in relative humidity with a photoperiod of 16 h light/8 h dark. Table 8-EV. The insects were fed on the leaf discs for 2 days after which 0316 C. Recombination of the Epilachna varivetis Genes the insects were transferred to a new plate containing freshly into the Plant Vector pK7GWIWG2D(II) treated leaf discs. Thereafter, 4 days after the start of the 0317. Since the mechanism of RNA interference operates bioassay, the insects were transferred to a petriplate contain through dsRNA fragments, the target nucleotide sequences of ing untreated fresh bean leaves every day until day 10. Insect the target genes, as selected above, are cloned in anti-sense mortality was recorded at day 2 and every other day thereaf and sense orientation, separated by the intron-CmR-intron, ter whereby CmR is the chloramphenicol resistance marker, to 0322 Feeding Snap bean leaves containing Surface-ap form a dsRNA hairpin construct. These hairpin constructs are plied intact naked target dsRNAs to E. varivestis larvae generated using the LR recombination reaction between an resulted in significant increases in larval mortalities, as indi attl-containing entry clone (see Example 5A) and an attR cated in FIG. 1. Tested double-stranded RNAs of targets containing destination vector (pK7GWIWG2D(II)). The Ev010, Ev015, & Ev016 led to 100% mortality after 8 days, plant vector pK7GWIWG2D(II) is obtained from the VIB/ whereas dsRNA of target Ev005 took 10 days to kill all larvae. Plant Systems Biology with a Material Transfer Agreement. The majority of the insects fed on treated leaf discs containing LR recombination reaction is performed by using LR Clo control gfp dsRNA or only the surfactant Triton X-100 were naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol sustained throughout the bioassay (FIG. 1-EV). lowing the manufacturers instructions. These cloning 0323 E. Laboratory Trials to Test dsRNA Targets Using experiments result in a hairpin construct for each of the target Bean Leaf Discs for Activity Against Epilachna varivestis genes, having the promoter-sense-intron-CmR-intron-anti Adults sense orientation, and wherein the promoter is the plant oper 0324. The example provided below is an exemplification able 35S promoter. The binary vector pK7GWIWG2D(II) of the finding that the Mexican bean beetle adults are suscep with the 35S promoter is suitable for transformation into A. tible to orally ingested dsRNA corresponding to own target tumefaciens. genes. 0318 Restriction enzyme digests were carried out on 0325 In a similar bioassay set-up as for Mexican bean pCR8/GW/TOPO plasmids containing the different targets beetle larvae, adult MBBs were tested against double (see Example B). The band containing the gene of interest stranded RNAS topically-applied to bean leaf discs. Test flanked by the attl sites using Qiaquick Gel Extraction Kit dsRNA from each target Ev010, Ev015 and Ev016 was (Cat. Nr. 28706, Qiagen) is purified. An amount of 150 ng of diluted in 0.05% Triton X-100 to a final concentration of 0.1 purified fragment and 150 ng pK7GWIWG2D(II) is added ug/ul. Bean leaf discs were treated by topical application of together with the LR clonase II enzyme and incubated for at 30 ul of the test solution onto each disc. The discs were least 1 h at 25°C. After proteinase K solution treatment (10 allowed to dry completely before placing each on a slice of min at 37° C.), the whole recombination mix is transformed gellified 2% agar in each well of a 24-well multiwell plate. into Top 10 chemically competent cells. Positive clones are Three-day-old adults were collected from the culture cages selected by restriction digest analyses. and fed nothing for 7-8 hours prior to placing one adult to 0319 D. Laboratory Trials to Test dsRNA Targets Using each well of the bioassay plate (thus 24 adults per treatment). Bean Leaf Discs for Activity Against Epilachna varivetis The plates were kept in the insect rearing chamber (under the Larvae same conditions as for MBB larvae for 24 hours) after which 0320. The example provided below is an exemplification the adults were transferred to a new plate containing fresh of the finding that the Mexican bean beetle (MBB) larvae are dsRNA-treated leaf discs. After a further 24 hours, the adults Susceptible to orally ingested dsRNA corresponding to own from each treatment were collected and placed in a plastic box target genes. with dimensions 30 cmx15 cmx10 cm containing two potted 0321) To test the different double-stranded RNA samples and untreated 3-week-old bean plants. Insect mortality was against MBB larvae, a leaf disc assay was employed using assessed from day 4 until day 11. Snap bean (Phaseolus vulgaris variety Montano; source: 0326 All three target dsRNAs (Ev010, Ev015 and Ev016) Aveve NV, Belgium) leaf material as food source. The same ingested by adults of Epilachna varivestis resulted in signifi variety of beans was used to maintain insect cultures in the cant increases in mortality from day 4 (4 days post bioassay US 2014/0373.197 A1 Dec. 18, 2014 29 start), as shown in FIG. 2-EV (a). From day 5, dramatic primers. The sequences of the respective primers for ampli changes in feeding patterns were observed between insects fying the sense template for each of the target genes are given fed initially with target-dsRNA-treated bean leaf discs and in Table 8-AG. A touchdown PCR was performed as follows: those that were fed discs containing control gfp dsRNA or 1 minute at 95°C., followed by 20 cycles of 30 seconds at 95° surfactant Triton X-100. Reductions in foliar damage by C., 30 seconds at 60°C. with a decrease intemperature of 0.5° MBB adults of untreated bean plants were clearly visible for C. per cycle and 1 minute at 72°C., followed by 15 cycles of all three targets when compared to gfp dsRNA and Surfactant 30 seconds at 95°C., 30 seconds at 50° C. and 1 minute at 72° only controls, albeit at varying levels; insects fed target 15 C., followed by 10 minutes at 72° C. The anti-sense T7 caused the least damage to bean foliage (FIG. 2-EV(b)). template was generated using specific forward and specific T7 reverse primers in a PCR reaction with the same condi Example 6 tions as described above. The sequences of the respective primers for amplifying the anti-sense template for each of the Anthonomus grandis (Cotton Boll Weevil) target genes are given in Table 8-AG. The resulting PCR 0327 A. Cloning Anthonomus grandis Partial Sequences products were analyzed on agarose gel and purified by PCR 0328 High quality, intact RNA was isolated from the 3 purification kit (Qiaquick PCR Purification Kit, Cat. Nr. instars of Anthonomus grandis (cotton boll weevil; Source: 28106, Qiagen) and NaClO precipitation. The generated T7 Dr. Gary Benzon, Benzon Research Inc., 7 Kuhn Drive, Car forward and reverse templates were mixed to be transcribed lisle, Pa. 17013, USA) using TRIZol Reagent (Cat. Nr. 15596 and the resulting RNA strands were annealed, DNase and 026/15596-018, Invitrogen, Rockville, Md., USA) following RNase treated, and purified by sodium acetate, following the the manufacturers instructions. Genomic DNA present in the manufacturers instructions. The sense Strand of the resulting RNA preparation was removed by DNase treatment follow dsRNA for each of the target genes is given in Table 8-AG. ing the manafacturers instructions (Cat. Nr. 1700, Promega). 0335 C. Recombination of Anthonomus grandis Genes cDNA was generated using a commercially available kit (Su into the Plant Vector pK7GWIWG2D(II) perScriptTM III 0336. Since the mechanism of RNA interference operates 0329 Reverse Transcriptase, Cat. Nr. 18080044, Invitro through dsRNA fragments, the target nucleotide sequences of gen, Rockville, Md., USA) following the manufacturers the target genes, as selected above, are cloned in anti-sense instructions. and sense orientation, separated by the intron-CmR-intron, 0330. To isolate cDNA sequences comprising a portion of whereby CmR is the chloramphenicol resistance marker, to form a dsRNA hairpin construct. These hairpin constructs are the AG001, AG005, AG010, AG014 and AG016 genes, a generated using the LR recombination reaction between an series of PCR reactions with degenerate primers were per att-containing entry clone (see Example 6A) and an attR formed using Amplitaq Gold (Cat. Nr. N8080240, Applied containing destination vector (pK7GWIWG2D(II)). The Biosystems) following the manafacturers instructions. plant vector pK7GWIWG2D(II) is obtained from the VIB/ 0331. The sequences of the degenerate primers used for Plant Systems Biology with a Material Transfer Agreement. amplification of each of the genes are given in Table 2-AG. LR recombination reaction is performed by using LR Clo These primers were used in respective PCR reactions with the naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol following conditions: for AG001, AG005 and AG016, 10 lowing the manufacturers instructions. These cloning minutes at 95°C., followed by 40 cycles of 30 seconds at 95° experiments result in a hairpin construct for each of the target C., 1 minute at 50° C. and 1 minute and 30 seconds at 72°C., genes, having the promoter-sense-intron-CmR-intron-anti followed by 7 minutes at 72°C.; for AG010, 10 minutes at 95° C., followed by 40 cycles of 30 seconds at 95°C., 1 minute at sense orientation, and wherein the promoter is the plant oper 54°C. and 2 minutes and 30 seconds at 72°C., followed by 7 able 35S promoter. The binary vector pK7GWIWG2D(II) minutes at 72°C.; for AG014, 10 minutes at 95°C., followed with the 35S promoter is suitable for transformation into A. by 40 cycles of 30 seconds at 95°C., 1 minute at 55° C. and tumefaciens. 1 minute at 72° C., followed by 7 minutes at 72° C. The 0337 Restriction enzyme digests were carried out on resulting PCR fragments were analyzed on agarose gel, puri pCR8/GW/TOPO plasmids containing the different targets fied (QIAquick Gel Extraction kit, Cat. Nr. 28706, Qiagen), (see Example 6B). The band containing the gene of interest cloned into the pCR8/GW/TOPO vector (Cat. Nr. K2500-20, flanked by the atti sites using Qiaquick Gel Extraction Kit Invitrogen) and sequenced. The sequences of the resulting (Cat. Nr. 28706, Qiagen) is purified. An amount of 150 ng of PCR products are represented by the respective SEQID NOS purified fragment and 150 ng pK7GWIWG2D(II) is added as given in Table 2-AG and are referred to as the partial together with the LR clonase II enzyme and incubated for at sequences. The corresponding partial amino acid sequence least 1 h at 25°C. After proteinase K solution treatment (10 are represented by the respective SEQ ID NOs as given in min at 37° C.), the whole recombination mix is transformed Table 3-AG. into Top 10 chemically competent cells. Positive clones are 0332 B. dsRNA Production of the Anthonomus grandis selected by restriction digest analyses. (Cotton Boll Weevil) Genes 0338. D. Laboratory Trials to Test Escherichia coli 0333 dsRNA was synthesized in milligram amounts Expressing dsRNA Targets Against Anthonomus grandis using the commercially available kit T7 RibomaxTM Express RNAi System (Cat. Nr. P1700, Promega). First two separate Plant-Based Bioassays single 5'T7 RNA polymerase promoter templates were gen 0339 Whole plants are sprayed with suspensions of erated in two separate PCR reactions, each reaction contain chemically induced bacteria expressing dsRNA prior to feed ing the target sequence in a differentorientation relative to the ing the plants to CBW. The are grown from in a plant growth T7 promoter. room chamber. The plants are caged by placing a 500 ml 0334 For each of the target genes, the sense T7 template plastic bottle upside down over the plant with the neck of the was generated using specific T7 forward and specific reverse bottle firmly placed in the soil in a pot and the base cut open US 2014/0373.197 A1 Dec. 18, 2014 30 and covered with a fine nylon mesh to permit aeration, reduce cloned into the pCR8/GW/TOPO vector (Cat. Nr. K2500-20, condensation inside and prevent insect escape. CBW are Invitrogen), and sequenced. The sequences of the resulting placed on each treated plant in the cage. Plants are treated PCR products are represented by the respective SEQID NOS with a suspension of E. coli AB301-105(DE3) harboring the as given in Table 2-TC and are referred to as the partial pGXXXOXX plasmids or pGN29 plasmid. Different quanti sequences. The corresponding partial amino acid sequences ties of bacteria are applied to the plants: for instance 66, 22. are represented by the respective SEQ ID NOs as given in and 7 units, where one unit is defined as 10 bacterial cells in Table 3-TC. 1 ml of a bacterial Suspension at optical density value of 1 at (0345 B. dsRNA Production of the Tribolium castaneum 600 nm wavelength. In each case, a total volume of between Genes 1 and 10 mls sprayed on the plant with the aid of a vaporizer. 0346 dsRNA was synthesized in milligram amounts One plant is used per treatment in this trial. The number of using the commercially available kit T7 RibomaxTM Express survivors are counted and the weight of each survivor RNAi System (Cat. Nr. P1700, Promega). First two separate recorded. single 5'T7 RNA polymerase promoter templates were gen 0340 Spraying plants with a suspension of E. coli bacte erated in two separate PCR reactions, each reaction contain rial strain AB301-105(DE3) expressing target dsRNA from ing the target sequence in a different orientation relative to the pGXXXOXX lead to a dramatic increase in insect mortality T7 promoter. when compared to pGN29 control. These experiments show 0347 For each of the target genes, the sense T7 template that double-stranded RNA corresponding to an insect gene was generated using specific T7 forward and specific reverse target sequence produced in either wild-type or RNaseIII primers. The sequences of the respective primers for ampli deficient bacterial expression systems is toxic towards the fying the sense template for each of the target genes are given insect interms of Substantial increases in insect mortality and in Table 8-TC. The conditions in the PCR reactions were as growth/development delay for larval survivors. It is also clear follows: 1 minute at 95° C., followed by 20 cycles of 30 from these experiments that an exemplification is provided seconds at 95°C., 30 seconds at 60° C. (-0.5° C./cycle) and for the effective protection of plants/crops from insect dam 1 minute at 72°C., followed by 15 cycles of 30 seconds at 95° age by the use of a spray of a formulation consisting of C., 30 seconds at 50° C. and 1 minute at 72°C., followed by bacteria expressing double-stranded RNA corresponding to 10 minutes at 72°C. The anti-sense T7 template was gener an insect gene target. ated using specific forward and specific T7 reverse primers in a PCR reaction with the same conditions as described above. Example 7 The sequences of the respective primers for amplifying the anti-sense template for each of the target genes are given in Tribolium castaneum (Red Flour Beetle) Table 8-TC. The resulting PCR products were analyzed on 0341 A. Cloning Tribolium castaneum Partial Sequences agarose gel and purified by PCR purification kit (Qiaquick 0342 High quality, intact RNA was isolated from all the PCR Purification Kit, Cat. Nr. 28106, Qiagen) and NaClO. different insect stages of Tribolium castaneum (red flour precipitation. The generated T7 forward and reverse tem beetle; source: Dr. Lara Senior, Insect Investigations Ltd., plates were mixed to be transcribed and the resulting RNA Capital Business Park, Wentloog, Cardiff, CF3 2PX, Wales, strands were annealed, DNase and RNase treated, and puri UK) using TRIZol Reagent (Cat. Nr. 15596-026/15596-018, fied by sodium acetate, following the manufacturers instruc Invitrogen, Rockville, Md., USA) following the manufactur tions. The sense strand of the resulting dsRNA for each of the er's instructions. Genomic DNA present in the RNA prepa target genes is given in Table 8-TC. ration was removed by DNase treatment following the 0348 C. Recombination of Tribolium castaneum Genes manafacturers instructions (Cat. Nr. 1700, Promega). cDNA into the Plant Vector pK7GWIWG2D(II) was generated using a commercially available kit (Super 0349. Since the mechanism of RNA interference operates Script TM III Reverse Transcriptase, Cat. Nr. 18080044, Invit through dsRNA fragments, the target nucleotide sequences of rogen, Rockville, Md., USA) following the manufacturers the target genes, as selected above, are cloned in anti-sense instructions. and sense orientation, separated by the intron-CmR-intron, 0343 To isolate cDNA sequences comprising a portion of whereby CmR is the chloramphenicol resistance marker, to the TC001, TC002, TC010, TC014 and TC015 genes, a series form a dsRNA hairpin construct. These hairpin constructs are of PCR reactions with degenerate primers were performed generated using the LR recombination reaction between an using Amplitaq Gold (Cat. Nr. N8080240, Applied Biosys att-containing entry clone (see Example 7A) and an attR tems) following the manafacturers instructions. containing destination vector (pK7GWIWG2D(II)). The 0344) The sequences of the degenerate primers used for plant vector pK7GWIWG2D(II) is obtained from the VIB/ amplification of each of the genes are given in Table 2-TC. Plant Systems Biology with a Material Transfer Agreement. These primers were used in respective PCR reactions with the LR recombination reaction is performed by using LR Clo following conditions: 10 minutes at 95°C., followed by 40 naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol cycles of 30 seconds at 95°C., 1 minute at 50° C. and 1 minute lowing the manufacturers instructions. These cloning and 30 seconds at 72° C., followed by 7 minutes at 72° C. experiments result in a hairpin construct for each of the target (TC001, TC014, TC015); 10 minutes at 95°C., followed by genes, having the promoter-sense-intron-CmR-intron-anti 40 cycles of 30 seconds at 95°C., 1 minute at 54° C. and 2 sense orientation, and wherein the promoter is the plant oper minutes and 30 seconds at 72°C., followed by 7 minutes at able 35S promoter. The binary vector pK7GWIWG2D(II) 72°C. (TC010); 10 minutes at 95°C., followed by 40 cycles with the 35S promoter is suitable for transformation into A. of 30 seconds at 95°C., 1 minute at 53° C. and 1 minute at 72° tumefaciens. C., followed by 7 minutes at 72° C. (TC002). The resulting 0350 Restriction enzyme digests were carried out on PCR fragments were analyzed on agarose gel, purified pCR8/GW/TOPO plasmids containing the different targets (QIAquick Gel Extraction kit, Cat. Nr. 28706, Qiagen), (see Example 7B). The band containing the gene of interest US 2014/0373.197 A1 Dec. 18, 2014 31 flanked by the attl sites using Qiaquick Gel Extraction Kit 0358 To isolate cDNA sequences comprising a portion of (Cat. Nr. 28706, Qiagen) is purified. An amount of 150 ng of the MP001, MP002, MP010, MP016 and MP027 genes, a purified fragment and 150 ng pK7GWIWG2D(II) is added series of PCR reactions with degenerate primers were per together with the LR clonase II enzyme and incubated for at formed using Amplitaq Gold (Cat. Nr. N8080240, Applied least 1 h at 25°C. After proteinase K solution treatment (10 Biosystems) following the manafacturers instructions. min at 37° C.), the whole recombination mix is transformed into Top 10 chemically competent cells. Positive clones are 0359 The sequences of the degenerate primers used for selected by restriction digest analyses. amplification of each of the genes are given in Table 2-MP. 0351. D. Laboratory Trials to Test dsRNA Targets. Using These primers were used in respective PCR reactions with the Artificial Diet for Activity Against Tribolium castaneum Lar following conditions: for MP001, MP002 and MP016, 10 Wa minutes at 95°C., followed by 40 cycles of 30 seconds at 95° 0352. The example provided below is an exemplification C., 1 minute at 50° C. and 1 minute 30 seconds at 72° C., of the finding that the red flour beetle (RFB) larvae are sus followed by 7 minutes at 72° C.; for MP027, a touchdown ceptible to orally ingested dsRNA corresponding to own tar program was used: 10 minutes at 95° C., followed by 10 get geneS. cycles of 30 seconds at 95°C., 40 seconds at 60° C. with a 0353 Red flour beetles, Tribolium castaneum, were main decrease in temperature of 1° C. per cycle and 1 minute 10 tained at Insect Investigations Ltd. (origin: Imperial College seconds at 72° C., followed by 30 cycles of 30 seconds at 95° of Science, Technology and Medicine, Silwood Park, Berk C., 40 seconds at 50° C. and 1 minute 10 seconds at 72°C., shire, UK). Insects were cultured according to company SOP/ followed by 7 minutes at 72°C.; for MP010, 10 minutes at 95° 251/01. Briefly, the beetles were housed in plastic jars or C., followed by 40 cycles of 30 seconds at 95°C., 1 minute at tanks. These have an open top to allow ventilation. A piece of 54° C. and 3 minutes at 72°C., followed by 7 minutes at 72° netting was fitted over the top and secured with an elastic band C. The resulting PCR fragments were analyzed on agarose to prevent escape. The larval rearing medium (flour) was gel, purified (QIAquick Gel Extraction kit, Cat. Nr. 28706, placed in the container where the beetles can breed. The Qiagen), cloned into the pCR8/GW/TOPO vector (Cat. Nr. stored product beetle colonies were maintained in a con K2500-20, Invitrogen), and sequenced. The sequences of the trolled temperature room at 25+3°C. with a 16:8 hour light: resulting PCR products are represented by the respective SEQ dark cycle. ID NOs as given in Table 2-MP and are referred to as the 0354) Double-stranded RNA from target TC014 (with partial sequences. The corresponding partial amino acid sequence corresponding to SEQID NO 799) was incorpo sequences are represented by the respective SEQID NOS as rated into a mixture of flour and milk powder (wholemeal given in Table 3-MP. flour:powdered milk in the ratio 4:1) and left to dry overnight. Each replicate was prepared separately: 100 ul of a 10 ug/ul 0360 B. dsRNA Production of Myzus persicae Genes dsRNA solution (1 mg dsRNA) was added to 0.1 g flour/milk 0361 dsRNA was synthesized in milligram amounts mixture. The dried mixture was ground to a fine powder. using the commercially available kit T7 RibomaxTM Express Insects were maintained within Petri dishes (55 mm diam RNAi System (Cat. Nr. P1700, Promega). First two separate eter), lined with a double layer offilter paper. The treated diet single 5'T7 RNA polymerase promoter templates were gen was placed between the two filter paper layers. Ten first instar, erated in two separate PCR reactions, each reaction contain mixed sex larvae were placed in each dish (replicate). Four ing the target sequence in a different orientation relative to the replicates were performed for each treatment. Control was T7 promoter. Milli-Q water. Assessments (number of survivors) were made on a regular basis. During the trial, the test conditions were 0362 For each of the target genes, the sense T7 template 25-33°C. and 20-25% relative humidity, with a 12:12 hour was generated using specific T7 forward and specific reverse light:dark photoperiod. primers. The sequences of the respective primers for ampli fying the sense template for each of the target genes are given 0355 Survival of larvae of T. castaneum over time on in Table 8-MP. A touchdown PCR was performed as follows: artificial diet treated with target TC014 dsRNA was signifi 1 minute at 95°C., followed by 20 cycles of 30 seconds at 95° cantly reduced when compared to diet only control, as shown C., 30 seconds at 55° C. (for MP001, MP002, MP016, MP027 in FIG. 1-TC. and gfp) or 30 seconds at 50° C. (for MP010) with a decrease Example 8 in temperature of 0.5° C. per cycle and 1 minute at 72°C., followed by 15 cycles of 30 seconds at 95°C., 30 seconds at 45° C. and 1 minute at 72° C. followed by 10 minutes at 72° Myzus persicae (Green Peach Aphid) C. The anti-sense T7 template was generated using specific 0356 A. Cloning Myzus persicae Partial Sequences forward and specific T7 reverse primers in a PCR reaction 0357 High quality, intact RNA was isolated from nymphs with the same conditions as described above. The sequences of Myzus persicae (green peach aphid; source: Dr. Rachel of the respective primers for amplifying the anti-sense tem Down, Insect & Pathogen Interactions, Central Science Labo plate for each of the target genes are given in Table 8-MP. The ratory, Sand Hutton, York, YO41 1LZ, UK) using TRIZol resulting PCR products were analyzed on agarose gel and Reagent (Cat. Nr. 15596-026/15596-018, Invitrogen, Rock purified by PCR purification kit (Qiaquick PCR Purification ville, Md., USA) following the manufacturer's instructions. Kit, Cat. Nr. 28106, Qiagen) and NaClO precipitation. The Genomic DNA present in the RNA preparation was removed generated T7 forward and reverse templates were mixed to be by DNase treatment following the manafacturers instruc transcribed and the resulting RNA strands were annealed, tions (Cat. Nr. 1700, Promega). cDNA was generated using a DNase and RNase treated, and purified by sodium acetate, commercially available kit (SuperScriptTM III Reverse Tran following the manufacturers instructions. The sense Strand scriptase, Cat. Nr. 18080044. Invitrogen, Rockville, Md., of the resulting dsRNA for each of the target genes is given in USA) following the manufacturer's instructions. Table 8-MP. US 2014/0373.197 A1 Dec. 18, 2014 32
0363 C. Recombination of Myzus persicae Genes into the the diet was prepared as a 5x concentrate Stock as follows: in Plant Vector pK7GWIWG2D(II) mg/L, amino benzoic acid 100, ascorbic acid 1000, biotin 1, 0364 Since the mechanism of RNA interference operates calcium panthothenate 50, choline chloride 500, folic acid 10. through dsRNA fragments, the target nucleotide sequences of myoinositol 420, nicotinic acid 100, pyridoxine hydrochlo the target genes, as selected above, were cloned in anti-sense ride 25, riboflavin 5, thiamine hydrochloride 25. The ribofla and sense orientation, separated by the intron-CmR-intron, whereby CmR is the chloramphenicol resistance marker, to vin was dissolved in 1 ml HO at 50° C. and then added to the form a dsRNA hairpin construct. These hairpin constructs Vitamin mix stock. The vitamin mix was aliquoted in 20 ml were generated using the LR recombination reaction between per aliquot and stored at -20°C. One aliquot of vitamin mix an attL-containing entry clone (see Example 8A) and an was added to the amino acid solution. Sucrose and MgSO. attR-containing destination vector (pK7GWIWG2D(II)). 7HO was added with the following amounts to the mix: 20 g The plant vector pK7GWIWG2D(II) was obtained from the and 242 mg, respectively. Trace metal stock Solution was VIB/Plant Systems Biology with a Material Transfer Agree prepared as follows: in mg/100 ml, CuSO4.5H2O4.7, FeCl. ment. LR recombination reaction was performed by using LR 6HO 44.5, MnO1.4H2O 6.5, NaCl 25.4, ZnCl 8.3. Ten ml ClonaseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) of the trace metal solution and 250 mg KHPO was added to following the manufacturers instructions. These cloning the diet and Milli-Q water was added to a final liquid diet experiments resulted in a hairpin construct for each of the volume of 100 ml. The pH of the diet was adjusted to 7 with MP001, MP002, MP010, MP016 and MP026 genes, having 1 M KOH solution. The liquid diet was filter-sterilised the promoter—sense-intron-CmR-intron-antisense orienta through an 0.22 um filter disc (Millipore). tion and wherein the promoter is the plant operable 35S promoter. The binary vectorpK7GWIWG2D(II) with the 35S 0374 Green peach aphids (Myzus persicae; source: Dr. promoter is Suitable for transformation into A. tumefaciens. Rachel Down, Insect & Pathogen Interactions, Central Sci 0365. A digest with restriction enzyme Alwa41 was done ence Laboratory, Sand Hutton, York, YO41 1LZ, UK) were for all the targets cloned into pCR8/GW/topo (see Example reared on 4- to 6-week-old oilseed rape (Brassica napus 8B). The band containing the gene of interest flanked by the variety SW Oban; source: Nick Balaam, Sw Seed Ltd., 49 atti sites using Qiaquick Gel Extraction Kit (Cat. Nr. 28706, North Road, Abington, Cambridge, CB1 6AS, UK) in alu Qiagen) was purified. An amount of 150 ng of purified frag minium-framed cages containing 70 um mesh in a controlled ment and 150 ng pK7GWIWG2D(II) was added together environment chamber with the following conditions: 23+2 with the LR clonase II enzyme and incubated for at least 1 h C. and 60+5% relative humidity, with a 16:8 hours light:dark at 25°C. After proteinase K solution treatment (10 min at 37° photoperiod. C.), the whole recombination mix was transformed into Top 10 chemically competent cells. Positive clones were selected 0375 One day prior to the start of the bioassay, adults were by restriction digest analysis. The complete sequence of the collected from the rearing cages and placed on fresh detached hairpin construct for: oilseed rape leaves in a Petri dish and left overnight in the 0366 MP001 (sense-intron-CmR-intron-antisense) is insect chamber. The following day, first-instar nymphs were represented in SEQID NO 1066: picked and transferred to feeding chambers. A feeding cham 0367 MP002 (sense-intron-CmR-intron-antisense) is ber comprised of 10 first instar nymphs placed in a small Petri represented in SEQID NO 1067; dish (with diameter 3 cm) covered with a single layer of thinly 0368 MP010 (sense-intron-CmR-intron-antisense) is stretched parafilm Monto which 50 ul of diet was added. The represented in SEQID NO 1068; chamber was sealed with a second layer of parafilm and 0369 MPO16 (sense-intron-CmR-intron-antisense) is incubated under the same conditions as the adult cultures. represented in SEQID NO 1069; Diet with dsRNA was refreshed every other day and the 0370 MP027 (sense-intron-CmR-intron-antisense) is insects survival assessed on day 8 i.e. 8" day post bioassay represented in SEQID NO 1070. start. Per treatment, 5 bioassay feeding chambers (replicates) 0371 Table 9-MP provides complete sequences for each were set up simultaneously. Test and control (gfp) dsRNA hairpin construct. Solutions were incorporated into the diet to a final concentra 0372 D. Laboratory Trials to Test dsRNA Targets Using tion of 2 g/ul. The feeding chambers were kept at 23+2°C. Liquid Artificial Diet for Activity Against Myzus persicae and 60+5% relative humidity, with a 16:8 hours light:dark 0373) Liquid artificial diet for the green peach aphid, photoperiod. A Mann-Whitney test was determined by Myzus persicae, was prepared based on the diet Suitable for GraphPad Prism version 4 to establish whether the medians pea aphids (Acyrthosiphon pisum), as described by Febvay et do differ significantly between target 27 (MP027) and gfp al. (1988) Influence of the amino acid balance on the dsRNA. improvement of an artificial diet for a biotype of Acyrthosi 0376. In the bioassay, feeding liquid artificial diet supple phon pisum (Homoptera:Aphididae). Can. J. Zool. 66: 2449 mented with intact naked dsRNA from target 27 (SEQID NO 2453, but with some modifications. The amino acids com 1061) to nymphs of Myzus persicae using a feeding chamber, ponent of the diet was prepared as follows: in mg/100 ml, resulted in a significant increase in mortality, as shown in alanine 178.71, beta-alanine 6.22, arginine 244.9, asparagine FIG. 1. Average percentage Survivors for target 27, gfp 298.55, aspartic acid 88.25, cysteine 29.59, glutamic acid dsRNA and diet only treatment were 2, 34 and 82, respec 149.36, glutamine 445.61, glycine 166.56, histidine 136.02, tively. Comparison of target 027 with gfp dsRNA groups isoleucine 164.75, leucine 231.56, lysine hydrochloride 351. using the Mann-Whitney test resulted in an one-tailed P-value 09, methionine 72.35, ornithine (HCl) 9.41, phenylalanine of 0.004 which indicates that the median of target 027 is 293, proline 129.33, serine 124.28, threonine 127.16, tryp significantly different (P<0.05) from the expected larger tophane 42.75, tyrosine 38.63, L-valine 190.85. The amino median of gfp dsRNA. The green peach aphids on the liquid acids were dissolved in 30 ml Milli-Q HO except for tyrosine diet with incorporated target 27 dsRNA were noticeably which was first dissolved in a few drops of 1 M HCl before smaller than those that were fed on diet only or with gfp adding to the amino acid mix. The vitamin mix component of dsRNA control (data not presented). US 2014/0373.197 A1 Dec. 18, 2014
0377 E. Laboratory Trials of Myzus periscae (Green C.; for NL004: 10 minutes at 95°C., followed by 40 cycles of Peach Aphid) Infestation on Transgenic Arabidopsis thaliana 30 seconds at 95°C., 1 minute at 51° C. and 1 minute at 72° Plants C.; for NL005: 10 minutes at 95°C., followed by 40 cycles of 30 seconds at 95°C., 1 minute at 54° C. and 1 minute at 72° Generation of Transgenic Plants C., followed by 10 minutes at 72° C.; for NL006: 10 minutes 0378 Arabidopsis thaliana plants were transformed using at 95°C., followed by 40 cycles of 30 seconds at 95°C., 1 the floral dip method (Clough and Bent (1998) Plant Journal minute at 55° C. and 3 minute 30 seconds at 72°C., followed 16:735-743). Aerial parts of the plants were incubated for a by 10 minutes at 72° C.; for NL007: 10 minutes at 95°C., few seconds in a solution containing 5% Sucrose, resus followed by 40 cycles of 30 seconds at 95°C., 1 minute at 54° pended Agrobacterium tumefaciens strain C58C1 Rif cells C. and 1 minute 15 seconds at 72°C., followed by 10 minutes from an overnight culture and 0.03% of the surfactant Silwet at 72°C.; for NL008&NL014: 10 minutes at 95°C., followed L-77. After inoculation, plants were covered for 16 hours with by 40 cycles of 30 seconds at 95°C., 1 minute at 53° C. and a transparent plastic to maintain humidity. To increase the 1 minute at 72° C., followed by 10 minutes at 72° C.; for transformation efficiency, the procedure was repeated after NL009, NL011, NL012 & NL019; 10 minutes at 95° C., one week. Watering was stopped as seeds matured and dry followed by 40 cycles of 30 seconds at 95°C., 1 minute at 55° seeds were harvested and cold-treated for two days. After C. and 1 minute at 72°C., followed by 10 minutes at 72°C.; sterilization, seeds were plated on a kanamycin-containing for NL010: 10 minutes at 95°C., followed by 40 cycles of 30 seconds at 95°C., 1 minute at 54°C. and 2 minute 30 seconds growth medium for selection of transformed plants. at 72° C., followed by 10 minutes at 72° C.; for NL013: 10 0379 The selected plants are transferred to soil for opti minutes at 95°C., followed by 40 cycles of 30 seconds at 95° mal T2 seed production. C., 1 minute at 54° C. and 1 minute 10 seconds at 72° C., Bioassay followed by 10 minutes at 72° C.; for NL015 & NL016:10 minutes at 95°C., followed by 40 cycles of 30 seconds at 95° 0380 Transgenic Arabidopsis thaliana plants are selected C., 1 minute at 54° C. and 1 minute 40 seconds at 72° C., by allowing the segregating T2 seeds to germinate on appro followed by 10 minutes at 72° C.; for NL018: 10 minutes at priate selection medium. When the roots of these transgenics 95° C., followed by 40 cycles of 30 seconds at 95° C., 1 are well-established they are then transferred to fresh artifi minute at 54°C. and 1 minute 35 seconds at 72°C., followed cial growth medium or soil and allowed to grow under opti by 10 minutes at 72° C.; for NL021, NL022 & NL027: 10 mal conditions. Whole transgenic plants are tested against minutes at 95°C., followed by 40 cycles of 30 seconds at 95° nymphs of the green peach aphid (Myzus persicae) to show C., 1 minute at 54° C. and 1 minute 45 seconds at 72° C., (1) a significant resistance to plant damage by the feeding followed by 10 minutes at 72° C. The resulting PCR frag nymph, (2) increased nymphal mortality, and/or (3) decreased ments were analyzed on agarose gel, purified (QIAquick Gel weight of nymphal Survivors (or any other aberrant insect Extraction kit, Cat. Nr. 28706, Qiagen), cloned into the pCR8/ development). GW/topo vector (Cat. Nr. K2500 20, Invitrogen), and sequenced. The sequences of the resulting PCR products are Example 9 represented by the respective SEQID NOs as given in Table 2-NL and are referred to as the partial sequences. The corre Nilaparvata lugens (Brown Plant Hopper) sponding partial amino acid sequences are represented by the 0381 A. Cloning Nilaparvata lugens Partial Sequences respective SEQID NOs as given in Table 3-NL. 0382 From high quality total RNA of Nilaparvata lugens 0385 B. Cloning of a Partial Sequence of the Nilaparvata (source: Dr. J. A. Gatehouse, Dept. Biological Sciences, lugens NL023 Gene Via EST Sequence Durham University, UK) clNA was generated using a com 0386 From high quality total RNA of Nilaparvata lugens mercially available kit (SuperScriptTM III Reverse Tran (source: Dr. J. A. Gatehouse, Dept. Biological Sciences, scriptase, Cat N. 18080044, Invitrogen, Rockville, Md., Durham University, UK) clNA was generated using a com USA) following the manufacturer's protocol. mercially available kit (SuperScriptTM III Reverse Tran 0383 To isolate cDNA sequences comprising a portion of scriptase, Cat N. 18080044, Invitrogen, Rockville, Md., the Nilaparvata lugens NL001, NL002, NL003, NL004, USA) following the manufacturer's protocol. NL005, NL006, NL007, NL008, NL009, NL010, NL011, 0387. A partial clNA sequence, NL023, was amplified NL012, NL013, NL014, NL015, NL016, NLO18, NL019, from Nilaparvata lugens cDNA which corresponded to a NL021, NL022, and NL027 genes, a series of PCR reactions Nilaparvata lugens EST sequence in the public database with degenerate primers were performed using Amplitaq Genbank with accession number CAH65679.2. To isolate Gold (Cat N. N8080240; Applied Biosystems) following the cDNA sequences comprising a portion of the NL023 gene, a manufacturer's protocol. series of PCR reactions with EST based specific primers were 0384 The sequences of the degenerate primers used for performed using PerfectShot TM EXTaq (Cat N. RR005A, amplification of each of the genes are given in Table 2-NL. Takara Bio Inc.) following the manafacturer's protocol. These primers were used in respective PCR reactions with the (0388 For NL023, the specific primers oGBKW002 and following conditions: for NL001: 5 minutes at 95°C., fol oGBKW003 (represented herein as SEQ ID NO 1157 and lowed by 40 cycles of 30 seconds at 95°C., 1 minute at 55° C. SEQ ID NO 1158, respectively) were used in two indepen and 1 minute at 72° C., followed by 10 minutes at 72° C.: for dent PCR reactions with the following conditions: 3 minutes NL002: 3 minutes at 95° C., followed by 40 cycles of 30 at 95°C., followed by 30 cycles of 30 seconds at 95°C., 30 seconds at 95°C., 1 minute at 55° C. and 1 minute at 72°C., seconds at 56° C. and 2 minutes at 72°C., followed by 10 followed by 10 minutes at 72°C.; for NL003: 3 minutes at 95° minutes at 72°C. The resulting PCR products were analyzed C., followed by 40 cycles of 30 seconds at 95°C., 1 minute at onagarose gel, purified (QIAquick R. Gel Extraction Kit; Cat. 61° C. and 1 minute at 72° C., followed by 10 minutes at 72° No. 28706, Qiagen), cloned into the pCR4-TOPO vector (Cat US 2014/0373.197 A1 Dec. 18, 2014 34
N. K4575-40, Invitrogen) and sequenced. The consensus P1700, Promega). First two separate single 5'T7 RNA poly sequence resulting from the sequencing of both PCR products merase promoter templates were generated in two separate is herein represented by SEQID NO 1111 and is referred to as PCR reactions, each reaction containing the target sequence the partial sequence of the NL023 gene. The corresponding in a different orientation relative to the T7 promoter. Forgfp. partial amino acid sequence is herein represented as SEQID the sense T7 template was generated using the specific T7 FW NO 1112. primer oGAU183 and the specific RV primer oGAU182 (rep 0389 C. dsRNA Production of Nilaparvata lugens Genes resented herein as SEQ ID NO 236 and SEQ ID NO 237, 0390 dsRNA was synthesized in milligram amounts respectively) in a PCR reaction with the following conditions: using the commercially available kit T7 RibomaxTM Express 4 minutes at 95°C., followed by 35 cycles of 30 seconds at RNAi System (Cat. Nr. P1700, Promega). First two separate 95°C., 30 seconds at 55° C. and 1 minute at 72°C., followed single 5'T7 RNA polymerase promoter templates were gen by 10 minutes at 72° C. The anti-sense T7 template was erated in two separate PCR reactions, each reaction contain generated using the specific FW primer oGAU181 and the ing the target sequence in a differentorientation relative to the specific T7 RV primer oGAU184 (represented herein as SEQ T7 promoter. ID NO 238 and SEQ ID NO 239, respectively) in a PCR 0391) For each of the target genes, the sense T7 template reaction with the same conditions as described above. The was generated using specific T7 forward and specific reverse resulting PCR products were analyzed on agarose gel and primers. The sequences of the respective primers for ampli purified (QIAquick R. PCR Purification Kit; Cat. N. 28106, fying the sense template for each of the target genes are given Qiagen). The generated T7 FW and RV templates were mixed in Table 8-NL. The conditions in the PCR reactions were as to be transcribed and the resulting RNA strands were follows: for NL001 & NL002: 4 minutes at 94° C., followed annealed, DNase and RNase treated, and purified by precipi by 35 cycles of 30 seconds at 94° C., 30 seconds at 60° C. and tation with sodium acetate and isopropanol, following the 1 minute at 72° C., followed by 10 minutes at 72° C.; for manufacturer's protocol, but with the following modification: NL003: 4 minutes at 94° C., followed by 35 cycles of 30 RNA peppet is washed twice in 70% ethanol. The sense seconds at 94°C., 30 seconds at 66° C. and 1 minute at 72°C., strands of the resulting dsRNA is herein represented by SEQ followed by 10 minutes at 72°C.; for NL004, NL006, NL008, ID NO 235. NL009, NL010& NL019.4 minutes at 95°C., followed by 35 0393 D. Laboratory Trials to Screen dsRNA Targets cycles of 30 seconds at 95°C., 30 seconds at 54° C. and 1 Using Liquid Artificial Diet for Activity Against Nilaparvata minute at 72°C., followed by 10 minutes at 72°C.; for NL005 lugens & NL016: 4 minutes at 95°C., followed by 35 cycles of 30 0394 Liquid artificial diet (MMD-1) for the rice brown seconds at 95°C., 30 seconds at 57°C. and 1 minute at 72°C., planthopper, Nilaparvata lugens, was prepared as described followed by 10 minutes at 72° C.; for NL007 & NL014: 4 by Koyama (1988) Artificial rearing and nutritional physi minutes at 95°C., followed by 35 cycles of 30 seconds at 95° ology of the planthoppers and leafhoppers (Homoptera: Del C., 30 seconds at 51° C. and 1 minute at 72°C., followed by phacidae and Deltocephalidae) on a holidic diet. JARO 22: 10 minutes at 72°C.; for NL011, NL012&NL022: 4 minutes 20-27, but with a modification in final concentration of diet at 95°C., followed by 35 cycles of 30 seconds at 95°C., 30 component Sucrose: 14.4% (weight over Volume) was used. seconds at 53° C. and 1 minute at 72° C., followed by 10 Diet components were prepared as separate concentrates: 10x minutes at 72° C.; for NL013, NL015, NL018 & NL021: 4 mineral stock (stored at 4°C.), 2xamino acid stock (stored at minutes at 95°C., followed by 35 cycles of 30 seconds at 95° -20°C.) and 10x vitamin stock (stored at -20°C.). The stock C., 30 seconds at 55° C. and 1 minute at 72°C., followed by components were mixed immediately prior to the start of a 10 minutes at 72°C.; for NL023 & NL027: 4 minutes at 95° bioassay to 4/3x concentration to allow dilution with the test C., followed by 35 cycles of 30 seconds at 95°C., 30 seconds dsRNA solution (4x concentration), pH adjusted to 6.5, and at 52° C. and 1 minute at 72°C., followed by 10 minutes at 72° filter-sterilised into approximately 500 ul aliquots. C. The anti-sense T7 template was generated using specific 0395 Rice brown planthopper (Nilaparvata lugens) was forward and specific T7 reverse primers in a PCR reaction reared on two-to-three month old rice (Oryza sativa cv Tai with the same conditions as described above. The sequences chung Native 1) plants in a controlled environment chamber: of the respective primers for amplifying the anti-sense tem 27+2°C., 80% relative humidity, with a 16:8 hours light:dark plate for each of the target genes are given in Table 8-NL. The photoperiod. A feeding chamber comprised 10 first or second resulting PCR products were analyzed on agarose gel and instar nymphs placed in a small petri dish (with diameter 3 purified by PCR purification kit (Qiaquick PCR Purification cm) covered with a single layer of thinly stretched parafilm M Kit, Cat. Nr. 28106, Qiagen). The generated T7 forward and onto which 50 ul of diet was added. The chamber was sealed reverse templates were mixed to be transcribed and the result with a second layer of parafilm and incubated under the same ing RNA strands were annealed, DNase and RNase treated, conditions as the adult cultures but with no direct light expo and purified by Sodium acetate, following the manufacturers sure. Diet with dsRNA was refreshed every other day and the instructions, but with the following modification: RNA pep insects survival assessed daily. Per treatment, 5 bioassay pet is washed twice in 70% ethanol. The sense strand of the feeding chambers (replicates) were set up simultaneously. resulting dsRNA for each of the target genes is given in Table Test and control (gfp) dsRNA solutions were incorporated 8-NL. into the diet to a final concentration of 2 mg/ml. The feeding 0392 The template DNA used for the PCR reactions with chambers were kept at 27+2°C., 80% relative humidity, with T7 primers on the green fluorescent protein (gfp) control was a 16:8 hours light:dark photoperiod. Insect survival data were the plasmid pPD96.12 (the Fire Lab, http://genome-www. analysed using the Kaplan-Meier Survival curve model and Stanford.edu/group/fire?), which contains the wild-type gfp the Survival between groups were compared using the logrank coding sequence interspersed by 3 synthetic introns. Double test (Prism version 4.0). Stranded RNA was synthesized using the commercially avail 0396. Feeding liquid artificial diet supplemented with able kit T7 RiboMAXTM Express RNAi System (Cat. N. intact naked dsRNAS to Nilaparvata lugens in vitro using a US 2014/0373.197 A1 Dec. 18, 2014 feeding chamber resulted in significant increases in nymphal Script TM III Reverse Transcriptase, Cat. Nr. 18080044, Invit mortalities as shown in four separate bioassays (FIGS. 1(a)- rogen, Rockville, Md., USA) following the manufacturers (d)-NL. Tables 10-NL(a)-(d)) (Durham University). These instructions. results demonstrate that dsRNAs corresponding to different 04.04 To isolate cDNA sequences comprising a portion of essential BPH genes showed significant toxicity towards the the CS001, CS002, CS003, CS006, CS007, CS009, CS011, rice brown planthopper. CS013, CS014, CS015, CS016 and CS018 genes, a series of 0397 Effect of gfp dsRNA on BPH survival in these bio PCR reactions with degenerate primers were performed using assays is not significantly different to Survival on diet only Amplitaq Gold (Cat. Nr. N8080240, Applied Biosystems) 0398 Tables 10-NL(a)-(d) show a summary of the sur following the manafacturers instructions. vival of Nilaparvata lugens on artificial diet Supplemented 04.05 The sequences of the degenerate primers used for with 2 mg/ml (final concentration) of the following targets; in amplification of each of the genes are given in Table 2-CS. Table 10-NL(a): NL002, NL003, NL005, NL010; in Table These primers were used in respective PCR reactions with the 10-NL(b): NL009, NL016; in Table 10-NL(c): NL014, following conditions: 10 minutes at 95°C., followed by 40 NL018; and in Table 10-NL(d): NL013, NL015, NL021. In cycles of 30 seconds at 95°C., 1 minute at 55° C. and 1 minute the survival analysis column, the effect of RNAi is indicated at 72°C., followed by 10 minutes at 72°C. The resulting PCR as follows: +-significantly decreased Survival compared to fragments were analyzed on agarose gel, purified (QIAquick gfp dsRNA control (alpha<0.05); --no significant difference Gel Extraction kit, Cat. Nr. 28706, Qiagen), cloned into the in survival compared to gfp dsRNA control. Survival curves pCR4/TOPO vector (Cat. Nr. K2500-20, Invitrogen), and were compared (between diet only and diet Supplemented sequenced. The sequences of the resulting PCR products are with test dsRNA, gfp dsRNA and test dsRNA, and diet only represented by the respective SEQID NOs as given in Table and gfp dsRNA) using the logrank test. 2-CS and are referred to as the partial sequences. The corre 0399 E. Laboratory Trials to Screen dsRNAs at Different sponding partial amino acid sequences are represented by the Concentrations Using Artificial Diet for Activity Against respective SEQID NOs as given in Table 3-CS. Nilaparvata lugens 0406 B. dsRNA Production of the Chilo suppressalis 0400 Fifty ul of liquid artificial diet supplemented with Genes different concentrations of target NL002 dsRNA, namely 1, 0407 dsRNA was synthesized in milligram amounts 0.2, 0.08, and 0.04 mg/ml (final concentration), was applied using the commercially available kit T7 RibomaxTM Express to the brown planthopper feeding chambers. Diet with RNAi System (Cat. Nr. P1700, Promega). First two separate dsRNA was refreshed every other day and the insects sur single 5'T7 RNA polymerase promoter templates were gen vival assessed daily. Per treatment, 5 bioassay feeding cham erated in two separate PCR reactions, each reaction contain bers (replicates) were set up simultaneously. The feeding ing the target sequence in a different orientation relative to the chambers were kept at 27+2°C., 80% relative humidity, with T7 promoter. a 16:8 hours light:dark photoperiod. Insect survival data were 0408 For each of the target genes, the sense T7 template analysed using the Kaplan-Meier Survival curve model and was generated using specific T7 forward and specific reverse the Survival between groups were compared using the logrank primers. The sequences of the respective primers for ampli test (Prism version 4.0). fying the sense template for each of the target genes are given 04.01 Feeding liquid artificial diet supplemented with in Table 8-CS. The conditions in the PCR reactions were as intact naked dsRNAs of target NL002 at different concentra follows: 4 minutes at 95° C., followed by 35 cycles of 30 tions resulted in significantly higher BPH mortalities at final seconds at 95°C., 30 seconds at 55° C. and 1 minute at 72°C., concentrations of as low as 0.04 mg dsRNA per ml diet when followed by 10 minutes at 72°C. The anti-sense T7 template compared with survival on diet only, as shown in FIG. 2-NL was generated using specific forward and specific T7 reverse and Table 11-NL. Table 11-NL summarizes the survival of primers in a PCR reaction with the same conditions as Nilaparvata lugens artificial diet feeding trial Supplemented described above. The sequences of the respective primers for with 1, 0.2, 0.08, & 0.04 mg/ml (final concentration) of target amplifying the anti-sense template for each of the target genes NL002. In the survival analysis column the effect of RNAi is are given in Table 8-CS. The resulting PCR products were indicated as follows: +-significantly decreases Survival com analyzed on agarose gel and purified by PCR purification kit pared to diet only control (alpha<0.05); --no significant dif (Qiaquick PCR Purification Kit, Cat. Nr. 28106, Qiagen) and ferences in survival compared to diet only control. Survival NaClO precipitation. The generated T7 forward and reverse curves were compared using the logrank test. templates were mixed to be transcribed and the resulting RNA strands were annealed, DNase and RNase treated, and Example 10 purified by Sodium acetate, following the manufacturers instructions. The sense strand of the resulting dsRNA for each Chilo suppressalis (Rice Striped Stem Borer) of the target genes is given in Table 8-CS. 04.09 C. Recombination of the Chilo suppressalis Genes 0402 A. Cloning of Partial Sequence of the Chilo sup into the Plant Vector pK7GWIWG2D(II) pressalis Genes Via Family PCR 0410 Since the mechanism of RNA interference operates 0403. High quality, intact RNA was isolated from the 4 through dsRNA fragments, the target nucleotide sequences of different larval stages of Chilo suppressalis (rice striped stem the target genes, as selected above, are cloned in anti-sense borer) using TRIZol Reagent (Cat. Nr. 15596-026/15596 and sense orientation, separated by the intron-CmR-intron, 018, Invitrogen, Rockville, Md., USA) following the manu whereby CmR is the chloramphenicol resistance marker, to facturers instructions. Genomic DNA present in the RNA form a dsRNA hairpin construct. These hairpin constructs are preparation was removed by DNase treatment following the generated using the LR recombination reaction between an manafacturers instructions (Cat. Nr. 1700, Promega). cDNA att-containing entry clone (see Example 10A) and an attR was generated using a commercially available kit (Super containing destination vector (pK7GWIWG2D(II)). The US 2014/0373.197 A1 Dec. 18, 2014 36 plant vector pK7GWIWG2D(II) is obtained from the VIB/ Two neonates are transferred from the rearing tray to each Plant Systems Biology with a Material Transfer Agreement. dsRNA treated leaf section (24 larvae per treatment). After 4 LR recombination reaction is performed by using LR Clo and 8 days, the larvae are transferred to fresh treated rice leaf naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol sections. The number of live and dead larvae are assessed on lowing the manufacturers instructions. These cloning days 4, 8 and 12; any abnormalities are also recorded. experiments result in a hairpin construct for each of the target genes, having the promoter-sense-intron-CmR-intron-anti Example 11 sense orientation, and wherein the promoter is the plant oper able 35S promoter. The binary vector pK7GWIWG2D(II) Plutella xylostella (Diamondback Moth) with the 35S promoter is suitable for transformation into A. 0416 A. Cloning of a Partial Sequence of the Plutella tumefaciens. xylostella 0411 Restriction enzyme digests were carried out on 0417 High quality, intact RNA was isolated from all the pCR8/GW/TOPO plasmids containing the different targets different larval stages of Plutella xylostella (Diamondback (see Example 10B). The band containing the gene of interest moth; Source: Dr. Lara Senior, Insect Investigations Ltd., flanked by the attl sites using Qiaquick Gel Extraction Kit Capital Business Park, Wentloog, Cardiff, CF3 2PX, Wales, (Cat. Nr. 28706, Qiagen) is purified. An amount of 150 ng of UK) using TRIZol Reagent (Cat. Nr. 15596-026/15596-018, purified fragment and 150 ng pK7GWIWG2D(II) is added Invitrogen, Rockville, Md., USA) following the manufactur together with the LR clonase II enzyme and incubated for at er's instructions. Genomic DNA present in the RNA prepa least 1 h at 25°C. After proteinase K solution treatment (10 ration was removed by DNase treatment following the manu min at 37° C.), the whole recombination mix is transformed facturer's instructions (Cat. Nr. 1700, Promega). cDNA was into Top 10 chemically competent cells. Positive clones are generated using a commercially available kit (SuperScriptTM selected by restriction digest analyses. III Reverse Transcriptase, Cat. Nr. 18080044. Invitrogen, 0412 D. Laboratory Trials to Test dsRNA Targets. Using Rockville, Md., USA) following the manufacturer's instruc Artificial Diet for Activity Against Chilo suppressalis Larvae tions. 0413 Rice striped stem borers, Chilo suppressalis, (ori 0418. To isolate cDNA sequences comprising a portion of gin: Syngenta, Stein, Switzerland) were maintained on a the PX001, PX009, PX010, PXO15, PXO16 genes, a series of modified artificial diet based on that described by Kamano PCR reactions with degenerate primers were performed using and Sato, 1985 (in: Handbook of Insect Rearing. Volumes I & Amplitaq Gold (Cat. Nr. N8080240, Applied Biosystems) II. PSingh and RF Moore, eds., Elsevier Science Publishers, following the manufacturers instructions. The sequences of Amsterdam and New York, 1985, pp. 448). Briefly, a litre diet the degenerate primers used for amplification of each of the was made up as follows: 20 g of agar added to 980 ml of genes are given in Table 2-PX. These primers were used in Milli-Q water and autoclaved; the agar solution was cooled respective PCR reactions with the following conditions: 10 down to approximately 55° C. and the remaining ingredients minutes at 95°C., followed by 40 cycles of 30 seconds at 95° were added and mixed thoroughly: 40 g corn flour (Polenta), C., 1 minute at 50° C. and 1 minute and 30 seconds at 72°C., 20 g cellulose, 30 g. Sucrose, 30 g casein, 20 g wheat germ followed by 7 minutes at 72° C. (for PX001, PX009, PX015, (toasted), 8 g Wesson salt mixture, 12 g VanderZant vitamin PX016); 10 minutes at 95°C., followed by 40 cycles of 30 mix, 1.8 g. Sorbic acid, 1.6 g nipagin (methylparaben), 0.3 g seconds at 95°C., 1 minute at 54° C. and 2 minute and 30 aureomycin, 0.4 g cholesterol and 0.6 g L-cysteine. The diet seconds at 72° C., followed by 7 minutes at 72° C. (for was cooled down to approx. 45° C. and poured into rearing PX010). The resulting PCR fragments were analyzed on aga trays or cups. The diet was left to set in a horizontal laminair rose gel, purified (QIAquick Gel Extraction kit, Cat. Nr. flow cabin. Rice leaf sections with oviposited eggs were 28706, Qiagen), cloned into the pCR8/GW/TOPO vector removed from a cage housing adult moths and pinned to the (Cat. Nr. K2500-20, Invitrogen) and sequenced. The Solid diet in the rearing cup ortray. Eggs were left to hatch and sequences of the resulting PCR products are represented by neonate larvae were available for bioassays and the mainte the respective SEQ ID NOs as given in Table 2-PX and are nance of the insect cultures. During the trials and rearings, the referred to as the partial sequences. The corresponding partial conditions were 28+2° C. and 80+5% relative humidity, with amino acid sequence are represented by the respective SEQ a 16:8 hour light:dark photoperiod. ID NOs as given in Table 3-PX. 0414. The same artificial diet is used for the bioassays but 0419 B. dsRNA Production of the Plutella xylostella in this case the diet is poured equally in 24 multiwell plates, Genes with each well containing 1 ml diet. Once the diet is set, the 0420 dsRNA was synthesized in milligram amounts test formulations are applied to the diet's surface (2 cm), at using the commercially available kit T7 RibomaxTM Express the rate of 50 ul of 1 lug/ul dsRNA of target. The dsRNA RNAi System (Cat. Nr. P1700, Promega). First two separate solutions are left to dry and two first instar moth larvae are single 5'T7 RNA polymerase promoter templates were gen placed in each well. After 7 days, the larvae are transferred to erated in two separate PCR reactions, each reaction contain fresh treated diet in multiwell plates. At day 14 (i.e. 14 days ing the target sequence in a different orientation relative to the post bioassay start) the number of live and dead insects is T7 promoter. recorded and examined for abnormalities. Twenty-four larvae 0421 For each of the target genes, the sense T7 template in total are tested per treatment. was generated using specific T7 forward and specific reverse 0415. An alternative bioassay is performed in which primers. The sequences of the respective primers for ampli treated rice leaves are fed to neonate larvae of the rice striped fying the sense template for each of the target genes are given stem borer. Small leafsections of Indicarice variety Taichung in Table 8-PX. The conditions in the PCR reactions were as native 1 are dipped in 0.05% TritonX-100 solution containing follows: 1 minute at 95° C., followed by 20 cycles of 30 1 g/ul of target dsRNA, left to dry and each section placed in seconds at 95°C., 30 seconds at 60° C. (-0.5° C./cycle) and a well of a 24 multiwell plate containing gellified 2% agar. 1 minute at 72°C., followed by 15 cycles of 30 seconds at 95° US 2014/0373.197 A1 Dec. 18, 2014 37
C., 30 seconds at 50° C. and 1 minute at 72°C., followed by formulations are allowed to dry and one first instar moth larva 10 minutes at 72°C. The anti-sense T7 template was gener is placed in each tube. The larva is placed on the surface of the ated using specific forward and specific T7 reverse primers in diet in the lid and the tube carefully closed. The tubes are a PCR reaction with the same conditions as described above. stored upside down, on their lids such that each larva remains The sequences of the respective primers for amplifying the on the surface of the diet. Twice weekly the larvae are trans anti-sense template for each of the target genes are given in ferred to new Eppendorf tubes with fresh diet. The insects are Table 8-PX. The resulting PCR products were analyzed on provided with treated diet for the first two weeks of the trial agarose gel and purified by PCR purification kit (Qiaquick and thereafter with untreated diet. PCR Purification Kit, Cat. Nr. 28106, Qiagen) and NaClO. 0428 Assessments are made twice weekly for a total of 38 precipitation. The generated T7 forward and reverse tem days at which point all larvae are dead. At each assessment the plates were mixed to be transcribed and the resulting RNA insects are assessed as live or dead and examined for abnor strands were annealed, DNase and RNase treated, and puri malities. Forty single larva replicates are performed for each fied by sodium acetate, following the manufacturers instruc of the treatments. During the trial the test conditions are 23 to tions. The sense strand of the resulting dsRNA for each of the 26° C. and 50 to 65% relative humidity, with a 16:8 hour target genes is given in Table 8-PX. light:dark photoperiod. 0422 C. Recombination of the Plutella xylostella Genes into the Plant Vector pK7GWIWG2D(II) Example 12 0423. Since the mechanism of RNA interference operates through dsRNA fragments, the target nucleotide sequences of Acheta domesticus (House Cricket) the target genes, as selected above, are cloned in anti-sense 0429 A. Cloning Acheta domesticus Partial Sequences and sense orientation, separated by the intron-CmR-intron, 0430 High quality, intact RNA was isolated from all the whereby CmR is the chloramphenicol resistance marker, to different insect stages of Acheta domesticus (house cricket; form a dsRNA hairpin construct. These hairpin constructs are Source: Dr. Lara Senior, Insect Investigations Ltd., Capital generated using the LR recombination reaction between an Business Park, Wentloog, Cardiff, CF3 2PX, Wales, UK) attL-containing entry clone (see Example 1 1A) and an attR using TRIZol Reagent (Cat. Nr. 15596-026/15596-018, Invit containing destination vector (pK7GWIWG2D(II)). The rogen, Rockville, Md., USA) following the manufacturers plant vector pK7GWIWG2D(II) is obtained from the VIB/ instructions. Genomic DNA present in the RNA preparation Plant Systems Biology with a Material Transfer Agreement. was removed by DNase treatment following the manafactur LR recombination reaction is performed by using LR Clo er's instructions (Cat. Nr. 1700, Promega). cDNA was gen naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol erated using a commercially available kit (SuperScriptTM III lowing the manufacturers instructions. These cloning Reverse Transcriptase, Cat. Nr. 18080044, Invitrogen, Rock experiments result in a hairpin construct for each of the target ville, Md., USA) following the manufacturer's instructions. genes, having the promoter-sense-intron-CmR-intron-anti 0431. To isolate cDNA sequences comprising a portion of sense orientation, and wherein the promoter is the plant oper the AD001, AD002, AD009, AD015 and AD016 genes, a able 35S promoter. The binary vector pK7GWIWG2D(II) series of PCR reactions with degenerate primers were per with the 35S promoter is suitable for transformation into A. formed using Amplitaq Gold (Cat. Nr. N8080240, Applied tumefaciens. Biosystems) following the manafacturers instructions. 0424 Restriction enzyme digests were carried out on 0432. The sequences of the degenerate primers used for pCR8/GW/TOPO plasmids containing the different targets amplification of each of the genes are given in Table 2-AD. (see Example 11B). The band containing the gene of interest These primers were used in respective PCR reactions with the flanked by the attl sites using Qiaquick Gel Extraction Kit following conditions: 10 minutes at 95°C., followed by 40 (Cat. Nr. 28706, Qiagen) is purified. An amount of 150 ng of cycles of 30 seconds at 95°C., 1 minute at 50° C. and 1 minute purified fragment and 150 ng pK7GWIWG2D(II) is added and 30 seconds at 72°C., followed by 7 minutes at 72°C. The together with the LR clonase II enzyme and incubated for at resulting PCR fragments were analyzed on agarose gel, puri least 1 h at 25°C. After proteinase K solution treatment (10 fied (QIAquick Gel Extraction kit, Cat. Nr. 28706, Qiagen), min at 37° C.), the whole recombination mix is transformed cloned into the pCR8/GW/topo vector (Cat. Nr. K2500 20, into Top 10 chemically competent cells. Positive clones are Invitrogen) and sequenced. The sequences of the resulting selected by restriction digest analyses. PCR products are represented by the respective SEQID NOS 0425 D. Laboratory Trials to Test dsRNA Targets. Using as given in Table 2-AD and are referred to as the partial Artificial Diet for Activity Against Plutella xylostella Larvae sequences. The corresponding partial amino acid sequence 0426 Diamond-back moths, Plutella xylostella, were are represented by the respective SEQ ID NOs as given in maintained at Insect Investigations Ltd. (origin: Newcastle Table 3-AD. University, Newcastle-upon-Tyne, UK). The insects were 0433 B. dsRNA Production of the Acheta domesticus reared on cabbage leaves. First instar, mixed sex larvae (ap Genes proximately 1 day old) were selected for use in the trial. 0434 dsRNA was synthesized in milligram amounts Insects were maintained in Eppendorf tubes (1.5 ml capac using the commercially available kit T7 RibomaxTM Express ity). Commercially available Diamond-back moth diet (Bio RNAi System (Cat. Nr. P1700, Promega). First two separate Serv, NJ. USA), prepared following the manafacturers single 5'T7 RNA polymerase promoter templates were gen instructions, was placed in the lid of each tube (0.25 ml erated in two separate PCR reactions, each reaction contain capacity, 8 mm diameter). While still liquid, the diet was ing the target sequence in a different orientation relative to the Smoother over to remove excess and produce an even Surface. T7 promoter. 0427. Once the diet has set the test formulations are 0435 For each of the target genes, the sense T7 template applied to the diet's surface, at the rate of 25 ul undiluted was generated using specific T7 forward and specific reverse formulation (1 lug/ul dsRNA of targets) per replicate. The test primers. The sequences of the respective primers for ampli US 2014/0373.197 A1 Dec. 18, 2014 fying the sense template for each of the target genes are given purified fragment and 150 ng pK7GWIWG2D(II) is added in Table 8-AD. The conditions in the PCR reactions were as together with the LR clonase II enzyme and incubated for at follows: 1 minute at 95° C., followed by 20 cycles of 30 least 1 h at 25°C. After proteinase K solution treatment (10 seconds at 95°C., 30 seconds at 60° C. (-0.5° C./cycle) and min at 37° C.), the whole recombination mix is transformed 1 minute at 72°C., followed by 15 cycles of 30 seconds at 95° into Top 10 chemically competent cells. Positive clones are C., 30 seconds at 50° C. and 1 minute at 72°C., followed by selected by restriction digest analyses. 10 minutes at 72°C. The anti-sense T7 template was gener 0439 D. Laboratory Trials to Test dsRNA Targets. Using ated using specific forward and specific T7 reverse primers in Artificial Diet for Activity Against Acheta domesticus Larvae a PCR reaction with the same conditions as described above. 0440 House crickets, Acheta domesticus, were main The sequences of the respective primers for amplifying the tained at Insect Investigations Ltd. (origin: Blades Biological anti-sense template for each of the target genes are given in Ltd., Kent, UK). The insects were reared on bran pellets and Table 8-AD. The resulting PCR products were analyzed on cabbage leaves. Mixed sex nymphs of equal size and no more agarose gel and purified by PCR purification kit (Qiaquick than 5 days old were selected for use in the trial. Double stranded RNA is mixed with a wheat-based pelleted rodent PCR Purification Kit, Cat. Nr. 28106, Qiagen) and NaClO. diet (rat and mouse standard diet, B & K Universal Ltd., precipitation. The generated T7 forward and reverse tem Grimston, Aldbrough, Hull, UK). The diet, BK001P, contains plates were mixed to be transcribed and the resulting RNA the following ingredients in descending order by weight: strands were annealed, DNase and RNase treated, and puri wheat, soya, wheatfeed, barley, pellet binder, rodent 5 vit min, fied by sodium acetate, following the manufacturers instruc fat blend, dicalcium phosphate, mould carb. The pelleted tions. The sense strand of the resulting dsRNA for each of the rodent diet is finely ground and heat-treated in a microwave target genes is given in Table 8-AD. oven prior to mixing, in order to inactivate any enzyme com 0436 C. Recombination of the Acheta domesticus Genes ponents. All rodent diet is taken from the same batch in order into the Plant Vector pK7GWIWG2D(II) to ensure consistency. The ground diet and dsRNA are mixed 0437. Since the mechanism of RNA interference operates thoroughly and formed into Small pellets of equal weight, through dsRNA fragments, the target nucleotide sequences of which are allowed to dry overnight at room temperature. the target genes, as selected above, are cloned in anti-sense 0441 Double-stranded RNA samples from targets and gfp and sense orientation, separated by the intron-CmR-intron, control at concentrations 10 g/ul were applied in the ratio 1 whereby CmR is the chloramphenicol resistance marker, to g ground diet plus 1 ml dsRNA solution, thereby resulting in form a dsRNA hairpin construct. These hairpin constructs are an application rate of 10 mg dsRNA per g pellet. Pellets are generated using the LR recombination reaction between an replaced weekly. The insects are provided with treated pellets attL-containing entry clone (see Example 12A) and an attR for the first three weeks of the trial. Thereafter untreated containing destination vector (pK7GWIWG2D(II)). The pellets are provided. Insects are maintained within lidded plant vector pK7GWIWG2D(II) is obtained from the VIB/ plastic containers (9 cm diameter, 4.5 cm deep), ten per con Plant Systems Biology with a Material Transfer Agreement. tainer. Each arena contains one treated bait pellet and one LR recombination reaction is performed by using LR Clo water source (damp cotton wool ball), each placed in a sepa naseTM II enzyme mix (Cat. Nr. 11791-020, Invitrogen) fol rate small weigh boat. The water is replenished ad lib lowing the manufacturers instructions. These cloning throughout the experiment. experiments result in a hairpin construct for each of the target 0442 Assessments are made at twice weekly intervals, genes, having the promoter-sense-intron-CmR-intron-anti with no more than four days between assessments, until all sense orientation, and wherein the promoter is the plant oper the control insects had either died or moulted to the adult able 35S promoter. The binary vector pK7GWIWG2D(II) stage (84 days). At each assessment the insects areassessed as with the 35S promoter is suitable for transformation into A. live or dead, and examined for abnormalities. From day 46 tumefaciens. onwards, once moulting to adult has commenced, all insects 0438 Restriction enzyme digests were carried out on (live and dead) are assessed as nymph or adult. Surviving pCR8/GW/TOPO plasmids containing the different targets insects are weighed on day 55 of the trial. Four replicates are (see Example 12B). The band containing the gene of interest performed for each of the treatments. During the trial the test flanked by the attl sites using Qiaquick Gel Extraction Kit conditions are 25 to 33°C. and 20 to 25% relative humidity, (Cat. Nr. 28706, Qiagen) is purified. An amount of 150 ng of with a 12:12 hour light:dark photoperiod. TABLE 1A C. elegans id D. melanogaster id description devgen RNAi screen BO2SO.1 CG1263 large ribosomal Subunit L8 protein. Acute lethal or lethal BO336.10 CG3661 large ribosomal Subunit L23 protein. Acute lethal or lethal BO336.2 CG838S ADP-ribosylation factor Acute lethal or lethal B0464.1 CG3821 Putative aspartyl (D) tRNA synthetase. Acute lethal or lethal CO1 G8.5 CG10701 Ortholog of the ERM family of cytoskeletal linkers Acute lethal or lethal CO1H6.5 CG331.83 Nuclear hormone receptor that is required in all larval molts Acute lethal or lethal CO2C6.1 CG18102 Member of the DYNamin related gene class Acute lethal or lethal CO3D6.8 CG6764 Large ribosomal Subunit L24 protein (Rp24-p) Acute lethal or lethal CO4F12.4 CG6253 rpl-14 encodes a large ribosomal subunit L14 protein. Acute lethal or lethal CO4HS.6 CG10689 Product with RNA helicase activity (EC: 2.7.7.—) involved in nuclear Embryonic lethal or sterile mRNA splicing, via spliceosome which is a component of the spliceosome complex C13B9.3 CG14813 Delta Subunit of the coatomer (COPI) complex Acute lethal or lethal C17H12.14 CG1088 Member of the Vacuolar HATPase gene class Acute lethal or lethal C26E6.4 CG318O DNA-directed RNA polymerase II Acute lethal or lethal US 2014/0373.197 A1 Dec. 18, 2014 39
TABLE 1 A-continued C. elegans id D. melanogaster id description devgen RNAi screen F23F12.6 CG16916 Triple AATPase subunit of the 26S proteasome's 19S regulatory particle Acute lethal or letha (RP) base subcomplex F57B9.10 CG10149 Member of the proteasome Regulatory Particle, Non-ATPase-like gene Acute lethal or letha class K11D9.2 CG3725 sarco-endoplasmic reticulum Ca2+-ATPase homolog Embryonic lethal or sterile T20GS.1 CG9012 Clathrin heavy chain Acute lethal or letha T2OH4.3 CGS394 Predicted cytoplasmic prolyl-tRNA synthetase (ProRS) Acute lethal or letha T21E12.4 CG7507 Cytoplasmic dynein heavy chain homolog Acute lethal or letha COSC10.3 CG1140 Orthologue to the human gene 3-OXOACID COATRANSFERASE Acute lethal or letha CO9D4S CG2746 Ribosomal protein L19, structural constituent of ribosome involved in Acute lethal or letha protein biosynthesis which is localised to the ribosome CO9E10.2 CG31140 Orthologue of diacylglyerol kinase involved in movement, egg laying, and Acute lethal or letha synaptic transmission, and is expressed in neurons. C13B9.3 CG14.813 Delta subunit of the coatomer (COPI) Acute lethal or letha C14B9.7 CG12775 Large ribosomal subunit L21 protein (RPL-21) involved in protein Acute lethal or letha biosynthesis C15H11.7 CG30382 Type 6 alpha subunit of the 26S proteasome's 20S protease core particle Acute lethal or letha (CP) C17E4.9 CG9261 Protein involved with Na+/K+-exchanging ATPase complex Embryonic lethal or sterile C17H12.14 CG1088 V-ATPase E subunit Acute lethal or letha C23G10.4 CG11888 Non-ATPase subunit of the 26S proteasome's 19S regulatory paritcle Acute lethal or letha base subcomplex (RPN-2) C26D10.2 CGT269 Product with helicase activity involved in nuclear mRNA splicing, via Acute lethal or letha spliceosome which is localized to the nucleus C26E6.4 CG318O RNA polymerase II 140 kD subunit (RpII140), DNA-directed RNA Acute lethal or letha polymerase activity (EC: 2.7.7.6) involved in transcription from Pol II promoter which is a component of the DNA-directed RNA polymerase II, core complex C26F1.4 CG15697 Product with function in protein biosynthesis and ubiquitin in protein Acute lethal or letha degradation. C30C11.1 CG12220 Unknown function Acute lethal or letha C30C11.2 CG10484 Member of the proteasome Regulatory Particle, Non-ATPase-like gene Acute lethal or letha class C36A4.2 CG13977 cytochrome P450 Acute lethal or letha C37C3.6 CG33103 Orthologous to thrombospondin, papilin and lacunin Acute lethal or letha C37H5.8 CG8542 Member of the Heat Shock Protein gene class Acute lethal or letha C39F7.4 CG332O Rab-protein 1 involved in cell adhesion Acute lethal or letha C41C4.8 CG2331 Transitional endoplasmic reticulum ATPase TER94, Golgi organization Growth delay or arrested in and biogenesis growth C42D8.5 CG8827 ACE-like protein Acute lethal or letha C47E12.5 CG1782 Ubiquitin-activating enzyme, function in an ATP-dependent reaction that Acute lethal or letha activates ubiquitin prior to its conjugation to proteins that will Subsequently be degraded by the 26S proteasome. C47E8.5 CG1242 Member of the abnormal DAuer Formation gene class Acute lethal or letha C49H3.11 CGS920 Small ribosomal subunit S2 protein. Acute lethal or letha CS2E4.4 CG1341 Member of the proteasome Regulatory Particle, ATPase-like gene class Acute lethal or letha CS6C10.3 CG8055 Carrier protein with putatively involved in intracellular protein transport Growth delay or arrested in growth CD4.6 CG4904 Type 1 alpha subunit of the 26S proteasome's 20S protease core particle Acute lethal or letha (CP). D100.7.1.2 CG9282 Large ribosomal subunit L24 protein. Acute lethal or letha D1054.2 CGS266 Member of the Proteasome Alpha Subunit gene class Acute lethal or letha D1081.8 CG6905 MYB transforming protein Acute lethal or letha FO7D10.1 CG7726 Large ribosomal subunit L11 protein (RPL-11.2) involved in protein Acute lethal or letha biosynthesis. F11C3.3 CG17927 Muscle myosin heavy chain (MHC B) Acute lethal or letha F13B10.2 CG4863 Large ribosomal subunit L3 protein (rpl-3) Acute lethal or letha F16A11.2 CG998.7 Methanococcus hypothetical protein 0682 like Acute lethal or letha F2OB6.2 CG17369 V-ATPase B subuni Growth delay or arrested in growth F23F12.6 CG16916 Triple AATPase subunit of the 26S proteasome's 19S regulatory particle Acute lethal or letha (RP) base subcomplex (RPT-3) F2SHS.4 CG-2238 Translation elongation factor 2 (EF-2), a GTP-binding protein involved in Growth delay or arrested in protein synthesis growth F26D10.3 CG4264 Member of the Heat Shock Protein gene class Acute lethal or letha F28C6.7 CG6846 Large ribosomal subunit L26 protein (RPL-26) involved in protein Embryonic lethal or sterile biosynthesis F28D1.7 CG841S Small ribosomal subunit S23 protein (RPS-23) involved in protein Acute lethal or letha biosynthesis F29G9.5 CGS289 Member of the proteasome Regulatory Particle, ATPase-like gene class Acute lethal or letha F32H2S CG3523 Mitochondrial protein Acute lethal or letha F37C12.11 CG-2986 Small ribosomal subunit S21 protein (RPS-21) involved in protein Acute lethal or letha biosynthesis F37Cl12.4 CGT622 Large ribosomal subunit L36 protein (RPL-36) involved in protein Acute lethal or letha biosynthesis US 2014/0373.197 A1 Dec. 18, 2014 40
TABLE 1 A-continued C. elegans id D. melanogaster id description devgen RNAi screen
CG1527 Small ribosomal subunit S14 protein (RPS-14) involved in protein Acute le 8 O (8 biosynthesis CG6699 beta' (beta-prime) subunit of the coatomer (COPI) complex Acute le 8 O (8 CG10305 Small ribosomal subunit S26 protein (RPS-26) involved in protein Acute le 8 O (8 biosynthesis Member of the Proteasome Beta Subunit gene class Acute le 8 O (8 Ribosomal protein S9 (RpS9), structural constituent of ribosome involved Acute le 8 O (8 in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit CGT808 Small ribosomal subunit S8 protein (RPS-8) involved in protein Acute le 8 O (8 biosynthesis CG5378 Member of the proteasome Regulatory Particle, Non-ATPase-like gene Acute le 8 O (8 class CG2O33 Small ribosomal subunit S15a protein. Acute le 8 O (8 CG4897 arge ribosomal subunit L7 protein (rpl-7) Acute le 8 O (8 CG8977 Unknown function Acute le 8 O (8 CG1915 Product with Sallimus (sls), myosin-light-chain kinase activity (EC: 2.7.1.117) involved in mitotic chromosome condensation which is ocalized to the nucleus CG11271 Small ribosomal subunit S12 protein (RPS-12) involved in protein Acute le 8 O (8 biosynthesis FSSA11.2 CG4214 Member of the SYNtaxin gene class Acute le 8 O (8 FSSA3.3 CG1828 transcritpion factor Acute le 8 O (8 F55C10.1 CG11217 Ortholog of calcineurin B, the regulatory subunit of the protein Acute le 8 O (8 phosphatase 2B CG21.68 rps-1 encodes a small ribosomal subunit S3A protein. Acute (8 O (8 CG10149 Member of the proteasome Regulatory Particle, Non-ATPase-like gene Acu e e 8 O 8. class CG2968 ATP synthase Acu 8 O 8. CG3948 Zeta subunit of the coatomer (COPI) complex Acu 8 O 8. CG3195 Large ribosomal subunit L12 protein (rpl-12) Acu 8 O 8. CG1404 Putative RAN Small monomeric GTPase (cell adhesion) Acu 8 O 8. CG18734 Subtilase Acu 8 O 8. CG12323 Member of the Proteasome Beta Subunit gene class Acu 8 O 8. CG18174 Putative proteasome regulatory particle, lid Subcomplex, rpn11 Acu 8 O 8. CG3725 Sarco-endoplasmic reticulum Ca2+ ATPase Em b Oil ic letha or sterile; Acu 8 O 8. An actin that is expressed in body wall and Vulval muscles and the Acu 8 O 8. spermatheca. CG1109 six WD40 repeats Acute le 8 O (8 CG15319 Putative transcriptional cofactor Acute le 8 O (8 CG3416 Protein with endopeptidase activity involved in proteolysis and Acute le 8 O (8 peptidolysis CG101.19 Member of the Intermediate Filament, B gene class Embryonic lethal or sterile CG11397 Homolog of the SMC4 subunit of mitotic condensin Embryonic lethal or sterile CG5771 GTPase homologue Embryonic lethal or sterile CG5055 PDZ domain-containing protein Embryonic lethal or sterile CG3612 ATP synthase Growth elay or arrested in growth K12C11.2 CG4494 Member of the SUMO (ubiquitin-related) homolog gene class Embryonic lethal or sterile R12E2.3 CG3416 Member of the proteasome Regulatory Particle, Non-ATPase-like gene Acute le 8 O (8 class CG6141 Ribosomal protein L9, structural constituent of ribosome involved in Acute le 8 O (8 protein biosynthesis which is localised to the ribosome CG4046 rps-16 encodes a small ribosomal subunit S16 protein. Acu 8 O 8. CG7007 proteolipid protein PPA1 like protein Acu 8 O 8. CG5374 Cytosolic chaperonin Acu 8 O 8. CG5605 eukaryotic peptide chain release factor subunit 1 Acu 8 O 8. CG17248 N-synaptobrevin; V-SNARE, vesicle-mediated transport, synaptic vesicle CG17332 ATPase subunit Growth elay or arrested in growth CG9012 Clathrin heavy chain Acute le 8 O (8 CG7033 t-complex protein 1 Embryonic lethal or sterile CG17907 Acetylcholineesterase CG8264 Member of the mammalian SKIP (Ski interacting protein) homolog gene Acute le 8 O (8 class ZC434.5 CGS394 predicted mitochondrial glutamyl-tRNA synthetase (GluRS) 8 O (8 BOS11.6 CG6375 helicase ic lethal or sterile DY3.2 CG101.19 Nuclear lamin; LMN-1 protein elay or arrested in
R13 G10.1 CG11397 homolog of the SMC4 subunit of mitotic condensin e T26E3.7 CG3612 Predicted mitochondrial protein. elay or arrested in CG1250 GTPase activator, ER to Golgi prot transport, component of the Golgi hal or lethal stack US 2014/0373.197 A1 Dec. 18, 2014 41
TABLE 1 A-continued C. elegans id D. melanogaster id description devgen RNAi screen Y43B11 AR4 CG11276 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved Acute lethal or lethal in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit Y46GSA4 CGS931 Y46G5A.4 gene Acute lethal or lethal Y71F9AL.17 CGT961 Alpha subunit of the coatomer (COPI) complex Acute lethal or lethal Y76B12C.7 CG10110 Gene cleavage and polyadenylation specificity factor Embryonic lethal or sterile Y37D8A.10 CG1751 Unknown function Embryonic lethal or sterile CGT765 CO6G3.2 Member of the Kinesin-Like Protein gene class CG10922 C44E4.4 RNA-binding protein Embryonic lethal or sterile CG4145 FO1 G12.5 alpha-2 type IV collagen Embryonic lethal or sterile CG13391 F28H1.3 apredicted cytoplasmic alanyl-tRNA synthetase (AlaRS) Growth delay or arrested in growth CGT765 ROSD3.7 Member of the UNCoordinated gene class Embryonic lethal or sterile CGA398 RO6A4.4 Member of the IMportin Beta family gene class Embryonic lethal or sterile CGA436 T17E9.2 Unknown function Embryonic lethal or sterile CG2666 T2SG3.2 putative chitin synthase Embryonic lethal or sterile CG17603 WO4A8.7 TATA-binding protein associated factor TAF1L (TAFII250) Embryonic lethal or sterile
TABLE 1-LD Dm SEQ ID SEQID Target ID identifier NONA NOAA Function (based on Flybase) LDOO1 CG11276 1 2 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit LDOO2 CG8055 3 4 Carrier protein with putatively involved in intracellular protein transport LDOO3 CG3395 5 6 Ribosomal protein S9 (RpS9), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit LDOO6 CG318O 7 8 RNA polymerase II 140 kD subunit (RpII140), DNA-directed RNA polymerase activity (EC: 2.7.7.6) involved in transcription from Pol II promoter which is a component of the DNA-directed RNA polymerase II, core complex LDOO7 CGT269 9 10 Helicase at 25E (Hel25E), also known in FlyBase as Dbp25F, Hel, I(2)25Eb and I(2)k11511, pre mRNA splicing factor activity involved in nuclear mRNA splicing, via spliceosome which is localized to the nucleus LDO10 CG1250 11 12 GTPase activator, ER to Golgi prot transport, component of the Golgi stack LDO11 CG1404 13 14 Tutative RAN Small monomeric GTPase (cell adhesion) LDO14 CG1088 15 16 V-ATPase E subunit LDO15 CG2331 17 18 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis LDO16 CG17369 19 2O V-ATPase B subunit LDO18 CG1915 21 22 Sallimus (sls), myosin-light-chain kinase activity (EC: 2.7.1.117) involved in mitotic chromosome condensation which is localized to the nucleus LDO27 CG6699 23 24 Beta-coatamer protein, Subunit of a multimeric complex that forms a membrane vesicle coat
TABLE 1-PC Target Dm SEQID SEQID ID identifier NONA NOAA Function (based on Flybase) PCOO1 CG11276 247 248 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit PCOO3 CG3395 249 250 Ribosomal protein S9 (RpS9), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit PCOOS CG2746 251 252 Ribosomal protein L19, structural constituent of ribosome involved in protein biosynthesis which is localised to the ribosome PCO1 O CG1250 253 254 GTPase activator, ER to Golgi prot transport, component of the Golgi stack PCO14 CG1088 255 256 V-ATPase E Subunit PCO16 CG17369 257 258 V-ATPase B Subunit PCO27 CG6699 259 260 Beta-coatamer protein, Subunit of a multimeric complex that forms a membrane vesicle coat
TABLE 1-EV Target Dm SEQID SEQID ID identifier NONA NOAA Function (based on Flybase) EVOOS CG2746 513 514 Ribosomal protein L19, structural constituent of ribosome involved in protein biosynthesis which is localised to the ribosome EVOO9 CG9261 515 516 Protein involved with Na+/K+-exchanging ATPase complex EVO10 CG1250 517 518 GTPase activator, ER to Golgi prot transport, component of the Golgi stack US 2014/0373.197 A1 Dec. 18, 2014 42
TABLE 1-EV-continued Target Dm SEQID SEQID ID identifier NONA NOAA Function (based on Flybase) EVO1S CG2331 519 520 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis EVO16 CG17369 521 522 V-ATPase B Subunit
TABLE 1-AG Target Dm SEQID SEQID ID identifier NONA NOAA Function (based on Flybase) AGOO1 CG11276 6O1 602 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit AGOOS CO2746 603 604 Ribosomal protein L19, structural constituent of ribosome involved in protein biosynthesis which is localised to the ribosome AGO 10 CG1250 60S 606 GTPase activator, ER to Golgi prot transport, component of the Golgi stack AGO14 CG1088 607 608 V-ATPase E Subunit AGO16 CG17369 609 610 V-ATPase B Subunit
TABLE 1-TC Target Dm SEQID SEQID ID identifier NONA NOAA Function (based on Flybase) TCOO1 CG11276 793 794 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit TCOO2 CG8055 795 796 Protein with putatively involved in intracellular protein transport TC010 CG1250 797 798 GTPase activator, ER to Golgi prot transport, component of the Golgi stack TC014 CG1088 799 800 V-ATPase E Subunit TCO15 CO2331 8O1 802 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis
TABLE 1.-MP Target Dm SEQID SEQID ID identifier NONA NOAA Function (based on Flybase) MPOO1 CG11276 888 889 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit MPOO2 CG8OSS 890 891 Carrier protein with putatively involved in intracellular protein transport MPO10 CG1250 892 893 GTPase activator, ER to Golgi prot transport, component of the Golgi stack MPO16 CG17369 894 895 V-ATPase B Subunit MPO27 CG6699 896 897 Beta-coatamer protein, subunit of a multimeric complex that forms a membrane vesicle coat
TABLE 1-NL
Dm SEQID SEQID Target ID identifier NONA NOAA Function (based on Flybase) NLOO1 CG11276 O71 072 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit NLOO2 CG8055 O73 074 Protein with putatively involved in intracellular protein transport NLOO3 CG3395 O75 076 Ribosomal protein S9 (RpS9), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit NLOO4 CG6141 O77 078 Ribosomal protein L9, structural constituent of ribosome involved in protein biosynthesis which is ocalised to the ribosome NLOOS CG2746 O79 080 Ribosomal protein L19, structural constituent of ribosome involved in protein biosynthesis which is ocalised to the ribosome NLOO6 CG318O O81 082 RNA polymerase II 140 kD subunit (RpII140), DNA-directed RNA polymerase activity (EC: 2.7.7.6) involved in transcription from Pol II promoter which is a component of the DNA-directed RNA polymerase II, core complex NLOO7 CGT269 O83 084 Helicase at 25E (Hel25E), also known in FlyBase as Dbp25F, Hel, I(2)25Eb and I(2)k11511, pre mRNA splicing factor activity involved in nuclear mRNA splicing, via spliceosome which is localized to he nucleus NLOO8 CG3416 O85 086 Protein with endopeptidase activity involved in proteolysis and peptidolysis which is a component of he proteasome regulatory particle, lid Subcomplex (sensu Eukarya) NLOO9 CG9261 O87 088 Protein involved with Na+/K+-exchanging ATPase complex NLO10 CG1250 O89 090 GTPase activator, ER to Golgi prot transport, component of the Golgi stack NLO11 CG1404 O91 092 Putative RAN small monomeric GTPase (cell adhesion) US 2014/0373.197 A1 Dec. 18, 2014 43
TABLE 1-NL-continued
Dm SEQID SEQID Target ID identifier NONA NOAA Function (based on Flybase)
NLO12 CG17248 093 094 N-synaptobrevin; V-SNARE, vesicle-mediated transport, synaptic vesicle NLO13 CG18174 O95 096 Putative proteasome regulatory particle, lid subcomplex, rpn11 NLO14 CG1088 O97 098 V-ATPase E Subunit NLO15 CG2331 O99 100 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis NLO16 CG17369 101 102 V-ATPase B Subunit NLO18 CG1915 103 104 Sallimus (sils), myosin-light-chain kinase activity (EC: 2.7.1.117) involved in mitotic chromosome condensation which is localized to the nucleus NLO19 CG332O 105 106 Rab-protein 1 involved in cell adhesion NLO21 CG10110 107 108 Gene cleavage and polyadenylation specificity factor NLO22 CG10689 109 110 Product with RNA helicase activity (EC: 2.7.7.—) involved in nuclear mRNA splicing, via spliceosome which is a component of the spliceosome complex NLO23 CG17907 111 112 Acetylcholineesterase NLO27 CG6699 113 114 Beta-coatomer protein
TABLE 1-CS Dm SEQ ID SEQID Target ID identifier NONA NOAA Function (based on Flybase) CSOO1 CG11276 682 683 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit CSOO2 CG8055 684 685 Carrier protein with putatively involved in intracellular protein transport CSOO3 CG3395 686 687 Ribosomal protein S9 (RpS9), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit CSOO6 CG318O 688 689 RNA polymerase II 140 kD subunit (RpII140), DNA-directed RNA polymerase activity (EC: 2.7.7.6) involved in transcription from Pol II promoter which is a component of the DNA-directed RNA polymerase II, core complex CSOO7 CGT269 690 691 Helicase at 25E (Hel25E), also known in FlyBase as Dbp25F, Hel, I(2)25Eb and I(2)k11511, pre mRNA splicing factor activity involved in nuclear mRNA splicing, via spliceosome which is localized o the nucleus CSOO9 CG9261 692 693 Protein involved with Na+/K+-exchanging ATPase complex CSO11 CG1404 694 695 Tutative RAN Small monomeric GTPase (cell adhesion) CSO13 CG18174 696 697 Putative proteasome regulatory particle, lid subcomplex, rpn11 CSO14 CG1088 698 699 V-ATPase E Subunit CSO15 CG2331 700 701 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis CSO16 CG17369 702 703 V-ATPase B Subunit CSO18 CG1915 704 705 Sallimus (sils), myosin-light-chain kinase activity (EC: 2.7.1.117) involved in mitotic chromosome condensation which is localized to the nucleus
TABLE 1-PX Dm SEQID SEQ ID Target ID identifier NONA NOAA Function (based on Flybase) PXOO1 CG11276 2100 2101 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit PX009 CG9261 2102 2103 Protein involved with Na+/K+-exchanging ATPase complex PXO10 CG1250 2104 2105 GTPase activator, ER to Golgi prot transport, component of the Golgi stack PXO15 CG2331 2106 2107 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis PXO16 CG17369 2108 2109 V-ATPase B Subunit
TABLE 1-AD Dm SEQID SEQ ID Target ID identifier NONA NOAA Function (based on Flybase) ADOO1 CG11276 2364 2365 Ribosomal protein S4 (RpS4), structural constituent of ribosome involved in protein biosynthesis which is a component of the cytosolic Small ribosomal subunit ADOO2 CG8055 2366 2367 Carrier protein with putatively involved in intracellular protein transport ADOO9 CG9261 2368 2369 Protein involved with Na+/K+-exchanging ATPase complex ADO15 CG2331 2370 2371 Transitional endoplasmic reticulum ATPase TER94, Golgi organization and biogenesis ADO16 CG17369 2372 2373 V-ATPase B Subunit
US 2014/0373.197 A1 Dec. 18, 2014 69
TABLE 4 -LD
SEQ Target ID ID NO Sequences* Example Gi-number and species LDOO1 49 GGCCCCAAGAAGCATTTGAAGCGTTT 31.01175 (Drosophila melanogaster), 924.77283 (Drosophila erecta) LDOO1 5 O AATGCCCCAAAAGCATGGATGTTGGATAAA 709094.80 (Carabus granulatus), 77325294 (Chironomus TTGGGAGGTGT tentans), 9 OO945 (Ctenocephalides felis), 6O297219 (Diaprepes abbreviatus), 37951951 (Ips pini), 75735533 (Tribolium castaneum), 22O39624 (Ctenocephalides felis)
DOO1 51 GAAGTTACTAAGATTGTTATGCA 333 68080 (Glossina morsitans)
DOO1 52 ATTGAAAAAACTGGTGAATTTTTCCG 6O297219 (Diaprepes abbreviatus) DOO1 53 ACACACGACGGCCGCACCATCCGCT 27555937 (Anopheles gambiae), 333550O8 (Drosophila yakuba), 22474.232 (Helicoverpa armigera), 3738704 (Manduca sexta) DOO1 54 ACACACGACGGCCGCACCATCCGCTA 9247 7283 (Drosophila erecta) DOO1 55 CCCAAGAAGCATTTGAAGCGTTTG 92.954810 (Drosophila ananassae), 922316 O5 (Drosophila Willistoni) DOO2 is 6 GCAATGTCATCCATCATGTCGTG 17861597 (Drosophila melanogaster), 92223378 (Drosophila Willistoni), 924.713 O9 (Drosophila erecta) DOO3 57 CAGGTTCTTCCTCTTGACGCGTCCAGG 24975810 (Anopheles gambiae), 3478578 (Antheraea yamamai), 42764756 (Armigeres subalbatus), 246 61714 (Drosophila melanogaster), 6826 7151 (Drosophila simulians), 33355 OOO (Drosophila yakuba), 49532931 (Plutella xylostella), 76.552910 (Spodoptera frugiperda), 92.959651 (Drosophila ananassae), 9246.7993 (Drosophila erecta) LDOO3 58 TTGAGCGAGAAGTCAATATGCTTCT 4955893 O (Boophilus microplus) LDOO3 59 TTCCAAGAAATCTTCAATCTTCAAACCCAA 62238.687 (Diabrotica virgifera), 761699 O7 (Diploptera punctata), 678.72253 (Drosophila pseudoobscura), 55877642 (Locusta migratoria), 66548956 (Apis mellifera) LDOO3 6 O TTCATCCAACACTCCAATACG 2204 O140 (Ctenocephalides felis)
LDOO3 61 AAGAGCATTGCCTTCAAACAACCT 2459311 (Antheraea yamamai) LDOO3 62 AGTTCTCTGGCAGCTTTACGGATTTT 76.1699 O7 (Diploptera punctata)
LDOO3 63 CCACACTTCACGTTTGTTCCT 57963694 (Heliconius melpomene) LDOO3 64 CCGTATGAAGCTTGATTACGT 108742527 (Gryllius rubens), 108742525 (Gryllius pennsylvanicus), 108742523 (Gryllius veletis), 108742521 (Gryllius bimaculatus), 108742519 (Gryllius firmus), 109194897 (Myzus persicae) DOO3 65 AGGAACAAACGTGAAGTGTGGCG 109194897 (Myzus persicae)
DOO6 66 AGCGCTATGGGTAAGCAAGCTATGGG 2781997O (Drosophila melanogaster) DOO6 67 TGTTATACTGGTTATAATCAAGAAGAT 558O1622 (Acyrthosiphon pisum), 6653.513 O (Apis mellifera)
LDO Of 68 GAAGTTCAGCACGAATGTATTCC 50563 603 (Homalodisca coagulata)
LDO Of 69 CAAGCAAGTGATGATGTTCAGTGCCAC 50563 603 (Homalodisca coagulata)
LDO Of 70 TGCAAGAAATTCATGCAAGATCC 21068658 (Chironomus tentans)
LDO Of 71 AAATGAAAAGAATAAAAAATT 492O1437 (Drosophila melanogaster)
LDO Of 72 CAGAATTTCCCAGCCATAGGAAT 67895.225 (Drosophila pseudoobscura)
LDO Of 73 AGCAGTTCAAAGATTTCCAGAAG 77848709 (Aedes aegypti)
LDO Of 74 TTCCAAATCAGCAAAGAGTACGAG 91083250 (Tribolium castaneum)
DO1 O 75 TACCCGCAGTTCATGTACCAT 29558345 (Bombyx mori) US 2014/0373.197 A1 Dec. 18, 2014 70
TABL H 4-LD- Continued
SEQ Target ID ID NO Sequences* Example Gi-number and species DO1 O 76. CAGTCGCTGATCATGATCCAGCC 49559866 (Boophilus microplus)
DO1 O 77 CTCATGGACACGTTCTTCCAGAT 60293559 (Homalodisca coagulata)
DO1 O 78 GGGGCTGCATACAGTTCATCAC 92971.011 (Drosophila mojavensis)
DO1 O 79 CCCGCAGTTCATGTACCATTTG 92952825 (Drosophila ananassae)
DO1 O 8OGACAATGCCAAATACATGAAGAA 92.92.1253 (Drosophila virilis)
DO1 O 81TTCGATCAGGAGGCAGCCGCAGTG 92.92.1253 (Drosophila virilis)
DO 82AGCAGGGCTGGCATGGCGACAAA. 28317118 (Drosophila melanogaster)
DO 83 TTCTCAAAGTTGTAGTTAGATTTGGC 37951963 (Ips pini)
DO 84 TACTGCAAATTCTTCTTCCTATG 55883.846 (Locusta migratoria)
DO 8. GGTACATTCTTGTATGTAACTC 67885713 (Drosophila pseudoobscura)
DO 86 TCAAACATGATAATAGCACACTG 68771114 (Acanthos curria domesiana)
DO 87 TCTCCTGACCGGCAGTGTCCCATA 1794 4197 (Drosophila melanogaster), 77843 537 (Aedes aegypti), 9446.9127 (Aedes aegypti), 24664595 (Drosophila melanogaster)
DO 88 GCTACTTTGGGAGTTGAAGTCCATCC 101.410 627 (Plodia interpuntella)
DO 89 TAACTACAACTTTGAGAAGCCTTTCCT 90813103 (Nasonia vitripennis)
DO 9 OAAGTTTGGTGGTCTCCGTGATGG 84267747 (Aedes aegypti)
DO14 91 GCAGATCAAGCATATGATGGC 9732 (Manduca sexta), 90814338 (Nasonia vitripennis), 87266590 (Choristoneura fumiferana)
DO14 92 ATCAAGCATATGATGGCTTTCATTGA 7547 O953 (Tribolium castaneum), 7616939 O (Diploptera punctata)
DO14 93 AATATTGAAAAGGGGCGCCTTGT 78055682 (Heliconius erato)
DO14 94 CAACGTCTCAAGATTATGGAATA 37659584 (Bombyx mori) DO14 95 ATTATGGAATATTATGAGAAGAAAGA 66556286 (Apis mellifera)
DO14 96 AACAAAATCAAGATCAGCAATACT 25958976 (Curculio glandium)
DO16 97 ATGTCGTCGTTGGGCATAGTCA 27372076 (Spodoptera littoralis)
DO16 98 GTAGCTAAATCGGTGTACATGTAACCTGGG 27372076 (Spodoptera littoralis), 55797 015 (Acyrthosiphon AAACCACGACG pisum), 73 615307 (Aphis gossypii), 4 680479 (Aedes aegypti), 9713 (Manduca sexta), 76.555122 (Spodoptera frugiperda), 237458 (Heliothis virescens), 53883819 (Plutella xylostella), 22038926 (Ctenocephalides felis), 1014 03557 (Plodia interpuntella), 92.96.9578 (Drosophila grimshawi), 91.82.9127 (Bornbyx mori)
DO16 99 GCAGATAC CTCACGCAAAGCTTC 62239897 (Diabrotica virgifera)
DO16 1OOGGATCGTTGGCCAAATTCAAGAACAGGCA 67882712 (Drosophila pseudoobscura), 92.985.459 (Drosophila grimshawi)
DO16 101TTCTCCATAGAACCGTTCTCTTCGAAATCCT 4680479 (Aedes aegypti), 27372O76 (Spodoptera littoralis) G
DO16 1O2 GCTGTTTCCATGTTAACACCCAT 49558344 (Boophilus microplus)
DO16 103TCCATGTTAACACCCATAGCAGCGA 622.38871 (Diabrotica virgifera)
DO16 104 CTACAGATCTGGGCAGCAATTTCATTGTG 22O38926 (Ctenocephalides felis), 16898595 (Ctenocephalides felis)
DO16 105 GGCAGACCAGCTGCAGAGAAAAT 22O38926 (Ctenocephalides felis), 16898595 (Ctenocephalides felis) US 2014/0373.197 A1 Dec. 18, 2014 71
TABL 4-LD- Continued
SEQ Target ID ID NO Sequences* Example Gi-number and species
LDO16 106 GAGAAAATGGGGATCTTCTGACCACGAGCA 4680479 (Aedes aegypti), 9713 (Mandu.ca sexta), ATGGAGTTCATCACGTC 22O38926 (Ctenocephalides felis), 16898595 (Ctenocephalides felis), 67877903 (Drosophila pseudoobscura), 10763875 (Manduca sexta), 76.554661 (Spodoptera frugiperda), 77905105 (Aedes aegypti), 50562965 (Homalodisca coagulate), 27372076 (Spodoptera littoralis)
LDO16 107 ATGGAGTTCATCACGTCAATAGC 9713 (Manduca sexta), 237458 (Heliothis vires cens), 76.5546 61 (Spodoptera frugiperda), 22474331 (Helicoverpa armigera)
LDO16 108 GTCTGGATCATTTCCTCAGGATAGATACGG 16898595 (Ctenocephalides felis), GACCACGGATTGATTGGTTGACCCTGGATG 22O38926 (Ctenocephalides felis), TCCAAGAAGTCTTCAGCCAAAATTGGGGGA 50562965 ((Homalodisca coagulate), CCTTTGTC 493951.65 (Drosophila melanogaster), 6901845 (Bombyx mori), 92.931OOO (Drosophila virilis
LDO16 109 ATTGGGGGACCTTTGTCGATGGG 10763875 (Manduca sexta)
LDO16 11 OATGGGTTTTCCTGATCCATTGAAAACACGTC 493951.65 (Drosophila melanogaster), CCAACATATCTTCAGAAACAGGAGTCCTCA 55905051 (Locusta migratoria) AAATATCTCCTGTGAATTCACAAGCGGTGTT TTTGGCGTCGATTCCTGATGTGCCCTCGAA CACTTGAACCACAGCTTT
DO16 1ACAGCTTTTGACCCACTGACTTCCAG 216422 66 (Amblyomma variegatum)
DO16 2 GACCCACTGACTTCCAGAACTTGTCCCGAA 493951.65 (Drosophila melanogaster) CGTATAGTGCCATCAGCCAGTTTGAGT
DO16 3. GGACCGTTCACACCAGACACAGT 24 64 6342 (Drosophila melanogaster)
DO16 4 GACTGTGTCTGGTGTGAACGGTCCTCT 1037691.63 (Drosophila melanogaster), 92 O48971 (Drosophila Willistoni)
DO16 STTCTCTTCGAAATCCTGTTTGAA 84.116133 (Dermatophagoides fairinae)
DO16 6 GACTGTGTWTGGTGTGAACGGTCC 24 64 6342 (Drosophila melanogaster)
DO16 7 GGTCGTCGTGGTTTCCCAGGTTACATGTAC 922.31646 (Drosophila Willistoni), 91755555 (Bombyx mori), ACCGATTT 8422 8226 (Aedes aegypti)
DO16 8TGACAGCTGCCGAATTCTTGGC 92231646 (Drosophila Willistoni)
DO18 9 CAAGTCACCGACGACCACAACCACAA 91080016 (Tribolium castaneum)
DO18 2OATCGCGATTGACGGTGGAGCC 91080016 (Tribolium castaneum)
DO27 21AGACGATCGGTTGGTTAAAATC 665O1387 (Apis mellifera)
DO27 22 GATATGGGAGCATGTGAAATATA 77326476 (Chironomus tentans)
DO27 2.3TTAGAGAATTGTTTGAATTAT 9012 9719 (Bicyclius any nana)
TABLE 4 - PC Target SEQ ID ID NOSequence * Example Gi-number and species PCOO1 275 AAAATTGTCATGCAAAGGTTGAT 37952206 (Ips pini)
PCOO1 276 AAAGCATGGATGTTGGACAAA. 98.994282 (Antheraea my litta) 10997 8109 (Gryllius pennsylvanicus) 55904580 (Locusta migratoria)
PCOO1 277 AAAGCATGGATGTTGGACAAATT 313 66663 (Toxoptera citricida) US 2014/0373.197 A1 Dec. 18, 2014 72
TABLE 4 - PC-continued Target SEQ ID ID NOSequence * Example Gi-number and species PCOO 278 AAAGCATGGATGTTGGACAAATTGGG 60311985 (Papilio dairdanus)
PCOO 279 AAAGCATGGATGTTGGACAAATTGGGGGGTGT 37951951 (Ips pini)
PCOO 28 O AAATACAAGTTGTGTAAAGTAA 846,47793 (Myzus persicae)
PCOO 281 AAGCATGGATGTTGGACAAATTGGGGGGTGT 709 O94.86 (Mycetophagus quadripustulatus)
PCOO 282 ATGGATGTCATTACTATTGAGAA 25957367 (Carabus granulatus)
PCOO 283 CATCAAATTTGAATCTGGCAACCT 379522O6 (Ips pini)
PCOO 284 CATGATGGCAGAACCATTCGTTA (Julodis onopordi)
PCOO 285 CCAAAGCATGGATGTTGGACAA 9 O1381.64 (Spodoptera frugiperda)
PCOO 286 CCATTTTTGGTAACACATGATGG 11101.1915 (Apis mellifera)
PCOO 287 CCCAAAGCATGGATGTTGGACAA SOS 65.112 (Homalodisca coagulata)
PCOO 288 CCCAAAGCATGGATGTTGGACAAA. 103790417 (Heliconius era to 101.4.19954 (Plodia interpunctella)
PCOO 289 CCCAAAGCATGGATGTTGGACAAATT f3 612809 (Aphis gossypii)
PCOO 29 O CCCAAAGCATGGATGTTGGACAAATTGGG 773.2925.4 (Chironomus tentans)
PCOO 291 CCCAAAGCATGGATGTTGGACAAATTGGGGGGTGT (Mycetophagus quadripustulatus)
PCOO 292 CCCAAAGCATGGATGTTGGACAAATTGGGGGGTGTCTTCGC 846.47995 (Myzus persicae)
PCOO 293 CGTTACCCTGACCCCAACATCAA (Aphis gossypii)
PCOO 294 GCAAAATACAAGTTGTGTAAAGTAA 836 62334 (Myzus persicae)
PCOO 295 GCATGGATGTTGGACAAATTGGG 929 69396 (Drosophila grimshawi)
PCOO 296 GCATGGATGTTGGACAAATTGGGGG 67885868 (Drosophila pseudoobscura)
PCOO 297 GCATGGATGTTGGACAAATTGGGGGGTGT 25.956.479 (Biphyllius lunatus
PCOO 298 GCATGGATGTTGGACAAATTGGGGGGTGTCT 90814901 (Nasonia vitripennis)
PCOO 299 GCTCCCAAAGCATGGATGTTGGA 11026O785 (Spodoptera frugiperda)
PCOO 300 GCTCCCAAAGCATGGATGTTGGACAA 76.551269 (Spodoptera frugiperda)
PCOO 301 GCTCCCAAAGCATGGATGTTGGACAAA 56O85210 (Bombyx mori)
PCOO 3O2 GCTCCCAAAGCATGGATGTTGGACAAATTGGG 22474.232 (Helicoverpa armigera)
PCOO 3O3 GGTCCCAAAGGAATCCCATTTTTGGT SOS 65.112 (Homalodisca coagulata)
PCOO 3O4 GGTGTCTTCGCCCCTCGTCCA 82575022 (Acyrthosiphon pisum)
PCOO 305 GTGAAGTCACTAAAATTGTCATGCAAAG 25.95682O (Biphyllius lunatus
PCOO 3 O 6 TCCACCGGGCCTCACAAGTTGCG 58371410 (Lonomia obliqua)
PCOO 3. Of TCCCAAAGCATGGATGTTGGA 11026.3957 (Spodoptera frugiperda)
PCOO 3O8 TGCTCCCAAAGCATGGATGTTGGACAA 489.27129 (Hydropsyche sp.)
PCOO 309 TGGATGTTGGACAAATTGGGGGGTGTCT 90814 560 (Nasonia vitripennis)
PCOO3 31 O AAAATTGAAGATTTCTTGGAA 108742519 (Gryllius firmus) 1099.78291 (Gryllius pennsylvanicus) (Lysiphlebus testacelipes) (Rhynchosciara americana)
PCOO3 311 AACAAACGTGAAGTGTGGAGAGT 579 63 755 (Heliconius melpomene)
PCOO3 312 AAGTCGCCCTTCGGGGGTGGCCG 77884 O26 (Aedes aegypti) US 2014/0373.197 A1 Dec 18, 2014 73
TABLE 4 - PC-continued Target SEQ ID ID NOSequence * Example Gi-number and species
PCOO3 313 ACTTCTCCCTGAAGTCGCCCTTCGG 929 92.453 (Drosophila mojavensis)
PCOO3 314 AGATTGTTTGAAGGTAATGCACTTCT 6O2.98816 (Diaphorina citri)
PCOO3 315 ATCCGTAAAGCTGCTCGTGAA 33373 689 (Glossina morsitans)
PCOO3 316 ATCGACTTCTCCCTGAAGTCGCC 92987113 (Drosophila grimshawi)
PCOO3 317 ATCGACTTCTCCCTGAAGTCGCCCT 18995.48 (Drosophila melanogaster)
PCOO3 3.18 ATGAAGCTTGATTATGTTTTGGGTCTGAAAATTGAAGATTTCT 71539,459 (Diaphorina citri) TGGAAAGA
PCOO3 319 ATTGAAGATTTCTTGGAAAGA 6224 OO69 (Diabrotica virgifera)
PCOO3 CACATCGACTTCTCCCTGAAGTC 715.50961 (Oncome topia nigricans)
PCOO3 321 CAGAAGCACATCGACTTCTCCCTGAAGTCGCCCTTCGG 682 6715.1 (Drosophila simulians) 33355 OOO (Drosophila yakuba)
PCOO3 322 CAGAAGCACATCGACTTCTCCCTGAAGTCGCCCTTCGGGGG 215.2719 (Drosophila melanogaster)
PCOO3 323 CGACTTCTCCCTGAAGTCGCC 107324 644 (Drosophila melanogaster)
PCOO3 324 CTCCCTGAAGTCGCCCTTCGG 154 61311 (Drosophila melanogaster)
PCOO3 3.25 CTGGACTCGCAGAAGCACATCGACTTCTCCCTGAA 38624772 (Drosophila melanogaster)
PCOO3 326 GACTTCTCCCTGAAGTCGCCCTTCGG 92.959 651 (Drosophila ananassae) 92.981958 (Drosophila mojavensis) 76.552 4 67 (Spodoptera frugiperda)
PCOO3 327 GCTAAAATCCGTAAAGCTGCTCGTGA 6O296953 (Diaprepes abbreviatus)
PCOO3 328 GCTAAAATCCGTAAAGCTGCTCGTGAACT 773.293 41 (Chironomus tentans)
PCOO3 329 GTGCGCAAGCAGGTGGTGAACATCCC 6 O312414 (Papilio dairdanus)
PCOO3 33 O TACACTTTGGCTAAAATCCGTAAAGCTGC 22O4. O14 O (Ctenocephalides felis)
PCOO3 331 TCGCAGAAGCACATCGACTTCTC 18883211 (Anopheles gambiae)
PCOO3 332 TCGCAGAAGCACATCGACTTCTCCCTGAAGTCGCCCTTCGG 929 63.738 (Drosophila grimshawi)
PCOO3 333 TCTCCCTGAAGTCGCCCTTCGG 380.47836 (Drosophila yakuba) 272 60897 (Spodoptera frugiperda)
PCOO3 334 TGAAAATTGAAGATTTCTTGGAA 61.646980 (Acyrthosiphon pisum) f3 61.5225 (Aphis gossypii) 836 61890 (Myzus persicae) 378 O.477s (Rhopalosiphum padi) 3OO 49209 (Toxoptera citricida)
PCOO3 335 TGAAAATTGAAGATTTCTTGGAAAGA 90813959 (Nasonia vitripennis)
PCOO3 336 TGGACTCGCAGAAGCACATCGACTTCTCCCT 25.9594 O8 (Meliadema coriacea)
PCOO3 337 TGGCTAAAATCCGTAAAGCTGC 76.1699. Of (Diploptera punctata)
PCOO3 338 TGGGTCTGAAAATTGAAGATTTCTTGGA 34788 O46 (Calilosobruchus maculatus)
PCOO3 339 TTCTCCCTGAAGTCGCCCTTCGG 10733 1362 (Drosophila melanogaster) 11024 O861 (Spodoptera frugiperda)
PCOO3 34 O TTGGGTCTGAAAATTGAAGATTTCTTGGAAAG 37952 462 (Ips pini)
PCOO3 341 GGGTGCGCAAGCAGGTGGTGAAC 110887729 (Argas monoliakensis)
PCOOS 342 CTCCTCAAAAAGTACAGGGAGGCCAAGAA 635.12537 (Ixodes scapularis)
PCOOS 343 AAAAAGAAGGTGTGGTTGGATCC 33.491424 (Trichoplusia ni)
PCOOS 344 AAAAAGAAGGTGTGGTTGGATCCAAATGAAATCAA 91759.273 (Bombyx mori) 559 O8261 (Locusta migratoria) US 2014/0373.197 A1 Dec. 18, 2014 74
TABLE 4 - PC-continued Target SEQ ID ID NOSequence * Example Gi-number and species
PCOOS 345 AAAGAAGGTGTGGTTGGATCCAAATGAAATCA 101.414 616 (Plodia interpunctella)
PCOOs 346 AACACCAACTCAAGACAAAACAT 25957531 (Cicindela campestris)
PCOOS 347 AACACCAACTCAAGACAAAACATCCGTAA 25958948 (Curculio glandium)
PCOOS 348 AACT CAAGACAAAACATCCGTAA 60314333 (Panorpa cf. vulgaris APV-2005) PCOOS 349 AAGAACACTGAAGCCAGAAGGAAGGGAAGGCATTGTGG 25958948 (Curculio glandium)
PCOOS 350 AATGAAATCAACGAAATCGCCAACAC 9297916O (Drosophila grimshawi) 92232O72 (Drosophila Willistoni) PCOOS 351 ATGGAGTACATCCACAAGAAGAAGGC 15454802 (Drosophila melanogaster)
PCOOS 352 CAAGATGCTGTCTGACCAGGC 67872905 (Drosophila pseudoobscura)
PCOOS 353 CGCCTCCT CAAAAAGTACAGGGAGGC 754.71260 (Tribolium cast aneum) PCOOS 354 CGTATCGCCACCAAGAAGCAG 6.82 67374 (Drosophila simulians) PCOOS 355 CTGTACATGAAAGCGAAGGGTAA 2595724 6 (Carabus granulatus)
PCOOS 356 GAACAAGAGGGTCCTTATGGAG 90977107 (Aedes aegypti)
PCOOS 357 GAACAAGAGGGTCCTTATGGAGTACATCCA 40544432 (Tribolium cast aneum)
PCOOS 358 GAGCGTATCGCCACCAAGAAGCA 924.80972 (Drosophila erecta) 3335.4497 (Drosophila yakuba) PCOOS 359 GAGTACATCCACAAGAAGAAGGC 15516174 (Drosophila melanogaster)
PCOOS 360 GATCCAAATGAAATCAACGAAAT 56149737 (Rhynchosciara americana)
PCOOS 361 GCCAACACCAACT CAAGACAAAACATCCG 103 019061 (Tribolium castaneum)
PCOOS 362 GCCAACACCAACT CAAGACAAAACATCCGTAAGCTCAT 56149737 (Rhynchosciara americana) PCOOS 363 GGCAAAAAGAAGGTGTGGTTGGATCCAAATGAAATCA 101.417 O42 (Plodia interpunctella)
PCOOS 364 GGGTCCTTATGGAGTACATCCACAAGAA 67885759 (Drosophila pseudoobscura)
PCOOS 365 TGCGATGCGGCAAAAAGAAGGT 56149531 (Rhynchosciara americana)
PCOOS 366 TGGTTGGATCCAAATGAAATCAACGAAAT 15355452 (Apis mellifera) 83662749 (Myzus persicae) PCOOS 367 TTGGATCCAAATGAAATCAACGAAAT 110985.444 (Apis mellifera) 111158.439 (Myzus persicae) PCO1 O 368 CCGCAGTTCATGTACCATTTG 92952 825 (Drosophila ananassae) PCO1 O 369 CTGATGGAGATGAAGCAGTGCTGCAATTC 583 95529 (Anopheles gambiae str. PEST)
PCO1 O 37 O GACGTGCTCAGATGGGTGGACAG 56152422 (Rhynchosciara americana)
PCO1 O 3.71 GCCCGAGCCTGTGTTGTTGGA 9293982O (Drosophila virilis)
PCO1 O 372 GGCACATGCTGATGCGTGAGGAT 83937570 (Lutzomyia longipalpis)
PCO1 O 373. GGGCACATGGTCATGGGCGATTC 3337934 (Drosophila melanogaster)
PCO14 374. AAGATCATGGAGTACTACGAGAA 85577611 (Aedes aegypti)
PCO14 375 ACGAGAAAAAGGAGAAGCAAG 67838315 (Drosophila pseudoobscura)
PCO14 376 ATGGAGTACTACGAGAAAAAGGAGAAGCAAGT 92.928915 (Drosophila virilis) PCO14 377 CAAAAACAAATCAAACACATGATGGC 82574 OO1 (Acyrthosiphon pisum) 11116 0670 (Myzus persicae)
PCO14 378 CTCAAGATCATGGAGTACTACGA 55692554 (Drosophila yakuba) US 2014/0373.197 A1 Dec. 18, 2014 75
TABLE 4 - PC-continued Target SEQ ID ID NOSequence * Example Gi-number and species PCO 4. 379 CTCAAGATCATGGAGTACTACGAGAA 929 423 O1 (Drosophila ananassae 92.4761.96 (Drosophila erecta) 53884266 (Plutella xylostella)
PCO GAACAAGAAGCCAATGAGAAAGC 11116 0670 (Myzus persicae)
PCO 381 GACT CAAGATCATGGAGTACT 112432414 (Myzus persicae)
PCO 382 GATGTTCAAAAACAAATCAAACACATGATGGC 736.18688 (Aphis gossypii)
PCO 383 TACTACGAGAAAAAGGAGAAGC 62239529 (Diabrotica virgifera) PCO 384 TTCATTGAACAAGAAGCCAATGA 15357365 (Apis mellifera)
PCO 385 ACACGACCGGCGCGCTCGTAAAT 75710699 (Tribolium cast aneum)
PCO 386 ACCAGCACGTGCTTCTCGCACTGGTAGGCCAAGAATTCGGC 92.048971 (Drosophila willistoni)
PCO 387 AGCACGTGCTTCTCGCACTGGTAGGC 92.985.459 (Drosophila grimshawi)
PCO 388 ATACGCGACCACGGGTTGATCGG 18868609 (Anopheles gambiae 312O6154 (Anopheles gambiae str. PEST)
PCO 389 ATCGGTGTACATGTAACCGGGGAAACC 292 1501 (Culex pipiens) 62239897 (Diabrotica virgifera) 92.957249 (Drosophila ananassae) 92477818 (Drosophila erecta) 92965. 644 (Drosophila grimshawi) 246.46342 (Drosophila melanogaster) 67896654 (Drosophila pseudoobscura) 75710699 (Tribolium cast aneum)
PCO 390 ATCGTTGGCCAAGTTCAAGAACAG 92950254 (Drosophila ananassae)
PCO 391 CACGTGCTTCTCGCACTGGTAGGCCAAGAA 4680479 (Aedes aegypti)
PCO 392 CCAGTCTGGATCATTTCCTCGGG 67884 189 (Drosophila pseudoobscura)
PCO 393 CCAGTCTGGATCATTTCCTCGGGATA 929 40287 (Drosophila virilis
PCO 394 CGCTCGATGGTCGGATCGTTGGCCAAGTTCAAGAACA 292 1501 (Culex pipiens)
PCO 395 CGCTCGATGGTCGGATCGTTGGCCAAGTTCAAGAACAGACA 92477818 (Drosophila erecta) CACGTTCTCCAT 15061308 (Drosophila melanogaster)
PCO 396 CGTGCTTCTCGCACTGGTAGGCCAAGAA 13752998 (Drosophila melanogaster)
PCO 397 CTGGCAGTTTCCATGTTGACACCCATAGC 16898595 (Ctenocephalides felis)
PCO 398 CTTAGCATCAATACCTGATGT 61646 107 (Acyrthosiphon pisum)
PCO 399 GACATGTCGGTCAAGATGACCAGCACGTG 9713 (Mandu.ca sexta)
PCO 4 OO GACATGTCGGTCAAGATGACCAGCACGTGCTTCTCGCACTG 92.933 153 (Drosophila virilis)
PCO GACATGTCGGTCAAGATGACCAGCACGTGCTTCTCGCACTG 292 1501 (Culex pipiens) GTA
PCO GAGCCGTTCTCTTCGAAGTCCTG 237458 (Heliothis virescens)
PCO GATGACCAGCACGTGCTTCTC 18883474 (Anopheles gambiae
PCO GATGACCAGCACGTGCTTCTCGCACTG 92477818 (Drosophila erecta)
PCO 405 GATGACCAGCACGTGCTTCTCGCACTGGTAGGCCAAGAA 15061308 (Drosophila melanogaster) 67883 622 (Drosophila pseudoobscura)
PCO GATGACCAGCACGTGCTTCTCGCACTGGTAGGCCAAGAATTC 312O6154 (Anopheles gambiae str. PEST)
PCO 4. Of GATGGGGATCTGCGTGATGGA 101403557 (Plodia interpunctella)
PCO 408 GATGGGGATCTGCGTGATGGAGCCGTTGCGGCCCTCCAC 53883819 (Plutella xylostella) US 2014/0373.197 A1 Dec. 18, 2014 76
TABLE 4 - PC-continued Target SEQ ID ID NOSequence * Example Gi-number and species PCO16 4O9 GGAATAGGATGGGTGATGTCGTCGTTGGGCATAGT 11024 O379 (Spodoptera frugiperda)
PCO16 41 O GGAATAGGATGGGTGATGTCGTCGTTGGGCATAGTCA 27372076 (Spodoptera littoralis)
PCO16 411 GGATCGT GGCCAAGTTCAAGAA 917 57299 (Bombyx mori)
PCO16 412 GGATCGT GGCCAAGTTCAAGAACA 103 O2O3 68 (Tribolium castaneum)
PCO16 413 GGATCGT GGCCAAGTTCAAGAACAG 237458 (Heliothis virescens)
PCO16 414 GGATGGG GATGTCGTCGTTGGGCAT 101403557 (Plodia interpunctella)
PCO16 415 GGCAGTT CCATGTTGACACCCATAGC 4680479 (Aedes aegypti)
PCO16 416 GGCATAG CAAGATGGGGATCTG 929 24977 (Drosophila virilis)
PCO16 417 GTCTGGA CATTTCCTCGGGATA 929 66144 (Drosophila grimshawi)
PCO16 418 GTGATGA GCGCTCGATGGTCGGATCGTTGGCCAAGTTCAA 1551475 O (Drosophila melanogaster) GAACAGACACACGTTCTCCAT
PCO16 419 GTGTACA GTAACCGGGGAAACC 929 24977 (Drosophila virilis)
PCO16 42O GTTTCCA GTTGACACCCATAGC 91826 756 (Bombyx mori)
PCO16 421 (CAATGGGTTTTCCTGATCCATTGAA 493 95.165 (Drosophila melanogaster) 990 O9492 (Leptinotarsa decemlineata)
PCO16 422 CATCCAGCACAGACTTGCCAG 10763875 (Manduca sexta)
PCO16 423 CATCCAGCACAGACTTGCCAGG 9713 (Mandu.ca sexta)
PCO16 424 CCATGTTGACACCCATAGCAGC 929 62.756 (Drosophila ananassae)
PCO16 425 CCATGTTGACACCCATAGCAGCAAACAC 6O2956O7 (Homalodisca coagulata)
PCO16 426 CGAAGTCCTGCTTGAAGAACCTGGC 101403557 (Plodia interpunctella)
PCO16 427 CGATGGTCGGATCGTTGGCCAAGTTCAAGAACAGACACAC 4680479 (Aedes aegypti) GTTCTCCAT
PCO16 428 CGGATCGTTGGCCAAGTTCAAGAACAGACACACGTTCTCCA 2.793275 (Drosophila melanogaster)
PCO16 429 CGTTGGCCAAGTTCAAGAACAG 90.1375O2 (Spodoptera frugiperda)
PCO16 43 O GGGTGATGTCGTCGTTGGGCAT 53883819 (Plutella xylostella)
PCO16 431 TCTCGCACTGGTAGGCCAAGAA 11024 O379 (Spodoptera frugiperda) 27372076 (Spodoptera littoralis)
PCO16 432 TCTCTTCGAAGTCCTGCTTGAAGAACCTGGC 9713 (Mandu.ca sexta)
PCO16 433 TGGCCAAGTTCAAGAACAGACACACGTT 559 O5051 (Locusta migratoria)
PCO16 434 GTTTCCATGTTGACACCCATAGCAGCAAA 841.16133 (Dermatophagoides farinae
TABLE
Target ID SEQ ID NO Sequence * Example Gi-number and species
EWOOS 533 AAGCGACGTGAAGAGCGTATCGC 7655.32O6 (Spodoptera frugiperda)
EWOOS 534 ATTAAAGATGGTCTTATTATTAA 153554.52 (Apis mellifera)
EWOOS 535 CGTAAGCGACGTGAAGAGCGTATCGC 33.491424 (Trichoplusia ni)
EWOOS 536 GGTCGTCATTGTGGATTTGGTAAAAG 6O314333 (Panorpa cf. vulgaris APW-2005)
EWOOS s37 TGCGATGCGGCAAGAAGAAGGT 1504893 O (Drosophila melanogaster) US 2014/0373.197 A1 Dec. 18, 2014 77
TABLE 4 - EV-continued Target ID SEQ ID NO Sequence * Example Gi-number and species EWOOS 538 TGCGGCAAGAAGAAGGTTTGG 93 OO2524 (Drosophila mojavensis) 92.93 0455 (Drosophila virilis) 92 044532 (Drosophila Willistoni) EWOOS 539 TTGTGGATTTGGTAAAAGGAA 603 O 6723 (Sphaerius sp.)
EWO1 O 54 O CAAGTGTTCAATAATTCACCA 83.937567 (Lutzomyia longipalpis)
EWO1 O 541 CATTCTATAGGCACATGTTGATG 29558345 (Bombyx mori)
EWO1 O 542 CTGGCGGCCACATGGTCATGGG 92476940 (Drosophila erecta) 9297 7931 (Drosophila grimshawi) 2871327 (Drosophila melanogaster) EWO15 543 AACAGGCCCAATTCCATCGACCC 92.947821 (Drosophila ananassae)
EWO15 544 AGAGAAAAAATGGACCTCATCGAC 62239128 (Diabrotica virgifera) EWO15 545 CGCCATCCGTCGCTGTTCAAGGCGATCGG 1886 6954 (Anopheles gambiae)
EWO15 546 CTGGCAGTTACCATGGAGAACTTCCGTTACGCCATG 62239128 (Diabrotica virgifera) EWO15 547 GTGATCGTGATGGCGGCCACGAA 18887285 (Anopheles gambiae)
EWO15 548 GTGATCGTGATGGCGGCCACGAAC 83423460 (Bombyx mori)
EWO15 549 TGATGGACGGCATGAAGAAAAG 91086234 (Tribolium castaneum) EWO16 550 AATATGGAAACAGCCAGATTCTT 109193 659 (Myzus persicae)
EWO16 551 ATGATCCAGACTGGTATTTCTGC 92.938857 (Drosophila virilis)
EWO16 552 ATTGATGTGATGAATTCCATTGCC 55905051 (Locusta migratoria)
EWO16 553 GAAATGATCCAGACTGGTATTTCTGC 50562965 (Homalodisca coagulata) EWO16 554 GAAGAAATGATCCAGACTGGTAT 92.96.9748 (Drosophila mojavensis) EWO16 555 GACTGTGTCTGGTGTGAACGG 2286 639 (Drosophila melanogaster) 92 O42621 (Drosophila Willistoni) EWO16 556 GATATGTTGGGTCGTGTGTTTAA 92.96.9748 (Drosophila mojavensis)
EWO16 sist GATCCTACCATTGAAAGAATTAT 99.01.1193 (Leptinotarsa decemlineata)
EWO16 558 GTGTCTGAAGATATGTTGGGTCGTGT 76.554661 (Spodoptera frugiperda)
EWO16 559 GTGTCTGGTGTGAACGGACCG 22474331 (Helicoverpa armigera)
EWO16 560 TCTGAAGATATGTTGGGTCGTGT 27372076 (Spodoptera littoralis)
EWO16 561 TGGCATATCAATGTGAGAAGCA 6033 6595 (Homalodisca coagulata)
EWO16 562 TTGAACTTGGCCAATGATCCTACCAT 91827863 (Bombyx mori)
TABLE 4-AG Target SEQ ID ID NOSequence * Example Gi-number and species AGOO1 621 AAAACTGGTGAATTCTTCCGTTTGAT 37953169 (Ips pini)
AGOO1 622 AAAGCATGGATGTTGGACAAA. 98.994282 (Antheraea my litta) 10997 8109 (Gryllius pennsylvanicus) 55904580 (Locusta migratoria) AGOO1 623 AAAGCATGGATGTTGGACAAATT 313 66663 (Toxoptera citricida)
AGOO1 624 AAAGCATGGATGTTGGACAAATTGGG 60311985 (Papilio dairdanus)
AGOO1 625 AAAGCATGGATGTTGGACAAATTGGGGGGTGT 37951951 (Ips pini) 1091951 07 (Myzus persicae) US 2014/0373.197 A1 Dec. 18, 2014 78
TABLE 4-AG-Continued Target SEQ ID ID NOSequence * Example Gi-number and species
AGOO 626 AAATACAAATTGTGCAAAGTCCG 25958703 (Curculio glandium)
AGOO 627 AACTTGTGCATGATCACCGGAG 22O39624 (Ctenocephalides felis)
AGOO 628 AAGCATGGATGTTGGACAAATTGGGGG 112433559 (Myzus persicae)
AGOO 629 AAGCATGGATGTTGGACAAATTGGGGGGTGTGTT 709 O9486 (Mycetophagus quadripustulatus)
AGOO 63 O ACTGGTGAATTCTTCCGTTTGAT 773273O3 (Chironomus tentains
AGOO 631 ATTGAAAAAACTGGTGAATTCTTCCGTTTGATCTATGATGTTA. 22039624 (Ctenocephalides felis) A.
AGOO 632 CCAAAGCATGGATGTTGGACAA 9 O1381.64 (Spodoptera frugiperda)
AGOO 633 CCCAAAGCATGGATGTTGGACAA 4892 7129 (Hydropsyche sp.) 76551269 (Spodoptera frugiperda)
AGOO 634 CCCAAAGCATGGATGTTGGACAAA. 91835558 (Bombyx mori) 103783745 (Heliconius erato) 101.419954 (Plodia interpunctella)
AGOO 635 CCCAAAGCATGGATGTTGGACAAATT 73619372 (Aphis gossypii) 77329254 (Chironomus tentains
AGOO 636 CCCAAAGCATGGATGTTGGACAAATTGGG 22474.232 (Helicoverpa armigera)
AGOO 637 CCCAAAGCATGGATGTTGGACAAATTGGGGG 84647382 (Myzus persicae)
AGOO 638 CCCAAAGCATGGATGTTGGACAAATTGGGGGGTGT 846.47995 (Myzus persicae)
AGOO 639 CCCAAAGCATGGATGTTGGACAAATTGGGGGGTGTGTT 603 O542O (Mycetophagus quadripustulatus)
AGOO 64 O CTGGATTCATGGATGTGATCA 27617172 (Anopheles gambiae
AGOO 641 GAATTCTTCCGTTTGATCTATGATGT 50565112 (Homalodisca coagulata) 71049326 (Oncome topia nigricans)
AGOO 642 GCATGGATGTTGGACAAATTGGG 929 69396 (Drosophila grimshawi) 93 OO1617 (Drosophila mojavensis) 92.929 731 (Drosophila virilis
AGOO 643 GCATGGATGTTGGACAAATTGGGGG 67885868 (Drosophila pseudoobscura)
AGOO 644 GCATGGATGTTGGACAAATTGGGGGGTGT 90814901 (Nasonia vitripennis)
AGOO 645 GCATGGATGTTGGACAAATTGGGGGGTGTGTTCGCCCC 25956.479 (Biphyllius lunatus)
AGOO 646 GCCCCCAAAGCATGGATGTTGGACAA 50565112 (Homalodisca coagulata)
AGOO 647 GCTGGATTCATGGATGTGATC 103775903 (Heliconius erato)
AGOO 648 GGATCATTCGATATTGTCCACAT 113 017118 (Bemisia tabaci)
AGOO 649 GGCAACTTGTGCATGATCACCGGAGG 25958703 (Curculio glandium)
AGOO 650 TACAAATTGTGCAAAGTCCGCAA 56161193 (Rhynchosciara americana)
AGOO 651 TATCCTGCTGGATTCATGGATGT 4093.4103 (Bombyx mori)
AGOO 652 TCACCATTGAAAAAACTGGTGAATTCTTC 62O83410 (Lysiphlebus testacelipes)
AGOO 653 TGCATGATCACCGGAGGCAGGAA 347855O (Antheraea yamamai)
AGOO 654 TGCATGATCACCGGAGGCAGGAATTTGGG 14627585 (Drosophila melanogaster) 333.55008 (Drosophila yakuba)
AGOO 655 TGGATGTTGGACAAATTGGGGGGTGT 90814560 (Nasonia vitripennis)
AGOO 656 TGTGCATGATCACCGGAGGCAG 929.49859 (Drosophila ananassae 92999306 (Drosophila grimshawi)
AGOO 657 TGTGCATGATCACCGGAGGCAGGAATTTGGG 6784.2487 (Drosophila pseudoobscura) US 2014/0373.197 A1 Dec. 18, 2014 79
TABLE 4-AG-continued Target SEQ ID ID NOSequence * Example Gi-number and species
AGOOs 658 AAGATCGACAGGCATCTGTACCACG 83935 651 (Lutzomyia longipalpis)
AGOOs 659 AAGATCGACAGGCATCTGTACCACGCCCTGTACATGAAGGC 76.552995 (Spodoptera frugiperda)
AGOOs 66O AAGGGTAACGTGTTCAAGAACAA 18932248 (Anopheles gambiae) 603 06 606 (Sphaerius sp.) AGOOs 661 AAGGGTAACGTGTTCAAGAACAAG 18953 735 (Anopheles gambiae) 25957811 (Cicindela campestris) 60311920 (Euclidia glyphica) AGOOs 662 AAGGGTAACGTGTTCAAGAACAAGAGAGT 25958948 (Curculio glandium) 90812513 (Nasonia giraulti) AGOOs 663 ACAAGAAGAAGGCTGAGAAGGC 603117OO (Euclidia glyphica)
AGOOs 664 ATCAAGGATGGTTTGATCATTAA 25957811 (Cicindela campestris)
AGOOs 665 ATGGAATACATCCACAAGAAGAAG 56149737 (Rhynchosciara americana) AGOOs 666 CAAAACATCCGTAAATTGATCAAGGATGGT 60314333 (Panorpa cf. vulgaris APV-2005)
AGOOs 667 CAAAACATCCGTAAATTGATCAAGGATGGTTTGATCAT 25958948 (Curculio glandium)
AGOOs 668 CAAGGGTAACGTGTTCAAGAA 476608 (Drosophila melanogaster) 380483 OO (Drosophila yakuba) AGOOs 669 CAAGGGTAACGTGTTCAAGAACAAG 92.946023 (Drosophila ananassae 2871633 (Drosophila melanogaster) 68.267374 (Drosophila simulans) 3335.4497 (Drosophila yakuba) 83937.096 (Lutzomyia longipalpis) AGOOs 670 CATCTGTACCACGCCCTGTACATGAAGGC 101.417 O42 (Plodia interpunctella)
AGOOs 671 GAAGAAGGCTGAGAAGGCCCG 40874303 (Bombyx mori) AGOOs 672 GACAGGCATCTGTACCACGCCCTGTACATGAAGGC 901.35865 (Bicyclus any nana) AGOOs 673 GAGAAGGCCCGTGCCAAGATGTTG 82572137 (Acyrthosiphon pisum)
AGOOs 674 GATCCAAATGAAATCAATGAGATTGC 60312128 (Papilio dairdanus) AGOOs 675 GCTCGTATGCCTCAAAAGGAACTATGG 2595724 6 (Carabus granulatus)
AGOOs 676 GGGTAACGTGTTCAAGAACAAG 4447348 (Drosophila melanogaster)
AGOOs 677 GGTAACGTGTTCAAGAACAAG 18948649 (Anopheles gambiae)
AGOOs 678 TACATCCACAAGAAGAAGGCTGAGAAG 2871633 (Drosophila melanogaster)
AGOOs 679 TACCACGCCCTGTACATGAAGGC 10764114 (Manduca sexta) AGOOs 680 TCAATGAGATTGCCAACACCAACTC 83935 651 (Lutzomyia longipalpis)
AGOOs 681 TGATCAAGGATGGTTTGATCAT 77642775 (Aedes aegypti) 276.15052 (Anopheles gambiae 929 82271 (Drosophila grimshawi) 67896.961 (Drosophila pseudoobscura)
AGOOs 6.82 TGATCAAGGATGGTTTGATCATTAAGAA 92O42883 (Drosophila Willistoni)
AGOOs 683 TGGTTGGATCCAAATGAAATCA 40867709 (Bombyx mori) 101.417 O42 (Plodia interpunctella) AGOOs 684 TGGTTGGATCCAAATGAAATCAA 15355452 (Apis mellifera) 83662749 (Myzus persicae) AGOOs 685 TGGTTGGATCCAAATGAAATCAATGAGAT 63 013469 (Bombyx mori) 55908261 (Locusta migratoria) AGOOs 686 TGTACCACGCCCTGTACATGAAGGC 23573 622 (Spodoptera frugiperda) US 2014/0373.197 A1 Dec. 18, 2014 80
TABLE 4-AG-continued Target SEQ ID ID NOSequence * Example Gi-number and species AGOOs 687 TTGATCAAGGATGGTTTGATCA 113019292 (Bemisia tabaci)
AGOOs 688 TTGATCAAGGATGGTTTGATCAT 61674956 (Aedes aegypti) 41576849 (Culicoides sonorensis) AGOOs 689 TTGATGGAATACATCCACAAGAAGAAGGC 92.225847 (Drosophila willistoni)
AGOOs 69 O AGGATGCGTGTCTTGAGGCGTCT 110887217 (Argas monoliakensis)
AGOOs 691 AAGGCCAAGGGTAACGTGTTCAAGAACAAG 110887217 (Argas monoliakensis)
AGO1 O 692 CGTTTGTGTCAAAAGTTTGGAGAATA 785397O2 (Glossina morsitans)
AGO1 O 693 GATGTTTTAAGATGGGTCGATCG 110759793 (Apis mellifera)
AGO1 O 694 TTTTACAGGCATATGCTTATGAGGGAAGATTT 55902158 (Locusta migratoria)
AGO1 O 695 TTTTTCGAGGTGGTCAATCAGCATTCGGC 92.92.5934 (Drosophila virilis)
AGO14 696. AACATGCTGAACCAAGCCCGT 754.668O2 (Tribolium cast aneum)
AGO14 697 AACATGCTGAACCAAGCCCGTCT 87266590 (Choristoneura fumiferana) 103779114 (Heliconius erato) AGO14 698 AAGATCATGGAATACTATGAGAAGAA 101.403826 (Plodia interpunctella) AGO14 699 AAGATCATGGAATACTATGAGAAGAAGGAGAA 8152O 950 (Lutzomyia longipalpis)
AGO14 7OO AATGAAAAGGCCGAGGAAATTGATGC 62239529 (Diabrotica virgifera) AGO14 701 ATGGAATACTATGAGAAGAAGGA 169 O1350 (Ctenocephalides felis)
AGO14 702 CAATCCTCCAACATGCTGAACCA 53148,472 (Plutella xylostella)
AGO14 703 CAGATCAAGCATATGATGGCCTTCAT 53148,472 (Plutella xylostella)
AGO14 704 GCAGATCAAGCATATGATGGCCTTCAT 87266590 (Choristoneura fumiferana) 9732 (Mandu.ca sexta) 90814338 (Nasonia vitripennis) AGO14 705 GCGGAAGAAGAATTTAACATTGAAAAGGG 50558386 (Homalodisca coagulata) 7155217 O (Oncometopia nigricans) AGO16 7O6. AACGACGACATCACCCATCCTATTC 1102481.86 (Spodoptera frugiperda) 27372076 (Spodoptera littoralis) AGO16 707 AACGGTTCCATGGAGAACGTGTG 292 1501 (Culex pipiens) 92950254 (Drosophila ananassae) 11024 O379 (Spodoptera frugiperda) AGO16 708 AACGGTTCCATGGAGAACGTGTGTCT 246.46342 (Drosophila melanogaster)
AGO16 7 O9 AACGGTTCCATGGAGAACGTGTGTCTCTTCTTGAA 91829127 (Bombyx mori) AGO16 71. O ATGATCCAGACCGGTATCTCCGC 22474 04 O (Helicoverpa armigera) AGO16 711 ATGCCGAACGACGACATCACCCATCC 312O6154 (Anopheles gambiae str. PEST)
AGO16 712 CAATGCGAGAAACACGTGCTGGT 9713 (Mandu.ca sexta)
AGO16 713 CCGCACAACGAAATCGCCGCCCAAAT 754 69507 (Tribolium cast aneum) AGO16 714 CGTTTCTTCAAGCAGGACTTCGA 83937868 (Lutzomyia longipalpis)
AGO16 715 CTTGGACATCCAAGGTCAACCCATCAACCCATGGTC 104530890 (Belgica antarctica) AGO16 71.6 GAAATGATCCAGACCGGTATCTC 292 1501 (Culex pipiens) 929 66144 (Drosophila grimshawi) AGO16 717 GAAATGATCCAGACCGGTATCTCCGCCATCGACGTGATGAAC 312O6154 (Anopheles gambiae str. PEST) TC
AGO16 718 GAAGAAATGATCCAGACCGGTAT 754 69507 (Tribolium cast aneum) US 2014/0373.197 A1 Dec. 18, 2014 81
TABLE 4-AG-continued Target SEQ ID ID NOSequence * Example Gi-number and species AGO16 719 GAAGAAGTACCCGGACGTCGTGG 22O38926 (Ctenocephalides felis)
AGO16 72 O GACATCCAAGGTCAACCCATCAA 16898595 (Ctenocephalides felis) AGO16 721 GCCCGTTTCTTCAAGCAGGACTTCGA 312O6154 (Anopheles gambiae str. PEST)
AGO16 722 GCCGCCCAAATCTGTAGACAGGC 6O2956O7 (Homalodisca coagulata) AGO16 723 GGATCAGGAAAACCCATTGACAAAGGTCC 493 95.165 (Drosophila melanogaster) 990 O9492 (Leptinotarsa decemlineata) AGO16 724. GGTTACATGTACACCGATTTGGC 91829127 (Bombyx mori)
AGO16 72 GGTTACATGTACACCGATTTGGCCACCAT 77750765 (Aedes aegypti) 9713 (Mandu.ca sexta) 1102481.86 (Spodoptera frugiperda) 27372076 (Spodoptera littoralis) AGO16 726 GGTTACATGTACACCGATTTGGCCACCATTTACGAA 92231.646 (Drosophila Willistoni) AGO16 727 GTGTCGGAGGATATGTTGGGCCG 924 6O250 (Drosophila erecta) 246.46342 (Drosophila melanogaster) 55694673 (Drosophila yakuba) AGO16 728 TACATGTACACCGATTTGGCCACCAT 312O6154 (Anopheles gambiae str. PEST) AGO16 729 TTCAACGGATCAGGAAAACCCATTGACAAAGGTCC 99010 653 (Leptinotarsa decemlineata) AGO16 73. O TTCCCCGGTTACATGTACACCGATTTGGCCAC 292 1501 (Culex pipiens) 75710699 (Tribolium cast aneum) AGO16 731 TTCCCCGGTTACATGTACACCGATTTGGCCACCAT 62239897 (Diabrotica virgifera) 92.957249 (Drosophila ananassae) 92477149 (Drosophila erecta) 67896654 (Drosophila pseudoobscura) AGO16 732 TTCCCCGGTTACATGTACACCGATTTGGCCACCATTTA 929 69578 (Drosophila grimshawi)
AGO16 733 TTCCCCGGTTACATGTACACCGATTTGGCCACCATTTACGA 103744758 (Drosophila melanogaster)
AGO16 734 TTCGCCATCGTGTTCGCCGCCATGGGTGT 312O6154 (Anopheles gambiae str. PEST)
AGO16 735 TTCTTCAAGCAGGACTTCGAAGA 9713 (Mandu.ca sexta)
AGO16 736 TTCTTGAATTTGGCCAACGATCC 929 72277 (Drosophila grimshawi) 990 11193 (Leptinotarsa decemlineata)
AGO16 737 TTCTTGAATTTGGCCAACGATCCCACCATCGAG 67839381 (Drosophila pseudoobscura)
AGO16 738 GCCGAATTTTTGGCTTATCAATG 841.16133 (Dermatophagoides farinae)
TABLE 4-TC Target SEQ D ID NOSequence * Example Gi-number and species TCOO1 813 AAAGCATGGATGTTGGATAAA 709 O948 O (Carabus granulatus) 16898 765 (Ctenocephalides felis) 60298 OOO (Diaprepes abbreviatus) TCOO1 814 AATTTGTGTATGATTACTGGAGG 55904576 (Locusta migratoria) TCOO1 815 ACTGGAGGTCGTAACTTGGGGCGTGT 60298 OOO (Diaprepes abbreviatus)
TCOO1 816 ATGATTACTGGAGGTCGTAACTTGGGGCGTGT 73619372 (Aphis gossypii) 37804548 (Rhopalosiphum padi TCOO1 817 ATGCAAAGATTGATTAAAGTTGACGG 709 O9478 (Biphyllius lunatus)
TCOO1 818 ATTAAAGTTGACGGAAAAGTT 110763874 (Apis mellifera) US 2014/0373.197 A1 Dec. 18, 2014 82
TABLE 4 -TC-continued Target SEQ D ID NOSequence * Example Gi-number and species TCOO 819 ATTGAGAAAACTGGGGAATTCTTCCG 37952206 (Ips pini) TCOO 82O ATTGTTATGCAAAGATTGATTAAAGTTGACGGAAAAGT 709 O9486 (Mycetophagus quadripustulatus)
TCOO 821 CCAAGAAGCATTTGAAGCGTCT 55904580 (Locusta migratoria)
TCOO 822 CCAAGAAGCATTTGAAGCGTCTC 83935971 (Lutzomyia longipalpis)
TCOO 823 GCGCCCAAAGCATGGATGTTGGA 103790417 (Heliconius erato) 101.419954 (Plodia interpunctella) TCOO 824 GGCCCCAAGAAGCATTTGAAGCGT 147OO 642 (Drosophila melanogaster)
TCOO 825 TGATTACTGGAGGTCGTAACTTGGGGCGTGT 7361.2212 (Aphis gossypii)
TCOO 826 TGTATGATTACTGGAGGTCGTAACTTGGGGCGTGT 709 O9478 (Biphyllius lunatus)
TCOO 827 TTGATTTATGATGTTAAGGGA 773254.85 (Chironomus tentans) TCOO 828 TTGTGTATGATTACTGGAGGTCGTAA 603 0581.6 (Mycetophagus quadripustulatus)
TCOO2 829 AAAAACAAACGAGCGGCCATCCAGGC 1892O284 (Anopheles gambiae)
TCOO2 83. O ATCGACCAAGAGATCCT CACAGCGAAGAAAAACGCGTCGAAA 75717966 (Tribolium cast aneum) AACAAACGAGCGGCCATCCAGGCC
TCOO2 831. CTCCAGCAGATCGATGGCACCCT 92475657 (Drosophila erecta) 1376322O (Drosophila melanogaster)
TCOO2 832 TCAAGAGGAAGAAACGCTACGAAAAGCAGCTCCAGCAGATC 75717966 (Tribolium cast aneum) GATGGCACCCTCAGCACCATCGAGATGCAGCGGGAGGCCCT CGAGGGGGCCAACACCAACACAGCCGTACT CAAAACGATGA AAAACGCAGCGGACGCCCT CAAAAATGCCCACCTCAACATG GATGTTGATGAGGT
TCOO 833. AACCTCAAGTACCAGGACATGCCCGA 90973566 (Aedes aegypti)
TCOO 834 AGCCGATTTTGTACAGTTATA 92.944 62O (Drosophila ananassae)
TCOO 83. ATGGACACATTTTTCCAAATT 33427937 (Glossina morsitans)
TCOO 836 ATGGACACATTTTTCCAAATTTTGATTTTCCACGG 56151768 (Rhynchosciara americana)
TCOO 837 CAAGTACCAGGACATGCCCGA 1891.1059 (Anopheles gambiae)
TCOO 838 CACATGCTGATGCGGGAGGACCTC 678.93321 (Drosophila pseudoobscura)
TCOO 839 CCTCAAGTACCAGGACATGCCCGA 678.93324 (Drosophila pseudoobscura)
TCOO 84 O TCAAGTACCAGGACATGCCCGA 678.93321 (Drosophila pseudoobscura)
TCOO 841 TTCATGTACCATTTGCGCCGCTC 92952 825 (Drosophila ananassae)
TC014 842 AAAATTCAGTCGTCAAACATGCTGAA 7616939 O (Diploptera punctata)
TC014 843 AACATGCTGAACCAAGCCCGT 87266590 (Choristoneura fumiferana) 103779114 (Heliconius erato)
TC014 844 CACAGCAACTTGTGCCAGAAAT 92.923 718 (Drosophila virilis)
TC014 845 GAGAAAGCCGAAGAAATCGATGC 773.2583 O (Chironomus tentans)
TC014 846 GCCCGCAAACGTCTGGGCGAA 92232132 (Drosophila Willistoni)
TC014 847 TAAAAGTGCGTGAAGACCACGT 58371699 (Lonomia obligua)
TCO15 848 ACACTGATGGACGGCATGAAGAA 78531609 (Glossina morsitans)
TCO15 849 ATCGGCGGTTGTCGCAAACAACT 6904417 (Bombyx mori)
TCO15 850 CCCGATGAGAAGATCCGGATGAA 83922.984 (Lutzomyia longipalpis) US 2014/0373.197 A1 Dec 18, 2014 83
TABLE 4 -TC-continued
Target SEQ ID ID NOSequence * Example Gi-number and species TCO15 851 CTGCCCCGATGAGAAGATCCG 929 48836 (Drosophila ananassae)
TCO15 82 AACGAAACCGGTGCTTTCTTCTT 84.116 975 (Dermatophagoides farinae)
TABLE 4-MP
SEQ Target ID ID NO Sequence * Example Gi-number and species MPOO1 908 AAAGCATGGATGTTGGACAAA. 98.994.282 (Antheraea my litta) 10878.976.8 (Bombyx mori) 1099.78109 (Gryllius pennsylvanicus) 5590458O (Locusta migratoria)
MPOO1 909 AAAGCATGGATGTTGGACAAAT 773254.85 Chironomus tentans) 37951951 Ips pini) 60311985 Papilio dairdanus) 3OO31258 Toxoptera citricida)
POO AAGAAGCATTTGAAGCGTTTAAACGCACC 36585.72 (Manduca sexta)
POO AAGCATTTGAAGCGTT AAACGC 103790417 (Heliconius erato) 22474.232 (Helicoverpa armigera)
POO AAGCATTTGAAGCGTT AAACGCACC 25957217 (Carabus granulatus)
POO AAGTCCGTACCGACCC AATTATCCAGC 46994.131 (Acyrthosiphon pisum)
POO ACGCACCCAAAGCATGGATGTT 4699 9037 (Acyrthosiphon pisum)
POO ACTATTAGATACGATA TGCA 46998791 (Acyrthosiphon pisum)
POO ACTGGACCCAAAGGTG GCCATTTTTAACTACTCATGATGGC 46.997137 (Acyrthosiphon pisum) CGTACTAT
POO AGAAGCATTTGAAGCG TTAAA 2762O566 (Anopheles gambiae)
POO AGAAGCATTTGAAGCG TTAAACGCACC 98.994.282 (Antheraea my litta)
POO AGAAGCATTTGAAGCG TTAAACGCACCCAAAGCATGGATGT f3 6.19.191 (Aphis gossypii) TGGACAAAT
POO AGTAAGGGAGTTAAAT GACTA 46998791 (Acyrthosiphon pisum)
POO 921 ATACAAGTTGTGTAAAGTAAAG 295.53519 (Bombyx mori)
POO 922 ATGGATGTTATATCTA CCAAAAGACCAGTGAGCACTTTAGAT 46998791 (Acyrthosiphon pisum) TGATCTATGATGTGAAAGGTCGTTTCAC
POO 923 ATTGATCTATGATGTGAAAGGTCGTTTCAC 4699 9037 (Acyrthosiphon pisum)
POO 924 CAAAAGACCAGTGAGCACTTTAGATTGAT 3OO31258 (Toxoptera citricida)
POO 925 CACAGAATTACTCCTGAAGAAGC f3 6.19.191 (Aphis gossypii)
POO 926 CACAGAATTACTCCTGAAGAAGCAAAATACAAG 46998791 (Acyrthosiphon pisum) 3OO31258 (Toxoptera citricida)
POO 927 CATCCAGGATCTTTTGATATTGTTCACATTAA 313 64848 (Toxoptera citricida)
POO 928 CATCCAGGATCTTTTGATATTGTTCACATTAAGGATGCAAATG 37804548 (Rhopalo siphum padi) AACATATTTTTGCTAC
POO 929 CATCTAAAATTTTGGATCATATCCGTTTTGAAACTGGAAACTT 46998791 (Acyrthosiphon pisum) GTGCATGAT
POO 930 CATTTGAAGCGTTTAAACGCACC 3OO31258 (Toxoptera citricida)
POO 931 CATTTGAAGCGTTTAAACGCACCCAAAGCATGGATGTT 46998791 (Acyrthosiphon pisum)
POO 932 CCAAAGCATGGATGTTGGACAA 90.1381.64 (Spodoptera frugiperda)