Taira et al., Nano Biomedicine 3(2), 294-299, 2011

ORIGINAL ARTICLE

Quantitative Real-time RT-PCR Analyses of DNA-damage–recovery-related Expressions of Mouse Macrophage-like Cell Line RAW264 when Exposed to IC50 Nickel Ions

Masayuki TAIRA1, Tadayoshi KAGIYA2, Minoru SASAKI3, and Shigenobu KIMURA3

1Department of Biomedical Engineering, 2Division of Functional Morphology, Department of Anatomy, 3Division of Molecular Microbiology, Department of Microbiology, Iwate Medical University, Iwate, Japan

Synopsis The primary purpose of this study was to analyze the effects of IC50 nickel (Ni) (2+) ions on ex- pressions of seven DNA-damage-recovery (Mre11a, Dclre1a, Ddb1, Msh3, Rad51, Ercc1 and Xpa) of mouse macrophage-like cell line RAW264 cultured for 4h and 24h. Quantitative real-time RT-PCR analyses revealed that IC50 Ni (2+) ions significantly down-regulated expres- sions of these seven genes with time. Additional analyses clarified that IC50 Ni (2+) ions up-regulated expression of two cell-protection genes (Hmox1 and Ier3) and one anti-metal-toxicity gene (MT1) of RAW264 cells with time. Taken together, our data suggested that excessive (i.e. IC50 concentration) Ni (2+) ions overcame intrinsic cell protective mechanisms of RAW264 cells, and inhibited productions of DNA-damage-recovery genes, leading to reduced cell viabilities.

Key words: macrophage, nickel ions, LPS, , DNA damage

Introduction into the nucleus of the macrophage, causing We have already reported that by DNA microar- DNA damage by cross-link, excision interfer- ray analyses, IC50 Ni (2+) ions (24 h) rendered ence and de-activation, etc. It is also known that macrophage-like RAW264 cells to moderately DNA damage by metal ions can be fixed by up-regulate 28 genes more than 8-fold, which DNA-damage-repair enzymes (e.g. Mre11a [4]) included genes for chemokines (e.g. Cxcl2 and encoded by corresponding DNA-damage-repair Ccl4), vascular endothelial growth factor (Vegfa), genes. The effects of IC50 Ni (2+) ions on ex- prostaglandin synthase 2 (Ptgs2), and an- pressions of these genes of RAW264 cells have, ti-oxidant (Hmox1) [1]. Although the reason to however, not been systematically studied, yet reduce cell viabilities to 50% was not clarified in [5]. details at gene expression levels, one possible The main purpose of this investigation was, mechanism must be associated with DNA dam- therefore, to evaluate expressions of seven se- age [2]. Wataha et al [3 ] reported that Ni (2+) lected DNA-damage-repair genes of RAW264 ions were easily transferred and accumulated cells exposed to IC50 Ni (2+) ions by quantitative

294 Taira et al., Ni Ions vs. DNA Damage Recovery Genes, Nano Biomedicine 3(2), 294-299, 2011 real-time RT-PCR analyses. Furthermore, the 2. Selection of genes analyses were conducted on six genes of Seven DNA-damage-repair genes (Mre11a, RAW264 cells, functions of which were related Dclre1a, Ddb1, Msh3, Rad51, Ercc1 and Xpa), to inflammation (three genes), cell-protection three inflammation-related genes (Nfkb1, Cxcl2 (two genes) and anti-metal-toxicity (one gene). and Ptgr2), two cell-protection-related genes As a positive stimulation control, effects of (Hmox1 and Ier3) , one anti-metal-toxicity gene LPS-stimulation for 4h on 13 genes of RAW264 (Mt1) and control gene (GAPDH) were selected cells were also evaluated in this study. for expression consideration in this study. Brief explanations of 13 genes are as follows. Materials and Methods MRE11A gene encodes double-strand break re- 1. Culture of RAW264 cells pair MRE11A [4]. Dclre1a gene encodes RAW264 cells (RCB0535, Riken Biosource DNA cross-link repair 1A protein (Dclre1a pro- Center Cell Bank, Tsukuba, Ibaraki, Japan) were tein) [7]. Ddb1 gene encodes DNA dam- routinely cultured in -minimum essential me- age-binding protein 1 (Ddb1 protein). This pro- dium (-MEM) (Invitrogen, Carlsbad, CA, tein contributes to nucleotide-excision repair [8]. U.S.A.) supplemented with 10% fetal bovine Msh3 gene encodes DNA mismatch repair pro- serum (Invitrogen), 2% antibiotics (penicil- tein Msh3 [9]. Rad51 gene encodes DNA repair lin-streptomycin-amphotericin, Invitrogen) and protein RAD51 [10]. Ercc1 gene encodes DNA 0.1 mM non-essential amino acid solution (Invi- excision repair protein Ercc1 [11]. Xpa gene trogen) in a 5% CO2 incubator at 37℃. After encodes DNA repair protein complementing confluence, cells were collected by trypsiniza- XP-A cells [12]. Nfkb1 gene encodes nuclear tion with phosphate buffered saline solution factor NF-kappa-B p105 subunit protein which (PBS(-)) containing 0.08% trypsin (Invitrogen) plays a significant role in inflammation domi- and 0.14% EDTA (Invitrogen) and sub-cultured nated by Toll-like receptor signaling pathway by 1:3 ratios. [13]. Cxcl2 gene encodes a small cytokine be- Ni (II) chloride anhydrous (Code No. longing to the CXC chemokine family that is 19035-0401, Jyunsei Chemical, Tokyo, Japan) also called macrophage inflammatory protein was dissolved in super-pure water at the concen- 2-alpha (MIP2-alpha) [14]. Ptgr2 gene encodes tration of 0.2 mol/L (Ni (II) stock solution) and prostaglandin reductase 2 (enzyme) that is in- sterilized by membrane filtration. By diluting volved in the metabolism of prostaglandins [15]. this stock solution, medium containing Ni (II) Hmox1 gene encodes heme oxygenase (decy- ions with concentrations of 500 mol/L was cling) 1 enzyme in heme catabolism which prepared. For RAW264 cells cultured for 24 h, works as a detoxification agent of xenobiotics [16]. Ier3 gene encodes immediate early re- the IC50 concentration was 500 mol/L Ni (2+) ions [6]. For LPS-stimulation, a commercial LPS sponse 3 protein. This protein functions in the (Esherichia coli. O26, DIFCO Lab., Detroit, MI, protection of cells from Fas- or tumor necrosis U.S.A.) dissolved in sterile PBS (-) solution was factor type alpha-induced apoptosis [17]. Mt1 added to the media at a final concentration of 1 gene encodes metallothionein 1 protein. This protein detoxifies toxic metals like cadmium, g/mL. 7 silver, copper and mercury, and protects cells The RAW264 cells (1 x 10 ) were cultured against reactive oxygen species [18]. at 37℃ in a humidified 5% CO atmosphere in 2 10 mL of -MEM with and without IC50 Ni (2+) 3. Quantitative real-time RT-PCR analyses ions and LPS for two periods (4 h and 24 h), Total RNAs (at least 1 g) were extracted from selecting subsequent four culture conditions, the cells using RNeasy Plus Mini Kit (Qiagen, such as (i) LPS (-) without Ni (2+) ions for 4 h Hilden, Germany). Reverse transcription was (Control); (ii) LPS (-) IC50 Ni (2+) ions for 4 h performed using the PrimeScript RT reagent Kit (IC50 Ni ions 4h); (iii) LPS (-) IC50 Ni (2+) ions for 24 h (IC50 Ni ions 24h); and (iv) LPS (+) without Ni (2+) ions for 4 h (LPS 4h).

295 Taira et al., Ni Ions vs. DNA Damage Recovery Genes, Nano Biomedicine 3(2), 294-299, 2011

Table 1 Primers for quantitative real-time RT-PCR (TaKaRa, Ohtsu, Japan). The mRNA levels of total 14 genes were determined by quantitative Primersfor Sequences RT-PCR using SYBR Premix Ex Taq (TaKaRa) F ATCCACGGCAACCATGATGA Mre11a and Thermal Cycler Dice Real Time System R GATTCACAAACCCAGCACAGCTTA TP8000 (TaKaRa) and 14 primers (Table 1) de- F GATACTGCCCAAGCTGCCAGA Dclre1a signed by the Perfect Real Time support system R AGCGAGCAGGATTGTGACGTGTATTT (TaKaRa). After an initial denaturation at 95°C F TGCAGTGGAGATCTTGGATGATG Ddb1 for 30 sec, a two-step cycle procedure was used R TTGACAAACTCGCCCAGGTG (denaturation at 95°C for 5 sec, annealing and F TGCAAGCATACCTACCCACAGA Msh3 extension at 60°C for 30 sec) for 40 cycles. R CGGCAGTTTCAGTTTGCTTCAC Gene expression levels were normalized and F TGCTGCTTCGACTTGCTGATG Rad51 calibrated according to the level of GAPDH ex- R TTGGGCTACTACCTGGTTGGTGA pression. Relative amounts (RQ values) of each F TTCGTGTGCTGCTGGTTCAAG Ercc1 mRNAs in each sample were calculated by R AGGGTGCAGTCAGCCAAGATG Ct method [19]. The gene expression analy- F TTATGAACCACTTTGGATCTGCCAAC Xpa ses were triplicated. To ensure reproducibility, R AAGGTACTCTTGCTTTCGCTTCTGTC every sample was analyzed in duplicate. Data F CAGGACCCAAGGACATGGTG Nfkb1 were presented as means ± standard deviation. R TCCGTGCTTCCAGTGTTTCAA

F GCGCTGTCAAATGCCTGAAGA Cxcl2 Results R TTTGACCGCCCTTGAGAGTG Fig 1 shows RQ values of seven F GCCAGGCTGAACTTCGAAACA Ptgr2 DNA-damage-recovery genes of RAW264 cells R GCTCACGAGGCCACTGATACCTA cultured in four different media. It became F TGCAGGTGATGCTGAACAGAGG Hmox1 clearly evident that IC Ni (2+) ions declined R GGGATGAGCTAGTGCTGATCTGG 50 gene expressions of all seven F ACCGCGCGTTTGAACACTT Ier3 DNA-damage-recovery genes (Mre11a, Dclre1a, R CTCTGGCAATGTTGGGTTCCT Ddb1, Msh3, Rad51, Ercc1 and Xpa) with time Mt1 F CCGTAGCTCCAGCTTCACCA from 4h to 24h. The decline in the gene expres- R GTGCACTTGCAGTTCTTGCAG sion at 24h culture was the largest for Dclre1a, GAPDH F TGTGTCCGTCGTGGATCTGA R TTGCTGTTGAAGTCGCAGGAG

Fig. 1 RQ values of seven DNA-damage-repair genes (Mre11a, Dclre1a, Ddb1, Msh3, Rad51, Ercc1 and Xpa) of mouse macrophage-like RAW264 cells exposed to four media, namely (i) LPS (-) without Ni (2+) ions for 4 h (Control); (ii) LPS (-) IC50 Ni (2+) ions for 4 h (IC50 Ni ions 4h); (iii) LPS (-) IC50 Ni (2+) ions for 24 h (IC50 Ni ions 24h); and (iv) LPS (+) without Ni (2) ions for 4 h (LPS 4h). NS means that the marked data value was not statistically significantly different from that of Control at p<0.05.

296 Taira et al., Ni Ions vs. DNA Damage Recovery Genes, Nano Biomedicine 3(2), 294-299, 2011

Fig. 2 RQ values of three inflammation-related genes (Nfkb1, Cxcl2 and Ptgr2), two cell-protection- related genes (Hmox1 and Ier3) and one an- ti-metal-cytotoxicity gene (MT1) of mouse macrophage-like RAW264 cells exposed to four media, namely (i) LPS (-) without Ni (2+) ions for 4 h (Control); (ii) LPS (-) IC50 Ni (2+) ions for 4 h (IC50 Ni ions 4h); (iii) LPS (-) IC50 Ni (2+) ions for 24 h (IC50 Ni ions 24h); and (iv) LPS (+) without Ni (2) ions for 4 h (LPS 4h). NS means that the marked data value was not statistically significantly different from that of Control at p<0.05.

followed by Mre11a, RAD51, Xpa, Ddb1, Msh creased gene expressions of Mt1, respectively. and Ercc1 in this order. On the other hand, LPS stimulation for 4h caused RAW264 cells to in- Discussion crease expression of one gene (Ercc1); to main- Ni ions are eluted from Ni-containing dental tain expression levels of two genes (Ddb1 and metallic materials such as stainless steel wire, Xpa) similar to those of Control; and to decrease Co-Cr-Ni alloys and Ti-Ni super-elastic wire expressions of four genes (Mre11a, Dclre1a, [20]; and still cause adverse effects including Msh3 and Rad51). nickel allergy [21] on patients. The study of cy- Fig 2 indicates RQ values of three inflam- totoxicity due to Ni ions is, thus, still needed. mation-related genes (Nfkb1, Cxcl2 and Ptgr2), It has already been reported that nickel ions two cell-protection-related genes (Hmox1 and enters the nucleus, directly binds to and damage Ier3) and one anti-metal-cytotoxicity gene DNA; intracellular nickel ions react with H2O2 (MT1) of RAW264 cells cultured in four differ- to form reactive nickel-oxygen complexes, re- ent media. As for inflammation-related genes, sulting in the oxidation of thymine and cytosine IC50 Ni (2+) ions reduced gene expressions of residues accompanied by 8-OH-dG formation; Nfkb1 with time while LPS 4h considerably in- and oxidative stress generated severely damages creased gene expression of Nfkb1. IC50 Ni (2+) DNA and inhibits DNA repair pathways [22-25]. ions increased expressions of two genes (Cxcl2 The last pathways are still not well known in and Ptgr2) with time. The magnitudes of these details. There are three major DNA repairing increments were, however, much smaller than mechanisms: base excision, nucleotide excision those caused by LPS 4h. As for (e.g. Ddb1, XPA and Rad51) and mismatch re- cell-protection-related genes, IC50 Ni (2+) ions pair (e.g. Msh3) [26]. This study selected con- also increased expressions of two genes (Hmox1 tained genes categorized in latter two groups. and Ier3) with time. LPS 4h declined gene ex- DNA repair mechanism is complicated, beyond pression of Hmox1, but increased that of Ier3. the scope of this study, and described in details As for a anti-metal-toxicity gene, IC50 Ni (2+) in other literature [26]. ions for 24h and LPS 4h increased and de- It was clarified from the analyses obtained

297 Taira et al., Ni Ions vs. DNA Damage Recovery Genes, Nano Biomedicine 3(2), 294-299, 2011

(Fig. 1) that IC50 Ni (2+) ions significantly re- with various concentrations in the future. duced expression levels of seven DNA-damage-repair genes (Mre11a, Dclre1a, Acknowledgments Ddb1, Msh3, Rad51, Ercc1 and Xpa) with time. This study was supported in part by (1) This report was first made in related research Grant-in-Aid (B) 21390526 by Japan Society for fields. One reason of this decline might be at- the Promotion of Science and (2, 3) tributed to free radicals, as explained above. An- Grant-in-Aids for the Open Research Project other possible reason might arise from intercala- from 2007 to 2011 and for Strategic Medical tion of Ni (2+) ions or Ni (2+) ions-bound pro- Science Research Center from 2010 to 2014 tein between DNA double strands [27], which from Ministry of Education, Culture, Sports, hinder formation of many genes (mRNAs) in- Science and Technology, Japan cluding DNA-damage-recovery genes. It is highly expected to study these unveiled research References areas in the future. 1) Taira M, Sasaki M, Sasaki K, Saitoh S, Nezu T, Kimura S, Araki Y. DNA microarray analyses It was interesting to see that IC50 Ni (2+) of the effects of LPS-stimulation and IC50 ions down-regulated gene expressions of Nfkb1 nickel ions on gene expressions of mouse while LPS 4h significantly up-regulated gene macrophage-like RAW264 cell line. Nano expression of Nfkb1 (Fig. 2). As reported before Biomed 2009:1:59-69. [1], IC Ni (2+) ions appeared to cause inflam- 2) Snyder RD, Davis GF, Lachmann PJ. Inhibi- 50 tion by metals of X-ray and ultravio- mation (i.e. up-regulation of Cxcl2 and Ptgr2 let-induced DNA repair in human cells. Biol genes) via MAP kinase [28] whilst LPS differ- Trace Elem Res 1989;21:389-398. ently activated inflammation pathway, depend- 3) Edwards DL, Wataha JC, Hanks CT. Uptake ent on Toll-like receptor signaling pathway [13]. and reversibility of uptake of nickel by human It should be also noted that RAW264 cells macrophages. J Oral Rehabil 1998:25:2-7. 4) Xie H, Wise SS, Wise JP Sr. Deficient repair subjected to IC50 Ni (2+) ions attempted to pro- of particulate hexavalent chromium-induced tect themselves by up-regulating two DNA double strand breaks leads to neoplastic cell-protection-related genes (Hmox1 and Ier3) transformation. Mutat Res 2008;649:230-238. and one anti-metal-toxicity gene (Mt1) (Fig. 2) 5) Lü X, Bao X, Huang Y, Qu Y, Lu H, Lu Z. while liberated free radicals might heavily attack Mechanisms of cytotoxicity of nickel ions based on gene expression profiles. Biomate- protein and DNA of RAW264 cells. It was spe- rials 2009;30:141-148. culated that the protection was insufficient to 6) Taira M, Sasaki M, Kimura S, Araki Y. offset two much Ni (2+) ions contained in the Dose-dependent effects of Ni (II) ions on pro- culture media with IC50 Ni (2+) ions. It was duction of three inflammatory cytokines postulated that this protection had been effective (TNF-alpha, IL-1beta and IL-6), superoxide dismutase (SOD) and free radical NO by mur- if the concentration of Ni (2+) ions was small. ine macrophage-like RAW264 cells with or In the brief summary, it was confirmed without LPS-stimulation. J Mater Sci Mater from obtained results in this study that (1) IC50 Med 2008;19:2173-2178. Ni (2+) ions significantly down-regulated seven 7) Fachin AL, Mello SS, Sandrin-Garcia P, Junta DNA-damage-recovery genes (Mre11a, Dclre1a, CM, Donadi EA, Passos GA, Sakamoto-Hojo ET. Effects of low-dose gamma radiation on Ddb1, Msh3, Rad51, Ercc1 and Xpa) of DNA damage, chromosomal aberration and RAW264 cells with time, (2) IC50 Ni (2+) ions expression of repair genes in human blood moderately up-regulated two inflamma- cells. Int J Hyg Environ Health tion-related genes (Cxcl2 and Ptgr2) of RAW264 2006;209:503-511. 8) Alekseev S, Luijsterburg MS, Pines A, Geverts cells with time whilst down-regulating Nfkb1 B, Mari PO, Giglia-Mari G, Lans H, Houts- gene, and (3) IC50 Ni (2+) ions up-regulated two muller AB, Mullenders LH, Hoeijmakers JH, cell-protection-related genes (Hmox1 and Ier3) Vermeulen W. Cellular concentrations of and one anti-metal-cytotoxicity gene (Mt1) of DDB2 regulate dynamic binding of DDB1 at RAW264 cells with time. It was highly expected UV-induced DNA damage. Mol Cell Biol 2008;28:7402-7413. to examine DNA damage recovery pathways of 9) Hirata H, Hinoda Y, Kawamoto K, Kikuno N, RAW 264 cells when exposed to Ni (2+) ions Suehiro Y, Okayama N, Tanaka Y, Dahiya R.

298 Taira et al., Ni Ions vs. DNA Damage Recovery Genes, Nano Biomedicine 3(2), 294-299, 2011

Mismatch repair gene MSH3 polymorphism is pression analyses of human macrophage associated with the risk of sporadic prostate phagocytizing sub-m titanium particles by al- cancer. J Urol 2008;179:2020-2024. lergy DNA chip (GenopalTM). Biomed Mater 10) Westermark UK, Lindberg N, Roswall P, Eng 2009;19:63-70. Bråsäter D, Helgadottir HR, Hede SM, Zet- 20) Yonekura Y, Endo K, Iijima M, Ohno H, terberg A, Jasin M, Nistér M, Uhrbom L. Mizoguchi I. In vitro corrosion characteris- RAD51 can inhibit PDGF-B-induced glioma- tics of commercially available orthodontic genesis and genomic instability. Neuro Oncol wires. Dent Mater J 2004;23:197-202. 2011;13:1277-1287. 21) Noble J, Ahing SI, Karaiskos NE, Wiltshire 11) Lima LM, de Souza LR, da Silva TF, Pereira WA. Nickel allergy and orthodontics, a review CS, Guimarães AL, de Paula AM, de Andrade and report of two cases. Br Dent J Carvalho H. DNA repair gene excision repair 2008;204:297-300. cross complementing-group 1 (ERCC1) in 22) Dally H, Hartwig A. Induction and repair inhi- head and neck squamous cell carcinoma: bition of oxidative DNA damage by nickel (II) analysis of methylation and polymorphism and cadmium (II) in mammalian cells. Car- (G19007A), protein expression and association cinogenesis 1997;18:1021-1026. with epidemiological and clinicopathological 23) Kasprzak KS, Sunderman FW Jr, Salnikow K. factors. Histopathology. 2011 Dec 16. doi: Nickel carcinogenesis. Mutat Res 2003;533: 10.1111/j.1365-2559.2011.04062.x. [Epub 67-97. ahead of print] 24) Cavallo D, Ursini CL, Setini A, Chianese C, 12) Li Z, Musich PR, Serrano MA, Dong Z, Zou Y. Piegari P, Perniconi B, Iavicoli S. Evaluation XPA-Mediated Regulation of Global Nucleo- of oxidative damage and inhibition of DNA tide Excision Repair by ATR Is repair in an in vitro study of nickel exposure. p53-Dependent and Occurs Primarily in Toxicol In Vitro 2003;17:603-607. S-Phase. PLoS One. 6(12):e28326. Epub 2011 25) Cameron KS, Buchner V, Tchounwou PB. Ex- Dec 12, 2011. ploring the molecular mechanisms of 13) Sharif O, Bolshakov VN, Raines S, Newham P, nickel-induced genotoxicity and carcinogenic- Perkins ND. Transcriptional profiling of the ity: a literature review. Rev Environ Health LPS induced NF-kappaB response in ma- 2011;26:81-92. cro-phages. BMC Immunol. 8:1. 26) Web Books Publishing. DNA repair mecha- (doi:10.1186/1471-2172-8-1) (Open access nisms. paper) (Dec. 24, 2011). http://www.web-books.com/MoBio/Free/Ch7G 14) Rice TM, Clarke RW, Godleski JJ, Al-Mutairi .htm (Dec. 24, 2011) E, Jiang NF, Hauser R, Paulauskis JD. Differ- 27) Kang J, Wang X, Dong S. Mechanism of DNA ential ability of transition metals to induce strand cleavage induced by hexaaza macrocyc- pulmonary inflammation. Toxicol Appl Phar- lic nickel (II) complex. Toxicol Mech Methods macol 2011;177:46-53. 2006;16:515-523. 15) Hirasawa N, Goi Y, Tanaka R, Ishihara K, 28) Wu HC, Yang CY, Hung DZ, Su CC, Chen KL, Ohtsu H, Ohuchi K. Involvement of pros- Yen CC, Ho TJ, Su YC, Huang CF, Chen CH, taglandins and histamine in nickel Tsai LM, Chen YW. Nickel (II) induced JNK wire-induced acute inflammation in mice. J activation-regulated mitochondria-dependent Biomed Mater Res A 2010;93:1306-1311. apoptotic pathway leading to cultured rat pan- 16) AForti E, Salovaara S, Cetin Y, Bulgheroni A, creatic β-cell death. Toxicology 2011;289: Tessadri R, Jennings P, Pfaller W, Prieto P. In 103-111. vitro evaluation of the toxicity induced by nickel soluble and particulate forms in human airway epithelial cells. Toxicol In Vitro 2011; (Received: December 19, 2011/ 25:454-461. Accepted: December 24, 2011) 17) Arlt A, Schäfer H. Role of the immediate early response 3 (IER3) gene in cellular stress re- sponse, inflammation and tumorigenesis. Eur J Corresponding author: Cell Biol 2011;90:545-552. Masayuki TAIRA, Ph.D 18) Wesselkamper SC, McDowell SA, Medvedo- Department of Biomedical Engineering, vic M, Dalton TP, Deshmukh HS, Sartor MA, Iwate Medical University, Case LM, Henning LN, Borchers MT, Nishi-Tokuda 2-1-1, Yahaba-chou, Shiwa-gun, Tomlinson CR, Prows DR, Leikauf GD. The Iwate 028-3694, Japan role of metallothionein in the pathogenesis of Tel: 019-651-5111 Ext. 4217 acute lung injury. Am J Respir Cell Mol Biol Fax: 019-651-8407 2006;34:73-82. E-mail: [email protected] 19) Taira M, Nezu T, Sasaki M, Kimura S, Kagiya T, Harada H, Narushima T, Araki Y. Gene ex-

299