DOCSLIB.ORG

Transcriptional Regulation of ST14, SPINT1 and SPINT2 Genes in Intestinal Epithelium

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transcriptional Regulation of ST14, SPINT1 and SPINT2 Genes in Intestinal Epithelium FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN Master thesis E. Thomas Danielsen Transcriptional regulation of ST14, SPINT1 and SPINT2 genes in intestinal epithelium External supervisor: Professor Jesper T. Troelsen External supervisor: Associate Professor Lotte K. Vogel Internal supervisor: Professor, Berthe M. Willumsen Submitted: October 14th 2011 Preface This master thesis is submitted to the Faculty of Science, University of Copenhagen in order to obtain the Master of Science degree in Biochemistry. The research presented in this thesis was carried out at the Department of Cellular and Molecular Medicine, Faculty of Health Science, University of Copenhagen and at The Department of Science, Systems and Models, Roskilde University under guidance of my external supervisors, Professor Jesper T. Troelsen and Associate Professor Lotte K. Vogel and under guidance of my internal supervisor Professor Berthe M. Willumsen (Department of Biology, Faculty of Science, University of Copenhagen). Acknowledgment First, I wish to thank my daily supervisors Professor Jesper T. Troelsen and Associate Professor Lotte K. Vogel for giving me the opportunity to work in their groups. Thank you for your guidance and meaningful discussions throughout my thesis project. I also want to thank my internal supervisor Professor Berthe M. Willumsen for accepting me as her thesis student. Thanks to my fellow colleagues in the Troelsen-group; Anders Krüger Olsen, Mehmet Coskun and Mette Juel Riisager and in the Vogel-group; Sine Godiksen, Christoffer Søndergaard, Stine Friis, Simon Steffensen, Brian Roland, Jette Bornholdt, Joanna Selzer-Plon and Pernille Smith. Thank you for a great time. Lotte Laustsen, Lotte lé Fevre Bram, Pernille Smith and Mette Juel Riisager are acknowledged for their kind help and support in the laboratory. Anders Krüger Olsen and Mehmet Coskun are acknowledged for their help and collaboration regarding the siRNA and ChIP experiments respectively. I wish to thank the Danish Cancer Society for supporting me financially with a 9 month scholarship. Also thanks to Aage og Johanne Louis-Hansens fund for financial support which gave me the opportunity to present parts of my project at the XIIIth International Workshop on Molecular & Cellular Biology of Plasminogen Activation, 9th- 13th of july 2011, Cambridge UK. Final thanks go to my family and friends for their love and support. Copenhagen, October 2011 E. Thomas Danielsen 1 Table of Contents Abstract ...................................................................................................................................................... 5 Dansk Resumé ............................................................................................................................................. 6 List of Abbreviations ................................................................................................................................... 7 1. Introductory Remarks.......................................................................................................................... 8 2. Aim of study ........................................................................................................................................ 8 3. Introduction ........................................................................................................................................ 9 3.1 Overview of structure and function of the intestine ........................................................................... 9 3.2 Maintenance of the intestinal epithelial homeostasis ........................................................................10 3.3 The Caco-2 cell line- a model for studying the intestinal epithelium ..................................................11 3.4 Matriptase ........................................................................................................................................11 3.5 Matriptase inhibitors, HAI-1 and HAI-2 ..............................................................................................13 3.6 Eukaryotic transcriptional regulatory elements .................................................................................14 3.7 Intestinal epithelium-specific transcription ........................................................................................15 3.7.1 CDX2 ..........................................................................................................................................16 3.7.2 HNF4a ........................................................................................................................................16 3.7.3 HNF1 ..........................................................................................................................................17 3.7.4 GATAs ........................................................................................................................................17 3.7.5 Sp1 .............................................................................................................................................17 4. Materials and methods ......................................................................................................................19 4.1 Cell culture ........................................................................................................................................19 4.2 Construction of reporter plasmids .....................................................................................................19 4.2.1 Cloning of the ST14, SPINT1 and SPINT2 promoters ....................................................................19 4.2.2 Cloning of the ST14, SPINT1 and SPINT2 enhancers ....................................................................21 4.3 Analysis of promoter activity .............................................................................................................22 4.3.1 Transfection ...............................................................................................................................22 4.3.2 Luciferase-β-galactosidase measurement ...................................................................................22 2 4.4 Transfection of CDX2 siRNA ...............................................................................................................23 4.4.1 Total RNA extraction ..................................................................................................................23 4.4.2 Reverse transcription (cDNA synthesis).......................................................................................23 4.4.3 RT-qPCR for mRNA analysis ........................................................................................................24 4.5 Electrophoretic Mobility Shift and Supershift Assay ...........................................................................24 4.5.1 Annealing of oligonucleotides .....................................................................................................25 4.5.2 -32P labelling of oligonucleotides ..............................................................................................25 4.5.3 EMSA reaction and gel electrophoresis .......................................................................................25 4.6 Chromatin immunoprecipitation assay ..............................................................................................26 4.6.1 Cross-linking of protein/DNA ......................................................................................................26 4.6.2 Sonication ..................................................................................................................................27 4.6.3 Immunoprecipitation ..................................................................................................................27 4.6.4 DNA purification .........................................................................................................................27 4.6.5 Real-time qPCR analysis of ChIP DNA ..........................................................................................28 4.7 Statistical Analysis ............................................................................................................................28 5. Results ................................................................................................................................................29 5.1 Analysis of human ST14 promoter and putative enhancer element ...................................................29 5.1.1 Identification of promoter and putative enhancer element of ST14 ............................................29 5.1.2 In silico analysis of promoter and putative enhancer element of ST14 .......................................31 5.1.3 CDX2 binds ST14 enhancer in vivo in Caco-2 cells ........................................................................32 5.1.4 In vitro analysis of CDX2-binding sites within the ST14 enhancer ................................................33 5.1.5 ST14 enhancer stimulates the ST14 promoter activity specific in Caco-2 cells ............................35 5.1.7 Over-expression experiment affected the pGL4.10 control plasmid ............................................36 5.1.8 ST14 promoter and enhancer reporter assay with over-expression of TFs ..................................37 5.2 Analysis of human SPINT1 promoter and putative enhancer element ................................................38 5.2.1 Identification
Load more

Recommended publications
  • The Genetical Society of Great Britain
    Heredity 59 (1987) 151—160 The Genetical Society of Great Britain THEGENETICAL SOCIETY (Abstracts of papers presented at the TVVO HUNDRED AND FIFTH MEETING of the Society held on Friday, 14th and Saturday, 15th November 1986 at UNIVERSITY COLLEGE, LONDON) 1. Selection of somatic cell D. J. Porteous, P. A. Boyd, N. D. Hastie and hybrids with specific chromosome V. van Heyningen content for mapping the WAGR MAC Clinical and Population Cytogenetics Unit, Western General Hospital, Crewe Road, syndrome Edinburgh EH4 2XU. J. M. Fletcher, H. Morrison, J. A. Fantes, Clonedprobes for a number of available chromo- A. Seawright, S. Christie, D. J. Porteous, some ii assigned genes were used to define the N. D. Hastie and V. van Heyningen extent of deletions associated with the Wilms' MAC Clinical and Population Cytogenetics Unit, tumour, aniridia, genitourinary abnormalities and Western General Hospital, Crewe Road, mental retardation (WAGR) syndrome. Establish- Edinburgh EH4 2XU. ing reliable dosage studies for a number of different probes has proved difficult. We have therefore WAGR(Wilms tumour, aniridia, genitourinary abnormalities and mental retardation) syndrome concentrated on segregating the deleted chromo- is frequently associated with deletions on the short some 11 from a number of patients in somatic cell arm of chromosome 11. The deletions vary in size hybrids and analysing DNA from these to produce but always include part of band lipl3. To home a consistent map of chromosome lip. At the same in on the Wilms tumour and aniridia loci the end time we have determined the deletion breakpoints points of the different deletion breakpoints need at a molecular level and shown that the results are to be defined at the DNA level.
    [Show full text]
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Hepatocyte Growth Factor Activator Inhibitor Type 1 (Hai-1/Spint1) Is a Suppressor of Intestinal Tumorigenesis
    Author Manuscript Published OnlineFirst on February 27, 2013; DOI: 10.1158/0008-5472.CAN-12-3337 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Hepatocyte growth factor activator inhibitor type 1 (Hai-1/Spint1) is a suppressor of intestinal tumorigenesis Shinri Hoshiko,*,# Makiko Kawaguchi,* Tsuyoshi Fukushima,* Yukihiro Haruyama,* Kenji Yorita,* Hiroyuki Tanaka,* Motoharu Seiki,‡ Haruhiko Inatsu,# Kazuo Kitamura# and Hiroaki Kataoka* *Section of Oncopathology and Regenerative Biology, Department of Pathology and #Section of Circulatory and Body Fluid Regulation, Department of Internal Medicine, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan; ‡Division of Cancer Cell Research, Institute of Medical Science, The University of Tokyo, Tokyo, Japan. S.H. and M.K. contributed equally to this study Running title: HAI-1 suppresses intestinal tumorigenesis Key words: HAI-1, carcinogenesis, colon cancer, hepatocyte growth factor, epithelial integrity Financial support: This work was supported by Grant-in-Aid for Scientific Research no. 24390099 (H.K.) and no. 23790250 (M.K.) from the Ministry of Education, Science, Sports and Culture, Japan. Corresponding author: Hiroaki Kataoka, Section of Oncopathology and Regenerative Biology, Department of Pathology, Faculty of Medicine, University of Miyazaki, 5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan. Phone, +81-985-852809; Fax, +81-985-856003; E-mail, [email protected] 1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 27, 2013; DOI: 10.1158/0008-5472.CAN-12-3337 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • SPINT1) by Transcription Published: Xx Xx Xxxx Factor CDX2 E
    www.nature.com/scientificreports OPEN Intestinal regulation of suppression of tumorigenicity 14 (ST14) and serine peptidase inhibitor, Kunitz Received: 5 April 2018 Accepted: 23 July 2018 type -1 (SPINT1) by transcription Published: xx xx xxxx factor CDX2 E. Thomas Danielsen 1,2, Anders Krüger Olsen2, Mehmet Coskun3, Annika W. Nonboe2, Sylvester Larsen 1,4, Katja Dahlgaard1, Eric Paul Bennett5, Cathy Mitchelmore1, Lotte Katrine Vogel2 & Jesper Thorvald Troelsen 1 The type II membrane-anchored serine protease, matriptase, encoded by suppression of tumorgenicity-14 (ST14) regulates the integrity of the intestinal epithelial barrier in concert with its inhibitor, HAI-1 encoded by serine peptidase inhibitor, Kunitz type -1 (SPINT1). The balance of the protease/inhibitor gene expression ratio is vital in preventing the oncogenic potential of matriptase. The intestinal cell lineage is regulated by a transcriptional regulatory network where the tumor suppressor, Caudal homeobox 2 (CDX2) is considered to be an intestinal master transcription factor. In this study, we show that CDX2 has a dual function in regulating both ST14 and SPINT1, gene expression in intestinal cells. We fnd that CDX2 is not required for the basal ST14 and SPINT1 gene expression; however changes in CDX2 expression afects the ST14/SPINT1 mRNA ratio. Exploring CDX2 ChIP-seq data from intestinal cell lines, we identifed genomic CDX2-enriched enhancer elements for both ST14 and SPINT1, which regulate their corresponding gene promoter activity. We show that CDX2 displays both repressive and enhancing regulatory abilities in a cell specifc manner. Together, these data reveal new insight into transcriptional mechanisms controlling the intestinal matriptase/inhibitor balance.
    [Show full text]
  • SARS-Cov-2 Entry Protein TMPRSS2 and Its Homologue, TMPRSS4
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441280; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 SARS-CoV-2 Entry Protein TMPRSS2 and Its 2 Homologue, TMPRSS4 Adopts Structural Fold Similar 3 to Blood Coagulation and Complement Pathway 4 Related Proteins ∗,a ∗∗,b b 5 Vijaykumar Yogesh Muley , Amit Singh , Karl Gruber , Alfredo ∗,a 6 Varela-Echavarría a 7 Instituto de Neurobiología, Universidad Nacional Autónoma de México, Querétaro, México b 8 Institute of Molecular Biosciences, University of Graz, Graz, Austria 9 Abstract The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) utilizes TMPRSS2 receptor to enter target human cells and subsequently causes coron- avirus disease 19 (COVID-19). TMPRSS2 belongs to the type II serine proteases of subfamily TMPRSS, which is characterized by the presence of the serine- protease domain. TMPRSS4 is another TMPRSS member, which has a domain architecture similar to TMPRSS2. TMPRSS2 and TMPRSS4 have been shown to be involved in SARS-CoV-2 infection. However, their normal physiological roles have not been explored in detail. In this study, we analyzed the amino acid sequences and predicted 3D structures of TMPRSS2 and TMPRSS4 to under- stand their functional aspects at the protein domain level. Our results suggest that these proteins are likely to have common functions based on their conserved domain organization.
    [Show full text]
  • ST14 (NM 021978) Human 3' UTR Clone – SC207486 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC207486 ST14 (NM_021978) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: ST14 (NM_021978) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: ST14 Synonyms: ARCI11; CAP3; HAI; MT-SP1; MTSP1; PRSS14; SNC19; TADG15; TMPRSS14 ACCN: NM_021978 Insert Size: 569 bp Insert Sequence: >SC207486 3’UTR clone of NM_021978 The sequence shown below is from the reference sequence of NM_021978. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GACTGGATCAAAGAGAACACTGGGGTATAGGGGCCGGGGCCACCCAAATGTGTACACCTGCGGGGCCAC CCATCGTCCACCCCAGTGTGCACGCCTGCAGGCTGGAGACTGGACCGCTGACTGCACCAGCGCCCCCAG AACATACACTGTGAACTCAATCTCCAGGGCTCCAAATCTGCCTAGAAAACCTCTCGCTTCCTCAGCCTC CAAAGTGGAGCTGGGAGGTAGAAGGGGAGGACACTGGTGGTTCTACTGACCCAACTGGGGGCAAAGGTT TGAAGACACAGCCTCCCCCGCCAGCCCCAAGCTGGGCCGAGGCGCGTTTGTGCATATCTGCCTCCCCTG TCTCTAAGGAGCAGCGGGAACGGAGCTTCGGGGCCTCCTCAGTGAAGGTGGTGGGGCTGCCGGATCTGG GCTGTGGGGCCCTTGGGCCACGCTCTTGAGGAAGCCCAGGCTCGGAGGACCCTGGAAAACAGACGGGTC TGAGACTGAAATTGTTTTACCAGCTCCCAGGGTGGACTTCAGTGTGTGTATTTGTGTAAATGAGTAAAA CATTTTATTTCTTTTTA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer:
    [Show full text]
  • SPINT2 Suppresses Hippo Effector YAP and Limits Cellular Tolerance for Aneuploidy
    SPINT2 Suppresses Hippo Effector YAP and Limits Cellular Tolerance for Aneuploidy The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Zhang, Huadi. 2017. SPINT2 Suppresses Hippo Effector YAP and Limits Cellular Tolerance for Aneuploidy. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42061511 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA SPINT2 Suppresses Hippo Effector YAP and Limits Cellular Tolerance for Aneuploidy A dissertation presented by Huadi Zhang to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts August 2017 © 2017 Huadi Zhang All rights reserved. Dissertation Advisor: Professor David Pellman Huadi Zhang SPINT2 Suppresses Hippo Effector YAP and Limits Cellular Tolerance for Aneuploidy Abstract Oncogenic transformation is often accompanied by chromosome instability, an increased rate of chromosome missegregation. The consequent gain or loss of chromosomes—termed aneuploidy—hinders the growth of most non-cancerous tissues, but is prevalent in tumors. During tumorigenesis, aneuploidy contributes to cellular heterogeneity and may promote downstream mutations, including chromosome rearrangements and oncogene amplification. Cellular mechanisms that safeguard against aneuploidy remain unclear. The Hippo pathway is a tumor-suppressor mechanism with essential roles in regulating tissue homeostasis.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Quantitative Proteomics Screen Identifies a Substrate Repertoire Of
    www.nature.com/scientificreports OPEN Quantitative proteomics screen identifes a substrate repertoire of rhomboid protease RHBDL2 in Received: 27 April 2017 Accepted: 21 June 2017 human cells and implicates it in Published: xx xx xxxx epithelial homeostasis Nicholas Johnson1, Jana Březinová 1,2, Elaine Stephens3, Emma Burbridge5, Matthew Freeman3,4, Colin Adrain5 & Kvido Strisovsky1 Rhomboids are intramembrane serine proteases conserved in all kingdoms of life. They regulate epidermal growth factor receptor signalling in Drosophila by releasing signalling ligands from their transmembrane tethers. Their functions in mammals are poorly understood, in part because of the lack of endogenous substrates identifed thus far. We used a quantitative proteomics approach to investigate the substrate repertoire of rhomboid protease RHBDL2 in human cells. We reveal a range of novel substrates that are specifcally cleaved by RHBDL2, including the interleukin-6 receptor (IL6R), cell surface protease inhibitor Spint-1, the collagen receptor tyrosine kinase DDR1, N-Cadherin, CLCP1/DCBLD2, KIRREL, BCAM and others. We further demonstrate that these substrates can be shed by endogenously expressed RHBDL2 and that a subset of them is resistant to shedding by cell surface metalloproteases. The expression profles and identity of the substrates implicate RHBDL2 in physiological or pathological processes afecting epithelial homeostasis. Proteins of the rhomboid family are the most widely occurring intramembrane proteases and are spread through- out the tree of life. Rhomboid proteases are cardinal regulators of EGF receptor signalling in Drosophila1 but their functions in mammals are poorly understood; no mouse knockout experiments have been published for the human non-mitochondrial rhomboids and their substrate repertoires are largely unknown.
    [Show full text]
  • Research2007herschkowitzetvolume Al
    Open Access Research2007HerschkowitzetVolume al. 8, Issue 5, Article R76 Identification of conserved gene expression features between comment murine mammary carcinoma models and human breast tumors Jason I Herschkowitz¤*†, Karl Simin¤‡, Victor J Weigman§, Igor Mikaelian¶, Jerry Usary*¥, Zhiyuan Hu*¥, Karen E Rasmussen*¥, Laundette P Jones#, Shahin Assefnia#, Subhashini Chandrasekharan¥, Michael G Backlund†, Yuzhi Yin#, Andrey I Khramtsov**, Roy Bastein††, John Quackenbush††, Robert I Glazer#, Powel H Brown‡‡, Jeffrey E Green§§, Levy Kopelovich, reviews Priscilla A Furth#, Juan P Palazzo, Olufunmilayo I Olopade, Philip S Bernard††, Gary A Churchill¶, Terry Van Dyke*¥ and Charles M Perou*¥ Addresses: *Lineberger Comprehensive Cancer Center. †Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA. ‡Department of Cancer Biology, University of Massachusetts Medical School, Worcester, MA 01605, USA. reports §Department of Biology and Program in Bioinformatics and Computational Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA. ¶The Jackson Laboratory, Bar Harbor, ME 04609, USA. ¥Department of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA. #Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057, USA. **Department of Pathology, University of Chicago, Chicago, IL 60637, USA. ††Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT 84132, USA. ‡‡Baylor College of Medicine, Houston, TX 77030, USA. §§Transgenic Oncogenesis Group, Laboratory of Cancer Biology and Genetics. Chemoprevention Agent Development Research Group, National Cancer Institute, Bethesda, MD 20892, USA. Department of Pathology, Thomas Jefferson University, Philadelphia, PA 19107, USA. Section of Hematology/Oncology, Department of Medicine, Committees on Genetics and Cancer Biology, University of Chicago, Chicago, IL 60637, USA.
    [Show full text]
  • ST14 Gene Variant and Decreased Matriptase Protein Expression Predict Poor Breast Cancer Survival
    Published OnlineFirst August 17, 2010; DOI: 10.1158/1055-9965.EPI-10-0418 Cancer Research Article Epidemiology, Biomarkers & Prevention ST14 Gene Variant and Decreased Matriptase Protein Expression Predict Poor Breast Cancer Survival Jaana M. Kauppinen1, Veli-Matti Kosma1, Ylermi Soini1, Reijo Sironen1, Minna Nissinen1, Timo K. Nykopp1, Vesa Kärjä1, Matti Eskelinen2, Vesa Kataja3, and Arto Mannermaa1 Abstract Background: Matriptase plays a role in carcinogenesis, but the role of its genetic variation or that of the hepatocyte growth factor activator inhibitor-1 (HAI-1) has not been evaluated. This study aimed to examine the genetic variation of matriptase (ST14 gene) and HAI-1 (SPINT1 gene) in breast cancer risk and prognosis, to assess matriptase and HAI-1 gene and protein expression in breast tumors, and to identify their clinico- pathologic correlations and prognostic significance. Methods: Five single nucleotide polymorphisms in ST14 and three in SPINT1 were genotyped in 470 in- vasive breast cancer cases and 446 healthy controls. Gene expression analysis was done for 40 breast cancer samples. Protein expression was assessed by immunohistochemical analyses in 377 invasive breast tumors. The statistical significance of the associations among genotypes, clinicopathologic variables, and prognosis was assessed. Results: The ST14 single nucleotide polymorphism rs704624 independently predicted breast cancer surviv- al, a poor outcome associated with the minor allele (P = 0.001; risk ratio, 2.221; 95% confidence interval, 1.382- 3.568). Moreover, ST14 gene expression levels were lower among the minor allele carriers (P = 0.009), and negative/low matriptase protein expression was independently predictive of poorer survival (P = 0.046; risk ratio, 1.554; 95% confidence interval, 1.008-2.396).
    [Show full text]