Transcriptional Regulation of ST14, SPINT1 and SPINT2 Genes in Intestinal Epithelium

FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN

Master thesis E. Thomas Danielsen

Transcriptional regulation of ST14, SPINT1 and SPINT2 genes in intestinal epithelium

External supervisor: Professor Jesper T. Troelsen External supervisor: Associate Professor Lotte K. Vogel Internal supervisor: Professor, Berthe M. Willumsen

Submitted: October 14th 2011

Preface

This master thesis is submitted to the Faculty of Science, University of Copenhagen in order to obtain the Master of Science degree in Biochemistry. The research presented in this thesis was carried out at the Department of Cellular and Molecular Medicine, Faculty of Health Science, University of Copenhagen and at The Department of Science, Systems and Models, Roskilde University under guidance of my external supervisors, Professor Jesper T. Troelsen and Associate Professor Lotte K. Vogel and under guidance of my internal supervisor Professor Berthe M. Willumsen (Department of Biology, Faculty of Science, University of Copenhagen).

Acknowledgment

First, I wish to thank my daily supervisors Professor Jesper T. Troelsen and Associate Professor Lotte K. Vogel for giving me the opportunity to work in their groups. Thank you for your guidance and meaningful discussions throughout my thesis project.

I also want to thank my internal supervisor Professor Berthe M. Willumsen for accepting me as her thesis student.

Thanks to my fellow colleagues in the Troelsen-group; Anders Krüger Olsen, Mehmet Coskun and Mette Juel Riisager and in the Vogel-group; Sine Godiksen, Christoffer Søndergaard, Stine Friis, Simon Steffensen, Brian Roland, Jette Bornholdt, Joanna Selzer-Plon and Pernille Smith. Thank you for a great time.

Lotte Laustsen, Lotte lé Fevre Bram, Pernille Smith and Mette Juel Riisager are acknowledged for their kind help and support in the laboratory. Anders Krüger Olsen and Mehmet Coskun are acknowledged for their help and collaboration regarding the siRNA and ChIP experiments respectively.

I wish to thank the Danish Cancer Society for supporting me financially with a 9 month scholarship. Also thanks to Aage og Johanne Louis-Hansens fund for financial support which gave me the opportunity to present parts of my project at the XIIIth International Workshop on Molecular & Cellular Biology of Plasminogen Activation, 9th- 13th of july 2011, Cambridge UK.

Final thanks go to my family and friends for their love and support.

Copenhagen, October 2011

E. Thomas Danielsen

Table of Contents Abstract ...... 5

Dansk Resumé ...... 6

List of Abbreviations ...... 7

1. Introductory Remarks...... 8

2. Aim of study ...... 8

3. Introduction ...... 9

3.1 Overview of structure and function of the intestine ...... 9

3.2 Maintenance of the intestinal epithelial homeostasis ...... 10

3.3 The Caco-2 cell line- a model for studying the intestinal epithelium ...... 11

3.4 Matriptase ...... 11

3.5 Matriptase inhibitors, HAI-1 and HAI-2 ...... 13

3.6 Eukaryotic transcriptional regulatory elements ...... 14

3.7 Intestinal epithelium-specific transcription ...... 15

3.7.1 CDX2 ...... 16

3.7.2 HNF4a ...... 16

3.7.3 HNF1 ...... 17

3.7.4 GATAs ...... 17

3.7.5 Sp1 ...... 17

4. Materials and methods ...... 19

4.1 Cell culture ...... 19

4.2 Construction of reporter plasmids ...... 19

4.2.1 Cloning of the ST14, SPINT1 and SPINT2 promoters ...... 19

4.2.2 Cloning of the ST14, SPINT1 and SPINT2 enhancers ...... 21

4.3 Analysis of promoter activity ...... 22

4.3.1 Transfection ...... 22

4.3.2 Luciferase-β-galactosidase measurement ...... 22

4.4 Transfection of CDX2 siRNA ...... 23

4.4.1 Total RNA extraction ...... 23

4.4.2 Reverse transcription (cDNA synthesis)...... 23

4.4.3 RT-qPCR for mRNA analysis ...... 24

4.5 Electrophoretic Mobility Shift and Supershift Assay ...... 24

4.5.1 Annealing of oligonucleotides ...... 25

4.5.2 -32P labelling of oligonucleotides ...... 25

4.5.3 EMSA reaction and gel electrophoresis ...... 25

4.6 Chromatin immunoprecipitation assay ...... 26

4.6.1 Cross-linking of protein/DNA ...... 26

4.6.2 Sonication ...... 27

4.6.3 Immunoprecipitation ...... 27

4.6.4 DNA purification ...... 27

4.6.5 Real-time qPCR analysis of ChIP DNA ...... 28

4.7 Statistical Analysis ...... 28

5. Results ...... 29

5.1 Analysis of human ST14 promoter and putative enhancer element ...... 29

5.1.1 Identification of promoter and putative enhancer element of ST14 ...... 29

5.1.2 In silico analysis of promoter and putative enhancer element of ST14 ...... 31

5.1.3 CDX2 binds ST14 enhancer in vivo in Caco-2 cells ...... 32

5.1.4 In vitro analysis of CDX2-binding sites within the ST14 enhancer ...... 33

5.1.5 ST14 enhancer stimulates the ST14 promoter activity specific in Caco-2 cells ...... 35

5.1.7 Over-expression experiment affected the pGL4.10 control plasmid ...... 36

5.1.8 ST14 promoter and enhancer reporter assay with over-expression of TFs ...... 37

5.2 Analysis of human SPINT1 promoter and putative enhancer element ...... 38

5.2.1 Identification of promoter and putative enhancer element of SPINT1 ...... 38

5.2.2 In silico analysis of promoter and putative enhancer element of SPINT1 ...... 38

5.2.3 CDX2 binds SPINT1 enhancer in vivo in Caco-2 cells ...... 41

5.2.4 CDX2 binds SPINT1 enhancer in vitro in Caco-2 cells ...... 41

5.2.5 SPINT1 enhancer stimulates promoter activity in both Caco-2 and RKO cells ...... 42

5.2.6 SPINT1 promoter and enhancer activity were affected by CDX3 and Sp1 over-expression in a cell-type specific manner ...... 43

5.2.7 Sp1 binds SPINT1 promoter ...... 44

5.3 Analysis of human SPINT2 promoter and putative enhancer element ...... 45

5.3.1 Identification of promoter and putative enhancer element of SPINT1...... 45

5.3.2 In silico analysis of promoter and putative enhancer element of SPINT2 ...... 45

5.3.3 SPINT2 enhancer does not stimulate SPINT2 promoter in either Caco-2 or RKO cells ...... 47

5.3.4 SPINT2 enhancer is activated dramatically with co-expression of CDX3 and HNF4α in RKO cells.48

5.4 CDX2 siRNA experiment did not affect ST14 and SPINT1 mRNA levels in Caco-2 cells ...... 50

6. Discussion ...... 51

6.1 CDX2 binds ST14 enhancer in Caco-2 cells ...... 51

6.2 ST14 promoter activity is increased by ST14 enhancer specific in Caco-2 cell ...... 52

6.3 CDX2 binds SPINT1 enhancer...... 53

6.4 SPINT1 enhancer increases the promoter activity and is affected by CDX3 and Sp1 over-expression in a cell-type specific manner ...... 54

6.5 SPINT2 enhancer is activated dramatically with co-expression of CDX3 and HNF4α in RKO cells ...... 54

6.6 CDX2 siRNA experiment did not affect ST14 and SPINT1 mRNA levels in Caco-2 cells ...... 55

7. Conclusions and Perspectives ...... 57

8. Reference List ...... 59

9. Appendices ...... 66

9.1 APPENDIX I ...... 66

9.2 APPENDIX II ...... 67

Abstract Matriptase (encoded by ST14) is a serine type II transmembrane protease which possesses a strong oncogenic potential. Under physiological conditions matriptase is strictly regulated in epithelial cells by its cognate co-expressed inhibitors HAI-1(encoded by SPINT1) and HAI-2 (encoded by SPINT2). A disturbance of the balance in the co-expression of matriptase and its inhibitors may therefore lead to uncontrolled protease activity and contribute to carcinogenesis. In colorectal adenomas and carcinomas, the matriptase/HAI-1 mRNA ratio is elevated in comparison to corresponding tissue from control individuals.

This thesis project aimed at clarifying the underlying transcriptional mechanisms which regulate the co-expression of ST14, SPINT1 and SPINT2 in the intestinal epithelium. This was performed with emphasis on investigating their respective gene promoters and putative enhancer elements in the intestinal epithelium using the colorectal cancer cell line, Caco-2, as a model.

The identification of the putative ST14 and SPINT1 enhancers was based on a distinct binding-peak of the CDX2 transcription factor observed in previous performed CDX2-ChIP-seq data obtained from the Caco-2 cell. Another previous study in Caco-2 cells revealed that these putative enhancer regions were DNAseI hypersensitive and were moreover marked by histone 3 di-methylation at lysine 4, indicating a possible regulatory active region. By performing additional CDX2 Chromatin Immunoprecipitation (ChIP) assays we confirmed CDX2-binding enrichment within the enhancers in the Caco-2 cell which is likely to be due to binding of CDX2 at five potential sites within the ST14 enhancer and at one potential site within the SPINT1 enhancer, as showed by Electrophoretic Mobility Shift Assay (EMSA) in the Caco-2 cell. Using a luciferease reporter assay, we showed that both the ST14 and SPINT1 promoter activities were enhanced by their respective putative enhancers. Another interesting observation was that the ST14 enhancer activity was cell specific. Thus, the ST14 enhancer activity was not observed in the colorectal cell line, RKO which is known to have a low endogenous CDX2-expression level compared to the Caco-2 cell. Both the ST14 and SPINT1 enhancer activities are likely to be influenced by CDX2-regulation although further studies are needed to confirm this hypothesis.

The putative SPINT2 enhancer was selected based on a previous performed HNF4α ChIP-seq peak from Caco-2 cells. The SPINT2 enhancer region also contained an accumulation of CDX2-binding observed in the CDX2 ChIP-seq data and the enhancer sequence was moreover DNAseI hypersensitive and marked with histone 3 di-methylation at lysine 4, suggesting a regulatory active region. We showed that the SPINT2 promoter did not become stimulated by the putative SPINT2 enhancer in the reporter assay, but co-expression of HNF4α and CDX3 (CDX2 hamster homologue) dramatically increased the enhancer activity in RKO cells.

The possible role of CDX2 in regulating the endogenous mRNA level of ST14 and SPINT1 was also investigated using siRNA mediated knock-down of CDX2 in Caco-2 cells. The CDX2 knock- down did not have a noteworthy impact on the ST14 and SPINT1 mRNA levels, but the validity of this experiment still needs to be confirmed. Overall this work shows that the ST14 and SPINT1 (and SPINT2) expression may be coordinately regulated by CDX2. This could explain their observed co- expression in the intestine.

Dansk Resumé Matriptase (kodet af ST14) er en type II transmembran serin protease som har et stærk onkogent potentiale. Under fysiologiske forhold er matriptase tæt reguleret af sine co-ekpresserede hæmmere HAI-1 (kodet af SPINT1) og HAI-2 (kodet af SPINT2) i epitelceller. En forstyrrelse af balancen i co-ekspression af matriptase og dens hæmmere kan derfor føre til en ukontrolleret protease aktivitet hvilket kan bidrage til carcinogenese. I kolorektale adenomer og karcinomer, er matriptase/HAI-1 mRNA ratioen øget i forhold til tilsvarende væv fra kontrol personer.

Projektet i denne afhandling sigtede på at afklare de underliggende transkriptionelle mekanismer, der medvirker i reguleringen af co-ekspression af ST14, SPINT1 og SPINT2 i tarm epitel. Dette blev udført ved at undersøge deres respektive gen promotere og formodede enhancer elementer i tarmens epitel ved at bruge den kolorektale cancer cellelinie, Caco-2, som model.

Identificeringen af de formodede ST14 og SPINT1 enhancere var baseret på et markant bindings signal af CDX2 transkriptionsfaktoren observeret i tidligere udførte CDX2-chip-seq data fra Caco-2 cellen. Tidligere udførte eksperimenter i Caco-2 cellen afslørede, at disse formodede enhancer regioner var DNAseI sensitive og i øvrigt var præget af histon 3 di-methylering på lysin 4, hvilket indikerer mulige regulatorisk aktive regioner. Ved at udføre CDX2 Chromatin Immunoprecipitation (CHIP) assay fik vi bekræftet CDX2-bindingsberigelsen i enhancerene i Caco-2 cellen, som muligvis skyldes binding af CDX2 ved fem potentielle bindingssteder i ST14 enhanceren og ved et enkelt potentielt bindingssted i SPINT1 enhanceren, vist ved Electrophoretic Mobility Shift Assay (EMSA) i Caco-2 cellen. I et luciferease reporter assay, viste vi, at både ST14 og SPINT1 promotor aktiviteten, blev stimuleret af deres tilsvarende formodede enhancere. En anden interessant observation var at ST14 enhancer aktiviteten var celle-specifik. Således blev ST14 enhancer stimuleringen ikke observeret i den kolorektale cellelinie, RKO, som har et lavt endogent CDX2- ekpressions niveau i forhold til Caco-2 cellen. Både ST14 og SPINT1 enhancer aktiviten bliver muligvis påvirket af CDX2-regulering, selvom yderligere undersøgelser for at klarlægge denne hypotese er nødvendige.

SPINT2 enhanceren blev identificeret på baggrund af et HNF4α Chip-seq peak fra et tidligere udført arbejde i Caco-2 celler. SPINT2 enhancer regionen indeholdt også en ophobning af CDX2- bindinger observeret i CDX2 chip-seq data og enhancer sekvensen var i øvrigt DNAseI sensitiv og mærket med histon 3 di-methylering på lysin 4, hvilet indikerer en aktiv regulerende region. Vi har vist at SPINT2 promoteren ikke blev stimuleret af den formodede SPINT2 enhancer i reporter assayet, men co-ekspression af HNF4α og CDX3 (CDX2 hamster homolog) øgede enhancer- aktiviteten dramatisk i RKO celler.

Den mulige biologiske rolle af CDX2 i reguleringen af det endogene mRNA niveau af ST14 og SPINT1 blev også undersøgt ved hjælp af siRNA medieret knock-down af CDX2 i Caco-2 celler. CDX2 knock-down havde ingen markant effekt på ST14 og SPINT1 mRNA ekpressionen, men dette eksperimentelle forsøg kræver endnu at bekræftes ved yderligere forsøg. Samlet set viser dette projekt at ekspressionen af ST14 og SPINT1 (og SPINT2) muligvis er reguleret af CDX2 på en koordineret måde. Dette kunne bidrage til at forklare deres co-ekspression i tarmen.

List of Abbreviations aa amino acid ATP Adenosine triphophate bp Base pair CDX2 Caudal homeobox 2 ChIP Chromatin Immunoprecipitation Cp Crossing point CUB Cls/Clr, urchin embryonic growth factor, bone morphogenetic protein-1 DEPC diethylpyrocarbonate DMEM Dulbecco's Modified Eagle's Medium EMSA Electrophoretic mobility shift assay FBS Foetal bovine serum HAI-1 Hepatocyte growth factor activator inhibitor-1 HAI-2 Hepatocyte growth factor activator inhibitor-2 HEPH Hephaestin HNF Hepatocyte nuclear factor IN Input IP Immunoprecipitated LB Luria Broth LDLRa low density lipoprotein receptor-like protein type a repeat LPH Lactase-phlorizin hydrolase mRNA Messenger ribonucleic acid Mut Mutant nt Nucleotide PCR Polymerase Chain Reaction PI3K Phosphatidylinositol 3-Kinase RefSeq reference sequence RT reverse transcriptase SEA sea urchin sperm protein, enteropeptidase, agrin SI Sucrase-isomaltase siRNA short interfering RNA Sp1 Specificity protein 1 Sp3 Specificity protein 3 SPINT1 serine peptidase inhibitor, Kunitz type 1 SPINT2 serine peptidase inhibitor, Kunitz type 2 ST14 Suppression of tumorigenicity 14 TAD Transactivation domain TF transcription factor TSS Transcription start site Wt Wild-type

1. Introductory Remarks Matriptase (encoded by ST14), a serine type II membrane protease, is constitutively expressed in epithelial cells and has shown to be implicated in the development of the epidermis and affects the epithelial barrier (reviewed in (BUGGE et al. 2007)). However, a modest over-expression of matriptase in mice skin promotes malignant transformation (LIST et al. 2005). The potent oncogenic activity of matriptase is suppressed and tightly regulated by its cognate inhibitor hepatocyte growth factor activator inhibitor-1, HAI-1 (encoded by SPINT1). The critical importance of controlling matriptase is underscored by various clinically isolated epithelial tumors showing a dysregulated matriptase/ HAI-1 ratio (reviewed in (LIST 2009)). In addition, a recent study has reported HAI-2 (encoded by SPINT2) to be yet another physiologically important inhibitor of matriptase which has homology to HAI-1 (SZABO et al. 2008). The strict control of the highly oncogenic potential of matriptase by its two inhibitors supports its role as a critical key player in the epithelial tissue. In colorectal adenomas and carcinomas, the matriptase/HAI-1 mRNA ratio is elevated in comparison to corresponding tissue from control individuals (VOGEL et al. 2006). However, the underlying transcriptional mechanisms which regulate the balance of matriptase and HAI-1 (and HAI-2) in colorectal cancer remain to be investigated.

The epithelial cells of both the small and large intestine undergoe a differentiation process from the stem cell niche located near the crypt towards the intestinal lumen. Many years of research have expanded our knowledge of the regulatory network of transcription factors which is deeply implicated in controlling the intestinal gene expression profile and is a driving force in the intestinal differentiation process.

2. Aim of study The aim of this thesis project is to investigate the transcriptional regulation of ST14, SPINT1 and SPINT2 in intestinal epithelial cells.

3. Introduction

3.1 Overview of structure and function of the intestine The gut tube derives from the three germ layers during embryogenesis in the intestine. The ectoderm contributes to the formation of the enteric nervous system, the mesoderm contributes to the formation of the smooth muscles and the connective tissue and finally the endoderm generates the columnar intestinal epithelial cell layer. The gut is divided into the small intestine and large intestine (figure 1). Along the anterior-posterior body-axis the small intestine can further be subdivided into the duodenum, jejunum and ileum, while the large intestine is subdivided into colon and rectum. The anatomy of the small intestine is characterized by finger-like projections into the lumen of the gut, named villi, which dramatically increase the surface area available for nutrition absorption. Between the villi lie the crypts of Lieberkühn. The large intestine has no villi but contains crypts. The difference in the structure of the small and large intestine is reflected in their function. The main function of the small intestine is to absorb nutritents while the large intestine is responsible for compaction of the stools and reabsorption of fluids. In addition, the intestinal epithelial cells contain tight junctions which create a polarized intercellular barrier separating the apical and basolateral spaces (reviewed in (TSUKITA et al. 2008)). The belt-like tight junction structure surrounding the cells functions as a protective barrier against the intestinal lumen and selects for passage of small molecules required for intestinal homeostasis. The intestinal surface epithelium constantly undergoes renewal and the senescent cells are shed into the lumen. Therefore the intestine is a highly dynamic organ of self renewing processes with an average life span of less than a week for the epithelial cell (HEATH 1996).

Figure 1: Depiction of the gastrointestinal tract and the epithelial structure of the small and large intestine. (A) Overview of the gastrointestinal tract from anterior to posterior. (B) Crypt-villus structure of the small intestine. (C) Crypt structure in the large intestine. Illustration from web reference (13/10-2011); http://edoc.hu- berlin.de/dissertationen/haegebarth-andrea- 2005-08-18/HTML/image002.jpg.

The differentiated intestinal epithelial cells arise from the pluripotent intestinal stem cell (ISCs) in the crypts where the generated highly proliferative progenitor cells migrate upwards to the villi of small intestine, cease proliferation and become terminally differentiated cells (figure 1) (reviewed in (VAN DER FLIER and CLEVERS 2009)). In the colon, the cells migrate from the crypts towards the surface of the lumen.

In the small intestine, the transient amplifying progenitor cells differentiate into four distinct cell types; the absorptive enterocyte cell, the mucus producing goblet cell, the hormone secreting enteroendocrine cell and the Paneth cell (CHENG 1974; MARSHMAN et al. 2002; MILLS et al. 2002). The Paneth cell is the only of the terminally differentiated cell linages which migrate back to the crypt base where it is suggested to participate in maintaining the stem cell niche (BRY et al. 1994; SATO et al. 2011). In contrast to the small intestine, the colon is devoid of Paneth cells and contain mainly absorptive colonocytes, some goblet cells and entereoendocrine cells (BARKER et al. 2007).

3.2 Maintenance of the intestinal epithelial homeostasis The high frequency of gastrointestinal cancers has spurned research into the mechanisms that govern the normal development of the intestine and also clinical investigations of tumor formation. Disturbance in the fine-tuning signals controlling the stem cell activation and the differentiation process has been shown to be implicated in the progression of malignant intestinal tumor formation (BRABLETZ et al. 2009; MEDEMA and VERMEULEN 2011; RADTKE et al. 2006). So far five major pathways have been described to be crucial and they include the Wnt, Hedgehog (HH), Notch, Phosphatidylinositol 3-kinase (PI3K) and bone morphogenic (BMP) pathways.

The activity of the Wnt signaling is highest in the crypt region containing the stem cells and the transient amplifying cells. The Wnt activity is moreover believed to be the key player in inducing stemness-and proliferation target genes (PINTO et al. 2003) and maturation of Paneth cells (VAN ES et al. 2005). The Wnt signaling activity decreases along the crypt-vilus axis of the small intestine and towards the intestinal lumen in the colon and is assumed to be the switch between proliferation and differation of intestinal cells (VAN DE WETERING et al. 2002) in interaction with Notch signaling (FRE et al. 2005; NAKAMURA et al. 2007). Crosstalk of Wnt signaling with the BMP and PI3K signaling is also important in modulating and creating the intestinal stem-cell and differentiation region niches (HARDWICK et al. 2004; VIVANCO and SAWYERS 2002).

The importance of the Wnt signalling as a central pathway is underlined by the observation that mutations in Wnt-related genes result in adenomatous polyp formation or colon cancer in mice studies and in clinical human samples (KINZLER and VOGELSTEIN 1996; SHIBATA et al. 1997).

An emerging biological paradigm is the concept of cancer stem cells (CSSs) (reviewed in (CLEVERS 2011)). The idea of the CSS which escapes chemotherapy due to the low proliferation rate could explain the tumor disease relapse. Colon cancer research has therefore focused on characterizing expression profiles of colon CSSs and trying to identify potential biomarkers including Lgr5 which

10 is a Wnt target gene and which interacts with Wnt signaling (BARKER et al. 2007; DE LAU et al. 2011; MERLOS-SUAREZ et al. 2011).

The interaction of Wnt, BMP, Notch and other pathways target and activates transcription factors (TFs) in a coordinated regulatory network which defines the genetic expression program of the intestinal differentiation process (MARIADASON et al. 2002; MARIADASON et al. 2005). In the search for intestinal specific TFs, highly expressed intestinal specific genes have been investigated including lactase-phlorizin hydrolase (LPH, involved in lactose digestion) and sucrase-isomaltase (SI, involved in digestion of sucrose and α-dextrins). Research included these two genes has led to the identification of important intestinal TFs including HNF-1α/β, HNF-4α, GATA factors and CDX2 (BOUDREAU et al. 2001; BOUKAMEL and FREUND 1994; FANG et al. 2001; STEGMANN et al. 2006; TROELSEN et al. 1997).

3.3 The Caco-2 cell line- a model for studying the intestinal epithelium The human colorectal adenocarcinoma cell line Caco-2 was established from a Caucasian male more than 30 years ago (FOGH et al. 1977). The Caco-2 cell has the unique ability to spontaneously differentiate when cultured in vitro. When the cells are seeded they grow as a monolayer and when confluent they change morphology, grow in height and differentiate into polarized columnar epithelial cells with characteristics of the enterocytes on the villi of the small intestine. The differentiated Caco-2 cell has intestinal-like morphology and biochemical characteristics including a well-developed brush border (microvilli), intercellular junctions which divide their membranes into an apical and basolateral side and moreover the cells express digestive enzymes. The Caco-2 cell is a widely used in vitro model for studying the intestinal epithelial including intestinal membrane transport, drug absorption (ARTURSSON et al. 2001; HIDALGO et al. 1989). The Caco-2 cell has also been widely used for investigating regulation of intestinal genes by intestinal specific transcription factors including CDX2 which is essential for the intestinal differentiation process (VERZI et al. 2010). RKO is another colorectal cancer cell line which does not differentiate into an intestinal-like morphology and has moreover a low CDX2 expression level (DA COSTA et al. 1999). However, Caco-2 is a cancer cell line with 89 chromosomes (MELCHER et al. 2002) and the cell composition of the monolayer is limited to enterocyte-like cells.

3.4 Matriptase The type II transmembrane serine protease, Matriptase encoded by ST14 (suppressor of tumorigenicity 14) is expressed in epithelial tissues, including in the intestine (OBERST et al. 2003). Foremost, matriptase has drawn attention due to its oncogenic potential which is shown in a study using transgenic mice with a modest overexpression of the serine protease in the skin resulting in dysplasia development in all transgenic mice whereas 70% progressed into cell squamous carcinoma (LIST et al. 2005). Clinically, the oncogenic potential is supported by studies showing matriptase to be expressed in a variety of carcinomas (epithelia derived cancer) (OBERST et al. 2001) with observations of dysregulated expression levels (reviewed in (LIST et al. 2006; SZABO and BUGGE 2008)).

Ablation of matriptase has also been shown to have an impact on the formation and maintenance of the epithelial barrier of the skin and in the intestine. Matriptase knock-out mice die within 48 hours due to abnormal epidermis with symptoms of dysfunctional epidermal barrier leading to dehydration (LIST et al. 2002). Furthermore, tissue-specific conditional knock-out in adult mice in the intestine leads to dysfunctional epithelial barrier and permeability with loss of intercellular adhesion (LIST et al. 2009). The effect of matriptase ablation on the barrier integrity of intestinal epithelial cells has also been investigated with in vitro studies. siRNA-mediated knock down of matriptase in Caco-2 cells affects the epithelial integrity by a decrease in the transepithelial resistance with observations of altered expression of the tight junction protein, Claudin-2 (BUZZA et al. 2010). Moreover, a proteolytic cascade of matriptase and a trypsin-like protease, prostasin is reported to be implicated in epidermal differentiation (NETZEL-ARNETT et al. 2006).

Figure 2: Protein structure of membrane bound (A) matriptase and (B) HAI-1 and HAI-2. The drawn proteins are not to scale. The lines in the cleaved SEA domain of the active matriptase represent non-covalent interactions and the disulfide (S-S) bridges do not correspond to the actual location or number.

Matriptase consists of 855 amino acids and has a molecular weight of 95 kDa without glycosylations. As seen in figure 2, the protein multidomain structure contains a short cytosolic N- terminal domain, a transmembrane domain and an extracellular stem-region containing one SEA

(sea urchin sperm protein, enteropeptidase, agrin) domain, two CUB (Cls/Clr, urchin embryonic growth factor, bone morphogenetic protein-1) domains and four LDLRa (low density lipoprotein receptor-like protein type a repeat) domains (BUGGE et al. 2007). The catalytic activity of matriptase requires two post-translational cleavages (see figure 2); the first cleavage occurs at Gly149 at the SEA domain generating two non-covalently associated fragments and the second auto-catalytic cleavage occurs at Arg614 resulting in an active catalytic domain covalently associated with the stem-region by disulfide bridges (LIST et al. 2006; TSUZUKI et al. 2005).

An interesting question is how matriptase contributes to carcinogenesis. In search for potential substrates for the proteolytic activity of matriptase, a series of in vitro assays have been performed revealing potential substrates including urokinase-type plasminogen activator (uPA), protease activated receptor 2 (PAR2) and pro-hepatocyte growth activator (pro-HGF) (LEE et al. 2000; NETZEL-ARNETT et al. 2006; TAKEUCHI et al. 2000). The cancerous effect of matriptase might be linked to its ability to cleave and activate these substrates which are known to be implicated in tumor-growth, invasion and metastasis (ANDREASEN et al. 2000; COMOGLIO and BOCCACCIO 2001; SCHAFFNER and RUF 2009). In addition, a recent study links matriptase to c-Met induced epithelial carcinogenesis (SZABO et al. 2011).

3.5 Matriptase inhibitors, HAI-1 and HAI-2 Another topic regarding matriptase and its malignant capacity has been the strict regulation of the protease, especially the complex relationship with its two cognate inhibitors, Hepatocyte growth factor activator inhibitor-1 and 2 (HAI-1 and HAI-2).

HAI-1 is encoded by SPINT1 and consists of 529 amino acids and has a molecular weight of approximately 58kDa. The protein structure consists of a short intracellular C-terminal region, a transmembrane domain and two Kunitz-type inhibitor domains (KD1 and KD2) separated by a LDLRa domain (see figure 2) (LIST et al. 2006). Giving its name, HAI-1 was originally discovered as being an inhibitor of hepatocyte growth factor activator (HGFA), which like matriptase can convert pro-HGF into the active HGF (SHIMOMURA et al. 1999). However, HAI-1 was discovered to form a complex with matriptase in human milk (LIN et al. 1999). The importance of HAI-1 as being an essential inhibitor of matriptase was shown in a study using transgenic mice where the ongogenic effect of matriptase over-expression was completely negated when co-expressed with HAI-1, resulting in a phenotype similar to wild type mice (LIST et al. 2005). This suggests that the malignant effect of matriptase over-expression might be due to the amount of unopposed and active protease. The importance of their interaction is also supported by their co-expression in a variety of normal and malignant epithelial tissues (OBERST et al. 2001; SZABO et al. 2008). In addition, it has been shown that matriptase and HAI-1 mRNA levels are both lowered but creates a higher matriptase/HAI-1 ratio during colorectal carcinogenisis compared to normal control tissue (VOGEL et al. 2006). The critical inhibition of matriptase by HAI-1 has also been investigated at the cellular level showing that matriptase requires HAI-1 for correct intracellular trafficking by strict and complex control mechanisms (GODIKSEN et al. 2008; OBERST et al. 2005; TSUZUKI et al. 2005). Only moments after matriptase becomes active it is inhibited by a rapidly forming complex with HAI-1 (WANG et al. 2009).

After the discovery of HAI-1, yet another HGFA inhibitor was found, HAI-2 (KAWAGUCHI et al. 1997; MARLOR et al. 1997). HAI-1 and HAI-2 share high degree of homology although HAI-2 does not contain the LDLRa domain between its two Kunitz domains (see figure 2). HAI-2 is encoded by SPINT2 and consists of 252 amino acids with a molecular weight of approximately 28kDa. HAI-2 has been observed in vitro to have the ability to inhibit the proteolytic activity of matriptase towards known substrates by forming a complex with the protease (SZABO et al. 2008). Moreover, in mice HAI-2 is observed to be co-expressed with matriptase in great amount in epithelial cells as reported for HAI-1 (SZABO et al. 2008).

The importance of both HAI-1 and HAI-2 in matriptase inhibition was shown in a study using transgenic mice with different allelic knockout combinations of the three proteins (SZABO et al. 2009). In this study it was reported that the presence of matriptase expression required three out of four HAI alleles for embryonic survival. Altogether, it is clear that the severe oncogenic potential of matriptase requires strict and tight regulation in order to maintain epithelial homeoastasis.

Matriptase seems to be differential expressed along the crypt-villus axis in the intestine. In situ hybridization on rat intestine shows that matriptase mRNA expression increases towards the villus tip region of the small intestine and towards the intestinal lumen in colon (SATOMI et al. 2001). This expression pattern is also supported by data from a microarray database on mRNA expression from isolated crypts and villus of adult mouse ileal epithelium showing that st14 expression is upregulated with a 2.24-fold in the villus compared to the crypt (see figure 26 in Appendix II) (STEGMANN et al. 2006). Based on a cell-detachment in vitro study, matriptase is suggested to participate in shedding of villus tips cells (MOCHIDA et al. 2010). HAI-1 and HAI-2 are expressed throughout the crypt-villus axis (SZABO et al. 2008) where they are likely to participate in inhibiting other proteases than matriptase also, ex. HGF (reviewed in (PARR et al. 2010)). However, the Spint1 expression is also up-regulated with a 3.36-fold in the villus region compared to the crypt region of mouse small intestine (see figure 27, Appendix II).

3.6 Eukaryotic transcriptional regulatory elements In general, the core promoter of genes (figure 3) is considered to generate a very low basal transcription activity. The basal transcription machinery is often stabilized by interaction with factors that are bound to site-specific DNA regulatory elements which are able to increase the transcription activity and/or recruit co-activators (reviewed in (THOMAS and CHIANG 2006)).

During the developmental differentiation process, DNA regulatory elements are believed to have a central role in the spatiotemporal gene expression patterns that determine the cell/ tissue type (reviewed in (ONG and CORCES 2011)). The transcriptional regulatory DNA elements, including enhancers, silencers and insulators (figure 3) can function in chromatin loops from distal sites. The sequence of the regulatory elements is suggested to encode epigenetic memory which is responsible for the timing of TF-binding which determines cell fate by fine-tuning the specific gene expressing programs (ONG and CORCES 2011). The epigenetic chromatin signature defining enhancer sites includes H3K4me1/2 (histone H3 mono- or dimethylation at lysine 4), H3.3/2.A.Z (histone variants

H3.3 and H2A.Z), DNAseI hypersensitivity and occupancy of CBP (cyclic AMP-responsive element-binding (CREB) protein) (figure 3) (reviewed in (ONG and CORCES 2011)).

Figure 3: Eukaryotic transcriptional elements. Transcriptional start site (TSS) located within the core promoter which is flanked by proximal- and distal promoter elements. Enhancer, silencer and insulator regulatory elements are located distanly and interspersed within the chromosome. Enhancer sites are suggested to be marked by specific chromatin features including H3K4me1, H3K4me2, H3.3/2.A.Z variants, DNAse I hypersensitivity and binding of CBP Illustration is adapted from (ONG and CORCES 2011).

Techniques including ChIP-chip (microarray hybridization of chromatin immunoprecipitation) and ChIP-seq (high-throughput sequencing of chromatin immunoprecipitation) have contributed to genome-wide mapping of TF-binding sites (ALEKSIC and RUSSELL 2009) and epigenetic marks such as histone-modifications, DNA-methylation and DNAseI hypersensitive regions. However, these techniques do not confirm the biological function of the interaction between gene promoter and putative regulatory elements. In contrast the more recent technique, Chromosome Conformation Capture (3C) has enabled revealing the physical interactions between promoters and long-range enhancers within the nucleus (SIMONIS et al. 2007). This technique is very useful in validating the communication between the promoter and enhancers in chromatin loops during gene activation (CHAMBEYRON and BICKMORE 2004).

The massive amounts of generated data from binding of tissue and/or cell specific TFs can be used for bioinformatic analysis of co-occupying binding sites and help to reveal transcriptional regulatory networks and identify target genes in the differentiation process that determine the cell fate.

3.7 Intestinal epithelium-specific transcription The following section introduces the important transcription factors for the intestinal epithelial homeoastasis; HNF-1α/β, GATA factors, HNF-4α, CDX2 and the ubiquitously expressed non- specific Sp1/Sp3 TFs.

3.7.1 CDX2 The CDX2 TF belongs to the homeobox gene family and was originaly discovered in Drosophila Melanogaster (MLODZIK et al. 1985). CDX2 is known to have an important part in the embryonic development but it is limited to the gut of the mammalian adult with an increasing expression from the upper crypt region towards vilus of the small intestine and from the base crypt towards the intestinal lumen of the large intestine (RINGS et al. 2001; SILBERG et al. 2000). Studies have shown that the transcriptional activity of CDX2 is differently regulated along the crypt-vilus axis. In the proliferating cells, CDX2 is inhibited by phosporylation at Ser60 by the mitogen-activated protein kinase pathway whereas an increased transactivating capacity is mainly found in the differentiated epithelial cells where CDX2 is predominantly non-phosphorylated at Ser60 (RINGS et al. 2001). CDX2 has been established as being an critical factor for intestinal homeoastasis regarding regulating cell proliferation and differentiation (SUH and TRABER 1996). Transgenic mice with conditional inactivation of Cdx2 in the intestine exhibit abnormal villus morphology and differentiation of cells in the small intestine whereas the colonocytes of the large intestine differentiate into a more gastric-like phenotype (GAO et al. 2009). CDX2 targets and regulates a variety of intestinal specific genes encoding digestive and absorptive proteins (DRUMMOND et al. 1996; SUH and TRABER 1996; TROELSEN et al. 1997). CDX2 is also observed to function in cooperation with other TFs in the intestine. Cooperation between CDX2, GATA-4 and HNF1α has been suggested to regulate expression of intestinal genes including sucrase-isomaltase, lactase- phlorizin hydrolase and the tight junction component, Claudin-2 (BOUDREAU et al. 2002; MITCHELMORE et al. 2000; SAKAGUCHI et al. 2002).

It is thus clear that CDX2 has an important role in gut development and in maintenance of intestinal homeostasis but it has also been given a role as a tumor-suppressor in colon (BONHOMME et al. 2003). Transgenic mice with heterozygotic expression of Cdx2+/- are reported to have a higher probability of developing polyp-like lesions compared to wild type mice (CHAWENGSAKSOPHAK et al. 1997). In addition, studies have revealed Cdx2 to be implicated in cell migration in wound healing and spreading of metastatic colon cancer (BRABLETZ et al. 2004; GROSS et al. 2008; RAO et al. 1999). The suggested critical role of CDX2 in colon cancer is also supported by its reduced expression level in colon cancer samples compared to normal control tissue (BRABLETZ et al. 2004; CHOI et al. 2006; WERLING et al. 2003).

3.7.2 HNF4a Another important TF involved in intestinal differentiation is hepatocyte nuclear factor 4α, HNF4α which is found with the highest expression in the jejunum (LEHNER et al. 2010). A study using transgenic mice with intestine-specific conditional knock down of HNF4α results in abnormally increased cell proliferation in the crypts of the small intestine (CATTIN et al. 2009). Several studies have shown that HNF4α regulates genes that are markers of the differentiated enterocyte in the small intestine. These target genes include lactase phlorizin hydrolase, intestinal alkaline phosphatase, ((ARCHER et al. 2005; OLSEN et al. 2005; STEGMANN et al. 2006)). Genes encoding intestinal digestive brush border enzymes including aminopeptidase N, trehalase (TREH) and the tight junction protein cingulin (CGN) are also bound by HNF4α as shown by using ChIP-chip

(BOYD et al. 2009). Therefore, HNF4α is assumed to have an important role in the intestinal differentiation process.

3.7.3 HNF1 Hepatocyte nuclear factor 1α and 1β (HNF-1α/1β) are two related TFs which share homology in their DNA-binding domain and target DNA sequences as homodimers or as heterodimers (MENDEL et al. 1991). They are expressed in several epithelia and in the small intestine of mouse, HNF-1α is expressed throughout the crypt-villus axis while HNF-1β expression is restricted to the crypt (SERFAS and TYNER 1993). Conditional knockout in mouse intestine of both TFs results in a lethal phenotype with dysfunctional intestinal water absorption and defects in cell linage differentiation (D'ANGELO et al. 2010).

3.7.4 GATAs GATA TFs are widely expressed in a variety of tissues and are involved in gene expression regulating proliferation and differentiation (MOLKENTIN 2000). In the gut, the GATA subgroub containing GATA4/5 and 6 is expressed in different patterns. GATA4 is mainly expressed in cells lining the villus region in jejunum and ileum of the small intestine and a modest GATA4 expression is observed in the colon (BOUDREAU et al. 2002). GATA5 is expressed throughout the small intestine, but not in the large intestine. GATA6 is expressed in both the small- and large intestine (DUSING et al. 2003). Studies using transgenic mice with conditional knockdown of GATA4 and GATA6 report that these two factors have an impact on cellular proliferation and differentiation in the small intestine (BEULING et al. 2011).

3.7.5 Sp1 Specificity protein 1 (Sp1) belong to the Specificity Protein/Krüppel-like Factor (SP/KLF) TF family (reviewed in (LI and DAVIE 2010)). Sp1 is expressed in all mammalian cells and is involved in regulating transcription of genes implicated in almost all cellular processes. Sp1 is reported to bind mainly GC-boxes but it also has the ability to bind CT- and GT-boxes with a lower affinity. Sp1 consists of two glutamine-rich transactivation domains (TADs) which enables the TF to interact with TATA-binding protein (TBP) and TBP-associated feactor 4 (TAF4). Sp1 was originaly assumed to be involved in transcribing genes which are not highly regulated such as housekeeping genes and other TATA-less genes. However Sp1 target genes has expanded to also include genes containing TATA-boxes. Sp1 competes its binding to GC, CT-and GT-boxes with its homologue specificity protein 3, Sp3. A general observation is that Sp1 function as an activator whereas Sp3 functions as either a repressor or activates with a lower degree than Sp1 (reviewed in (WIERSTRA 2008)).

Sp1 is reported to interact and coorperate with TFs including CDX2. Studies have shown that Sp1 and CDX2 coorperates in regulating intestine specific expression of PEPTI and ELMO3 (COSKUN et al. 2010; SHIMAKURA et al. 2005; SHIMAKURA et al. 2006).

Cooperation between CDX2, HNF-1α and GATA-4 in target intestinal specific genes indicates an intestine specific transcriptional regulatory network (BENOIT et al. 2010; BOUDREAU et al. 2002;

MITCHELMORE et al. 2000). The existence of a intestine specific network is further supported by ChIP-chip data revealing CDX2, HNF-4α co-occupancy at intestine target sites in the differentiation process (VERZI et al. 2010).

4. Materials and methods

4.1 Cell culture Caco-2 cells (human colon carcinoma cell line) and RKO cells (human colon carcinoma cell line) were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, Lonza, cat#BE12-604F) containing 4,5g/L Glucose, L-Glutamine and supplemented with 10% heat-inactivated foetal bovine serum (FBS, PAA, cat#A15-151), 100 U/ml penicillin and 100 U/ml streptomycin. Both cell lines were grown in T175 flasks (Nunc, cat#159910) at 37˚C in a humid atmosphere with 5% CO2. Cells were passaged every 3-4 days when they were ca. 80% confluent. First, the medium was removed and the cells were rinsed with 0.085 mM sodium citrate followed by addition of 5 ml of 0.05% trypsin- EDTA (Gibco, cat#25300-054) and the cells were incubated 5 min. at 37˚C in a humid atmosphere with 5% CO2 to loosen cells. The proteolytic activity of trypsin was stopped by adding 10 ml of growth medium and depending on the confluence the cells were passaged ca. 1/10 into new T175 flask with 30 ml medium.

4.2 Construction of reporter plasmids

4.2.1 Cloning of the ST14, SPINT1 and SPINT2 promoters The Gateway® Technology (Invitrogen) was used to clone the selected promoter sequences into the firefly luciferase reporter vecter, pGL4.10 (Promega) which had previously been converted into a Gateway Destination Vector in our group (see figure 25 in Appendix I). First, the sequence of interest was cloned into a Gateway entry vector using the TOPO TA cloning system (Invitrogen). Second, the promoter was cloned from the TOPO TA cloning entry vector into the pGL4.10 Gateway destination vector by Gateway LR recombination reaction.

Primers listed in table 1 were used to amplify the following upstream flanking human promoter sequences position relative to the 1+ transcriptional start site; ST14 (Ref-seq no. NM_021978) position -947 to +173 (1120 bp), SPINT1 (Ref-seq no. NM_181642) position -1030 to +27 (1057 bp) and SPINT2 (Ref-seq no. NM_021102) position -1012 to +172 (1184 bp). The primers were designed using the web-based Primer3 software and they were purchased from Eurofins MWG. Advantage™-GC cDNA PCR kit (Clontech, cat#639112) was used for the for Polymerase Chain Reaction (PCR) amplification and the reaction contained 50 ng Human Genomic DNA (Roche, cat#11691112001), 10 pmol of each forward and reverse primer, 5 µl 5x GC cDNA PCR reaction buffer, 7,5 µl GC melt buffer, 0,5 µl 50xdNTP mix, 0,5 µl Advantage- GC cDNA Polymerase Mix and Milli-Q H2O to a final volume of 25 µl. A “touchdown” PCR program was used for the amplification reaction to gradually lower the annealing temperature to reduce non-specific background. The PCR settings were as follow; an initial denaturation for 5 minutes at 94˚C, 10 cycles of; 94˚C for 30 sec. (denaturation), 68˚C (first cycle) to 58˚C (last cycle) for 1 min. (annealing), 72˚C 1 min. (extension) and 30 cycles of 94˚C, 30 sec (denaturation), 58˚C, 30 sec. (annealing), 72˚C 30 sec. (extension) with a final extension for 7 min. at 72˚C.

The PCR product was run on a 1,5% agarose gel and purified according to the manufactures procedure using NucleoSpin®Extract II kit (Macherey-Nagel, cat#740 609.250). The product was eluted in 15 µl elution buffer supplied from the kit.

Name Sequence (5’-3’) Length (bp) st14 prom. F: AACAGTGGAAAATGGGCAAG 20 R: GGTCTCACAGGCGTCGTC 18 st14 enh. F: GGATCCTCCTTTGGCCAGGATCTAAC 26 R: GGATCCAGCGAGGCTGTCAGCAGT 24 SPINT1 prom. F: TGGAGGATGTTGCAGTTCAG 20 R: CTTCTCCCCCTGGTTTCTG 19 SPINT1 enh. F: GTCGACGCACTGAGAGCTTCCAAACC 26 R: GTCGACTCCCTCCTTGCATTTTGTAGA 27 SPINT2 prom. F: AGCCAAGATCACTCCATTGC 20 R: CTTTCCGGACCTTCAGTGTG 20 SPINT2 enh. F: GGATCCTGGTAGAATTGAAATAGGCTTCA 29 R: GGATCCATGAAGACAGGACTAATATAGGGACA 32 Promoter Sequencing F: CTAGCAAAATAGGCTGTCCC 20 R: TGGGCCCTTCTTAATGTTTT 20 Enhancer Sequencing F: GTCATAAGTGCGGCGACGATAGT 23 R: AGGGGGAGGTGTGGGAGGTTTT 22 Table 1: Primers for DNA amplification and sequencing of pGL4.10 vector

For TOPO TA cloning, 4,5 µl of the purified PCR product was mixed with 0,5 µl pCR8/GW/TOPO TA Vector (Invitrogen, cat#45-0642) and incubated for 5 min. at room temperature. 2 µl of the TOPO cloning mix were added to 25 µl XL-1 Blue supercompetent cells (Agilent Technologies, cat#200236) and incubated for 30 min. on ice for transformation. After incubation on ice, the cells were transferred to a 42˚C waterbath for 45 sec. for a heat shock and better uptake of plasmids. The cells were returned to ice for 2 min. and 250 µl S.O.C. medium (Invitrogen, cat#15544-034) were added followed by an incubation for one hour at 37˚C under 170 rpm horizontal shaking. The cells were plated onto two plates of Luria Broth (LB) agar plates (Tryptone-B, Yeast Extract-B, NaCl and Agar-B) containing 10 µl/ml spectinomycin and incubated over night at 37˚C. Next day, forming colonies were inoculated in 3 ml LB medium (Tryptone-B, Yeast Extract-B, NaCl) containing spectinomycin for selection and incubated over night at 37˚C. The cell culture was harvest for isolation of plasmid using GeneElute™ Plasmid Miniprep Kit (Sigma Aldrich, cat#079k6106). The minipreps were screened and validated for successful cloning and right orientation by restriction analysis and the DNA concentration was measured using spectrometry (ND-1000, NanoDrop).

The attL sites of the pCR8/GW/TOPO TA entry vector and the attR sites of the pGL4.10 Gateway destination vector were used for recombination reaction and transfering of the cloned promoter sequences. 150 ng pCR8/GW/TOPO with inserted promoter sequences were mixed with, 150 ng pGL4.10 vector, 2 µl Gateway® LR Clonase™II Enzyme Mix (Invitrogen, cat# 11791-100) and added with TE buffer to a final volume of 10 µl and incubated for one hour at room temperature. 2

µl of the Gateway reaction mixture was added to 25 µl XL-1 Blue supercompetent cells (Agilent Technologies, cat#200236) and the cells were transformed with the same procedure as described above for the TOPO TA constructs with the exceptions of using 50 µg/ml ampicilin for selection of transformed cells. Moreover, the cloned pGL4.10 vectors were selected by replacing the ccdB sensitive gene within the pGL4.10 vector with the inserted cloned fragment. pGl4.10 minipreps were validated with restriction analysis and successfully cloned plasmids were sent to sequencing at Eurofins MWG using the sequencing primers listed in table 1. The pGL4.10 constructs containing the selected promoter sequences are termed pST14 prom., pSPINT1 prom. and SPINT2 prom in the luciferase reporter assay results.

4.2.2 Cloning of the ST14, SPINT1 and SPINT2 enhancers Primer3 were used for design of primers (listed in table 1) for amplification of following putative enhancer elements position relative to the 1+ transcriptional start site; ST14 (Ref-seq no. NM_021978) position +21579 to +22159 (580 bp), SPINT1 (Ref-seq no. NM_181642) position +3331 to +3863 (532 bp) and SPINT2 (Ref-seq no. NM_021102) position +8807 to +9332 (525 bp). The ST14 and SPINT2 primer pairs were designed with an additional flanking BamHI restriction site used for cloning. The SPINT1 primer pair was likewise designed with a flanking SalI restriction site. Primers were purchased from Eurofins MWG.

The putative enhancer elements for the respectively genes were PCR amplified and TOPO TA cloned with the same procedure as for the promoter constructs with the exception that the PCR products were cloned into pCR2.1 TOPO TA entry vector (Invitrogen, cat#45-0641) and with selection of transformed cells using 50 µg/ml ampicilin, 0,7µl/ml 100mM IPTG and 2µl/ml 200 µg/ml Xgal. Minipreps were validated using restriction analysis.

Next, the enhancer sequences inserted in the pCR2.1 TOPO TA entry vector were transferred into the respectively pGL4.10 promoter constructs. pCR2.1 TOPO vectors containing ST14 and SPINT2 enhancer sequences and pGL4.10 containing ST14 and SPINT2 promoters were digested with BamHI (Fermentas, ER0051) for 1,5 hour at 37˚C. Likewise, the pCR2.1 TOPO vector and pGL4.10 vector containing SPINT1 enhancer and promoter sequences respectively were digested with SalI (Fermentas, cat#ER0641). The linerized pGL4.10 constructs were purified using S-200 columns (Microspin™ S-200 HR Columns, GE Healthcare, cat#27-5120-01) and the digested ends were dephoshorylated with Calf Intestine Alkaline Phosphatase (CIAP, Fermentas, cat#EF0341) for 1 hour at 37˚C and run on a 1,5% agarose gel together with the digested pCR2.1 TOPO vectors. The linerized pGL4.10 vectors and the digested enhancer sequences were gel purified and the DNA concentration was measured. The purified enhancer sequences were ligated into the linerized and dephosphorylated pGL4.10 (containing the respectively promoters) in a ca. 3:1 molar ratio using T4 DNA ligase (Fermentas, cat# EL0011) and incubated for one hour at room temperature. The ligated mix was transformed into XL-1 Blue supercompetent cells (Agilent Technologies, cat# 200236) with the same conditions as for the pGL4.10 promoter contructs. Minipreps were validated with restriction analysis and sequenced. The pGL4.10 constructs containg both cloned promoter and enhancer are termed pST14 prom. + enh., pSPINT1 prom. + enh. and SPINT2 prom. + enh. in the luciferase reporter assay results.

All successfully cloned minipreps were grown up in large scale by transferring 500 µl of miniprep culture into 200 ml of fresh LB medium containing 50 µg/ml ampicilin and were cultured over night followed by a maxi plasmid preparation according to manufactures procedure using Plasmid Maxi kit (QIAGEN, cat#12165). The DNA concentration was measured on a Nanodrop (ND-1000) and the stock was stored at -20˚C.

4.3 Analysis of promoter activity

4.3.1 Transfection A non-commercial transfection reagent has been introduced in our group as a substitution for our previous use of Exgen-500 in vitro (Fermentas,cat#R0511). The new reagent, Polyethyleneimine, linear (Alfa Aesar, cat#43896) was dissolved in milliQ water and calibrated to pH7 using 4M HCL and the final concentration of the transfection reagent (now termed PEI25) stock was 1mM. For use in transfection experiments the stock was diluted in 150 mM NaCl to a final concentration of 2 µM. The use of PEI25 as a transfection reagent has been validated by comparing with Exgen-500 in vitro. PEI25 seems to have an acceptable transfection efficiency and it does not have an impact on the transfection results due to the change of transfection reagent.

Caco-2 cells and RKO cells were seeded in 24 well plates (Costar, cat#3526) at a density of 5x10^4 cells/well and transfected the following day at an approximately 60-80% cell confluence. Each experiment contained 0.2 µg of pGL4.10 reporter plasmid construct, 0.1 µg pCMV-lacZ (internal transfection control) and pBluescript SK+ plasmid was added to correct the total amount of DNA to 1.2 µg. For co-transfection experiments, 0.1 µg of each expression vector was used, pCMV-CDX3 (CDX2 hamster homologue expressing vector), pCMV-Sp1, pCMV-GATA4 and pCMV-HNF4α. pcDNA3.1+ was added to correct for the total amount of CMV-driven vectors. The DNA mix was supplemented with 150mM NaCl to a total volume 100 µl and was incubated with 100 µl of 2 µM PEI25 for 1,5 hour at room temperature. The culture medium of the cells was changed and the DNA/PEI25 complex was split into four replicates by pippeting 49 µl of the mix into each well and the 24-well plates were centrifuged for 5 min. at 1200 rpm. The medium was replaced after 24 hours, and after 48 hours the cells were harvested for the luciferase-β-galactosidase assay.

4.3.2 Luciferase-β-galactosidase measurement For harvest, the cells were washed with cold phosphate-buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4 7H2O and 1.4 mM KH2PO4) and lysed in 130 µl lysis buffer (provided in the Dual Light® assay kit, Tropix, cat #T1004) supplemented with 0.5 µl/ml 1M DTT per well and incubated for 5 min. at room temperature. The luciferase activity was measured in a luminometer (Berthold, Lumat LB9501) by mixing 10 µl cell lysate with 25 µl Buffer A (Tropix, cat# T1004) followed by an injection of 100 µl Buffer B supplemented with Galacton plus (Tropix, cat#T1004) into the reaction tube. The luminometer was programmed with a 2 sec. delay followed by a 5 sec. measuring time. After measuring the luciferase activity, the samples were incubated for one hour at room temperature and then the β-galactosidase activity was measured by injection of

100 µl Accelerator (Tropix, cat#T1004). For each replicate the luciferase acivity was normalized to the β-galactosidase activity.

4.4 Transfection of CDX2 siRNA The following CDX2 siRNA experiment was performed in collaboration with PhD.stud. Anders Krüger Olsen.

Transfection of siRNA was performed in 24 well plates (Costar cat#3526) and optimized using a combination of two Caco-2 cell densities (2,5- and 5 x 10^4 cells per well) and two siRNA concentrations (25 nM and 100 nM) with X-tremeGene siRNA Transfection Reagent (Roche, cat #04476093001). All experiments were performed in four replicates. The cells were transfected the day after they were seeded. Before transfection, the culture medium was replaced with 450 µl/ well of DMEM medium with 10% heat-inactivated serum only. Both the CDX2 siRNA (siRNA-CDX2, Eurogentec, #1121595) and the control siRNA (Pool of four non-targeting siRNAs (Dharmacon; D- 001810-10-05)) stocks were diluted to a final concentration of 25 nM and 100 nM per well. First, the siRNA and 2,5 µl transfection reagent were each diluted in 50 µl of serum- and antibioticfree DMEM medium and incubated for 5 min. at room temperature. Next, the siRNA solution were mixed cautiously with the transfection reagent solution and incubated for 20 min. at room temperature to form complex. Finally, the transfection mix was carefully pipetted onto the cells. The cells were harvested on day 2 and day 4 for total RNA extraction. On day 2, the medium for the day 4-harvest was replaced with DMEM medium with 10% heat-inactivated serum only.

4.4.1 Total RNA extraction The total RNA for the siRNA experiments was extracted according to the manufactures protocol using the E.Z.N.A. Total RNA KIT I (Omega Bio-Tek, cat#R6834-02). The RNA for each sample was eluted in 40 µl diethylpyrocarbonate (DEPC)-treated water and the RNA concentration was measured using spectrometry.

4.4.2 Reverse transcription (cDNA synthesis) The reaction, for the reverse transcription and cDNA synthesis contained 600 ng RNA from day 2 harvest or 500 ng RNA from day 4 harvest, 4 µl qSript cDNA SuperMix (qScript™cDNA Supermix, Quanta Biosciences, cat#95048-100) and supplemented with DEPC water to a final volume of 20 µl. The samples were incubated with the following PCR program, 5 min. at 25˚C, 30 min. at 42˚C, 5 min. at 80˚C and a final hold at 4˚C.

Name Sequence (5’-3’) Length (bp)

ST14 F: GCGCTCCCTGAAGTCCTTT 19 R:GTCCTGGGTCCTCTGTACTGTTTT 24 SPINT1 F: CGCGGCATCTCCAAGAAG 18 R: GAACACTGCGACAGCCATCTC 21 CDX2 F: GGCAGCCAAGTGAAAACCAG 20 R:GGTGATGTAGCGACTGTAGTGAA 23 SI F: TTTTGGCATCCAGATTCGAC 20 R: ATCCAGGCAGCCAAGAATC 19 RPLPo F: GCAATGTTGCCAGTGTCTG 19 R: GCCTTGACCTTTTCAGCAA 19 Table 2: Primers for RT-qPCR analysis.

4.4.3 RT-qPCR for mRNA analysis RT (reverse transcriptase)-qPCR analysis was performed in a LightCycler® 480 PCR machine (Roche Diagnostics). The total 10 µl reaction volume contained 5 µl SYBR Green I Master (Roche, cat#04 887 352 001), 0.5 µl of each forward and reverse primer (listed table 2), 4 µl of 8 times diluted cDNA. The following program was used for qPCR amplification; an initial cycle of 95˚C for 30 sec followed by 40 cycles of a denaturation (95˚C for 10 sec.), annealing (59˚C for 10 sec.) and extension (72˚C for 10 sec.). In all qPCR reactions, a non-template control (NTC) was included as a negative control for contamination and false positive results. The experiments were performed with 4 replicates and the LightCycler® Software version 1.5 (Roche Diagnostics) was used for obtaining and validating data. Melting curve analysis was used for confirming amplification of the right target by observing a single melting peak or if false signals had occurred from non-specific products or primer-dimers. A background baseline was set in order to compare the PCR amplified fluorescence signal between the samples. For each sample, a crossing point (CP) value was determined and defined by the point in the PCR cycle where the generated fluorescence signal exceeds the baseline.

The lower CP value reflects a greater amount of target in the sample. The relative target mRNA level were calculated by normalizing the CP values of the target gene with the CP values of the

CP _ t arget CP _ ref reference gene, RPLP0 using the CP comparative method; 2 .

4.5 Electrophoretic Mobility Shift and Supershift Assay Electrophoretic Mobility Shift Assay (EMSA) was applied to assay binding of transcription factors to DNA. The DNA oligonucleotides listed in Table 3, were designed to cover putative CDX2 binding sites based on an in silico analysis using TRANSFAC® Professional 12.1 database. BamHI and SalI sites were added to the flanking ends of the oligoes which should have been used for cloning into the luciferase reporter vector. Based on TRANSFAC analysis, the additional nucleotides does not result in unwanted binding of TFs.

4.5.1 Annealing of oligonucleotides The double-stranded DNA probes for the assay were produced by mixing 250 pmol of each complementary oligonucleotides in 0,1 M NaCl followed by an incubation at 95˚C on a heating block for 5 min. and the nucleotides were annealed by gradually reducing the heat to room temperature.

4.5.2 -32P labelling of oligonucleotides 0,6 pmol of the double-stranded probes were 5’-end-labelled with 0,5 µl kinase buffer (Fermentas), 7.5 µl of 3000 Ci/mmol [ -32P]adenosine triphosphate ([ -32P]ATP, Perkin Elmer, cat# Blu502H250UC) and 0,5 µl T4 polynucleotide kinase (Fermentas, cat# EK0031). The mix was incubated for 30 min. at 37˚C and 20 µl TE buffer (10 mM tris-HCL, 1 mM Na2EDTA•2H2O, pH 8.0) was added followed by a purification using Microspin G-25 columns (GE Healthcare, cat# 27- 5325-01) to remove excess of unincorporated ([ -32P]ATP. TE buffer was added to the eluted labelled probe to a final volume of 100 µl.

4.5.3 EMSA reaction and gel electrophoresis The EMSA protein/DNA binding reaction contained 2 µl of 10 day differentiated Caco-2 nuclear extracts, 3 µl dialysis buffer (25 mM Hepes pH 7.6, 40 nM KCl, 0.1 mM EDTA and 10% glycerol),

10 µl Gelshift buffer (25mM Tris-HCl pH 7.5, 5 mM MgCl2, 60 mM KCl, 0.5 mM EDTA, 5% Ficoll 400, 2.5% glycerol, 1 mM DTT and protease inhibitors), 0.5 µl dI-dC (homopolymer of deoxyinosine and deoxycytidine). For competition assay, 1 µl of unlabeled unspecific, wild type or CDX2-bindingsite-mutated oligonucleotide was added and for the super shift assay 1 µl of CDX2- antibody (BioGenex, cat#MU392A-UC) or 1 µl of non-immune serum (normal rabbit serum, Santa Cruz Biotechnology, SC-2338) was added. The reaction mix was incubated on ice for 20 minutes and then 1 µl of radiolabeled probe was added followed by a further incubation for 20 minutes on ice.

Finally, 2 µl of Gelshift loading buffer (10% glycerol, 0,2% Bromphenol blue and 0,5xTris-borate- EDTA buffer (2xTBE, 44.5 mM Tris-HCL pH 8.0, 44.5 mM boric acid and 1 mM EDTA)) was added to the binding reaction mixture. The protein/DNA complexes were resolved on a 5% non- denaturing polyacrylamide gel in 0,5x TBE buffer as running buffer for approximately one hour with electrophoresis performed under cooling and with settings of 100mV and 25mA/gel. The gel was dried on a Slab gel Dryer SGD4050 (Savant) for one hour and exposed on a phosphor-image screen for 1 to 2 days. The phosphor screens were scanned on a Storm 840 scanner (Molecular Dynamics) and the image was analysed using the Image-Quant Software version 5.2.

Name Sequence (5’-3’) Length (bp)

ST14 enh_wtCDX2-A F: GATCCTATCTGTGTTTATGGTAAGCAGACG 30 R: TCGACGTCTGCTTACCATAAACACAGATAG 30 ST14 enh_mutCDX2-A F: GATCCTATCTGTGCATATGGTAAGCAGACG 30 R: TCGACGTCTGCTTACCATATGCACAGATAG 30 ST14 enh_wtCDX2-B F: GATCCATAGCACCGTTTTATGTGTGCACCG 30 R: TCGACGGTGCACACATAAAACGGTGCTATG 30 ST14 enh_mutCDX2-B F: GATCCATAGCACCGCATATGGTGTGCACCG 30 R: TCGACGGTGCACACCATATGCGGTGCTATG 30 ST14 enh_wtCDX2-C F: GATCCTTCACTGACTTTATTAACTTTGTGG 30 R: TCGACCACAAAGTTAATAAAGTCAGTGAAG 30 ST14 enh_mutCDX2-C_#1 F: GATCCTTCACTGACTTCATATGCTTTGTGG 30 R: TCGACCACAAAGCATATGAAGTCAGTGAAG 30 ST14 enh_mutCDX2-C_#2 F: GATCCTTCACTGACTTCATATGCTCTGTGG 30 R: TCGACCACAGAGCATATGAAGTCAGTGAAG 30 ST14 enh_wtCDX2-D F: GATCCTGTTCTTATCAATAAAACGATGGGG 30 R: TCGACCCCATCGTTTTATTGATAAGAACAG 30 ST14 enh_mutCDX2-D F: GATCCTGTTCTTCATATGAAAACGATGGGG 30 R: TCGACCCCATCGTTTTCATATGAAGAACACCTAG 34 ST14 enh_wtCDX2-E F: GATCCAAGAGCTAAGGTTATAAAAGGAAGG 30 R: TCGACCTTCCTTTTATAACCTTAGCTCTTG 30 ST14 enh_mutCDX2-E F: GATCCAAGAGCTAAGGTTCATATGGGAAGG 30 R: TCGACCTTCCCATATGAACCTTAGCTCTTG 30 SPINT-1 enh_wtCDX2 F: GCTGGTTTTATTGCCACTCTAGCC 24 R: GGGCTAGAGTGGCAATAAAACCAG 24 SPINT-1 enh_mutCDX2 F: 36 TGGGGGAGGGGCTGGCATATGTGCCACTCTAGCCCT 36 R: GGGCTAGAGTGGCACATATGCCAGCCCCTCCCCCAG Table 3: Oligonucleotides for EMSA. Mutations introduced are underlined.

4.6 Chromatin immunoprecipitation assay The purified CDX2-ChIP, HA-ChIP and input DNA was kindly provided by PhD.stud. Mehmet Coskun form Herlev Hospital.

4.6.1 Cross-linking of protein/DNA Caco-2 cells were grown for 5-6 days after confluence in 245x245 mm tissue culture dish (Nunc, #WZ-01930-37) and were cross-linked by adding 11% formaldehyde 1/10 volume of the culture DMEM medium at room temperature for 30 min. Glycine was added to a final concentration of 0.125M and incubated for 5 min. at room temperature to stop cross-linking. The cells were washed with 1xPBS and collected with a cell scratcher followed by centrifugation at 5000 rpm for 10 min. and the pellet was collected.

4.6.2 Sonication The pellet with fixed cells was kept on ice and resuspended in 6 ml 1%SDS buffer (1%SDS, 10mMEDTA, 50 mMtris-HCL pH 8.0) followed by sonication using a Branson sonicator (level: 50%,repeated cycles for 6 min.; sonication time: 15 sec., resting time: 30 sec. ) yielding DNA fragment sizes of approximately 500-1000 bp. The sonicated lysate was spun at 10.000g at 4˚C for 15 min. and the supernatant was collected. The DNA fragment size was validated as a control for the sonication. A solution of 50 µl of sonicated cells and 250 µl elution buffer (1%SDS, 0.1 M

NaHCO3 and 200 mM NaCl ) were incubated over night at 65˚C to reverse the DNA/protein cross- linking. The DNA was purified and run on 1% agarose electrophoresis gel and the fragment sizes were validated.

4.6.3 Immunoprecipitation The immuneprecipitations were performed in four replicates. Tubes and buffers in the following procedure were kept on ice. For each sample, 300 µl of crosslinked and sonicated cell lysate were mixed with 1.2 ml ChIP buffer (1% Triton X-100, 150mM NaCl, 2mM EDTA, 20 mM Tris-HCL pH 8.1) and 1,5 µl protease inhibitor (Sigma Aldrich). From each replicate, 15 µl (1%) was removed and used as input control. The rest of the samples were mixed with either 10 µl CDX2 antibody (BioGenex, Mu329A-UC), or 10 µl Sp1 antibody (Santa Cruz Biotechnology, SC-59) or with 3,25 µl HA (Hemagglutinin antibody) antibody (Santa Cruz Biotech, sc-805). The HA-ChIP serves as a negative control. The samples were then transferred to new tubes containing 50 µl of Dynabeads Protein A/G beads washed with ChIP buffer and the samples were incubated at 4˚C for 16 hours on rotation. Next, the beads with the precipitated immunocomplexes were washed on the magnet; two washing steps with 1 ml Washing Buffer 1 (0.1% SDS, 1% Triton X-100, 0.1% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, 2 mM EDTA and 20 mM Tris-HCL, pH 8.0),two washing steps with 1 ml Washing Buffer 2 (0.1% SDS, 1% Triton X-100, 0.1% sodium deoxycholate, 500 mM NaCl, 1 mM EGTA, 2 mM EDTA and 20 mM Tris-HCL, pH 8.0),one washing steps with 1 ml Washing Buffer 3 (0.25 LiCL, 0.5% sodium, 0.5% nonidet P-40, 0.5 mM EGTA, 1 mM EDTA and 10 mM Tris-HCL, pH 8.0) and two washing steps with 1 ml TE buffer (10 mM Tris-HCL.1 mM EDTA, pH 8.0). Finally, the precipitated immunocomplexes were eluted in 300 µl elution buffer (1% SDS, 0.1 M NaHCO3 and 200 mM NaCl) and incubated for 30 min. at 65˚C and the supernatant was transferred to new tubes and mixed with 12 µl 5 M NaCL. The DNA/protein complexes were de-cross-linked by incubating the samples over night at 65˚C followed by the DNA purification procedure.

4.6.4 DNA purification The samples were mixed with 1.5 µl 20 mg/ml glycogen, 240 µl TE buffer and 10 µl 10mg/ml RNase and incubated at 37˚C for 30 min followed by an addition of 8 µl 12.5mg/ml proteinase K and an incubation at 55˚C for 2 hours to digest proteins in the solution. The reaction was stopped by adding 55 µl of 4 M LiCl. The DNA was mixed with 600 µl phenol buffer (pH 7.9) and vortexed vigorously followed by centrifugation at 15.000g for 10 min. The upper water phase containing DNA was transferred and precipitated by mixing with 1 ml of -20˚C abs. ethanol and incubated at - 20˚C for 30 min. The samples were centrifuged at 20.000g for 30 min. at 4˚C and the pellet was

27 washed with 1 ml of -20˚C 70% ethanol followed by centrifugation at 20.000g for 10 min. at 4˚C.

Finally, the purified DNA pellets were air dried, resuspended in 20 µl H2O and stored at -80˚C. The purified DNA was diluted 10 times before use for the real-time qPCR reaction.

Name Sequence (5’-3’) Length (bp)

ST14 enh. F: CCCCACCCAGGAGTTAAAAG 20 R: AAAGAGAGGGAGTGGCCTGT 20 SPINT1 enh. F:GTCCTATGAAGGAGTGGCTTAGG 23 R: CCCCTCCCCCAGTTAGTTAC 20 SPINT1 prom. F: AGCGCAAGGGTGAATGTC 18 R: CTTCTCCCCCTGGTTTCTG 19 MYC prom. F: AGATCCTCTCTCGCTAATCTCC 22 R: TCCTCAGCCGTCCAGACC 18 HEPH prom. F: AGCAGAGGCCTTATCCCTTC 20 R: GCTGAGATCCAAGTCCAAGC 20 Table 4: Primers for real-time qPCR for ChIP analysis

4.6.5 Real-time qPCR analysis of ChIP DNA For each sample, the reaction contained 10 µl SYBR Green I Master (Roche, #04 887 352 001), 1 µl of each forward and reverse primer, 2,5 µl of DNA for the CDX2-ChIP experiment or 5 µl for the Sp1-Chip experiment and Milli-Q H2O to a total volume of 20 µl. Primers listed in, table 4 were designed using Primer3 software to target the promoter and enhancer for ST14 and SPINT1 and the promoter of MYC. The primers were purchased from Eurofins MWG. The primers for targeting the hephaestin (HEPH) promoter have previous been used in our laboratory. The real-time qPCR amplification was performed using the same instrument and PCR program as described in the RT- qPCR section. The experiments were performed in 4 replicates and a non-template control was included in all setups. Melting curves was validated using LightCycler® Software version 1.5 (Roche Diagnostics). The relative CDX2, HA- or Sp1- ChIP fold enrichments were calculated by normalizing the CP values of the IP (Immune Precipitated) data with the CP values of the IN (Input) C C data using (as reported in (SPANDIDOS et al. 2010)); % of total IN= 2 P _ IN P _ IP *1%.

4.7 Statistical Analysis Results obtained from luciferase reporter assay and real-time qPCR/RT-qPCR is presented as the mean with S.D. (standard deviation). The statistical significance of the values of the grouped data were assessed by applying an unpaired student T test with p-values *p<0.05, **p<0.01 and ***p<0.001. Graphs has been created using GraphPad Prism 5.

5. Results

5.1 Analysis of human ST14 promoter and putative enhancer element

5.1.1 Identification of promoter and putative enhancer element of ST14 For investigation of the transcriptional regulation of the human ST14 gene (Ref-seq no. NM_021978) we selected a sequence of the 5’-flanking region with position -947 to +173 (1120 bp) relative to transcriptional start site (TSS) which was considered to contain the gene promoter (figure 4). The genome sequences were analyzed for nearby binding of HNF4α and CDX2 based on previous ChIP-seq data on Caco-2 cells performed in our group (BOYD et al. 2009; BOYD et al. 2010). A distinct CDX2-binding peak between exon one and exon two of the ST14 gene sequence was observed and therefore this region was also included in my investigation as a putative enhancer element which had the position +21579 to +22159 (580 bp) relative to TSS. Additional epigenetic feature tracks in the UCSC GenomeBrowser session were also included in the analysis of the selected promoter and enhancer region. These features include custom tracks of histone 3 di- methylation at lysine 4 (H3K4me2) from Caco-2 cells (VERZI et al. 2010), DNAseI hypersensitivity performed in Caco-2 cells and layered histone 3 mono- and trimethylation at lysine 4(H3K4me1- and me3) marks from different cell lines released as part of the Encyclopedia of DNA Elements (ENCODE) project. All of these tracks are involved in indicating open chromatin structure which might mark positions of active regulatory sites.

Figure 4: Identification of promoter and putative enhancer element of the ST14 gene. Promoter and enhancer are indicated by a blue and green arrow respectively. The selected ST14 (RefSeq: NM_021978) promoter is located with position -947 to +173 (1120 bp) relative to TSS and the putative ST14 enhancer is located with position +21579 to +22159 (580 bp) between exon one and exon two. The graphical overview has been obtained from the UCSC Genome browser. The additional custom tracks includes CDX2 ChIP-seq (BOYD et al. 2010), H3K4me2 cycling (Caco-2) (VERZI et al. 2010), Caco-2 DNaseI Hypersensitivity and ENCODE-tracks of layered H3K4Me1 and H3K4Me3.

Figure 5: In silico analysis of ST14 promoter. Clustal W alignment of human ST14 promoter sequence (position -947 to +173 (1120 bp) relative to TSS) with mouse sequence. Different nucleotides are presented in grey boxes. Putative binding sites are marked with arrow; CDX2 (white), Sp1 (blue) and GATA4 (red). The graphical view was created by using the software, CLC Main Workbench version 6.

Figure 6: In silico analysis of putative ST14 enhancer Computational sequence analysis of ST14 enhancer with position +21579 to +22159 (580 bp) relative to TSS. The search for TF binding sites was performed using the TRANSFAC® database. Potential CDX2-binding sites are indicated with an open white arrow while the potential GATA4 site is marked with a red arrow. The human ST14 enhancer sequence was aligned with mouse sequence by performing a Clustal W alignment. The grey boxes within the sequence marks the different nucleotides between human and mouse. The graphical view was created by using the software, CLC Main Workbench version 6.

5.1.2 In silico analysis of promoter and putative enhancer element of ST14 The selected putative ST14 enhancer was analyzed by computational sequence analysis for localization of potential CDX2-binding site(s) in order to support the observed CDX2 ChIP signal in figure 4. The search for CDX2-binding sites was performed with the TRANSFAC® database using the tool Match™ with stringently settings to minimize false positive results. CDX2 is known to have a binding affinity towards the core sequence of TTTAT/C (FANG et al. 2000; SUH et al. 1994). Nucleotides flanking the core sequence are also important for the binding stabilization. Six putative CDX2-binding sites were found; CDX-A, CDX2-B, CDX-C1, CDX-C2, CDX-D and CDX-E. The search also revealed another relevant binding of GATA-4. The location of the binding sites within the human enhancer sequence is shown in figure 6 together with a Clustal W alignment of the corresponding mouse sequence. The alignment revealed a low conservation of the enhancer region between human and mouse.

TRANSFAC® analysis of the human ST14 promoter sequence revealed five potential CDX2 binding sites, three potential GATA4-binding sites and three potential Sp1-binding sites (figure 5). Clustal W alignment of the human and mouse sequences revealed an overall low conservation even within the binding sites. c

5.1.3 CDX2 binds ST14 enhancer in vivo in Caco-2 cells In order to confirm the CDX2 ChIP-seq signals observed within the ST14 enhancer region (figure 4), a new ChIP assay was performed in Caco-2 cells with a CDX2-antibody. The enrichments of the ChIP samples were analyzed with primers covering the ST14 enhancer region and quantified by performing a real-time qPCR. Primers covering the HEPH promoter were also included in the qPCR as a positive control for the CDX2-enrichment and for comparison with the enrichment of the ST14 enhancer target. HEPH is an ion transport protein and has previous been shown to be regulated by CDX2 in intestinal epithelium (HINOI et al. 2005). As shown in figure 7, a significant enrichment of CDX2-binding compared to enrichment of unspecific HA-antibody binding for both ST14 enhancer target (**p<0.01) and HEPH promoter target (*p<0.05) were formed. This result showed that CDX2 binds to the ST14 enhancer in vivo in Caco-2 cells.

0.25 * CDX2 Figure 7: CDX2 binds ST14 enhancer 0.20 HA in vivo in Caco-2 cells. real-time qPCR analysis of CDX2-ChIP, HA-ChIP and 0.15 Input DNA from 5-6 days confluent ** Caco-2 cells using primers covering 0.10 ST14 enhancer and the positive control, HEPH promoter. Immune- precipitated DNA are presented as percentage of % input total of 0.05 total DNA input and represent the mean with S.D. (N=4). CDX2-binding 0.00 enrichments are statistically significant ST14 enh. HEPH from the negative HA-enriched control samples (*P<0.05, **P<0.01, Student T test).

5.1.4 In vitro analysis of CDX2-binding sites within the ST14 enhancer EMSA was applied in order to verify the CDX2-binding sites within the ST14 enhancer from the computational sequence analysis. Double stranded probes containing the putative CDX2-binding sites were labeled with [γ32]ATP in order to visualize the physical interaction with protein from Caco-2 nuclear extracts.

Two specific protein/DNA complexes were formed between the wtCDX2-A probe and the Caco-2 nuclear extract, a faster migrating complex II and a slower migrating complex I (figure 8A top, lane 1). The specificity of the probe was confirmed by addition of excess of unlabeled unspecific oligonucleotides which did not influence the complex formation (lane 2). Only when adding excess of unlabeled wtCDX2-A (lane 3). Addition of excess of mutCDX2-A (containing mutated CDX2 binding site) out-competed complex I but not complex II which indicated that only complex II was depending on the CDX2 binding site (lane 4). CDX2 antibody was added in order to verify CDX2 binding which created a supershift in the gel. When adding CDX2 antibody the complex II was supershifted and might be disappeared to the same position as complex I (lane 5). Addition of non- immune serum was added as a negative control for the CDX2 antibody (lane 6). Altogether this in vitro assay showed an unknown binding of a protein(s) to complex I and a confirmed binding of CDX2 to complex II which depended on the putative CDX2 binding site. However, a Clustal W multiple alignment revealed a low conservation score for the CDX2-A binding site (figure 8A bottom).

Analysis of the wtCDX2-B probe revealed only one distinct specific EMSA shift with competitive effect from unlabeled wtCDX2-B probe but not from unlabeled unspecific probe (figure 8B top, lane 1 to 3). Addition of unlabeled mutCDX2-B oligonucleotides and CDX2 antibody revealed that the CDX2 site was specific for the complex band and that CDX2 was bound to the probe (lane 5 and 6). Alignment analysis showed a low conservation with mouse (figure 8B bottom).

The wtCDX2-C probe contained two potential CDX2 sites and formed two complexes on the gel, complex I and complex II (figure 8C top, lane 1). Complex I seemed to contain two bands when closely looked at but due to the low quality of the gel they were referred to as complex I. Lane 2 and lane 3 confirmed the specificity of the probe in the formed complex. Addition of mut#1CDX2- C (containing mutated CDX2-C1) and mut#2CDX2-C (containing mutated CDX2-C1 and C2 site) revealed that both complex I and complex II depended on the CDX2-C1 site (lane 4 and 5) but only complex II was bound by CDX-2 (lane 6). The conservation of the CDX2-binding sites was low (figure 8C bottom).

Both wtCDX2-D and wtCDX2-E formed one distinct EMSA specific complex (figure 8D and 8E respectively, lane 1 to 3) which depended on the putative CDX2 site (lane 4) and was bound by CDX2 (lane 5). However, the alignment showed a low conservation (figure 8D and 8E bottom).

Altogether, all probes covering the putative CDX2 sites were bound by CDX2 from Caco-2 nuclear extracts and thereby confirming the computational analysis. These sites may contribute to the CDX2-enrichment within the ST14 enhancer in Caco-2 cells observed in figure 7.

Figure 8: CDX2 binds the ST14 enhancer in vitro in Caco-2 cells. Gel shift analysis of five double stranded [γ32]ATP labeled oligonucleotides wtCDX2-A (A) wtCDX2-B (B) wtCDX2-C (C) wtCDX2-D (D) wtCDX2-E (E) covering putative CDX2 sites within ST14 enhancer. [γ32]ATP labeled probes were incubated with Caco-2 nuclear extracts and resulted in shifted DNA/protein complexes (lane 1). Competition by unlabeled unspecific (lane 2), wt (lane 3) and mut (lane 4 (two mut sites for (C) in lane 4 and 5)) oligonucleotides were used for validating the specificity of the shifted DNA/protein complexes. Addition of Anti-human CDX2 antibody were used for the supershift assays (lane 5 (lane 6 for (C))) with non- immune serum (lane 6 (lane 7 for (C))) as negative control. Supershifted complexes indicated by red arrows.

5.1.5 ST14 enhancer stimulates the ST14 promoter activity specific in Caco-2 cells In order to determine the promoter activity and possible stimulation by the selected putative enhancer elements, the sequences of interest were cloned into the firefly luciferase pGL4.10 reporter vector. The cloned plasmids were transiently transfected into Caco-2 cells and RKO cells.

A B Caco-2 Cells RKO Cells 200 *** 10

8 *** 150 6 100 4 50

*** 2 Relative Luciferase Activity Luciferase Relative Relative Luciferase Activity Luciferase Relative 0 0

pGL4.10 pGL4.10

pST14-prom. pST14-prom. pST14-prom.+enh. pST14-prom.+enh.

Figure 9: ST14 enhancer stimulates ST14 promoter activity specific in Caco-2 cells. (A) Caco-2 cells and (B) RKO cells were transiently transfected with pGL4.10 (empty reporter control plasmid) and with reporter plasmid containing ST14 promoter or promoter + enhancer. The luciferase activity was corrected for transfection efficiency by normalizing to β-galactosidase activity from cotransfected pCMV-lacZ (internal control). Data are shown as the relative luciferase activity compared to pGL4.10 and represent the mean with S.D. (N=4) (*P<0.05, **P<0.01, ***P<0.001, Student T test).

The ST14 reporter assay results in Caco-2 cells revealed that the ST14 promoter construct exceeded the base line of the pGL4.10 activity with a significantly (p<0.001) 27-fold stimulation (figure 9A). Moreover, the ST14 enhancer increased the ST14 promoter activity with a dramatically 6-fold up- regulation (p<0.001) (figure 9A).

The transfection experiments were also performed in the RKO cell which also is a colon cancer cell line but unlike Caco-2 cells, they do not differentiate into intestinal-like epithelium. The relative luciferase activity of ST14 promoter was 7-fold higher (p<0.001) when comparing to the pGL4.10 plasmid in RKO cells (figure 9B). Interestingly, ST14 enhancer activity seemed to be absent in RKO cells.

Altogether, the ST14 promoter seemed to be functional and have a remarkably activity in both Caco-2 cells and in RKO cells. However, the interaction and stimulation with the ST14 enhancer was limited to the Caco-2 cells.

5.1.7 Over-expression experiment affected the pGL4.10 control plasmid Co-transfection assay with over-expression of CDX3 (CDX2 hamster homologue), Sp1, GATA4 and HNF4α was also performed. Unfortunately the co-transfection experiment also affected the pGL4.10 control plasmid. CDX3 over-expression dramatically increased the luciferase activity in both Caco-2 cells (figure 10A) and RKO cells (figure 10B). GATA4 over-expression also had an effect in Caco-2 cells but only to a minor degree in RKO cells. Combination experiments of CDX3 over-expression with over-expression of Sp1, GATA4 or HNF4α were therefore also affected. Surprisingly the pGL4.10 control plasmid contained 12 potential CDX2 binding sites and 6 potential GATA-4 binding sites (figure 10c). The many CDX2 and GATA4 sites are likely to stimulate the reporter constructs. Therefore the following reporter assays with over-expression of TFs were critically analyzed and validated with emphasis on false positive results.

A B Caco-2 Cells RKO Cells 20 40 no TF no TF *** CDX3 *** CDX3 30 15 Sp1 *** *** Sp1 *** GATA4 *** GATA4 20 10 HNF4a *** HNF4a *** CDX3 + Sp1 CDX3 + Sp1 5 *** CDX3 + GATA4 10 CDX3 + GATA4

** CDX3 + HNF4a * CDX3 + HNF4a Relative Luciferase Activity Luciferase Relative Relative Luciferase Activity Luciferase Relative 0 0 pGL4.10 pGL4.10

Figure 10: Over-expression reporter assay affects the control plasmid, pGL4.10. Transiently transfection of pGL4.10 with co-expression of CDX3, Sp1, GATA4 and HNF4α in (A) Caco-2 cells and in (B) RKO cells. CMV- driven plasmids were corrected by adding empty pcDNA3.1+. The luciferase activity was corrected for transfection efficiency by normalizing to β-galactosidase activity from cotransfected pCMV-lacZ (internal control). Data are shown as the relative luciferase activity compared to pGL4.10 without cotransfection of TF’s and represent the mean with S.D. (N=4) (*P<0.05, **P<0.01, ***P<0.001, Student T test). (C) pGL4.10 (empty reporter control plasmid) map containing following sites; CDS1 (luciferase gene, green arrow), Poly A signal-1 and-2, SDS(AmpR)2 (ampincilin resistance, grey arrow), 12 CDX2-binding sites, 6 GATA4-binding sites and one Sp1-binding site.

5.1.8 ST14 promoter and enhancer reporter assay with over-expression of TFs Although the ST14 promoter contained CDX2- and GATA4 sites, the over-expression pattern with CDX3 and GATA4 was similar to that of the control plasmid in Caco-2 cells (figure 11A). It was therefore not clear which part of the over-expression stimulation that was derived from interaction with the binding sites in the ST14 promoter or in the pGL4.10 plasmid. The pST14-prom+enh. construct did not seemed to be affected markedly by over-expression except that HNF4α seemed to inhibit the reporter activity although no HNF4α-binding sites were found in the in silico analysis (figure 5).

The over-expression pattern of CDX3 in RKO cells in figure 11B seemed to be the same for the reporter constructs as for the pGL4.10 vector (figure 10B). The notion that the pST14-prom + enh. Luciferase activity levels at CDX3 over-expression were almost the same as for pST14-prom indicated that the stimulation was through the ST14 promoter.

B RKO Cells * 10 * * * * * * * * * * Figure 11: ST14 promoter and enhancer 8 * * * * * no TF reporter assay with over-expression of TFs. * * * * * * * CDX3 (A) Caco-2 cells and (B) RKO cells were 6 * Sp1 transiently transfected with pGL4.10 (empty GATA4 reporter control plasmid) and with reporter 4 HNF4 plasmid containing ST14 promoter or promoter CDX3 + Sp1 * + enhancer. Cotransfection of pCMV-CDX3, 2 * * CDX3 + GATA4 pCMV-Sp1, pCMV-GATA4 and pCMV- Relative Luciferase Activity Luciferase Relative * * * CDX3 + HNF4 * HNF4α were corrected for CMV-driven 0 plasmids by adding empty pcDNA3.1+. The luciferase activity was corrected for pGL4.10 transfection efficiency by normalizing to β- pST14-prom. galactosidase activity from cotransfected pST14-prom + enh. pCMV-lacZ (internal control). Data are shown as the relative luciferase activity compared to pST14-prom. without cotransfection of TF’s A Caco-2 cells and represent the mean with S.D. (N=4) 10 (*P<0.05, **P<0.01, ***P<0.001, Student T * test). 8 * no TF

* CDX3 6 * * * Sp1 * * * * * * GATA4 4 * * HNF4 * * * * CDX3 + Sp1 * * 2 CDX3 + GATA4

Relative Luciferase Activity Luciferase Relative * * CDX3 + HNF4 * 0

pGL4.10 pST14-prom.

pST14-prom + enh.

Altogether, the stimulation of the activity of the cloned ST14 reporter constructs in Caco-2 and RKO cells with CDX3 and GATA4 over-expression was uncertain when comparing to the pGL4.10 plasmid.

5.2 Analysis of human SPINT1 promoter and putative enhancer element

5.2.1 Identification of promoter and putative enhancer element of SPINT1 A 5’-flanking region with position -1030 to +27 (1057 bp) relative to TSS of the SPINT1gene (RefSeq: NM_181642) was selected for investigation of the gene promoter (figure 12). A distinct CDX2-binding peak between exon one and exon two in the gene sequence was observed and therefore this region was investigated as a putative enhancer element which had the position +3331 to +3863 (532 bp). The putative enhancer was moreover located within a DNAseI hypersensitivity region with accumulation of H3K4me2.

Figure 12: Identification of promoters and putative enhancer element of the SPINT1 gene. Promoter and enhancer are indicated by a blue and green arrow respectively. SPINT1 (RefSeq: NM_181642 ) promoter, nt -1030 to +27 (1057 bp) and SPINT1 enhancer, nt +3331 to +3863 (532 bp) relative to TSS. The graphical overview has been obtained from the UCSC Genome browser. The additional custom tracks includes CDX2 ChIP-seq (BOYD et al. 2010), H3K4me2 cycling (Caco-2) (VERZI et al. 2010), DNaseI Hypersensitivity (Caco-2) and ENCODE-tracks of layered H3K4Me1 and H3K4Me3.

5.2.2 In silico analysis of promoter and putative enhancer element of SPINT1 Computational sequence analysis of the putative SPINT1 enhancer was applied in order to search for putative CDX2-binding sites. Within the human SPINT1 enhancer sequence, TRANSFAC® results revealed a single potential CDX2 binding site (termed CDX2-A) (figure 14). The search also revealed a HNF4α and a GATA4 binding site. Clustal W alignment of the human sequence with the mouse sequence reveals an overall low conservation.

Search for binding of transcription factors within the SPINT1 promoter revealed three potential GATA4 sites, one CDX2 site and three Sp1 sites (figure 13). Alignment of the human SPINT1 promoter with the corresponding with mouse sequence revealed that only Sp1-A, Sp1-C and GATA4-C seemed to be conserved with mouse.

Figure 13: In silico analysis of SPINT1 promoter. Clustal W alignment of human SPINT1 promoter sequence( -1030 to +27 (1057 bp) relative to TSS) with mouse sequence. Different nucleotides are presented in grey boxes. Putative binding sites are marked with arrow; CDX2 (white), Sp1 (blue) and GATA4 (red).

Figure 14: In silico analysis of human SPINT1 enhancer. Sequence with position +3331 to +3863 (532 bp) relative to TSS together with a Clustal W alignment with mouse sequence. Different nucleotides are marked with grey boxes. Potential binding sites are marked with arrow; CDX2 (white), HNF4α (green) and GATA4 (red).

5.2.3 CDX2 binds SPINT1 enhancer in vivo in Caco-2 cells As for the ST14 enhancer, the SPINT1 enhancer was also validated for the CDX2 ChIP-seq peak by performing a new CDX2 ChIP assay followed by a real-time qPCR with primers targeting SPINT1 enhancer region and the HEPH promoter. A significant CDX2-enrichment compared to HA- enrichment was observed for both SPINT1 enhancer region (***p<0.001) and for the positive control, HEPH (*p<0.05) (figure 15A). This result confirmed the CDX2 ChIP-seq peak and showed that CDX2 binds to the SPINT1 enhancer in vivo in Caco-2 cells.

A 0.25 * CDX2 0.20 HA

0.15 *** 0.10

% total input of 0.05

0.00 SPINT1 enh. HEPH

Figure 15: CDX2 binds SPINT1 enhancer. (A) real-time qPCR analysis with primers spanning the SPINT1 enhancer and HEPH promoter using CDX2 ChIP, HA ChIP and Input DNA from Caco-2 cells. Antibody-enriched ChIP DNA are presented as percentage of total DNA input and represent the mean S.D. (N=4 (HEPH samples), N=3 (SPINT1 enh. samples)). CDX2-binding enrichments were statistically significant from the negative HA-enriched control samples (*P<0.05, ***P<0.001, Student T test). (B) EMSA supershift analysis of [γ32]ATP labeled probe wtCDX2-A covering putative CDX2 sites within SPINT1 enhancer. Labeled probe were incubated with Caco-2 nuclear extracts (lane 1) resulting in a shifted DNA/protein complex. Competition assay using addition of 100 fold excess unlabeled unspecific (lane 2), wt (lane 3) and mutated (lane 4) oligonucleotides were used for demonstrating the specificity of the shifted DNA/protein complex. A supershift of the CDX2/DNA complex (indicated by red arrow) was demonstrated by adding CDX2 antibody (lane 5) with non-immune serum (lane 6) as negative control.

5.2.4 CDX2 binds SPINT1 enhancer in vitro in Caco-2 cells EMSA using radiolabeled probe covering the single potential CDX2-binding site within the SPINT1 enhancer sequence and Caco-2 nuclear extracts was performed. Formation of a complex appeared on the gel (figure 15B, top, lane 1) which showed to be specific for the wtCDX2-A probe by competition experiments (lane 2 and 3). Addition of unlabeled mutCDX2-A oligonucleotides revealed that the CDX2-binding site was specific for the complex formation (lane 4) and addition of a CDX2 antibody showed that CDX2 bounded to the probe and created a prominent shift (lane 5).

The binding site was conserved in rhesus monkey, mouse and elephant but not in dog (figure 15B bottom).

The confirmed CDX2-binding of the putative CDX2-binding site is likely to contribute to the CDX2-enrichment within the SPINT1 enhancer observed in figure 15A.

5.2.5 SPINT1 enhancer stimulates promoter activity in both Caco-2 and RKO cells The SPINT1 promoter activity was significantly higher with 7-fold activation compared to the pGL4.10 vector in Caco-2 cells (figure 16A). The SPINT1enhancer element further increased the SPINT1 promoter activity 5,5-fold (p<0.001) in Caco-2 cells (figure 16A). In RKO cells the SPINT1 promoter activity was approximately 33 times higher (p<0.001) than the pGL4.10 activity and the SPINT1 enhancer sequence further stimulated the promoter activity with a significantly 8- fold up-regultion (p<0.001) (figure 16B).

Altogether, the SPINT1 promoter was remarkably active and was stimulated by the putative SPINT1 enhancer in both Caco-2 cells and in RKO cells.

A B Caco-2 Cells RKO Cells 250 50 *** *** 200 40

30 150

20 100 *** 10 *** 50

Relative Luciferase Activity Luciferase Relative 0 Relative Luciferase Activity Luciferase Relative 0

pGL4.10 pGL4.10

pSPINT1-prom. pSPINT1-prom. pSPINT1-prom.+enh. pSPINT1-prom.+enh.

Figure 16: SPINT1 enhancer stimulates promoter activity in both Caco-2 and RKO cells. (A) Caco-2 cells and (B) RKO cells were transiently transfected with pGL4.10 (empty reporter control plasmid) and with reporter plasmid containing SPINT1 promoter or promoter + enhancer. The luciferase were corrected for transfection efficiency by normalizing to β-galactosidase activity from cotransfected pCMV-lacZ (internal control). Data are shown as the relative luciferase activity compared to pGL4.10 and represent the mean with S.D. (N=4) (*P<0.05, **P<0.01, ***P<0.001, Student T test).

5.2.6 SPINT1 promoter and enhancer activity were affected by CDX3 and Sp1 over-expression in a cell-type specific manner Again, the CDX3 and GATA4 over-expression stimulation pattern (figure 17A) was similar to the pGL4.10 vector in Caco-2 cells. However, pSPINT1-prom + enh. was remarkably stimulated by over-expression whereas pST14-prom + enh. in figure 16A was not.

In RKO cells, the CDX3 and GATA4 over-expression did not have an impact on the SPINT1 promoter activity (figure 17B). Over-expression of HNF4α resulted in a decrease of the promoter activity which was also seen in the pSPINT1 prom. + enh. construct. CDX3 over-expression inhibited the activity of pSPINT1-prom + enh whereas Sp1 stimulated to a minor degree.

A Caco-2 Cells 25

* * * * 20 * * * * * * no TF * * 15 CDX3 * Sp1 * * * * * * * * * GATA4 10 * * * * * HNF4 * * * CDX3 + Sp1 5 CDX3 + GATA4 * Relative Luciferase Activity Luciferase Relative * * * * CDX3 + HNF4 0

pGL4.10

pSPINT1-prom.

pSPINT1-prom + enh.

B RKO Cells 10 * * * 8 no TF CDX3 6 * Sp1 * * GATA4 * 4 * * * * * HNF4 * * * * * * * CDX3 + Sp1 * * * * 2 * CDX3 + GATA4

Relative Luciferase Activity Luciferase Relative * * CDX3 + HNF4 * 0

pGL4.10

pSPINT1-prom. pSPINT1-prom + enh.

Figure 17: SPINT1 promoter and enhancer reporter assay with over-expression of TFs. (A) Caco-2 cells and (B) RKO cells were transiently transfected with pGL4.10 (empty reporter control plasmid) and with reporter plasmid containing SPINT1 promoter or promoter + enhancer. Cotransfection of pCMV-CDX3, pCMV-Sp1, pCMV-GATA4 and pCMV-HNF4α were corrected for CMV-driven plasmids by adding empty pcDNA3.1+. The luciferase were corrected for transfection efficiency by normalizing to β-galactosidase activity from cotransfected pCMV-lacZ (internal control). Data are reported as the relative fold-activation relative to pSPINT- prom. without cotransfection of TF’s and represent the mean with S.D. (N=4) (*P<0.05, **P<0.01, ***P<0.001, Student T test).

5.2.7 Sp1 binds SPINT1 promoter In vivo binding of Sp1 to the SPINT1 promoter in Caco-2 cells was analyzed by performing a Sp1 ChIP-assay. Primers covering the Sp1-binding site near TSS (figure 13) were used for real-time qPCR. Primers covering the approximately 100 bp between P1 and P2 (promoter 1- and 2 respectively) of the MYC gene was used as a positive control. Sp1 has been reported to regulate MYC expression at both promoters (BENTLEY and GROUDINE 1986; WIERSTRA and ALVES 2007). The result in figure 18 showed a significant enrichment of Sp1 binding compared to enrichment of unspecific HA-antibody binding for both SPINT1 promoter target (p<0.05) and MYC promoter target (p<0.01). This result showed that Sp1 binds to the SPINT1 promoter in vivo in Caco-2 cells. The same experiment was also performed with primers covering the ST14 promoter, however the qPCR melting curve showed two target products which disqualified the result (data not shown).

0.4 Sp1 Figure 18: Sp1 binds SPINT1 promoter in ** HA vivo in Caco-2 cells. Real-time qPCR 0.3 * analysis with primers spanning the SPINT1 promoter and Myc promoter using Sp1- 0.2 ChIP, HA ChIP and Input DNA from Caco-2 cells. Antibody-enriched ChIP DNA are presented as percentage of total DNA input 0.1 and represent the mean with S.D (N=4). Sp1

% of total input total of % binding enrichments are statistically 0.0 significant from the negative HA-enriched SPINT1 prom. MYC prom. control samples (*P<0.05, ***P<0.001, Student T test).

5.3 Analysis of human SPINT2 promoter and putative enhancer element

5.3.1 Identification of promoter and putative enhancer element of SPINT1 For investigation of the transcriptional regulation of the human SPINT2 (RefSeq: NM_021102) promoter we selected a sequence with position -1012 to +172 (1184 bp) relative to transcriptional start site (TSS) (figure 19). A putative enhancer element was selected based on a distinct HNF4α- binding peak in a ChIP-seq custom track previous performed in our group(BOYD et al. 2009). This putative enhancer region located between exon one and exon two with the position +8807 to +9332 (525 bp) relative to TSS of the SPINT2 gene also contained an accumulation of CDX2-binding (figure19). The enhancer region was also DNAseI hypersensitivity and contained H3K4me2 marks in the Caco-2 cell.

Figure 19: Identification of promoters and putative enhancer elements of the SPINT2 gene. Promoters and enhancers are indicated by a blue and green arrow respectively. SPINT2 (RefSeq: NM_021102) promoter, nt -1012 to +172 (1184 bp) and SPINT2 enhancer, nt +8807 to+ 9332 (525 bp) relative to TSS. The graphical overview has been obtained from the UCSC Genome browser. The additional tracks includes HNF4α and CDX2 ChIP-seq (BOYD et al. 2009; BOYD et al. 2010), H3K4me2 cycling (Caco-2) (VERZI et al. 2010), Caco-2 DNaseI Hypersensitivity, H3K4Me1 and H3K4Me3.

5.3.2 In silico analysis of promoter and putative enhancer element of SPINT2 Computional sequence analysis of the SPINT2 promoter revealed two CDX2 sites, two HNF4α sites and three Sp1 sites (figure 20). Within the SPINT2 enhancer two GATA4 sites, two CDX2 sites and one HNF4α site were found (figure 21). The overall homology of the human sequences compared with the mouse sequences was low for both the promoter and the enhancer.

Figure 20: In silico analysis of SPINT2 promoter. Clustal W alignment of human SPINT2 promoter sequence (-1012 to +172 (1184 bp) relative to TSS) with mouse sequence. Different nucleotides are presented in grey boxes. Putative binding sites are marked with arrow; CDX2 (red), Sp1 (blue) and HNF4α (green).

Figure 21: In silico analysis of SPINT2 enhancer. Clustal W alignment of human SPINT2 enhancer sequence (+8807 to +9332 (525 bp) relative to TSS) with mouse sequence. Different nucleotides are presented in grey boxes. Putative binding sites are marked with arrow; CDX2 (white), GATA4 (red) and HNF4α (green).

5.3.3 SPINT2 enhancer does not stimulate SPINT2 promoter in either Caco-2 or RKO cells Of all of the three genes, SPINT2 had the most active promoter sequence. In Caco-2 cells, the SPINT2 promoter sequence yielded an approximately 450-fold (p<0.001) activation compared to the pGL4.10 vector (figure 22A). In RKO cells this activation was 290-fold (p<0.001) (figure 22B). However, the SPINT2 enhancer sequence did not have a significantly impact on the promoter activity in either Caco-2 cells or in RKO cells (figure 22A and 22B respectively).

B A RKO Cells Caco-2 Cells 400 *** 600 *** * 300 400 200

200 100

Relative Luciferase Activity Luciferase Relative 0 Relative Luciferase Activity Luciferase Relative 0

pGL4.10 pGL4.10

pSPINT2-prom. pSPINT2-prom.

pSPINT2-prom.+enh. pSPINT2-prom.+enh.

Figure 22: SPINT2 enhancer does not interact with SPINT2 promoter in either Caco-2 or RKO cells. (A) Caco-2 cells and (B) RKO cells were transiently transfected with pGL4.10 (empty reporter control plasmid) and with reporter plasmid containing SPINT2 promoter or promoter + enhancer. The luciferase were corrected for transfection efficiency by normalizing to β-galactosidase activity from cotransfected pCMV-lacZ (internal control). Data are shown as the relative luciferase activity compared to pGL4.10 and represent the mean with S.D. (N=4) (*P<0.05, **P<0.01, ***P<0.001, Student T test).

5.3.4 SPINT2 enhancer is activated dramatically with co-expression of CDX3 and HNF4α in RKO cells The over-expression pattern in Caco-2 cells had a comparable activity level between the pSPINT2- prom. and pSPINT2-prom. + enh. constructs indicating that stimulation was through the promoter activity (figure 23A). However again, the CDX3 and GATA4 over-expression pattern was the same as for the pGL4.10 vector.

Co-expression of CDX3 and HNF4α seemed to have a synergistic effect on the SPINT2 promoter activity in RKO cells (figure 23B). The pSPINT2-prom + enh. construct was stimulated by HNF4α alone and luciferase activity was dramatically synergistically increased by co-expression of CDX3 and HNF4α. The noteworthy effect of HNF4α stimulation might be due to the potential HNF4α- binding site(s) found in both the SPINT2 promoter and in the SPINT2 enhancer (figure 20 and 21 respectively).

A Caco-2 Cells 5 * * * 4 * * * * * * * * * * * * no TF * * * * * CDX3 3 * * * * Sp1 GATA4 * * 2 * * * * HNF4 CDX3 + Sp1 1 * CDX3 + GATA4

Relative Luciferase Activity Luciferase Relative CDX3 + HNF4 0

pGL4.10

pSPINT2-prom.

pSPINT2-prom + enh.

B RKO Cells 8 * *

6 no TF CDX3 Sp1 4 * * GATA4 * * * * * * * * * * HNF4 * * * * * CDX3 + Sp1 2 * * CDX3 + GATA4 * Relative Luciferase Activity Luciferase Relative * * * * * CDX3 + HNF4 0

pGL4.10

pSPINT2-prom.

pSPINT2-prom + enh.

Figure 23: SPINT2 promoter and enhancer reporter assay with over-expression of TFs. (A) Caco-2 cells and (B) RKO cells were transiently transfected with pGL4.10 (empty reporter control plasmid) and with reporter plasmid containing SPINT2 promoter or promoter + enhancer. Cotransfection of pCMV-CDX3, pCMV-Sp1, pCMV-GATA4 and pCMV-HNF4α were corrected for CMV-driven plasmids by adding empty pcDNA3.1+. The luciferase were corrected for transfection efficiency by normalizing to β-galactosidase activity from cotransfected pCMV-lacZ (internal control). Data are reported as the relative fold-activation relative to pSPINT2- prom. without cotransfection of TF’s and represent the mean with S.D. (N=4) (*P<0.05, **P<0.01, ***P<0.001, Student T test).

5.4 CDX2 siRNA experiment did not affect ST14 and SPINT1 mRNA levels in Caco-2 cells Knock-down of CDX2 in Caco-2 cells using siRNA was performed in order investigate the influence of CDX2 on the endogenous level of ST14 and SPINT1. 2,5*10^4 Caco-2 cells were transiently transfected with 25 nM CDX2 siRNA or 25 nM control siRNA. Total RNA was harvest at day 2 and day 4 followed by cDNA synthesis and RT-qPCR. RPLP0 was chosen as housekeeping gene since it has been described to be a reliable reference gene when normalizing genes for quantative RT-PCR in differentiated human intestinal epithelial cells including the Caco-2 cell line (DYDENSBORG et al. 2006). The results shown in figure 24A revealed a significant approximately 50 % knockdown of CDX2 in Caco-2 cells both at day 2 (***p<0.001) and at day 4 (**p<0.01). Primers targeting sucrase-isomaltase (SI) were included as a positive control. CDX2 is known to regulate SI expression in intestinal epithelium (BOUDREAU et al. 2002). The relative SI mRNA level was significantly (*p<0.05) lowered at day 4 to approximately 35 % compared to the siRNA control (figure 24B). However, there was no significantly chance in the relative mRNA expression of either ST14 or SPINT1 (figure 24C and D).

B SI A CDX2 150 * 150 Control siRNA ** CDX2 siRNA *** Control siRNA 100 100 CDX2 siRNA

50 50 Relative mRNA level [%] level mRNA Relative Relative mRNA level [%] level mRNA Relative 0 0 Day 2 Day 4 Day 2 Day 4

C ST14 D SPINT1 150 Control siRNA 150 CDX2 siRNA Control siRNA 100 100 CDX2 siRNA

50 50 Relative mRNA level [%] level mRNA Relative 0 [%] level mRNA Relative 0 Day 2 Day 4 Day 2 Day 4

Figure 24: CDX2 siRNA experiment. Real-time qPCR analysis of the relative gene expression of (A) CDX2, (B) SI, (C) ST14 and (D) SPINT1 from transiently transfection of 25 nM CDX2 or control siRNA in Caco-2 cells at day 2 and 4 after transfection. Relative expression level was normalized to the expression level of RPLP0 and represent the mean with S.D (N=4). (*P<0.05, **P<0.01, ***P<0.001, Student T test).

6. Discussion Inhibition of the oncogenic potential of matriptase by its two inhibitors HAI-1 and HAI-2 is assumed to contribute to prevention of cancer progression and growth. This notion is supported by the notion that matriptase is co-expressed with HAI-1 and HAI-2 in epithelial tissues (SZABO et al. 2008). A dysregulated matriptase/HAI-1 mRNA level is observed in colorectal adenomas and carcinomas compared to healthy control tissue (VOGEL et al. 2006). The underlying transcriptional changes causing this event are unknown. However, HAI-2 expression is reported to be unchanged in colorectal carcinomas (KATAOKA et al. 2000). Colorectal cancer is one of the most common types of cancer in the western world (JEMAL et al. 2002).

This thesis project aimed at identifying the transcriptional regulation of human ST14, SPINT1 and SPINT2 genes in the intestine by studying their respectively promoters and putative enhancer elements using Caco-2 cells as a model for intestinal epithelial.

6.1 CDX2 binds ST14 enhancer in Caco-2 cells A genomic sequence analysis of the human ST14 gene revealed a distinct previous performed CDX2-ChIP-seq peak in Caco-2 cells between exon one and exon two (figure 4). This CDX2-peak is located within a region of H3K4me2 marks and was moreover DNAseI hypersensitive, both observations were previous performed in Caco-2 cells. These epigenetic marks indicated a region which might be regulatory active and where CDX2 perhaps have a biological relevant function. The CDX2 ChIP-seq peak was validated by performing a new CDX2-ChIP assay in Caco-2 cells. The result confirmed significantly CDX2-enrichment within the putative ST14 enhancer region compared to the HA-ChIP control enrichments (figure 7). The CDX2-enrichment in the ST14 enhancer was comparable with the CDX2-enrichments of the HEPH promoter region which is known to be regulated by CDX2 (HINOI et al. 2005). A computational analysis of the ST14 enhancer sequence revealed six potential CDX2-binding sites (figure 6) which were verified for CDX2-binding by performing an in vitro EMSA supershift assay (figure 8). All of the EMSA probes covering the putative CDX2-binding sites showed to be bound by CDX2 from Caco-2 nuclear extracts. Probe C contained two binding sites and where depended on the CDX2-binding site number one. However, it is important to bear in mind that these EMSA experiments of CDX2- binding are in vitro and that the actual CDX2-binding to the same sequence within the living cell in the intestine may be different due to the chromatin state and presence of other co-factors.

Altogether, these observations have confirmed in vivo binding of CDX2 within the ST14 enhancer and that this binding is likely to be due to five potential CDX2-binding sites showed by in vitro EMSA study with Caco-2 nuclear extracts. Epigenetic marks indicate the ST14 enhancer to be a regulatory site (see figure 4) which has a possible potential to interact with the ST14 promoter and stimulate the activity with the possible role of CDX2 to be involved.

6.2 ST14 promoter activity is increased by ST14 enhancer specific in Caco-2 cell The luciferase reporter assay is a sensitive technique to validate gene promoter activity and interaction with putative enhancer elements. The reporter activity depends on the transfection efficiency, the endogenous pool of TFs and the DNA-looping and accessibility of the reporter plasmid. However, the cloned reporter plasmid is different from the endogenous DNA counterpart which depends on the state of the chromatin structure.

Transiently transfection of ST14 reporter constructs showed that the enhancer element stimulated the promoter activity with a 6-fold in Caco-2 cells (figure 9A) which together with the notion of epigenetic markers of the endogenous enhancer (see figure 4) supports this site as being regulatory active.

The over-expression experiment is a sensitive method to observe an effect of specific TFs but it also creates a different condition and is moreover highly artificial for the living cell. The over- expression of TFs are likely to cause unwanted side effects and alterations of the endogenous gene expression. Over-expression of TFs can also result in non-natural bindings within the reporter construct which can give false stimulations or repressions.

Unfortunately the co-transfection experiment affected the pGL4.10 control vector. CDX3 over- expression dramatically increased the luciferase activity in both Caco-2 cells (figure 10A) and RKO cells (figure 10B). GATA4 over-expression also had an effect in Caco-2 cells but only to a minor degree in RKO cells. Combination experiments of CDX3 over-expression with over-expression of Sp1, GATA4 or HNF4α were therefore also affected. Surprisingly the pGL4.10 control vector contained 12 potential CDX2 binding sites and 6 potential GATA-4 binding sites (figure 10c). PGL4.10 from Promega was originally designed as an upgraded reporter vector with minimized binding sites. A Poly A Signal (no.2) is located just before the translational start site of the luciferase gene which functions to terminate an unwanted transcription. However, within this Poly A Signal 2 was located a CDX2-binding site which might function in recruitment of the basal transcriptional machinery by binding with the co-activator, p300 (HUSSAIN and HABENER 1999; VO and GOODMAN 2001). GATA4 is also reported to interact with p300 (DAI and MARKHAM 2001). However GATA4 mediated transcription from its binding sites within the pGL4.10 vector should be terminated by the Poly A Signal 2. The GATA4 over-expression effect on the pGL4.10 vector is greatest in the Caco-2 cell which is known to have a relative high level of endogenous CDX2 in contrast to RKO cells. A possible explanation might be that GATA4 binding functioned as an enhancer stimulating the minimal transcription mediated from binding of endogenous CDX2 to the CDX2-binding site within the Poly A Signal 2. However, in the cloned reporter constructs this Poly A Signal 2 was located upstream of the inserted promoter sequence. The many CDX2 and GATA4 sites are likely to stimulate the reporter constructs. Therefore the following reporter assays with over-expression of TFs were critically analyzed and validated with emphasis on false positive results.

The stimulation of the ST14 promoter activity in Caco-2 cells by CDX3 and GATA4 over- expression was likely to be false positive signals from the CDX2 and GATA4 sites found in the pGL4.10 vector (figure 10C) which is shown in the control experiment (figure 10A). However, CDX2 and GATA4 sites were also found in the ST14 promoter (figure 5) which might contribute to the observed stimulation. Although the above notion of the ability of CDX2 to bind to the enhancer, the CDX3 over-expression did not stimulate the pST14-prom.+enh. construct. This observation might indicate the CDX2 binding in the enhancer does not have a function in the interaction with the promoter. However we also speculate that the pST14-prom.+enh. construct was saturated with binding of endogenous CDX2 proteins and therefore the reporter activity does not become affected by CDX3 over-expression. CDX2 is highly expressed in Caco-2 cells and to overcome this problem we tried to use another colorectal cell line known to have a low CDX2 level. The colorectal cell line, RKO does not differentiate as seen with Caco-2 cells and RKO cells are reported to have a low level of CDX2 due to the observation of one mutated allele of CDX2 (DA COSTA et al. 1999). The use of this cell line was therefore implied with the possible of seeing an effect of CDX3 over- expression. However, as seen in figure 11B the ST14 enhancer did not stimulate the promoter activity. This interesting observation showed that the ST14 enhancer is specific for the Caco-2 cell. This indicates that there are some factors in the Caco-2 cell which are critical for the enhancer activation. The stimulated activity level from CDX3 and GATA4 over-expression in RKO cells was the same with or without the enhancer element indicating that this stimulation was through the promoter activity. However, again this stimulation pattern was similar to the control experiment (figure 10B) and was therefore likely to be false positive signals. CDX2 may be a critical factor for the enhancer activity observed in Caco-2 since CDX2 expression is low in RKO cells and high in Caco-2 cells.

The computational analysis of the ST14 promoter sequence did not reveal any binding site for TATA-binding protein (TBP) but instead the sequence contained GC-rich regions (GpC-islands) and three putative Sp1-binding was observed (figure 5). Analysis of Sp1-binding within the ST14 promoter by performing a Sp1-ChIP assay failed in the qPCR analysis due to a disqualified set of primers (data not shown). However, Sp1-over-expression did not noteworthy transactivate the ST14 reporter constructs. This observation might be influenced by the endogenous amount of Sp3 which have the same binding-affinity as Sp1 and is reported to repress Sp1-mediated transactivation of promoters with more than one Sp1/Sp3 binding sites (YU et al. 2003). Sp3 contains an inhibitory domain which repress the transactivation domains (TADs) of Sp1 and Sp3 which can block the synergistically transactivation ability between two or more Sp1 TFs (DENNIG et al. 1996; HAGEN et al. 1994; MAJELLO et al. 1997).

6.3 CDX2 binds SPINT1 enhancer The SPINT1 enhancer was also identified and selected based on a distinct CDX2 ChIP-seq peak found between exon one and exon two of the SPINT1 gene (figure 12). This region was also DNAseI hypersensitive and marked with H3K4me2 in Caco-2 cells suggesting a regulatory region. The CDX2-ChIP-seq peak was confirmed with a new CDX2 ChIP assay in Caco-2 cells which showed significantly CDX2-enrichment compared to HA-ChIP and was moreover comparable with

CDX2-enrichment of the positive HEPH promoter (figure 15A). Computational search of the selected enhancer sequence revealed a potential CDX2-binding site (figure 14) and in vitro EMSA experiment of a probe covering the site showed to bind CDX2 and were depended of the CDX2 site using Caco-2 nuclear extracts (figure 15B). These observations might indicate the enhancer region as being a regulatory site with the possibility of CDX2 to have a functional role.

6.4 SPINT1 enhancer increases the promoter activity and is affected by CDX3 and Sp1 over-expression in a cell-type specific manner Computational sequence analysis revealed three potential GATA4 sites, one CDX2 site and three Sp1 sites within the SPINT1 promoter (figure 13) and the SPINT1 enhancer contained a potential CDX2, a GATA4 and a HNF4α binding site (figure 14).

The SPINT1 reporter assay revealed a stimulation of the promoter by the enhancer in both Caco-2 cells (figure 16A) and in RKO cells (figure 16B). CDX3 and GATA4 over-expression stimulated both the promoter activity and the enhancer activity in Caco-2 cells (figure 17A), with the same stimulation pattern as observed for the control pGL4.10 vector (figure 10B). However, in RKO cells the CDX3 over-expression did not affect the SPINT1 promoter activity and more dramatically CDX3 repressed the enhancer activity (figure 17B) showing that CDX3 over-expression affects the SPINT1 reporter constructs in a cell-specific manner.

Sp1 over-expression stimulated the enhancer activity to a minor degree in RKO cells (figure 17B). The Sp1-A and Sp1-C binding sites located within the proximal region of the SPINT1 promoter (figure 13) have previously been reported but not been validated for Sp1 binding or stimulation activity (ITOH et al. 2001). In the same article it was reported that neither the SPINT1 nor SPINT2 promoter contained TATA-or CAAAT boxes. Here we report for first time binding of Sp1 to the SPINT1 promoter region in vivo in Caco-2 cells by performing a Sp1-ChIP assay (figure 18).

6.5 SPINT2 enhancer is activated dramatically with co-expression of CDX3 and HNF4α in RKO cells The identification of the selected SPINT2 enhancer region was based on a previous performed HNF4α ChIP-seq peak between exon one and exon two of the SPINT2 gene (figure 19). This region also contained epigenetic marks of H3K4me2 and DNAseI hypersensitivity but also a little noteworthy accumulation of CDX2-binding enrichment in the CDX2 ChIP-seq track. The TRANSFAC analysis revealed two potential CDX2 sites, two HNF4α sites and three Sp1 sites within the SPINT2 promoter sequence (figure 20) and two GATA4 sites, two CDX2 sites and one HNF4α site within the SPINT2 enhancer sequence (figure 21).

The SPINT2 reporter assay revealed no functional interaction between promoter and enhancer neither in Caco-2 cells (figure 22A) nor in RKO cells (figure 22B). The CDX3 and GATA4 stimulation observed through the promoter in Caco-2 cells (figure 23A) was similar to the pattern of the pGL4.10 control vector (figure 10A). However, in RKO cells the promoter activity was stimulated synergistically by co-expression of CDX3 and HNF4α (figure 23B). Expression of

HNF4α alone stimulated the enhancer activity 2-fold. The CDX3 stimulation was also increased with the enhancer element compared to the promoter alone. Moreover, co-expression of HNF4α and CDX3 dramatically increased the enhancer activity synergistically (figure 23B) which supports the notion of a HNF4α and a CDX2 ChIP-seq binding accumulation within the enhancer region (figure 19). Perhaps these two observations are due to the potential binding sites of HNF4α and CDX2 observed within the SPINT2 enhancer (figure 21). Perhaps this enhancer region has a regulatory function supported by the reporter assay in RKO cells and the epigenetic marks seen in Caco-2 cells (figure 19). An interesting question is why the HNF4α effect on the enhancer activity only is seen in RKO cells and not in Caco-2 cells. Perhaps there are some factors blocking the effect of HNF4α in Caco-2 cells.

6.6 CDX2 siRNA experiment did not affect ST14 and SPINT1 mRNA levels in Caco-2 cells Transfection of siRNA is a method to manipulate the endogenous expression level of a specific gene. The double stranded siRNA is designed to inhibit the expression of a specific gene by target its mRNA and degrade it by using the endogenous cellular RNA-induced silencing complex (RISC). The knock down efficiency depends on the endogenous expression level of the target gene, the cell density, siRNA concentration and the transfection reagent. The siRNA transfection may have off-target effects and disturb the homeostasis of the RISC complex activity. Therefore transfection of a non-target siRNA is included as a control. Since we were investigating the effect of a TF regulating the transcription of genes we analyzed the effect on the mRNA level by performing real-time qPCR. The cells were harvested at day 2 and 4 which was considered to be an optimal time period. Within this period the CDX2 mRNA needs to be efficiently knocked down followed by an effect on the CDX2 protein level which in turn affects the transcript of its target genes which also are depended on their specific mRNA turnover rate.

The CDX2 siRNA efficiency was rather poor with only 50% CDX2 knock down in Caco-2 cells (figure 24). The reference gene, RPLP0 only varied within a half qPCR cycle indicating that it is a reliable housekeeping gene as previous reported (DYDENSBORG et al. 2006). The knock-down result was likely to be due to a wrong combination of cell density and siRNA concentration, although these parameters were tried to be optimized. The transfection reagent was kept constant by the recommended concentration from the manufactures protocol. CDX2 is also reported to affect the E- Cadherin at the cell membrane which is implicated in the intestinal polarization and cell-cell adhesion (FUNAKOSHI et al. 2010; KELLER et al. 2004; SCHREIDER et al. 2002). The possibility that CDX2 knock down might alter the Caco-2 cell adhesion could explain that efficient knock-down - cells are loosen and washed away at the total RNA harvest and thereby increase the background level from untransfected cells. However, the CDX2 knock-down was effective enough to see a regulation on SI gene expression (figure 24) which is known to be regulated by CDX2 (BOUDREAU et al. 2002). The mRNA level of SI was even more reduced that the CDX2 expression indicating that SI expression is extremely sensitive with a high CDX2-dependend threshold. The notion that the ST14 and SPINT1 mRNA levels did not chance (see figure 24) might be explained by that these to genes have a low threshold regarding their sensitivity of CDX2 regulation or maybe the total

RNA was harvest at a wrong point of time. Another explanation could be redundancy of other TFs taken over the function of CDX2 or finally an explanation could be that CDX2 does not have any biological role regarding regulation of ST14 and SPINT1 gene expression.

Matriptase is expressed together with its inhibitors in most epithelial tissues (OBERST et al. 2001; SZABO et al. 2008). There is a possibility that the expression of matitriptase is tissue depended and might be influenced by regulation of tissue specific transcription factors. Moreover, the notion of matriptase to be co-expressed with its inhibitors in epithelial tissues may also suggest that their expression share regulation of common tissue specific TFs.

This present study indicates that the ST14, SPINT1 promoter activity functionally interact with a putative enhancer region in Caco-2 cells which is supported on the endogenous level with epigenetic marks. The ST14 and SPINT1 enhancer regions are likely to be influenced by CDX2 regulation although, further studies are needed to clarify this hypothesis. However, this possibility of ST14 and SPINT1 expression to be commonly regulated by a CDX2 could contribute to their observed co-expression in the intestine. Considering this statement, then the observed down- regulation of ST14 and SPINT1 during the progression of colorectal cancer (VOGEL et al. 2006) could be a consequence of CDX2 down-regulation which also is observed in colon cancer (BRABLETZ et al. 2004; CHOI et al. 2006; WERLING et al. 2003).

Recent studies has observed HAI-2 expression level to be reduced by epigenetic inactivation in human and renal carcinoma (MORRIS et al. 2005), hepatocellular carcinoma (TUNG et al. 2009) and gastric cancer (MORRIS et al. 2005). HAI-2 expression is moreover observed to be down-regulated during prostate cancer (BERGUM and LIST 2010) and upregulated in pancreatic cancer (MULLER- PILLASCH et al. 1998). Alternatively, the down-regulation of ST14 and SPINT1 expression observed during colorectal carcinogenesis (VOGEL et al. 2006) could also be due to an epigenetic inactivation as observed for SPINT2 expression in various cancer types (MORRIS et al. 2005; TUNG et al. 2009).

7. Conclusions and Perspectives Below are listed my concluding remarks based on key observations with suggestions of future possible studies.

Analysis of ST14 regulation revealed a functional and active promoter which specifically becomes stimulated by a putative regulatory active ST14 enhancer in Caco-2 cells. CDX2 was observed to bind this enhancer region probably through five CDX2-binding sites. However, CDX3 over-expression did not stimulate the enhancer activity in the reporter assay and we suggest that this is due to a saturated enhancer activity from binding of endogenous CDX2. A likely future study would be to mutate the five CDX2-binding sites within the ST14 enhancer in the reporter construct and verify the importance of these sites.

Analysis of SPINT1 regulation also revealed a functional and active promoter which becomes stimulated by a potential SPINT1 enhancer in both Caco-2 and RKO cells. The enhancer showed CDX2-binding in vivo in Caco-2 cell and the single putative CDX2 site is likely to contribute to the observed CDX2-enrichment. A future study would be to mutate the CDX2-binding site within the SPINT1 enhancer in the reporter construct and verify the role of CDX2 in regulating the enhancer activity.

Of the three genes investigated, SPINT2 showed to have the most active promoter in the reporter assay. The promoter did not interact with the putative enhancer element, however co-expression of HNF4α and CDX3 dramatically increased the enhancer activity in RKO cells. A likely future study would be to validate the importance of the HNF4α-binding site within the enhancer sequence with site-directed mutagenesis within the reporter construct.

The potential biological role of CDX2 in regulating the endogenous mRNA level of ST14 and SPINT1 is still uncertain. The CDX2 knock down experiment using siRNA did not have a noteworthy impact on the ST14 and SPINT1 mRNA levels. It is unclear if this observation is due to an inefficient CDX2 knockdown or if CDX2 do not have any relevant biological regulatory function towards the ST14 and SPINT1 gene expression. An optimized and acceptable CDX2 knock-down experiment is needed in order to clarify the possible role of CDX2 in regulating ST14 and SPINT1 gene expression. A lentiviral strategy using a virus such as the human immunodeficiency virus (HIV) could be considered to infect the Caco-2 cells with short hairpin RNA (BOS et al. 2009) targeting CDX2. The high efficiency of using lentivirus also has the advantage of infecting non-dividing and differentiated cells. qPCR analysis was used when observing the mRNA level of the target genes but if a significant and noteworthy change is observed in the gene expression then it would also be interesting to observe the protein level using Western Blotting.

The idea of CDX2 to have a potential role in regulating ST14 and SPINT1 promoter activity was based on previous performed CDX2 ChIP-seq without knowing if CDX2 had any biological relevant function towards the expression of the ST14 and SPINT1 genes. An idea for future studies of identifying CDX2-target genes in Caco-2 cells could be to consider to perform a microarray

57 expression analysis on an efficient CDX2 siRNA experiment and select for interesting affected genes and then afterwards use the CDX2 ChIP-seq to search for putative CDX2 regulatory sites.

Giving the scenario that CDX2 do have an in vivo regulatory function towards the endogenous level of ST14 and SPINT1 expression, then it would be interesting to know if the putative enhancer elements are responsible for the endogenous regulation. The promoter and enhancer interaction seen in the reporter assay does not account for the endogenous chromatin structure. This validation would require the use of a technique such as the Chromosome Conformation Capture (C3) method which can visualize promoter/enhancer interactions within the cell (SIMONIS et al. 2007). Another technique to validate the importance of the endogenous TF-binding sites of interest within the enhancer sites is by using Zinc Finger Nucleases (ZFNs). ZFNs are DNA-binding proteins which edits the genome-specific target by creating a double-strand break followed by a genome deletion processed by non-homologues end joining or a genome integrations/correction processed by homologous recombination with co-transfection of a repair-template plasmid (GUTSCHNER et al. 2011; URNOV et al. 2005). Using this technology, the endogenous TF-binding sites of the enhancers within the Caco-2 cell line can be manipulated and mutated.

8. Reference List

ALEKSIC, J., and S. RUSSELL, 2009 ChIPing away at the genome: the new frontier travel guide. Mol Biosyst 5: 1421-1428. ANDREASEN, P. A., R. EGELUND and H. H. PETERSEN, 2000 The plasminogen activation system in tumor growth, invasion, and metastasis. Cell Mol Life Sci 57: 25-40. ARCHER, A., D. SAUVAGET, V. CHAUFFETON, P. E. BOUCHET, J. CHAMBAZ et al., 2005 Intestinal apolipoprotein A-IV gene transcription is controlled by two hormone-responsive elements: a role for hepatic nuclear factor-4 isoforms. Mol Endocrinol 19: 2320-2334. ARTURSSON, P., K. PALM and K. LUTHMAN, 2001 Caco-2 monolayers in experimental and theoretical predictions of drug transport. Adv Drug Deliv Rev 46: 27-43. BARKER, N., J. H. VAN ES, J. KUIPERS, P. KUJALA, M. VAN DEN BORN et al., 2007 Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449: 1003-1007. BENOIT, Y. D., F. PARE, C. FRANCOEUR, D. JEAN, E. TREMBLAY et al., 2010 Cooperation between HNF-1alpha, Cdx2, and GATA-4 in initiating an enterocytic differentiation program in a normal human intestinal epithelial progenitor cell line. Am J Physiol Gastrointest Liver Physiol 298: G504-517. BENTLEY, D. L., and M. GROUDINE, 1986 Novel promoter upstream of the human c-myc gene and regulation of c-myc expression in B-cell lymphomas. Mol Cell Biol 6: 3481-3489. BERGUM, C., and K. LIST, 2010 Loss of the matriptase inhibitor HAI-2 during prostate cancer progression. Prostate 70: 1422-1428. BEULING, E., N. Y. BAFFOUR-AWUAH, K. A. STAPLETON, B. E. ARONSON, T. K. NOAH et al., 2011 GATA factors regulate proliferation, differentiation, and gene expression in small intestine of mature mice. Gastroenterology 140: 1219-1229 e1211-1212. BONHOMME, C., I. DULUC, E. MARTIN, K. CHAWENGSAKSOPHAK, M. P. CHENARD et al., 2003 The Cdx2 homeobox gene has a tumour suppressor function in the distal colon in addition to a homeotic role during gut development. Gut 52: 1465-1471. BOS, T. J., E. DE BRUYNE, C. HEIRMAN and K. VANDERKERKEN, 2009 In search of the most suitable lentiviral shRNA system. Curr Gene Ther 9: 192-211. BOUDREAU, F., E. H. RINGS, H. M. VAN WERING, R. K. KIM, G. P. SWAIN et al., 2002 Hepatocyte nuclear factor-1 alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase- isomaltase gene. J Biol Chem 277: 31909-31917. BOUDREAU, F., Y. ZHU and P. G. TRABER, 2001 Sucrase-isomaltase gene transcription requires the hepatocyte nuclear factor-1 (HNF-1) regulatory element and is regulated by the ratio of HNF-1 alpha to HNF-1 beta. J Biol Chem 276: 32122-32128. BOUKAMEL, R., and J. N. FREUND, 1994 The cis-element CE-LPH1 of the rat intestinal lactase gene promoter interacts in vitro with several nuclear factors present in endodermal tissues. FEBS Lett 353: 108- 112. BOYD, M., S. BRESSENDORFF, J. MOLLER, J. OLSEN and J. T. TROELSEN, 2009 Mapping of HNF4alpha target genes in intestinal epithelial cells. BMC Gastroenterol 9: 68. BOYD, M., M. HANSEN, T. G. JENSEN, A. PEREARNAU, A. K. OLSEN et al., 2010 Genome-wide analysis of CDX2 binding in intestinal epithelial cells (Caco-2). J Biol Chem 285: 25115-25125. BRABLETZ, S., O. SCHMALHOFER and T. BRABLETZ, 2009 Gastrointestinal stem cells in development and cancer. J Pathol 217: 307-317. BRABLETZ, T., S. SPADERNA, J. KOLB, F. HLUBEK, G. FALLER et al., 2004 Down-regulation of the homeodomain factor Cdx2 in colorectal cancer by collagen type I: an active role for the tumor environment in malignant tumor progression. Cancer Res 64: 6973-6977.

BRY, L., P. FALK, K. HUTTNER, A. OUELLETTE, T. MIDTVEDT et al., 1994 Paneth cell differentiation in the developing intestine of normal and transgenic mice. Proc Natl Acad Sci U S A 91: 10335-10339. BUGGE, T. H., K. LIST and R. SZABO, 2007 Matriptase-dependent cell surface proteolysis in epithelial development and pathogenesis. Front Biosci 12: 5060-5070. BUZZA, M. S., S. NETZEL-ARNETT, T. SHEA-DONOHUE, A. ZHAO, C. Y. LIN et al., 2010 Membrane-anchored serine protease matriptase regulates epithelial barrier formation and permeability in the intestine. Proc Natl Acad Sci U S A 107: 4200-4205. CATTIN, A. L., J. LE BEYEC, F. BARREAU, S. SAINT-JUST, A. HOULLIER et al., 2009 Hepatocyte nuclear factor 4alpha, a key factor for homeostasis, cell architecture, and barrier function of the adult intestinal epithelium. Mol Cell Biol 29: 6294-6308. CHAMBEYRON, S., and W. A. BICKMORE, 2004 Does looping and clustering in the nucleus regulate gene expression? Curr Opin Cell Biol 16: 256-262. CHAWENGSAKSOPHAK, K., R. JAMES, V. E. HAMMOND, F. KONTGEN and F. BECK, 1997 Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386: 84-87. CHENG, H., 1974 Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. IV. Paneth cells. Am J Anat 141: 521-535. CHOI, B. J., C. J. KIM, Y. G. CHO, J. H. SONG, S. Y. KIM et al., 2006 Altered expression of CDX2 in colorectal cancers. APMIS 114: 50-54. CLEVERS, H., 2011 The cancer stem cell: premises, promises and challenges. Nat Med 17: 313-319. COMOGLIO, P. M., and C. BOCCACCIO, 2001 Scatter factors and invasive growth. Semin Cancer Biol 11: 153- 165. COSKUN, M., M. BOYD, J. OLSEN and J. T. TROELSEN, 2010 Control of intestinal promoter activity of the cellular migratory regulator gene ELMO3 by CDX2 and SP1. J Cell Biochem 109: 1118-1128. D'ANGELO, A., O. BLUTEAU, M. A. GARCIA-GONZALEZ, L. GRESH, A. DOYEN et al., 2010 Hepatocyte nuclear factor 1alpha and beta control terminal differentiation and cell fate commitment in the gut epithelium. Development 137: 1573-1582. DA COSTA, L. T., T. C. HE, J. YU, A. B. SPARKS, P. J. MORIN et al., 1999 CDX2 is mutated in a colorectal cancer with normal APC/beta-catenin signaling. Oncogene 18: 5010-5014. DAI, Y. S., and B. E. MARKHAM, 2001 p300 Functions as a coactivator of transcription factor GATA-4. J Biol Chem 276: 37178-37185. DE LAU, W., N. BARKER, T. Y. LOW, B. K. KOO, V. S. LI et al., 2011 Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling. Nature 476: 293-297. DENNIG, J., M. BEATO and G. SUSKE, 1996 An inhibitor domain in Sp3 regulates its glutamine-rich activation domains. EMBO J 15: 5659-5667. DRUMMOND, F., J. SOWDEN, K. MORRISON and Y. H. EDWARDS, 1996 The caudal-type homeobox protein Cdx-2 binds to the colon promoter of the carbonic anhydrase 1 gene. Eur J Biochem 236: 670-681. DUSING, M. R., E. A. FLORENCE and D. A. WIGINTON, 2003 High-level activation by a duodenum-specific enhancer requires functional GATA binding sites. Am J Physiol Gastrointest Liver Physiol 284: G1053-1065. DYDENSBORG, A. B., E. HERRING, J. AUCLAIR, E. TREMBLAY and J. F. BEAULIEU, 2006 Normalizing genes for quantitative RT-PCR in differentiating human intestinal epithelial cells and adenocarcinomas of the colon. Am J Physiol Gastrointest Liver Physiol 290: G1067-1074. FANG, R., L. C. OLDS, N. A. SANTIAGO and E. SIBLEY, 2001 GATA family transcription factors activate lactase gene promoter in intestinal Caco-2 cells. Am J Physiol Gastrointest Liver Physiol 280: G58-67. FANG, R., N. A. SANTIAGO, L. C. OLDS and E. SIBLEY, 2000 The homeodomain protein Cdx2 regulates lactase gene promoter activity during enterocyte differentiation. Gastroenterology 118: 115-127. FOGH, J., J. M. FOGH and T. ORFEO, 1977 One hundred and twenty-seven cultured human tumor cell lines producing tumors in nude mice. J Natl Cancer Inst 59: 221-226. FRE, S., M. HUYGHE, P. MOURIKIS, S. ROBINE, D. LOUVARD et al., 2005 Notch signals control the fate of immature progenitor cells in the intestine. Nature 435: 964-968.

FUNAKOSHI, S., J. KONG, M. A. CRISSEY, L. DANG, D. DANG et al., 2010 Intestine-specific transcription factor Cdx2 induces E-cadherin function by enhancing the trafficking of E-cadherin to the cell membrane. Am J Physiol Gastrointest Liver Physiol 299: G1054-1067. GAO, N., P. WHITE and K. H. KAESTNER, 2009 Establishment of intestinal identity and epithelial-mesenchymal signaling by Cdx2. Dev Cell 16: 588-599. GODIKSEN, S., J. SELZER-PLON, E. D. PEDERSEN, K. ABELL, H. B. RASMUSSEN et al., 2008 Hepatocyte growth factor activator inhibitor-1 has a complex subcellular itinerary. Biochem J 413: 251-259. GROSS, I., I. DULUC, T. BENAMEUR, A. CALON, E. MARTIN et al., 2008 The intestine-specific homeobox gene Cdx2 decreases mobility and antagonizes dissemination of colon cancer cells. Oncogene 27: 107-115. GUTSCHNER, T., M. BAAS and S. DIEDERICHS, 2011 Noncoding RNA gene silencing through genomic integration of RNA destabilizing elements using zinc finger nucleases. Genome Res. HAGEN, G., S. MULLER, M. BEATO and G. SUSKE, 1994 Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J 13: 3843-3851. HARDWICK, J. C., G. R. VAN DEN BRINK, S. A. BLEUMING, I. BALLESTER, J. M. VAN DEN BRANDE et al., 2004 Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. Gastroenterology 126: 111-121. HEATH, J. P., 1996 Epithelial cell migration in the intestine. Cell Biol Int 20: 139-146. HIDALGO, I. J., T. J. RAUB and R. T. BORCHARDT, 1989 Characterization of the human colon carcinoma cell line (Caco-2) as a model system for intestinal epithelial permeability. Gastroenterology 96: 736-749. HINOI, T., G. GESINA, A. AKYOL, R. KUICK, S. HANASH et al., 2005 CDX2-regulated expression of iron transport protein hephaestin in intestinal and colonic epithelium. Gastroenterology 128: 946-961. HUSSAIN, M. A., and J. F. HABENER, 1999 Glucagon gene transcription activation mediated by synergistic interactions of pax-6 and cdx-2 with the p300 co-activator. J Biol Chem 274: 28950-28957. ITOH, H., H. KATAOKA, J. Y. MENG, R. HAMASUNA, N. KITAMURA et al., 2001 Mouse hepatocyte growth factor activator inhibitor type 1 (HAI-1) and type 2 (HAI-2)/placental bikunin genes and their promoters. Biochim Biophys Acta 1519: 92-95. JEMAL, A., A. THOMAS, T. MURRAY and M. THUN, 2002 Cancer statistics, 2002. CA Cancer J Clin 52: 23-47. KATAOKA, H., H. ITOH, H. UCHINO, R. HAMASUNA, N. KITAMURA et al., 2000 Conserved expression of hepatocyte growth factor activator inhibitor type-2/placental bikunin in human colorectal carcinomas. Cancer Lett 148: 127-134. KAWAGUCHI, T., L. QIN, T. SHIMOMURA, J. KONDO, K. MATSUMOTO et al., 1997 Purification and cloning of hepatocyte growth factor activator inhibitor type 2, a Kunitz-type serine protease inhibitor. J Biol Chem 272: 27558-27564. KELLER, M. S., T. EZAKI, R. J. GUO and J. P. LYNCH, 2004 Cdx1 or Cdx2 expression activates E-cadherin-mediated cell-cell adhesion and compaction in human COLO 205 cells. Am J Physiol Gastrointest Liver Physiol 287: G104-114. KINZLER, K. W., and B. VOGELSTEIN, 1996 Lessons from hereditary colorectal cancer. Cell 87: 159-170. LEE, S. L., R. B. DICKSON and C. Y. LIN, 2000 Activation of hepatocyte growth factor and urokinase/plasminogen activator by matriptase, an epithelial membrane serine protease. J Biol Chem 275: 36720-36725. LEHNER, F., U. KULIK, J. KLEMPNAUER and J. BORLAK, 2010 Mapping of liver-enriched transcription factors in the human intestine. World J Gastroenterol 16: 3919-3927. LI, L., and J. R. DAVIE, 2010 The role of Sp1 and Sp3 in normal and cancer cell biology. Ann Anat 192: 275- 283. LIN, C. Y., J. ANDERS, M. JOHNSON and R. B. DICKSON, 1999 Purification and characterization of a complex containing matriptase and a Kunitz-type serine protease inhibitor from human milk. J Biol Chem 274: 18237-18242. LIST, K., 2009 Matriptase: a culprit in cancer? Future Oncol 5: 97-104. LIST, K., T. H. BUGGE and R. SZABO, 2006 Matriptase: potent proteolysis on the cell surface. Mol Med 12: 1-7.

LIST, K., C. C. HAUDENSCHILD, R. SZABO, W. CHEN, S. M. WAHL et al., 2002 Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis. Oncogene 21: 3765-3779. LIST, K., P. KOSA, R. SZABO, A. L. BEY, C. B. WANG et al., 2009 Epithelial integrity is maintained by a matriptase- dependent proteolytic pathway. Am J Pathol 175: 1453-1463. LIST, K., R. SZABO, A. MOLINOLO, V. SRIURANPONG, V. REDEYE et al., 2005 Deregulated matriptase causes ras- independent multistage carcinogenesis and promotes ras-mediated malignant transformation. Genes Dev 19: 1934-1950. MAJELLO, B., P. DE LUCA and L. LANIA, 1997 Sp3 is a bifunctional transcription regulator with modular independent activation and repression domains. J Biol Chem 272: 4021-4026. MARIADASON, J. M., D. ARANGO, G. A. CORNER, M. J. ARANES, K. A. HOTCHKISS et al., 2002 A gene expression profile that defines colon cell maturation in vitro. Cancer Res 62: 4791-4804. MARIADASON, J. M., C. NICHOLAS, K. E. L'ITALIEN, M. ZHUANG, H. J. SMARTT et al., 2005 Gene expression profiling of intestinal epithelial cell maturation along the crypt-villus axis. Gastroenterology 128: 1081-1088. MARLOR, C. W., K. A. DELARIA, G. DAVIS, D. K. MULLER, J. M. GREVE et al., 1997 Identification and cloning of human placental bikunin, a novel serine protease inhibitor containing two Kunitz domains. J Biol Chem 272: 12202-12208. MARSHMAN, E., C. BOOTH and C. S. POTTEN, 2002 The intestinal epithelial stem cell. Bioessays 24: 91-98. MEDEMA, J. P., and L. VERMEULEN, 2011 Microenvironmental regulation of stem cells in intestinal homeostasis and cancer. Nature 474: 318-326. MELCHER, R., S. KOEHLER, C. STEINLEIN, M. SCHMID, C. R. MUELLER et al., 2002 Spectral karyotype analysis of colon cancer cell lines of the tumor suppressor and mutator pathway. Cytogenet Genome Res 98: 22-28. MENDEL, D. B., L. P. HANSEN, M. K. GRAVES, P. B. CONLEY and G. R. CRABTREE, 1991 HNF-1 alpha and HNF-1 beta (vHNF-1) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev 5: 1042-1056. MERLOS-SUAREZ, A., F. M. BARRIGA, P. JUNG, M. IGLESIAS, M. V. CESPEDES et al., 2011 The intestinal stem cell signature identifies colorectal cancer stem cells and predicts disease relapse. Cell Stem Cell 8: 511- 524. MILLS, J. C., N. ANDERSSON, C. V. HONG, T. S. STAPPENBECK and J. I. GORDON, 2002 Molecular characterization of mouse gastric epithelial progenitor cells. Proc Natl Acad Sci U S A 99: 14819-14824. MITCHELMORE, C., J. T. TROELSEN, N. SPODSBERG, H. SJOSTROM and O. NOREN, 2000 Interaction between the homeodomain proteins Cdx2 and HNF1alpha mediates expression of the lactase-phlorizin hydrolase gene. Biochem J 346 Pt 2: 529-535. MLODZIK, M., A. FJOSE and W. J. GEHRING, 1985 Isolation of caudal, a Drosophila homeo box-containing gene with maternal expression, whose transcripts form a concentration gradient at the pre-blastoderm stage. EMBO J 4: 2961-2969. MOCHIDA, S., S. TSUZUKI, K. INOUYE and T. FUSHIKI, 2010 A recombinant catalytic domain of matriptase induces detachment and apoptosis of small-intestinal epithelial IEC-6 cells cultured on laminin-coated surface. J Biochem 148: 721-732. MOLKENTIN, J. D., 2000 The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression. J Biol Chem 275: 38949-38952. MORRIS, M. R., D. GENTLE, M. ABDULRAHMAN, E. N. MAINA, K. GUPTA et al., 2005 Tumor suppressor activity and epigenetic inactivation of hepatocyte growth factor activator inhibitor type 2/SPINT2 in papillary and clear cell renal cell carcinoma. Cancer Res 65: 4598-4606. MULLER-PILLASCH, F., C. WALLRAPP, K. BARTELS, G. VARGA, H. FRIESS et al., 1998 Cloning of a new Kunitz-type protease inhibitor with a putative transmembrane domain overexpressed in pancreatic cancer. Biochim Biophys Acta 1395: 88-95. NAKAMURA, T., K. TSUCHIYA and M. WATANABE, 2007 Crosstalk between Wnt and Notch signaling in intestinal epithelial cell fate decision. J Gastroenterol 42: 705-710.

NETZEL-ARNETT, S., B. M. CURRIE, R. SZABO, C. Y. LIN, L. M. CHEN et al., 2006 Evidence for a matriptase-prostasin proteolytic cascade regulating terminal epidermal differentiation. J Biol Chem 281: 32941-32945. OBERST, M., J. ANDERS, B. XIE, B. SINGH, M. OSSANDON et al., 2001 Matriptase and HAI-1 are expressed by normal and malignant epithelial cells in vitro and in vivo. Am J Pathol 158: 1301-1311. OBERST, M. D., L. Y. CHEN, K. KIYOMIYA, C. A. WILLIAMS, M. S. LEE et al., 2005 HAI-1 regulates activation and expression of matriptase, a membrane-bound serine protease. Am J Physiol Cell Physiol 289: C462- 470. OBERST, M. D., B. SINGH, M. OZDEMIRLI, R. B. DICKSON, M. D. JOHNSON et al., 2003 Characterization of matriptase expression in normal human tissues. J Histochem Cytochem 51: 1017-1025. OLSEN, L., S. BRESSENDORFF, J. T. TROELSEN and J. OLSEN, 2005 Differentiation-dependent activation of the human intestinal alkaline phosphatase promoter by HNF-4 in intestinal cells. Am J Physiol Gastrointest Liver Physiol 289: G220-226. ONG, C. T., and V. G. CORCES, 2011 Enhancer function: new insights into the regulation of tissue-specific gene expression. Nat Rev Genet 12: 283-293. PARR, C., A. J. SANDERS and W. G. JIANG, 2010 Hepatocyte growth factor activation inhibitors - therapeutic potential in cancer. Anticancer Agents Med Chem 10: 47-57. PINTO, D., A. GREGORIEFF, H. BEGTHEL and H. CLEVERS, 2003 Canonical Wnt signals are essential for homeostasis of the intestinal epithelium. Genes Dev 17: 1709-1713. RADTKE, F., H. CLEVERS and O. RICCIO, 2006 From gut homeostasis to cancer. Curr Mol Med 6: 275-289. RAO, J. N., J. LI, L. LI, B. L. BASS and J. Y. WANG, 1999 Differentiated intestinal epithelial cells exhibit increased migration through polyamines and myosin II. Am J Physiol 277: G1149-1158. RINGS, E. H., F. BOUDREAU, J. K. TAYLOR, J. MOFFETT, E. R. SUH et al., 2001 Phosphorylation of the serine 60 residue within the Cdx2 activation domain mediates its transactivation capacity. Gastroenterology 121: 1437-1450. SAKAGUCHI, T., X. GU, H. M. GOLDEN, E. SUH, D. B. RHOADS et al., 2002 Cloning of the human claudin-2 5'- flanking region revealed a TATA-less promoter with conserved binding sites in mouse and human for caudal-related homeodomain proteins and hepatocyte nuclear factor-1alpha. J Biol Chem 277: 21361-21370. SATO, T., J. H. VAN ES, H. J. SNIPPERT, D. E. STANGE, R. G. VRIES et al., 2011 Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469: 415-418. SATOMI, S., Y. YAMASAKI, S. TSUZUKI, Y. HITOMI, T. IWANAGA et al., 2001 A role for membrane-type serine protease (MT-SP1) in intestinal epithelial turnover. Biochem Biophys Res Commun 287: 995-1002. SCHAFFNER, F., and W. RUF, 2009 Tissue factor and PAR2 signaling in the tumor microenvironment. Arterioscler Thromb Vasc Biol 29: 1999-2004. SCHREIDER, C., G. PEIGNON, S. THENET, J. CHAMBAZ and M. PINCON-RAYMOND, 2002 Integrin-mediated functional polarization of Caco-2 cells through E-cadherin--actin complexes. J Cell Sci 115: 543-552. SERFAS, M. S., and A. L. TYNER, 1993 HNF-1 alpha and HNF-1 beta expression in mouse intestinal crypts. Am J Physiol 265: G506-513. SHIBATA, H., K. TOYAMA, H. SHIOYA, M. ITO, M. HIROTA et al., 1997 Rapid colorectal adenoma formation initiated by conditional targeting of the Apc gene. Science 278: 120-123. SHIMAKURA, J., T. TERADA, T. KATSURA and K. INUI, 2005 Characterization of the human peptide transporter PEPT1 promoter: Sp1 functions as a basal transcriptional regulator of human PEPT1. Am J Physiol Gastrointest Liver Physiol 289: G471-477. SHIMAKURA, J., T. TERADA, Y. SHIMADA, T. KATSURA and K. INUI, 2006 The transcription factor Cdx2 regulates the intestine-specific expression of human peptide transporter 1 through functional interaction with Sp1. Biochem Pharmacol 71: 1581-1588. SHIMOMURA, T., K. DENDA, T. KAWAGUCHI, K. MATSUMOTO, K. MIYAZAWA et al., 1999 Multiple sites of proteolytic cleavage to release soluble forms of hepatocyte growth factor activator inhibitor type 1 from a transmembrane form. J Biochem 126: 821-828.

SILBERG, D. G., G. P. SWAIN, E. R. SUH and P. G. TRABER, 2000 Cdx1 and cdx2 expression during intestinal development. Gastroenterology 119: 961-971. SIMONIS, M., J. KOOREN and W. DE LAAT, 2007 An evaluation of 3C-based methods to capture DNA interactions. Nat Methods 4: 895-901. SPANDIDOS, A., X. WANG, H. WANG and B. SEED, 2010 PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res 38: D792-799. STEGMANN, A., M. HANSEN, Y. WANG, J. B. LARSEN, L. R. LUND et al., 2006 Metabolome, transcriptome, and bioinformatic cis-element analyses point to HNF-4 as a central regulator of gene expression during enterocyte differentiation. Physiol Genomics 27: 141-155. SUH, E., L. CHEN, J. TAYLOR and P. G. TRABER, 1994 A homeodomain protein related to caudal regulates intestine-specific gene transcription. Mol Cell Biol 14: 7340-7351. SUH, E., and P. G. TRABER, 1996 An intestine-specific homeobox gene regulates proliferation and differentiation. Mol Cell Biol 16: 619-625. SZABO, R., and T. H. BUGGE, 2008 Type II transmembrane serine proteases in development and disease. Int J Biochem Cell Biol 40: 1297-1316. SZABO, R., J. P. HOBSON, K. CHRISTOPH, P. KOSA, K. LIST et al., 2009 Regulation of cell surface protease matriptase by HAI2 is essential for placental development, neural tube closure and embryonic survival in mice. Development 136: 2653-2663. SZABO, R., J. P. HOBSON, K. LIST, A. MOLINOLO, C. Y. LIN et al., 2008 Potent inhibition and global co-localization implicate the transmembrane Kunitz-type serine protease inhibitor hepatocyte growth factor activator inhibitor-2 in the regulation of epithelial matriptase activity. J Biol Chem 283: 29495- 29504. SZABO, R., A. L. RASMUSSEN, A. B. MOYER, P. KOSA, J. M. SCHAFER et al., 2011 c-Met-induced epithelial carcinogenesis is initiated by the serine protease matriptase. Oncogene 30: 2003-2016. TAKEUCHI, T., J. L. HARRIS, W. HUANG, K. W. YAN, S. R. COUGHLIN et al., 2000 Cellular localization of membrane- type serine protease 1 and identification of protease-activated receptor-2 and single-chain urokinase-type plasminogen activator as substrates. J Biol Chem 275: 26333-26342. THOMAS, M. C., and C. M. CHIANG, 2006 The general transcription machinery and general cofactors. Crit Rev Biochem Mol Biol 41: 105-178. TROELSEN, J. T., C. MITCHELMORE, N. SPODSBERG, A. M. JENSEN, O. NOREN et al., 1997 Regulation of lactase- phlorizin hydrolase gene expression by the caudal-related homoeodomain protein Cdx-2. Biochem J 322 ( Pt 3): 833-838. TSUKITA, S., Y. YAMAZAKI, T. KATSUNO and A. TAMURA, 2008 Tight junction-based epithelial microenvironment and cell proliferation. Oncogene 27: 6930-6938. TSUZUKI, S., N. MURAI, Y. MIYAKE, K. INOUYE, H. HIRAYASU et al., 2005 Evidence for the occurrence of membrane-type serine protease 1/matriptase on the basolateral sides of enterocytes. Biochem J 388: 679-687. TUNG, E. K., C. M. WONG, T. O. YAU, J. M. LEE, Y. P. CHING et al., 2009 HAI-2 is epigenetically downregulated in human hepatocellular carcinoma, and its Kunitz domain type 1 is critical for anti-invasive functions. Int J Cancer 124: 1811-1819. URNOV, F. D., J. C. MILLER, Y. L. LEE, C. M. BEAUSEJOUR, J. M. ROCK et al., 2005 Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435: 646-651. VAN DE WETERING, M., E. SANCHO, C. VERWEIJ, W. DE LAU, I. OVING et al., 2002 The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 111: 241-250. VAN DER FLIER, L. G., and H. CLEVERS, 2009 Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annu Rev Physiol 71: 241-260. VAN ES, J. H., P. JAY, A. GREGORIEFF, M. E. VAN GIJN, S. JONKHEER et al., 2005 Wnt signalling induces maturation of Paneth cells in intestinal crypts. Nat Cell Biol 7: 381-386.

VERZI, M. P., H. SHIN, H. H. HE, R. SULAHIAN, C. A. MEYER et al., 2010 Differentiation-specific histone modifications reveal dynamic chromatin interactions and partners for the intestinal transcription factor CDX2. Dev Cell 19: 713-726. VIVANCO, I., and C. L. SAWYERS, 2002 The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2: 489-501. VO, N., and R. H. GOODMAN, 2001 CREB-binding protein and p300 in transcriptional regulation. J Biol Chem 276: 13505-13508. VOGEL, L. K., M. SAEBO, C. F. SKJELBRED, K. ABELL, E. D. PEDERSEN et al., 2006 The ratio of Matriptase/HAI-1 mRNA is higher in colorectal cancer adenomas and carcinomas than corresponding tissue from control individuals. BMC Cancer 6: 176. WANG, J. K., M. S. LEE, I. C. TSENG, F. P. CHOU, Y. W. CHEN et al., 2009 Polarized epithelial cells secrete matriptase as a consequence of zymogen activation and HAI-1-mediated inhibition. Am J Physiol Cell Physiol 297: C459-470. WERLING, R. W., H. YAZIJI, C. E. BACCHI and A. M. GOWN, 2003 CDX2, a highly sensitive and specific marker of adenocarcinomas of intestinal origin: an immunohistochemical survey of 476 primary and metastatic carcinomas. Am J Surg Pathol 27: 303-310. WIERSTRA, I., 2008 Sp1: emerging roles--beyond constitutive activation of TATA-less housekeeping genes. Biochem Biophys Res Commun 372: 1-13. WIERSTRA, I., and J. ALVES, 2007 FOXM1c and Sp1 transactivate the P1 and P2 promoters of human c-myc synergistically. Biochem Biophys Res Commun 352: 61-68. YU, B., P. K. DATTA and S. BAGCHI, 2003 Stability of the Sp3-DNA complex is promoter-specific: Sp3 efficiently competes with Sp1 for binding to promoters containing multiple Sp-sites. Nucleic Acids Res 31: 5368-5376.

9. Appendices

9.1 APPENDIX I pGL4.10 Gate Way destination vector map

Figure 25: Features of pGL4.10 destination vector for cloning of reporter constructs; CDS1- luciferase gene (nt 59 to nt 1711); CDS( ampR)2- ampicilin resistance (nt 3083 to nt 3943); CM(R) –chloramphenicol resistance (nt 4481 to nt 5161); ccdB gene-(nt 5481 to nt 5786); MISC Feature 2- (SV40 late poly(A) region) (nt 1746 to nt 1967); attR1- (nt 4248 to nt 4372) and attR2–(nt 5827 to nt 5951)- Gateway cloning sites.

9.2 APPENDIX II St14 and spint1 gene expression in adult mouse intestinal epithelium

The mouse intestinal gene expression data base (MouseCVDB; (http://gastro.imbg.ku.dk/mousecv/)) is a microarray database of genes expressed in isolated crypts and villi of ileal epithelium of adult mouse intestine (STEGMANN et al. 2006).

Figure26: st14 gene expression in crypt/villus of adult mouse small intestine. The left red box marks the title of the probe in the microarray database. The right red box enclosures the result of the fold change in expression between crypt and villus. The illustration to the right (THE CV NAVIGATOR) depicts the expression in the cypt and villus region where “red color” indicates higher expression compared to “green color”.

Figure27: spint1 gene expression in crypt/villus of adult mouse small intestine. The left red box marks the title of the probe in the microarray database. The right red box enclosures the result of the fold change in expression between crypt and villus. The illustration to the right (THE CV NAVIGATOR) depicts the expression in the cypt and villus region where “red color” indicates higher expression compared to “green color”.