A High-Density Genetic Map of Arachis Duranensis, a Diploid Ancestor of Cultivated Peanut

UC Davis UC Davis Previously Published Works

Title A high-density genetic map of Arachis duranensis, a diploid ancestor of cultivated peanut

Permalink https://escholarship.org/uc/item/9vv047q8

Journal BMC Genomics, 13(1)

ISSN 1471-2164

Authors Nagy, Ervin D Guo, Yufang Tang, Shunxue et al.

Publication Date 2012-09-11

DOI http://dx.doi.org/10.1186/1471-2164-13-469

Peer reviewed

eScholarship.org Powered by the California Digital Library University of California Nagy et al. BMC Genomics 2012, 13:469 http://www.biomedcentral.com/1471-2164/13/469

RESEARCH ARTICLE Open Access A high-density genetic map of Arachis duranensis, a diploid ancestor of cultivated peanut Ervin D Nagy1, Yufang Guo1, Shunxue Tang1, John E Bowers1, Rebecca A Okashah1, Christopher A Taylor1, Dong Zhang1, Sameer Khanal1, Adam F Heesacker1, Nelly Khalilian1, Andrew D Farmer2, Noelia Carrasquilla-Garcia3, R Varma Penmetsa3, Douglas Cook3, H Thomas Stalker4, Niels Nielsen4, Peggy Ozias-Akins5* and Steven J Knapp1

Abstract Background: Cultivated peanut (Arachis hypogaea) is an allotetraploid species whose ancestral genomes are most likely derived from the A-genome species, A. duranensis, and the B-genome species, A. ipaensis. The very recent (several millennia) evolutionary origin of A. hypogaea has imposed a bottleneck for allelic and phenotypic diversity within the cultigen. However, wild diploid relatives are a rich source of alleles that could be used for crop improvement and their simpler genomes can be more easily analyzed while providing insight into the structure of the allotetraploid peanut genome. The objective of this research was to establish a high-density genetic map of the diploid species A. duranensis based on de novo generated EST databases. Arachis duranensis was chosen for mapping because it is the A-genome progenitor of cultivated peanut and also in order to circumvent the confounding effects of gene duplication associated with allopolyploidy in A. hypogaea. Results: More than one million expressed sequence tag (EST) sequences generated from normalized cDNA libraries of A. duranensis were assembled into 81,116 unique transcripts. Mining this dataset, 1236 EST-SNP markers were developed between two A. duranensis accessions, PI 475887 and Grif 15036. An additional 300 SNP markers also were developed from genomic sequences representing conserved legume orthologs. Of the 1536 SNP markers, 1054 were placed on a genetic map. In addition, 598 EST-SSR markers identified in A. hypogaea assemblies were included in the map along with 37 disease resistance gene candidate (RGC) and 35 other previously published markers. In total, 1724 markers spanning 1081.3 cM over 10 linkage groups were mapped. Gene sequences that provided mapped markers were annotated using similarity searches in three different databases, and gene ontology descriptions were determined using the Medicago Gene Atlas and TAIR databases. Synteny analysis between A. duranensis, Medicago and Glycine revealed significant stretches of conserved gene clusters spread across the peanut genome. A higher level of colinearity was detected between A. duranensis and Glycine than with Medicago. Conclusions: The first high-density, gene-based linkage map for A. duranensis was generated that can serve as a reference map for both wild and cultivated Arachis species. The markers developed here are valuable resources for the peanut, and more broadly, to the legume research community. The A-genome map will have utility for fine mapping in other peanut species and has already had application for mapping a nematode resistance gene that was introgressed into A. hypogaea from A. cardenasii.

* Correspondence: [email protected] 5Department of Horticulture, University of Georgia, Tifton, GA 31793, USA Full list of author information is available at the end of the article

© 2012 Nagy et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Nagy et al. BMC Genomics 2012, 13:469 Page 2 of 11 http://www.biomedcentral.com/1471-2164/13/469

Background than 200 loci and with more than the expected 20 link- Cultivated peanut (Arachis hypogaea L.) is a major crop age groups [9-13]. An exception is the recently published in most tropical and subtropical areas of the world and map containing 1114 loci across 21 linkage groups provides a significant source of oil and protein to large that was constructed in part with highly polymorphic segments of the population in Asia, Africa and the markers derived from sequences harboring miniature Americas. In the U. S., peanut is a high-value cash crop inverted repeat transposable elements [14]. Therefore, of regional importance, with major production areas there is a continuing need to generate dense linkage concentrated in the Southeast. Plant breeding efforts to maps for the cultivated tetraploid peanut that will not pyramid genes for disease and insect resistances, quality, only cluster the markers into the expected 20 linkage and yield is hampered by the polyploid genetics of the groups to cover the haplotype chromosomes, but also crop species, the multigenic nature of many traits (e.g., to facilitate marker-trait association and eventually assist yield), and the difficulty of selecting for many traits in its genetic improvement. in the field (e.g., soil borne diseases). Thus, secondary The domesticated peanut is thought to have arisen selection methods that are environmentally neutral from a single hybridization event between two diploid would greatly facilitate crop improvement efforts. Mole- wild species followed by whole genome duplication cular markers fit this criterion, but only recently have approximately 3,500 years ago [15]. This short evolu- markers been developed that reveal sufficient polymorph- tionary history, along with hybridization barriers be- isms in A. hypogaea and related species to have wide- tween diploids and the tetraploid have resulted in a spread application in peanut breeding. Preliminary steps narrow genetic base for the cultivated tetraploid peanut. for utilizing molecular markers for crop improvement On the contrary, diploid Arachis species are genetically are developing collections of polymorphic markers and diverse, have simpler inheritance patterns, and most im- utilizing them to construct dense and high-resolution portantly, contain a rich source of agronomically import- genetic maps. ant traits for peanut improvement. Due to these Constructing a high-quality genetic map depends attributes, diploid Arachis species have been proposed as largely upon finding one or more marker systems that model systems to map the peanut genome. Because the can detect high levels of polymorphism between two genomes of progenitor diploid species [i.e., A. duranensis individual parents. Unfortunately, low levels of molecu- (A-genome donor) and A. ipaensis (B-genome donor)] lar polymorphism were observed within tetraploid are closely allied to the cultivated peanut [16], mapping (2n=4x=40) A. hypogaea throughout the 1990s and the genome of one or both of these species should be early 2000s with the marker systems available at that useful for predicting the positions of loci in the cultivated time [1,2]. However, compared with the limited numbers peanut. This approach has been employed in wheat of polymorphic markers detected for the tetraploid, the [17,18], alfalfa [19,20], oat [21], and other crop species. same marker systems can uncover high levels of mole- One accession of A. ipaensis and 67 accessions of cular polymorphism within and between the diploid A. duranensis have been collected in South America. (2n=2x=20) peanut species. This polymorphism led The largest concentration of A. duranensis is in southern researchers to create molecular maps for Arachis. The Bolivia and northern Argentina, with a few populations first molecular map in peanut was constructed between being reported in Paraguay and one in central Brazil the diploids A. stenosperma Krapov. and W.C. Gregoryx [22,23]. The species is morphologically diverse and the and A. cardenasii Krapov. and W.C. Gregory by Halward Bolivia and Argentina types can be separated cytogeneti- et al. [3] who used Restriction Fragment Length Poly- cally and morphologically [24]. Due to the availability of morphisms (RFLPs) to associate 117 markers into 11 diverse accessions to produce intraspecific crosses in the linkage groups. Additional maps were subsequently pub- greenhouse, a dense linkage map in the diploid species lished using Randomly Amplified Polymorphic DNA A. duranensis was produced using large numbers of (RAPD) [4] and Simple Sequence Repeats (SSRs) [5,6]. molecular markers derived from transcribed sequences. Burow et al. [7] published the first tetraploid map in peanut based on 370 RFLP loci across 23 link- Results and discussion age groups by utilizing the complex interspecific cross, Species relationships Florunner × 4x [A. batizocoi Krapov. and W.C. Gregory A preliminary study of SSR marker variation among 37 (A. cardenasii × A. diogoi Hoehne)]. Another interspeci- A. duranensis accessions using 556 markers indicated fic tetraploid linkage map of 298 loci and 21 linkage that the species is highly polymorphic at the molecular groups was derived from a backcross population be- level and individual accessions could be separated based tween A. hypogaea and a synthetic amphidiploid [8]. on a cluster analysis (Figure 1). Interestingly, we found Only recently have linkage maps been developed from that A. ipaensis, the proposed B-genome (BB) progenitor crosses between A. hypogaea genotypes, most with less species, clustered with the A-genome (AA) species Nagy et al. BMC Genomics 2012, 13:469 Page 3 of 11 http://www.biomedcentral.com/1471-2164/13/469

A. duranensis (AA)

PI468201 PI468319 PI468202 PI468203 Grif14248

PI468325

PI468328

PI468329

PI468326 PI468327 468322 A. batizocoi PI Grif15033 (BB) Grif7731 A. stenosperma PI591351 Grif15030 A. ipaensis Figure 1 Genetic relationships among A- and B-genome Arachis species. Clustering of A- (A. duranensis and A. stenosperma) and B- (A. ipaensis and A. batizocoi) genome species according to analysis of data from SSR markers. The two parents used for mapping are indicated by arrows.

A. stenosperma and not with the B-genome species A. (Guo Y et al: Comparative mapping in intraspecific popu- batizocoi. Recent molecular cytogenetic analysis of A- lations uncovers a high degree of macrosynteny between and non-A- (i.e., B-) genome species suggests that karyo- A-and B-genome diploid species of peanut, submitted). type diversity among non-A-genome species is extensive enough to support separation into additional genome Arachis duranensis genetic map classes where A. ipaensis remains in B sensu stricto while The total number of published SSR markers has now A. batizocoi is placed into a separate group [25]. There- risen beyond the 2,847 cataloged in a related paper by fore, A. batizocoi is less typical of B-genome species. Guo et al. (Guo Y et al: Comparative mapping in intras- The number of polymorphic SSR markers between pecific populations uncovers a high degree of macro- paired A. duranensis accessions ranged from 160 to 375 synteny between A-and B-genome diploid species of out of 556, which is 29 to 67% of the total number of peanut, submitted) to around 6,000 [26]. Those most SSR markers screened. This is a significant amount of recently reported include: 14 by Gimenes et al. [27]; 51 variation, which indicates the high genetic diversity by Mace et al. [28]; 188 by Proite et al. [29]; 104 by Cuc within the species. Based on cluster analysis, success of et al. [30]; 138 by Yuan et al. [31]; 33 by Song et al. [32]; crosses, and fertility of F1s, accessions PI 475887 and 123 by Wang et al. [33]; 290 by Liang et al. [34]; and Grif 15036 were selected for subsequent mapping stud- 1,571 by Koilkonda et al. [35]. Five hundred and ninety- ies using 94 F2 progenies. Screening of the parental eight of these markers are included in the A. duranensis accessions with 2,138 SSR markers derived from A. map (Figure 2). Of the 34 genomic SSR markers mapped hypogaea EST sequences resulted in 1,768 (82.7%) that in the current study (Table 1), 24 were mapped previ- were scorable (detected by ABI3730XL genotyping sys- ously in an interspecific population between A. duranen- tems) and 896 (41.9%) that were polymorphic (Guo Y et al: sis and A. stenosperma [6,36]. These markers served to Comparative mapping in intraspecific populations anchor and align the current and previously published uncovers a high degree of macrosynteny between A- and peanut maps (Figure 2). Linkage group assignments of B-genome diploid species of peanut, Submitted). The all markers were consistent between the current map same markers were used to create a map between and that of Bertioli et al. [36] except for the marker two A. batizocoi accessions and to determine syntenic GM117 (AC3C02 on map in reference 36 derived from relationships between the A and B genome species GenBank accession DQ099133) that was localized on Nagy et al. BMC Genomics 2012, 13:469 Page 4 of 11 http://www.biomedcentral.com/1471-2164/13/469

1A 2A 3A 4A 5A 6A 7A 8A 9A 10A

0.0 SNP545 SNP74 SNP197 0.6 GM2421 SNP37 SNP126 2.3 SNP362 8.2 SNP145 8.7 SNP997 9.8 GM1239 GM1073 9.9 GM2269 16.8 SNP967 17.1 SNP61 17.8 SNP184 24.1 GM1134 25.1 SNP998 0.0 SNP770 0.0 GM32#3 25.6 RGC206 RGC108b SNP1012 0.3 8.1 SNP712 26.6 RGC268 SNP1063 8.9 GM2599 0.0 SNP210 27.6 GM1628 5.2 SNP716 9.1 SNP927 GM2598 SNP23 SNP930 28.4 GM1320 0.0 SNP626 0.9 5.6 SNP370 SNP984 9.3 SNP125 GM2473 29.3 GM1575 0.0 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0 SNP26 SNP431 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 8.2 SNP1035 0.6 SNP261 30.0 SNP43 SNP340 9.4 GM2818 SNP732 0 1 2 3 1.1 9.3 GM24#1 30.4 GM1872 GM2845 9.7 SNP931 SNP142 SNP845 1.6 SNP60 SNP58 1.4 SNP508 SNP358* GM2001 12.8 GM1030 GM825 0.0 0.0 0.0 32.1 SNP840 0.0 0.0 12.1 GM2261 2.9 SNP768 2.2 SNP713 15.1 SNP25 2.1 SNP628 35.0 GM2055* 13.4 GM2372 4.0 GM2770 3.1 GM852 15.5 SNP850 3.2 SNP398* 35.8 GM1932 14.0 GM1760 5.6 SNP333 3.4 GM1633 16.0 SNP308 4.0 SNP395* 36.0 GM10#8 15.7 GM1149 6.0 GM2703 2.8 SNP999 4.0 GM2073 18.4 SNP415 4.7 GM2186* 3.5 SNP857 36.2 SNP740 17.3 SNP682* GM1609* 6.2 SNP493 SNP753 4.6 GM963 19.1 SNP717* 6.1 GM2232 3.9 GM1840 36.9 GM2758 4.7 SNP467 20.2 GM1191 6.7 RGC44 4.9 GM2146 20.8 SNP498 SNP979 6.2 SNP853* 4.6 SNP597 GM2147 38.5 SNP48 SNP287 5.3 GM1174 20.4 GM1425* 7.3 SNP974 5.0 5.5 GM950 22.9 GM1331 6.4 SNP522* 39.4 SNP298 6.6 SNP673 21.2 GM2764* SNP478* 9.5 SNP11 GM1898 5.3 SNP434 GM1373 23.5 SNP454 6.8 GM922* 6.6 GM2014 39.8 GM1961 7.0 SNP477 6.3 25.3 SNP164* 10.1 SNP989 6.5 SNP295 SNP556 GM1118b GM1761 7.0 GM1355* SNP416* 7.2 GM2057 SNP452 SNP775 SNP1034 7.4 GM1856 GM1835 8.4 GM2266 24.1 28.3 SNP832 11.8 SNP265 SNP936 6.8 SNP198 SNP403 41.3 GM2022 7.6 SNP820* 8.1 SNP306 SNP1048 7.9 SNP615 8.9 SNP107 GM2082 30.1 GM2087 12.4 GM1728 7.0 SNP77 SNP14 SNP146 8.4 SNP1068 9.2 SNP59 42.7 SNP251 SNP324 8.5 SNP256 9.0 GM951 25.4 SNP113* SNP335* 12.7 GM1253 10.1 SNP817 7.3 GM1621 SNP169 8.7 SNP249* 31.4 9.5 GM2091 43.1 SNP94 GM883 9.2 GM1562 SNP342* 13.7 GM1519 10.6 SNP1037 7.4 SNP585 26.5 SNP754 43.2 GM1844 10.1 GM2577 SNP551* SNP772* 31.5 SNP780* 15.6 SNP842 11.2 SNP596 7.8 SNP955 28.3 SNP78 SNP363 11.4 43.6 SNP159 11.3 SNP350 12.2 SNP372* GM1655* 32.7 SNP1045* 16.8 GM948 13.3 GM1521 SNP112 8.1 SNP1059 30.9 SNP873 SNP2 44.7 SNP1065 SNP304* SNP530* 12.6 SNP3* 33.9 SNP890* 12.4 SNP227 17.8 SNP291 GM1495 SNP27 8.6 12.6 SNP640 12.7 34.1 GM1504 45.3 GM2400 SNP614* SNP805* 35.4 SNP231* 18.0 GM1261 13.8 SNP102 SNP344 8.8 GM2177 34.6 SNP797 45.8 SNP22 12.9 GM810* 36.6 SNP491* 18.5 SNP869 SNP888 9.5 SNP20 GM1929 36.3 GM2568* 14.8 GM1120 46.1 GM1744 14.6 SNP516* 37.5 SNP632* 19.6 SNP664 14.2 GM1682* SNP24 SNP1020 37.1 SNP514 GM1132 15.4 GM817* 15.9 SNP822 11.5 46.6 SNP393 37.9 GM1266* 20.6 GM2793* GM1250 37.3 SNP1067 15.8 GM2838* 16.5 SNP458 GM1175 47.2 SNP209 GM2101 38.0 GM2407* 23.8 GM1119 16.7 SNP518 12.3 16.3 SNP321 38.7 SNP73* 16.7 SNP881 48.1 SNP475 SNP34* SNP813* 24.2 SNP252 GM1118a 17.3 SNP544 SNP357 SNP588 39.7 GM1208* 17.6 SNP852* 38.1 12.6 SNP684 SNP925 18.0 SNP157 GM1107 SNP1008* 25.4 SNP622 SNP759 GM1940 SNP782 GM1140 48.4 40.8 SNP555 18.1 RGC193* 18.0 SNP1028 SNP527 SNP828 38.3 GM1360* RGC146b 26.0 SNP804 13.6 GM2454 18.7 41.0 SNP565 48.7 GM1136 SNP838 SNP186* SNP314* 26.4 SNP699 19.4 SNP131 14.4 GM1785 21.7 GM2438 41.4 GM2603 49.0 SNP360 GM58 19.5 SNP994 39.1 SNP904* RGC72a* 27.7 SNP816 15.1 SNP589 GM1600* GM324#9* 42.2 SNP546 20.7 SNP53* SNP519 GM2050 49.3 GM1965 23.7 20.7 RGC33 GM2693* GM2694* 28.3 SNP325 24.5 GM226 15.4 SNP441* 44.0 SNP629 SNP785 GM2156 49.4 GM1165 21.2 GM2316 SNP31* SNP137* 31.7 SNP379 25.4 GM1567 15.5 24.3 SNP599* SNP1017* 44.5 SNP636 GM2199 49.6 SNP208 21.9 SNP1004 22.9 SNP405* 39.9 SNP534* SNP552* 32.4 SNP617 26.9 SNP39 SNP286 15.6 SNP887* GM2120* 45.0 GM2024 SNP564 49.7 SNP443 24.7 23.0 SNP147 GM1733* RGC17b* 36.3 GM1317* 31.2 SNP920 16.5 GM1338* 45.6 SNP367 GM1942 SNP248 SNP501 24.1 RGC1 24.4 GM2808* 40.2 SNP194* 37.0 SNP559 SNP767 32.8 GM1548 16.7 50.1 27.0 GM1237* 46.0 GM1423 SNP566* GM2230* 16.8 GM1494 SNP830 28.2 SNP149* SNP774* 25.5 GM1836* 40.8 38.2 SNP750 33.8 SNP76 25.5 GM1561 46.4 SNP484 GM2524* 16.9 SNP381 50.6 SNP368 SNP948* 25.9 GM2098* 26.0 GM2010 38.3 GM1154 34.1 GM1547 28.7 SNP254 SNP404 46.6 GM1483 SNP634 50.8 GM741 25.9 SNP222* SNP792* SNP191 SNP691 34.5 SNP898 SNP450 17.3 SNP577* GM1952* SNP510 GM2173 SNP278 27.2 SNP427* GM1910* 39.5 GM1632 50.9 SNP659 28.9 46.7 41.4 RGC177* RGC170* GM1313 35.1 SNP950 17.8 GM1876* SNP678 SNP988 28.0 SNP97 SNP235 51.2 SNP598 SNP755 RGC70b* RGC182* SNP54 17.9 SNP469 SNP364* SNP437* 47.1 SNP271 SNP471 40.1 GM2170 SNP497 SNP361 SNP613 30.0 29.4 GM2814* 42.0 RGC249 RGC220 29.1 GM1528 SNP161 SNP162 36.1 SNP517 SNP929 18.6 GM1111 51.5 SNP521* 48.1 GM2153 SNP33 SNP1085 29.6 GM2121* 42.3 GM2467* 29.7 SNP225 40.8 SNP182 SNP504 37.1 GM1286 19.2 30.5 SNP385* SNP439* 48.7 GM2233 43.5 SNP328* 20.7 GM1114 51.6 GM2182 GM1559* SNP65* 30.8 SNP746 GM1163 SNP313 SNP563 GM2771 38.9 SNP726 33.3 49.0 GM2607 44.9 SNP601* 31.5 20.9 GM846 51.8 SNP937 GM1650* 31.2 GM1624 SNP976 SNP170 SNP702 41.1 SNP1033 49.3 GM170#1 45.8 RGC140b 42.6 21.2 GM1688 52.7 SNP758 34.4 SNP975* GM1732* 31.7 GM2041 32.6 GM76#4 SNP964 42.4 GM1385 49.5 SNP1013 46.3 GM1656* 21.7 SNP481 SNP1022 SNP1061 36.2 SNP378* SNP571 44.2 GM2663 44.8 GM1968 SNP394 52.8 49.6 GM917 33.6 GM2257* 33.1 GM2588 GM1092 46.7 GM1487* SNP165* 45.0 SNP757 SNP1019 45.7 SNP1007 21.9 36.6 GM1893* 49.7 GM2015 34.7 GM1647 GM1023 53.0 GM2125 34.1 SNP158 47.0 SNP447* SNP856* 46.6 GM2662 46.2 GM2844 22.0 SNP218* SNP226* 49.9 GM1171 35.5 GM1466 GM1623 53.1 SNP319 SNP637 36.7 35.5 SNP745* 47.7 GM828 SNP737 SNP844 47.3 SNP128 22.6 SNP919* SNP1009* 50.0 GM890 GM2597 35.6 GM2108 47.0 54.1 SNP166 SNP259 36.1 SNP656* 49.5 GM2206* GM1987 SNP408* SNP123* 22.9 SNP608 37.1 SNP346* 37.0 SNP879 SNP19 SNP70 49.1 54.2 GM2787 49.6 GM2364* 47.6 GM1332 SNP331* 23.1 SNP595 SNP837 37.5 SNP679* 37.2 GM1764 SNP79 SNP104 55.0 GM2089 50.0 SNP660* 37.9 SNP91 SNP620 48.7 GM2092 SNP911 SNP9 23.5 SNP397 38.0 SNP356* 39.6 GM2140 SNP110 SNP122 38.0 SNP178 50.3 55.6 SNP132* 51.2 GM2352* 49.0 SNP134 SNP718 23.9 SNP217 SNP455 39.0 SNP525* 40.7 GM2029 SNP127 SNP242 SNP882 56.1 GM1281 39.2 SNP106 SNP918 51.7 GM2184 39.7 SNP778 GM1445 49.8 GM2031 50.7 SNP752 SNP311 24.4 39.6 SNP630* 41.3 SNP541 SNP258 SNP351 56.3 GM2144 40.8 SNP662* 52.1 GM2274 40.3 SNP337 50.2 SNP201 51.3 SNP864 24.7 GM2222 41.5 SNP47* 43.2 GM2058 SNP388 SNP460 56.4 GM2551 41.0 GM2111 52.6 SNP917 41.7 SNP503 GM2043 GM2063 25.4 SNP339 SNP1026 42.0 GM1796* 44.2 GM926 SNP466 SNP523 50.7 51.7 SNP18 SNP359 41.1 GM1668 53.0 SNP653 42.9 GM2448 GM874 SNP956 SNP267 25.8 SNP707 42.3 GM66* 45.3 GM927 50.1 SNP536 SNP665 51.0 52.6 GM2842 GM1613 54.0 GM774 43.3 GM1738 GM996 SNP1025 26.7 GM1858 43.2 SNP860* 47.2 SNP603 SNP846 SNP848 42.9 SNP421* 52.8 SNP607 56.6 SNP535 SNP910 SNP330 SNP894 43.4 SNP1014 51.5 SNP1030 27.1 SNP485 SNP296* SNP413* 47.3 GM1195 SNP861 SNP893 43.5 GS110* SNP384* 54.6 53.3 SNP417 GM2788 GM1566 43.8 SNP472 52.9 GM1049 54.5 GM664 GM959 27.3 SNP946 SNP959 43.7 SNP482* SNP711* 48.1 GM2303 SNP901 SNP947 44.6 RGC233* GM1076 57.3 GM1709 54.9 GM1034 44.3 GM839 SNP144 SNP654 54.9 GM1505 SNP694 28.1 RGC144b* 49.0 SNP230 GM22#1 GM1649 53.1 57.6 SNP401 56.5 SNP377* 45.1 SNP302 SNP742 GM2820 SNP971 28.7 GM1451 SNP84* SNP111* 50.3 GM2722 GM1992 GM2527 46.8 SNP320* 55.2 57.7 GM1201 57.1 SNP939 45.9 GM1173 GM1892 GM2701 29.0 SNP592 44.2 SNP402* SNP465* 50.4 SNP121 GM1233 GM1972 48.1 SNP962* 53.2 55.9 SNP315 SNP657 57.2 GM898 53.4 GM2078 GM1185 SNP418 29.3 SNP479 57.8 SNP1057* 51.3 GM1868 GM2287 49.0 RGC236 56.1 SNP798 57.7 SNP540 53.5 GM1257 GM92#6 29.4 GM2034 44.8 SNP952* 51.8 GM1481 50.2 GM1048 49.1 SNP228* SNP968* 48.3 GM1867* 57.9 GM2832 58.6 GM1618* 53.6 SNP135 57.1 GM2702 30.4 SNP611 SNP672* SNP762* 52.6 SNP724 50.3 GM672 49.6 SNP872 58.1 GM2643 GM1001 45.4 SNP167 SNP823 GM68#5 SNP72 SNP449 GM2423 SNP114 SNP1043* SNP57 SNP376 50.5 GM824 49.8 GM126#2 59.1 58.1 58.4 SNP206 53.1 GM1473 50.8 SNP438 SNP86 SNP207 GM988 SNP138 SNP196 46.5 SNP446* SNP715 SNP1006 50.8 GM286#1 50.7 SNP407 SNP670 58.2 30.9 59.6 GM1798 59.4 SNP69 51.7 SNP277 SNP554 SNP810 SNP301 GM1651 47.1 SNP871* 53.4 SNP303 51.0 GM1777 51.3 SNP729 53.7 58.3 SNP1023 SNP115 SNP245 SNP30* SNP285* 51.9 SNP986 SNP818 SNP859 GM2326 48.3 GM2164* 53.8 SNP781 51.7 SNP396 SNP899 SNP12 SNP499 59.7 GM1461 SNP155 60.0 SNP826 51.4 SNP809* GM1763* 52.8 SNP270 SNP862 SNP1000 SNP352 SNP459 31.1 GM1922 48.9 GM1069* SNP99 SNP426 52.8 GM2840 GM2474 58.4 60.4 GM2644 60.5 GM19#3* 53.1 SNP269 SNP831 53.8 GM1577 SNP480 SNP539 GM1937 SNP200 49.9 SNP28* 54.4 SNP506 SNP731 SNP16 SNP216 51.9 SNP420 32.0 61.3 GM2640 60.7 SNP241* SNP500* GM1565 SNP814* 54.4 GM2160 SNP575 SNP1032 SNP688 SNP985 51.2 SNP1052* SNP996 53.2 SNP316 SNP332 52.5 SNP180 SNP883 55.4 61.6 SNP965 61.0 GM2008 SNP1015* GM2246* 54.8 GM1482 GM1035 SNP1 32.1 GM1315 51.5 SNP38* SNP616* SNP788 GM1243 SNP647 GM1065 53.0 SNP643 62.1 GM1903a 55.1 61.2 SNP926 57.2 GM1021* GM1955 SNP562 SNP44 SNP136 GM1829 SNP318 51.9 SNP708* SNP787* GM2320 53.6 SNP1046 GM1353 53.2 RGC141 54.9 32.2 62.5 SNP619 61.8 GM1583 57.5 GM1720* SNP847 SNP179 SNP224 SNP520 SNP791 52.3 GM2172* 55.6 SNP709 53.9 SNP604 53.5 SNP90 62.6 SNP633 62.1 RGC18b* 57.8 GM1755 GM1967 SNP310 SNP557 SNP260 SNP655 GM2839* SNP96* 55.9 SNP590 54.3 SNP55 SNP10 SNP168 55.0 32.7 SNP1100 SNP214 62.6 GM1500 57.9 GM1296* SNP108 SNP538 SNP578 SNP642 SNP710 52.6 SNP733* SNP827* 56.3 GM2383 54.5 SNP232 SNP185 SNP272 56.1 59.1 62.9 GM1240 GM1053* SNP572* 58.0 GM2589* GM16#5 SNP705 SNP793 SNP375 SNP568 GM2359* 56.7 SNP829 55.1 SNP779 GM1330 SNP494 SNP505 63.0 57.1 33.0 RGC244 RGC219 GM2449 58.2 SNP268* SNP761 SNP821 SNP876 SNP870 53.2 GM1911* 56.8 SNP250 56.0 GS22b 53.7 SNP570 SNP734 57.6 63.3 GM1629 SNP583 SNP605 SNP329* SNP468* 58.2 SNP211 SNP1049 GM1096 34.6 GM1477 SNP338* SNP701* 57.3 GM1341 SNP747 GM1339 SNP756 SNP1003 63.7 GM1901 56.9 63.4 SNP777 SNP783 SNP909* GM218* GM28#5 GM1962 GM1896 36.9 GM59#7* 53.7 SNP851* SNP934* 57.6 GM2040 GM933 GM2455 GM1516 58.4 58.7 SNP663 SNP1064 SNP943 SNP1040* SNP1062* 58.8 SNP139 SNP212 GM83 37.3 SNP766* SNP1044* SNP1050* 57.9 GM2084 57.3 SNP95 GM1503 59.3 63.9 GM1905 GM1934 64.1 SNP1018 SNP1073* 59.0 SNP80 SNP625 SNP238 38.4 GM1219* GM2747* SNP972* GM1979* 58.2 GM2207 57.8 SNP412 SNP692 53.9 GM1075 59.4 GM2339 54.5 64.4 GM783 58.6 SNP470* GM2813* 60.0 SNP411 SNP624 39.6 SNP192* GM2792b* GM1834* 58.4 GM1563 58.0 GM1444 54.2 SNP433 SNP880 64.4 GM2312 65.0 GM2586 SNP811 58.9 GM1887* 60.4 GM1018 59.9 SNP1027 40.7 SNP369* 55.1 GM2778* 58.5 GM784 58.8 GM2724 54.5 SNP587 SNP586* SNP1036* 64.6 SNP892 65.6 SNP661 59.3 GM1959* 61.3 GM2347 60.1 GM2366* SNP41* 41.0 55.5 GM565* GM2582 GM1322 SNP808 SNP981 54.9 SNP190 SNP366* SNP771* SNP116 SNP266 59.1 66.6 SNP896* 59.8 GM2311* 63.0 SNP156 SNP680 60.8 SNP67 43.2 55.6 SNP429* GM328#9* SNP109 SNP119 GM1950 55.3 SNP863 64.9 SNP334 SNP365 67.6 SNP283 GM2402 60.8 SNP983* SNP812 SNP958 GM2306 44.3 SNP932* 55.7 GM2847* SNP202 SNP380 59.5 SNP515 55.5 GM2491 63.5 61.4 SNP877 GM2600 69.4 GM1645 62.1 GM2572* 63.8 GM1890 GM2429 SNP511 46.5 GM2494 SNP68* SNP85* SNP486 SNP651 59.7 GM2390 56.2 GM1598 61.9 65.1 SNP473 SNP849 58.6 71.7 SNP686* 62.9 GM2006* SNP66 SNP205 62.3 GM1909 48.9 GM1701 55.9 SNP92* GM2553* SNP683 SNP695 60.2 GM1879 56.7 GM1386 64.1 65.5 GM1839 71.8 SNP905 SNP689* SNP693* SNP720 SNP941 SNP464 RGC53a 51.2 SNP841 GM2292* SNP865 SNP922 60.4 SNP213 SNP280 57.2 SNP348 63.3 62.5 66.0 GM2601 75.5 GM1659a SNP889* 64.7 GM1218 GM2487 RGC53b 52.5 SNP549 56.2 SNP735* SNP993 GM1303 SNP148 GM2783 59.6 SNP602* 66.3 GM1936 76.4 SNP524* 64.0 SNP1002* 64.8 SNP82 SNP728 55.2 SNP795 56.6 GM1851* GM117#2 GM2349 GM1913 62.6 SNP1010 63.2 66.9 GM1831 77.4 GM1681* 64.4 GM1465* SNP237 GM2672 GM1617 55.6 GM802 GM1411* SNP5* 58.7 GM1526 GM1933 SNP866 SNP487 63.7 SNP177 65.9 63.6 SNP81 SNP221 60.6 77.9 GM1443* 64.7 GM1995* GM1070* GM2673 GM1782 SNP681 58.6 SNP940* 67.3 SNP567* SNP978* 58.8 SNP532 SNP399 SNP373 64.2 SNP101 66.2 64.3 SNP476 56.7 GM1369* SNP263* 65.2 SNP921* 69.1 GM2137 RGC93b 59.2 SNP343* GM2003* GM2389* 59.1 GM1875 SNP355 SNP236 64.7 SNP293 78.3 65.4 67.4 GM2176 SNP435* SNP387* SNP582* SNP392 62.3 SNP784* GM1853* GM2843* SNP234 SNP257 SNP50 66.1 GM2496 65.6 69.3 66.4 GM1748 SNP924 GM2665 SNP46* SNP223* GM1805* SNP129 GM2231 64.3 GM69#7* 57.3 GM1291* SNP627 SNP749 60.7 GM1771 SNP867 GM1714 69.4 66.5 SNP789 67.6 GM2664 59.6 66.5 SNP317* SNP354* 66.0 SNP430* 69.5 GM2769 GM900 67.3 SNP275 SNP650 57.9 SNP36* SNP685* GM2104 GM1460 60.8 GM2350 GM2797 67.0 67.9 GM1917 SNP383* SNP425* 66.3 SNP453* SNP836* 69.7 GM1788 SNP400 70.2 GS3b 58.4 SNP422* SNP739* GM1172 60.9 SNP558 67.7 SNP391 67.8 68.2 GM1189 SNP436* SNP445* 66.7 GM916* 70.5 GM1227 SNP969 GM2425 71.3 GM1214 SNP154* SNP874* 59.8 SNP409 61.0 GM1501 72.8 GM1946 78.5 68.4 68.7 GM1509 59.5 SNP513* SNP561* 67.0 SNP172* 70.6 SNP89 SNP322 74.9 SNP641 SNP951* 60.1 GM1581 GM1542 SNP462 72.9 SNP424 68.9 GM2827 61.1 SNP666* SNP885* SNP638* SNP1060* 70.8 SNP171 SNP569 SNP461 75.5 SNP389 59.7 SNP953* 60.3 SNP243 GM1599 75.3 GM2047 67.4 68.9 69.0 GM2564 GM1797 SNP949* SNP980* GM1186* GM1643* GM1228 77.2 GM980 59.9 GM1841* 60.7 SNP133 61.4 GM2418 77.9 GM1852 71.1 69.6 SNP573 SNP419 SNP769 GM1502* GM1717* 67.5 RGC89 SNP579 SNP187 78.0 SNP835 69.2 SNP790* GM7#9* 61.2 GM2348 GM1408 61.5 GM2132 78.6 SNP574 71.2 69.7 GM2712 GM2713 78.6 GM2215* SNP593* GM1167* 71.3 GM1878 SNP215 78.4 GM1347 60.2 GM1998* GM1999* 62.3 SNP677 61.9 GM1871 79.6 GM1724 67.7 70.0 69.6 SNP913 78.8 SNP56* GM96* 71.5 GM2017 70.1 GM1572 SNP803 GM1348 GM1047* 63.3 SNP240 62.2 GM2004 79.7 GM1160 78.5 GM2526 69.9 GM71#8 79.1 GM2556* SNP698* 68.0 GM2142* 73.2 GM1843 70.3 SNP195 SNP151 60.4 SNP100* SNP150* 63.6 GM1453 62.3 SNP189 81.3 RGC5b 70.2 GM1659b 79.4 SNP327* SNP349* 68.7 GM1013* 74.5 SNP580 SNP730 SNP51 79.0 SNP1016 61.0 SNP609* 64.2 GM2531 62.7 GM1684 81.8 GM2500 71.1 70.7 GM1713 79.6 SNP690 SNP935* SNP960* 76.7 GM1778 GM2817 79.6 GM840 62.4 GM2033* SNP606 SNP658 63.1 GM2061 GM733 SNP799 69.4 71.5 GM1238 64.7 83.1 80.1 SNP262* SNP895* SNP1024* GM2482* 76.8 SNP253* SNP902* GM255#6 80.6 GM953 63.4 S197* SNP802 63.7 SNP1056 GM2016 71.7 71.7 SNP502 SNP560 80.6 SNP631 70.2 GM2480* 77.4 SNP282* GM1293* 72.3 SNP1058 82.3 SNP274 65.8 SNP6* 65.4 SNP649 64.5 SNP307 84.5 SNP807 71.8 SNP140 81.6 GM1249* 70.8 SNP336* SNP220* 66.2 SNP141* 65.7 GM1527 67.3 SNP736 86.4 SNP594 77.9 72.8 SNP239 SNP374 83.1 SNP990 71.2 RGC205* GM1554* 72.6 67.3 SNP13* SNP550* 67.0 GM2283 71.0 SNP386 GM2653 SNP646 79.8 SNP130* 73.5 GM847 86.9 83.9 SNP233 GM162* SNP45* 73.8 GM2417 70.0 SNP875* 69.1 SNP618 SNP923 73.2 SNP229 SNP288 80.5 SNP723* 74.3 GM1498 88.1 SNP300 SNP423 SNP93* SNP183* SNP432 SNP474 70.3 SNP124* 70.8 SNP488 73.8 SNP744 GM1819 84.6 81.1 SNP957* 75.2 SNP312 74.4 88.9 SNP542 71.7 SNP495* SNP982* SNP891 GS43b 70.6 SNP977* 71.8 GM2148 74.0 GM2053 82.7 SNP63* SNP903* 75.8 SNP509 85.0 GM2772 GM1726 GM1190* 74.8 SNP174 SNP1054 SNP49* SNP292* 72.0 SNP105 SNP1029 74.4 GM1573 90.9 SNP806 83.3 SNP29* SNP40* 77.0 SNP721 73.0 SNP163 SNP440 GM1143 75.2 SNP963 SNP584* SNP674* 76.0 SNP244 SNP933 75.9 SNP52 72.0 83.9 SNP199* SNP289* 77.2 GM2446 85.7 SNP833 GM2051 GM1907* 75.5 GM1957 73.3 SNP621* 78.6 SNP444 76.3 GM38#1 72.4 84.4 GM944* SNP991 SNP273 SNP1111 SNP451* SNP938* 75.7 GM1587 73.8 GS20a* 79.7 SNP528 76.7 SNP706 73.8 84.8 GM1902* SNP299 SNP490 93.8 GM1930 86.2 GM1883 GM1919* 77.7 77.3 GM2099 78.2 SNP794* 80.6 GM2218 77.1 SNP345 74.9 88.9 SNP117 SNP553 SNP834 88.4 SNP531 GM1679* 79.8 SNP21* 80.7 SNP703 79.7 GM1275 GM1620 75.9 91.0 SNP71 GM1912 SNP858 SNP995 89.3 SNP1001* GM1594* 83.0 GM1803* 81.5 SNP193 80.3 SNP610 GM1277 77.0 91.1 GM1816 80.1 SNP1041 SNP203* 96.3 SNP897 91.7 SNP32* SNP623* 79.0 SNP279* 91.7 GM1904 80.7 SNP907 GM2109* 86.0 RGC63* 82.4 SNP669 SNP160 SNP868 93.4 SNP645 87.7 SNP722* 83.3 GM1520c 81.8 SNP1042 GM1085 80.2 SNP323* 94.2 SNP83 SNP652 83.2 GM2110 95.0 GM2416 GM1298* 89.2 GM2529* SNP581 SNP878 83.8 GM2344* 81.0 95.9 SNP64 83.5 SNP75 SNP906 SNP908 GM1729* 89.3 SNP533* GM1459 83.4 GM1886 GM1520a 87.1 GM1750 95.9 81.5 96.5 SNP35 85.0 SNP456 GM2027 GM1223* SNP884* SNP1055* GM1520b 88.5 SNP188 SNP489 82.6 97.1 RGC279 86.8 SNP281 SNP635 91.1 97.0 GM743 GM2236* GM1117* 83.8 SNP297 89.5 SNP1011 83.2 89.6 GM2414* 100.7 SNP687 98.7 SNP801 SNP704* 93.0 GM1329* 91.6 SNP548 GM857 91.4 GM1612 85.8 92.6 SNP246* SNP796* 99.1 SNP17 SNP600 SNP284 94.1 GM1312* 96.7 SNP671 96.8 SNP928* 87.5 93.1 SNP1053 SNP727* 101.1 GM2419 90.2 SNP714* GM13#4* 93.6 GM2337 94.2 GM1607* 97.3 SNP547 103.7 GM1865 101.9 SNP204 SNP543 91.1 GM2583* 94.2 GM2767 95.0 SNP1109* 99.0 SNP173 SNP1021 103.9 SNP88 102.4 GM2528 94.5 GM942* SNP143 SNP1047 97.4 SNP276* SNP748* 100.2 SNP406 SNP390 SNP463 95.3 GM955 95.9 SNP152 97.8 SNP457* 103.8 SNP98 102.7 GM1108 GM1885 96.8 GM1062 SNP676 SNP900 99.4 SNP738 GM1199* 98.0 GM2069* 97.8 SNP944* SNP942 100.5 GM2081 GM1389 103.0 SNP371 SNP576 SNP824* 101.0 SNP305* 98.9 107.8 SNP410 99.1 GM2066 103.3 GM866 SNP4 104.6 SNP1110* 99.9 108.3 SNP294 99.3 GM1490 108.4 GM2166 103.8 SNP103 SNP644 100.4 SNP442* 100.4 GM1497 106.5 SNP537* 104.0 SNP1031* 101.0 SNP954* 100.9 SNP700 SNP916 110.2 SNP815 GM2032 104.2 SNP945* 101.3 SNP825 SNP1039 111.7 SNP1066* 101.5 105.1 GM2765 102.0 GM1817 112.0 GM1702* 104.8 SNP118 111.4 SNP696 108.4 GM1084* 102.9 GM735* GM1162 SNP62* 105.3 GM1506 109.3 SNP176 106.3 GM1963* 112.1 109.8 SNP915* SNP7* SNP886* GM1944* 110.0 109.1 SNP1005 GM2792a* 112.0 GM1045 110.4 GM714 112.9 GM2755* 111.4 SNP264 SNP290 GM2021 116.4 GM1352* 112.0 SNP496 115.8 GM2020 114.5 GM1326* 116.3 SNP855* SNP970* 116.9 SNP776* 118.7 SNP819* 119.3 SNP153* 119.8 GM1954* SNP219* SNP353* 120.5 SNP675* SNP773* 121.7 GM1321* 122.3 GM1652* GM2228* SNP255* 122.9 SNP326* SNP483* SNP839* 124.6 GM2103* 124.7 GM2805* SNP507* SNP529* 124.8 SNP639* SNP966* GM1213* 125.2 GM1591* 131.7 SNP42* 126.5 SNP912* SNP961* 127.1 GM1536* 127.6 SNP800* 127.7 GM74#3* 128.8 SNP741* 129.4 SNP725* 129.8 SNP668* SNP743* 130.5 GM2302* 131.2 GM2301* 132.1 SNP87* 132.6 SNP120* SNP1051* 133.2 SNP763* 136.0 SNP591* 137.4 SNP341* SNP347* SNP15* SNP612* 138.4 SNP914* GM1263* 138.6 SNP1038* 138.9 SNP8* SNP719* 139.9 GM1854 140.8 SNP492* 141.1 SNP786 141.8 SNP175 143.5 SNP526* 145.6 GM2757 Figure 2 High-density linkage map of Arachis duranensis including 1,724 markers. SNP and SSR markers are prefixed by ‘SNP’ and ‘GM’, respectively, resistance gene candidate markers are prefixed by ‘RGC’ and ‘GS’. Twenty-four previously published markers (underlined) were selected from an interspecific map between A. duranensis and A. stenosperma [36] to establish synteny between the current and former linkage groups. The original linkage group assignments are given in the marker names separated by the pound (#) sign. Loci with significant segregation distortion (p = 0.05) are labeled with an asterisk. Graphs to the right of the linkage groups represent recombination frequencies. Each data point represents genetic distances between adjacent markers averaged for a window of 20 markers. chromosome 2A (the ‘A’ following a chromosome num- The A. duranensis map produced in this study con- ber is presented in this study to represent chromosomes tained 1,724 markers combined into 10 linkage groups in the A genome of peanut) in their interspecific map, with a total genetic distance of 1081.3 cM. MSTMap, a while mapping to chromosome 10A in the A. duranensis software program that accommodates large numbers of intraspecific map. Although detailed information for par- markers and utilizes a “minimum spanning tree” algo- ental alleles in the study by Bertioli et al. [36] was not rithm, was used to construct an initial genetic map using presented, GM117 amplified only one locus from each only the codominant markers. The 1,673 codominant parent in both their population and ours. It is, therefore, markers were distributed into 810 co-segregating groups unlikely that the marker location discrepancy was due to (bins). Although this program has been reported to mapping of multiple loci and perhaps could reflect a be accurate for large-scale mapping projects [38], few small chromosomal rearrangement. Chromosomal rear- independent studies are available establishing consistency rangements are not unexpected based on previous cyto- between MSTMap and other commonly used mapping logical observations in the genus [24,37]. software [39]. To confirm the linkage group assignments, EST libraries of A. duranensis were developed to pro- marker orders, and genetic distances determined by alter- duce Single Nucleotide Polymorphism (SNP) markers native software, both codominant and dominant markers for mapping (Table 2). Of the 1,536 SNP markers devel- were mapped with Joinmap 3.0. Marker orders and gen- oped (Additional file 1), 1,054 were included in the etic distances were highly consistent between MSTMap A. duranensis map (Figure 2). The remaining 482 SNP and Joinmap 3.0 (Additional file 2). markers were either of low quality (GC quality score Significant segregation distortion (p = 0.05) was <0.25) or they showed segregation patterns (extremely observed for 513 (29.8%) markers (Figure 2, Additional distorted) that could not be mapped. Of the 1,054 file 3). Chromosomes 4A and 9A carried particularly mapped SNP markers, 815 were derived from the cDNA long segments of distorted segregation suggesting large- sequencing project while the other 239 were genomic scale chromosomal selection in these regions. Guo et al. legume orthologs. (Guo Y et al: Comparative mapping in intraspecific Nagy et al. BMC Genomics 2012, 13:469 Page 5 of 11 http://www.biomedcentral.com/1471-2164/13/469

Table 1 Previously published genomic SSR markers mapped in Arachis duranensis Universal Name Original Name Forward (50-30) Reverse (50-30) Reference GM7 Ah1TC1D02 GATCCAAAATCTCGCCTTGA GCTGCTCTGCACAACAAGAA Moretzsohn et al. 2005 GM10 Ah1TC1E05 GAAGGATAAGCAATCGTCCA GGATGGGATTGAACATTTGG Moretzsohn et al. 2005 GM13 Ah1TC1H04 CATTACTTCCTAGGTTTGTTTTCCA ATGGCGTGACAACGGAAC Moretzsohn et al. 2005 GM16 Ah1TC2B01 TTGCAGAAAAGGCAGAGACA GAAAGAAGCTAAGAAGGACCCATA Moretzsohn et al. 2005 GM19 Ah1TC2C07 CACCACACTCCCAAGGTTTT TCAAGAACGGCTCCAGAGTT Moretzsohn et al. 2005 GM22 Ah1TC2D06 AGGGGGAGTCAAAGGAAAGA TCACGATCCCTTCTCCTTCA Moretzsohn et al. 2005 GM24 Ah1TC2E05 GAATTTATAAGGCGTGGCGA CCATCCCTTCTTCCTTCACA Moretzsohn et al. 2005 GM28 Ah1TC3A12 GCCCATATCAAGCTCCAAAA TAGCCAGCGAAGGACTCAAT Moretzsohn et al. 2005 GM32 Ah1TC3E02 TGAAAGATAGGTTTCGGTGGA CAAACCGAAGGAGGAACTTG Moretzsohn et al. 2005 GM38 Ah1TC3H02 CTCTCCGCCATCCATGTAAT ATGGTGAGCTCGACGCTAGT Moretzsohn et al. 2005 GM58 Ah1TC4G06 ATTTCACATTCCCTAGCCCC CATCGACTGACTTGAAAAATGG Moretzsohn et al. 2005 GM59 Ah1TC4G10 TTCGGTCATGTTTGTCCAGA CTCGAGTGCTCACCCTTCAT Moretzsohn et al. 2005 GM66 Ah1TC5D06 GAAATTTTAGTTTTCAGCACAGCA TTTTCCCCTCTTAAATTTTCTCG Moretzsohn et al. 2005 GM68 Ah1TC6E01 CTCCCTCGCTTCCTCTTTCT ACGCATTAACCACACACCAA Moretzsohn et al. 2005 GM69 Ah1TC6G09 GGAGGTTGCATGCATCATAGT TCATTGAACGTATTTGAAAGCTC Moretzsohn et al. 2005 GM71 Ah2TC7A02 CGAAAACGACACTATGAAACTGC CCTTGGCTTACACGACTTCCT Moretzsohn et al. 2005 GM74 Ah2TC7E04 GAAGGACCCCATCTATTCAAA TCCGATTTCTCTCTCTCTCTCTC Moretzsohn et al. 2005 GM76 Ah2TC7G10 AATGGGGTTCACAAGAGAGAGA CCAGCCATGCACTCATAGAATA Moretzsohn et al. 2005 GM83 Ah2TC9C06 CAAATGGCAGAGTGCGTCTA CCCTCCTGACTGGGTCCT Moretzsohn et al. 2005 GM92 Ah2TC11A04 ACTCTGCATGGATGGCTACAG CATGTTCGGTTTCAAGTCTCAA Moretzsohn et al. 2005 GM96 Ah2TC11C06 TCCAACAAACCCTCTCTCTCT GAACAAGGAAGCGAAAAGAA Moretzsohn et al. 2005 GM117 Ah2AC3C02 TCTAACGCACACAAATCGAA CTTGTACCTGCGCCATTCT Moretzsohn et al. 2005 GM126 AS1RI1F06 TGTCTCTCTTCCTTTCCTTGCT CCTTTTGCTTCTTTGCTTCC Moretzsohn et al. 2005 GM162 AS1RN9C02 CGTTACACTGAGCCAGCAACTC ACGGCGGCGATAGTTTCA Moretzsohn et al. 2005 GM170 AS1RN11E05 CTCGGTCCAGAAAACACAGG GTAGAGGCGAAGAAGGCAGAG Moretzsohn et al. 2005 GM218 gi-30419832 GCCACTTTATTCTAAGCACTCC AAGAGACCACACGCTCACA Moretzsohn et al. 2005 GM226 gi-30419936 TCACAGATCCATAGACTTTAACATAGC CCGGTGTGGATTCATAGTAGAG Moretzsohn et al. 2005 GM255 pPGPSeq4H6 CCAACATTGCAGAAGCAAGA CAAAGAGAGGCACACCACAA Moretzsohn et al. 2005 GM286 Ah-193 CTTGCTGAAGGCAACTCCTACG TCGGTTTGTCTCTTTGGTCACTC Moretzsohn et al. 2004 GM324 Ah-649 GGAAATGCCAAATCCATCCTTC GTTGTTCGGTGTGAAAACGGTC Moretzsohn et al. 2004 GM328 Ah-671 AGAAAGAGCACGGGACATTACC ATGAATGAGTGGTCATACGCGA Moretzsohn et al. 2004 GM565 pPGSseq17E3 TTTCCTTTCAACCCTTCGTG AATGAGACCAGCCAAAATGC Ferguson et al. 2004 GM664 GM664 CTTCACCTCCAAAATCAACCA ACCGCTGACATTTGATTGTTC Guo et al. 2011 GM671 GM671 TGGATGCTGTAAGGAATGGAC TTATCGAGCTTGCCTCAGAAA Guo et al. 2011 Markers were renamed in order to follow a unified marker nomenclature. The complete list of renamed markers can be found in Guo et al. (Guo Y et al: Comparative mapping in intraspecific populations uncovers a high degree of macrosynteny between A-and B-genome diploid species of peanut, Submitted). populations uncovers a high degree of macrosynteny be- increased toward the telomeres, a pattern typical of many tween A-and B-genome diploid species of peanut, Sub- plant species [40,41]. More even distribution was mitted) found that a single linkage group (4/9B) in A. observed along chromosome 3A and only slightly sup- batizocoi was syntenic with chromosomes 4A and 9A of pressed recombination was observed around the presum- A. duranensis implicating inversion and reciprocal able location of the centromere (Figure 2). translocation events as the underlying chromosomal Across the A. duranensis linkage map, each linkage rearrangements in this B-genome species. Recombination group spanned on average 108.1 cM (77.3-145.6 cM) frequencies were generally low in the central, presumably and included 172.4 markers (119–266) (Table 3). This is centromeric chromosomal regions of A. duranensis and considerably denser than the previously published AA, Nagy et al. BMC Genomics 2012, 13:469 Page 6 of 11 http://www.biomedcentral.com/1471-2164/13/469

Table 2 cDNA sequence reads generated for single derived from a cross between cultivated peanut and a nucleotide polymorphism (SNP) discovery in Arachis synthetic A. ipaensis x A. duranensis tetraploid (Ozias- duranensis* Akins, unpublished). Accession Sequencing Tissue type Total Platform Developing seed Root Gene annotation and comparative mapping PI 475887 Sanger 22,356 21,487 43,843 Homology search of the 1,724 mapped loci resulted in PI 475887 454 212,938 266,575 479,513 significant hits for 1,463 loci in at least one of the three Grif 15036 454 296,242 235,245 531,487 databases: Medicago, Uniprot and GenBank NR data- Total 531,536 523,307 1,054,843 base, and 580 of the mapped loci gave significant simi- larities in either of the two gene ontology databases: * Assembly is deposited at NCBI as Accession: PRJNA50587. Medicago Gene Atlas and TAIR (Additional file 4). Altogether 1,366 gene ontology terms were assigned to BB, and AABB maps consisting of only a few hundred the 580 genes. These were distributed among the three markers. For example, the A. ipaensis × A. magna B- major gene ontology categories as follows: 521 molecular genome map published by Moretzsohn et al. [5] had 149 functions, 534 biological processes, and 311 cellular SSR markers grouped into 10 linkages, whereas the components (Additional file 4). B-genome SSR-based map in our related paper consists The sequences used to create the A. duranensis map of 449 loci in 16 linkage groups (Guo Y et al: Compara- also were compared to the genomes of two legumes tive mapping in intraspecific populations uncovers a where 995 loci on the A. duranensis map could be high degree of macrosynteny between A-and B-genome mapped to M. truncatula, and 2,711 matches could be diploid species of peanut, Submitted). The A-genome found in G. max (with potentially two hits per mapped map produced using the interspecific hybrid A. duranen- locus). While a majority of the dots in the synteny plots sis × A. stenosperma had 339 SSRs that were mapped appear to be random (Figure 3), there are definite clus- into 11 linkage groups [6,42]. For A. hypogaea, there are ters of markers, and striking examples of colinearity (red now several maps with the most dense consensus map arrows), especially for the comparisons to Glycine. Pre- containing 324 loci on 21 linkage groups [11]. sumably there has been extensive single gene movement The map produced in the current study is the first since the last common ancestors in one or both species, high-density map available in peanut, and because it was but many genes remain in the ancestral locations and generated from a progenitor species of A. hypogaea,we can be detected. Overall, the synteny patterns for G. anticipate that it will have significant applications for max showed the recent whole genome duplication analyzing the cultivated genome. For example, the data within Glycine, with each location in peanut showing generated in this map was used by Nagy et al. [43] corresponding synteny at two locations in Glycine. Co- to more precisely map the Rma gene for nematode linearity between Medicago and Arachis is much less resistance that originated from an introgression line conserved than between Arachis and Glycine. This could between A. hypogaea and A. cardenasii. The A-genome be due to extensive inversions in either genome, or more SNP array also has been useful at the tetraploid level likely, due to preliminary ordering of sequences within for genotyping a recombinant inbred line population the Medicago unfinished genome assembly. In general, the patterns showed strong synteny on the chromosomal ends in both genetic and physical distance, while the Table 3 Genetic distances and distribution of markers on central regions of chromosomes tended to show less the ten linkage groups of A. duranensis synteny. Presumably this could be attributed to pericen- Linkage group Genetic distance (cM) Markers tromeric heterochromatin which is known to define less 1A 96.8 186 recombinogenic regions where genomic rearrangements 2A 103.9 119 are more likely to persist [44]. Chromosome arms tend 3A 145.6 266 to be maintained as syntenic between Glycine and Ara- 4A 115.8 149 chis, but there is evidence that chromosome arms have 5A 131.7 178 been translocated in some cases so that synteny exists at 6A 109.8 181 the chromosome arm level, but less so at the whole 7A 82.3 141 chromosome level. 8A 77.3 180 Conclusions 9A 106.5 171 This investigation provided a large number of de novo 10A 111.4 153 EST sequences that were deposited into GenBank. The Total 1081.3 1724 markers developed here are valuable resources for peanut Nagy et al. BMC Genomics 2012, 13:469 Page 7 of 11 http://www.biomedcentral.com/1471-2164/13/469

Figure 3 Synteny between diploid A-genome peanut (A. duranensis,2n=20) and Glycine max (2n = 40). Arrows indicate clusters of genes in common between the two genomes. For plotting the data on the Y axis, the peanut genome for each chromosome is proportional in size to the total map size in centimorgans. For the X axis, the unit of measure is scaled to bp within the chromosomal assemblies of the respective genomes. The plot was obtained with a visual basic program that plotted the x-y coordinates of each hit. The total number of matches for each pair wise comparison is listed at the upper left corner. and, more broadly to the legume research community. species A. duranensis which contributed the A genome This research presents the first high-density molecular of A. hypogaea, it will serve as the reference map for map in peanut with 1,724 markers grouped into the 10 both wild and cultivated species. Lastly, synteny was expected linkage groups for an A-genome species. found between Arachis and the Glycine and Medicago Because the map was produced with the progenitor genomes, which indicates that markers developed for Nagy et al. BMC Genomics 2012, 13:469 Page 8 of 11 http://www.biomedcentral.com/1471-2164/13/469

other legume species may be of value for crop improve- polymorphic fragments. The matrix was imported into ment in peanut. The A-genome map will have utility for Phylip v3.67 [55] for the construction of the neighbor- fine mapping in other peanut species and has already joining tree. had application to mapping a nematode resistance gene that was introgressed to A. hypogaea from A. cardenasii. Marker development Simple sequence repeat (SSR) markers Methods A total of 101,132 unigenes (37,916 contigs (GenBank Acc. Plant materials No. EZ720985-EZ758900) and 63,216 singletons) from Thirty-seven accessions of A. duranensis, 14 accessions tetraploid peanut ESTs (GenBank Acc. No. CD037499- of A. stenosperma (A genome), one accession of A. CD038843, ES702769-ES768453, GO256999-GO269325, ipaensis, and eight accessions of A. batizocoi (B genome) GO322902- GO343529 and short-read Sequence Read were obtained from the USDA or NCSU germplasm col- Archive accessions SRX020012, SRX019979, SRX019972, lections. Plants were then grown in greenhouses at the SRX019971) representing ca. 37 Mb of the A. hypogaea University of Georgia at Athens. The accessions evalu- genome were mined for 2,138 EST-SSR markers (GM710- ated are shown in Figure 1. Hybrids were made between GM2847) (Guo Y et al: Comparative mapping in intraspe- three pairs of A. duranensis accessions, including PI cific populations uncovers a high degree of macrosynteny 468200 × PI 468198, PI 468319 × PI 475885, and between A-and B-genome diploid species of peanut, PI 475887 × Grif 15036. The hybrid combination Submitted). Unigenes in the transcript assembly were PI 475887 × Grif 15036 was one of the most poly- screened for perfect repeat motifs using SSR-IT http:// morphic as revealed by using a panel of SSR markers www.gramene.org/db/markers/ssrtool) and for imperfect as described below and thus was selected for subse- motifs using FastPCR (http://primerdigital.com/fastpcr. quent mapping. PI 475887 was originally collected by html). The repeat count (n) threshold for each motif type Krapovickas, Schinini, and Simpson near Salta, was set for n ≥ 5. SSR markers were genotyped on an Argentina during 1980, and Grif 15036 was originally ABI3730XL Capillary DNA Sequencer (Applied Biosys- collected by Williams, Simpson, and Vargas near tems, Foster City, CA) using forward primers labelled Boqueron, Paraguay during 2002 [22]. Crosses were with FAM, HEX, or TAMRA fluorophores. PCR was per- made by manually emasculating flowers of the female formed in a 12 μL reaction mixture containing 1.0 × PCR parent PI 475887 during the late afternoon and pollin- buffer, 2.5 mM Mg++,0.2mMeachofdNTPs,5.0pmol ating stigmas between 8 and 10 am the following of each primer, 0.5 unit of Taq polymerase, and 10 ng of morning with pollen from the male parent Grif 15036. genomic DNA. Touchdown PCR was used to reduce An F2 population was developed by self-pollinating spurious amplification. The SSR markers were screened multiple F1 individuals. The intraspecific F2 population for length polymorphisms using GeneMapper 3.0 software (n = 94) from a hybrid between two A. duranensis (Applied Biosystems, Foster City, CA). Of the 2,138 EST- accessions was then used for mapping studies. SSR primer pairs tested, markers derived from 598 could be mapped. A set of 34 SSR markers from genomic Molecular diversity between and within A- and B-genome sequences of Arachis previously screened for polymor- diploid species phism between parents of the A. duranensis mapping DNA was isolated from leaf samples of A. duranensis, population (Guo Y et al: Comparative mapping in intras- A. ipaensis, A. stenosperma, and A. batizocoi accessions pecific populations uncovers a high degree of macrosyn- using a modified CTAB method [45,46]. The 60 DNA teny between A-and B-genome diploid species of peanut, samples were amplified using 709 different SSR primer Submitted) were also mapped (Table 1). pairs (GM1-GM709) that had been generated from sequences reported in the literature [6,29,47-53] and Single-stranded conformational polymorphism screened for polymorphisms. SSR markers were geno- (SSCP) markers typed on an ABI3730XL Capillary DNA Sequencer SSCP markers were developed from genomic DNA tem- (Applied Biosystems, Foster City, CA) as described in plates for previously described NBS sequences isolated a related paper by Guo et al. (Guo Y et al: Compara- by targeting conserved sequence motifs in NBS-LRR tive mapping in intraspecific populations uncovers a encoding genes [56,57] and from Arachis unigenes high degree of macrosynteny between A-and B-genome showing similarity to R-gene homologs identified by min- diploid species of peanut, Submitted) using forward ing a peanut transcript assembly [43]. SSCP fragments primers labelled with FAM, HEX, or TAMRA fluoro- were amplified using touch-down PCR and detected by phores. Microsat [54] was used for construction of a silver-staining as previously described [58-60]. A total distance matrix based on the proportion of shared of 380 SSCP markers were evaluated for polymorphism bands (D = 1 - ps) from 556 primer pairs amplifying between the parents PI 475887 and Grif 15036. The Nagy et al. BMC Genomics 2012, 13:469 Page 9 of 11 http://www.biomedcentral.com/1471-2164/13/469

resistance gene analog markers are prefixed by either ‘GS’ linkage groups. The recombinant inbred line2 (RIL2) al- or ‘RGC’ in the map. cDNA sequences for unigenes gorithm and Kosambi function were used to calculate targeted for SSCP marker development in the present genetic distances. The program Joinmap 3.0 [63] was study were deposited in GenBank (Acc. No. GF100476- used to localize the dominant markers and to confirm GF100638). One additional marker, the SCAR marker the marker order, a range of LOD scores of 5–16 was S197 linked to a root-knot nematode resistance gene in used to create groups. The Kosambi mapping function Arachis hypogaea [43,61] was also mapped. was used for map length estimations. Markers were tested for segregation distortion by the chi-square test. Development of single nucleotide polymorphism (SNP) Graphic presentation of the map was drawn using Map- markers chart 2.0 software [64]. Total RNA was isolated from roots of young seedlings (up to four trifoliate) and from developing seeds (up to Gene annotation developmental stage R6) of the two parental genotypes, The cDNA sequences included in the genetic map have PI 475887 and Grif 15036 (alias DUR25 and DUR2, been used to search for homologous genes in the Medi- respectively). cDNA libraries were developed using the cago (www.medicago.org), Uniprot (www.uniprot.org) Mint cDNA synthesis kit (Evrogen) and normalized and GenBank NR (http://www.ncbi.nlm.nih.gov/genbank) using the Trimmer cDNA normalization kit (Evrogen). databases using various blast algorithms. Gene ontology cDNA sequences were generated by Sanger and 454 GS- annotations were also added by searching Medicago FLX sequencing methods and assembled using the tool Gene Atlas (http://mtgea.noble.org) and The Arabidopsis Mira [62]. Altogether, more than one million cDNA Information Resource (TAIR, www.arabidopsis.org) data- sequence reads were generated from A. duranensis PI bases. A significance threshold of E =1e-5 was applied in 475887 and Grif 15036. These were assembled into all inquiries. 81,116 unique transcripts (unigenes) (GenBank Accn. No. HP000001-HP081116). Assemblies were searched Synteny between Arachis, Medicago, and Glycine for single nucleotide polymorphisms (SNPs) that fulfilled The EST sequences used for marker-development were the following two criteria: (a) the SNP position is compared to the whole genome sequences of Glycine covered at least by two reads from each genotype, and max and Medicago truncatula to establish synteny. (b) at least 80% of the reads call the SNP in the particu- Sequences for the genomes G. max V5 and M. trunca- lar genotype. Using these criteria, we identified 8,478 tula MT3.0 were obtained through www.phytozome.net. SNPs in 3,922 unigenes. To facilitate the selection of The sequences associated with each locus on the A. dura- candidate SNPs for designing and building Illumina nensis peanut map (Additional file 1 and Additional file 5) GoldenGate SNP genotyping arrays, putative intron were searched against the respective whole genome positions were predicted by aligning Arachis contigs with sequences using blastn and E < =1e-6. For comparison to Arabidopsis and Medicago genomic DNA sequences Medicago, only the best match was retained because dip- identified by BLAST analyses. SNPs within 60 bp of a loid peanut and M. truncatula are at the same relative putative intron were eliminated, thereby reducing the ploidy level. However for Glycine,thetwobestmatches collection of candidate SNPs to 6,789 in 3,264 unigenes for each peanut sequence were retained because of the re- from which 1,236 high-quality SNPs, each representing cent polyploidy within soybean and the high level of reten- separate unigenes, were selected for genotyping. SNPs tion of duplicated genes in the species. Blast hits to were also detected by allele re-sequencing in a subset of scaffolds or Bacterial Artificial Chromosomes (BACs) not 768 conserved legume orthologs identified by coauthors anchored to the chromosomal assembly in the target (R.V. Penmetsa, N. Carrasquilla-Garcia, A. D. Farmer genomes were discarded. Plotting the data and proces- and D.R. Cook), and 300 of these SNPs were added to sing of blast results were performed with Visual Basic the GoldenGate array. SNP genotyping on the Golden- programs written for this study. Gate array was conducted at the Emory Biomarker Service Center, Emory University. The BeadStudio (Illu- Additional files mina) genotyping module was used for calling genotypes. Markers with GC quality scores lower than 0.25 Additional file 1: SNP markers on Illumina GoldenGate array. were excluded from subsequent analysis. Marker ID along with sequence information for OPAs and target ESTs are provided. Additional file 2: Comparative genetic mapping of Arachis Map construction duranensis using two different software programs on the same The program, MSTMap [39] was used to build a core dataset. Genetic maps were constructed by MSTMap (left) using 1673 genetic map including all codominant markers using co-dominant markers and Joinmap 3.0 (right) using 1724 markers. Linkage group assignments, marker orders and genetic distances were the cut-off p-value of 10-12 for clustering markers into Nagy et al. BMC Genomics 2012, 13:469 Page 10 of 11 http://www.biomedcentral.com/1471-2164/13/469

highly consistent, except for the order among a few closely linked loci. two diploid species of Arachis stenosperma and A. cardenasii. Peanut Sci – Marker positions determined by Joinmap 3.0 are provided in Additional 2005, 32:1 8. file 6. 5. Moretzsohn MC, Barbosa AVG, ves-Freitas DMT, Teixeira C, Leal-Bertioli SCM, Guimaraes PM, Pereira RW, Lopes CR, Cavallari MM, Valls JFM, et al: A Additional file 3: Mapped markers with segregation distortion linkage map for the B-genome of Arachis (Fabaceae) and its synteny to (p = 0.05) and their position on the map. Column A lists the marker the A-genome. BMC Plant Biol 2009, 9:40. positions on each chromosome, column B indicates marker name, 6. Moretzsohn MC, Leoi L, Proite K, Guimaraes PM, Leal-Bertioli SCM, column C is the chromosome number, columns D to H list the number Gimenes MA, Martins WS, Valls JFM, Grattapaglia D, Bertioli DJ: A χ2 of individuals in each genotype class, and columns J and K provide microsatellite-based, gene-rich linkage map for the AA genome of and P values, respectively. Arachis (Fabaceae). Theor Appl Genet 2005, 111:1060–1071. Additional file 4: Annotated loci mapped in Arachis duranensis. 7. Burow MD, Simpson CE, Starr JL, Paterson AH: Transmission genetics Columns B to J include homologs identified in the Medicago (B-D), of chromatin from a synthetic amphidiploid to cultivated peanut GenBank-NR (E-G) and Uniprot-Sprot (H- J) databases. Columns L to S (Arachis hypogaea L.): Broadening the gene pool of a monophyletic include gene ontology (GO) terms identified in the three major GO polyploid species. Genetics 2001, 159:823–837. categories: molecular function (N, O), biological process (P,Q) and cellular 8. Fonceka D, Hodo-Abalo T, Rivallan R, Faye I, Sall MN, Ndoye O, component (R,S). Favero AP, Bertioli DJ, Glaszmann JC, Courtois B, et al: Genetic mapping Additional file 5: Sequences associated with SSR and SSCP markers of wild introgressions into cultivated peanut: a way toward enlarging for synteny analysis. Column A is the marker name and column B is the the genetic basis of a recent allotetraploid. BMC Plant Biol 2009, Genebank ID or sequence used as query for synteny analysis. 9:103. 9. Varshney RK, Bertioli DJ, Moretzsohn MC, Vadez V, Krishnamurthy L, Aruna R, Additional file 6: Marker positions for the linkage map. Nigam SN, Moss BJ, Seetha K, Ravi K, et al: The first SSR-based genetic linkage map for cultivated groundnut (Arachis hypogaea L.). Theor Appl Competing interests Genet 2009, 118:729–739. The authors declare that they have no competing interests. 10. Hong YB, Chen XP, Liang XQ, Liu HY, Zhou GY, Li SX, Wen SJ, Holbrook CC, Guo BZ: A SSR-based composite genetic linkage map for the cultivated Authors’ contributions peanut (Arachis hypogaea L.) genome. BMC Plant Biol 2010, 10:17. EDN developed the cDNA libraries, organized sequencing and SNP 11. Qin H, Feng S, Chen C, Guo Y, Knapp S, Culbreath A, He G, Wang M, genotyping, and constructed the initial genetic maps. YG conducted Zhang X, Holbrook CC, Ozias-Akins P, Guo B: An integrated genetic linkage parental genotyping and constructed final genetic maps. EDN and ST map of cultivated peanut (Arachis hypogaea L.) constructed from two – developed the mapping population. EDN and RAO genotyped the SSR, RGC, RIL populations. Theor Appl Genet 2011, 124:653 664. and RS markers. JEB performed the synteny analysis. ST, YG, SK, AFH, NK 12. Gautami B, Pandey MK, Vadez V, Nigam SN, Ratnakumar P, Krishnamurthy L, developed the SSR markers. SK performed the genetic diversity study. CAT Radhakrishnan T, Gowda MVC, Narasu ML, Hoisington DA, et al: and DZ assembled the ESTs and nominated SNPs for the genic sequences. Quantitative trait locus analysis and construction of consensus genetic ADF, NCG, RVP and DC nominated the conserved legume ortholog SNPs. map for drought tolerance traits based on three recombinant inbred EDN and JEB participated in manuscript writing. DC, HTS and NN line populations in cultivated groundnut (Arachis hypogaea L.). Mol Breed contributed to project design. POA was Co-PI of the project and finalized the 2012, 30:757–772. manuscript. SJK was the PI of the project, designed experiments, coordinated 13. Ravi K, Vadez V, Isobe S, Mir RR, Guo Y, Nigam SN, Gowda MVC, the study, and participated in manuscript writing. All authors read and Radhakrishnan T, Bertioli DJ, Knapp SJ, et al: Identification of several small approved the final manuscript. main-effect QTLs and a large number of epistatic QTLs for drought tolerance related traits in groundnut (Arachis hypogaea L.). Theor Appl – Acknowledgements Genet 2011, 122:1119 1132. This research was supported by funding from the USDA National Institute of 14. Shirasawa K, Koilkonda P, Aoki K, Hirakawa H, Tabata S, Watanabe M, Food and Agriculture National Research Initiative Competitive Grants Hasegawa M, Kiyoshima H, Suzuki S, Kuwata C, et al: In silico Program (#2006-35604-17242) awarded to SJK and POA and by the National polymorphism analysis for the development of simple sequence repeat Peanut Board, the Peanut Foundation, the Georgia Seed Development and transposon markers and construction of linkage map in cultivated Commission, and Georgia Research Alliance endowment funding awarded to peanut. BMC Plant Biol 2012, 12:80. SJK. 15. Singh AK, Simpson CE: In Biosystematics and genetic resources, Chap.4 in the Groundnut crop: A scientific basis for improvement. Edited by Smart J. Author details London: Chapman &Hall; 1994. 1Institute of Plant Breeding, Genetics and Genomics, University of Georgia, 16. Kochert G, Stalker HT, Gimenes M, Galgaro L, Lopes CR, Moore K: RFLP and 111 Riverbend Rd, Athens, GA 30605, USA. 2National Center for Genome cytogenetic evidence on the origin and evolution of allotetraploid Resources, 2935 Rodeo Park Drive East, Santa Fe, NM 87505, USA. domesticated peanut, Arachis hypogaea (Leguminosae). Am J Bot 1996, 3Department of Plant Pathology, University of California, Davis, CA 95616, 83:1282–1291. USA. 4Department of Crop Science, North Carolina State University, Raleigh, 17. Guyomarc'h H, Sourdille P, Charmet G, Edwards KJ, Bernard M: NC 27695, USA. 5Department of Horticulture, University of Georgia, Tifton, GA Characterisation of polymorphic microsatellite markers from Aegilops 31793, USA. tauschii and transferability to the D-genome of bread wheat. Theor Appl Genet 2002, 104:1164–1172. Received: 22 December 2011 Accepted: 30 August 2012 18. Gill KS, Lubbers EL, Gill BS, Raupp WJ, Cox TS: A genetic linkage map of Published: 11 September 2012 Triticum tauschii (DD) and its relationship to the D-genome of bread wheat (AABBDD). Genome 1991, 34:362–374. References 19. Echt CS, Kidwell KK, Knapp SJ, Osborn TC, McCoy TJ: Linkage mapping in 1. Stalker HT, Mozingo LG: Molecular markers of Arachis and marker-assisted diploid alfalfa (Medicago sativa). Genome 1993, 37:61–71. selection. Peanut Sci 2001, 28:117–123. 20. Brummer EC, Bouton JH, Kochert G: Development of an RFLP map in 2. Paterson AH, Stalker HT, Gallo-Meagher M, Burow MD, Dwivedi SL, Crouch diploid alfalfa. Theor Appl Genet 1993, 86:329–332. JH, Mace ES: Genomics and genetic enhancement of peanut.InGenomics 21. Yu GX, Wise RP: An anchored AFLP- and retrotransposon-based map of for Legume Crops. Edited by Wilson RF, Stalker HT, Brummer CE. Champaign, diploid Avena. Genome 2000, 43:736–749. IL: Amer Oil Chem Soc; 2004:97–109. 22. Stalker HT, Ferguson ME, Valls JFM, Pittman RN, Simpson CE, Bramel-Cox P: 3. Halward T, Stalker HT, Kochert G: Development of an RFLP linkage map in Catalog of Arachis germplasm collection; 2002. http://wwwicrisatorg/text/ diploid peanut species. Theor Appl Genet 1993, 87:379–384. research/grep/homepage/groundnut/arachis/starthtm. 4. Garcia GM, Stalker HT, Schroeder E, Lyerly JH, Kochert G: A RAPD-based 23. USDA-ARS: Germplasm Resources Information Network Species Records of linkage map of peanut based on a backcross population between the Arachis. 2011. http://wwwars-gringov/cgi-bin/npgs/html/splistpl?889. Nagy et al. BMC Genomics 2012, 13:469 Page 11 of 11 http://www.biomedcentral.com/1471-2164/13/469

24. Stalker HT, Kochert GD, Dhesi JS: Genetic diversity within the species conservation of microsynteny to chromosome structure and Arachis duranensis Krapov. & W.C. Gregory, a possible progenitor of recombination in grasses. Proc Natl Acad Sci USA 2005, 102:13206–13211. cultivated peanut. Genome 1995, 38:1201–1212. 45. Murray MG, Thompson WR: Rapid isolation of high molecular weight 25. Robledo G, Seijo G: Species relationships among the wild B genome of plant DNA. Nucl Acids Res 1980, 8:4321–4325. Arachis species (section Arachis) based on FISH mapping of rDNA loci 46. Doyle JJ, Doyle JL: A rapid DNA isolation procedure for small quantities and heterochromatin detection: A new proposal for genome of fresh leaf tissue. Phytochem Bull 1987, 19:11–15. arrangement. Theor Appl Genet 2010, 121:1033–1046. 47. Hopkins MS, Casa AM, Wang T, Mitchell SE, Dean RE, Kochert GD, 26. Pandey MK, Monyo E, Ozias-Akins P, Liang X, Guimarães P, Nigam SN, Kresovich S: Discovery and characterization of polymorphic simple Upadhyaya HD, Janila P, Zhang X, Guo B, et al: Advances in Arachis sequence repeats (SSRs) in peanut. Crop Sci 1999, 39:1243–1247. genomics for peanut improvement. Biotech Adv 2012, 30:639–651. 48. Palmieri DA, Bechara MD, Curi RA, Gimenes MA, Lopes CR: Novel 27. Gimenes MA, Hoshino AA, Barbosa AVG, Palmieri DA, Lopes CR: polymorphic microsatellite markers in section Caulorrhizae (Arachis, Characterization and transferability of microsatellite markers of the Fabaceae). Mol Ecol Notes 2005, 5:77–79. cultivated peanut (Arachis hypogaea). BMC Plant Biol 2007, 7:9. 49. Palmieri DA, Hoshino AA, Bravo JP, Lopes CR, Gimenes MA: Isolation and 28. Mace ES, Varshney RK, Mahalakshmi V, Seetha K, Gafoor A, Leeladevi Y, characterization of microsatellite loci from the forage species Arachis Crouch JH: In silico development of simple sequence repeat markers pintoi (Genus Arachis). Mol Ecol Notes 2002, 2:551–553. within the aeschynomenoid/dalbergoid and genistoid clades of the 50. He G, Meng R, Newman M, Gao G, Pittman RN, Prakash CS: Microsatellites Leguminosae family and their transferability to Arachis hypogaea, as DNA markers in cultivated peanut (Arachis hypogaea L.). BMC Plant groundnut. Plant Sci 2008, 174:51–60. Biol 2003, 3:3. 29. Proite K, Leal-Bertioli S, Bertioli D, Moretzsohn M, da Silva F, Martins N, 51. Ferguson ME, Burow MD, Schulze SR, Bramel PJ, Paterson AH, Kresovich S, Guimaraes P: ESTs from a wild Arachis species for gene discovery and Mitchell S: Microsatellite identification and characterization in peanut marker development. BMC Plant Biol 2007, 7:7. (A. hypogaea L.). Theor Appl Genet 2004, 108:1064–1070. 30. Cuc LM, Mace ES, Crouch JH, Quang VD, Long TD, Varshney RK: Isolation 52. Krishna GK, Zhang J, Burow M, Pittman RN, Delikostadinov SG, Lu Y, and characterization of novel microsatellite markers and their Puppala N: Genetic diversity analysis in Valencia peanut (Arachis application for diversity assessment in cultivated groundnut (Arachis hypogaea L.) using microsatellite markers. Cell Mol Biol Lett 2004, hypogaea). BMC Plant Biol 2008, 8:55. 9:685–697. 31. Yuan M, Gong LM, Meng RH, Li SL, Dang P, Guo BZ, He GH: Development 53. Moretzsohn MC, Hopkins MS, Mitchell SE, Kresovich S, Valls JF, Ferreira ME: of trinucleotide (GGC)n SSR markers in peanut (Arachis hypogaea L.). Genetic diversity of peanut (Arachis hypogaea L.) and its wild relatives Electronic J Biotech 2010, 13(6):6. based on the analysis of hypervariable regions of the genome. BMC Plant 32. Song GQ, Li MJ, Xiao H, Wang XJ, Tang RH, Xia H, Zhao CZ, Bi YP: EST Biol 2004, 4:11. sequencing and SSR marker development from cultivated peanut 54. Minch E, Ruiz-Linares A, Goldstein D, Feldman M, Cavalli-Sforza LL: (Arachis hypogaea L.). Electronic J Biotech 2010, 13(3):10. MICROSAT: A computer program for calculating various statistics on 33. Wang CT, Yang XD, Chen DX, Yu SL, Liu GZ, Tang YY, Xu JZ: Isolation of microsatellite allele data, ver. 1.5d.: ; 1997. http://hpglstanfordedu/projects/ simple sequence repeats from groundnut. Electronic J Biotech 2007, microsat/. 10(3):10. 55. Felsenstein J: PHYLIP - Phylogeny Inference Package (version 3.2). – 34. Liang XQ, Chen XP, Hong YB, Liu HY, Zhou GY, Li SX, Guo BZ: Utility of Cladistics 1989, 5:164 166. EST-derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachis 56. Bertioli DJ, Leal-Bertioli SCM, Lion MB, Santos VL, Pappas G, Cannon SB, wild species. BMC Plant Biol 2009, 9:35. Guimaraes PM: A large scale analysis of resistance gene homologues in – 35. Koilkonda P, Sato S, Tabata S, Shirasawa K, Hirakawa H, Sakai H, Sasamoto S, Arachis. Mol Genet Genom 2003, 270:34 45. Watanabe A, Wada T, Kishida Y, et al: Large-scale development of 57. Yuksel B, Estill JC, Schulze SR, Paterson AH: Organization and evolution of – expressed sequence tag-derived simple sequence repeat markers and resistance gene analogs in peanut. Mol Genet Genom 2005, 274:248 263. diversity analysis in Arachis spp. Mol Breed 2012, 30:125–138. 58. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T: Detection of 36. Bertioli DJ, Moretzsohn MC, Madsen LH, Sandal N, Leal-Bertioli SCM, polymorphisms of human DNA by gel-electrophoresis as single-strand – Guimaraes PM, Hougaard BK, Fredslund J, Schauser L, Nielsen AM, et al: conformation polymorphisms. Proc Natl Acad Sci USA 1989, 86:2766 2770. An analysis of synteny of Arachis with Lotus and Medicago sheds new 59. Sanguinetti CJ, Neto ED, Simpson AJG: Rapid silver staining and recovery light on the structure, stability and evolution of legume genomes. of PCR products separated on polyacrylamide gels. Biotechniques 1994, BMC Genomics 2009, 10:45. 17:914. 60. Radwan O, Gandhi S, Heesacker A, Whitaker B, Taylor C, Plocik A, Kesseli R, 37. Stalker HT, Dhesi JS, Parry D: An analysis of the B genome species Arachis Kozik A, Michelmore RW, Knapp SJ: Genetic diversity and genomic batizocoi (Fabaceae). Plant Syst Evol 1991, 174:159–169. distribution of homologs encoding NBS-LRR disease resistance proteins 38. Wells DE, Gutierrez L, Xu Z, Krylov V, Macha J, Blankenburg KP, Hitchens M, in sunflower. Mol Genet Genom 2008, 280:111–125. Bellot LJ, Spivey M, Stemple DL, et al: A genetic map of Xenopus tropicalis. 61. Chu Y, Holbrook CC, Timper P, Ozias-Akins P: Development of a PCR-based Devel Biol 2011, 354:1–8. molecular marker to select for nematode resistance in peanut. Crop Sci 39. Wu Y, Bhat PR, Close TJ, Lonardi S: Efficient and accurate construction of 2007, 47:841–847. genetic linkage maps from the minimum spanning tree of a graph. PLoS 62. Chevreux B, Pfisterer T, Drescher B, Driesel AJ, Muller WEG, Wetter T, Suhai S: Genet 2008, 4:10. Using the miraEST assembler for reliable and automated mRNA 40. Heslop-Harrison JS: Comparative genome organization in plants: From transcript assembly and SNP detection in sequenced ESTs. Genome Res sequence and markers to chromatin and chromosomes. Plant Cell 2000, 2004, 14:1147–1159. 12:617–635. 63. Van Ooijen JW, Voorrips RE: JoinMap 3.0 software for the calculation of 41. Paape T, Zhou P, Branca A, Briskine R, Young N, Tiffin P: Fine-scale genetic linkage maps. Wageningen, the Netherlands: Plant Research population recombination rates, hotspots, and correlates of Internation; 2001. recombination in the Medicago truncatula genome. Genome Biol Evol 64. Voorrips RE: MapChart: software for the graphical presentation of linkage 2012, 4:726–732. maps and QTLs. J Hered 2002, 93:77–78. 42. Leal-Bertioli SCM, Jose ACVF, ves-Freitas DMT, Moretzsohn MC, Guimaraes PM, Nielen S, Vidigal BS, Pereira RW, Pike J, Favero AP, et al: Identification of doi:10.1186/1471-2164-13-469 candidate genome regions controlling disease resistance in Arachis. Cite this article as: Nagy et al.: A high-density genetic map of Arachis BMC Plant Biol 2009, 9:112. duranensis, a diploid ancestor of cultivated peanut. BMC Genomics 2012 43. Nagy ED, Chu Y, Guo YF, Khanal S, Tang SX, Li Y, Dong WBB, Timper P, 13:469. Taylor C, Ozias-Akins P, et al: Recombination is suppressed in an alien introgression in peanut harboring Rma, a dominant root-knot nematode resistance gene. Mol Breed 2010, 26:357–370. 44. Bowers JE, Arias MA, Asher R, Avise JA, Ball RT, Brewer GA, Buss RW, Chen AH, Edwards TM, Estill JC, et al: Comparative physical mapping links