LIFE & SCIENCE Print ISSN 2521-0475

EDITOR-IN-CHIEF MANAGING EDITOR Majeed SMI Gilani R

BOARD OF EDITORS ASSISTANT EDITOR Aslam M Malik RA Mohyuddin A

EXECUTIVE EDITORS Aziz Q Kang A Qazilbash MH Shafi M Sohail M

EDITORIAL ADVISIORY BOARD NATIONAL Blumenberg M (New York, USA) Ali S (Rawalpindi) Chundrigar T (Taif, KSA) Ayub K (Islamabad) Hashmi R (South Wales, Australia) Aly SM (Karachi) Ichihara K (Minami-kogushi, Japan) Ansar M (Islamabad) Islam M (Toledo, USA) Abidi SH (Islamabad) Khan AR (Jeddah, KSA) Baig SM (Rawalpindi) Majeed G (London, UK) Kaiser F (Islamabad) Makhdoomi KR (Dammam, KSA) Quadri KHM (Islamabad) Perera R (USA) Ramzan M (Wah Cantt) Qureshi N (Missouri, USA) Syed JH (Islamabad) Qureshi J (Arizona, USA) Usman J (Rawalpindi) Rehmani R (Mississauga, Canada) Silva FA (Zaragoza, Spain) INTERNATIONAL Soufo HJD (Freiburg, Germany) Ahmed W (Al Ahsa, KSA) Shokoohizadeh L (Hamadan, Iran) Adil MM (Maryland, USA) Yusuf OB (Nigeria)

This is an Open Access journal distributed under the terms of the Creative Commons Attribution License (http: / / creativecommons.org/ Licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MAILING ADDRESS: Editor in Chief Life and Science Telephone: +92-51-9274910 E-mail: [email protected] Web page: http://lifenscience.org

ii CONTENTS Volume 1 Number 2 Apr 2020 EDITORIAL Majeed SMI 53 History of Contraception

ORIGINAL ARTICLES Phylogenetic Analysis of Astigmatid Mites Naz S, Chaudhry FR, Rizvi DA, Ismail M 55 Sarcoptes scabiei and Dermatophagoides farinae using ITS-2 as a Genetic Marker Item Analysis of Multiple-Choice Questions at the Ramzan M, Imran SS, Bibi S, Khan KW, 60 Department of Community Medicine, Wah Maqsood I Medical College, Pakistan Comparison of Hemodynamic Response to Aslam KZ, Kashif S, Gulrez A 64 Orotracheal Intubation with Conventional Laryngoscope versus Fiberoptic Bronchoscope Substance Abuse: From Abstinence to Relapse Javed S, Chughtai K, Kiani S 68 Inimical Effects of Sodium Fluoride on Ovarian Athar T, Suhail M, Iqbal J, Muzaffar T, Majid H 72 Weight and Relative Tissue Weight Index of Adult Albino Rats

Concentration of Aluminum in Drinking Water of Farhat SM, Ali M 77 Pakistan and Its Implications on Human Health

CASE REPORT Rett Syndrome without MECP2 Mutation in a Dad R, Sawal HA, Ahmad A, Ullah MI 83 Pakistani Girl 86

ii EDITORIAL

53 54 Life & Science 2020 Vol. 1, No. 2 Phylogenetic Analysis of Astigmatid Mites using ITS-2 ORIGINAL
ARTICLE Phylogenetic Analysis of Astigmatid Mites Sarcoptes scabiei and Dermatophagoides farinae using ITS-2 as a Genetic Marker Shumaila Naz1, Farhana Riaz Chaudhry2, Dilawar Abbas Rizvi3, Muhammad Ismail4 ABSTRACT Objective: The coding of astigmatid mites based on their morphological and developmental characteristics often leads to uncertainty in the results. The ribosomal internal transcribed spacer (ITS-2) region, being highly conserved in eukaryotes is commonly employed as a barcode for identification of mite species. The present study was an attempt to characterize the gene sequences of astigmatid mites i.e. Sarcoptes scabiei (S. scabiei), Dermatophagoides farinae (D. farinae) using ITS-2 as a genetic marker. Place and Duration of Study: The study was conducted at Department of Dermatology, Military Hospital (MH), Rawalpindi from September 2012 to October 2013. Materials and Methods: In order to characterize relationship of astigmatid mites, the ITS-2 marker was successfully amplified and sequenced. The resulting ITS-2 gene sequences were aligned using Clustal W. MEGA 7 was used to construct phylogenetic tree of the aligned sequence. Results: The phylogenetic tree showed an overall genetic distance of 0.53 indicating close genetic relationship among astigmatid mite species. Pairwise distance was calculated for the ITS-2 gene and low genetic diversity values were observed within S. scabiei and D. farinae that range from 0.003-0.008 and 0.006-0.038 respectively. Conclusion: The study supports the view that the ITS-2 region can be used to identify morphologically difficult astigmatid mites but is not useful in characterization of different species based on the geographical distribution. This study has important implication in our understanding of the epidemiology of S. scabiei and D. farinae and development of control strategies in human transmission.

Key Words: Dermatophagoides Farina (Derf), House Dust Mite (HDM), ITS-2 region, Pakistan, Sarcoptes scabiei var. hominis.

How to cite this: Naz S, Chaudhry FR, Rizvi DA, Ismail M. Phylogenetic Analysis of Astigmatid Mites Sarcoptes scabiei and Dermatophagoides farinae using ITS-2 as a Genetic Marker. Life and Science. 2020; 1(2): 55-59. doi: http://doi.org/10.37185/LnS.1.1.75 Introduction morphological identification of different Due to the ubiquitous nature of parasitic mites, they developmental stages of mites often leads to are known to infect invertebrates, vertebrates and uncertainty in the results. In the adult stage, mites plants. The parasitic infections are responsible for are difficult to identify with high level of accuracy; massive disease burden to humans and animals complexity and similarity in taxonomy and which in turn leads to higher levels of morbidity morphology has made it challenging to differentiate 4,5,6 and mortality than any other infection.1,2,3 The between them with great precision. 1,2Department of Zoology The limited availability of genomic data of astigmatid Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi mites has implications related to genetic structure, Current Address: National University of Medical Sciences epidemiology and monitoring protocols of the Rawalpindi 7,8 3 mites. Advances in molecular studies have allowed Department of Dermatology the exploration of the whole genomic sequence of Military Hospital, Rawalpindi 9 4Instituteof Biomedical and Genetic Engineering, Islamabad mites which has enabled the recognition of Correspondence: taxonomically complex species and to comprehend Dr. Shumaila Naz associations between mite taxa.10,11 Assistant Professor, Biological Sciences National University of Medical Sciences, Rawalpindi Phylogenetic relationships among different mite E-mail: [email protected] families are based on their morphological Funding Source: HEC; Conflict of Interest: NIL characteristics, allergen characterization, Received: Sept 26, 2019; Revised: Jan 21, 2020 geographical distribution and physiological Accepted: Feb 26, 2020 55 Life & Science 2020 Vol. 1, No. 2 Phylogenetic Analysis of Astigmatid Mites using ITS-2

responses of mites to the environment and further processing. association with their hosts.12,13 Currently, molecular Extraction of Genomic DNA tools used to evaluate genetic diversification of The genomic DNA of 20 individual astigmatid mites species and to study phylogenetic interaction and i.e. 10 of each Sarcoptes and HDM mites were relatedness among individual species are employing extracted individually using the hotshot plus thermal mitochondrial genes, ribosomal genes and internal shock technique.22 According to this method, 25 μl of transcribed spacers.14,15 alkaline lysis buffer (25 mM NaOH, 0.2 mM disodium In acarological research, the internal transcribed EDTA) was added in thermal-cycler tubes followed by spacer ITS-2 gene has been used to study three cycles of thermal shocks. Then 25 μl organization and kinship of a population, and to neutralizing reagent (40 mM Tris-HCl) was added to identify taxonomically challenging species.16 disrupt the exoskeleton and to adjust the pH. The Previous literature showed that the ITS-2 region has concentration of DNA was determined by nanodrop been used as a genetic marker for scrutinizing the 2000 Spectrometer (Thermo Scientific, USA) at 260 diversity and exploring phylogenetic relationships and 280 nm wavelength. among astigmatid mites.17 ITS-2 marker has been PCR Amplification and Sequencing used to successfully verify the taxonomy of closely The DNA of mites was amplified by using ITS-2 related species and to differentiate and identify forward and reverse primers of sequence 5' different species of astigmatid mites.18,19 In this study, C G A C T T T C G A A C G C ATAT T G C 3 ' a n d 5 ' we used ITS-2 region to characterize astigmatid GCTTAAATTCAGGGGGTAATCTGC3' respectively.23,24 mites i.e. S. scabiei and house dust mites (HDMs) and PCR was carried out in a final volume of 20 μl with the then apply it as a phylogenetic marker to infer the following steps: pre-denaturation for 2 min at 95 °C, genetic relationships among these two group of followed by 30 cycles of the 30 s at 94 °C, 30 sec at 56 species. °C, 50 sec at 72 °C. 8 µl PCR product of HDM was Materials and Methods digested individually with restriction enzymes Hinf I Sample Collection (10 U) and Taq I (20 U). Hinf I was incubated at 37°C The ethical approval for the collection of mites was and Taq I at 65°C overnight. The amplicons were granted by the Institutional Review Board (IRB) of Pir visualized on 3% agarose gel, stained with ethidium Mehr Ali Shah Arid Agriculture University bromide. The Big Dye® Terminator v3.1 cycle Rawalpindi, Pakistan (letter No. PMAS-AAUR/ZOOL sequencing kit was used to directly sequence 10 362 approved on 22-3-2012). The S. scabiei mites purified PCR products in both directions by ABI 310 were isolated from scabies infested patients visiting genetic analyzer (Applied Biosystems, Foster City, Military Hospital (MH), Rawalpindi after obtaining USA). written informed consent from 20 individuals with Sequence Analysis ordinary scabies between September 2012 and C h r o m a s P r o ( v e r s i o n 1 . 5 ) s o f t w a r e October 2013. The cases of ordinary scabies were (https://chromaspro.software.informer.com/1.5/) confirmed through clinical presentation, positive was used to edit and assemble the sequences. To identification of mites and mite parts under the verify results of sequenced samples, BLAST microscope. (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM For the collection of HDM, dust samples were =blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blast collected from mattresses of beds and couches in the home) was performed. The resulting top hit randomly selected houses and other places of nucleotide sequences of ITS-2 were aligned using human dwelling using vacuum cleaner.20 The ClustalW (http://www. genome.jp/tools- saturated sodium chloride floatation method was bin/clustalw). The aligned sequences were further used to isolate collected HDM from dust with used to study and construct phylogenetic tree using supernatant filtered through 45µm filter paper.21 The Molecular Evolutionary Genetics Analysis (MEGA 7) 25 astigmatid mites were then identified under the based on Kimura-2-parameter (K2P) distance. microscope. Both S. scabiei and HDM mites were Results then fixed in 70% ethanol and stored at 4°C until Genomic DNAs of S. scabiei and HDM mites were

56 Life & Science 2020 Vol. 1, No. 2 Phylogenetic Analysis of Astigmatid Mites using ITS-2

isolated from a total of twenty specimens and digested PCR products with both Hinf I and Taq I confirmed the morphologically identified D. farinae and no unexpected bands of PCR products or restriction fragments were observed. The sequences of ITS-2 gene from S. scabiei and D. farinae showed 99% similarity respectively with whole genome of astigmatid mite (Accession no. AB778919.1 and GQ205600.1). The sequences obtained as a result of this study were submitted in GenBank under accession numbers KR010367, evolutionary percentage and for certain genealogical KJ409446, KT724354 and KT724355 for two S. scabiei tests. samples (Sspak1, Sspak2) and two D. farinae samples Phylogenetic Analysis (DerfPak1 and DerfPak2) respectively as shown in The phylogram constructed by using MEGA 7 Table 1. software revealed two distinct clusters denoted by cluster I and cluster II (Fig 1) separating S. scabiei from the HDMS.

The length of the ITS-2 sequences was between 335bp and 376bp for S. scabiei var. hominis and D. farinae respectively. ITS-2 sequences of astigmatid mites showed differences in terms of their length because of insertions and deletion at several sites. Three variable sites were determined for both astigmatid mites i.e. at 68, 235 and 272 positions in ITS-2 sequence of S. scabiei and 97, 174 and 281 nucleotide positions in the ITS-2 sequences of D. farinae when compared with reported ITS-2 gene sequences in NCBI nucleotide database.

Fig 1: Phylogenetic relationship of S. scabiei and HDM mites based on ITS-2 sequences The phylogenetic tree Cluster I includes D. farinae samples indicating close genetic similarity with bootstrap value of 100. The Pakistani D. farinae (DerfPak1 and DerfPak2) lie within the HDM cluster, showing closer genetic relationship to each other than to the other HDMs included in the study (bootstrap value = 73). Cluster II includes the Tandem repeats of nucleotides (AAA) , (TTT) and Pakistani S. scabiei samples (SsPak1 and SsPak2) and n n other S. scabiei sequences with bootstrap value of (GATT)n were observed in the ITS-2 gene of both astigmatid mites are useful in determining 93. The phylogram showed an overall genetic 57 Life & Science 2020 Vol. 1, No. 2 Phylogenetic Analysis of Astigmatid Mites using ITS-2

distance of 0.1 indicating close genetic distance phylogenetic tree based on their genetic between HDM and Sarcoptes mites, indicating close characteristics. genetic correlation. Our study with ITS-2 region is also supported by Pairwise Distance Calculation Suarez-Martinez et al. in which it has been Pairwise distance was calculated on the basis of ITS-2 established that ITS-2 region is not able to gene sequences of D farinae and S. scabiei mites discriminate geographically isolated mite species. (Table 2 and Table 3). The values for genetic diversity The mitochondrial 12S rDNA is also not able to reflect were calculated within species for both S. scabiei and differences between the families Pyroglyphidae D. farinae separately. The values of genetic diversity and Acaridae29 because of sequence conservation for D. farinae range from 0.006-0.038 with an the use of this marker is limited. In comparison, ITS-2 average of 0.022. Similarly, the values of genetic region is advantageous in studying population diversity for S. scabiei range from 0.003-0.008 with structure of astigmatid mites and can help us study an average of 0.004. These values indicate that genes low-level phylogenetic relationships between were genetically related with each other and there astigmatid mites.23,26 was little genetic diversity among them. The overall Conclusion genetic distance between S. scabiei and D. farinae The present study is the first report from Pakistan was calculated to be 0.53. using ITS-2 marker for the phylogenetic analysis of Discussion astigmatid mites. Although it is challenging to In the present study we characterized S. scabiei var. distinguishing the astigmatid mites based on their hominis sequences and compared them with other morphological characteristics, the ITS-2 region can reported ITS-2 (mostly animals as a host) as previous be for this purpose. However, ITS-2 region is not studies on astigmatid mites did not include Sarcoptes convenient for geographical discrimination of mite from human host.23,26 Results of the studies different species30 but it can be used to study low- carried out in Pakistan showed that ITS-2 sequences level phylogenetic relationships between astigmatid of D. farinae is characterized by 3 transitions i.e. Y, R mites. and W and of S. scabiei var. hominis sequences is Acknowledgements characterized by two transitions and one The authors are thankful to Higher Education transversion. Commission, Islamabad, Pakistan for financial The comparison of ITS-2 sequences of astigmatid support under 5000 Indigenous Fellowship Program. mites with sequences obtained from GenBank revealed that the sequences could not be used to REFERENCES differentiate geographical populations implying that 1. Buczek A, Pabis B, Bartosik K, Stanislawek IM, Salata M, the ITS-2 region was highly conserved in mites from Pabis A. Epidemiological study of scabies in different different areas.26,27 The lower level of intraspecific environmental conditions in central Poland. Annals of epidemiology. 2006; 16: 423-8. variation and the relatively higher level of 2. He Q, Ma Z, Dang X, Xu J, Zhou Z. Identification, diversity and interspecific variation in ITS-2 region show that evolution of MITEs in the genomes of microsporidian these genes may be suitable for studying the Nosema parasites. PloS one. 2015; 10: e0123170. phylogeny of astigmatid mites. These species of 3. Lozano-Fernandez J, Tanner AR, Giacomelli M, Carton R, Vinther J, Edgecombe GD, et al. Increasing species sampling mites were positioned in the phylogenetic trees 28 in chelicerate genomic-scale datasets provides support for according to their morphological characteristics. monophyly of Acari and Arachnida. Nature As reported by Yang et al27 the genetic distances communications. 2019; 10: 2295. between the species were higher as compared to 4. Colloff MJ, Stewart GA. House dust mites. Asthma. 1997; 2: distances within the species.26 The study revealed 1089-103. 5. Pepato AR, da Rocha CE, Dunlop JA. Phylogenetic position of that ITS-2 region is suitable for phylogenetic studies the acariform mites: sensitivity to homology assessment of astigmatid mites as this region shows relatively under total evidence. BMC Evolutionary Biology. 2010; 10: lower variation within the species and higher 235. variation between the different species of mites. 6. Wong SF, Chong AL, Mak JW, Tan J, Ling SJ, Ho TM. Molecular identification of house dust mites and storage mites. These astigmatid mites were placed in the 58 Life & Science 2020 Vol. 1, No. 2 Phylogenetic Analysis of Astigmatid Mites using ITS-2

Experimental and applied acarology. 2011; 55: 123. identifying Chinese Zanthoxylum. Applications in plant 7. Dong X, Armstrong SD, Xia D, Makepeace BL, Darby AC, sciences. 2018; 6: e01157. Kadowaki T. Draft genome of the honey bee ectoparasitic 19. Weeks AR, Opijnen TV, Breeuwer JAJ. AFLP fingerprinting mite, Tropilaelaps mercedesae, is shaped by the parasitic for assessing intraspecific variation and genome mapping in life history. Gigascience. 2017; 6: gix008. mites. Experimental and Applied Acarology. 2000; 24: 775- 8. Carroll EL, Bruford MW, DeWoody JA, Leroy G, Strand A, 93. Waits L, et al. Genetic and genomic monitoring with 20. Dautartiene A. Seasonal changes in house dust mites. minimally invasive sampling methods. Evolutionary Ekologija. 2001; 2: 3-7. applications. 2018; 11: 1094-119. 21. Arlian LG, Woodford PJ, Bernstein IL, Gallagher JS. Seasonal 9. Mounsey KE, Willis C, Burgess ST, Holt DC, McCarthy J, p o p u l at i o n st r u c t u re o f h o u s e d u st m i te s , Fischer K. Quantitative PCR-based genome size estimation Dermatophagoides spp. (Acari: Pyroglyphidae). Journal of of the astigmatid mites Sarcoptes scabiei, Psoroptes ovis Medical Entomology. 1983; 20: 99-102. and Dermatophagoides pteronyssinus. Parasites & vectors. 22. Alasaad S, Rossi L, Maione S, Sartore S, Soriguer RC, Pérez 2012; 5: 3. JM, et al. HotSHOT Plus ThermalSHOCK, a new and efficient 10. Navajas M, Fenton B. The application of molecular markers technique for preparation of PCR-quality mite genomic in the study of diversity in acarology: a review. Experimental DNA. Parasitology research. 2008; 103: 1455. and applied acarology. 2000; 24: 751-74. 23. Noge K, Mori N, Tanaka C, Nishida R, Tsuda M, Kuwahara Y. 11. Skoracka A, Magalhaes S, Rector BG, Kuczyński L. Cryptic Identification of astigmatid mites using the second internal speciation in the Acari: a function of species lifestyles or our transcribed spacer (ITS2) region and its application for ability to separate species?. Experimental and Applied phylogenetic study. Experimental & applied acarology. Acarology. 2015; 67: 165-82. 2005; 35: 29-46. 12. Beroiz B, Couso-Ferrer F, Ortego F, Chamorro MJ, Arteaga C, 24. Wong SF, Chong AL, Mak JW, Tan J, Ling SJ, Ho TM. Molecular Lombardero M, et al. Mite species identification in the identification of house dust mites and storage mites. production of allergenic extracts for clinical use and in Experimental and applied acarology. 2011; 55: 123. environmental samples by ribosomal DNA amplification. 25. Kumar S, Stecher G, Tamura K. MEGA7: molecular Medical and veterinary entomology. 2014; 28: 287-96. evolutionary genetics analysis version 7.0 for bigger 13. Arlian LG, Morgan MS. A review of Sarcoptes scabiei: past, datasets. Molecular biology and evolution. 2016; 33: 1870- present and future. Parasites & vectors. 2017; 10: 297. 4. 14. Cruickshank RH. Molecular markers for the phylogenetics of 26. Song Z, Wang X, Liang G. Species identification of some mites and ticks. Systematic and Applied Acarology. 2002; 7: common necrophagous flies in Guangdong province, S 3-15. outhern China based on the rDNA internal transcribed 15. Kane NC, King MG, Barker MS, Raduski A, Karrenberg S, spacer 2 (ITS2). Forensic Science International. 2008; 175: Yatabe Y, et al. Comparative genomic and population 17-22. genetic analyses indicate highly porous genomes and high 27. Yang B, Cai J, Cheng X. Identification of astigmatid mites levels of gene flow between divergent Helianthus species. using ITS2 and COI regions. Parasitology research. 2011; Evolution: International Journal of Organic Evolution. 2009; 108: 497-503. 63: 2061-75. 28. Fain A. Adaptation, specificity and host-parasite 16. Fukuyama S, Nishimura T, Yotsumoto H, Gushi A, Tsuji M, coevolution in mites (Acari). International journal for Kanekura T, et al. Diagnostic usefulness of a nested parasitology. 1994; 24: 1273-83. polymerase chain reaction assay for detecting Sarcoptes 29. Suarez-Martinez EB, Montealegre F, Sierra-Montes JM, scabiei DNA in skin scrapings from clinically suspected Herrera RJ. Molecular identification of pathogenic house scabies. British Journal of Dermatology. 2010; 163: 892-4. dust mites using 12S rRNA sequences. Electrophoresis. 17. Feng S, Jiang M, Shi Y, Jiao K, Shen C, Lu J, et al. Application of 2005; 26: 2927-34. the ribosomal DNA ITS2 region of Physalis (Solanaceae): 30. Alasaad S, Soglia D, Spalenza V, Maione S, Soriguer RC, Pérez DNA barcoding and phylogenetic study. Frontiers in plant JM, et al. Is ITS-2 rDNA suitable marker for genetic science. 2016; 7: 1047. characterization of Sarcoptes mites from different wild 18. Zhao LL, Feng SJ, Tian JY, Wei AZ, Yang TX. Internal animals in different geographic areas? Veterinary transcribed spacer 2 (ITS 2) barcodes: A useful tool for parasitology. 2009; 159: 181-5.

59 Life & Science 2020 Vol. 1, No. 2 Psychometry-Item Analysis ORIGINAL
ARTICLE Item Analysis of Multiple-Choice Questions at the Department of Community Medicine, Wah Medical College, Pakistan Musarat Ramzan1, Shezadi Sabah Imran2, Saana Bibi3, Khola Waheed Khan4, Imrana Maqsood5 ABSTRACT Objective: The objective of the study was to assess the quality of multiple-choice questions (MCQs) of three different assessments in the subject of Community Medicine by computing the difficulty index, discrimination index and reliability and to estimate the relationship between difficulty and discrimination indices. Study Design: Retrospective observational study. Place and Duration of Study: Department of Community Medicine at Wah Medical College from August to December 2018. Materials and Methods: Three sets of MCQs were included in the study. Mean and standard deviation of difficulty and discrimination indices were calculated and one-way analysis of variance and Kruskal Wallis test were applied on difficulty and discrimination indices. The association was determined by Pearson correlation and considered significant at p value of < 0.05. Results: The mean difficulty index of first term, second term and send-up examination were 41.5, 48.8 and 51.9 respectively. Mean discrimination indices were 0.28, 0.27 and 0.26 and reliability were 0.83, 0.81 and 0.79. In the study, 72% MCQs of the first term, 61.5 % of the second term and 63% of the send-up examinations were in the range 30-70% of difficulty. There was a significant difference in the difficulty indices of the three question papers. The correlation between discrimination and difficulty indices was curvilinear and positively correlated. Conclusion: It is concluded that all three question papers have acceptable reliability, more than 65% MCQs have acceptable difficulty index and about 69% have good discriminatory power.

Key Words: Assessment, Difficulty Index, Discrimination Index, Multiple Choice Questions, Reliability.

How to cite this: Ramzan M, Imran SS, Bibi S, Khan KW, Maqsood I. Item Analysis of Multiple-Choice Questions at the Department of Community Medicine, Wah Medical College, Pakistan. Life and Science. 2020; 1(2): 60-63. doi: http://doi.org/10.37185/LnS.1.1.53 Introduction method of assessment in medical colleges.2 The A Assessment is a crucial component of both learning type MCQ provides four to five options, and students and teaching. Continuous improvement in are supposed to select the best answer. These assessment tools has significant impact on the questions not only assess memory and quality of learning and it also enhances the capability understanding but also higher levels of learning i.e of learners.1 Written assessment can be done by application, analysis and evaluation of problems. number of tools including multiple- choice questions Thus, many aspects of the subject can be examined 4 (MCQs). A type of MCQs are the most common with MCQs of high reliability in a short time period. The answering and scoring of MCQs is time effective 1,2,4Department of Community Medicine/ Medical Education3 and logistically efficient.5 However construction of a Wah Medical College flawless MCQ needs time and expertise.6,7 National University of Medical Sciences, Rawalpindi Department of Pharmacology The quality control of items is an important factor to 5Fazaia Medical College improve the quality of assessments and item analysis Air University, Islamabad is a process which assesses not only the quality of Correspondence: items but the entire assessment simultaneously. It Dr. Shezadi Sabah Imran analyzes student responses to individual test items, Associate Professor, Community Medicine Wah Medical College and it is very helpful in recognizing redundant items National University of Medical Sciences, Rawalpindi thus developing a pool of valid items.6,8 Email: [email protected] In item analysis many indices can be calculated like Funding Source: NIL; Conflict of Interest: NIL difficulty index, discrimination index, reliability of Received: July 11, 2019; Revised: Feb 24, 2020 Accepted: Feb 05, 2020 the test, distractor functionality and test score 60 Life & Science 2020 Vol. 1, No. 2 Psychometry-Item Analysis

distribution. Difficulty index also called p value discrimination indices were calculated and one-way depicts the proportion of students who get the item analysis of variance (ANOVA) was applied on right; a high percentage indicates easy and low difficulty indices after assessing the normality of percentage indicates difficult items. The distribution using Kolmogorov-Smirnov test and recommended range is 30-70% and the items Kruskal-Wallis test on discrimination indices of the outside this range have very little power of three examinations. Furthermore, post-hoc analysis discrimination. Discrimination index distinguishes using Tukey HSD test was also done to determine between high and low achievers. Its value ranges which question paper was different from others from 0 to 1. Positive discrimination index means high regarding difficulty index. The relationship between performers choose the right answer of each item difficulty and discrimination indices of 195 items was more frequently than the low achievers who achieve determined by Pearson correlation and it was lower overall score. Negative value means low considered significant at p value of < 0.05. The items performing students get the item right. This may be with index less than 30% were considered difficult due to vague stems or an error in the answer key.1,6,8 and more than 70% were regarded easy. The Difficulty and discrimination indices have positive discrimination index of more than 0.3 considered as association except when the difficulty index is either excellent discrimination, 0.2-0.29 as good. 0-0.19 as too high or too low.2,9 Reliability is also a poor and negative value as defective MCQ. measurement of internal consistency of assessment Results and it ranges from 0 to 1, the higher the value the There were 65 MCQs in all three sets of questions. 1,3 more is the reliability. The Optical Machine Reader The reliability of first term was 0.83, second term was (OMR) uses software programs to find out the item 0.81 and send-up examination was 0.79. Mean with statistics including p value, point biserial, reliability standard deviation and ranges of difficulty and and standard error. discrimination indices regarding first term, second The objective of this study was to assess the quality term and send-up examinations are shown in the of MCQs of three different assessments of Table 1. Community Medicine by computing the difficulty index, discrimination index and reliability and to estimate the relationship between difficulty and discrimination indices. The results of such analysis identify the items that can be retained or modified, 41.5 17.7 revalidated or discarded. This helps in the development of a valid question bank for assessment in the subject of Community Medicine. Materials and Methods The percentages of easy, difficult and acceptable The study was carried out at the Department of items are presented in Figure 1 and the percentages Community Medicine at Wah Medical College from of items having poor, acceptable and excellent August to December 2018. It was a retrospective discrimination are illustrated in Figure 2. observational study and three sets of MCQs in Community Medicine were included in the study. Each question paper comprised of 65 MCQs, one best type with one correct answer (key) and four distracters. A true response to an item was awarded one mark and zero was given to the wrong answer. The response sheets were assessed by an OMR which calculated the difficulty index, discrimination index of each question and reliability of three sets of MCQs. SPSS version 22 was used for further analysis. Fig 1: Difficulty index of MCQ papers of first term, Mean and standard deviation of difficulty and second term and sendup assessments 61 Life & Science 2020 Vol. 1, No. 2 Psychometry-Item Analysis

Discussion MCQs are a valuable and efficient tool to assess student cognition however, their effectiveness depends on the quality of MCQs which is best appraised by item analysis. We aimed to perform item analysis of three question papers of our Department. The mean difficulty indices of first term, second term and send-up examination were 41.5, 48.8 and 51.9, respectively. This showed that all three assessments Fig 2: Discrimination index of MCQ papers of first term, had questions with moderate difficulty. The results second term and sendup assessments were comparable with the studies carried out by The mean difficulty indices of the three internal Mozaffal et al9 and Sushua et al10 but contradictory to examinations were significantly different from each Joao Pais et al11 and Sanju Gajjar et al.2 other and post hoc analysis showed that the send-up The mean discrimination indices of the three examination was significantly different from the first examinations were 0.28, 0.27 and 0.26 showing that term examination (Table 2) while mean all three assessments had good discrimination. The discrimination indices of the three examinations results were similar to the studies conducted by were not significant (p value=0.181) after applying Sushua et al 10and Pais et al11 but dissimilar with the Kruskal-Wallis test. Gajjar et al2 and Sook Park et al.12 In the current study, 72% MCQs of the first term, 61.5% of the second term and 63% of the send- up examinations were in the acceptable range of difficulty. The rest of the MCQs were either very easy or very difficult needing modification or substitution. This result was almost similar with the prior study of Manish et al.13 Regarding discrimination index, 72% MCQs of the first term and 67.6% MCQs of the *P<0.05 was considered significant using one-way ANOVA. second term and send-up examination respectively **Send-up results found significantly different from 1st were in the acceptable range and had a tendency to term results by using Tukey HSD test. discriminate between the high and low achievers.14 The scatter diagram showed curvilinear relationship As 69% of total MCQs had acceptable discriminatory between difficulty and discrimination indices of 195 power therefore these three papers were considered items was made. The discrimination index correlated to be good question papers.15 The MCQs having poor positively with the difficulty index (r= 0.438 p<0.001) or negative discrimination were either very easy or and maximum discrimination i.e more than 0.4 was very difficult16 and required to be reviewed by experts corresponding with the items having difficulty index for identifying possible reasons of poor of 30 to 78 percent (Figure 3). discrimination like ambiguous questions, wrong key, implausible distracters and need to be reconstructed as valid items. The reliability of all three assessments was good and acceptable as they were low stakes examinations. The difficulty index of the send-up examination was significantly different from other assessments and this might be because of better preparation of students for send-up examinations. MCQs having difficulty index between 30 to 78 percentage had Fig 3: Correlation between difficulty and discrimination more discriminatory power as compared to MCQs indices of three assessments 62 Life & Science 2020 Vol. 1, No. 2 Psychometry-Item Analysis that were not with in this range. Similar results have GK, Syed S, et al. Faculty development programs improve been observed in different studies. Sim et al showed the quality of Multiple Choice Questions items' writing. Sci Rep. 2015; 5: 9556. non-linear relation between both the indices of the 6. Kaur M, Singla S, Mahajan R. Item analysis of in use multiple 17 three examinations of year two medical students. choice questions in pharmacology. Int JAppl Basic Med Res. Deena et al showed significant dome shaped 2016; 6: 170-3. correlation (r=0.162) between difficulty and 7. Rush BR, Rankin DC, White BJ. The impact of item-writing discrimination indices.18 Mitra et al showed flaws and item complexity on examination item difficulty and discrimination value. BMC Med Edu. 2016; 16: 250. significant negative correlation between difficulty 8. Namdeo SK, Sahoo B. Item analysis of multiple choice 19 and discrimination indices (-0.325). This means that questions from an assessment of medical students in with increasing difficulty index, there was decrease Bhubaneswar, India. International Journal of Research in in discrimination index. Habib et al showed negative Medical Sciences. 2016; 4: 1716-9. 20 9. Hingorjo MR, Jaleel F. Analysis of one-best MCQs: the correlation (-0.453) between the two indices. difficulty index, discrimination index and distractor Recommendations efficiency. J Pak Med Assoc. 2012; 62: 142-7. This study emphasizes the need of modification and 10. Pande SS, Pande SR, Parate VR, Nikam AP, Agrekar SH. reconstruction of MCQs having less discriminatory Correlation between difficulty and discrimination indices of MCQs in formative exam in physiology. South-East Asian ability. The items having negative discrimination Journal of Medical Education. 2013; 7: 45-50. index should be evaluated to determine flaws either 11. Pais J, Silva A, Guimarães B, Povo A, Coelho E, Silva-Pereira F, in the vignette, lead in or in the key. Based on the et al. Do item-writing flaws reduce examinations results of this study it is recommended that post hoc psychometric quality? BMC Res Notes. 2016; 9: 399. 12. Park IS, Suh YO, Park HS, Kang SY, Kim KS, Kim GH, et al. Item analysis of all examinations should be performed to development process and analysis of 50 case-based items increase the validity and authenticity of question for implementation on the Korean Nursing Licensing bank for future use. This analysis would also help the Examination. J Educ Eval Health Prof. 2017; 14: 20. educators to identify their inadequacy in making 13. Badkur M, Suryavanshi G, Abraham AK. The correlation assessments. between the acceptable range of difficulty and discrimination indices in four response type multiple choice Conclusion questions in physiology. Indian Journal of Basics and It is concluded that all three question papers have Applied Medical Research. 2017; 6: 695-700. acceptable reliability which were 0.83, 0.81 and 0.79, 14. Tejinder S, Piyush G, Dalijit S. Principles of medical education. 3rded. New Dehli: Jaypee Brothers. 2013. p. 70-1. respectively. More than 65% MCQs have an 15. Hermi A, Achour W. Item analysis of examinations in the acceptable difficulty index and about 69% have good Faculty of Medicine of Tunis.Tunis Med. 2016; 94: 247-52. discriminatory power. The items which do not meet 16. Borwn FG. Principles of educational and psychological rd the acceptable criteria may be altered or discarded. testing. 3 ed. New York: Rinehart and Winston. 1983. p. 55- 6. 17. Sim SM, RasiahRI. Relationship between item difficulty and REFERENCES discrimination indices in true/false-type multiple choice 1. Islam Zu, Usmani A. Psychometric analysis of Anatomy questions of a para-clinical multidisciplinary paper. Ann MCQs in Modular examination. Pak J Med Sci. 2017; 33: Acad Med Singapore. 2006; 35: 67-71. 1138-43. 18. Kheyami D, Jaradat A, Al-Shibani T, Ali FA. Item Analysis of 2. Gajjar S, Sharma R, Kumar P, Rana M. Item and test analysis Multiple Choice Questions at the Department of to identify quality multiple choice questions (MCQs) from Paediatrics, Arabian Gulf University, Manama, Bahrain. an assessment of medical students of Ahmedabad, Gujarat. Sultan Qaboos Univ Med J. 2018; 18: 68-74. Indian J Community Med. 2014; 39: 17-20. 19. Mitra NK, Nagaraja HS, Ponnudurai G, Judson JP. The levels 3. Rahma NAA, Shamad MMA, Idris MEA, Elfaki OA, Elfakey of difficulty and discrimination indices in type a WEM, Salih KMA. Comparison in the quality of distractors in multiplechoice questions of pre-clinical semester 1, three and four options type of multiple choice questions. multidisciplinary summative tests. IeJSME. 2009; 3: 2-7. Adv Med Educ Prac. 2017; 8: 287-91. 20. Habib MA, Talukder HK, Rahman MM, Ferdousi S. Post- 4. Ramakrishnan M, Sathe AB, Vinayak A. Item analysis: a tool application Quality Analysis of MCQs of Preclinical to increase MCQ validity. Indian J Basic Appl Med Res. 2017; Examination Using Item Analysis. Bangladesh Journal of 6: 67-71. Medical Education. 2016; 7: 2-7. 5. Abdulghani HM, Ahmad F, Irshad M, Khalil MS, Al-Shaikh

63 Life & Science 2020 Vol. 1, No. 2 Hemodynamics of Orotracheal Intubation ORIGINAL
ARTICLE Comparison of Hemodynamic Response to Orotracheal Intubation with Conventional Laryngoscope versus Fiberoptic Bronchoscope Khalid Zaeem Aslam, Sanum Kashif, Amna Gulrez ABSTRACT Objective: To compare the hemodynamic response to orotracheal intubation via direct laryngoscope versus fiberoptic bronchoscope in patients undergoing general anesthesia. Study Design: Comparative Study. Place and Duration of Study: Anesthesia Department of Military Hospital, Rawalpindi from 1st March to 30th May 2014. Materials and Methods: A total of 110 patients for elective surgeries with general anesthesia, were included and randomized into two groups. The patient in group F (n=55) were intubated by direct laryngoscopy (DLS) and group L (n=55) cases intubated by fiberoptic bronchoscopy (FOB). The hemodynamic response heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP) and mean arterial pressure (MAP) were recorded at baseline, at induction, at laryngoscopy, at the time of intubation and 3 minutes after intubation. Results: The age of the patients ranged between 19-45 years. Average age of participants was 33.76 and 31.56 and average weight of patients was 71.22±1.493 and 73.18±1.390 Kg in group F and L respectively. At induction, hemodynamic values dropped to 20% of the baseline values. At the time of intubation (laryngoscopy or fiberoptic bronchoscopy) and 3 min after intubation, hemodynamic values increased significantly (p<0.05) in both groups. Conclusion: Our study demonstrated that both groups (Fiberoptic bronchoscopy verses direct laryngoscopy) showed same hemodynamic responses during orotracheal intubations.

Key Words: Direct Laryngoscope (DLS), Fiberoptic Bronchoscope (FOB), Hemodynamic Response, Orotracheal Intubation.

How to cite this: Aslam KZ, Kashif S, Gulrez A. Comparison of Hemodynamic Response to Orotracheal Intubation with Conventional Laryngoscope versus Fiberoptic Bronchoscope. Life and Science. 2020; 1(2): 64-67. doi: https://doi.org/10.37185/LnS.1.1.56 Introduction management. Fiberoptic intubation can avoid Hemodynamic responses are affected by the mechanical stimulus to oropharyngeal and laryngeal technique of laryngoscopy and the type of structures, thereby it is likely to attenuate instruments like direct laryngoscope (DLS) h em od y na m i c r esponses during orotracheal and fiberoptic bronchoscope (FOB).1,2 These intubation. However, relevant studies show 5,6 interventions increase sympathetic activity which conflicting results. The rationale of this study was results in hypertension and tachycardia. to compare the hemodynamic response of Most routine orotracheal or nasotracheal orotracheal intubation using FOB versus DLS in intubations are performed with the help of patients undergoing general anesthesia. conventional laryngoscope that has a curved or Materials and Methods straight blade and other external adjuncts such as The study was conducted at Anesthesia Department external laryngeal pressure, a bougie, a stylet, or of Military Hospital, Rawalpindi from 1st March to 30th Magill forceps may also be needed.3,4 May 2014 after approval by ethical review FOB is an important instrument for difficult airway committee of Military Hospital Rawalpindi and Department of Anethesia written informed consent, 110 adult patients, Military Hospital, Rawalpindi American Society of Anesthesiologists (ASA) physical Correspondence: status I-II, scheduled for elective surgeries under Maj Dr. Sanum Kashif general anesthesia requiring orotracheal intubation Department of Anethesia Military Hospital, Rawalpindi were included in this study. Patients with anticipated E-mail: [email protected] difficult airways, asthma, cardiovascular disease, Funding Source: NIL; Conflict of Interest: NIL gastroesophageal reflux disease, morbid obesity and Received: Jul 15, 2019; Revised: Jan 28, 2020 known hypertension, were excluded from the study. Accepted: Feb 11, 2020 64 Life & Science 2020 Vol. 1, No. 2 Hemodynamics of Orotracheal Intubation

Patients were randomly divided equally into the L induction values, at direct laryngoscopy and (laryngoscope) group (n=55) and the F (fiberoptic fiberoptic bronchoscopy, in both group L and F bronchoscope) group (n=55). Randomization was caused same significant increases in BP and HR based on computer-generated codes that were (p<0.05) (Table 1). maintained in sequentially numbered opaque envelopes. All patients were nil by mouth (NPO) at the time of surgery. Baseline hemodynamics were recorded. Anesthesia was induced with Propofol 2mg/kg, Atracurium 0.5mg/kg and Nalbuphine 0.1mg /kg via 20G intravenous cannula. Hemodynamics were noted just after induction of anesthesia. Direct laryngoscopy or fiberoptic bronchoscopy was started as per randomization three minutes after Atracurium injection. In group L, the tracheal tube was inserted into the trachea under direct vision using a Macintosh laryngoscope (size 3.0) according to the conventional manner. In the group F, a FOB with an outer diameter of 5.1 mm was used for tracheal intubation. Hemodynamic 45 45 responses were recorded at intubation and three minutes after intubation. After successful 33 31 intubation, intermittent positive pressure ventilation (IPPV) was performed with a fresh gas flow of 1.5 L/min. Anesthesia was maintained with 19 20 1% isoflurane and 50% nitrous oxide in oxygen. Patients requiring more than one attempt to achieve successful intubation were excluded from the study. All data was analyzed with SPSS 10.1 statistical software (SPSS Inc., Chicago, USA). Demographic and F Group L Group clinical data from the two groups were compared Fig 1: Median age in years between groups using the two-tailed t-test and chi-square test. The comparisons of hemodynamic data of the two 90 90 groups were made using the two-way repeated measure analysis of variance (ANOVA) and t-test. All 70 quantitative data were expressed as mean standard 65 G) deviation (SD). A p<0.05 was considered statistically 50 40 significant. Results The study reported no significant difference in the demographic and baseline values of blood pressure MEDIAN WEIGHT (K (BP) and heart rate (HR) (Table 1). Age of the patients ranged between 19-45 years. Average age of F Group L Group participants was 33.76 and 31.56 years (p=0.815) as Groups shown in (Figure 1) and average weight of patients Fig 2: Mean weight in kg between groups was 71.22+_1.493 and 73.18+_1.390 (Kg) in group F and L (p=0.338) respectively (Figure 2). At induction, Discussion haemodynamic values were decreased but within Hemodynamic stability during airway manipulation 20% of the baseline values. The baseline and for endotracheal intubation is crucial in surgeries

65 Life & Science 2020 Vol. 1, No. 2 Hemodynamics of Orotracheal Intubation

under general anesthesia. Profound hemodynamic manipulation produces more sympathetic changes during direct laryngoscopy or fiberoptic stimulation. Tracheal tube insertion itself is the most bronchoscopy may cause deleterious effects. There invasive stimulus and may be the major cause of are different ways to attenuate that hemodynamic cardiovascular responses to the tracheal response.7,8 Paul A et al, in their study on ASA I and II intubation.18 patients (n=50) scheduled for elective surgery under Conclusion general anesthesia requiring orotracheal intubation, Our study showed that orotracheal intubation with demonstrated that the orotracheal intubations using the help of FOB in surgeries under general anesthesia different laryngoscopes produced similar in adult patients, causes the same significant 9 hemodynamic responses. Micpovilytė V et al increase in hemodynamics as a DLS. showed that patients who were scheduled for different elective surgeries under general REFERENCES anesthesia, produced almost same stress response 1. Gill N, Purohit S, Kalra P, Lall T, Khare A. Comparison of to tracheal intubation.10 Buhari FS, Selvaraj V et al, hemodynamic responses to intubation: Flexible fiberoptic conducted a study on ASA I–II patients, (n=90) bronchoscope versus McCoy laryngoscope in presence of rigid cervical collar simulating cervical immobilization for requiring orotracheal intubation under general traumatic cervical spine. Anesthesia, essays and anethesia via different laryngoscopes. Patients were researches. 2015; 9: 337-42. randomly allocated into three groups. Results of 2. Aggarwal H, Kaur S, Baghla N, Kaur S. Hemodynamic study showed that the orotracheal intubation via Response to Orotracheal Intubation: Comparison between conventional laryngoscopy with Macintosh Macintosh, McCoy, and C-MAC Video Laryngoscope. Anesthesia, essays and researches. 2019; 13: 308-12. larnygoscope produced less haemodynamic 3. Zhang Y, Zeng Z, Xiao G, Zhang W, Lin W, Deng J. A 11 response as compare to other laryngoscopes. randomized trial to evaluate a modified tracheal catheter Hegazy AA et al reported that endotracheal with upper and lower balloons for anesthetic intubation using fiberoptic bronchoscope, produces administration: effect on the cardiovascular, stress response, and comfort in patients undergoing laparoscopic more stimulus to the airway due to prolonged cholecystectomy. BMC anesthesiology. 2019; 19: 211. intubation time, which invalidates its benefit of 4. Bansal S, Bansal S, Kaur D, Sharma S. Comparative avoiding oropharyngeal and laryngeal stimulation.12 evaluation of intubating conditions and hemodynamic In addition, the advancement of the tracheal tube response to laryngoscopy and intubation with McCoy and over the FOB is often impeded when the Murphy's Macintosh laryngoscopes; a prospective randomized study. Anaesthesia, Pain & Intensive Care. 2018; 22: 193-8. tip catches on the downward sagging epiglottis, 5. Zhang Y, Xiao D, Lin W, Zhang W, Luo R. Comparison of video arytenoid cartilage, vocal cords and anterior tracheal laryngoscope, direct laryngoscopy and fibreoptic wall. On such occasions, the successful intubation bronchoscope nasal intubation on hemodynamics, often requires some specific maneuvers for example, inflammatory and stress response. China Journal of Endoscopy. 2016; 22: 51-6. rotating the tracheal tube, further lifting jaw upward 6. Amini S, Shakib M. Hemodynamic changes following and adjusting the patient's head-neck position which endotracheal intubation in patients undergoing cesarean can result in hypertension and tachycardia.13 All section with general anesthesia: application of glidescope® these procedures are invasive, and may further videolaryngoscope versus direct laryngoscope. stimulate the pharyngeal and laryngeal structures. Anesthesiology and pain medicine. 2015; 5: e21836. 7. Sachidananda R, Umesh G. A review of hemodynamic These responses can be attenuated by different response to the use of different types of laryngoscopes. 14 group of drugs e.g dexmedetomidine and fentanyl. Anaesthesia, Pain & Intensive Care. 2019; 24: 201-8. During the fiberoptic intubation, the insertion cord 8. Rajan S, Kadapamannil D, Barua K, Tosh P, Paul J, Kumar L. must be placed into the trachea for guidance Ease of intubation and hemodynamic responses to nasotracheal intubation using C-MAC videolaryngoscope followed by advancing the tracheal tube over the with D blade: a comparison with use of traditional insertion cord into the trachea and then the FOB is Macintosh laryngoscope. Journal of anaesthesiology, removed.15 This can cause repeated friction and clinical pharmacology. 2018; 34: 381-5. irritation to the trachea.16,17 The laryngoscopy 9. Paul A, Nathroy A. Comparison of hemodynamic changes produces a balanced stimulation of vagal and cardiac during laryngoscopy with McCoy and Macintosh laryngoscopes. Journal of Health Research and Reviews. accelerator fibers, whereas the intratracheal 2017; 4: 35-9.

66 Life & Science 2020 Vol. 1, No. 2 Hemodynamics of Orotracheal Intubation

10. Micpovilytė V, Zubavičiūtė I, Rancevienė D, Macas A. study. Journal of anaesthesiology, clinical pharmacology. Flexible fiberoptic intubation comparison with other 2015; 31: 212-6. intubation techniques. SVEIKATOS. 2018; 28: 75-83. 15. Parasa M, Yallapragada SV, Vemuri NN, Shaik MS. 11. Buhari FS, Selvaraj V. Randomized controlled study Comparison of GlideScope video laryngoscope with comparing the hemodynamic response to laryngoscopy Macintosh laryngoscope in adult patients undergoing and endotracheal intubation with McCoy, Macintosh, and elective surgical procedures. Anesthesia, essays and C-MAC laryngoscopes in adult patients. Journal of researches. 2016; 10: 245-9. anaesthesiology, clinical pharmacology. 2016; 32: 505-9. 16. Hoshijima H, Denawa Y, Tominaga A, Shiga T, Nagasaka H. 12. Hegazy AA, Al-Kawally H, Ismail EF, Abedlmabood MA, Videolaryngoscope versus Macintosh laryngoscope for Mandour UA. Comparison between fiberoptic tracheal intubation in adults with obesity: A systematic bronchoscope versus C-MAC video-laryngoscope for awake review and meta-analysis. Journal of clinical anesthesia. intubation in obese patients with predicted difficult airway. 2018; 44: 69-75. Research and Opinion in Anesthesia and Intensive Care. 17. Tseng KY, Lu IC, Shen YC, Lin CH, Chen PN, Cheng KI. A 2018; 5: 134-40. comparison of the video laryngoscopes with Macintosh 13. Bharti N, Arora S, Panda NB. A comparison of McCoy, laryngoscope for nasotracheal intubation. Asian journal of TruView, and Macintosh laryngoscopes for tracheal anesthesiology. 2017; 55: 17-21. intubation in patients with immobilized cervical spine. 18. Godbole MR, Saundattikar G. A prospective randomized Saudi journal of anaesthesia. 2014; 8: 188-92. control trial-Comparison of hemodynamic response to 14. Mondal S, Ghosh S, Bhattacharya S, Choudhury B, Mallick S, laryngoscopy and intubation–Macintosh versus McCoy Prasad A. Comparison between dexmedetomidine and blade. Indian Journal of Clinical Anaesthesia. 2018; 5: 110- fentanyl on intubation conditions during awake fiberoptic 3. bronchoscopy: A randomized double-blind prospective

67 Life & Science 2020 Vol. 1, No. 2 Substance Abuse ORIGINAL
ARTICLE Substance Abuse: From Abstinence to Relapse Saira Javed1, Kamran Chughtai2, Shoaib Kiani3 ABSTRACT Objective: The current study objective was to identify and explore the common reasons of relapse after abstinence in drug addiction. Study Design: Cross sectional. Place and Duration of Study: The study was conducted at the Department of Psychiatry Combined Military Hospital, Abbottabad from January to August 2019. Materials and Methods: Individuals who were drug dependent and reported for detoxification were included in the study. Individual interviews were conducted through thematic guide regarding demographic details, name of substance of abuse, duration of substance abuse, number of previous self-attempts to quit the drug, average period of abstinence after self-attempt, reason of relapse after self-attempt, previous assisted attempts to quit the habit, average period of abstinence after assisted attempt, reason of relapse after assisted attempts. The responses were analyzed by using content analysis. Results: Participants (N=34) were males, age range 25 to 40 years, 58% married, 11% uneducated, 79% employed, 47% heroin addiction and 11% were using cannabis. The common reasons of relapse among self –attempt and assisted-attempt addicts after abstinence in drug addiction were peer pressure (social pressure), negative emotions from family (aggression discouragement and lack of empathy/sympathy), stress (traumatic events, bad physical/mental health)/ lack of motivation and easy availability of drugs (cheap, affordable and distributors are approachable). Resentment against confinement at rehabilitation centers was found only among assisted-attempt addicts after abstinence. Half of the self-attempt participants of the study, were abusing drugs for about last 5 years, 20% had tried to quit the drug on their own at least twice, 41.18 % for two weeks, 32.35 % for 1 month, and 26.47% remained abstinent after self-attempt to quit the drug for more than 6 months. On the contrary, 47 % of these individuals had two previous assisted attempts at rehabilitation centers to quit the drug. After assisted attempts 32.35 % remained abstinent for less than one day, 52.94% for one day, and 14.71 % for less than one week. Conclusion: It is concluded that the main reasons of relapse are emotional instability, lack of family cooperation and confinement at rehabilitation centers against the will of individual for longer time. Therefore, rehabilitation process should be initiated with the motivation of the individual, followed by psycho education of the family and avoidance of unnecessary prolongs admission without consent of the individual.

Key Words: Abstinence, Rehabilitation, Substance Abuse.

How to cite this: Javed S, Chughtai K, Kiani S. Substance Abuse: From Abstinence to Relapse. Life and Science. 2020; 1(2): 68-71. doi: http://doi.org/10.37185/LnS.1.1.94 1Department of Social and Behavioral Sciences Introduction National University of Medical Sciences, Rawalpindi 2 Pakistan is one of the highest-ranking countries in Department of Psychiatry the world with maximum number of drug addicts Combined Military Hospital, Abbottabad 3 i.e., 6.7 million drug users. Substance abuse is Personal Administration Directorate GHQ, Rawalpindi conceptualized as one of the chronic ailments, Correspondence: accompanied with many physical and psychiatric Ms. Saira Javed issues that also poses substantial economic burden, Department of Social and Behavioral Sciences not solely for an individual itself but for rest of family National University of Medical Sciences, Rawalpindi members and society too.1 In every culture or nation, E-mail: [email protected] prevention of relapse is one the biggest and most Funding Source: NIL; Conflict of Interest: NIL important challenge.2 The phenomenon of relapse is Received: Jan 16, 2020; Revised: Feb 25, 2020 Accepted: Mar 05, 2020 not easy to understand. It is complex, unpredictable 68 Life & Science 2020 Vol. 1, No. 2 Substance Abuse

and dynamic. Many studies have found relapse after about 47% and 32% respectively in addition with successful detoxification and rehabilitation. The core other drugs like ice, cough syrups and barbiturates. feature of addiction is relapse to drug usage.3,4 In this study it is evident to mention that 14.7% However, in ideal situation, substance dependency is participants have shown no specific evidence of thought to condense after efficacious detoxification relapse after self and assisted attempt. and rehabilitation determinations, but evidence has Reason of relapse after self-attempt were recorded shown the hardest job for drug addicts is to keep 26.5% due to peer pressure (social pressure), 41.2% away from drugs. Most of the relapsed cases (90%) have reported that negative emotions from family had been reported in time duration of six months, (aggression discouragement and lack of after been discharged from rehabilitation center. empathy/sympathy) resulted in relapse. With most of the addicts were heroine abuser.4 Many Furthermore, 14.7% participants reported stress national and international programs are being run by (traumatic events, bad physical/mental health) and various rehabilitation centers in Pakistan. Evidences 2.9% easy availability of drugs (cheap, affordable and have shown that 70% to 90% substance abusers distributors are approachable) were main cause of return to the practice within one year after relapse after- self attempt of abstinent. In contrast, detoxification from hospitals or rehabilitation reason of failure after assisted attempt or relapse in centers, if they are constrained and apprehended at 20.6% were because of peer pressure (social the recovery centers.4,5 Relapse is a complex pressure), negative emotions from family phenomenon which resulted in clusters of factors (aggression discouragement and lack of like personality types, temperaments, lack of coping empathy/sympathy) were the cause in 5.9% only skills, emotional instability, pessimistic approach, drug addicts, whereas lack of motivation was in 2.9% traumatic events, aggression, peer pressure, and 55.9% was resentment against confinement at f i n a n c i a l co n st ra i nt s , d efe c t i ve fa m i l y rehabilitation centers as shown in table 1. communication, culture and other environmental factors.5,6,7 The aim of this study is to explore the reasons for relapse after successful abstinence, and to provide empirical insight for health care professionals.7-8 Materials and Methods The study was conducted at the Department of Psychiatry from Combined Military Hospital, Abbottabad, from January to August 2019. Questionnaire was designed after extensive literature review of reasons of relapse after abstinence. In depth psychiatric inquiry was also done after filling of structured demographic sheet (tendencies for relapse, interpersonal conflicts, social pressures, self-efficacy, social /family support and employer attitude towards drug abuse) from the participants. Only those individuals were included in this study who were able to sign the consent form. Results In this study thirty four patients were included who were relapsed addicts undergoing treatment at rehabilitation centers. All participants were males, mostly 25 to 40 years of age, 58% were married, 11% were uneducated, 79% were employed. Most In self-attempt, 50% of participants were abusing common drug of abuse was heroin and cannabis drugs for about last 5 years. 20% of these individuals 69 Life & Science 2020 Vol. 1, No. 2 Substance Abuse

had tried to quit the drug on their own (self- were able to maintain abstinence for six months or attempted) at least twice in last five years, 41.18% for more There are numerous factors responsible for two weeks, 32.35% for 1 month, and 26.47% drug abuser relapse.8 Identification of causes among remained abstinent after self-attempt to quit the addicts associated with relapse can help to devise a drug for more than 6 months. On the contrary, 47% management plan so that patients can continue of these individuals had two previous assisted abstinent effectively.9 Studies have explained that attempts at rehabilitation centers to quit the drug. relapse is more expected to happen among After assisted attempts 32.35% remained abstinent individuals who have maladaptive coping strategies8, for less than one day, 52.94% for 1 day, and 14.71% low socioeconomic status10, higher distress11,13 and for less than 1 week as shown in table 2. anxiety.12,13 Similar trends have been seen in this study, where highest relapse rate has been found among individual with negative emotions and receive insufficient support from their loved ones.14,15 Respondents 41% have reported that negative emotions from the family demotivates them. Furthermore, 26% individuals explained that peer pressure leads to relapse in otherwise motivated individuals. It is important to document that duration of abstinence was higher among those participants who were convinced and encouraged to quit habit as compared to those participants who were forced to choose abstinent against their choice.16,17 Apart from many other bio-psycho-social causes that eventually Discussion contribute to relapse, social/peer pressure and The most common challenge faced by community, negative emotions from family are the most family or by drug abuse individual himself is of dominant. Positive support from family members relapse. Relapse is accompanied by many psycho- induce confidence, brings emotional stability and 9,10 social factors that lead to abstinent. The study develop optimistic approach in addicts that explored the common reasons for the relapse of motivates them to quit drug abuse by bringing substance abuse. Evidences have shown that the positive reinforcement. It is important to motivate excessive abuse of heroine drug is followed by the drug abuser to quit but equally important is to cannabis. Interestingly, many drug addicts reported educate member to identify negative behaviors and that they intent to stop the habit of substance abuse, approaches so that rehabilitation and abstinence of 72% participants tried to quit the habit of drug abuse the individual is more operative, efficient and willingly by noticing its consequences in daily life and persistent.17,18,19 on their health, but they also reported that despite Conclusion the factor of motivation and insight of consequences It is concluded that efficient rehabilitation programs they were unable to quit and were not able to are required to avoid relapse after abstinence as continue abstinence. The empirical evidence of the number of successful cases are lower than the current study is opposing to the previous studies expected rate. It is also important to bring insight where researchers found it was difficult for the among drug abusers through various formal and abusers to quit drugs.8,11 non-formal education programs. Individuals must It has been seen that substance abusers who were not be confined to rehab against their consent. The self-motivated were able to retain their abstinence family needs to be educated about consequences of for an extended period of six months. Conversely, issue. Finding a tailor-made solution for these those participants who were forced to leave the individuals may substantiate to be like exploring a habit against their will in rehabilitation centers, the needle in haystack, but it's worth trying to facilitate abstinence time is less than one week and only few 70 Life & Science 2020 Vol. 1, No. 2 Substance Abuse these individuals who have been casted out of the relapse after inpatient opioid detoxification during 1 year society. follow up. J Addict. 2016: 7620860. 11. Dixit S, Chauhan VS, Azad S. Social support and treatment outcome in Alcohol dependence syndrome in Armed REFERENCES forces. J clin Dign Res. 2015; 9: VC01–VC05. 1. Aziz K, Mohsen N, Jafar H, Rostam M. Survival Analysis of 12. Bold KW, McCarthy DE, Minami H, Yeh VM, Chapman GB, Drug Abuse Relapse in Addiction Treatment Centers. Int J Waters AJ. Independent and interactive effects of real time High Risk Behav Addict. 2015; 4: e23402. risk factors on later temptations and lapses among smokers 2. Venniro M, Caprioli D, Shaham Y. Novel models of drug trying to quit. Drug alcohol Depend. 2016; 158: 30-7. relapse and craving after voluntary abstinence. 13. Al Abeiat DD, Hamdan-mansour AM, Hanouneh SI, Neuropsychopharmacology. 2019; 44: 234-5. Ghannam BM. Psychosocial predictors of relapse among 3. Korlakunta A, Chary RSS, Reddy CMP. Reasons for relapse in patients with alcohol problem. Curr Drug Abuse Rev. 2016; patients with alcohol dependence. AP J Psychol Med. 2012; 9: 19-25. 13: 108-4. 14. Macey PR. Alcohol Use Disorder Recovery and 4. Appiah R, Danquah SA, Nyarko K, Ofori-Atta AL, Aziato L. Relationships: The Impact of Family Functioning on the Pre- Precipitants of substance abuse relapse in Ghana: A Frontal Cortex and Romantic Relationships of Individuals in qualitative exploration. Journal of drug issues. 2017; 47: Recovery from Alcohol Use Disorder (Doctoral dissertation) 104-15. 2019. 5. McCabe SE, Cranford JA, Boyd CJ. Stressful Events and Other 15. Naji L, Dennis BB, Bawor M, Plater C, Pare G, Worster A, et al. Predictors of Remission from Drug Dependence in the A Prospective Study to Investigate Predictors of Relapse United States: Longitudinal Results from a National Survey. J among Patients with Opioid Use Disorder Treated with Subst Abuse Treat. 2016; 71: 41-7. Methadone. Subst Abuse. 2016; 10: 9-18. 6. Atadokht A, Hajloo N, Karimi M, Narimani M. The role of 16. Adinoff B, Carmody TJ, Walker R, Donovan DM, Brigham GS, family expressed emotion and perceived social support in Winhusen TM. Decision-making processes as predictors of predicting addiction relapse. Int J High Risk Behav Addict. relapse and subsequent use in stimulant-dependent 2015; 4: e21250. patients. Am J Drug Alcohol Abuse. 2016; 42: 88-97. 7. Appiah R, Boakye KE, Ndaa P, Aziato L. “Tougher than ever”: 17. Yang M, Mamy J, Gao P, Xiao S. From abstinence to relapse: a An exploration of relapse prevention strategies among preliminary qualitative study of drug users in a compulsory patients recovering from poly-substance use disorders in drug rehabilitation center in Changsha, China. PLoS One. Ghana. Drugs: Education, Prevention and Policy. 2018; 25: 2015; 10: e0130711. 467-74. 18. Albuquerque RC, Nappo SA. Reasons to crack consumption 8. kocak ND, Eren A, Akturk UA, Arinc S, Senqul A. Relapse rate relapse. Users' perspective. Jornal Brasileiro de Psiquiatria. and factors related to relapse in a 1 years follow up of 2018; 67: 194-200. subjects participating in smoking cessation program. Respir 19. Chan GH, Lo TW, Tam CH, Lee GK. Intrinsic motivation and Care. 2015; 60: 1796-803. psychological connectedness to drug abuse and 9. Matto SK, Chakrabarti S, Anjaiah M. Psychosocial factors rehabilitation: The perspective of self-determination. associated with relapse in men with alcohol or opioid International journal of environmental research and public dependence. Indian J Med Res. 2009; 130: 702-8. health. 2019; 16: 1934. 10. Chalana H, Kundal T, Gupta V, Malhari AS. Predictors of

71 Life & Science 2020 Vol. 1, No. 2 Inimical Effects of NaF on Rat Ovaries ORIGINAL
ARTICLE Inimical Effects of Sodium Fluoride on Ovarian Weight and Relative Tissue Weight Index of Adult Albino Rats Tahira Athar1, Muhammad Suhail2, Javaid Iqbal3, Tayyaba Muzaffar4, Hina Majid5 ABSTRACT Objective: To determine the impacts of sodium fluoride on ovarian weight and relative tissue weight index (RTWI) of adult Wistar albino rats. Study Design: Comparative study. Place and Duration of Study: This experimental study was performed at the Department of Anatomy, at Shaikh Zayed Postgraduate Medical Institute, Lahore from 25th November to 24th December 2016. Materials and Methods: Forty-four adult female albino Wistar rats were selected randomly for this study. They were segregated into 4 groups, each comprised of eleven rats. Group A was control, group B was low dose experimental, group C was medium dose experimental and group D was high dose experimental. The control group received distilled water whereas low, medium and high dose experimental groups received 100mg/L, 200mg/L and 300mg/L sodium fluoride solution respectively. The animals were weighed before and after experiment. At 31st and 32nd day, dissection was done, ovaries were removed and evaluated for ovarian tissue weight and RTWI. Results: The mean weight and RTWI of paired ovaries among the experimental groups were decreased. The differences among groups were statistically significant. Conclusion: The present study confirms that sodium fluoride has detrimental dose dependent effects on ovarian weight and RTWI of adult albino rats.

Key Words: Dental Health, Dental Caries, Sodium Fluoride, Wistar Rats.

How to cite this: Athar T, Suhail M, Iqbal J, Muzaffar T, Majid H. Inimical Effects of Sodium Fluoride on Ovarian Weight and Relative Tissue Weight Index of Adult Albino Rats. 2020; 1(2): 72-76 . doi: http://doi.org/10.37185/LnS.1.1.101 Introduction optimum fluoride intake range of 2-4mg/day 5,6 Sodium fluoride is a chemical compound that is used according to WHO criteria. to fluoridate drinking water.1,2 It occurs naturally in Sodium fluoride is an insecticide that acts as stomach 7 plutonic nepheline syenite rocks, which are present poison for plant feeding insects. It has bactericidal in different areas of world.3,4 Fluoride concentration action for oral microbes that maintain dental health 8 varies in different water sources while in drinking and prevent dental caries. It is also used in water, optimum fluoride level ranges 0.7-1.2ppm. toothpastes, mouthwashes, lozenges and varnishes. The average daily consumption of fluoride from The ionic fluorides not only repair the enamel of different sources by an adult female is 3mg/day and teeth but also make enamel acid resistant so that by an adult male is 4mg/day, which lies in the damage through acid production by microbial agents

1 is reduced. It leads to remineralization of teeth Department of Anatomy 9,10 Services Institute of Medical Sciences, Lahore enamel. It has many applications as cleaning 2,3,4Department of Anatomy agent, wood preservative, catalyst, ceramic pigment Shaikh Zayed Postgraduate Medical Institute, Lahore and paint dryer etc.7, 11,12 5 Department of Anatomy Ingested fluoride accumulates in tissues and organs Punjab Postgraduate Medical Institute, Lahore and then released slowly.13,14 Dental fluorosis with Correspondence: Dr. Tahira Athar tooth discoloration occurs due to fluoride excess Department of Anatomy leading to mottled enamel.15 Another fluoride Services Institute of Medical Sciences, Lahore induced bone disease i.e., skeletal fluorosis with E-mail: [email protected] increased risk of bone fracture and osteosarcoma Funding Source: NIL; Conflict of Interest: NIL 16,17 Received: Feb 09, 2020; Revised: Mar 12, 2020 occurs in cases of fluoride excess. Long term Accepted: Mar 15, 2020 exposure of fluoride leads to multiorgan damage 72 Life & Science 2020 Vol. 1, No. 2 Inimical Effects of NaF on Rat Ovaries

including lungs, liver, kidneys, spleen, brain and weight for all animals of those groups was calculated reproductive organs.18-21 In an animal study, ovarian and noted in proforma. RTWI was also measured. and uterine weight along with overall body weight The same procedure and calculations were repeated were reduced due to long term exposure to sodium for animals of Group C and D on 32nd day of fluoride (NaF) to rats.22 experiment. As NaF is used in fluoridation of drinking water, Analysis of data was done using SPSS version 23.0 toothpastes and mouthwashes and is consumed by (Statistical Package of Social Sciences). Quantitative humans of all age groups including young females, variables i.e., weight of paired ovaries and RTWI the present experiment was planned to determine were calculated using mean and standard deviation the probable impact of sodium fluoride solution on (SD). One-way ANOVA was applied for comparison gross parameters like ovarian weight and relative between groups. tissue weight index (RTWI) of adult albino rats. Statistically significant p-value was ≤ 0.05. Materials and Methods Results This experimental research was performed at the The mean weight of paired ovaries for the animals of Department of Anatomy of Shaikh Zayed group A (Control), group B (Low dose), group C Postgraduate Medical Institute, Lahore from 25th (Medium dose) and group D (High dose) was 0.115 ± November to 24th December 2016. 0.010 gm, 0.109 ± 0.009 gm, 0.106 ± 0.006 gm and Forty-four adult female albino Wistar rats were kept 0.100 ± 0.007 gm respectively (Fig 1). at room temperature of 23 ± 2 ˚C. They were acclimatized for 7 days and had access to water and food with ad lib feeding. After acclimatization, these animals were divided randomly by lottery method into four groups and kept separately. In the beginning of experiment, the body weights of all rats were noted. NaF salt in powder form was taken from Pakistan Council of Scientific and Industrial Research (PCSIR) chemical Fig 1: Bar chart showing comparison of mean weights (gm) of paired ovaries of albino Wistar rats after sodium laboratory, mixed with distilled water to form fluoride solution dosage between various groups aqueous solution of NaF at concentrations of 100mg/L, 200mg/L and 300mg/L for low, medium One-way ANOVA used to determine the differences and high dose groups respectively. The animals of in mean weights of paired ovaries among groups, control group were supplied with distilled water and the difference was found to be statistically while NaF solution was given to experimental groups significant (Table 1). by orogastric intubation. The duration of dosage was 30 days. The albino rats of group A were given 1ml of distilled water, while group B, C and D were given 1 ml of aqueous solution of sodium fluoride at doses of 0.1 mg/ml, 0.2 mg/ml and 0.3 mg/ml once daily respectively. Statistically significant difference is indicated by * st On the 31 day, the rats from groups A and B were Pair wise comparison showed difference of high dose weighed and then euthanized for dissection. group with control group was significant statistically. Anterior abdominal wall was opened by an incision The comparison of high dose group with low dose extending from xiphoid process of sternum to group was also statistically significant. (Table 2). symphysis pubis. After reflecting anterior abdominal The mean values of RTWI for animals of group A viscera and identifying the uterine tubes, the ovaries (Control), group B (Low dose) group C (Medium were removed for detailed study. Both ovaries from dose) and group D (High dose) groups were 0.054 ± Group A and B animals were weighed. Paired ovarian

73 Life & Science 2020 Vol. 1, No. 2 Inimical Effects of NaF on Rat Ovaries

* Significant difference * Significant difference 0.004, 0.053 ± 0.004, 0.052 ± 0.003 and 0.049 ± synthesis.24,25 Its deficiency causes dental caries while 0.003. (Fig 2). its excess leads to dental and skeletal fluorosis.15-17 Prolonged exposure to fluoride also adversely affect various organs including liver, kidneys, spleen, lungs, brain etc.18-21 In this experiment, the mean weight of paired ovaries was decreased after giving sodium fluoride solution for 30 days in the low, medium and high dose groups as compared to the control group. The difference of mean weight of paired ovaries was statistically significant among groups. The group wise comparison of mean paired ovarian weight showed that the differences of high dose group with Fig 2: Bar chart showing comparison of RTWI of ovaries control and low dose group were statistically of adult female albino Wistar rats after sodium fluoride significant. These results indicated that sodium dosage between control and experimental groups fluoride causes decreased ovarian weight in A significant difference was found in mean RTWI increasing doses. between groups. (Table 3). These above mentioned results are in accordance with the experiment carried out by Zhou Y, et al in which there was significant dose dependent lowering in ovarian organ coefficients in sodium fluoride treated groups as compared to the control group.22 The ovarian weight decreases with increase in dose of sodium fluoride solution. Studies done on rats for 15 and 30 days by Sharma JD, et al and on mouse by Chawla SL, et al for 30 days also showed the decrease in ovarian weight after sodium fluoride * Significant difference. exposure.26,27 This was due to the fact that sodium Group wise comparison showed difference of high fluoride in higher doses decreases nucleic acid dose group from control group statistically synthesis in ovary and alters DNA synthesis to significant. (p-value = 0.008) while all remaining produce structural changes in ovarian tissue. Sodium group wise differences were insignificant. (Table 4). fluoride also interferes ovarian steroidogenesis and proteogenesis, thus leads to decrease in ovarian Discussion 28,29 Sodium fluoride is an ionic compound that gives weight. Ovarian steroid hormones include sodium and fluoride ions in aqueous solution.23 The estrogen and progesterone, which are synthesized fluoride ion has toxic effects on metabolic enzymes from pregnenolone precursors. 3 β hydroxysteroid and alters the processes of DNA and RNA dehydrogenase and 17 β hydroxysteroid dehydrogenase enzymes, involved in intermittent 74 Life & Science 2020 Vol. 1, No. 2 Inimical Effects of NaF on Rat Ovaries processes of estrogen and progesterone synthesis, 6. Choi Al, Sun G, Zhang Y, Grandjean P. Development Fluoride are adversely affected by sodium fluoride resulting in Neurotoxicity A systematic review and Meta-Analysis. Environ Health Prespect. 2012; 120: 1362-8. decreased ovarian production of estrogens and 7. Jean A, Paul M, Didier D, Marius C, Robert F, Renée R, et al., 30 progesterones and altered ovarian steroidogenesis. editors. Fluorine Compounds, Inorganic. In: Ullmann's In the current research work, the fluctuation in Encyclopedia of Industrial Chemistry. Weinheim: Wiley- weights of paired ovaries when compared with the VCH; 2005. body weights of the animals were calculated by 8. Qin J, Chai G, Breuer JM, Lovelace LL, Leboida L. Fluoride inhibition of enolase: Crystal Structure and RTWI. It showed the decline in weight of paired Thermodynamics. Biochemistry. 2006; 45: 793-800. ovaries occurs with a relative reduction in the total 9. Mahajan P, Veersha KL, Mahajan A. Is Fluoride still a pivot of body weight of the adult female albino Wistar rats in preventive dentistry. Eur J Gen Dent. 2013; 2: 20-4. the low, medium and high dose groups after giving 10. Bronckers AL, Lyaruu DM, DenBesten PK. The impact of fluoride on ameloblasts and the mechanism of enamel sodium fluoride solution when compared with the fluorosis. J Dent Res. 2009; 88: 877-93. control group. When the mean RTWI was compared 11. Raz M, Aras G, Kucuk ON. The role of 18F-NaF PET/CT in between the groups, the comparison was metastatic bone disease. Journal of Bone oncology. 2015; 4: statistically significant. Group wise comparison of 92-7. RTWI showed that the difference of high dose group 12. Walsh KA. Beryllium chemistry and processing. In: Extractive Metallurgy. ASM International; 2009. p. 77-9. with control group was significant. 13. Pan C, Wang C. Sodium Fluoride for protection of wood These finding of reduced RTWI in experimental against field populations of subterranean termites. J Econ groups showed that sodium fluoride has more toxic Entomol. 2015; 108: 2121-4. effect on ovarian weight at higher doses as compared 14. Shahab S, Mustafa G, Khan I, Zahid M, Yasinzai M, Ameer N, et al. Effects of fluoride toxicity on animals, plants and soil to damaging effects on overall body weight. The health, a review. Fluoride. 2017; 50: 393-408. result is similar to the finding of Dhurvey V, et al on 15. DenBesten P, Li Wu. Chronic fluoride toxicity: dental rats where relatively more decrease in ovarian fluorosis. Monogr Oral Sci. 2011; 22: 81-96. weights in relation to decreasing overall body 16. Shivaprakash PK, Ohri K, Noorani H. Relation between weights was observed and RTWI was decreased at dental fluorosis and intelligent quotient in school children of Bagalkot district. J Indian Soc Pedod Prev Dent. 2011; 29: higher doses of sodium fluoride solution in 117-20. 31 experimental animals. 17. Bassin EB, Wypij D, Davis RB, Mittlemn MA. Age Specific Conclusion fluoride exposure in drinking water and osteosarcoma (United States). Cancer Cause Control. 2006; 17: 421-8. Fluoride rich diets and highly fluoridated water 18. Yildirim S, Ekin S, Huyut Z, Oto G, Comba A, Uyar H, et al. should be consumed cautiously as fluoride has toxic Effect of Chronic Exposure to Sodium Fluoride and 7,12 effects on reproductive organs mainly ovaries. dimethylbenz[a]anthracene on some blood parameters and hepatic, renal, and cardiac histopathology in rats. REFERENCES Fluoride J. 2018; 51: 278-90. 19. Gao Y, Liang C, Zhang J, Ma J, Wang J, Niu R, et al. 1. Waren JJ, Levy SM, Broffitt B, Cavanaugh JE, Kanellis MJ, Combination of Fluoride & SO2 induced DNA damage and Gasparioni KW. Consideration on optimal Fluoride intake morphological alterations in male rat kidney. Cell Physiol using Dental Fluorisis & Dental Caries outcomes- A Biochem. 2018; 50: 734-44. longitudinal study. J Public Health Dent. 2009; 69: 111-5. 20. Al-Harbi MS, Hamza RZ, Dwari AA. Sodium fluoride induced 2. Sodium monofluorophosphate as a source of fluoride antioxidant defense impairment and impaired renal added for nutritional purposes to food supplements. The biomarkers and ameliorative role of selenium and curcumin EFSA J. 2008; 886: 1-18. in male mice. Asian Pac J Trop Dis. 2014; 4: 990-7. 3. Motoki A, Sichel SE, Vargas T, Aires JR, Iwanuch W, Mello 21. Al-Harbi MS, Hamza RZ, Dwari AA. Ameliorative effect of SLM, et al. 2010. Geochemical evolution of the felsic Selenium and Curcumin on Sodium Fluoride induced alkaline rocks of Tanguá, Rio Bonito, and Itaúna intrusive Hepatotoxicity and Oxidative Stress in Male Mice. J Chem bodies, State of Rio de Janeiro, Brazil. 2010; 29: 291-310. Pharm Res. 2014; 6: 984-98. 4. Malkani MS, Khosa MH, Alyani MI, Khan K, Somro N, Zafar T, 22. Zhou Y, Zhang H, He J, Chen X, Ding Y, Wang Y, et al. Effects of et al. Mineral deposits of Khyber Pakhtunkhwa and FATA sodium fluoride on reproductive function in female rats. J (Pakistan). U J Sci Techl. 2017; 6: 23-46. Food and chem Toxicol. 2013; 56; 297-303. 5. Kilicel F, Dag B. Determination of Fluoride Ions in Resource 23. Toxicological profile for fluorides, hydrogen fluoride, and and Mineral Waters of the Van Region by Using Ion- fluorine: Chemical and physical information. Agency for Selective Electrode Method. Advances in Analytical Toxic Substances and Disease Registry ATDSR. 2003; p. 187- Chemistry. 2014; 4: 9-12. 90. 75 Life & Science 2020 Vol. 1, No. 2 Inimical Effects of NaF on Rat Ovaries

24. Hassan HA, Yousef MI. Mitigating effects of antioxidant 28. Connett PH. Fifty reasons to oppose fluoridation. P.H properties of blackberry juice on sodium fluoride induced Connett/Medical vertias. 2004; 1: 70-80. hepatotoxicity and oxidative stress in rats. Food Chem 29. Nureddin A, Khamage A. Anabolic action, genotoxicity and Toxicol. 2009; 47: 2332-7. carcinogenicity of fluoride. Review of Literature. Oral 25. Gao Q, Liu YJ, Guan ZZ. Decreased learning and memory Health and Dentistry. 2016; 1: 10-20. ability in rats with fluorosis: increased oxidative stress and 30. Maity PP, Jana LR, Deb B, Perveen H, Maity M, Khatun S, et reduced cholinesterase activity in the brain. Fluoride J. al. Sodium fluoride-induced uterine redox imbalance and 2009; 42: 277-85. steroidogenic hazards: dose dependent response. Fluoride. 26. Sharma JD, Solanki M, Solanki D. Sodium fluoride toxicity on 2019; 52: 337-47. reproductive organs of female rats. Asian J Exp Sci. 2007; 21: 31. Dhurvey V, Patil V, Thakare M. effect of sodium fluoride on 359-64. structure and function of the thyroid and ovary in albino 27. Chawla SL, Rao MV. Protective effect of melatonin against rats (Rattus norvegicus). Fluoride. 2017; 50: 235-46. fluoride-induced oxidative stress in the mouse ovary. Fluoride. 2012; 45: 125-32.

76 Life & Science 2020 Vol. 1, No. 2 Aluminum in Drinking Water of Pakistan REVIEW
ARTICLE Concentration of Aluminum in Drinking Water of Pakistan and Its Implications on Human Health Syeda Mehpara Farhat, Mahwish Ali ABSTRACT Aluminum (Al), is the third most abundant element in the earth's crust but it is “excluded from biology” as development of all biota has taken place without it and there are no known biological functions linked to it. Currently anthropogenic activities have resulted in great exposure of this non-essential metal to human beings. The intake of Al has implications on human health and increases risk of various diseases. Major sources of Al include occupational exposure, food and water. Water is of greatest concern because Al is commonly bioavailable in water. The alarming situation in Pakistan about Al concentration in drinking water calls for an immediate need to design policies and legislations to ensure below average risk of this metal's effects. Limiting human exposure to Al is the only way to reduce the risk of developing neurodegenerative disorders like Alzheimer's disease (AD). In view of the extensive literature review, we propose development of public health surveillance programs for AI at the policy level.

Key Words: Aluminum, Pakistan, Policy Development, Water Quality.

How to cite this: Farhat SM, Ali M. Concentration of Aluminum in Drinking Water of Pakistan and Its Implications on Human Health. Life and Science. 2020; 1(2): 77-82. doi: http://doi.org/10.37185/LnS.1.1.52

Introduction leaching of Al in food.5 Moreover, a study on bakery Aluminum (Al) is the third most abundant metal in items, including branded and non-branded biscuits the earth's crust and is released into the and bread, from Pakistan has reported that Al environment by volcanic eruptions and soil concentration in non-branded bakery items was very 6 erosion.1,2 Evolution of biota has occurred without Al, high. The non-branded bakery items are normally which explains the non-essentiality of Al in living used by middle and lower middle class families, organisms.3 But, anthropogenic activities have because these are cheaper than branded items, and converted the geochemical cycle of Al to a bio- high Al content in the non-branded bakery items 6 geochemical cycle.3 Due to the non-corrosive nature exposes larger population of country to this metal. of Al it is used in many industries e.g. electric, Similarly, evaluation of soft drinks and juices, automotive and construction industries. In addition, normally used in Pakistan, also revealed a higher Al 7 Al is also used in the production of different metal content as compared to WHO recommended limits. alloys, cooking utensils and food packaging (WHO, Only a few studies are available from Pakistan about 2004). Although, Al is naturally present in beverages sources of Al exposure to humans. With the and foods but packaging, processing, storage and industrial revolution, the use of Al has considerably cooking in Al utensils results in considerable increased and therefore, this era is termed as Al 3,8 elevation of Al content in food.4 Therefore, processed age. This wide Al use has resulted in a greatly and canned food consumption leads to higher Al increased human exposure to this non-essential 9 intake as compared to a natural diet.4 Al utensils are metal. Due to the role of Al in different pathological widely used in south Asia and a study from India conditions it is important to understand the future reported that low pH, during cooking, enhances the consequences of this burgeoning burden of Al, on 3 Department of Biological Sciences human health and introduce measures at the policy National University of Medical Sciences, Rawalpindi making level to reduce Al exposure to live safely. Correspondence: Implications of Aluminum on Human Dr. Syeda Mehpara Farhat Assistant Professor, Biological Sciences Health National University of Medical Sciences, Rawalpindi The deposition of AI is observed in the bones of E-mail: [email protected] chronic renal failure patients undergoing dialysis10, Funding Source: NIL; Conflict of Interest: NIL Received: Jun 19, 2019; Revised: Jan 09, 2020 patients of intestinal permeability and in the case of 11 Accepted: Jan 10, 2020 prolonged antacid administration. Effects of Al on 77 Life & Science 2020 Vol. 1, No. 2 Aluminum in Drinking Water of Pakistan

the crucial signaling pathways, that are involved in preservatives in many commercially prepared foods, bone development, maintenance and homeostasis, to color snacks and it is added in desserts and in results in increased risk for bone related diseases e.g. order to make salt free pourings.24 Almost 180 osteoporosis and osteomalacia. mg/serving of Al is found to be present in the ready Eposure to Al also leads to metastasis and to eat pancakes.32 Flour and processed dairy products tumorigenesis in normal epithelial cells of murine might be rich in Al content if they contain Al based mammary gland12 and human mammary glands.13 It is food additives.33 observed that Al concentration measured in breast Another major source of human exposure to Al is cancer cases14 are in the same range that can drinking water.24 Although food is an important transform mammary epithelial cells.12,13 Al has been contributor of Al exposure to humans however, Al is considered as an environmental risk factor for breast more bioavailable in drinking water.2 Al in food is cancer development but this still needs to be complexed with other elements forming phytates validated.15 and polyphenols which greatly reduce its absorption Al exposure, beyond adaptive capability of humans, but in water Al is present in uncomplexed form and is known to be related to many neurological therefore, can be readily absorbed from drinking disorders including Parkinson's disease, Alzheimer's water in gastrointestinal tract.23 Al is minimally disease16, multiple sclerosis17 and dialysis dementia.18 soluble at neutral pH of 5.5-6 but with increase or The causative role of Al in neurodegenerative decrease in pH the solubility of Al in water increases disorders is controversial but common consensus is considerably.28 Decreased pH, due to acid rain and that Al may exacerbate underlying events release of industrial wastes in water reservoirs, associated with neurodegenerative disorders.19 results in Al mobilization from environment and Sources of Aluminum Exposure to Humans increased solubility of Al in drinking water, causing a 34 Human exposure to Al occurs via different sources. Al further rise in human exposure to this metal. Al based compounds are added in antiperspirants, salts are added for water purification and are used as antacids and as adjuvant in vaccines (WHO, 2004). coagulant to reduce organic matter, microorganisms The Al in vaccines and during allergy and turbidity. This treatment is although useful but immunotherapy, may be completely absorbed in may greatly increase Al concentration in the water 2 body.20 Exposure to Al may occur from other sources reaching consumers. This high residual for example occupational exposure21, exposure to concentration may cause Al to deposit in water dialysis fluids containing high Al content22 and illicit distribution systems which on disturbance may drug abuse.23 cause an increase in Al concentration in tap water Human exposure to Al is mainly via oral ingestion of a (WHO, 2004). High Al consumption might result in Al range of commercially prepared foods containing Al toxicity that may lead to impairment in bone additives.24 Al exposure begins very early in life as metabolism, anemia, neurological disorders and 25, 26 infant parenteral nutrition25,26 and off-the-shelf infant cholestasis. formulas are known to be heavily loaded with Al.27 Aluminum via Drinking Water in Pakistan Most of Al in average diet comes from Al utensils In Pakistan drinking water is mostly taken from rivers used in cooking, preparing and eating foods.28 and canals or from underground aquifers 35 But with Moreover, cooking foods in Al wrappings in high increasing urbanization, population growth and acidic solutions at high temperature and for longer industrial development, water resources are duration results in Al leaching from foil and results in becoming more and more polluted.36 Industrial units increase in the amount of Al in food .29 The leaching of use a large quantity of water which after mixing with Al in food from Al food wraps was observed to be toxic substances is released in nearby water further increased with addition of spices.30 Some resources, i.e. lakes, rivers or in agricultural land.37 foods, for example spinach, potato and tea are This water along with dissolved toxic substances naturally high in Al and it has been reported that percolate down in soil resulting in contamination of cooking Indian tea in Al utensils results in Al leaching aquifers. A study from southern part of Pakistan from pots to the tea.31 The Al salts are also used as (Distt. Hyderabad)38 that reported elevated Al

78 Life & Science 2020 Vol. 1, No. 2 Aluminum in Drinking Water of Pakistan

concentration in ground water. Moreover, release of WHO recommended limits in District Hyderabad.47 farm and urban sewage and municipal wastes in Strategies for the Removal of Aluminum 39 rivers further worsen water pollution. Because of from Drinking Water unchecked release of industrial wastes in water There are different methods available worldwide for resources, the drinking water quality in major cities 40 the removal of Al from water i.e. physical, chemical of Pakistan is rapidly deteriorating. and biological methods. There are only a few reports that assess the drinking 41 Adsorption on Activated Carbon water quality from rural areas of Rawalpindi, 37 39 42 43 This is the most common and cheap method that is Sialkot, Peshawar, Southern Sindh, Punjab and 44 used worldwide for the removal of micropollutants, Kohat. These studies have mostly assessed the metals and organic contaminants from drinking physical parameters (pH, electrical conductivity, water and industrial wastewater. The adsorption of chemical oxygen demand, total dissolved and Al on activated carbon depends on various factors suspended solids), biological parameters (biological such as pH, presence of other electrolytes in water, oxygen demand and fecal coliform) and presence of contact time with the absorbent and concentration heavy metals (Cd, Zn, Cr, Pb, Mn, Ni, Cu, Fe) in of the Al to be removed from the water. It has been drinking water. Very few studies have determined reported that minimum five minutes are required for the Al concentration in drinking water in Pakistan. the adsorption of Al on activated carbon if proper There are only two reports that have assessed the Al 45,46 endothermic and thermodynamic conditions are concentration in drinking water. Assessment of given.48 Removal of the contaminants from the water drinking water from tube wells, in District Pishin, through activated carbon is also highly dependent Baluchistan, has shown that the quantities of upon the nature of the material used. Higher the Antimony and Al were higher than standard 46 affinity of the material, higher will be the removal recommended values. Moreover, the Al quantity rate.49 Nowadays this process is mostly used in was higher in low depth wells as compared to wells combination with other technologies such as reverse with greater depths, which makes water unfit for 50 46 osmosis and ion exchange. public use. An evaluation of drinking water from water bores in Qasimabad area of Rawalpindi, where Adsorption on Bentonite Clay and main drinking water source is from water bores, has Electrocoagulation shown that water concentration of Al was 0.95 and Bentonite, which predominantly belongs to 1.92 ppm. These values are alarmingly high as the phyllosilicate group of minerals is identified as clay recommended value of 0.2 ppm of Al is permissible that consists of one fine octahedral Al sheet for drinking water by Environmental Protection sandwiched between two tetrahedral Si sheets. This Agency (EPA).45 This situation calls for an immediate isomeric substitution of Al3+ for Si4+ and Mg2+ for Al3+ need to develop public health surveillance programs simultaneously in tetrahedral and octahedral sheets for health planning at the policy level in Pakistan. gives a net negative surface charge to bentonite clay. The elevated Al content in drinking water has severe When this charge becomes imbalanced it triggers consequences on the health of individuals. Positive the offset of cations (Na+, Ca2+ etc.) exchange at the correlation has been found between Al surface of bentonite. As bentonite clay surface is concentration in ground water and Al concentration negatively charged it attracts all the Al3+ ions present in blood samples of chronic kidney disease patients in the water that later are adsorbed on bentonite suggest that drinking water having high Al surface.51 In this way Al is removed from the drinking concentration might be a risk factor for kidney or wastewater. Electrocoagulation is another disorders.38 Another study by Panhwar et al. revealed method, mostly used with bentonite method, for that the risk of chronic kidney disease is even higher efficient removal of Al from water. In this process in individuals who are smokers and exposed to electrolysis is the phenomenon that is used for the drinking water with high Al content.47 In the same removal of unwanted suspended and dissolved study it was observed that Al concentration in both solids from the aqueous medium.51 The whole ground water and lake water was higher than the electrocoagulation process comprises of different

79 Life & Science 2020 Vol. 1, No. 2 Aluminum in Drinking Water of Pakistan

steps and processes such as: oxidation, coagulation, Conclusion flocculation and flotation. In electrocoagulation High Al ingestion by the human body, beyond process initially Al cathode is used for the removal of adaptive capability may lead to Al accumulation other ions such as: Fluoride, Zinc, Arsenic and leading to development of different disorders. 51-53 Mercury. Further flocculation and flotation is Limiting human exposure to Al, will be the simplest done along with bentonite method for the removal way to reduce the risk of developing 51 of Al from water. neurodegenerative disorders Biological Removal of Aluminum The Al in drinking and wastewater is present as a REFERENCES dissolved ion. The Al ion has strong affinity towards 1. Jalbani N, Kazi TG, Jamali MK, Arain BM, Afridi HI, Baloch A. other dissolved ions (P and N) present in aqueous Evaluation of aluminum contents in different bakery foods by electrothermal atomic absorption spectrometer. J. Food environment. Very rare studies have been reported Compos. Anal. 2007; 20: 226-31. on biological methods used for the removal of this 2. Ferreira PC, Piai KdA, Takayanagui AMM, Segura-Muñoz SI. toxic metal from water. The reported studies for Aluminum as a risk factor for Alzheimer's disease. Rev Lat biological removal of Al follows the principle of Am Enfermagem. 2008; 16: 151-7. filtration, adsorption and sedimentation. These 3. Exley C. Human exposure to aluminium. Environmental Science: Processes & Impacts. 2013; 15: 1807-16. methods are used due to the binding affinity of Al 4. Cabrera-Vique C, Mesías M. Content and bioaccessibility of towards other ions. In a study, removal of Al from aluminium in duplicate diets from Southern Spain. J Food industrial wastewater is reported by the process of Sci. 2013; 78: T1307-T12. phytoremediation using constructed wetland (CW) 5. Rao KS, Rao GV. Aluminium leaching from utensils--a kinetic 54 study. Int J Food Sci Nutr. 1995; 46: 31-8. technology , where water hyacinth (Eichhornia 6. Jalbani N, Kazi TG, Jamali MK, Arain BM, Afridi HI, Baloch A. crassipes (Mart.) Solms) was used for contaminant Evaluation of aluminum contents in different bakery foods removal from wastewater. It yields removal of 67- by electrothermal atomic absorption spectrometer. J Food 72% in different nutrients batch experiments.55 Compos Anal. 2007; 20: 226-31. Hence itis inferred that biological methods, can be 7. Jalbani N, Kazi TG, Arain BM, Jamali MK, Afridi HI, Sarfraz RA. Application of factorial design in optimization of ultrasonic- used for the removal of heavy metals from assisted extraction of aluminum in juices and soft drinks. wastewater and drinking water as a safe, cheap and Talanta. 2006; 70: 307-14. environmental friendly approach. 8. Exley C. Why industry propaganda and political interference cannot disguise the inevitable role played by human Suggestions for Policy Makers exposure to aluminum in neurodegenerative diseases, The Al toxicity to human beings needs the special including Alzheimer's disease. Frontiers neurol. 2014; 5: attention of environmentalists and policy makers 212. because it can increase the risk of neurological 9. Kaizer R, Correa M, Gris L, Da Rosa C, Bohrer D, Morsch V, et disorders. The assessment of Al concentration in al. Effect of long-term exposure to aluminum on the acetylcholinesterase activity in the central nervous system drinking water of major and industrial cities of and erythrocytes. Neurochem Res. 2008; 33: 2294-301. Pakistan is an urgent need of the time. This 10. Meira RDM, Carbonara CEM, Quadros KRDS, Santos CUD, assessment will help to devise more effective Schincariol P, Pêssoa GDS, et al. The enigma of aluminum policies to keep Al concentration within the set limits deposition in bone tissue from a patient with chronic kidney disease: a case report. Braz J Nephrol. 2018; 40: 201-5. in drinking water. Moreover, there is a dire need to 11. Chappard D, Bizot P, Mabilleau G, Hubert L. Aluminum and make well defined legislation for waste disposal of bone: Review of new clinical circumstances associated with the industries involved in working with Al. The Al Al3+ deposition in the calcified matrix of bone. content in processed food should be mentioned and Morphologie. 2016; 100: 95-105. people should be made aware to limit Al intake to 3 12. Mandriota SJ, Tenan M, Ferrari P, Sappino AP. Aluminium chloride promotes tumorigenesis and metastasis in normal mg or less. Moreover, Al concentration in processed murine mammary gland epithelial cells. Int J Cancer. 2016; water should be ensured to be less than 50 μg/L. 139: 2781-90. This is the responsibility of the organizations 13. Sappino AP, Buser R, Lesne L, Gimelli S, Béna F, Belin D, et al. involved in policy making, to protect the health of the Aluminium chloride promotes anchorage-independent growth in human mammary epithelial cells. J Appl Toxicol. nation by making policies and legislation which 2012; 32: 233-43. ensures that human exposure to Al is limited. 80 Life & Science 2020 Vol. 1, No. 2 Aluminum in Drinking Water of Pakistan

14. Mannello F, Tonti GA, Darbre PD. Concentration of aluminium. Food Addit Contam. 1995; 12: 119-28. aluminium in breast cyst fluids collected from women 34. Krewski D, Yokel RA, Nieboer E, Borchelt D, Cohen J, Harry J, affected by gross cystic breast disease. J Appl Toxicol. 2009; et al. Human health risk assessment for aluminium, 29: 1-6. aluminium oxide, and aluminium hydroxide J . Toxicol. 15. Allam MF. Breast cancer and deodorants/antiperspirants: a Environ. Health., Part B. 2007; 10: 1-269. systematic review. Cent Eur J Public Health. 2016; 24: 245. 35. Aziz J. Management of source and drinking-water quality in 16. Campdelacreu J. Parkinson's disease and Alzheimer Pakistan. 2005. disease: environmental risk factors. Neurología (English 36. Kahlown M, Tahir M, Ashraf M, editors. Water quality issues Edition). 2014; 29: 541-9. and status in Pakistan. Proceedings of the seminar on 17. Fulgenzi A, Vietti D, Ferrero ME. Aluminium involvement in strategies to address the present and future water quality neurotoxicity. BioMed Res Intl. 2014; 2014. issues; 2005. 18. Mardini J, Lavergne V, Ghannoum M. Aluminum transfer 37. Ullah R, Malik RN, Qadir A. Assessment of groundwater during dialysis: a systematic review. Int Urol Nephrol. 2014; contamination in an industrial city, Sialkot, Pakistan. Afr J 46: 1361-5. Environ Sci Technol. 2009; 3: 429-46. 19. Inan-Eroglu E, Ayaz A. Is aluminum exposure a risk factor for 38. Panhwar AH, Kazi TG, Afridi HI, Shah F, Arain MB, Arain SA. neurological disorders? Journal of research in medical Evaluated the adverse effects of cadmium and aluminum sciences: The official journal of Isfahan University of via drinking water to kidney disease patients: application of Medical Sciences. 2018; 23. a novel solid phase microextraction method. Environ Toxicol 20. Yokel RA, McNamara PJ. Aluminium toxicokinetics: an and Phar. 2016; 43: 242-7. updated minireview. Pharmacol Toxicol. 2001; 88: 159-67. 39. Tariq M, Ali M, Shah Z. Characteristics of industrial effluents 21. Elinder CG, Ahrengart L, Lidums V, Pettersson E, Sjögren B. and their possible impacts on quality of underground water. Evidence of aluminium accumulation in aluminium welders. Soil Environ. 2006; 25: 64-9. Br J Ind Med. 1991; 48: 735-8. 40. Bhutta M, Chaudhry M, Chaudhry A, editors. Groundwater 22. Alfrey AC, LeGendre GR, Kaehny WD. The dialysis quality and availability in Pakistan. Proceedings of the encephalopathy syndrome: possible aluminum seminar on strategies to address the present and future intoxication. N Engl J Med. 1976; 294: 184-8. water quality issues; 2005. 23. Yokel RA, Hicks CL, Florence RL. Aluminum bioavailability 41. Tahir MA, Chandio BA, Abdullah M, Rashid A, editors. from basic sodium aluminum phosphate, an approved food Drinking water quality monitoring in the rural areas of additive emulsifying agent, incorporated in cheese. Food Rawalpindi. National Workshop on Quality of Drinking Chem Toxicol. 2008; 46: 2261-6. Water; 1998. 24. Walton J. A longitudinal study of rats chronically exposed to 42. Memon M, Soomro MS, Akhtar MS, Memon KS. Drinking aluminum at human dietary levels. Neurosci Lett. 2007; water quality assessment in Southern Sindh (Pakistan). 412: 29-33. Environ Monit Assess. 2011; 177: 39-50. 25. Gura KM. Aluminum contamination in parenteral products. 43. Aziz JA, editor. Drinking water quality in Punjab. Curr Opin Clin Nutr Metab Care. 2014; 17: 551-7. Proceedings of the 68th annual session of the Pakistan 26. Hall AR, Arnold CJ, Miller GG, Zello GA. Infant parenteral Engineering Congress; 2001: 241-9. nutrition remains a significant source for aluminum toxicity. 44. Khan N, Hussain T, Hussain J, Jamila N, Ahmed S, Ullah R, et J Parenter Enteral Nutr. 2017; 41: 1228-33. al. Physiochemical evaluation of the drinking water sources 27. Redgrove J, Rodriguez I, Mahadevan-Bava S, Exley C. from district Kohat, Khyber Pakhtunkhwa, Pakistan. Afr J Prescription Infant Formulas Are Contaminated with Pharm Phamacol(Accepted for Publication). 2012. Aluminium. Int. J. Environ. Res. Public Health. 2019; 16: 899. 45. Sehar S, Naz I, Ali N, Ahmed S. Analysis of elemental 28. Brus R, Szkilnik R, Popieluch I, Kostrzewa RM, Mengel K. concentration using ICP-AES and pathogen indicator in Effect of aluminium exposure on central serotonine and drinking water of Qasim Abad, District Rawalpindi, Pakistan. muscarine receptors reactivity in rats. Med Sci Monit. 1997; Environ Monit Assess. 2013; 185: 1129-35. 3: BR631-BR6. 46. Tareen AK, Sultan IN, Parakulsuksatid P, Shafi M, Khan A, 29. Turhan S. Aluminium contents in baked meats wrapped in Khan MW, et al. Detection of heavy metals (Pb, Sb, Al, As) aluminium foil. Meat Sci. 2006; 74: 644-7. through atomic absorption spectroscopy from drinking 30. Bassioni G, Mohammed FS, Al Zubaidy E, Kobrsi I. Risk water of District Pishin, Balochistan, Pakistan. Int J Curr assessment of using aluminum foil in food preparation. Int J Microbiol App Sci. 2014; 3: 299-308. Electrochem Sci. 2012; 7: 4498-509. 47. Panhwar AH, Kazi TG, Afridi HI, Arain SA, Arain MS, 31. Rajwanshi P, Singh V, Gupta MK, Kumari V, Shrivastav R, Brahaman KD, et al. Correlation of cadmium and aluminum Ramanamurthy M, et al. Studies on aluminium leaching in blood samples of kidney disorder patients with drinking from cookware in tea and coffee and estimation of water and tobacco smoking: related health risk. Environ aluminium content in toothpaste, baking powder and paan Geochem Health. 2016; 38: 265-74. masala. Sci Total Environ. 1997; 193: 243-9. 48. Takassi MA, Hamoule T. Removal of aluminum from water 32. Saiyed SM, Yokel RA. Aluminium content of some foods and and industrial waste water. Orient J Chem. 2014; 30: 1365-9. food products in the USA, with aluminium food additives. 49. Cecen F, Aktaş Ö. Water and wastewater treatment: Food Addit Contam. 2005; 22: 234-44. Historical perspective of activated carbon adsorption and 33. Pennington JA, Schoen SA. Estimates of dietary exposure to its integration with biological processes. Activated Carbon 81 Life & Science 2020 Vol. 1, No. 2 Aluminum in Drinking Water of Pakistan

for Water and Wastewater Treatment: Integration of Ngameni E. Mercury (II) removal from water by Adsorption and Biological Treatment. 2011: 1-11. electrocoagulation using aluminium and iron electrodes. J 50. Aeppli J, Dyer-Smith P. Ozonation and granular activated Hazard Mater. 2009; 168: 1430-6. carbon filtration: The solution to many problems. 54. Wood R, McAtamney C. Constructed wetlands for waste International Ozone Association, Pymble Nsw water treatment: the use of laterite in the bed medium in 2073(Australia). 1996. phosphorus and heavy metal removal. Hydrobiologia. 1996; 51. Sinha R, Mathur S, Brighu U. Aluminium removal from water 340: 323-31. after defluoridation with the electrocoagulation process. 55. Jayaweera MW, Kasturiarachchi JC, Kularatne RK, Environ Technol. 2015; 36: 2724-31. Wijeyekoon SL. Removal of aluminium by constructed 52. Hu C, Lo S, Kuan W. Effects of co-existing anions on fluoride wetlands with water hyacinth (Eichhornia crassipes (Mart.) removal in electrocoagulation (EC) process using aluminum Solms) grown under different nutritional conditions. J electrodes. Water Res. 2003; 37: 4513-23. Environ Sci Health Part A. 2007; 42: 185-93. 53. Nanseu-Njiki CP, Tchamango SR, Ngom PC, Darchen A,

82 Life & Science 2020 Vol. 1, No. 2 Rett Syndrome in Pakistani Girl CASE
REPORT Rett Syndrome without MECP2 Mutation in a Pakistani Girl Rubina Dad1, Humaira Aziz Sawal2, Arsalan Ahmad3, Muhammad Ikram Ullah4, Muhammad Jawad Hassan5 ABSTRACT Rett syndrome is a rare inherited neurodegenerative disease which mostly affects females but has a lethal impact on males. Rett syndrome is mostly caused by mutations of Methyl CpG binding protein-2 (MECP2) gene located on chromosome Xq28. A 7-year girl from a consanguineous Pakistani family presented with history of abnormal social behavior, tonic colonic seizures, limb'sataxia, intellectual disability, growth retardation and speech abnormalities. Physical and neurological examinations established likely clinical features of Rett syndrome with abnormal electroencephalogram (EEG). Genetic testing of MECP2 gene did not identify any functional nucleotide variation indicating the involvement of another gene mutation in this patient. A consanguineous case of Rett syndrome did not carry the mutation of MECP2 gene. Due to heterogeneity of the phenotype, it is proposed that there might be involvement of another locus for this disease. In future, targeted next generation sequence can be helpful to identify the causative mutation in this patient.

Key Words: MECP2, Pakistan, Rett Syndrome, Seizures.

How to cite this: Dad R, Sawal HA, Ahmad A, Ullah MI. Rett Syndrome without MECP2 Mutation in a Pakistani Girl. Life and Science. 2020; 1(2): 83-85. doi: http://doi.org/10.37185/LnS.1.1.77 Introduction GRIN1 and KIF1A and cyclin-dependent kinase-like 5 Rett syndrome (RTT; OMIM 312750) is a rare (CDKL5) have been demonstrated in congenital RTT 4,5 neurodevelopmental disorder with prevalence of 1 and as pathogenic genes of early seizures. in 15,000 in females.1 Clinical features include ataxia, The most common causative gene for Rett syndrome loss of speech abilities, seizures onset, intellectual is MECP2 (NM_001110792) which is located at disability, severe developmental delay, cognitive candidate region on chromosome Xq28; however, impairments, breathing and swallowing difficulties, recently some other genes have been identified for 4 chewing and teeth grinding issues and sleep this phenotype. A number of mutations in MECP2 disorders.2 Methyl-CpG-binding protein 2 (MECP2) have been reported in different ethnic groups and 6,7 gene is responsible for typical RTT in 95% patients populations. According to various reports, 70%- and with different RTT feature in 73.2% patients.3 80% cases of Rett syndrome show mutations in Other genes like forkhead box protein G1 (FOXG1), MECP2 gene while other cases are associated with other genes.8 Depending on the cell type and 1 Department of Applied Biosciences development phases in the brain, MECP2 imparts Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of Sciences & Technology (NUST), Islamabad variable effects in these processes. RTT is reflected to 2Armed Forces Institute of Pathology the failure of functions at different levels, like gene Combined Military Hospital, Rawalpindi regulation and expression, synaptic function and 3 Division of Neurology neuronal circuitry, and during developmental Shifa International Hospital stages.9 Shifa Tameer e Millat University (STMU), Islamabad 4Department of Clinical Laboratory Sciences In the present study, we ascertained a Jouf University, Kingdom of Saudi Arabia consanguineous family with one affected girl who 5NUMS Department of Biological Sciences showed classical features of Rett syndrome and National University of Medical Sciences (NUMS), Rawalpindi mutation screening of MECP2 gene did not reveal Correspondence: Dr. Muhammad Jawad Hassan any nucleotide variation. Thus establishing the basis Associate Professor, Biological Sciences of heterogeneity of this disorder. National University of Medical Sciences, Rawalpindi E-mail: [email protected] Case Presentation Funding Source: NIL; Conflict of Interest: NIL A 7-year old girl visited the hospital, with a history of Received: Oct 14, 2019; Revised: Feb 19, 2020 hyperactive behavior, delayed milestones, Accepted: Mar 02, 2020 83 Life & Science 2020 Vol. 1, No. 2 Rett Syndrome in Pakistani Girl

generalized tonic clonic seizures, (onset at 6-month On recent clinical examination, she was mentally age). Her family history showed a consanguineous slow with partial loss of fluency of the language and relationship between her parents (Fig 1). She was speech. She also developed stereotypic hand treated previously with medication and remained movements bilaterally. She had disturbance in asymptomatic, followed by a period of relapse. She breathing when awake and showed impaired sleep had remained stable for 2-3 years. Since past three to pattern. She had growth retardation and with small four years, she had become aggressive. hands and feet. She was having inappropriate screaming spells, with intense eye communication. Neurological examination revealed normal cranial nerve functions. Manual muscular testing showed weakness of limb and abnormal muscle tone. Her deep tendon reflexes were normal and symmetrically preserved. Her planter response was equivocal on right side and flexor on left side. Electroencephalogram (EEG) showed frequent generalized spikes and wave discharges with mild background slopping and CT scan of head with chest showed bi-frontal atrophy (Fig 2 a, b, c). Urine for mucopolysaccharidosis was negative and Benedict's test for urine glucose was negative. These tests were performed to rule out mucopolysaccharidosis, as there is symptoms overlap. She was given carbamazepine 100mg twice a day with calcium supplements. Genetic testing of MECP2 gene did not identify any functional nucleotide variation Fig 1: Pedigree representation of family. Filled circle associated with this phenotype. shows affected female and clear squares and circles represent normal individuals. Horizontal line between two individuals demonstrates the relation while vertical lines describe the generations

Discussion Rett syndrome is a rare neurodevelopmental disease of childhood. It presents with diverse clinical Fig 2: Electroencephalogram and CT scan of affected girl features like abnormal social interactions, seizures, a: EEG shows generalized spike ataxia, microcephaly, speech and swallowing b and c: CT scan of brain showed bilateral atrophic abnormalities, intellectual disability, delay in growth changes 84 Life & Science 2020 Vol. 1, No. 2 Rett Syndrome in Pakistani Girl and loss of motor movements at later stage of Pinsky R, Martin E, et al. Mutations in epilepsy and disease.10 Mutations may be present in MECP2 or intellectual disability genes in patients with features of Rett syndrome. American Journal of Medical Genetics Part A. other related genes including CDKL5, FOXG1, GRIN1 2015; 167: 2017-25. 5,11 and KIF1A. 3. Percy AK, Neul JL, Glaze DG, Motil KJ, Skinner SA, Khwaja O, In the present case, we report a girl who showed et al. Rett syndrome diagnostic criteria: lessons from the hyperactive social behavior, fits and seizure, loss of Natural History Study. Ann Neurol. 2010; 68: 951-5. speech abilities, limb weakness, intellectual 4. Tao J, Van Esch H, Hagedorn-Greiwe M, Hoffmann K, Moser B, Raynaud M, et al. Mutations in the X-linked cyclin- disability and growth retardation. Her EEG showed dependent kinase-like 5 (CDKL5/STK9) gene are associated abnormal wave discharge confirming epileptic fits with severe neurodevelopmental retardation. Am J Hum and CT-scan showed atrophic changes. Supportive Genet. 2004; 75: 1149-54. diagnosis of Rett syndrome included breathing 5. Wang J, Zhang Q, Chen Y, Yu S, Wu X, Bao X. Rett and Rett-like syndrome: Expanding the genetic spectrum to KIF1A and difficulties, abnormal EEG and seizures, spasticity GRIN1 gene. Mol Genet Genomic Med. 2019; 11: e968. and ataxia, microcephaly, intellectual disability and 6. Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, delay in growth.12 Zoghbi HY. Rett syndrome is caused by mutations in X-linked Genetic testing in the present case did not find MECP2, encoding methyl-CpG-binding protein 2. Nature mutation in MECP2 gene although most common genetics. 1999; 23: 185. 3 7. Nasiri J, Salehi M, Hosseinzadeh M, Zamani M, Fattahpour S, mutations reported worldwide are in MECP2. Aryani O, et al. Genetic Analysis of MECP2 Gene in Iranian Mutations in genes other than MECP2, including Patients with Rett Syndrome. Iran J Child Neurol. 2019; 13: CDKL5, FOXG1, GRIN1 and KIF1A, are also reported in 25-34. families with Rett like features due to genetic 8. Tarquinio DC, Hou W, Neul JL, Lane JB, Barnes KV, O'Leary 5,11 HM, et al. Age of diagnosis in Rett syndrome: patterns of heterogeneity of this disease. recognition among diagnosticians and risk factors for late In Pakistan, very few reports with Rett syndrome diagnosis. Pediatric neurology. 2015; 52: 585-91. epilepsy have been described. Although, diverse 9. Dolce A, Ben-Zeev B, Naidu S, Kossoff EH. Rett syndrome features make differential diagnosis very and epilepsy: an update for child neurologists. Pediatric complicated, molecular studies established neurology. 2013; 48: 337-45. 13-15 10. Cianfaglione R, Clarke A, Kerr M, Hastings RP, Oliver C, Felce mutations in MECP2 and FOXG1 in our country. D. A national survey of Rett syndrome: Age, clinical Next generation sequencing is a remarkable tool for characteristics, current abilities, and health. American identification of causative genes in heterogeneous Journal of Medical Genetics Part A. 2015; 167: 1493-1500. disorders like Rett syndrome. 11. Williamson SL, Ellaway CJ, Peters GB, Pelka GJ, Tam PP, Christodoulou J. Deletion of protein tyrosine phosphatase, Conclusion non-receptor type 4 (PTPN4) in twins with a Rett syndrome- This is the fourth case of Rett syndrome reported like phenotype. European Journal of Human Genetics. from Pakistan and this case is without MECP2 gene 2015; 23: 1171. mutations. In future, other known genes will be 12. Kaufmann WE, Johnston MV, Blue ME. MECP2 expression and function during brain development: implications for sequenced to identify the pathogenic variant Rett syndrome's pathogenesis and clinical evolution. Brain through next generation sequencing in this girl. and Development. 2005; 27: S77-S87. Acknowledgments 13. Hussain A, Khan MA, Qazi SA, Rehman GN. The Rett syndrome: the first case report from Pakistan. Brain and We are thankful to the family for participating in this Development. 1991; 13: 442-4. research. 14. Sheikh TI, Harripaul R, Ayub M, Vincent JB. MECP2 AT-Hook1 mutations in patients with intellectual disability and/or REFERENCES schizophrenia disrupt DNA binding and chromatin 1. Ermel ÉL, Carneiro LC, Souza CF, Crippa AC, Sanseverino MT, compaction in vitro. Human Mutation. 2018; 39: 717-28. Raskin S. Epileptic encephalopathy and atypical Rett 15. Khan AA, Kirmani S. Mild presentation of the congenital syndrome with mutations in CDKL5: clinical and molecular variant Rett syndrome in a Pakistani male: expanding the characterization of two Brazilian patients. Arquivos de phenotype of the forkhead box protein G1 spectrum. neuro-psiquiatria. São Paulo. 2013; 71: 414-5. Clinical Dysmorphology. 2019. 2. Olson HE, Tambunan D, LaCoursiere C, Goldenberg M,

85 INSTRUCTIONS FOR AUTHORS All manuscripts should conform to the International ! REVIEW ARTICLE Committee of Medical Journal Editors' (ICMJE) Review articles should consist of a critical recommendations and Life and Science's overview/analysis of a topic of interest instructions to authors. Life and Science only accepts highlighting recent developments with online submissions. The manuscript should be reference to original literature. It should not submitted in Word document format by the exceed 4000 words with 50 references and corresponding author through the online Open should have an abstract of no more than 300 Journal System (OJS) along with signed certificates words with 3–6 key words as per MeSH. for Authorship, Declaration, Conflict of Interest and ! CASE REPORTS Checklist. The corresponding author will be Case reports should not exceed 1800 words with responsible for ensuring that the article has been 10 -15 references and a maximum of five spell checked and grammar checked. The manuscript tables/figures/photomicrographs. Authors of must include a structured abstract, figures, tables, case reports are required to fill in the CARE boxes and appendices that are necessary for checklist and attach it with their case reports. reporting the study findings in accordance with the ! SHORT COMMUNICATION study design. Word counts are limited (refer to Short communications should be a complete Article Type). body of work, not merely a preliminary report. It ARTICLE TYPE should not exceed more than 2000 words with The following types of manuscripts are accepted at maximum two figures/tables with an abstract of Life and Science: no more than 200 words and 12-15 references. ! ORIGINAL ARTICLE ! LETTERS Original articles must be relevant to the aim and Letters to the Editor may include academic scope of the journal. It should have a structured opinions related to articles published in Life and abstract with 3–6 keywords as per MeSH and not Science within the last three months. The Editor more than 6 tables or figures. The data should be reserves the right to rephrase/condense/redact supported with no more than 50 references, according to the journal policy and send for peer majority of which should be from last five years. review if the letter contains scientific data. A It should not exceed 3000 words and should have letter may be directed to the concerned author an abstract of 250–300 words for a reply, which can be published. A letter ! SYSTEMATIC REVIEW / META-ANALYSIS should not be more than 500 words, without Systematic reviews and meta-analysis must be headings, with not more than five references. A reported according to PRISMA or QUOROM maximum of three authors are allowed. guidelines. It should not exceed 4000 words and TERMS OF SUBMISSIONS should have an abstract of 450–500 words. Manuscripts must be submitted with the ! CLINICAL TRIALS understanding that they are unpublished and O n l y r e g i s t e r e d c l i n i c a l t r i a l s currently not under consideration by another (clinicaltrial.gov/ISRCTN/DRAP) will be journal. The corresponding author is responsible for considered for publication in Life and ensuring that the article has been approved by all the Science.Reports of trials must conform to the coauthors. In case of multicentered studies, it is the CONSORT guidelines and should be submitted responsibility of each author to obtain approval of with their protocols. the relevant institution. An acknowledgment from ! OBSERVATIONAL STUDIES the editorial office officially establishes the date of Observational studies should conform to the receipt. All correspondence and proofs will be sent to STROBE checklist. Manuscript should not exceed the corresponding author unless otherwise 4000 words and should have an abstract of 250- indicated. It is a condition of submission of a paper 300 words. that the authors permit editing of the paper for

86 readability. pdf. Relevant contributions must be declared for CONTRIBUTORS each author which may include study conception All authors should meet the conditions specified by and design, acquisition of data, analysis and t h e I C M J E a n d C O P E g u i d e l i n e s interpretation of data, drafting of manuscript and http://www.icmje.org/icmje-recommendations. critical revision at the end of article.

FORMATTING GUIDELINES Manuscript must be typed in 1.5 paragraph spacing followed by a gap statement and objectives of on A4 paper size (21.0 x 29.70 cm) with 2.5 cm margin the study. on both sides. Main title should be in 14 point Calibri E. MATERIALS AND METHODS font bold, headings in 12 point bold and text in 12 This section should contain sufficient details for point. purpose of reproducibility of methodology/ Paragraphs should be indented and left aligned with procedure. bottom central page numbering. Subsections can be made for description of more A. MANUSCRIPT TITLE PAGE than one method. Explanation of sample size, The title page should provide following sampling techniques, data collection information: procedures/techniques/experiments and ! Title (up to 25 words): Identifies the statistical methods with relevant software topic/research question, study population, program should be given. study settings, study design (if applicable) with F. RESULTS no abbreviations. This section can be subdivided if required. Extra ! Full author names: separate each name with a or supplementary materials can be placed in an comma. appendix, which will be available in the ! Address for a each author: separate each electronic version of the journal. Please include address name with comma. following terms in the results section of the ! Corresponding author details: give full address article: of corresponding author along with email ID and · For clinical trials: Event rates among contact number. experimental and control groups, relative ! Short running title for header. risk reduction (RRR), number needed to ! Authors are advised to suggest one national & treat (NNT), number needed to harm (NNH) one international reviewer. and its 95% confidence interval or if the trial B. ABSTRACT is of public health intervention number The abstract should be citation-free and in a helped per 1000 or 100,000. structured paragraph with objective, study · For cohort study: Odds ratio (OR) for design, place and duration of study, materials strength of association between exposure and methods, results and conclusion briefly and outcome along with 95% confidence explained. A trial registration number, should interval. included if applicable. It must not exceed 300 · For diagnostic test study: Sensitivity and words, but for CONSORT or PRISMA style specificity, positive predictive value (PPV) abstract word count may go up to 450–500 and negative predictive value (NPV). words. G. DISCUSSION C. KEY WORDS The discussion should emphasize the principle Three to six key words (MeSH) in alphabetical findings of the study in relation to other studies; order should be provided. discuss important similarities and differences; D. INTRODUCTION strengths and weaknesses of the study; possible This section should be succinct, without explanations/implications for the researchers subheadings including background, rationale and policy makers. 87 H. CONCLUSION N. UNITS OF MEASUREMENT The conclusion should be precise and supported Units of measurement should be consistent by results of the study. throughout the manuscript. System I. ACKNOWLEDGEMENTS International (SI) or Imperial system may be Acknowledgments (if any) should be included at used. the end of the paper before the references and O. CONFLICT OF INTEREST follow ICMJE recommendations. Funding Any financial/personal conflict of interest that sources/sponsors should be mentioned might influence the results/interpretations of separately with grant identification number. the study must be disclosed. J. APPENDICES P. PLAGIARISM POLICY Appendix must have a title and begin on a Life and Science follows the guidelines of ICMJE, separate page. It must be labeled with an PMC and HEC for any kind of plagiarism. These alphabet (A,B,C). Tables and figures within an guidelines can be accessed at www.icmje.org, appendix should be labeled by Arabic numerals www.pmdc.gov.pk and www.hec.gov.pk. added to the alphabets of the appendix (Table Authors are advised to go through these A.1; Fig A.1). guidelines before submitting their manuscript K. REFERENCES with Life and Science. Cases of plagiarism will be References must be cited consecutively as dealt according/recommendation of the ICMJE, superscript numerical. Vancouver style of PMC and HEC. All submitted papers will be referencing should be followed. checked for plagiarism using the anti-plagiarism L. FIGURES software “TURNITIN”. Articles with similarity Computer prepared images must be at minimum index more than 19% will not be accepted for of 300 dpi and should be submitted as JPEG or processing. TIFF format file. All figures should be in a Q. ETHICAL CONSIDERATION consecutive order. Photographs, X-rays, CT Authors are required to provide an approval scans, MRI and photomicrographs should be letter from their respective Institutional Review sent in digital format with a minimum resolution Board/ Biomedical Ethical Committee/IACUC for of 3.2 mega pixels in JPEG compression. Written all human and animal subject research. As a permission must be sought to use previously statement in the manuscript the author must published figures. Graphs or scatter plot or mention that the study obtained ethical histograms should be submitted along with their approval, include the name of the Ethics numerical data. Legends for photomicrographs Committee or Institutional Review Board, the should indicate the magnification, internal scale number/ID of the approval, and also that and the method of staining. Figure legends participants gave written informed consent should be provided on a separate page of the before taking part in the study. In case of main manuscript document. photographs or other identifiable material, the M. TABLES author should report that patients have Each table should be given on a separate page, provided their signed consent for publication of paginated as part of the manuscript. Tables such material. should be provided as editable text constructed R. DECLARATION in Microsoft Word using Table function with The authors are required to sign and submit the single spaces and without vertical lines. They following: should be numbered consecutively with Arabic · Certificate of Authorship numerals and labeled with a descriptive title. · Author Declaration form Units of numerical measurement should be · Conflict of Interest form written in the column heading and all · Article submission checklist abbreviations explained in the footnote. For technical support, please contact [email protected].

88 SUBMISSION PROCESS http://lifenscience.org/> Submit Manuscript > Make a Submission > Registration > Login > New Submission > (Follow Steps) > Save the page and continue

89