Curr Genet (2000) 37: 412±419 Ó Springer-Verlag 2000

ORIGINAL PAPER

Sergi Maicas á Ana C. Adam á Julio Polaina The ribosomal DNA of the Zygomycete Mucor miehei

Received: 21 December 1999 / 1 March 2000

Abstract The ribosomal DNA from the Zygomycete Introduction Mucor miehei has been characterised. The complete rDNA unit was cloned by heterologous PCR using Mucor (Rhizomucor) miehei is a signi®cant organism primers whose sequence matched conserved regions of from a biotechnological point of view because of its the rDNA from related fungal species. The sequence aspartic protease (MMP), a milk-clotting enzyme used of the overlapping PCR products revealed the existence as a substitute for calf chymosin in the cheese industry of a repeated unit of 9574 bp. The genes encoding the (Tonouchi et al. 1986; Foltmann 1987). Despite its bio- di€erent rRNA species were identi®ed by their homol- technological interest, M. miehei remains poorly char- ogy to the corresponding sequences from other fungi. acterised from a genetical point of view. At least in part, We estimate that the rDNA unit is present in the genome this may be due to its morphological characteristics. The of M. miehei in about 100 copies. This estimation was fungus does not form discrete colonies on solid medium. made by comparing the intensity of its hybridisation It has a di€use, ``cotton-like'' mycelial growth, which signal in a Southern blot with that of the mmp gene makes its manipulation dicult. The only available in- coding for aspartyl protease, which was assumed to be formation about its life cycle is that it is homothallic contained in single copy. The size and structure of the (Ohnuki et al. 1982). The analysis of the rDNA region M. miehei rDNA unit was similar to that of other fungi. of M. miehei is important for several reasons. (1) It The genes encoding the 25S, 18S and 5.8S RNAs are should help establishing taxonomical relationships to closely linked within the repeated unit which also con- other species (Buckler et al. 1997). (2) It may have tains the 5S gene. This latter gene appears to be tran- functional implications since replication origins (ARS scribed in the opposite direction. The 25S, 18S and 5.8S sequences) are known to be present within rDNA genes showed 70±80% homology to the corresponding sequences (Amin and Pearlman 1985; Wendland et al. genes from other fungi, whereas the degree of homology 1999). Additionally, (3) the repeated rDNA sequences for the 5S gene was much lower. The highest homology can be useful tools for the genetic manipulation of fungi, (about 80%) corresponded to the few available as they can be used as targets for gene integration by sequences from other Mucor species. Homology to genes homologous recombination (Lopes et al. 1989; Adam from other Zygomycota was no higher than that et al. 1995). Integrative transformation by homologous observed for genes from the Ascomycota or Basidiomy- recombination has been described for other Mucor cota fungi. species (Arnau et al. 1991; Wada et al. 1996). Fungi, like other eukaryotes, contain in their Key words Autonomous replication sequence á genomes multiple copies of a ribosomal DNA unit ar- Filamentous fungus á Ribosomal RNA ranged in tandem. The organisation of the rDNA varies in di€erent fungal species. The size of the repeated unit ranges from 7.7 to 12 kb (Rozek and Timberlake 1979; Communicated by L. A. Grivell van Heerikhuizen et al. 1985). Within the unit there is a cistron containing the 16S/18S, 5.8S and 25S/28S S. Maicas á A. C. Adam á J. Polaina (&) sequences. These three sequences are transcribed as a Instituto de Agroquõ mica y Tecnologõ a de Alimentos, high-molecular-weight (35S) precursor (Tague and Consejo Superior de Investigaciones Cientõ ®cas. Apartado de Correos 73. E-46100 Burjassot, Valencia, Spain Gerbi 1984; Rustchenko and Sherman 1994). The e-mail: [email protected] remaining rDNA functional sequence, 5S, is transcribed Tel.: +34-963-90-00-22; Fax: +34-963-63-63-01 independently and may or may not be genetically linked 413 to the others. In some species, such as Saccharomyces elements 15±20 base pairs long were chosen to be used as primers in cerevisiae and Mucor racemosus, the 35S rDNA cistron these experiments. As sequencing progressed, additional ampli®ca- tions were carried out using primers whose sequence corresponded and the 5S rDNA are linked but are transcribed from to the M. miehei rDNA. The relationship of the di€erent oligo- opposite strands (Aarstad and Oyen 1975; Bell et al. nucleotides used is presented in Table 1. For the ampli®cation of 1977; Cihlar and Sypherd 1980). In Cuprinus cinereus the M. miehei aspartyl protease gene (mmp), oligonucleotides M142 and Schizophyllum commune these sequences are linked and M143 (Table 1) were used as primers. These oligos correspond and are transcribed in the same direction (Buckner et al. to the 5¢ and 3¢ regions of the mmp coding sequence, respectively (Gray et al. 1986). The primers included suitable sites for restric- 1988; Cassidy and Pukkila 1987). Finally, in other spe- tion endonucleases to facilitate the subsequent cloning of the cies, such as Neurospora crassa, Schizosaccharomyces ampli®ed DNA. The PCR products were electrophoresed in an pombe, Yarrowia lipolytica and Aspergillus nidulans, the agarose gel, puri®ed from the gel, digested with the appropriate 5S region is not linked to the 35S cistron (Selker et al. restriction endonucleases, and cloned in pUC18. 1981; Tabata 1981; Mao et al. 1982; van Heerikhuizen et al. 1985; Metzemberg et al. 1985). This di€erence in DNA sequencing, Southern analysis, the structure of the rDNA has been used to establish and other molecular biology techniques phylogenetic relationships among fungal species (Chen DNA sequencing was carried out at ``SCSIE Universitat de Val- et al. 1984). eÁ ncia'', using an ABI373A equipment from Perkin-Elmer Applied In this paper we report the structure and complete Biosystem (Foster City, Calif., USA) and a dRhodamine Termi- sequence of the rDNA of M. miehei, and we determine nator Ready Reaction Kit from the same company. Overlapping the number of copies in which the rDNA unit is present DNA fragments to be sequenced were generated either by PCR- ampli®cation or by restriction endonuclease digestion of larger in the genome. This is the ®rst time that the rDNA fragments. DNA sequences were analysed with the programs Blast, region of a Zygomycete has been fully characterised. Pileup, Fasta and Best®t from the Sequence Analysis Software Package of the University of Wisconsin Genetics Computer Group (Devereux et al. 1984). The nucleotide sequence corresponding to the complete M. miehei rDNA unit has been submitted to the Materials and methods GenBank library (accession number AF205941). Southern analysis was carried out by using a non-radiactive procedure with the Microbial strains, plasmids and culture conditions DIG DNA labelling kit (Roche Diagnostics GmbH, Mannheim, Germany). Detection of the hybridisation signals was carried out M. miehei ATCC 26282 was cultivated in YPD liquid medium (1% by using an anti-digoxigenin-alkaline phosphatase conjugate and yeast extract, 2% peptone, 2% glucose), or on plates of the same the chemiluminiscence substrate CDP-Star (Roche Diagnostics medium containing 2% agar, at 37 °C. Liquid cultures were incu- GmbH, Mannheim, Germany). Equal amounts of two DNA bated with agitation in an orbital shaker set at 200 rpm. Cloning of fragments of the same size (0.5 kb), one internal to the mmp gene M. miehei DNA was carried out using plasmid pUC18 (Yanish- Perron et al. 1985) as the vector, and Escherichia coli DH5a (Hanahan 1983) as the host strain. Table 1 Oligonucleotides used as primers in PCR reactions

DNA puri®cation Name Sequence (5¢®3¢)a

M. miehei spores were inoculated in liquid medium and incubated M-94 CGTGGTAATTCTAGAGCTAATACATGC for 16 h. Young hyphal germlings were harvested by centrifuga- M-139 AAACTTTCAACAACGGATCTCTTG tion, washed with water and re-suspended in TES bu€er (100 mM M-140 GACGGGCGGTGTGTACAAA Tris-HCl, 25 mM EDTA, 2% SDS, pH 7.5). The germlings were M-142 ATAGAGCTCCAGACGAGTGTGAAGGTTGC disintegrated mechanically with 425±600-micron glass beads M-143 AGCGTCTAGAACCCAAACAAGAATAAGCG (Sigma Chemical Co., St. Louis, Mo., USA) in a Fast Prep Cell M-144 ACAGAGCTCCCGCTGAACTTAAGCATATC Disruptor (FP120) (Savant Instruments Inc., Vista, Calif., USA). M-145 AGCGTCTAGAACCTTGGAGAACCTGCTG The cell debris was removed by centrifugation at 20,000 ´ g for M-147 AGCGTCTAGAACGGGATTCTCACCCTC 10 min. The supernatant was subjected to de-proteinisation by M-151 AGCGTCTAGACCTGTGGTAACTTTTCTGGC treatment with phenol, and the nucleic acids were collected M-152 ACAGAGCTCTGAAAGTGTGGCCTATCG by precipitation with isopropanol. The RNA was eliminated by M-153 AGCGTCTAGACAAGGCCATGCGATTC treatment with RNase and the DNA was ®nally re-suspended in TE M-154 AACGAGGAATTCCTAGTAAGCGCAAG bu€er (10 mM Tris, 1 mM EDTA, pH 7.5). M-155 AGCGTCTAGAGGCTTTATCTAATAAGTGC M-162 ACAGAGCTCAGCAGGTCTCCAAGG M-163 ACAGAGCTCGTTGTTTGGGAATGC DNA sequence ampli®cations M-164 AGCGTCTAGAATAGGTTAAGGAC M-165 AGCGTCTAGATGTCAAACTAGAGTCAAG PCR ampli®cations were carried out in a Perkin-Elmer 2400 ther- M-168 CCAATAGCGTATATTAAAG mal cycler (Foster City, Calif., USA). The reactions contained M-174 CGATGTACTGAGATTAAGC 20 ng of M. miehei DNA as the template and 2 U of Biotaq M-175 CAGCGTCTAGACAACAAAGGCTACTC (Bioline Ltd., London, UK), in a ®nal volume of 50 ll. The pro- M-178 TCCAAAAGAAGAGCCTCC gram used consisted of 30 cycles of ampli®cation. In each cycle the M-179 CAGTCTGAAGACAAGTTG conditions of denaturation, annealing and extension were: 30 s at M-180 TTTGACCCTTGATCCC 95 °C, 1 min at 45±60 °C (depending on the primers used) and M-183 CTACTGCCCGTGGTTTCAGTCG 2 min at 60 °C, respectively. An initial denaturation step (5 min at 95 °C) and a ®nal extension step (10 min at 72 °C) were performed. a GAGCTC and TCTAGA are the sequences recognised by re- The sequence of the oligonucleotides initially used as primers for striction endonucleases SacI and XbaI, respectively, introduced in the cloning of M. miehei rDNA was designed by comparison with the primers to facilitate the cloning of the ampli®ed DNA frag- the rDNA sequences of related fungal species. Highly conserved ments 414 and the other internal to the 25S rDNA, were labelled in the same rDNA unit. The physical map of the entire unit, com- conditions to be used as probes. The intensity of the hybridisation posed from data of the di€erent fragments, is shown in bands in the Southerns was quanti®ed by densitometry, using a GDS-5000 Image Acquisition and Analysis System (Gelbase Fig. 1. The complete sequence of the repeated unit Analysis Software, Upland, California, USA). Other molecular was determined. It was 9574 bp, approximately 0.5-kb biology techniques were carried out using standard protocols longer than the ribosomal DNA unit of S. cerevisiae (Sambrook et al. 1989). (Rustchenko and Sherman 1994) and about the same size as that of M. racemosus (Cihlar and Sypherd 1980). The four regions coding for the rRNA species were Results identi®ed because of their homology to the sequences of other fungal species. The cistron containing the 18S, The rDNA region: cloning, sequencing 5.8S and 25S genes together with internal transcribed and determination of the number spacers (ITS1 and ITS2) has a size of about 5.7 kb. The of copies present in the genome 5.8S rRNA was located in the spacer between 18S and 25S rRNA as has been established for all fungi analysed The rDNA sequences from a number of fungal species to-date (Buckner et al. 1988; Garber et al. 1988; Wend- were aligned with the program Pileup. In the resulting land et al. 1999). The homology analysis indicated that alignment we searched for highly conserved stretches the 5S element was also contained in the repeated unit. with a minimum length of 12 bp. The information It is known that fungal species contain 100±200 tan- provided by this analysis was used to design a set of dem repeats of the rDNA unit (Russell et al. 1984; synthetic oligonucleotides that could be used as primers Buckner et al. 1988; Garber et al. 1988; Vilgalys and to amplify overlapping fragments covering the entire Gonzalez 1990). We decided to determine the number of copies present in M. miehei by comparing the intensity of hybridisation signals in a Southern analysis in which Fig. 1 Structure of the M. miehei rDNA unit. The physical map of the DNA of the fungus was probed with DNA frag- the unit was built by assembling data from the di€erent DNA ments from either the rDNA region or a single-copy fragments (F1±F24) obtained by PCR-ampli®cation, shown in the gene. Insucient information about M. miehei genes upper part of the ®gure. The oligonucleotides used as primers in the made it dicult to obtain a suitable probe. The gene ampli®cation reactions are represented by arrows, and their sequences encoding orotidine-5¢-monophosphate decarboxilase are given in Table 1. Abbreviations for restriction endonucleases are as follows: BBamHI; EEcoRI; HHindIII; NNsiI; PPstI; SSacI; was a ®rst choice, since its sequence had been MSmaI; XXbaI determined for other Zygomycota: Mucor circinelloides 415 pyrG (Benito et al. 1992); Rhizopus niveus pyr4 (EMBL Comparative analysis of the rDNA sequences accession number D17362); and Phycomyces blakeslee- anus pyrG (Diaz-Minguez et al. 1990). However, The position of the M. miehei 25S gene (3331 bp) within repeated attempts to amplify the homologous M. miehei the repeated unit of rDNA was assigned by comparison gene by PCR, using as primers di€erent combinations with the reported sequence from M. racemosus (3469 bp) of synthetic oligonucleotides matching conserved (Ji and Orlowsky 1990). Both sequences share a high sequences of the three related Zygomycota species, were degree of homology (77% identity). A comparable unsuccessful. As an alternative, we tried the mmp gene homology was found to the 25S sequences from other coding for aspartyl protease, one of the few genes of M. fungi (Table 2). miehei whose sequence has been reported (Gray et al. A homology analysis of the 18S rDNA from di€erent 1986). The mmp gene was cloned by PCR. A 0.5-kb fungi led to the de®nition of the M. miehei 18S gene as a fragment from this gene and another 0.5-kb fragment 1780-bp sequence. This sequence showed the highest from the 25S rDNA element were used as probes against homology (about 80%) to the 18S rDNA of two other M. miehei DNA. The result of the Southern hybridisa- Mucor species: M. racemosus and M. mucedo (Table 3). tion is shown in Fig. 2. A densitometry scanning of the Surprisingly, it showed a similar degree of homology to hybridisation signals showed that the intensity of the two entries of the database that supposedly corre- rDNA band was about 100-times stronger than that of sponded to the 18S rDNA of two algae, Cepedea vir- the mmp gene. The most-likely interpretation of this guloidea and Opalina ranarum (accession nos. AF141969 result is to assume that the mmp gene is present in the M. and AF141970). The 18S genes of M. miehei, M. rac- miehei genome as a single copy, and the rDNA unit emosus and the two algae share conserved sequences of in about 100 copies. 37 and 35 bp in their 5¢ and 3¢ termini, respectively. These sequences are also present in the 18S rDNA of S. cerevisiae, but are absent in the genes from other fungi, including two Mucor species: M. mucedo and M. rammanianus. We have also located the nucleotide sequence of M. miehei 5.8S rDNA by comparison with other fungal 5.8S sequences. The M. miehei 5.8S gene is 158-bp long. It showed higher homology to the 5.8S sequences of sev- eral Ascomycota and Basidiomycota species than to the available 5.8S sequences from the Zygomycota (Table 4). No 5.8S sequence from any other Mucor species was found in the databases. The region of M. miehei rDNA situated between the 25S and 18S subunits was examined in search of a sequence matching known 5S rDNA sequences available in the databases. A 122-bp sequence with this charac- teristic was found (Table 5). The putative M. miehei 5S gene was 1813 bp away from the 35S cistron and appeared to be transcribed in the opposite direction. This sequence showed lower homology to the 5S rDNA Fig. 2 A, B Comparative Southern analysis of the rDNA unit and the sequences in the databases than the other M. miehei mmp gene from M. miehei. In both panels, lanes 1 and 2 contain equal rDNA genes did to their corresponding homologues. amounts of undigested and EcoRI-digested DNA, respectively. The ®lters shown in panels A and B were hybridised with probes consisting The non-coding regions of M. miehei rDNA were ofa0.5-kbfragmentofthemmp gene and a 0.5-kb fragment of the also analyzed. The internal transcribed spacers, ITS1 rDNA, respectively. (198 bp) and ITS2 (255 bp), are AT-rich (66% and 77%,

Table 2 Comparison of genes a encoding 25/28S ribosomal Organism Taxa Size (bp) % GC % Identity to Accession no. RNA from di€erent species M. miehei gene Mucor miehei Z 3331 46.2 100 AF205941 Mucor racemosus Z 3469 42.8 77 M26190 Candida albicans A 3360 47.6 74 X70659 Cryptococcus neoformans B 3391 48.3 74 L14067 Saccharomycopsis ®buligera A 3362 43.7 73 U09238 Saccharomyces cerevisiae A 3392 47.9 73 J01355 Schizosaccharomyces japonicus A 3417 44.3 73 Z32848 Tricholoma matsutake B 3399 47.4 72 U62964 Magnaporthe grisea A 3338 53.9 72 AB026819 a A=Ascomycota;B=Basidiomycota;Z=Zygomycota 416

Table 3 Comparison of genes a encoding 16/18S ribosomal Organism Taxa Size (bp) % GC % Identity to Accession RNA from di€erent species M. miehei gene no. Mucor miehei Z 1780 46.1 100 AF205941 Mucor racemosus Z 1831 43.0 83 X54863 Mucor mucedo Z 1755 43.2 79 X89434 Candida lusitaniae A 1759 48.2 77 M55526 Saccharomyces cerevisiae A 1798 44.9 77 J01353 Cryptosporidium muris P 1743 42.3 75 L19069 Theileria sergenti P 1750 44.3 75 U97051 Mucor rammanianus Z 1739 43.8 75 X89435 Mortierella polycephala Z 1719 43.9 75 X89436 Neolecta vitellina A 1722 46.5 74 Z27393 Syncephalastrum racemosum Z 1756 47.5 73 X89437 a A=Ascomycota;P=Apicomplexa;Z=Zygomycota

Table 4 Comparison of genes a encoding 5.8S ribosomal RNA Organism Taxa Size (bp) % GC % Identity to Accession from di€erent species M. miehei gene no. Mucor miehei Z 158 40.5 100 AF205941 Omphalina ericetorum B 158 44.3 78 U66445 Piriformospora indica B 156 45.5 77 AF019636 Lipomyces kononenkoae A 158 41.1 77 U82454 Lipomyces spencermartinsiae A 158 41.1 77 U82455 Waltomyces lipofer A 158 41.1 77 U82461 Chimonobambusa marmorea B 158 39.2 77 U65613 Nematoctonus robustus B 156 45.8 76 U51978 Thelephoraceae sp. B 156 45.5 76 U83477 Tremella foliacea B 154 44.2 76 AF042427 Saccharomyces cerevisiae A 158 46.2 75 K01048 Glomus etunicatum Z 155 44.2 75 U94712 Scutellospora castanea Z 156 41.8 74 U31998 Entrophosphora infrequens Z 155 44.9 72 U94713 Entomophaga aulicae Z 155 38.5 67 U35394 a A=Ascomycota;B=Basidiomycota;Z=Zygomycota

Table 5 Comparison of genes a encoding 5S ribosomal RNA Organism Taxa Size (bp) % GC % Identity to Accession from di€erent species M. miehei gene no. Mucor miehei Z 122 32.8 100 AF205941 Basidiolobus magnus Z 120 50.8 46 M36313 Cunninghamella elegans Z 120 45.0 45 M36310 Linderina macrospora Z 120 45.0 45 M36308 Mortiriella formosensis Z 120 51.7 44 M36312 Phycomyces blakesleeanus Z 120 51.0 44 V01120 Dipsacomyces acuminosporus Z 119 47.1 44 M36307 Genistelloides hibernus Z 122 54.1 44 M36315 Blakeslea trispora Z 120 48.3 44 M36311 Capniomyces stellatus Z 121 55.4 43 M36316 Smittium culisetae Z 121 52.1 43 M36314 Saccharomyces cerevisiae A 121 52.1 41 X06838 Coemansia mojavensis Z 120 53.3 41 M36309 Amoebidium parasiticum Z 119 55.0 40 M36306 a A=Ascomycota;Z=Zygomycota respectively). Poly A and poly T tracts 6±12 nucleotides involved in the processing of the 35S precursor, were not long were found in both spacers. ITS1 is longer than the found in the M. miehei ITSs. corresponding sequence of other Zygomycota, but still The non-transcribed spacers of M. miehei rDNA, 163-bp shorter than the sequence of S. cerevisiae NTS1 and NTS2, comprise 1813 bp and 1917 bp, (Veldman et al. 1981). Some characteristic sequences respectively. As a comparison, S. cerevisiae NTS1 and found in S. cerevisiae (van Nues et al. 1994, 1995) and NTS2 are 1100 and 1250 bp, respectively. M. miehei Ashbya gossypii (Wendland et al. 1999), presumptively NTSs have low homology to the corresponding 417

Table 6 Possible ARS within the rDNA of M. miehei

Putative ARS sequences in M. miehei rDNA Positiona Location

C T T T A T G T C T T nt 7269±7279 NTS1 G T T T A T A T T T A nt 7574±7584 NTS1 T T T T A T A C T T T nt 5792±5802 5S T T T T A T A T T C A nt 8499±8509 NTS2 A T A T A T A T T T T nt 8601±8611 NTS2 A/T T T T A T A/G T T T A/T Consensus sequenceb a Nucleotide positions are referred to Genbank sequence AF205949 b S. cerevisiae ARS consensus sequence (Skryabin et al. 1984; Fabiani et al. 1996) sequences of other fungi. They show many poly A and The analysis of the 5S element revealed a much lower poly T tracts 6±12-bp long, which are more frequent in degree of homology to the corresponding sequences of NTS1. This feature is also present in S. cerevisiae other fungi than that observed for other rDNA genes. (Skryabin et al. 1984). The NTSs contains several direct This fact could be explained by the much higher heter- repeats of up to 26 bp, and inverted repeats 8±10-bp ogeneity shown by the 5S elements from di€erent long. A repeated (CAG)7 motif was also found in species, which can be transcribed in a di€erent direction NTS2. A computer search was done, looking for or even have a di€erent physical localisation. putative origins of replication (termed ACS for ``ARS The NTS is the most variable region in the rDNA, consensus sequences'') that have been described for both in length and in DNA sequence. The study of the di€erent types of eukaryotes, such as S. cerevisiae, M. miehei NTS revealed the existence of several Tetrahymena thermophila or Pisum sativum (Skryabin directed and inverted repetitions similar to those et al. 1984; Amin and Pearlman 1985; Herna ndez et al. described for S. cerevisiae (Skryabin et al. 1984). Smith 1993; Fabiani et al. 1996; Clyne and Kelly 1997; Sa n- (1976) proposed that duplications easily evolve within a chez et al. 1998). Five such sequences were found DNA region that has no sequence-speci®c function, by (Table 6), although their functional signi®cance remains random unequal crossing-over between sister chro- to be elucidated. matids. When duplicated sequences are contained in a highly repeated tandem, like the rDNA structure, the probability of ®nding such repetitions is much higher. Discussion The functional role of NTSs has been studied in S. cerevisiae and S. carlsbergiensis by Skryabin et al. The structure of the ribosomal DNA of M. miehei is (1984). They described the presence of an ARS, cor- similar to that of other fungi. The size of the rDNA unit responding to a chromosomal origin of replication, (9574 bp) and the disposition of the 5.8S, 18S, and 25S located on a fragment of 570 bp within NTS2. We have rRNA elements are about the same as in other Asc- found some sequences resembling an ARS in the omycota and Basidiomycota (Buckner et al. 1988; Tsuge M. miehei NTS, although their function as replication et al. 1989; Vilgalys and Gonzalez 1990). In M. miehei, origins has not been tested. the 5S element is also contained in the repeated unit, as Our analysis of M. miehei rDNA represents the ®rst occurs in S. cerevisiae (Philippsen et al. 1978), M. rac- complete characterisation of this sequence made for a emosus (Cihlar and Sypherd 1980) or Ashbya gossypii Zygomycete. As rDNA sequences are highly repeated in (Wendland et al. 1999). In contrast, other fungi such as the genome, their use as targets for homologous re- Neurospora, Aspergillus and Schizosaccharomyces con- combination could represent a valuable tool for genetic tain multiple copies of the 5S rDNA that are dispersed in analysis, as it has been for several fungi (Lopes et al. di€erent locations of the genome (Garber et al. 1988), a 1989; Tsuge et al. 1990; Adam et al. 1995). This possi- property shared with higher eukaryotes. bility would be of particular value in the case of a species As would be expected, M. miehei rDNA genes with a known biotechnological application, such as showed highest scores of homology to the few published M. miehei. sequences from other Mucor species (Tables 2 and 3). However, the degree of homology to genes from other Acknowledgments This work has been supported by grant ALI- Zygomycota is about the same as that observed in 0362-97 from CICYT. We are grateful to Gracia Gonza lez-Blasco Ascomycota and Basidiomycota species. Surprisingly, the for assistance with some of the experiments. 18S rDNA from M. miehei was found to be highly ho- mologous to sequences that supposedly belonged to two References seaweeds. The signi®cance of this result is unclear. It is possible that the sequenced DNA corresponds to a Aarstad K, Oyen TB (1975) On the distribution of 5s RNA cistrons contaminant or a symbiotic fungus associated with the on the genome of Saccharomyces cerevisiae. FEBS Lett 51: 227± algae. 231 418

Adam AC, Rubio-Texeira M, Polaina J (1995) Induced expression cerevisiae: a new vector for high-level expression. Gene 79: of bacterial beta-glucosidase activity in Saccharomyces. Yeast 199±206 11: 395±406 Mao J, Appel B, Schaack H, Yamada H, Soll D (1982) The 5S Amin AA, Pearlman RE (1985) Autonomous replicating sequences RNA genes of Schizosaccharomyces pombe. Nucleic Acids Res from the non-transcribed spacers of Tetrahymena thermophila 10: 487±500 ribosomal DNA. Nucleic Acids Res 13: 2647±2659 Metzemberg RL, Stevens JN, Selker EU, Morzycka-Wroblewska E Arnau J, Jepsen LP, Stroman P (1991) Integrative transformation (1985) Identi®cation and chromosomal distribution of 5S by homologous recombination in the Zygomycete Mucor cir- rRNA genes in Neurospora crassa. Proc Natl Acad Sci USA 82: cinelloides. Mol Gen Genet 225: 193±198 2067±2071 Bell GI, DeGennaro LJ, Gelfand DH, Bishop RJ, Valenzuela P, Nues RW van, Rientjes JMJ, van der Sande CAFM, Zerp SF, Rutter WJ (1977) Ribosomal RNA genes of Saccharomyces Sluiter C, Venema C, Planta RJ, Raue HA (1994) Separate cerevisiae. J Biol Chem 252: 8118±8125 structural elements within internal transcribed spacer I of Benito EP, Diaz-Minguez JM, Iturriaga EA, Campuzano V, Eslava Saccharomyces cerevisiae precursor ribosomal RNA direct the AP (1992) Cloning and sequence analysis of the Mucor circi- formation of 17S and 26S rRNA. Nucleic Acids Res 22: nelloides pyrG gene encoding orotidine-5¢-monophosphate 912±919 decarboxylase: use of the pyrG for homologous transformation. Nues RW van, Venema J, Rientjes JM, Dirks-Mulder A, Raue HA Gene 116: 59±67 (1995) Processing of eukaryotic pre-rRNA: the role of the Buckler ES, Ippolito A, Holtsford TP (1997) The evolution of transcribed spacers. Biochem Cell Biol 73: 789±801 ribosomal DNA: divergent paralogues and phylogenetic Ohnuki T, Etoh Y, Beppu T (1982) Intraspeci®c and interspeci®c implications. Genetics 145: 821±832 hybridization of Mucor pusillus and M. miehei by protoplast Buckner B, Novotny CP, Ullrich RC (1988) Organization of the fusion. Agric Biol Chem 46: 451±458 ribosomal RNA genes of Schizophyllum commune. Curr Genet Philippsen P, Thomas M, Kramer RA, Davis RW (1978) Unique 13: 417±424 arrangement of coding sequences for 5S, 5.8S, 18S and 25S Cassidy JR, Pukkila PJ (1987) Inversion of 5S ribosomal RNA ribosomal RNA in Saccharomyces cerevisiae as determined by genes within the genus Coprinus. Curr Genet 12: 33±36 R-loop and hybridization analysis. J Mol Biol 123: 387±404 Chen MW, Anne J, Volckaert G, Huysmans E, Vandenbergue A, Rozek CE, Timberlake WE (1979) Restriction endonuclease De Wachter R (1984) The nucleotide sequences of the 5S mapping by crossed contact hybridization: the ribosomal rRNAs of seven molds and a yeast and their use in studying RNA genes of Achlya ambisexualis. Nucleic Acids Res 7: 1567± Ascomycete phylogeny. Nucleic Acids Res 12: 4881±4892 1578 Cihlar RL, Sypherd PS (1980) The organization of the ribosomal Russell PJ, Wagner S, Rodland KD, Feilbaum RL, Russell JP, RNA genes in the fungus Mucor racemosus. Nucleic Acids Res Bret-Harte MS, Free SJ, Metzenberg RL (1984) Organization 8: 793±804 of the ribosomal ribonucleic acid genes in various wild-type Clyne RK, Kelly TJ (1997) Identi®cation of autonomous replicat- strains and wild-collected strains of Neurospora. Mol Gen ing sequence (ARS) elements in eukaryotic cells. Methods 13: Genet 196: 275±282 221±233 Rustchenko EP, Sherman F (1994) Physical constitution of ribos- Devereux J, Haeberli P, Smithies O (1984) A comprehensive set omal genes in common strains of Saccharomyces cerevisiae. of sequence analysis programs for the VAX. Nucleic Acids Res Yeast 10: 1157±1171 12: 387±395 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a Diaz-Minguez JM, Iturriaga EA, Benito EP, Corrochano L, Eslava laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, AP (1990) Isolation and molecular analysis of the orotidine- Cold Spring Harbor, New York 5¢-phosphate decarboxylase gene (pyrG)ofPhycomyces bla- Sa nchez JA, Kim SM, Huberman JA (1998) Ribosomal DNA kesleeanus. Mol Gen Genet 224: 269±278 replication in the ®ssion yeast Schizosaccharomyces pombe. Exp Fabiani L, Frontali L, Newton CS (1996) Identi®cation of an Cell Res 238: 220±30 essential core element and stimulatory sequences in a Kluyver- Selker EU, Yanofsky C, Driftmier K, Metzenberg RL, Alzner- omyces lactis ARS element, KARS101. Mol Microbiol 19: DeWeerd B, RajBhandary UL (1981) Dispersed 5S RNA genes 757±766 in N. crassa: structure, expression and evolution. Cell 24: 819± Foltmann B (1987) General and molecular aspects of rennets. In: 828 Fox PF (ed) Cheese: chemistry, physics and microbiology. Skryabin KG, Eldarov MA, Larionov VL, Bayev AA, Klootwijk J, Volume 1, general aspects. Elsevier Applied Science, London de Regt VC, Veldman GM, Planta RJ, Georgiev OI, Hadjiolov New York, pp 33±62 AA (1984) Structure and function of the non-transcribed spacer Garber RC, Turgeon BG, Selker EU, Yoder OC (1988) Organi- regions of yeast rDNA. Nucleic Acids Res 12: 2955±2968 zation of ribosomal RNA genes in the fungus Cochliobolus Smith GP (1976) Evolution of repeated DNA sequences by unequal heterostrophus. Curr Genet 14: 573±582 crossover. Science 191: 528±535 Gray GL, Hayenga K, Cullen D, Wilson LJ, Norton S (1986) Tabata S (1981) Nucleotide sequences of the 5S ribosomal RNA Primary structure of Mucor miehei aspartyl protease: evidence genes and their adjacent regions in Schizosaccharomyces pombe. for a zymogen intermediate. Gene 48: 41±53 Nucleic Acids Res 9: 6429±6437 Hanahan D (1983) Studies on transformation of Escherichia coli Tague BW, Gerbi SA (1984) Processing of the large rRNA pre- with plasmids. J Mol Biol 166: 557±560 cursor: two proposed categories of RNA-RNA interactions in Heerikhuizen H van, Ykema A, Klootwijk J, Gaillardin C, Ballas eukaryotes. J Mol Evol 20: 362±367 C, Fournier P (1985) Heterogeneity in the ribosomal RNA Tonouchi N, Shoun H, Uozumi T, Beppu T (1986) Cloning and genes of the yeast Yarrowia lipolytica; cloning and analysis of sequencing of a gene for Mucor rennin, an aspartate protease two size classes of repeats. Gene 39: 213±222 from Mucor pusillus. Nucleic Acids Res 14: 7557±7568 Hernandez P, Martin-Parras L, Martinez-Robles ML, Tsuge T, Kobayashi H, Nishimura S (1989) Organization of rib- Schvartzman JB (1993) Conserved features in the mode of osomal RNA genes in an Alternaria alternata Japanese pear replication of eukaryotic ribosomal RNA genes. EMBO J 12: pathotype, a hostselective AK-toxin-producing fungus. Curr 1475±1985 Genet 16: 267±272 Ji GE, Orlowsky M (1990) Primary and secondary structure of the Veldman GM, Klootwijk J, van Heerikhuizen H, Planta RJ (1981) 25S rRNA from the dimorphic fungus Mucor racemosus. Curr The nucleotide sequence of the intergenic region between the Genet 17: 499±506 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Lopes TS, Klootwijk J, Veenstra AE, van der Aar PC, van Possible implications for the interaction between 5.8S and 26S Heerikhuizen H, Raue HA, Planta RJ (1989) High-copy num- rRNA and the processing of the primary transcript. Nucleic ber integration into the ribosomal DNA of Saccharomyces Acids Res 10: 4847±4862 419

Vilgalys R, Gonzalez D (1990) Organization of ribosomal DNA Wendland J, PoÈ hlmann R, Dietrich F, Steiner S, Mohr C, Phil- in the Basidiomycete Thanatephorus praticola. Curr Genet 18: ippsen P (1999) Compact organization or rRNA genes in the 277±280 ®lamentous fungus Ashbya gossypii. Curr Genet 35: 618±625 Wada M, Beppu T, Horinouchi S (1996) Integrative transforma- Yanish-Perron C, Vieira J, Messing J (1985) Improved M13 phage tion of the Zygomycete Rhizomucor pusillus by homologous cloning vectors and host strains: nucleotide sequences of the recombination. Appl Microbiol Biotechnol 45: 652±657 M13mp18 and pUC19 vectors. Gene 33: 568±572