Cells and Epha Receptor Down-Regulation in T Ephrin-A1

Home , EPHA7, EPHB6, Ephrin, Ephrin A1, Ephrin A3, Ephrin B1

Ephrin-A1 Induces c-Cbl Phosphorylation and EphA Receptor Down-Regulation in T Cells

This information is current as Nigel Sharfe, Andrew Freywald, Ana Toro and Chaim M. of September 27, 2021. Roifman J Immunol 2003; 170:6024-6032; ; doi: 10.4049/jimmunol.170.12.6024 http://www.jimmunol.org/content/170/12/6024 Downloaded from

References This article cites 57 articles, 30 of which you can access for free at: http://www.jimmunol.org/content/170/12/6024.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 27, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Ephrin-A1 Induces c-Cbl Phosphorylation and EphA Receptor Down-Regulation in T Cells1

Nigel Sharfe,2 Andrew Freywald,2 Ana Toro, and Chaim M. Roifman3

Eph receptor tyrosine kinases are expressed by T lineage cells, and stimulation with their ligands, the ephrins, has recently been shown to modulate T cell behavior. We show that ephrin-A1 stimulation of Jurkat T cells induces tyrosine phosphorylation of EphA3 receptors and cytoplasmic proteins, including the c-cbl proto-oncogene. Cbl phosphorylation was also observed in peripheral blood T cells. In contrast, stimulation of Jurkat cells with the EphB receptor ligand ephrin-B1 does not cause Cbl phosphorylation. EphA activation also induced Cbl association with Crk-L and Crk-II adapters, but not the related Grb2 protein. Induction of Cbl phosphorylation upon EphA activation appeared to be dependent upon Src family kinase activity, as Cbl phosphorylation was selectively abrogated by the Src family inhibitor 4-amino-5(4-chlorophenyl-7-(tert-butyl)pyrazolo[3,4-d]pyri-

midine, while EphA phosphorylation was unimpaired. Ephrin-A1 stimulation of Jurkat cells was also found to cause down- Downloaded from regulation of endogenous EphA3 receptors from the cell surface and their degradation. In accordance with the role of Cbl as a negative regulator of receptor tyrosine kinases, overexpression of wild-type Cbl, but not its 70-Z mutant, was found to down- regulate EphA receptor expression. Receptor down-regulation could also be inhibited by blockage of Src family kinase activity. Our ﬁndings show that EphA receptors can actively signal in T cells, and that Cbl performs multiple roles in this signaling pathway, functioning to transduce signals from the receptors as well as regulating activated EphA receptor expression. The

Journal of Immunology, 2003, 170: 6024Ð6032. http://www.jimmunol.org/

ph receptor tyrosine kinases and their ligands, the ephrins, (2, 12). The ephrins themselves are membrane-associated proteins, play an important role in regulating cell migration and anchored by either a glycosylphosphatidylinositol linkage (ephrin- E targeting in the neuronal system and during embryonic A1 to -A6) or a trans-membrane domain (ephrin-B1 to -B3). Mo- development (1, 2). Eph receptors have been shown to generate nomeric soluble forms of the ephrins are inactive, most likely due adhesive or repulsive signals, guiding axonal growth cones and to a failure to form multimeric complexes, as artiﬁcially dimerized cell migration and regulating the formation of synapses (1, 3). soluble ephrins are active and can induce Eph signaling responses Recently, Eph receptor expression has been reported in cells of the (13, 14). The Ephs are categorized as EphA or EphB, according to immune system (4–6), and the ﬁrst reports examining their func- the class of ephrin bound. Receptor-ligand interaction is degener- by guest on September 27, 2021 tion and potential roles have begun to appear. Ephs were recently ate within each group, each Eph receptor binding many, if not all, shown to regulate platelet aggregation (7) and to modulate both of the ephrins (2, 12). All the Eph receptors, except EphB6, are thymocyte and T cell apoptosis (8, 9), while B lymphocytes have catalytically active tyrosine kinases (6, 15), undergoing autophos- been demonstrated to secrete soluble forms of ephrin-A4 upon phorylation and initiating signaling cascades. Recently, cross-talk activation (5). Most recently, activation of the EphB6 receptor in between Eph receptors and the formation of stable complexes be- T cells has been shown to selectively inhibit TCR-mediated acti- tween different members of the Eph family have also been de- vation of the c-Jun N-terminal kinase pathway (10). Activation of scribed (16). Eph receptors has also been shown to modulate the migration of T The signal transduction pathways downstream of the Ephs re- cells in response to a chemokine stimulus (11). main far from fully characterized. Eph receptor activation occurs The Ephs form the largest known family of receptor tyrosine as the result of ligand-induced oligomerization and subsequent au- kinases (RTK),4 with 14 members (1, 2), and are complemented by tophosphorylation, and a number of signaling proteins molecules nine ligands, known as ephrins (Eph family receptor interacting) have been shown to bind phosphorylated Eph tyrosine residues. These include the Grb2, Nck, and Src-like protein adapters; Src Immunology and Allergy, Department of Pediatrics, Infection, Immunity, Injury, and and Fyn kinases; and the lipid-modifying enzymes phosphoinositol Repair Program, Research Institute, Hospital for Sick Children, and University of 3-kinase (PI3-kinase) and phospholipase C (12), although in many Toronto, Toronto, Canada cases their function is unclear. Ephs have also been shown to be Received for publication December 11, 2002. Accepted for publication April 2, 2003. negative regulators of mitogen-activated protein kinase (MAPK) The costs of publication of this article were defrayed in part by the payment of page activation (17, 18). These investigations into Eph signaling have charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. been performed almost exclusively with in vitro assays or in neuronal and endothelial cells, and little is known of Eph receptor 1 This work was supported by the National Cancer Institute of Canada. signaling in lymphoid cells. 2 N.S. and A.F. made equal contributions to this paper. To address EphA receptor signaling in T cells we examined the 3 Address correspondence and reprint requests to Dr. Chaim M. Roifman, Division of Immunology and Allergy, Department of Pediatrics, Infection, Immunity, Injury, and signaling events resulting from ephrin-A stimulation of the Jurkat Repair Program, Research Institute of Hospital for Sick Children, 555 University Avenue, T cell line. Jurkat cells demonstrate strong binding of ephrin-A Toronto, Ontario, Canada M5G 1X8. E-mail address: [email protected] ligands and, according to RT-PCR analysis, predominantly express 4 Abbreviations used in this paper: RTK, receptor tyrosine kinase; EGF, epidermal the EphA1 and EphA3 receptors. We show here that EphA recep- growth factor; MAPK, mitogen-activated protein kinase; PBL-T, peripheral blood T cells; PDGF, platelet-derived growth factor; PI3-kinase, phosphoinositol 3-kinase; tor activation, but not EphB receptor activation, induces rapid ty- PP2, 4-amino-5(4-chlorophenyl)-7-(tert-butyl)pyrazolo[3,4-d]pyrimidine. rosine phosphorylation of the c-cbl proto-oncogene in Jurkat cells.

Ј Inducible Cbl phosphorylation was also observed in peripheral form soluble oligomers. F(ab) 2 goat anti-human Fc was used as a control blood T cells, which selectively express EphA1 and EphA4 recep- where necessary. Irrelevant Fc-fusion protein or purified human IgG were tors. EphA receptor activation also found to alter Cbl interactions used as specificity controls. with the signal transduction adapters Crk-L and Crk-II, but not the Pull-down assays, immunoprecipitation, and Western blotting related Grb2 protein. Induction of Cbl phosphorylation upon eph- and kinase assays rin-A stimulation, but not Eph receptor activation, was found to be For immunoprecipitation, cells were resuspended in ice-cold 1% Triton specifically abrogated by the Src family inhibitor 4-amino-5(4- lysis buffer consisting of 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% chlorophenyl)-7-(tert-butyl)pyrazolo[3,4-d]pyrimidine (PP2), sug- Triton X-100, 1 mM EDTA, and 1 mM sodium orthovanadate. Abs and gesting that Src family kinases may play a role in RTK-mediated protein G-Sepharose were added to cleared lysates and incubated at 4°C activation of Cbl. overnight. For ligand pull-down assays, cells were incubated on ice for 30 c-Cbl is a member of a family of related scaffold proteins (sli-1, min with the ephrin-Fc ligands before transfer to 37°C for the indicated times. Triton X-100 was replaced with 1% IGA-230, and ligand was pre- d-Cbl, c-Cbl, Cbl-b, and Cbl-3) (19, 20) and undergoes tyrosine cipitated by addition of protein G-Sepharose beads. Samples were sepa- phosphorylation in response to activation of a number of receptors, rated by SDS-PAGE and transferred to nitrocellulose membrane, and im- including the epidermal growth factor (EGF) and platelet-derived munoblotting Abs were added in PBS, 0.1% Tween 20. Bound Abs were growth factor (PDGF) tyrosine kinase receptors (21, 22). Upon detected using HRP-conjugated Abs and chemiluminescent reagents. All experiments were repeated at least three times. activation, c-Cbl can associate with a variety of signaling molecules, including the tyrosine kinases Zap-70, Syk, and Src family Transfection kinases; the adapter proteins Crk, Shc, and Grb2; and effectors such as 293T cells were transiently transfected with Myc-tagged EphA4 (0.2 ␮g), p85 PI3-kinase and Vav (19, 20, 23, 24). The function of Cbl in these Cbl, and 70-Z Cbl (2 ␮g each) cDNA in pcDNA3 vector as indicated using Downloaded from complexes remains ambiguous, but it is suggested to act as a scaffold, Lipofectamine (Invitrogen). The amounts of transfected DNA were equal- serving to juxtapose these disparate signaling molecules. ized with empty pcDNA3. Cells were harvested after 48 h. Cbl can also induce physical down-regulation of activated EGF, Eph receptor down-regulation assays PDGF, and CSF receptors from the plasma membrane through ϫ 5 induction of receptor ubiquitination, targeting them for internal- Jurkat cells (5 10 ) in serum-free RPMI were incubated at 37°C with a saturating concentration of ephrin-A1-Fc (10 ␮g/ml) or control IgG protein ization (19, 25–27). This activity is derived from its Ring finger for 30 min. Cells were stripped of bound ligand by acid wash with RPMI http://www.jimmunol.org/ domain, an E3 ubiquitin-ligase (28, 29). This appears to form a (pH 3.0) for 30 s and washed three times in ice-cold complete RPMI-10 negative feedback loop regulating the intensity and duration of before resuspension in cold PBS. Cells were stained with 10 ␮g/ml ephrin- receptor signaling. In accordance with the known properties of Cbl A1-Fc for1honice, washed three times in PBS, and incubated on ice with PE-labeled anti-Fc. Bound ligand was detected by flow cytometry. To fur- as a regulator of RTKs, we show here that cell surface expression ther analyze changes in cells expressing the highest EphA levels, the 25% of endogenous EphA receptor decreases following ephrin-A1 stim- most intensely ephrin-A1-staining cells were gated and analyzed in parallel ulation of Jurkat cells, and proteasome-dependent degradation of to the total population. In some experiments cells were preincubated with the EphA3 receptor is observed. EphA4 receptor expression could the Src family inhibitor PP2 (5 ␮M) or the inactive analog PP3 at 37°C. also be down-regulated in transfected cells by overexpression of wild-type Cbl, but not of a ubiquitin-ligase inactive 70-Z Cbl Results by guest on September 27, 2021 protein. Ephrin-A stimulates EphA receptor activation and tyrosine phosphorylation in T cells Materials and Methods RT-PCR analysis of Jurkat T cells demonstrated the presence of Abs and recombinant proteins mRNA for EphA1, EphA2, and EphA3 receptors (Fig. 1A), while Monoclonal anti-phosphotyrosine was obtained from Upstate Biotechnol- analysis of purified peripheral blood T cells (PBL-T) revealed ogy (Lake Placid, NY). Abs to Cbl, Crk-L, Crk-II, Grb2, Myc, and Fyn preferential expression of EphA1 and EphA4. Incubation of both were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Ephrin- Jurkat cells and PBL-T on ice with soluble ephrin-A-Fc chimeric human Fc chimeric fusion proteins were purchased from R&D Systems protein, followed by staining with FITC-labeled anti-Fc to detect (Minneapolis, MN). Purified human IgG was purchased from Serotec (Ox- bound ligand, revealed strong staining with ephrin-A1 to -A5 upon ford, U.K.). flow cytometric analysis (not shown), demonstrating the expres- Cell lines and isolation of T lymphocytes sion of functional EphA receptors at the cell surface. The mature T cell line Jurkat was grown in complete RPMI-10 medium. To examine EphA receptor signaling, Jurkat cells were stimu- PBL were purified from fresh peripheral blood by centrifugation on Ficoll lated with oligomeric ephrin-A1 or ephrin-A3 for 15 min at 37°C. and were cultured with PHA and IL-2 for 3 days in complete RPMI-10 This resulted in the appearance of a strongly phosphorylated band medium before transfer to RPMI-10 with IL-2. Suspension cells were col- of ϳ125 kDa in anti-phosphotyrosine blots of total cell lysates and lected after 6–8 days of culture. The resultant T cell lymphocytes are typically Ͼ95% CD3ϩ. minor bands of 100 and 65 kDa (Fig. 1B). Control stimulations with IgG did not induce tyrosine phosphorylation (not shown). RT-PCR analysis Members of the ephrin-A subclass demonstrate highly degenerate Total RNA was purified using RNAeasy (Qiagen, Valencia, CA). First- binding to EphA receptors (1, 2), and therefore, the similarity of strand cDNA was made with random primer and Superscript II (Invitrogen, responses to ephrin-A1 and ephrin-A3 was not unexpected. The San Diego, CA). The following primer pairs were used for analysis of Eph dominant phosphorylated 125-kDa band appeared to represent li- receptor expression, creating PCR products each of ϳ400 bp: EphA1, gaagcttcaggcacatctggag and ccttgaatccctgaatactgcaaag; EphA2, ctttgacccc gand-induced EphA receptor phosphorylation, being of approxi- cgcgtgtctatc and gatggggatccccacagtgttc; EphA3, cagtgcagccgcaaggccatc mately the expected m.w. to be a member of the EphA subfamily and cacgggaactgggccattctttg; EphA4, cggagagctccagacctaacac and gacgg (1, 2). The p125 phosphorylation was induced rapidly, was max- gaaccattctgccgtgc; and EphA7, ggaacttgtagtaggccaataagc and cacacttgaat imal after 10–15 min, and declined to a near basal level by 60 min gccagttccatg. PCRs were performed with the cycle conditions 94°C for (Fig. 1B, right panel). In the absence of Abs capable of immuno- 30 s, 60°C for 30 s, and 68°C for 45 s for 35 cycles. precipitating many EphA receptors, it is difficult to examine en- T cell stimulation dogenous receptor activation. However, we used the previously Soluble ephrin-Fc fusion proteins (dimerized) were precomplexed by in- demonstrated ability of ephrin-A ligands to pull-down EphA re- Ј cubation on ice with F(ab) 2 goat anti-human Fc (Pierce, Rockford, IL) to ceptors under permissive lysis conditions (18). Cells were incu- 6026 ACTIVATION OF Cbl BY EphA RECEPTORS IN T CELLS

125-kDa phosphoprotein was recognized by Abs to EphA3 (Fig. 2B). EphA1 was not detected in ephrin-A1 pull-downs despite at- tempts to Western blot with several different Abs to the receptor. However, as Ephs may act as heteroreceptor complexes, we cannot rule out the possibility that EphA1 is present, but undetectable due to the limited sensitivity of the assay. In accordance with the de- generacy of ephrin-A binding to EphA receptors, the 125-kDa EphA3 receptor could be speciﬁcally precipitated by all the ephrin-A ligands examined (not shown). All the EphA receptors are reported to be catalytically active tyrosine kinases (2), and in vitro kinase assays performed with ephrin-A pull-downs revealed strong phosphorylation of the 125-kDa protein consistent with autophos- phorylation (Fig. 2C).

Ephrin-A stimulation induces c-Cbl phosphorylation There were several candidates for the 100-kDa phosphorylated protein observed in ephrin-A1-stimulated total cell lysates. One of them, Cas, lies downstream of EphA receptors in NIH-3T3 cells

(30). Although Cas undergoes ephrin-A1-inducible tyrosine phos- Downloaded from phorylation in 3T3 cells, Cas phosphorylation was not detected upon ephrin-A1 stimulation of Jurkat (not shown). A second can- didate was the proto-oncogene c-cbl. Many receptor tyrosine kinases, such as the EGF and PDGF receptors, activate c-Cbl FIGURE 1. Ephrin-A stimulation induces tyrosine phosphorylation in through phosphorylation (22). Immunoprecipitation of Cbl re-

Jurkat cells. A, EphA receptor expression by Jurkat T cells and puriﬁed vealed a rapid induction of tyrosine phosphorylation upon eph- http://www.jimmunol.org/ PBL-T (from three unrelated individuals) was examined by RT-PCR anal- rin-A1 stimulation (Fig. 3A). Cbl phosphorylation could be de- ysis in parallel with HEK-293, which expresses all the EphA receptors tected within 30 s (not shown), peaking at levels 2- to 3-fold higher examined. One representative experiment of three is shown. B, Jurkat cells than basal at 10 min. Similar levels of Cbl phosphorylation (1.5- to (1 ϫ 106) were stimulated with 1 ␮g/ml oligomeric ephrin-1 or ephrin-A3 as indicated at 37°C for 10 min, and total cell lysates were Western blotted 2.5-fold increase) could also be induced by ephrin-A2 and eph- with anti-phosphotyrosine. Loading was controlled by reblotting with anti- rin-A3 (Fig. 3B). Cbl phosphorylation was not, however, altered in ␮ response to stimulation with ephrin-B1 (Fig. 3C), although Jurkat Gi␣. Right panel, Jurkat cells were stimulated with 1 g/ml ephrin-A1 for the indicated periods of time, and total cell lysates were Western blotted express mRNA for multiple EphB receptors (EphB1–4 and 6, not with anti-phosphotyrosine. One representative experiment of four is shown. shown). To determine whether ephrin-A1-induced Cbl phosphorylation by guest on September 27, 2021 was restricted to cell lines or could also occur in primary T cells, bated on ice with ephrin-A1 or control proteins before transfer to we examined whether ephrin-A1 could stimulate Cbl phosphory- 37°C for 15 min. Cells were then solubilized in Nonidet P-40 lysis lation in PBL-T. RT-PCR analysis of EphA receptors in PBL-T buffer, and the ligand-receptor complex was pulled-down by ad- revealed preferential expression of EphA1 and EphA4, rather than dition of protein G-Sepharose beads. Ephrin-A1, but not control the EphA1 and EphA3 observed in the mature T cell line Jurkat proteins, speciﬁcally precipitated the 125-kDa phosphoprotein (Fig. 1A). However, ephrin-A1 stimulation similarly resulted in (Fig. 2A), suggesting that this was indeed EphA receptor. RT-PCR c-Cbl phosphorylation (Fig. 3D). Induction of Cbl phosphorylation analysis of Eph expression in Jurkat cells revealed messages for was lower in primary T cells (consistently a 1.5-fold increase by EphA1 and EphA3, and Western blotting demonstrated that the densitometry) than in Jurkat cells, but this was probably due to a

FIGURE 2. Jurkat cells express active EphA3 receptor. A and B, Jurkat cells (107) were incubated with 1 ␮g/ml ephrin-A1-Fc or control proteins on ice for 30 min before transfer to 37°C for 15 min. Cells were then lysed in Nonidet P-40 lysis buffer, and the Fc ligand was precipitated by addition of protein G-Sepharose. Fc ligand pull-downs were Western blotted with anti-phosphotyrosine to detect the phosphorylated protein or anti- EphA3 or anti-EphA1 as indicated. IgG, purified human immunoglobulin; Fc, Fc, anti- human Fc F(ab)2; A1, ephrin-A1-Fc; FGF, fibroblast growth factor receptor-Fc. C, Ligand pull-downs were washed with kinase assay buffer before addition of 10 ␮Ci of [␥-33P]ATP and transfer to 37°C for 20 min. SDS-PAGE- separated samples were exposed to film. All experiments were repeated three times. The Journal of Immunology 6027

FIGURE 3. Ephrin-A stimulation induces Cbl phosphorylation. A, Jurkat cells (107) were stimulated with 1 ␮g/ml ephrin-A1-Fc for the indicated times. Cbl was immunoprecipitated from cell lysates in 1% Triton and blotted with anti- phosphotyrosine. Loading was controlled by reblotting with anti-Cbl. B, Cells were stimulated with ephrin-A1 to -A3 as indicated and analyzed as described in A. C, Jurkat cells were stimulated with ephrin-B1 for 10 min, and Cbl phosphorylation was examined as described in A. All experiments were repeated at least three times. D, PBL-T (5 ϫ 106) from two unrelated individuals were stimulated with 1 ␮g/ml ephrin-A1 for the indicated times, and Cbl phosphorylation was examined as described in A. Matching lysates were blotted with

anti-Cbl to control protein loading. Downloaded from http://www.jimmunol.org/ lower level of EphA receptor expression on primary T cells (as that Src family kinases are indeed involved in ephrin-A1-induced assessed by flow cytometry, not shown). Whether EphA1, com- Cbl phosphorylation. monly expressed by Jurkat and PBL-T, is alone responsible for activating Cbl, or whether many EphA receptors induce Cbl phos- Ephrin-A1 stimulation regulates the role of c-Cbl in signal phorylation remains to be determined. transduction There are at least two distinct aspects to c-Cbl function in T cells, Src family kinase inhibitor, PP2, blocks EphA-mediated Cbl one being a central role in connecting downstream signaling path- phosphorylation, but not EphA activation ways (19, 23). Cbl appears to act as a scaffold for the assembly of by guest on September 27, 2021 a large complex of signal transduction proteins. We therefore ex- Cbl phosphorylation in hemopoietic cells often appears to result amined the influence of ephrin-A1 stimulation on a number of from activation of soluble cytoplasmic kinases, most particularly well-described Cbl interactions. One of these is with the adapter members of the Src family (31–33). We therefore examined protein Crk-L (35–38). Crk-L was immunoprecipitated from eph- whether Src kinases might play a role in EphA receptor-induced rin-A1-stimulated Jurkat cells, and the association of tyrosine- Cbl phosphorylation. phosphorylated proteins was examined by Western blotting. Eph- Interaction between the T cell Src family kinase Fyn and Cbl is rin-A1 stimulation resulted in increased association of a 100-kDa well described in response to Ag receptor and cytokine stimuli. phosphoprotein in Crk-L immunoprecipitates (Fig. 5A, left panel), Fyn has been shown to bind Cbl both through its SH3 domain and which was confirmed as Cbl by Western blotting with anti-Cbl Abs in a phosphorylation-dependent manner via its SH2 domain. Anti- (Fig. 5A, right panel). While Cbl association with Crk-L increased phosphotyrosine blotting of Fyn immunoprecipitates from ephrin- 2- to 2.5-fold, it was not present in control immunoprecipitation A1-stimulated Jurkat cells revealed increased association of a 100- with irrelevant IgG (not shown). The correlation between Cbl/ kDa Cbl-like phosphoprotein (Fig. 4A), although reblotting with Crk-L association and Cbl phosphorylation is in accordance with anti-Cbl was unable to unambiguously confirm the identity of the binding mediated through the recognition of phosphorylated Cbl protein as Cbl. Fyn catalytic activity was also found to increase tyrosine residues by an SH2 domain of Crk-L as previously described (35, 36). Tyrosine phosphorylation of Crk-L itself (42 upon ephrin-A1 stimulation (not shown), suggesting that Fyn kDa) could not be detected. Jurkat cells also express the closely could indeed play a role in phosphorylation of proteins down- related Crk-II gene product, and ephrin-A1 induced similar bind- stream of the activated EphA receptor. A role for Src family ki- ing of pp100 to Crk-II (Fig. 5B; a similar 2-fold increase, con- nases in Cbl activation was further suggested when pretreatment of firmed as Cbl by direct blotting with anti-Cbl, not shown). Cbl also Jurkat T cells with the Src family-specific kinase inhibitor PP2, but undergoes a well-characterized interaction with the adapter protein not its inactive analog PP3, was found to inhibit ephrin-A1-in- Grb2 in response to certain stimuli (37, 39, 40). However, while duced Cbl phosphorylation (Fig. 4B). PP2 is reported to be a basal association of Grb2 with a 100-kDa phosphorylated protein highly specific inhibitor of Src family members (34), and EphA was evident, no increase in the phosphorylation of this protein was phosphorylation, resulting predominantly from autophosphoryla- observed upon ephrin-A1 stimulation (Fig. 5C), suggesting that the tion, was unaltered in its presence (Fig. 4B, right panel), confirm- Grb2-Cbl complex may not participate in EphA receptor signaling. ing the specificity of PP2. This inhibition of Cbl phosphorylation In addition to modulating Cbl association with the Crk proteins, was specific to PP2, as neither PP3, the Syk family inhibitor ephrin-A1 stimulation was found to alter interaction with p85 PI3- piceatannol, nor the MAPK kinase kinase inhibitor PD 98059 af- kinase and Vav (not shown), suggesting that EphA receptor acti- fected the induction of Cbl phosphorylation (Fig. 4C), suggesting vation may regulate many transduction pathways through Cbl. 6028 ACTIVATION OF Cbl BY EphA RECEPTORS IN T CELLS Downloaded from FIGURE 5. Ephrin-A1 stimulation induces association of Cbl with the Crk adapter proteins. A, Jurkat cells were stimulated with 1 ␮g/ml ephrin-A1 for the indicated times. Crk-L was immunoprecipitated from Triton lysates and blotted with anti-phosphotyrosine. Samples were reblotted with anti-Crk-L. Right panel, Crk-L was immunoprecipitated from ephrin-A1- stimulated Jurkat cell lysates and blotted with anti-Cbl. Immunoprecipi- tates of ephrin-A1-stimulated cells with control human IgG did not dem- http://www.jimmunol.org/ onstrate Cbl binding (not shown). B and C, Cells were stimulated as described in A, and Crk-II (B) or Grb2 (C) precipitates were blotted with anti-phosphotyrosine.

FIGURE 4. The Src family kinase inhibitor PP2 blocks Cbl phosphor- could be isolated by coexpression of EphA receptor and Cbl in ylation. A, Jurkat cells were stimulated with ephrin-A1 for the indicated times. Anti-Fyn immunoprecipitates were Western blotted with anti- 293T cells (Fig. 6A). Furthermore, overexpression of wild-type by guest on September 27, 2021 phosphotyrosine and subsequently with anti-Fyn. B, Jurkat cells (107) were Cbl, but not the 70-Z Cbl mutant, was found to decrease EphA pretreated with the Src kinase inhibitor PP2 or its inactive analog PP3. expression, although they bound the receptor equally well. 70-Z Cells were incubated at 37°C for 30 min with PP2 or PP3 (5 ␮M) before Cbl has a functional extended SH2 domain, allowing it to bind addition of ephrin-A1 for an additional 10 min. Cbl phosphorylation was activated receptors, but contains a deletion in its ubiquitin ligase examined as in Fig. 3A. Right panel, Jurkat cells were pretreated with PP2 ring ﬁnger domain, rendering it unable to induce RTK ubiquitina- or PP3. Fc ligand pull-downs from treated cells were blotted with anti- tion and, thus, down-regulation (26, 43). 70-Z Cbl did not decrease phosphotyrosine. Matching lysates were blotted with anti-Gi␣ to control EphA expression, but, rather, elevated it, further suggesting that protein loading. C, Jurkat cells were pretreated with Src kinase inhibitor activated EphA receptors undergo degradation as the result of in- PP2 (5 ␮M), PP3 (5 ␮M), the Syk family inhibitor picteannol (10 ␮M), or teraction with wild-type Cbl. the MAPK kinase kinase inhibitor PD 98059 (5 ␮M) for 30 min. Cbl precipitates were blotted with anti-phosphotyrosine and reblotted with anti- To assess the potential for endogenous EphA receptor down- Cbl, Eph receptor phosphorylation was monitored by blotting total cell regulation in Jurkat T cells, we analyzed cell surface expression of EphA receptors by ligand binding assay. Jurkat cells were incu- lysates with anti-phosphotyrosine, and lysates were reblotted with anti-Gi␣ to control loading. One representative experiment of at least three is shown bated with a saturating concentration of ephrin-A1-Fc (10 ␮g/ml) in all cases. or control IgG protein for 30 min at 37°C to induce receptor down- regulation. Cells were then stripped of bound ligand by acid wash (RPMI, pH 3.0) and stained with ephrin-A1-Fc ligand for 1 h on EphA receptors undergo down-regulation from the cell surface ice to detect EphA receptor expression. Bound ligand was detected upon ephrin-A1 stimulation by a secondary incubation on ice with PE-labeled anti-Fc and sub- c-Cbl has a second important function in addition to a role in signal sequent ﬂow cytometric analysis. EphA receptor expression was transduction. Cbl is known to be responsible for the physical consistently decreased following incubation at 37°C with ephrin- down-regulation of receptor tyrosine kinases from the cell surface, A1, but not with control protein (Fig. 6B). This was most notable including the EGF, PDGF, and CSF receptors (27, 41, 42). This when the cells initially displaying the highest levels of EphA re- would appear to form part of a negative feedback loop regulating ceptor expression were examined separately (ϳ25% of total), the intensity and duration of receptor signaling. The down-regulation where an ϳ80% drop in EphA receptor surface expression was of receptors requires receptor kinase activity (27) and may be depen- seen (Fig. 6B, right panel). Down-regulation of EphA receptors dent upon phosphorylation of Cbl (25), suggesting that the EphA re- reached a plateau after ϳ40 min (Fig. 6C), roughly paralleling the ceptors could be subject to Cbl-mediated down-regulation. disappearance of phosphorylated EphA receptor from total cell We were unable to coimmunoprecipitate EphA receptor and Cbl lysates (Fig. 1C). Control experiments using incubation with eph- from Jurkat cells, either because of the absence of an effective rin-A1 on ice did not show altered EphA receptor expression (not immunoprecipitating Ab to EphA3 or because of a relatively low shown). Interestingly, preincubation with the Src family inhibitor level of receptor expression. However, a constitutive complex PP2, but not PP3, was also found to block ephrin-A1-induced EphA The Journal of Immunology 6029 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 6. EphA receptor cell surface expression is down-regulated following ephrin-A1 stimulation. A, 293T cells were transiently transfected with Myc-tagged EphA4, Cbl, and 70-Z Cbl cDNA in the pcDNA3 vector. EphA4 was immunoprecipitated with anti-Myc, and samples were blotted with anti-Cbl and anti-Myc as indicated. Matching lysates were blotted with anti-Cbl to determine the expression of transfected Cbl proteins and anti-Gi␣ to control protein loading. One representative experiment of four is shown. B, Jurkat cells (5 ϫ 105) were incubated with 10 ␮g/ml ephrin-A1-Fc or control IgG protein for 30 min at 37°C. Cells were then stripped of bound ligand by acid wash before resuspension in cold PBS for staining. Cells were stained on ice with 10 ␮g/ml ephrin-A1-Fc and incubated with PE-labeled anti-Fc, and bound ligand was detected by flow cytometry. The average of three independent experiments is shown with SEs. Right panel, Cells initially displaying the highest levels of EphA receptor expression were examined separately (ϳ25% of total) and demonstrated an ϳ80% drop in EphA expression. C, Cells were treated with 10 ␮g/ml ephrin-A1-Fc or control IgG protein for the indicated periods of time at 37°C, and receptor expression was analyzed as described in B. The average of three experiments is shown. D, Jurkat cells were pretreated with the Src family inhibitor PP2 or inactive PP3 for 37°C for 30 min before addition of 10 ␮g/ml ephrin-A1 or control IgG for an additional 30 min. Receptor expression was analyzed as described in B. E, Jurkat cells were stimulated with ephrin-A1 or control IgG as indicated for up to 60 min at 37°C. Cells were lysed, 1 ␮g of ephrin-A1-Fc was added to each stimulated sample, and EphA3 receptor precipitated by Fc ligand pull-down. Receptor expression was revealed by blotting with anti-EphA3. Specificity was controlled by control immunoprecipitation with IgG. Lower panel, Sample loading ␣ ␮ was controlled by blotting matching lysates with anti-Gi . F, Cells were pretreated with the proteasomal inhibitor MG-132 (50 M) for 30 min before stimulation with ephrin-A1 at 37°C. EphA3 expression was then examined by pull-down and blotting with anti-EphA3 and was controlled by blotting matching lysates with anti-Erk2. One representative experiment of three is shown. 6030 ACTIVATION OF Cbl BY EphA RECEPTORS IN T CELLS down-regulation (Fig. 6D), suggestive of a requirement for Src kinase EphB6 binds Cbl, EphB1 does not (16). As the site of Cbl binding activity similar to that for induction of Cbl phosphorylation. to EphA receptors has not been identified, association with the The coexpression of EphA4 and Cbl in HEK-293 cells was ob- different subfamily members is not yet predictable. served to decrease receptor protein expression. Similarly, the level While Wang et al. (47) observed ligand-inducible EphA2-Cbl of EphA3 protein expression in Jurkat cells was found to decrease association, they did not report ligand-inducible receptor down- upon stimulation with ephrin-A1, but not control protein (Fig. 6E), regulation or induction of Cbl phosphorylation. However, it is pos- suggesting that the EphA3 receptor was not only removed from the sible that the preactivated status of the receptors due to persistent cell surface, but subsequently degraded. Indeed, pretreatment with contact with neighboring cell-expressed ephrins precludes the ob- the proteasomal inhibitor MG-132 prevented ligand-induced dis- servation of these events. Alternatively, the different natures of the appearance of EphaA3 (Fig. 6F). relatively immobile adherent epithelial cell and the mobile lymphoid cells may entail different modes of EphA receptor regulation Discussion in response to engagement by ephrin-A ligand. Our finding that EphA activation induces Cbl phosphorylation The ability to block ephrin-A1-induced Cbl phosphorylation in brings these receptors into a larger group of tyrosine kinase recep- Jurkat cells by inhibiting Src family kinase activity with PP2 was tors demonstrating the ability to regulate and be regulated by Cbl. surprising. This suggests that either the EphA receptor kinase do- These observations also add to our understanding of EphA recep- main is not responsible for Cbl phosphorylation, or alternatively, tor signaling and function in cells of the immune system and fur- that ligand-induced, Src family kinase-mediated phosphorylation thermore may reveal a basis by which EphA receptors can cross- is required for EphA-Cbl interaction. Although this observation talk with other T cell-expressed receptors, most importantly the Ag relies upon the use of a synthetic kinase inhibitor, PP2, and the Downloaded from and chemokine receptors. Eph costimulation has recently been shown closely related PP1 are considered to be specific inhibitors of the to modulate T cell responses to activation of both of these receptors Src family (34, 48–50) and are commonly used to examine the role (8, 9, 11). As the TCR and chemokine receptors both regulate Cbl of Src family kinases. Providing indirect support for a role for Src phosphorylation and function (35, 37, 44, 45), the ability to modulate family kinase(s) in ephrin-A1-induced Cbl phosphorylation, Fyn Cbl and its associated proteins may permit EphA receptors to influ- kinase activity was observed to be increased following ephrin-A1

ence the activation of these signaling pathways. stimulation (not shown) and a phosphorylated 100-kDa protein http://www.jimmunol.org/ While EphA receptor activation was observed to induce rapid consistent with Cbl was also observed to coimmunoprecipitate tyrosine phosphorylation of Cbl in Jurkat cells, interestingly Cbl with Fyn. It has been suggested that the Src family kinases Fyn and phosphorylation was not induced by ephrin-B1. This is despite the Yes may play a major role in Cbl phosphorylation, while the re- presence of multiple EphB receptors in Jurkat cells and suggests lated Lck phosphorylates Cbl ineffectively (33). In agreement, that EphBs may not be subject to regulation by Cbl. Previously, we pp100 was not observed in Lck immunoprecipitates from ephrin- have shown that the EphB6 receptor, but not EphB1, can bind Cbl A1-stimulated Jurkat cells, and an absence of Lck expression in the in transfected 293-T cells (16), but were unable to observe any J.Cam.1.6 cell line did not appear to hinder ephrin-A1-induced Cbl effect on Cbl phosphorylation. Luo et al. (8) also examined the phosphorylation (not shown). Our observations are clearly akin to linkage between EphB6 and Cbl using Jurkat cells, demonstrating the recent findings of Kassenbrock et al. (51), who demonstrated a by guest on September 27, 2021 that ligation of EphB6 with specific Ab caused a reduction in basal role for Src family kinases in EGF-induced phosphorylation of Cbl Cbl phosphorylation. We did not observe a decrease in Cbl phos- using the PP1 inhibitor. PP1 inhibited Cbl activation, but not phosphorylation upon stimulation of Jurkat with ephrin-B1, although phorylation of the EGF receptor itself, observations clearly similar this may reflect the different natures of ephrin-B and Ab stimuli, to our findings. While Kassenbrock et al. (51) were also able to one activating multiple EphB receptors and the other EphB6 alone. observe abrogation of EGF receptor-Cbl association upon PP1 To date, the potential for EphA down-regulation has received treatment, their observations similarly do not yet permit us to de- little attention, although down-regulation of the ephrin-A ligand termine the precise role of Src family-mediated phosphorylation. upon engagement by EphA receptor has been reported to occur as While the role of Cbl in regulating the expression of activated the result of proteolytic cleavage of the cell surface-expressed li- RTKs is beginning to be reasonably well understood, its precise gand (46). We observed down-regulation of EphA receptors from role in signal transduction is unclear, although interaction with a the surface of Jurkat cells following ephrin-A1 stimulation, with variety of signaling proteins has been observed. Currently, its role kinetics and magnitude of receptor down-regulation similar to is defined as that of a scaffold protein, serving to juxtapose other those previously reported for other RTKs, such as the EGF recep- proteins in a spatially and temporally regulated manner (23, 24, tor (25, 26). The PDGF, EGF, and CSF receptor tyrosine kinases 43). Following Ag receptor stimulation of T cells, Cbl undergoes all induce Cbl phosphorylation and undergo down-regulation as rapid tyrosine phosphorylation and associates with the Src homol- the result of Cbl-mediated ubiquitination (27, 41, 42). Although we ogy domain-containing adapters Grb2, Crk, and Crk-L (36, 37, could not unambiguously detect association between Cbl and the 44). In contrast, ephrin-A1 stimulation of Jurkat cells appeared to EphA3 receptors in Jurkat cells, a tyrosine-phosphorylated protein result in the association of phosphorylated Cbl with Crk proteins, of the correct m.w. was observed in ephrin-A pull-downs upon but not Grb2. Cbl has been suggested to sequester Grb2 away from long exposure of anti-phosphotyrosine Western blots (not shown). Sos, thus inhibiting Ras activation (52), and EphA activation has As with many RTKs, the isolation of the Cbl-EphA receptor com- indeed been reported to inhibit Ras-mediated MAPK activation in plex required overexpression of both proteins, and we were readily neuronal and endothelial cells (17, 18). We did not, however, ob- able to identify EphA4-Cbl complexes by cotransfection in HEK- serve decreased MAPK activity in Jurkat cells upon ephrin-A1 293 cells. Most recently, Wang et al. (47) have also demonstrated stimulation (data not shown), perhaps consistent with unchanged EphA2-Cbl association by coexpression in these cells. However, it Grb2 association. is not clear that all members of the EphA receptor family should While Crk-II was recently shown to link EphA3 activation to a bind Cbl and be subject to similar Cbl-mediated regulation. Cbl cellular retraction and detachment response in adherent 293T cells binding is known to be selective in the ErbB family of RTKs, with (53), the potential function of Crk-L in lymphoid cells in response subsequent differences in the regulation of activation and expres- to ephrin-A stimulation is uncertain. Through the ability to mod- sion (27), and we have previously demonstrated that although ulate Crk interactions, EphA receptors could potentially regulate The Journal of Immunology 6031 many aspects of T cell function. Cbl is the predominant phospho- 20. Rao, N., I. Dodge, and H. Band. 2002. The Cbl family of ubiquitin ligases: critical protein associated with the Crk proteins in activated lymphocytes negative regulators of tyrosine kinase signaling in the immune system. J. Leu- kocyte Biol. 71:753. and in response to Ag receptor stimulation, and this complex ap- 21. Meisner, H., and M. P. Czech. 1995. Coupling of the proto-oncogene product pears to have multiple functions (36, 54). The formation of a ter- c-Cbl to the epidermal growth factor receptor. J. Biol. Chem. 270:25332. nary complex of Cbl-Crk-L and C3G, a guanine nucleotide ex- 22. Galisteo, M. L., I. Dikic, A. G. Batzer, W. Y. Langdon, and J. Schlessinger. 1995. Tyrosine phosphorylation of the c-cbl proto-oncogene protein product and asso- change factor for the small G protein Rap1, has been reported upon ciation with epidermal growth factor (EGF) receptor upon EGF stimulation. Ag receptor stimulation of T cells (24, 35, 55). The role of Rap1 J. Biol. Chem. 270:20242. 23. Lupher, M. L., Jr., C. E. Andoniou, D. Bonita, S. Miyake, and H. Band. 1998. The activation is unclear and controversial, but it may antagonize Ras c-Cbl oncoprotein. Int. J. Biochem. Cell. Biol. 30:439. activation. Crk also associates with p130Cas; this complex plays 24. Miyake, S., M. L. Lupher, Jr., C. E. Andoniou, N. L. Lill, S. Ota, P. Douillard, an important role in regulating the attachment and migration of N. Rao, and H. Band. 1997. The Cbl protooncogene product: from an enigmatic oncogene to center stage of signal transduction. Crit. Rev. Oncog. 8:189. adherent cells (56). Carter et al. (30) have shown recently that 25. Levkowitz, G., H. Waterman, S. A. Ettenberg, M. Katz, A. Y. Tsygankov, EphA receptor stimulation modulates cytoskeletal rearrangement I. Alroy, S. Lavi, K. Iwai, Y. Reiss, A. Ciechanover, et al. 1999. Ubiquitin ligase through Cas in NIH-3T3 cells. In T cells the complex of activity and tyrosine phosphorylation underlie suppression of growth factor sig- ␤ naling by c-Cbl/Sli-1. Mol. Cell 4:1029. p105Cas-L and Crk plays an important role in 1 integrin signal- 26. Waterman, H., G. Levkowitz, I. Alroy, and Y. Yarden. 1999. The RING finger of ing, regulating migration on fibronectin (57). c-Cbl mediates desensitization of the epidermal growth factor receptor. J. Biol. In summary, Cbl would appear to play multiple roles down- Chem. 274:22151. 27. Levkowitz, G., H. Waterman, E. Zamir, Z. Kam, S. Oved, W. Y. Langdon, stream of the EphA receptors, functioning to transduce signals L. Beguinot, B. Geiger, and Y. Yarden. 1998. c-Cbl/Sli-1 regulates endocytic from activated receptors as well as regulating EphA receptor sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev. expression. 12:3663. Downloaded from 28. Zheng, N., P. Wang, P. D. Jeffrey, and N. P. Pavletich. 2000. Structure of a c-Cbl-UbcH7 complex: RING domain function in ubiquitin-protein ligases. Cell 102:533. Acknowledgments 29. Yokouchi, M., T. Kondo, A. Houghton, M. Bartkiewicz, W. C. Horne, H. Zhang, We thank Robin McNeilly and Daniel Hesse for technical assistance. A. Yoshimura, and R. Baron. 1999. Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J. Biol. Chem. 274:31707. References 30. Carter, N., T. Nakamoto, H. Hirai, and T. Hunter. 2002. EphrinA1-induced cy- http://www.jimmunol.org/ 1. Zisch, A. H., and E. B. Pasquale. 1997. The Eph family: a multitude of receptors toskeletal re-organization requires FAK and p130cas. Nat. Cell. Biol. 4:565. that mediate cell recognition signals. Cell Tissue Res. 290:217. 31. Panchamoorthy, G., T. Fukazawa, S. Miyake, S. Soltoff, K. Reedquist, B. Druker, 2. Zhou, R. 1998. The Eph family receptors and ligands. Pharmacol. Ther. 77:151. S. Shoelson, L. Cantley, and H. Band. 1996. p120cbl is a major substrate of 3. Ciossek, T., B. Monschau, C. Kremoser, J. Loschinger, S. Lang, B. K. Muller, tyrosine phosphorylation upon B cell antigen receptor stimulation and interacts in F. Bonhoeffer, and U. Drescher. 1998. Eph receptor-ligand interactions are nec- vivo with Fyn and Syk tyrosine kinases, Grb2 and Shc adaptors, and the p85 essary for guidance of retinal ganglion cell axons in vitro. Eur. J. Neurosci. subunit of phosphatidylinositol 3-kinase. J. Biol. Chem. 271:3187. 10:1574. 32. Tsygankov, A. Y., S. Mahajan, J. E. Fincke, and J. B. Bolen. 1996. Specific 4. Aasheim, H. C., L. W. Terstappen, and T. Logtenberg. 1997. Regulated expres- association of tyrosine-phosphorylated c-Cbl with Fyn tyrosine kinase in T cells. sion of the Eph-related receptor tyrosine kinase Hek11 in early human B lym- J. Biol. Chem. 271:27130. phopoiesis. Blood 90:3613. 33. Feshchenko, E. A., W. Y. Langdon, and A. Y. Tsygankov. 1998. Fyn, Yes, and 5. Aasheim, H. C., E. Munthe, S. Funderud, E. B. Smeland, K. Beiske, and Syk phosphorylation sites in c-Cbl map to the same tyrosine residues that become

T. Logtenberg. 2000. A splice variant of human ephrin-A4 encodes a soluble phosphorylated in activated T cells. J. Biol. Chem. 273:8323. by guest on September 27, 2021 molecule that is secreted by activated human B lymphocytes. Blood 95:221. 34. Zhu, X., J. L. Kim, J. R. Newcomb, P. E. Rose, D. R. Stover, L. M. Toledo, 6. Shimoyama, M., H. Matsuoka, A. Tamekane, M. Ito, N. Iwata, R. Inoue, H. Zhao, and K. A. Morgenstern. 1999. Structural analysis of the lymphocyte- K. Chihara, A. Furuya, N. Hanai, and T. Matsui. 2000. T-cell-specific expression specific kinase Lck in complex with non-selective and Src family selective kinase of kinase-defective Eph-family receptor protein, EphB6 in normal as well as inhibitors. Struct. Fold. Des. 7:651. transformed hematopoietic cells. Growth Factors 18:63. 35. Reedquist, K. A., T. Fukazawa, G. Panchamoorthy, W. Y. Langdon, 7. Prevost, N., D. Woulfe, T. Tanaka, and L. F. Brass. 2002. Interactions between S. E. Shoelson, B. J. Druker, and H. Band. 1996. Stimulation through the T cell Eph kinases and ephrins provide a mechanism to support platelet aggregation receptor induces Cbl association with Crk proteins and the guanine nucleotide once cell-to-cell contact has occurred. Proc. Natl. Acad. Sci. USA 99:9219. exchange protein C3G. J. Biol. Chem. 271:8435. 8. Luo, H., X. Wan, Y. Wu, and J. Wu. 2001. Cross-linking of EphB6 resulting in 36. Sawasdikosol, S., J. H. Chang, J. C. Pratt, G. Wolf, S. E. Shoelson, and signal transduction and apoptosis in Jurkat cells. J. Immunol. 167:1362. S. J. Burakoff. 1996. Tyrosine-phosphorylated Cbl binds to Crk after T cell ac- 9. Munoz, J. J., C. L. Alonso, R. Sacedon, T. Crompton, A. Vicente, E. Jimenez, tivation. J. Immunol. 157:110. A. Varas, and A. G. Zapata. 2002. Expression and function of the Eph A receptors 37. Buday, L., A. Khwaja, S. Sipeki, A. Farago, and J. Downward. 1996. Interactions and their ligands ephrins A in the rat thymus. J. Immunol. 169:177. of Cbl with two adapter proteins, Grb2 and Crk, upon T cell activation. J. Biol. 10. Freywald, A., N. Sharfe, C. Rashotte, T. Grunberger, and C. M. Roifman. 2003. Chem. 271:6159. The EphB6 receptor inhibits JNK activation in T lymphocytes and modulates T 38. Sattler, M., and R. Salgia. 1998. Role of the adapter protein CRKL in signal cell receptor-mediated responses. J. Biol. Chem. 293:10150. transduction of normal hematopoietic and BCR/ABL-transformed cells. Leuke- 11. Sharfe, N., A. Freywald, and C. M. Roifman. 2002. Ephrin stimulation modulates mia 12:637. T cell chemotaxis. Eur. J. Immunol. 32:3745. 39. Anderson, S. M., E. A. Burton, and B. L. Koch. 1997. Phosphorylation of Cbl 12. Kullander, K., and R. Klein. 2002. Mechanisms and functions of Eph and ephrin following stimulation with interleukin-3 and its association with Grb2, Fyn, and signalling. Nat. Rev. Mol. Cell. Biol. 3:475. phosphatidylinositol 3-kinase. J. Biol. Chem. 272:739. 13. Sakano, S., R. Serizawa, T. Inada, A. Iwama, A. Itoh, C. Kato, Y. Shimizu, 40. Donovan, J. A., Y. Ota, W. Y. Langdon, and L. E. Samelson. 1996. Regulation F. Shinkai, R. Shimizu, S. Kondo, et al. 1996. Characterization of a ligand for of the association of p120cbl with Grb2 in Jurkat T cells. J. Biol. Chem. 271: receptor protein-tyrosine kinase HTK expressed in immature hematopoietic cells. 26369. Oncogene 13:813. 41. Wang, Y., Y. G. Yeung, and E. R. Stanley. 1999. CSF-1 stimulated multiubiq- 14. Davis, S., N. W. Gale, T. H. Aldrich, P. C. Maisonpierre, V. Lhotak, T. Pawson, uitination of the CSF-1 receptor and of Cbl follows their tyrosine phosphorylation M. Goldfarb, and G. D. Yancopoulos. 1994. Ligands for EPH-related receptor and association with other signaling proteins. J. Cell Biochem. 72:119. tyrosine kinases that require membrane attachment or clustering for activity. Sci- 42. Miyake, S., M. L. Lupher, Jr., B. Druker, and H. Band. 1998. The tyrosine kinase ence 266:816. regulator Cbl enhances the ubiquitination and degradation of the platelet-derived 15. Gurniak, C. B., and L. J. Berg. 1996. A new member of the Eph family of growth factor receptor ␣. Proc. Natl. Acad. Sci. USA 95:7927. receptors that lacks protein tyrosine kinase activity. Oncogene 13:777. 43. Sawasdikosol, S., J. C. Pratt, W. Meng, M. J. Eck, and S. J. Burakoff. 2000. 16. Freywald, A., N. Sharfe, and C. M. Roifman. 2002. The kinase null EphB6 Adapting to multiple personalities: Cbl is also a RING finger ubiquitin ligase. receptor undergoes trans-phosphorylation in a complex with EphB1. J. Biol. Biochim. Biophys. Acta 1471:M1. Chem. 277:3823. 44. Fukazawa, T., K. A. Reedquist, T. Trub, S. Soltoff, G. Panchamoorthy, B. Druker, 17. Elowe, S., S. J. Holland, S. Kulkarni, and T. Pawson. 2001. Downregulation of L. Cantley, S. E. Shoelson, and H. Band. 1995. The SH3 domain-binding T cell the Ras-mitogen-activated protein kinase pathway by the EphB2 receptor tyrosine tyrosyl phosphoprotein p120: demonstration of its identity with the c-cbl pro- kinase is required for ephrin-induced neurite retraction. Mol. Cell. Biol. 21:7429. tooncogene product and in vivo complexes with Fyn, Grb2, and phosphatidyl- 18. Miao, H., B. R. Wei, D. M. Peehl, Q. Li, T. Alexandrou, J. R. Schelling, inositol 3-kinase. J. Biol. Chem. 270:19141. J. S. Rhim, J. R. Sedor, E. Burnett, and B. Wang. 2001. Activation of EphA 45. Chernock, R. D., R. P. Cherla, and R. K. Ganju. 2001. SHP2 and cbl participate receptor tyrosine kinase inhibits the Ras/MAPK pathway. Nat. Cell. Biol. 3:527. in ␣-chemokine receptor CXCR4-mediated signaling pathways. Blood 97:608. 19. Thien, C. B., and W. Y. Langdon. 2001. Cbl: many adaptations to regulate protein 46. Hattori, M., M. Osterfield, and J. G. Flanagan. 2000. Regulated cleavage of a tyrosine kinases. Nat. Rev. Mol. Cell. Biol. 2:294. contact-mediated axon repellent. Science 289:1360. 6032 ACTIVATION OF Cbl BY EphA RECEPTORS IN T CELLS

47. Wang, Y., S. Ota, H. Kataoka, M. Kanamori, Z. Li, H. Band, M. Tanaka, and 52. Lupher, M. L., Jr., N. Rao, M. J. Eck, and H. Band. 1999. The Cbl protoonco- H. Sugimura. 2002. Negative regulation of EphA2 receptor by Cbl. Biochim. protein: a negative regulator of immune receptor signal transduction. Immunol. Biophys. Acta 296:214. Today 20:375. 48. Hanke, J. H., J. P. Gardner, R. L. Dow, P. S. Changelian, W. H. Brissette, 53. Lawrenson, I. D., S. H. Wimmer-Kleikamp, P. Lock, S. M. Schoenwaelder, M. Down, A. W. Boyd, P. F. Alewood, and M. Lackmann. 2002. Ephrin-A5 E. J. Weringer, B. A. Pollok, and P. A. Connelly. 1996. Discovery of a novel, induces rounding, blebbing and de-adhesion of EphA3-expressing 293T and mel- potent, and Src family-selective tyrosine kinase inhibitor: study of Lck- and anoma cells by CrkII and Rho-mediated signalling. J. Cell Sci. 115:1059. FynT-dependent T cell activation. J. Biol. Chem. 271:695. 54. Feller, S. M., G. Posern, J. Voss, C. Kardinal, D. Sakkab, J. Zheng, and 49. Schindler, T., F. Sicheri, A. Pico, A. Gazit, A. Levitzki, and J. Kuriyan. 1999. B. S. Knudsen. 1998. Physiological signals and oncogenesis mediated through Crystal structure of Hck in complex with a Src family-selective tyrosine kinase Crk family adapter proteins. J. Cell Physiol. 177:535. inhibitor. Mol. Cell 3:639. 55. Amsen, D., A. Kruisbeek, J. L. Bos, and K. Reedquist. 2000. Activation of the 50. Liu, Y., A. Bishop, L. Witucki, B. Kraybill, E. Shimizu, J. Tsien, J. Ubersax, Ras-related GTPase Rap1 by thymocyte TCR engagement and during selection. J. Blethrow, D. O. Morgan, and K. M. Shokat. 1999. Structural basis for selective Eur. J. Immunol. 30:2832. 56. Klemke, R. L., J. Leng, R. Molander, P. C. Brooks, K. Vuori, and D. A. Cheresh. inhibition of Src family kinases by PP1. Chem. Biol. 6:671. 1998. CAS/Crk coupling serves as a “molecular switch” for induction of cell 51. Kassenbrock, C. K., S. Hunter, P. Garl, G. L. Johnson, and S. M. Anderson. 2002. migration. J. Cell Biol. 140:961. Inhibition of Src family kinases blocks epidermal growth factor (EGF)-induced 57. Ohashi, Y., S. Iwata, K. Kamiguchi, and C. Morimoto. 1999. Tyrosine phosphor- activation of Akt, phosphorylation of c-Cbl, and ubiquitination of the EGF re- ylation of Crk-associated substrate lymphocyte-type is a critical element in TCR- ␤ ceptor. J. Biol. Chem. 277:24967. and 1 integrin-induced T lymphocyte migration. J. Immunol. 163:3727. Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021