G C A T T A C G G C A T genes
Article Effect of Circadian Clock and Light–Dark Cycles in Onchidium reevesii: Possible Implications for Long-Term Memory
1,2,3, 1,2,3, 1,2,3, Guolyu Xu †, Tiezhu Yang † and Heding Shen * 1 National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China 2 International Research Center for Marine Biosciences, Shanghai Ocean University, Ministry of Science and Technology, Shanghai 201306, China 3 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Shanghai Ocean University, Ministry of Education, Shanghai 201306, China * Correspondence: [email protected]; Tel.: +86-21-61900446 These authors contributed equally to this work. † Received: 26 May 2019; Accepted: 24 June 2019; Published: 27 June 2019
Abstract: The sea slug Onchidium reevesii inhabits the intertidal zone, which is characterized by a changeable environment. Although the circadian modulation of long-term memory (LTM) is well documented, the interaction of the circadian clock with light–dark masking in LTM of intertidal animals is not well understood. We characterized the LTM of Onchidium and tested the expression levels of related genes under a light–dark (LD) cycle and constant darkness (i.e., dark–dark, or DD) cycle. Results indicated that both learning behavior and LTM show differences between circadian time (CT) 10 and zeitgeber time (ZT) 10. In LD, the cry1 gene expressed irregularly, and per2 expression displayed a daily pattern and a peak expression level at ZT 18. OnCREB1 (only in LD conditions) and per2 transcripts cycled in phase with each other. In DD, the cry1 gene had its peak expression at CT 10, and per2 expressed its peak level at CT 18. OnCREB1 had two peak expression levels at ZT 10 or ZT 18 which correspond to the time node of peaks in cry1 and per2, respectively. The obtained results provide an LTM pattern that is different from other model species of the intertidal zone. We conclude that the daily transcriptional oscillations of Onchidium for LTM were affected by circadian rhythms and LD cycle masking.
Keywords: long-term memory; light–dark cycle masking; circadian rhythm; cry1; per2; OnCREB1
1. Introduction The sea slug Onchidium reevesii (Gastropoda: Eupulmonata: Systellommatophora) inhabits the intertidal zone in rocky, muddy habitats. The endemic mollusk forages on the reed bed during low tide and homes during high tide [1]. Many intertidal organisms such as Onchidium show more than one biological rhythm for their variable habits [2–4]. Onchidium is an organism with a rather small number of neurons in its central nervous system. Additionally, its central nervous system is visible and easily dissected [5]. The Earth’s ecosystem is governed by diverse environmental cycles, yet all are ultimately governed by the rotation of the Earth around the Sun. These cycles produce environmental changes in light, temperature, and so on. Different species harbor specific rhythms to take advantage of these variable environmental conditions and to avoid predators [6,7]. The most common cycle is the day–night cycle; thus, organisms need to subtly attune to this cycle and develop rhythms to conform to this steady 24 h, day and night pattern. In recent years, key components of the core oscillator mechanism have been
Genes 2019, 10, 488; doi:10.3390/genes10070488 www.mdpi.com/journal/genes Genes 2019, 10, 488 2 of 15 identified [8–10]; one key gene of the circadian rhythm mechanism is period (per). The period protein, as a part of the circadian clock components, is thoroughly studied in insects and mammals [11–13]. Other common rhythms are the circatidal rhythm and circalunar rhythm; even though the circadian rhythm is well characterized, little is known about the circalunar rhythm and circatidal rhythm in marine invertebrate species. The tidal and lunar cycles robustly influence intertidal animals. Besides its role as a circadian clock gene, previous research suggested that cryptochrome (cry) is part of the tidal activity [10,14]. The cry is strongly related to UV-induced DNA damage repair and is sensitive to moonlight [15]. Some studies have shown that the lunar-dependent gene cry could also function as a state variable determining the lunar phase [14,16]. The circadian rhythm regulates a multitude of physiological activities [17] and also influences learning behaviors and long-term memory [18,19]. Long-term memory (LTM) is mediated by the CREB gene [20–22]; normally, more than one transcription factor plays an important role in both the signal path of circadian rhythms and in memory behaviors [23,24], and CREB1 is one of these transcription factors. Initial studies suggest that CREB1 activates the expression of downstream genes in the process of long-term memory in Aplysia [25,26], and the functional relationship between CREB activity and period gene expression has also been reported [27]. However, the regulatory effects of circadian rhythm on learning and memory have been investigated with different results. The most widely accepted result is that the time of day influences memory [19,28,29]. Some researchers found time-of-day effects on LTM [29]; however, some obtained contradictory results [30]. Interestingly, in some intertidal animals, light–dark cycle input could override the tendency of organisms to display a tidal rhythm of activity [3,31]; this is the result of the phenomenon called “masking” [32]. The key issue that has remained obscure is whether the light–dark (LD) cycle stimulates LTM directly in intertidal animals, or if the LD cycle independently influences their circadian rhythm and then induces LTM pattern change. This study aimed to determine the pattern of LTM rhythms and the oscillations of rhythm genes expressed by Onchidium reevesii when exposed to an LD cycle and complete darkness (i.e., dark–dark, or DD) cycle. In the behavioral experiments, the data obtained permitted us to test the hypothesis that the LD cycle influenced the animal’s activities. Learning abilities were subject to the cycle change; while the evidence showed that memory consolidation could be indirectly regulated by cycle change, as memory was determined by the amount of learning. The activity pattern of the mantle-upturned reflex in LD and DD expressed rhythmically and, to create enough data to determine the relationship between circadian rhythm and LTM in different cycles, we tested the expressions of the memory-related gene OnCREB1, circadian gene per2, and circalunar/circatidal-related gene cry1 in different cycles after training. In the molecular experiments, we determined whether per2 expressions were subject to circadian rhythms in LD and DD cycles after memory retrieval; moreover, we detected whether the cry1 expressions remained rhythmic in LD and DD cycles. Per2 expressed a daily rhythm in both LD and DD cycles, and cry1 expressed rhythmically only in DD, suggesting that the LD cycle disturbs the rhythmicity of cry1 expression. OnCREB1 had the same expression pattern as per2 in LD, and the peak expressions of OnCREB1 are combinations of peak expressions of per2 and cry1 in DD, suggesting that LD cycles might influence LTM by disturbing other rhythms rather than the circadian rhythm.
2. Materials and Methods
2.1. Experimental Animals In all studies, we followed the guidelines of the Care and Use of Laboratory Animals issued by the Chinese Council on Animals Research and Guidelines of Animal Care. The study was approved by the ethical committee of Shanghai Ocean University (No. Shou-DW-2018-023). Onchidium reevesii (9–13 g) were reared in plastic tanks (25–28 ◦C) in Shanghai Ocean University for one month in good Genes 2019, 10, 488 3 of 15 Genes 2019, 10, x FOR PEER REVIEW 3 of 15
93 goodexperimental experimental conditions conditions [33]. Animals [33]. Animals were not were used no int used experiments in experiments if they showed if they signsshowed of infectionsigns of 94 infectionor if they or showed if they inactivity. showed inactivity. 95 Animals were entrainedentrained toto 1212 h h light–12 light–12 h h dark dark (LD) (LD) cycles cycles (total (total light light intensity intensity exceeded exceeded 100 100 lux 96 luxduring during the lightthe light period period and wasand underwas under 6 lux during6 lux duri theng dark the period) dark period) for at least for 10at least days 10 before days training, before 97 training,and feeding and was feeding stopped was onestopped week one before week the before training the started.training started. 98 Some of the animals were in the trained group, while others were in the native group without 99 any training.training. AnimalsAnimals in in the the native native group group were were also dividedalso divided into two into conditions. two conditions. The native The animals native 100 animalswithout without any training any training were dissected were dissected at the same at th timee same as those time inas thethose trained in the group. trained group. 101 Half of the sample was transferred from LD cycles into constant dark (DD) cycles for five five days 102 to test the eeffectffect ofof light–darklight–dark cyclescycles (Figure(Figure1 1).). Onchidium photoreception is poor at wavelengths 103 above 620620 nmnm [ 34[34],], and and thus thus to facilitateto facilitate observation observation for the for experimenter, the experimenter, all experiments all experiments in darkness in 104 darknessconditions conditions were illuminated were illuminated with a dim with red lighta dim (light red intensity light (light was intensity under 6 lux).was Zeitgeberunder 6 lux). time 105 Zeitgeber(ZT, time-giver) time (ZT, is a time-giver) notation for is the a notation time during for th ane time entrained during circadian an entrained cycle; circadian ZT = 0 corresponds cycle; ZT = to0 106 correspondsfirst light, which to first is 06:00 light, local which time. is 06:00 The circadianlocal time. time The (CT) circadian approximates time (CT) to approximates the ZT in DD. to the ZT 107 in DD.
108
109 FigureFigure 1: Experimental 1. Experimental procedure procedure for forthe the whole whole experiment. experiment. A totaltotal ofof 216 216 animals animals were were used used in these in these 110 experiments.experiments. Animals Animals were trained were trained at ZT/CT at ZT3, 6,/CT 10, 3, 15, 6, 18, 10, and 15, 18,22 after and 22five-day after five-daytreatment treatment in an LD/DD in an cycle. 111 After LD24 /andDD cycle.48 h, all After trained 24 and animals 48 h, allwere trained tested animals at the weresame testedtime points at the same(ZT/CT time 3, 6, points 10, 15, (ZT 18,/CT and 3, 6,22). 10, N = 6 112 for every15, 18, time and point 22). Nin =the6 forbehavioral every time experiment point in the and behavioral n = 3 for experimentevery time point and n in= 3the for molecular every time experiment. point 113 ZT: zeitgeberin the molecular time, CT: experiment. circadian time, ZT: zeitgeberLD: light–dark, time, CT:DD: circadian dark–dark. time, LD: light–dark, DD: dark–dark.
114 2.2. Training Training Experiments 115 The animalsanimals were were measured measured for thefor sensitization the sensitization of their of mantle-upturned their mantle-upturned reflex (MUR) reflex (Figure (MUR)2A). 116 (FigureGotow et2 A). al. [Gotow35] described et al. [35] the elevationdescribed movement;the elevation this movement; response could this response be elicited could by direct be elicited electrical by 117 directstimulation electrical in neurons.stimulation The in amplitudeneurons. The and amp durationlitude ofand elevation duration depended of elevation on depended the frequency on the of 118 frequencyelectrical stimulation. of electrical With stimulatio increasedn. With frequency, increased the responsefrequency, to thethe stimuliresponse became to the larger. stimuli When became they 119 larger.received When an electric they received shock, their an mantleelectric upturned shock, their and mantle exposed upturned the hyponotum and exposed (Figure the2). Thehyponotum animals 120 (Figurewere trained 2). The by electricanimals shock were while trained simultaneously by electric measuring shock while MUR simultaneously duration. The samplemeasuring was placedMUR 121 duration.on its foot The in thesample center was of placed the table on its and foot allowed in the center to acclimate of the table for 6 and min allowed at rest; theto acclimate mantle of for the 6 122 minOnchidium at rest;was the inmantle a relaxed of the state, Onchidium contrary was to its in risen a relaxed state during state, contra simulation.ry to its After risen the state stimulation, during 123 simulation.MUR duration After began the stimulation, once the mantle MUR was duration upturned began (raised) once and the ended mantle when was theupturned mantle (raised) was relaxed. and 124 endedThe animal when received the mantle training, was relaxed. which consistedThe animal of received eight pulses training, of electricity which consisted (4 mA, 1of s eight in duration) pulses 125 of electricity (4 mA, 1 s in duration) delivered to the notum at 10-min intervals (Figure 2B). The 126 position of shock was at ~2/3 of the notum (close to posterior end of notum). During the
Genes 2019, 10, 488 4 of 15
Genes 2019, 10, x FOR PEER REVIEW 4 of 15 delivered to the notum at 10-min intervals (Figure2B). The position of shock was at ~2 /3 of the notum 127 consolidation(close to posterior stage, end the ofanimals notum). were During returned the consolidation to their environmental stage, the animals condition were returneduntil the to post-test their 128 at environmentalthe same time conditionpoint on the until next the day. post-test at the same time point on the next day.
129 130 Figure 2:Figure The mantle-upturned 2. The mantle-upturned reflex reflextraining training of Onchidium of Onchidium reevesii reevesii andand experimental experimental protocol protocol for for each each animal. 131 (A) Mantle-upturnedanimal. (A) Mantle-upturned reflex (MUR) reflexof O. (MUR) reevesii of. O.When reevesii animals. When received animals receivedthe stimulus the stimulus in the innotum, the their 132 mantle notum,elevated, their as mantleshown elevated,in the dorsal as shown view in and the late dorsalral viewview. and The lateral red line view. segment The red is line thesegment MUR amplitude. is the (B) 133 ExperimentalMUR amplitude. protocols. (TheB) Experimental timing of training protocols. and The testin timingg is ofshown training at relative and testing inte isrvals. shown The at duration relative of the 134 first-timeintervals. shock was The durationseen as ofthe the test first-time result shockin “befor wase seen training”, as the test and result the induration “before training”,of the last and shock the in “8x 135 training”duration was seen of the as lastthe shocktest result in “8x of training” acquisition. was seen After as the24 h test and result 48 ofh, acquisition.consolidation After testing 24 h andwas 48 performed h, 136 using oneconsolidation shock. The testing experimental was performed lighting using conditions one shock. depended The experimental on the cycles lighting that those conditions animals depended experienced. on the cycles that those animals experienced.
137 2.3.2.3. Cloning Cloning of ofcry1 cry1 and and per2 per2 Genes Genes and and Quantitative Quantitative Analysis ofof OnCREB1,OnCREB1, cry1, cry1, and and per2 per2 Genes Genes 138 WeWe sampled sampled the the ganglion ganglion during during different different circadiancircadian points points under under LD LD/DD/DD conditions. conditions. Animals Animals 139 werewere anaesthetized anaesthetized with with MgCl MgCl22 beforebefore dissection dissection [[36]36] andand centralcentral nervous nervous systems systems (CNSs) (CNSs) were were 140 immediatelyimmediately flash-frozen flash-frozen inin liquidliquid N N2 2before before extraction. extraction. Total Total RNA RNA was extractedwas extracted from thefrom tissues the withtissues 141 withRNAiso RNAiso Plus (TaKaRa,Plus (TaKaRa, Kusatsu, Kusatsu, Japan) according Japan) toaccording the manufacturer’s to the manufacturer’s recommended protocol. recommended Then, 142 protocol.the absorbance Then, the at Aabsorbance260 nm/A280 nmat andA260 Anm230/A280 nm nm/A 260and nm Awas230 nm measured/A260 nm was to determinemeasured theto determine quality and the 143 qualitypurity and of RNA. purity Complementary of RNA. Complementary DNA (cDNA) wasDNA synthesized (cDNA) was from synthesized the ganglion from messenger the ganglion RNA 144 messenger(mRNA) usingRNA a(mRNA) reverse transcriptionusing a reverse (RT) transcript reagent kition with (RT) genomic reagent DNAkit with (gDNA) genomic Eraser DNA (TaKaRa) (gDNA) 145 Eraseraccording (TaKaRa) to the according manufacturer’s to the instructions. manufacturer’s All primers instructions. were designed All primers using were Primer designed 5.0 software using 146 Primer(PREMIER 5.0 software Biosoft International,(PREMIER Biosoft Palo Alto, International, CA, USA). Palo Alto, CA, USA). 147 TheThe 3’ 3and0 and 5’ 5 0endsends of of the the cDNA cDNA were were obtained usingusing thetherapid rapid amplification amplification of of cDNA cDNA ends ends 148 (RACE)(RACE) technique technique (TaKaRa) (TaKaRa).. Partial Partial fragments fragments of of cry1 and per2per2 genesgenes were were obtained obtained from from the the de de 149 novonovo transcriptomic transcriptomic library. ToTo confirm confirm the the fragment fragment sequences, sequences, we used we specific used primersspecific toprimers amplify to the partial fragments and re-sequenced the PCR products. The specific primers used for cloning the 150 amplify the partial fragments and re-sequenced the PCR products. The specific primers used for full-length cDNA of per2 and cry1 are provided in Table1. The PCR cycling conditions were as follows; 151 cloning the full-length cDNA of per2 and cry1 are provided in Table 1. The PCR cycling conditions 94 C for 5 min, followed by 30 cycles of 94 C for 30 s, 58 C for 30 s, and 72 C for 1 min. The smart 152 were◦ as follows; 94 °C for 5 min, followed by◦ 30 cycles of◦ 94 °C for 30 s, 58 ◦°C for 30 s, and 72 °C for 5 -RACE (5 Full RACE Kit, TaKaRa) and 3 -RACE kits (3 -Full RACE Core Set Ver. 2.0, Takara) were 153 1 min.0 The smart0 5’-RACE (5’ Full RACE Kit,0 TaKaRa) and0 3’-RACE kits (3’-Full RACE Core Set Ver. used according to the manufacturers’ instructions. The RACE-PCR product was ligated into pGEM-T 154 2.0, Takara) were used according to the manufacturers’ instructions. The RACE-PCR product was Easy vector (Promega, Madison, WI, USA) and transformed into competent E. coli DH5-α cells. After 155 ligatedblue-white into pGEM-T selection Easy and PCR vector identification, (Promega, positiveMadison, clones WI, USA) were selectedand transformed and sequenced. into competent E. 156 coli DH5-Afterα cells. obtaining After the blue-white cDNA, the mRNAselection levels and of PCROnCREB1 identification,(MK801136), positivecry1 (MK801137), clones were and selectedper2 157 and(MK801138) sequenced. were studied by fluorescent real-time (RT)-PCR. In our experiments, the 18S ribosomal 158 After obtaining the cDNA, the mRNA levels of OnCREB1 (MK801136), cry1 (MK801137), and 159 per2 (MK801138) were studied by fluorescent real-time (RT)-PCR. In our experiments, the 18S 160 ribosomal RNA of O. reevesii was used as a housekeeping control gene [37], and 18S ribosomal RNA 161 expressions maintained their stability in ganglion tissue over 24 h in our pre-experiment. 162 Quantitative RT-PCR was performed using the Light Cycler® 480 II instrument (Roche, Basel, 163 Switzerland) with a QuantiFast® SYBR® Green PCR kit (Qiagen, Hilden, Germany). The qRT-PCR
Genes 2019, 10, 488 5 of 15
RNA of O. reevesii was used as a housekeeping control gene [37], and 18S ribosomal RNA expressions maintained their stability in ganglion tissue over 24 h in our pre-experiment. Quantitative RT-PCR was performed using the Light Cycler® 480 II instrument (Roche, Basel, Switzerland) with a QuantiFast® ® SYBR Green PCR kit (Qiagen, Hilden, Germany). The qRT-PCR steps were as follows: 94 ◦C for 5 min, followed by 30 cycles of 94 ◦C for 30 s, 51 ◦C for 30 s, and 72 ◦C for 1 min, and a final step at 72 ◦C for 5 min. Data were collected from each qRT-PCR experiment performed in triplicate and expressed as the mean SEM (standard error of the mean). All the primers used in this process are listed in Table1. ± Table 1. Polymerase chain reaction (PCR) primers used in gene cloning and realtime (RT)-PCR.
Usage Primer Name Primer Sequence (50-30) Description Test-1F GTTTAAAACGCCACCCCCAC Used to amplify one part of the Test-1R ATGCTGAACTGAGTGGGTGG per2 fragment Test-2F TTCGAAAACTGGGTGCAGGT Used to amplify one part of the Test-2R GTCTCAGGCTCTCTCATGCC per2 fragment Test-3F ATGAGAGAGCCTGAGACCGT Used to amplify one part of the Test-3R TGCGCATGTTCAGAAGGAGT per2 fragment Test-4F TCGTGAATCAGCGGACAACA Used to amplify one part of the Test-4R GAGGGCGATAGAAGCCAGTC per2 fragment Test-5F ACATCCCACCAGAAACGTCC Used to amplify one part of the Test-5R ATGGGCTCCTGAAACATGGG per2 fragment Test-6F CAGGTGATGACTGGCTTCTATC Used to amplify one part of the Test-6R CTGGTGTGTCGTAGTTCTCATC per2 fragment Test-7F CCCTAAGGATGGGTCCCTCA Used to amplify one part of the Test-7R CACCGTGGCTGTTGTTGATG per2 fragment RT-PCR Test-8F AAACCCTCACTGCCCAGATG Used to amplify one part of the Test-8R GTGAGAAAGCAAGCCACAGC cry1 fragment Test-9F GTGTACAAGAGGCTGGTGCT Used to amplify one part of the Test-9R AAAAGCCCTCAGGAGCTGAC cry1 fragment Test-10F GTCAGCTCCTGAGGGCTTTT Used to amplify one part of the Test-10R CCTTGTCTGCGTCACAAAGC cry1 fragment Test-11F GGTGCCTCACAAGTAGGAATTA Used to amplify one part of the Test-11R GATTGTGTTCCCACGGTATCT cry1 fragment Test-12F GATGCTGACTGGAGCGTAAA Used to amplify one part of the Test-12R CCCTCAGGAGCTGACTAATAAAC cry1 fragment Test-13F AGACTGCAGACCCTGTTAATG Used to amplify one part of the Test-13R ATGGGCTAGAGAGCTGATACT cry1 fragment Test-14F ATGGAAACAGCCCACCACTC Used to amplify one part of the Test-14R TCCACCACGAAACTGAGCTG cry1 fragment Test-15F AGCTCAGTTTCGTGGTGGAG Used to amplify one part of the Test-15R GGGGATAGTCCTTGCCGATG cry1 fragment 30RACE-F1 CCCTAAGGATGGGTCCCTCA Gene-specific outer primer for per2 30RACE-F2 AATGTGTCTCTCAGCCCTGC Gene-specific inner primer for per2 30RACE-F3 GTCAGCTCCTGAGGGCTTTT Gene-specific outer primer for cry1 30RACE-F4 AGACTGCAGACCCTGTTAATG Gene-specific inner primer for cry1 30RACE outer primer TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTC Primers from kit RACE 3 RACE inner primer 0 ACTATAGG 50RACE-R1 ATGCTGAACTGAGTGGGTGG Gene-specific outer primer for per2 50RACE-R2 AGACGAATGCTGCTGCTCTT Gene-specific inner primer for per2 50RACE-R3 GATTGTGTTCCCACGGTATCT Gene-specific outer primer for cry1 50RACE-R4 TCCACCACGAAACTGAGCTG Gene-specific inner primer for cry1 50RACE outer primer CATGGCTACATGCTGACAGCCTA CGCGGATCCACAGCCTACTGATG Primers from kit 5 RACE inner primer 0 ATCAGTCGATG qRT-PCR primer F TGTTGAGTCCGCCAACCTTT Used to amplify the per2 fragment qRT-PCR primer R AGTGGCTGCTCCTCTGAAAC for real-time PCR qRT-PCR primer F GATGCTGACTGGAGCGTAAA Used to amplify the Cry1 fragment qRT-PCR qRT-PCR primer R CCAAAGCCCACAGGACAATA for real-time PCR qRT-PCR primer F CCAGTTGGAGGAACCAATGT Used to amplify the OnCREB1 qRT-PCR primer R CATGTGCTGTGGACTTGAAATAG fragment for real-time PCR 18S primer F TCCGCAGGAGTTGCTTCGAT Used to amplify the 18S fragment 18S primer R ATTAAGCCGCAGGCTCCACT for real-time PCR Genes 2019, 10, x FOR PEER REVIEW 6 of 15 Genes 2019, 10, 488 6 of 15 172 3. Results 3. Results 173 3.1. Learning/Memory Acquisition and Long-Term Memory Expressed a Certain Rhythm in Different 174 Conditions3.1. Learning /Memory Acquisition and Long-Term Memory Expressed a Certain Rhythm in Different Conditions 175 TheThe difference difference inin LTMLTM might might be be driven driven by theby light–darkthe light–dark cycle, cycle, so darkness so darkness was set aswas a constantset as a 176 constantto test the to LDtest maskingthe LD masking regulation. regulation. As the results As the show results in Figureshow in3A, Figure the duration 3A, the ofduration the baseline of the 177 baselinemantle-upturned mantle-upturned reflex was reflex not significantly was not disignificantlyfferent in animals different measured in animals in LD compared measured with in DD.LD 178 comparedMoreover, with the mantle-upturned DD. Moreover, reflexthe mantle-upturned of Onchidium was reflex less sensitiveof Onchidium during was the daytimeless sensitive than duringduring 179 thethe daytime night-time than in bothduring LD the and night-time DD. The most in both sensitive LD periodand DD. of timeThe appearedmost sensitive late at period night. Duringof time 180 appearedthe daytime, late theat night. arousal During threshold the daytime, of Onchidium the arousalwas elevated threshold before of training,Onchidium which was correspondselevated before to 181 training,the fact thatwhichOnchidium correspondsare nocturnal to the fact animals that Onchidium (Figure3A). are nocturnal animals (Figure 3A). 182 TheThe training training of of OnchidiumOnchidium inin ZT ZT and and CT CT had had no no significant significant eeffectffect onon learninglearning ability,ability, exceptexceptat at 183 ZT/CTZT/CT 10 10 (Figure (Figure 33B).B). ForFor animalsanimals trainedtrained atat ZTZT 10,10, lessless sensitivitysensitivity was was acquired acquired compared compared with with 184 thatthat at at CT CT 10, 10, but but this this rather rather suggests suggests that that differences differences in observed learninglearning abilitiesabilities couldcould bebe duedue to to 185 conditioncondition differences differences in in the the induction induction of of the baseline mantle-upturned reflexreflex (Figure(Figure3 3A).A). Di Differentfferent 186 rhythmrhythm patterns patterns werewere observed observed before before and and after after training, training, showing showing that the that rhythm the rhythm patterns inpatterns learning in 187 learningare controlled are controlled by the circadian by the circadian rhythm. Therhythm. learning The pattern learning showed pattern di ffshowederences differences between ZT between 10 and 188 ZTCT 10 10, and suggesting CT 10, suggesting that the LD that cycles the influenceLD cycles the influence learning the in learning this time in period. this time period. 189 TheThe rhythms rhythms in in LTM LTM (Figure (Figure 33C,D)C,D) showedshowed thethe samesametendency tendency as as that that in in the the animals’ animals’ initial initial 190 learninglearning (Figure (Figure 33B).B). These These results results further further support support the conclusionthe conclusion that the that rhythm the rhythm in LTM in is notLTM directly is not 191 directlysubject subject to the LD to cycle.the LD Moreover, cycle. Moreover, the important the important reason forreason this rhythmfor this shownrhythm in shown LTM isin that LTM the is 192 thatanimals the animals trained hadtrained different had amountsdifferent ofamounts initial learning. of initial Together, learning. these Together, results these suggest results that, mostsuggest of 193 that,the time,most theof the rhythm time, pattern the rhythm of LTM pattern was dueof LTM to the was amount due to of the initial amount learning. of initial learning.
194 195 FigureFigure 3: The 3. rhythmsThe rhythms of mantle-upturned of mantle-upturned reflex reflex duration duration are shown are shown for Onchidium for Onchidium examinedexamined in constant in 196 darknessconstant (DD) darkness(blue circles) (DD) and (blue light–dark circles) and cycle light–dark (LD) (orange cycle (LD) triangle) (orange conditions. triangle) conditions.(A) The duration (A) The of the 197 baselineduration mantle-upturned of the baseline reflex mantle-upturned before long-term reflex memory before long-term(LTM) training memory shows (LTM) an training increased shows tendency an of 198 durationincreased in the tendency night-time. of duration Moreover, in the no night-time. significant Moreover, differences no significant were observed differences in were the observedduration in of the 199 mantle-upturnedthe duration reflex of the between mantle-upturned ZT and reflexCT, and between there ZTwas and no CT, significant and there effect was no of significant lighting condition effect × of lighting condition sampling time (p = 0.264). (B) Rhythm in the acquisition. Peak durations 200 sampling time (p = 0.264). (B×) Rhythm in the acquisition. Peak durations observed at CT/ZT 6 and CT/ZT 18. observed at CT/ZT 6 and CT/ZT 18. The duration in the “after training” stage revealed a significant 201 The duration in the “after training” stage revealed a significant effect of lighting condition (lighting condition, effect of lighting condition (lighting condition, p < 0.05), as well as a significant effect of sampling time 202 p < 0.05), as well as a significant effect of sampling time (time, p < 0.01). Bonferroni post hoc tests revealed that (time, p < 0.01). Bonferroni post hoc tests revealed that the durations between ZT 10 and CT 10 were 203 the durations between ZT 10 and CT 10 were significantly different (**p < 0.01). (C) A subset of animals was significantly different (** p < 0.01). (C) A subset of animals was tested after 24 h to determine whether 204 tested after 24 h to determine whether the rhythm in LTM persisted under LD/DD (lighting condition, p < 0.05; the rhythm in LTM persisted under LD/DD (lighting condition, p < 0.05; time, p < 0.001). The durations 205 time, p < 0.001). The durations between ZT 10 and CT 10 also exhibited significant differences (**p < 0.01). (D) between ZT 10 and CT 10 also exhibited significant differences (** p < 0.01). (D) Animals were tested 206 Animals were tested after 48 hours to determine whether the rhythm in LTM persisted under LD/DD. There after 48 h to determine whether the rhythm in LTM persisted under LD/DD. There was no significant 207 was no significant effect of lighting condition × sampling time (two-way analysis of variance (ANOVA), p > effect of lighting condition sampling time (two-way analysis of variance (ANOVA), p > 0.05), whereas 208 0.05), whereas the duration at ZT× 10 and CT 10 showed significant differences (**p < 0.01). Statistical analyses the duration at ZT 10 and CT 10 showed significant differences (** p < 0.01). Statistical analyses of 209 of all alldata data were were performed performed using using two-way ANOVAANOVA with with Bonferroni Bonferroni post post hoc hoc analysis analysis for comparisons for comparisons 210 betweenbetween groups. groups. Values Values are means are means ± SEM (standardSEM (standard error of error the ofmean) the mean) (n = 6 (forn = ZT6for 3, 6, ZT 10, 3, 15, 6, 10, 18, 15, and 18, 22 and ± 211 CT 3, 6,and 10, 2215, and 18, CTand 3, 22). 6, 10, 15, 18, and 22).
Genes 2019, 10, x FOR PEER REVIEW 7 of 15 Genes 2019, 10, 488 7 of 15
212 3.2. Expressions of cry1, per2, and OnCREB1 under The Control of Light–Dark (LD) and Constant Darkness 213 3.2.(DD) Expressions Cycles of cry1, per2, and OnCREB1 under The Control of Light–Dark (LD) and Constant Darkness (DD) Cycles 214 We identified the per2 and cry1 genes of Onchidium (Figure 4, 5, S1 and S2); the full length of 215 per2 isWe 7613 identified bp (MK801138) the per2 and andcry1 cry1genes is 3131 of Onchidium bp (MK801137).(Figures The4,5, predicted S1 and S2); Onchidium the full length CRY1 of proteinper2 is 216 7613contained bp (MK801138) the conserved and cry1 regionsis 3131 present bp (MK801137). in ortholog Thes of predictedother species,Onchidium includingCRY1 photolyase protein contained related 217 thedomain conserved (PHR regionsdomain) present and flavin in orthologs adenine ofdinu othercleotide species, binding including domain photolyase (FAD binding related domain) domain 218 (PHR(Figure domain) 4). The andpredicted flavin Onchidium adenine dinucleotide PERIOD2 protein binding contained domain (FAD the conserved binding domain) regions (Figurepresent4 in). 219 Theorthologs predicted of otherOnchidium species,PERIOD2 including protein HLH, contained PAS, and the conservedPAC domains regions (Figure present 5). inAll orthologs accession of 220 othernumbers species, for related including proteins HLH, appear PAS, andin Table PAC S1. domains (Figure5). All accession numbers for related 221 proteins appear in Table S1. 222
223 224 FigureFigure 4: Alignment 4. Alignment of ofconserved conserved regions regions for for CRY1. TheTheOnchidium OnchidiumCRY1 CRY1 protein protein contained contained conserved conserved 225 domainsdomains present present in orthologs in orthologs for Aplysia, for Aplysia, Pomacea, Pomacea, and andCrassostrea: Crassostrea: green green frame frame indicates indicates the thePHR PHR domain 226 and orangedomain frame and orange indicates frame the indicates FAD binding the FAD domain. binding Th domain.e blue shading The blue indicates shading indicatesidentical identicalresidue, pink 227 shadingresidue, indicates pink shadingresidues indicates with strongly residues similar with strongly properties, similar and properties, the cyan and shadin the cyang indicates shading indicatesresidues with 228 weaklyresidues similar with properties. weakly similar properties. 229
Genes 2019, 10, 488 8 of 15 Genes 2019, 10, x FOR PEER REVIEW 8 of 15
230 231 FigureFigure 5: Alignment 5. Alignment of conserved of conserved regions regions for PERIOD2. for PERIOD2. The Onchidium The Onchidium PERIOD2PERIOD2 protein protein contained contained conserved 232 domainsconserved present domains in orthologs present for in Bulla, orthologs Pomacea, for Bulla, and Pomacea,Mizuhopecten: and Mizuhopecten: blue frame indicates blue frame the indicatesHLH domain, 233 greenthe frame HLH indicates domain, the green PAS frame domain indicates and orange the PAS frame domain indicates and orange the PA frameC binding indicates domain. the PACThe bindingblue shading 234 indicatesdomain. identical The blueresidue, shading a pink indicates shading identical indicated residue, residue a pink with shading strongly indicated similar residue properties, with stronglyand the cyan 235 shadingsimilar indicates properties, residues and with the cyanweakly shading similar indicates properties. residues with weakly similar properties. 236 For OnCREB1, cry1, and per2 expressions were tested after 24 and 48 hh followingfollowing trainingtraining and 237 no training. As the transcriptional factor gene ( OnCREB1)) is important for memory consolidation, 238 the transcriptionaltranscriptional oscillation gene per2 is crucial for the circadian clock and cry1 is related to thethe 239 circalunarcircalunar/circatidal/circatidal clock. The The RN RNAA dynamic expressions of the thr threeee genes were assessed next to 240 determine whether those genes are rhythmic in the central nervous system. As an intertidal animal, 241 the daily activityactivity of Onchidium is synchronized not only by their circadian clock, but also by their 242 circalunarcircalunar/circatidal/circatidal clock clock [38 [38,39].,39]. We We tested tested the temporalthe temporal expression expression pattern pattern of cry1, per2of cry1, and, OnCREB1per2, and 243 throughoutOnCREB1 throughout the daily cycle the (CTdaily/ZT cycle 3, 6, 10,(CT/ZT 15, 18, 3, and 6, 22).10, 15, We 18, also and measured 22). We the also expression measured of per2 the, 244 cry1expression, and OnCREB1 of per2, incry1 the, nativeand OnCREB1 group without in the any native training. groupPer2 withoutand cry1 anyexpression training. levelsPer2 and were cry1 not 245 significantlyexpression levels changed were compared not significantly with those changed in the trained compared group with (Figure those6A,B). in the Strikingly, trained thegroup expression (Figure 246 of6A,B).OnCREB1 Strikingly,in the the trained expression group wasof OnCREB1 increased in by the training trained (Figure group6C), was and increased the expression by training of OnCREB1 (Figure 247 in6C), the and native the expression group was similarof OnCREB1 to that in in the the native trained group group. was similar to that in the trained group.
GenesGenes 20192019, 10, 10, x, 488FOR PEER REVIEW 9 of9 15 of 15
248 Figure 6. The expression comparison of related genes between native and trained group under LD 249 Figure 6 The expression comparison of related genes between native and trained group under LD and DD and DD cycle. (A) Expression comparison of per2. Quantitative analysis of per2 revealed that there 250 cycle. (A) Expression comparison of per2. Quantitative analysis of per2 revealed that there was not significantly was not significantly different between native and trained animals, and no interaction between both 251 differentfactors between (sampling native time and trainingtrained condition) animals, wereand detectedno interaction (LD, p > between0.05; DD, bothp > 0.05). factors (B) Expression(sampling time × × 252 trainingcomparison condition) of werecry1 .detected There was (LD, no p significant > 0.05; DD, eff ectp > of0.05). sampling (B) Expression time training comparison condition of on cry1cry1. There(LD, was no × 253 significantp > 0.05;effect DD, of samplingp > 0.05). (timeC) Expression × training comparison condition on of OnCREB1cry1 (LD,. p There > 0.05; was DD, a significant p > 0.05). eff(Cect) Expression of 254 comparisonsampling of OnCREB1 time training. There condition was a onsignificantOnCREB1 effectexpression of sampling (LD, p = time0.013; × DD,trainingp < 0.01). condition The training on OnCREB1 × 255 expressionincreased (LD, thep = OnCREB10.013; DD,expression, p < 0.01). butThe not training significant increased at all time the points.OnCREB1 * indicates expression,p < 0.05; but ** not indicates significant at 256 all timep points.< 0.01; **** indicates indicates p << 0.001.0.05; ** Statistical indicates analyses p < 0.01; of all*** data indicates wereperformed p < 0.001. usingStatistical two-way analyses analysis of all data 257 were performedof variance (ANOVA)using two-way with Bonferroni analysis post of hocvariance analysis (ANOVA) for comparisons with betweenBonferroni groups. post Error hoc bars analysis in for 258 comparisonsthe figure between represent groups. SEM Error (n = 3 ba forrsevery in the time figure point represent in each group).SEM (n = 3 for every time point in each group).
259 InIn trained trained animals,animals, the the peak peak expression expression of the ofcry1 thegene cry1 appeared gene appeared at CT 10 under at CT DD 10 conditions, under DD 260 conditions,and the expressions and the expressions under LD conditions under LD were cond arrhythmicitions were (two-way arrhythmic ANOVA, (two-wayp > 0.05) ANOVA, (Figure p7 >A). 0.05) 261 (FigureFor the 7A).per2 gene,For the the per2 expression gene, levelthe variedexpression with circadianlevel varied cycle, with with circadian peak expression cycle, beingwith atpeak 262 expressionZT/CT 18 being (Figure at7 B).ZT/CTOnCREB1 18 (Figure(in LD 7B). conditions) OnCREB1 and (inper2 LD transcriptsconditions) cycled and per2 in phase transcripts with each cycled 263 inother phase (Figure with each7C). otherOnCREB1 (Figurehad 7C). two OnCREB1 peak expression had two levels peakat expression ZT 10 and levels ZT 18. at ZT The 10OnCREB1 and ZT 18. 264 Thetranscript OnCREB1 at CT transcript 10 was in at antiphase CT 10 was with in the antiphase LTM, as shown with inthe Figure LTM,3C. as The shown results in showFigure that 3C. the The 265 resultsOnCREB1 showexpressions that the OnCREB1 are subject expressions not only to are circadian subject rhythm, not only but to also circadian the cycle rhythm, change. but CREB1 also the 266 cyclehas anchange. important CREB1 transcriptional has an important function intranscriptional the pathway of function long-term in memory. the pathway As a consequence, of long-term 267 memory.the results As also a suggestedconsequence, that long-termthe results memory also formationsuggested isthat associated long-term with circadianmemory rhythmformation and is 268 associatedthe LD cycle. with circadian rhythm and the LD cycle.
GenesGenes 2019, 10,, 488x FOR PEER REVIEW 10 of10 15 of 15
269 Figure 7. Temporal expression patterns of cry1, per2, and OnCREB1 in Onchidium reevesii under LD 270 Figure 7. Temporal expression patterns of cry1, per2, and OnCREB1 in Onchidium reevesii under LD and DD and DD cycles. (A) Expression of cry1. The expression of cry1 showed a significant effect based on 271 cycles. (A) Expression of cry1. The expression of cry1 showed a significant effect based on lighting conditions lighting conditions (light, p < 0.05; time, p > 0.05). Cry1 expressed irregularly in LD conditions (cry1 272 (light, p < 0.05; time, p > 0.05). Cry1 expressed irregularly in LD conditions (cry1 LD, p > 0.05) and expressed LD, p > 0.05) and expressed rhythmically in DD conditions (cry DD, p < 0.05), with peak expression at 273 rhythmically in DD conditions (cry DD, p < 0.05), with peak expression at CT 10 (Bonferroni’s post hoc analysis, CT 10 (Bonferroni’s post hoc analysis, ** p < 0.01 for ZT 10 vs. CT 10 at 24 and 48 h). (B) Expression of 274 p** < 0.01per2. for Quantitative ZT 10 vs. analysis CT 10 at of 24per2 andrevealed 48 h). a ( significantB) Expression effect of of per2 sampling. Quantitative time (time, analysisp < 0.05) of but per2 not revealed a 275 significantlighting effect conditions of sampling (light, p >time0.05). (time, The per2p
Genes 2019, 10, 488 11 of 15 stimuli controlled by oscillators have direct effects on locomotors (e.g., the locomotor activity of crabs is influenced by light). This process is called “masking” [43,44]. To determine whether the memory acquisition was completely due to the endogenous rhythm system or masking, animals were trained in DD conditions and, surprisingly, showed a significant difference at CT 10 compared with ZT 10. The activity, like circatidal activity, might have been overridden by the LD cycle. Moreover, the masking of circatidal activity rhythm in intertidal animals is not unusual, and this phenomenon is shown in Carcius maenas, crabs, Limulus polyphemus, and Apteronemobius asahinai [2,3,45–47]. This masking mechanism makes animals adapt to changes in the environment [32]. This can explain the fluctuation at CT/ZT 10, the junction period between day and night, suggesting that the learning rhythm is regulated by changes in cycles and the endogenous rhythm system. Another study tested the circadian and diurnal effects on the LTM process (Figure3C,D). However, the same tendency was previously observed, and the results for behavior suggested that LTM is largely subject to the amount of information/learning acquired initially. The results are difficult to square with other model species that involve different rhythmic modulations of learning and memory [38,48,49], suggesting not only the involvement of circadian regulations, but also other rhythms or phenomena. However, it is difficult to reach the conclusion that the LD cycle masks the circatidal rhythm, and the activity pattern is entirely subject to the circadian rhythm only through behavioral data. Therefore, molecular results in certain genes should be combined with behavioral data. OnCREB1 gene expression after 24 and 48 h showed the same tendency as the per2 gene during the light–dark (LD) cycle, which suggested that memory-related gene OnCREB1 expression is associated with the circadian rhythm. Some studies showed that overexpressing the per gene in flies could enhance long-term memory [50]. The per gene encodes an essential component of the circadian clock, and per regulates the circadian process through a transcriptional negative feedback loop [51,52]. Furthermore, a previous study found that phosphorylation of MAPK underwent a circadian oscillation, and MAPK can activate the CREB [53,54]. Thus, the circadian rhythms in memory-related gene OnCREB1 might also be related to the circadian gene per2. Constant darkness is necessary to evaluate whether the endogenous circadian rhythm drives the time-of-day effect, and it can also test other rhythms without the light–dark zeitgeber. Surprisingly, the OnCREB1 gene had two peak expressions under the complete darkness condition (DD), the tendency of which was different from that in LD. Interestingly, a new peak was expressed rhythmically, the time point of which, in accordance with ZT 10, showed MUR differences in behavior experiments. Intertidal animals can release their previous rhythms (circalunar and circatidal rhythms) when exposed to the DD cycle [3,32]. Therefore, the critical agent in circatidal/circalunar rhythm is tested by the cry1 gene. A previous study suggested that cry1 is connected with behavioral tidal rhythms [10], and that cry1 was sensitive to moonlight and likely to be controlled by a key element of the lunar clock [16]. The cry gene has been explored in previous research to study its role in the circatidal rhythm and its relationship with circalunar rhythm [10,16]. Cry1 expressed irregularly in the LD cycle, and the steady expression peak of cry1 shown at CT 10 in DD is the same as that of the time points of the peak expression of OnCREB1. Cry1 increased at CT 10 under DD conditions but showed a decreasing sensitization response, consistent with cry expression, inhibiting the phosphorylation of CREB and thus influencing memory activity [55]. The increasing OnCREB1 mRNA level at CT10 was opposite to that of memory activity, and similar negative feedback was also found in Aplysia [56]. The peak expression of cry1 and OnCREB1 at CT 10 was not shown in LD but appeared in DD, suggesting that these are circalunar rhythm-related genes and memory-related genes, at least partially suppressed by LD cycles. The per2 expression pattern did not show differences between LD and DD, and it seemed that the endogenous circadian clock enables them to express a daily rhythm in the absence of light–dark cues. Therefore, the memory pattern in LD is possibly the result of an LD masking effect and circadian rhythm, and the memory activity during the DD cycle might be controlled by the interaction of circadian and other rhythms without the LD masking effect. Although the transcriptional regulation of CREB1 genes was associated with long-term memory [57], the phosphorylation of CREB is also a critical step with implications on Genes 2019, 10, 488 12 of 15 long-term memory [58]. Therefore, the phosphor-CREB/total CREB ratio could also be considered to enhance the study of LTM. The study shows that the sea slug Onchidium harbors more than a circadian clock, even when kept in a laboratory for a long time. The results of this study were different from the rhythms of LTM in other model species [59,60]; this can be explained by the difference in species and species behavior. For instance, no circadian modulation in LTM has been observed in some rat species, while some studies show that strain differences affect circadian modulation in other rat species [61]. Another reason is that Onchidium, as an intertidal animal, lives in a harsh environment and thus harbors more biological rhythms [1,7], and the results shown in LTM contribute to the interactions of the circadian clock and LD cycle. Taken together, these results established relationships among LTM, circadian rhythms, and the LD cycle. A limitation of this study is the lack of monthly data for cry1 expression and behavior experiments. We gathered those data every few hours more than four days apart, and the small sample size did not allow for a longer experiment. The free-running rhythm was not considered in this study and will also need to be pursued further to make the conclusion more complete. Further studies will be necessary to determine the LTM pattern of Onchidium under natural conditions over a long period to study circatidal modulation.
Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4425/10/7/488/s1; Figure S1: Phylogenetic tree of CRY family proteins, Figure S2: Phylogenetic tree of PERIOD family proteins, Table S1: Accession numbers for proteins. Author Contributions: Conceptualization, G.X.; Data curation, G.X.; Methodology, T.Y., and G.X.; Project administration, H.S.; Resources, T.Y. and H.S.; Software, G.X.; Writing—original draft, G.X.; Writing—review and editing, H.S. and T.Y. Funding: The study was supported by the National Natural Science Foundation of China (No. 41276157) and the Shanghai Universities First-Class Disciplines Project of Fisheries. Acknowledgments: We appreciate the anonymous referees’ helpful comments on the paper. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.
References
1. Arey, L.B.; Crozier, W.J. The ‘homing habits’ of the pulmonate mollusk Onchidium. Proc. Natl. Acad. Sci. USA 1918, 4, 319–321. [CrossRef][PubMed] 2. Naylor, E. Tidal and diurnal rhythms of locomotory activity in Carcinus maenas (L.). J. Exp. Biol. 1958, 35, 131–138. 3. Dubofsky, E.A.; Simpson, S.D.; Chabot, C.C. Patterns of activity expressed by juvenile horseshoe crabs. Biol. Bull. 2013, 225, 42–49. [CrossRef][PubMed] 4. Forward, R.B.; Diaz, H.; Cohen, J.H. The tidal rhythm in activity of the mole crab Emerita talpoida. J. Mar. Biol. Assoc. UK 2005, 85, 895–901. [CrossRef] 5. Barker, G.M. Biology of Terrestrial Molluscs; CABI Publishing: New York, NY, USA, 2001. 6. Naylor, E. Chronobiology of Marine Organisms; Cambridge University Press: Cambridge, UK, 2010; pp. 1–252. 7. Kristin, T.R.; Florian, R.; Enrique, A. Another place, another timer: Marine species and the rhythms of life. Bioessays News Rev. Mol. Cell. Dev. Biol. 2015, 33, 165–172. 8. Deborah, B.P.; Cassone, V.M.; Earnest, D.J.; Golden, S.S.; Hardin, P.E.; Thomas, T.L.; Zoran, M.J. Circadian rhythms from multiple oscillators: Lessons from diverse organisms. Nat. Rev. Genet. 2005, 6, 544–556. 9. Hardin, P.E.; Hall, J.C.; Rosbash, M. Feedback of the Drosophila period gene product on circadian cycling of its messenger RNA levels. Nature 1990, 343, 536–540. [CrossRef][PubMed] 10. Mat, A.M.; Perrigault, M.; Massabuau, J.C.; Tran, D. Role and expression of cry1 in the adductor muscle of the oyster Crassostrea gigas during daily and tidal valve activity rhythms. Chronobiol. Int. 2016, 33, 949–963. [CrossRef] 11. Tei, H.; Okamura, H.; Shigeyoshi, Y.; Fukuhara, C.; Ozawa, R.; Hirose, M.; Sakaki, Y. Circadian oscillation of a mammalian homologue of the Drosophila period gene. Nature 1997, 389, 512–516. [CrossRef] Genes 2019, 10, 488 13 of 15
12. Padmanabhan, K.; Weitz, C.J. Feedback regulation of transcriptional termination by the mammalian circadian clock PERIOD complex. Science 2012, 337, 599. [CrossRef] 13. Cyran, S.A.; Buchsbaum, A.M.; Reddy, K.L.; Meng-Chi, L.; Glossop, N.R.J.; Hardin, P.E.; Young, M.W.; Storti, R.V.; Justin, B. vrille, Pdp1, and dClock form a second feedback loop in the Drosophila circadian clock. Cell 2003, 112, 329–341. [CrossRef] 14. Levy, O.; Appelbaum, L.; Leggat, W.; Gothlif, Y.; Hayward, D.C.; Miller, D.J.; Hoegh-Guldberg, O. Light-responsive cryptochromes from a simple multicellular animal, the coral Acropora millepora. Science 2007, 318, 467–470. [CrossRef][PubMed] 15. Todo, T.; Ryo, H.; Yamamoto, K.; Toh, H.; Inui, T.; Ayaki, H.; Nomura, T.; Ikenaga, M. Similarity among the Drosophila (6-4)photolyase, a human photolyase homolog, and the DNA photolyase-blue-light photoreceptor family. Science 1996, 272, 109–112. [CrossRef][PubMed] 16. Masato, F.; Takahiro, T.; Yuki, T.; Sung-Pyo, H.; Nozomi, S.; Akihiro, T.; Yoko, K.; Keiko, O.; Toshiyuki, O. Lunar phase-dependent expression of cryptochrome and a photoperiodic mechanism for lunar phase-recognition in a reef fish, goldlined spinefoot. PLoS ONE 2011, 6, e28643. 17. Feng, D.; Lazar, M.A. Clocks, metabolism, and the epigenome. Mol. Cell 2012, 47, 158–167. [CrossRef] [PubMed] 18. Dipesh, C.; Christopher, S.C. Circadian modulation of learning and memory in fear-conditioned mice. Behav. Brain Res. 2002, 133, 95–108. 19. Smarr, B.L.; Jennings, K.J.; Driscoll, J.R.; Kriegsfeld, L.J. A time to remember: The role of circadian clocks in learning and memory. Behav. Neurosci. 2014, 128, 283–303. [CrossRef] 20. Dash, P.K.; Hochner, B.; Kandel, E.R. Injection of the cAMP-responsive element into the nucleus of Aplysia sensory neurons blocks long-term facilitation. Nature 1990, 345, 718–721. [CrossRef] 21. Bourtchuladze, R.; Frenguelli, B.; Blendy, J.; Cioffi, D.; Schutz, G.; Silva, A.J. Deficient long-term memory in mice with a targeted mutation of the cAMP-responsive element-binding protein. Cell 1994, 79, 59–68. [CrossRef] 22. Silva, A.J.; Kogan, J.H.; And, P.W.F.; Kida, S. CREB and Memory. Annu. Rev. Neurosci. 1998, 21, 127–148. [CrossRef] 23. Gau, D.; Lemberger, T.; Gall, C.V.; Kretz, O.; Minh, N.L.; Gass, P.; Schmid, W.; Schibler, U.; Korf, H.W.; Schütz, G. Phosphorylation of CREB Ser142 regulates light-induced phase shifts of the circadian clock. Neuron 2002, 34, 245–253. [CrossRef] 24. Reppert, S.M.; Weaver, D.R. Coordination of circadian timing in mammals. Nature 2002, 418, 935–941. [CrossRef][PubMed] 25. Mohamed, H.A.; Yao, W.; Fioravante, D.; Smolen, P.D.; Byrne, J.H. cAMP-response elements in Aplysia creb1, creb2, and Ap-uch promoters: Implications for feedback loops modulating long term memory. J. Biol. Chem. 2005, 280, 27035–27043. [CrossRef][PubMed] 26. Bartsch, D.; Casadio, A.; Karl, K.A.; Serodio, P.; Kandel, E.R. CREB1 encodes a nuclear activator, a repressor, and a cytoplasmic modulator that form a regulatory unit critical for long-term facilitation. Cell 1998, 95, 211–223. [CrossRef] 27. Rawashdeh, O.; Jilg, A.; Maronde, E.; Fahrenkrug, J.; Stehle, J.H. Period1 gates the circadian modulation of memory-relevant signaling in mouse hippocampus by regulating the nuclear shuttling of the CREB kinase pP90RSK. J. Neurochem. 2016, 138, 731–745. [CrossRef][PubMed] 28. Campos, L.M.; Cruz-Rizzolo, R.J.; Pinato, L. The primate seahorse rhythm. Brain Res. 2015, 1613, 81–91. [CrossRef] 29. Fernandez, R.I.; Lyons, L.C.; Jonathan, L.; Omar, K.; Arnold, E. Circadian modulation of long-term sensitization in Aplysia. Proc. Natl. Acad. Sci. USA 2003, 100, 14415–14420. [CrossRef] 30. Mcdonald, R.J.; Hong, N.S.; Ray, C.; Ralph, M.R. No time of day modulation or time stamp on multiple memory tasks in rats. Learn. Motiv. 2002, 33, 230–252. [CrossRef] 31. Chabot, C.C.; Watson, W.H. Daily and Tidal Rhythms in Intertidal Marine Invertebrates; Springer: Tokyo, Japan, 2014. 32. Page, T.L. Masking in invertebrates. Chronobiol. Int. 1989, 6, 3–11. [CrossRef] 33. Shen, H.; Li, K.; Chen, H.; Chen, X.; He, Y.; Shi, Z. Experimental ecology and hibernation of Onchidium struma (Gastropoda: Pulmonata: Systellommatophora). J. Exp. Mar. Biol. Ecol. 2011, 396, 71–76. Genes 2019, 10, 488 14 of 15
34. Nishi, T.; Gotow, T. A neural mechanism for processing colour information in molluscan extra-ocular photoreceptors. J. Exp. Biol. 1992, 168, 77–91. 35. Gotow, T.; Tateda, H.; Kuwabara, M. The function of photoexcitive neurones in the central ganglia for behavioral activity of the marine mollusc, Onchidium verruculatum. J. Comp. Physiol. 1973, 83, 361–376. [CrossRef] 36. Shimotsu, K.; Nishi, T.; Nakagawa, S.; Gotow, T. A new role for photoresponsive neurons called simple photoreceptors in the sea slug Onchidium verruculatum: Potentiation of synaptic transmission and motor response. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2010, 156, 201–210. [CrossRef][PubMed] 37. Xu, G.; Yang, T.; Wang, D.; Li, J.; Liu, X.; Wu, X.; Shen, H. A comprehensive comparison of four species of Onchidiidae provides insights on the morphological and molecular adaptations of invertebrates from shallow seas to wetlands. PLoS ONE 2018, 13, e0196252. [CrossRef][PubMed] 38. Zantke, J.; Ishikawa-Fujiwara, T.; Arboleda, E.; Lohs, C.; Schipany, K.; Hallay, N.; Straw, A.; Todo, T.; Tessmar-Raible, K. Circadian and circalunar clock interactions in a marine annelid. Cell Rep. 2013, 5, 99–113. [CrossRef] 39. Goto, S.G.; Takekata, H. Circatidal rhythm and the veiled clockwork. Curr. Opin. Insect Sci. 2015, 7, 92–97. [CrossRef] 40. Page, T.L. Circadian regulation of learning and memory. Curr. Opin. Insect Sci. 2015, 7, 87–91. [CrossRef] 41. Garren, M.V.; Sexauer, S.B.; Page, T.L. Effect of circadian phase on memory acquisition and recall: Operant conditioning vs. classical conditioning. PLoS ONE 2013, 8, e58693. [CrossRef] 42. Vorster, A.P.A.; Krishnan, H.C.; Chiara, C.; Lyons, L.C. Characterization of sleep in Aplysia californica. Sleep 2014, 37, 1453. [CrossRef] 43. Marques, M.D.; Waterhouse, J.M. Masking and the evolution of circadian rhythmicity. Chronobiol. Int. 1994, 11, 146–155. [CrossRef] 44. Rietveld, W.J.; Minors, D.S.; Waterhouse, J.M. Circadian rhythms and masking: An overview. Chronobiol. Int. 1993, 10, 306–312. [CrossRef][PubMed] 45. Palmer, J.D. The rhythmic lives of crabs. Bioscience 1990, 40, 352–358. [CrossRef] 46. Chabot, C.C.; Skinner, S.J.; Watson, W.H. Rhythms of locomotion expressed by Limulus polyphemus, the American horseshoe crab: I. synchronization by artificial tides. Biol. Bull. 2008, 215, 34–45. [CrossRef] [PubMed] 47. Takekata, H.; Goto, S.G.; Satoh, A.; Numata, H. Light masking of the circatidal activity rhythm in the mangrove cricket Apteronemobius asahinai. Biol. Rhythm Res. 2014, 45, 229–233. [CrossRef] 48. Wang, M.C.; Dragich, J.M.; Kudo, T.; Odom, I.H.; Welsh, D.K.; O’Dell, T.J.; Colwell, C.S. Expression of the circadian clock gene Period2 in the hippocampus: Possible implications for synaptic plasticity and learned behaviour. ASN Neuro 2009, 1, 240–242. [CrossRef][PubMed] 49. Bjorn, R.; Jan, B. About sleep’s role in memory. Physiol. Rev. 2013, 93, 681–766. 50. Takaomi, S.; Takuya, T.; Toshihiro, K.; Yoshiaki, K. A clock gene, period, plays a key role in long-term memory formation in Drosophila. Proc. Natl. Acad. Sci. USA 2004, 101, 16058–16063. 51. Buhr, E.D.; Takahashi, J.S. Molecular Components of the Mammalian Circadian Clock. In Handbook of Experimental Pharmacology; Springer: Berlin/Heidelberg, Germany, 2013. 52. Montenegro-Montero, A.; Canessa, P.; Larrondo, L.F. Chapter Four—Around the Fungal Clock: Recent Advances in the Molecular Study of Circadian Clocks in Neurospora and Other Fungi. Adv. Genet. 2015, 92, 107–184. 53. Mahan, K.L. Circadian Oscillation of MAPK Activity and cAMP in the Hippocampus: Implications for Memory Persistence. Ph.D. Thesis, University of Washington, Seattle, WA, USA, 2008. 54. Adams, J.P.; Roberson, E.D.; English, J.D.; Selcher, J.C.; Sweatt, J.D. MAPK regulation of gene expression in the central nervous system. Acta Neurobiol. Exp. 2000, 60, 377–394. 55. Zhang, E.E.; Liu, Y.; Dentin, R.; Pongsawakul, P.Y.; Liu, A.C.; Hirota, T.; Nusinow, D.A.; Sun, X.; Landais, S.; Kodama, Y. Cryptochrome mediates circadian regulation of cAMP signaling and hepatic gluconeogenesis. Nat. Med. 2010, 16, 1152. [CrossRef] 56. Liu, R.Y.; Shah, S.; Cleary, L.J.; Byrne, J.H. Serotonin- and training-induced dynamic regulation of CREB2 in Aplysia. Learn. Mem. 2011, 18, 245–249. [CrossRef][PubMed] 57. Sadamoto, H.; Kitahashi, T.; Fujito, Y.; Ito, E. Learning-dependent gene expression of CREB1 isoforms in the molluscan brain. Front. Behav. Neurosci. 2010, 4, 25. [CrossRef][PubMed] Genes 2019, 10, 488 15 of 15
58. Mizuno, M.; Yamada, K.; Maekawa, N.; Saito, K.; Seishima, M.; Nabeshima, T. CREB phosphorylation as a molecular marker of memory processing in the hippocampus for spatial learning. Behav. Brain Res. 2002, 133, 135–141. [CrossRef] 59. Lyons, L.C.; Oliver, R.; Ayelet, K.; Susswein, A.J.; Arnold, E. Circadian modulation of complex learning in diurnal and nocturnal Aplysia. Proc. Natl. Acad. Sci. USA 2005, 102, 12589–12594. [CrossRef][PubMed] 60. Chiang, C.K.; Xu, B.; Mehta, N.; Mayne, J.; Sun, W.Y.L.; Cheng, K.; Ning, Z.; Dong, J.; Zou, H.; Cheng, H.Y.M. Phosphoproteome profiling reveals circadian clock regulation of posttranslational modifications in the murine hippocampus. Front. Neurol. 2017, 8, 110. [CrossRef][PubMed] 61. Cain, S.W.; Ko, C.H.; Chalmers, J.A.; Ralph, M.R. Time of day modulation of conditioned place preference in rats depends on the strain of rat used. Neurobiol. Learn. Mem. 2004, 81, 217–220. [CrossRef][PubMed]
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).