Conservation of the Mitf Gene, Its Role in Drosophila and the Effect of Micro-RNA’S

Conservation of the Mitf gene, its role in Drosophila and the effect of micro-RNA’s

Benedikta Steinunn Hafliðadóttir

Thesis for the degree of Philosophiae Doctor University of Iceland Faculty of Medicine School of Health Sciences September 2010

Conservation of the Mitf gene, its role in Drosophila and the effect of micro-RNA’s

Benedikta Steinunn Hafliðadóttir

Thesis for the degree of Philosophiae Doctor

Supervisors: Eiríkur Steingrímsson, Ph.D. Francesca Pignoni, Ph.D.

Doctoral committee: Ólafur S. Andrésson, Ph.D. Guðmundur Hrafn Guðmundsson, Ph.D. David Van Vactor, Ph.D.

University of Iceland School of Health Sciences Faculty of Medicine September 2010

Varðveisla Mitf-gensins, hlutverk í ávaxtaflugunni og áhrif micro-RNA sameinda

Benedikta Steinunn Hafliðadóttir

Ritgerð til doktorsgráðu

Umsjónarkennarar: Eiríkur Steingrímsson, Ph.D. Francesca Pignoni, Ph.D.

Doktorsnefnd: Ólafur S. Andrésson, Ph.D. Guðmundur Hrafn Guðmundsson, Ph.D. David Van Vactor, Ph.D.

Háskóli Íslands Heilbrigðisvísindasvið Læknadeild September 2010

Thesis for a doctoral degree at the University of Iceland. All right reserved. No part of this publication may be reproduced in any form without the prior permission of the copyright holder. © Benedikta Steinunn Hafliðadóttir 2010

ISBN 978-9979-9918-7-8

Printing by Háskólaprent ehf. Reykjavík, Iceland 2010’

ÁGRIP

MITF (Microphthalmia associated transcription factor) er bHLH-Zip umritunarþáttur sem er nauðsynlegur fyrir þroskun og starfsemi litfruma í húð og hári. MITF er einnig nauðsynlegt fyrir þroskun litfruma augans (retinal pigment epithelial cells) og er þannig mikilvægt fyrir eðlilega þroskun augans í spendýrum. Nýlega hefur verið sýnt að MITF er einnig nauðsynlegt fyrir viðhald sortuæxlisfruma. Ritgerð þessi er í þremur liðum og sýnir að: 1) Bygging Mitf gensins er varðveitt í ávaxtaflugunni og gegnir samskonar hlutverki í augnþroskun flugunnar og í hryggdýrum. Hlutverk þess er að tryggja að frumur þær sem eru aðlægar taugafrumum augans (RPE frumur í hryggdýrum, peripodial frumur í Drosophilu) geti ekki þroskast í taugafrumur. Ef genið vantar, verða þessar frumur að taugafrumum og eðlileg þroskun augans á sér ekki stað. 2) Mitf genið er vel varðveitt, ekki einungis hvað útraðir varðar heldur einnig hvað varðar stýrisvæði, hluta innraða og 3’UTR raðir gensins. Sem dæmi má nefna að varðveisla 3´UTR svæðisins (3´ untranslated region), sem er yfir 3 kb að lengd í músinni, er mjög mikil eða 35% á milli 11 hryggdýrategunda. Á þessum varðveittu svæðum eru bindiset fyrir microRNA (miRNA) sameindir. 3) miRNA bindisetin í 3´UTR svæðum MITF gensins gegna mikilvægu hlutverki við að stjórna magni á MITF mRNA sameindinni í sortuæxlisfrumum. Hér er hugsanlega um að ræða mikilvæga leið til að takmarka MITF mRNAið í þessum frumum og jafnvel leið til að eyða öllu MITF í sortuæxlisfrumum. Rannsóknir þessar sýna mikla varðveislu Mitf gensins, bæði hvað byggingu og hlutverk varðar. Einnig höfum við sýnt að miRNA sameindirnar miR-148 og miR-137 hafa áhrif á tjáningu gensins í sortuæxlisfrumum.

1 ABSTRACT

MITF (Microphthalmia associated transcription factor) is a bHLH-Zip transcription factor, necessary for the development and function of melanocytes in the skin and hair. It is also necessary for normal development of the pigment cells of the eye (retinal pigment epithelial cells) and is therefore important for the development of the vertebrate eye. Recently, it has been shown that MITF is also necessary for the maintenance of melanoma cells where it acts as a lineage survival oncogene. The thesis is divided into three parts and shows that: 1) Not only is the structure of the Mitf gene conserved between vertebrates and the fruitfly, but also its function is conserved with respect to eye development. The role of Mitf is to ensure that the cells adjacent to the neural cells in the eye (RPE cells in vertebrates, peripodial cells in Drosophila), acquire a non-neural fate. 2) The Mitf gene is well conserved, not only with respect to exons but also in the promoter and the 3ÚTR region. The 3ÚTR region is over 3 kb long in the mouse and has 35% conservation in 11 vertebrate species. These conserved areas contain microRNA (miRNA) binding sites. 3) The miRNA binding sites in the 3ÚTR region of the MITF gene are important for regulating the amount of MITF mRNA in melanoma cells. This is potentially a very important way to limit MITF mRNA in these cells and even to eliminate it altogether in melanoma cells. The results presented here show a very high conservation of the Mitf gene, both considering its structure and function. In addition, we show that the miRNAs miR-148 and miR-137 can regulate MITF expression in melanoma cells.

ACKNOWLEDGEMENTS

This work was carried out in Dr. Eiríkur Steingrímsson´s lab in the Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Iceland. The Drosophila work was mostly carried out in Dr. Francesca Pignoni´s lab at Massachusetts Eye and Ear Infirmary, Harvard Medical School in Boston, USA. I would like to thank all who contributed to this work, especially I would like to thank my supervisor, Dr. Eiríkur Steingrímsson for excellent supervision throughout the years and Dr. Francesca Pignoni for the great opportunity to work in her lab at MEEI, HMS. I would also like to thank the members of my PhD committee, Drs. David Van Vactor, Ólafur S. Andrésson and Guðmundur Hrafn Guðmundsson. My colleagues and friends both in Boston and Reykjavík I thank for their collaboration and discussions, especially Alexander Schepsky, Jón Hallsteinn Hallsson, Guðrún Valdimarsdóttir, Kristín Bergsteinsdóttir, Christian Praetorius, Christine Grill, Helga Bjarnadóttir, Bjarki Guðmundsson, Kristy Kenyon, Susan Tran, Christopher Clouser, Stephen Morandi, Swati S. Ranade, Yonghai Li and Gina Decene. Finally, I especially want to thank my family and friends for their invaluable support during my studies. This work was supported by grants from the Icelandic Research Fund, the University of Iceland Research Fund, Research to Prevent Blindness and the Massachusetts Lions Eye Research Fund.

3 LIST OF ORIGINAL PAPERS

I. Hallsson JH, Haflidadóttir BS, Stivers C, Odenwald W, Arnheiter H, Pignoni F, Steingrímsson E. The basic helix-loop-helix leucine zipper transcription factor Mitf is conserved in Drosophila and functions in eye development. Genetics. 2004 May;167(1):233-41. II. Hallsson JH †, Haflidadóttir BS †, Schepsky A, Arnheiter H, Steingrímsson E. Evolutionary sequence comparison of the Mitf gene reveals novel conserved domains. Pigment Cell Res. 2007 Jun;20(3):185-200. †Authors contributed equally to this work. III. Haflidadóttir BS, Bergsteinsdóttir, K, Praetorius, C and Steingrímsson E. 2010. miR-148 Regulates Mitf in melanoma cells. PloS ONE, 2010 Jul 14;5(7):e11574.

CLARIFICATION OF CONTRIBUTION

Paper I This paper describes the conservation and function of the Mitf gene in Drosophila. I performed the in vivo expression studies of pUAS-MitfWT and pUAS-MitfEA constructs in eye antennal discs and the peripodial layer of the eye discs, using the UAS-Gal4 system. I also performed the RNA in situ hybrydizations on Drosophila imaginal discs.

Paper II This paper describes the conservation of the Mitf gene and protein in both vertebrates and invertebrates. I analyzed the conservation of the sequences upstream of all nine 5´ first exons of Mitf and located potential transcription factor binding sites. I also preformed the conservation analysis of the 3ÚTR sequences and location of potential miRNA binding sites within the 3ÚTR sequence. I wrote the chapters on the 5ÚTR and 3ÚTR sequences in the paper.

Paper III This paper describes the effects of microRNAs on MITF in melanoma cells. I cloned the mouse Mitf 3´UTR sequence into a Luciferase vector, did the co- transfections with miRNAs and luciferase assays in HEK293 (Human embryonic kidney cells 293) and 501mel cells. I generated all the mutant clones, confirmed them by sequencing, performed the extraction of RNAs from MeWo cells and consecutive qRT-PCR on endogenous human MITF mRNA. I also extracted RNA from HEK293, 501mel and MeWo cells that was sent to Exiqon for endogenous miRNA expression analysis. The Western blot and the qRT-PCR experiments were performed with the assistance of KB and the experiments with the anti-miRNAs were performed by CP. I wrote the manuscript with the assistance of ES.

5 6

TABLE OF CONTENTS

ÁGRIP ...... 1 ABSTRACT ...... 2 ACKNOWLEDGEMENTS ...... 3 LIST OF ORIGINAL PAPERS ...... 4 CLARIFICATION OF CONTRIBUTION ...... 5 TABLE OF CONTENTS ...... 7 LIST OF FIGURES ...... 10 LIST OF ABBREVIATIONS ...... 11 1 INTRODUCTION ...... 17 1.1 Microphthalmia associated transcription factor ...... 17 1.2 Mutations in the Mitf gene ...... 18 1.3 Mitf gene structure and splice variants ...... 19 1.4 Regulation of Mitf expression ...... 23 1.5 Post-translational modifications ...... 25 1.6 The Mitf gene in vertebrates and invertebrates ...... 26 1.7 Evolution of the eye ...... 27 1.8 Eye development in vertebrates ...... 28 1.9 Mitf expression and function in the vertebrate eye ...... 29 1.10 Eye development in Drosophila ...... 31 1.11 Melanocytes ...... 32 1.12 Mitf expression during development ...... 34 1.13 Roles of Mitf ...... 34 1.13.1 Differentiation ...... 35 1.13.2 Survival and protection from apoptosis...... 35 1.13.3 Anti-proliferation ...... 37 1.13.4 Pro-proliferation ...... 37 1.14 Melanoma ...... 38 1.15 MITF in melanoma ...... 39

7 1.16 MicroRNAs ...... 42 1.17 MicroRNA biogenesis ...... 42 1.18 MicroRNAs in cancer ...... 45 1.19 MicroRNAs and melanoma ...... 46 1.20 MicroRNAs and Mitf ...... 46 2 AIMS OF THE THESIS ...... 49 2.1 Mitf in Drosophila ...... 49 2.2 Conservation of Mitf non-coding regions ...... 49 2.3 MicroRNAs affecting Mitf ...... 49 3 MATERIALS AND METHODS ...... 51 3.1 RNA in situ hybridization on imaginal discs ...... 51 3.2 Tissue specific dMitf expression ...... 51 3.3 Conservation of the Mitf promoter sequences ...... 51 3.4 Conservation of Mitf 3ÚTR sequences ...... 52 3.5 PCR amplification of the 3ÚTR sequence of Mitf ...... 52 3.6 MicroRNA molecules ...... 53 3.7 Cell culture conditions ...... 53 3.8 Co-transfections ...... 53 3.9 Luciferase measurements ...... 53 3.10 Site directed mutagenesis ...... 54 3.11 Transfection of miRNAs into MeWo cells ...... 54 3.12 RNA extraction and cDNA synthesis ...... 54 3.13 Quantitative reverse transcription PCR ...... 54 3.14 Reverse transcription PCR ...... 55 3.15 MicroRNA real-time qPCR ...... 55 3.16 Data pre-processing ...... 55 3.17 Western blot ...... 56 3.18 Statistical analysis ...... 56 4 RESULTS ...... 57 4.1 Mitf in Drosophila (Paper I) ...... 57 4.2 Conservation of the Mitf gene and protein (Paper II) ...... 60 4.3 Conservation of promoter sequences (Paper II) ...... 61 4.4 Conservation of the Mitf 3ÚTR region (Paper II) ...... 61

4.5 Potential miRNA binding sites (Paper II /Paper III) ...... 61 4.6 Functional miRNA binding sites (Paper III) ...... 63 4.6.1 miR-148 ...... 65 4.6.2 miR-137 ...... 68 4.6.3 miR-124 ...... 70 4.7 Synergistic effect of miRNAs (Paper III) ...... 71 5 DISCUSSION ...... 73 5.1 Mitf in Drosophila (Paper I) ...... 73 5.2 Conservation of Mitf non-coding regions (Paper II) ...... 74 5.3 miRNAs affecting Mitf (Paper III) ...... 75 REFERENCES ...... 81 APPENDIX ...... 105 ORIGINAL PAPERS ...... 121

9 LIST OF FIGURES

Figure 1. Genomic structure of mouse Mitf gene and protein isoforms...... 21 Figure 2. The α-MSH signaling pathway...... 24 Figure 3. Eye development in vertebrates and in Drosophila...... 30 Figure 4. MITF protein levels in melanoma...... 40 Figure 5. The miRNA pathway...... 43 Figure 6. The expression of dMitf in Drosophila eye-antennal discs...... 58 Figure 7. Overexpression of wt dMitf and a dominant negative dMitf...... 59 Figure 8. Conserved potential miRNA binding sites in the Mitf 3ÚTR sequence...... 62 Figure 9. Effects of miRNAs on the Mitf 3ÚTR-luciferase reporter...... 64 Figure 10. Effects of miRNAs on endogenous MITF...... 66 Figure 11. Inhibiting the miRNAs blocks their effect...... 67 Figure 12. Effects of mutating the miR-148 binding sites...... 68 Figure 13. Effects of mutating the miR-137 binding sites...... 69 Figure 14. Effects of mutating the miR-124 binding sites...... 71 Figure 15. Conservation of the Mitf 3ÚTR sequence in vertebrate species...... 105 Figure 16. Conservation of intron 6 in the Mitf gene...... 113 Figure 17. Conservation of intron 7 in the Mitf gene...... 114 Figure 18. Conservation of the dMitf 3ÚTR sequence ...... 116

LIST OF ABBREVIATIONS

3´UTR 3´ untranslated region 5´UTR 5´ untranslated region Aa Amino acid Ago Argonaute APOLD1 apolipoprotein L domain containing 1 Bad BCL2-associated agonist of cell death Bcl2 B-cell CLL/lymphoma 2 BHLH-Zip basic-helix-loop-helix zipper BMP4 Bone morphogenetic protein 4 Btau Bos taurus, cow Bp base pair BRAF v-raf murine sarcoma viral oncogene homolog B1 BRN2 brain-specific homeobox/POU domain protein 2 (POU3F2/N-Oct3) cAMP cyclic AMP Cfam Canis familiaris, dog CBP CREB binding protein CDK2 cyclin-dependent kinase 2 CDK4 cyclin-dependent kinase 4 CHX10 ceh-10 homeodomain containing homolog C-met met proto-oncogene (hepatocyte growth factor receptor) CRE cAMP response element CREB cAMP response element binding protein Dac Dachsund DCT dopachrome tautomerase Dia1/DIAPH1 diaphanous homolog 1

11 dMitf Drosophila Mitf gene DNA Deoxyribonucleic acid DP Disc proper Dpp Decapentaplegic EGFR Epidermal growth factor receptor ELAV embryonic lethal, abnormal vision ERK Extracellular signal-regulated kinase Ey Eyeless Eya Eyes absent Fcat Felis catus, cat Gal4 DNA binding transcription factor Ggal Gallus gallus, chicken GATA GATA transcription factor HEK293 Human embryonic kidney cells 293 HGF Hepatocyte growth factor Hh Hedgehog Hif-1α hypoxia inducible factor 1, alpha subunit Hsap Homo sapiens, human HPS4 Hermansky-Pudlak syndrome 4 IL6-RE Interleukin 6 responsive element IRF4 interferon regulatory factor 4 KCNN2 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 Kit C-Kit, cytokine receptor Lef1 Lymphoid enhancer-binding factor 1 Lin-14 abnormal cell LINeage Lafr Loxodonta africana, elephant LYST lysosomal trafficking regulator MAPK mitogen-activated protein kinase MBP myelin basic protein

MC1R Melanocortin 1 receptor MF Morphogenetic Furrow miRNA, miR microRNA miRNP miRNA-containing ribonucleo-protein particles Mitf Microphthalmia associated transcription factor MITF MITF protein in mouse and human MITF MITF gene and mRNA in human Mitf, mMitf Mitf gene and mRNA in mouse MitfEA mutated version of the dMitf gene MLANA melan-A Mdom Monodelphis domestica, opossum MSA Migration staging area MSCs Melanocyte stem cells Mmus Mus musculus, house mouse MYC v-myc myelocytomatosis viral oncogene homolog NC neural crest NR neural retina Nt nucleotide Oc-2 Onecut-2 Ocun Oryctolagus cuniculus, rabbit OC optic cup ON optic nerve p16Ink4a cyclin-dependent kinase inhibitor 2A p21Cip cyclin-dependent kinase inhibitor 1A p27Kip cyclin-dependent kinase inhibitor 1B p90RSK p90 ribosomal S6 kinase Ptro Pan troglodytes, chimpanzee PAS polyadenylation signal Pax2 paired box gene 2

13 Pax3 paired box gene 3 Pax6 paired box gene 6 PCR Polymerase chain reaction PIAS3 protein inhibitor of activated STAT PKA protein kinase A PL Peripodial layer PLA1A phospholipase A1 member A POMC pro-opiomelanocortin Pre-miRNA precursor miRNA Pri-miRNA primary miRNA PSEN2 presenilin 2 Rnor Rattus norvegicus, rat Rb Retinoblastoma protein RBM35A RNA binding motif protein 35A RISC RNA-induced silencing complex RNA Ribonucleic acid RPE Retinal pigment epithelium Scf Stem cell factor Silv silver homolog (PMEL17/gp100) So Sine oculis Sox10 SRY (sex determining region Y)-box 10 STAT3 Signal transducer and activator of transcription 3 TBX2 T-box 2 TFE3 Transcription factor E3 TFEB Transription factor EB TFEC Transcription factor EC Toy Twin of eyeless TYR Tyrosinase TYRP1 Tyrosine-related protein 1

TYRP2 Tyrosine-related protein 2 UAS Upstream activating sequence VEGF Vascular endothelial growth factor Wnt wingless-type MMTV integration site family of genes WSIIa Waardenburg syndrome type IIa WT wild type α-MSH α-melanocyte stimulating hormone

15 16

1 INTRODUCTION

This thesis and the associated papers present studies on the transcription factor Mitf (Microphthalmia associated transcription factor). Mitf is an important regulator in many cell types including melanocytes, melanoma cells and retinal pigment epithelium (RPE) of the eye. The study of transcription factors like Mitf is essential for our understaning of how they contribute to the normal and abnormal development of the eye and melanocytes. Additionally, it is of great significance to study MITF function in order to understand how melanoma develops and progresses with the future aim to develop better treatment options for this highly resistant cancer. High conservation of genes like Mitf give us further information on their potential function and importantly give us the opportunity to use animal models like Drosophila to study their roles.

1.1 Microphthalmia associated transcription factor Mitf is a bHLH-Zip (basic-helix-loop-helix zipper) transcription factor. Members of the bHLH family of transcription factors all have a basic domain for DNA binding and at the carboxy-terminal side a helix-loop-helix domain, containing two α-helices and a flexible loop in between, used for protein-protein interaction. This is followed by the leucine zipper domain which is also used for protein-protein interactions (Murre et al., 1989; Murre et al., 1994). The MITF protein belongs to the MYC (v-myc myelocytomatosis viral oncogene homolog) family of bHLH leucine zipper transcription factors (Hodgkinson et al., 1993; Hughes et al., 1993) and is most related to the TFE3, TFEB and TFEC proteins (Transcription factor 3, B and C) (Hemesath et al., 1994). These four proteins together form a subgroup of bHLH-Zip proteins, the MITF-TFE family. The MITF protein is located mainly in the nucleus (Takebayashi et al., 1996), where it activates its target genes by binding to the E-box sequence 5´-CANNTG-3´ either as a homodimer or a heterodimer with its family members TFE3, TFEB and TFEC (Hemesath et al., 1994). MITF also binds to a longer binding motif, the 11 bp M-box sequence, 5´-AGTCATGTGCT-3´, a pigment cell specific promoter element that includes the E-box sequence (Bentley et al., 1994; Bertolotto et al., 1998b).

17 Mitf was first discovered as a mutation in the mouse. The first Mitf mutant was identified by Paula Hertwig, in 1942, when she described mice with pigmentary abnormalities and small eyes among the progeny of X-ray treated mice (Hertwig, 1942). This mutation was later shown to be in the mouse Mitf gene, which was cloned and identified by two groups independently (Hodgkinson et al., 1993; Hughes et al., 1993). Subsequently, the human MITF gene was cloned (Tachibana et al., 1994) and since then the MITF protein has been shown to function in various cell types including melanocytes, retinal pigment epithelium of the eye, in osteoclasts, mast cells and melanocyte stem cells (MSCs) (reviewed in Steingrimsson et al., 2004).

1.2 Mutations in the Mitf gene Mutations in Mitf gene have been identified in several species (reviewed in Nakamura et al., 2002; Steingrimsson et al., 2004). In the mouse, Mitf mutations affect several different cell types, including the neural crest derived melanocytes, the RPE layer, osteoclasts and mast cells. Most mutations result in loss of pigmentation in the skin, hair and inner ear (Steingrimsson et al., 2004). Other phenotypes include deafness, osteopetrosis and mast cell defects (Roundy et al., 1999; Steingrimsson et al., 2004). More than 30 mutations have been identified at the mouse Mitf locus and their phenotype severity can be arranged in an allelic series (Steingrimsson et al., 2004; Bharti et al., 2006). The Mitf null mutant (Mitfvga9) has no melanocytes and the retinal pigment epithelium develops abnormally, leading to microphthalmia (Tachibana et al., 1992). All of the mutations affect melanocytes to a certain degree, some mutations also affect eye development while others also affect osteoclast development (reviewed in Steingrimsson et al., 2003; Steingrimsson et al., 2004). Half of the Mitf mutations are inherited semidominantly (including Mitfmi-wh, MitfMi-or, MitfMi-b, Mitfmi) and half are recessive mutations (including Mitfmi-sp, Mitfmi-rw, Mitfmi-ew, Mitfmi-vga9). The phenotypes caused by the semidominant mutations are less severe when they are associated with the wild type Mitf (Mitfwt) allele as heterozygotes, usually leading to white belly spots or coat colour dilution. The recessive mutations only show a phenotype when homozygous (Steingrimsson et al., 2003; Steingrimsson et al., 2004). One of the mutations, the Mitfmi-spotted (Mitfmi-sp) is unusual, as a phenotype is only observed in combination with other Mitf mutations (Moore, 1995; Steingrimsson et al., 2003).

An interesting phenotype is caused by the vitiligo mutation (Mitfvit). Mice carrying this mutation are normal in heterozygous condition. Homozygous mice have white spots at early age. However, with time the homozygous mice gradually lose their pigmentation and old mice are nearly completely white and without melanocytes. This phenotype resembles the vitiligo depigmentation disorder in humans (Lerner et al., 1986; Steingrimsson et al., 2004). In the Mitfvit mice, melanocytes stem cells located in the hair bulge are lost with each hair cycle (Nishimura et al., 2002; McGill et al., 2002; Nishimura et al., 2005). The molecular and biochemical changes of these mutations have been analyzed. The semidominant mutations affect the DNA binding domain or the transcriptional activation domain of the protein (Hodgkinson et al., 1993; Steingrimsson et al., 1994; Steingrimsson et al., 1996). The recessive mutations affect the transcription of the Mitf gene or the dimerization domain of the MITF protein (Hodgkinson et al., 1993; Hughes et al., 1993; Steingrimsson et al., 1994; Yajima et al., 1999). Thus the semidominant mutations lead to dominant negative proteins whereas the recessive mutations are non-functional proteins. In humans, mutations in the MITF gene cause Waardenburg syndrome type IIa (WSIIa), an autosomal dominantly inherited disorder represented by deafness caused by lack of melanocytes in the stria vascularis of the cochlea of the inner ear and pigment defects caused by lack of melanocytes in the skin and hair (Read and Newton, 1997). The mutations in WSIIa cause haploinsufficiency of the MITF gene resulting in the above mentioned defects (Smith et al., 2000). Tietz syndrome is caused by dominant negative mutations in the MITF gene in the basic region that results in a more severe form of pigment loss in the skin and RPE as well as hearing loss (Amiel et al., 1998; Smith et al., 2000). The other genes in the Mitf-Tfe family, Tfe3, TfeB, TfeC are thought to be expressed more broadly than Mitf. Germline knockout of the TfeB gene causes embryonic lethality but mutations in Tfe3 and TfeC do not have as severe effects (Steingrimsson et al., 1998). The Mitf gene seems to be the only member necessary for melanocyte function (reviewed in Levy et al., 2006).

1.3 Mitf gene structure and splice variants The vertebrate Mitf gene structure is complex, with the mouse and human gene containing at least nine distinct 5´exons which are alternatively spliced to the remaining exons 2 through 9. These splicing events result in MITF protein isoforms with different N-termini but most of them include the bHLH-Zip

19 domain (reviewed in Steingrimsson et al., 2004). Several additional splice variants have been identified by amplification of Mitf RNA from heart tissue (Hallsson et al., 2000). Rare variants were identified that are missing either exon 6, exon 2 or a part of exon 2 and several variants were missing exons 2, 3 and 4 (Hallsson et al., 2000). The nine 5éxons in the Mitf gene are, in the order of their genomic location starting from the 5énd: 1A (Amae et al., 1998), 1J (Hershey and Fisher, 2005), 1C (Fuse et al., 1999), 1MC (Takemoto et al., 2002), 1E (Oboki et al., 2002), 1H (Amae et al., 1998; Steingrimsson et al., 1994), 1D (Takeda et al., 2002), 1B (Udono et al., 2000) and 1M (Hodgkinson et al., 1993). Alternative promoter use is a way to control gene expression. The transcription factor binding sites in each of the promoters determines when and where each variant of the same gene is expressed. In addition to spatial and temporal control, alternative promoter use can affect mRNA stability and translational efficiency and is therefore a factor in gene regulation. Alternative promoter use has been reported for 52% of human genes with an average of 3.1 promoters per gene. In 17% of the genes analyzed, tissue specific expression was observed (Kimura et al., 2006). Three of the Mitf 5éxons, 1J, 1E and 1D are non-coding exons, as they do not have their own translation initiation sites (Hallsson et al., 2000; Hallsson et al., 2007; Hershey and Fisher, 2005; Steingrimsson et al., 1994). Exon 1B is divided into B1a and B1b and translation is initiated from the B1b exon for the J, E and D isoforms. The reading frame from the B1b exon is included in all MITF isoforms except the M isoform (Yasumoto et al., 1998; Steingrimsson, 2008). The nine different 5éxons and protein isoforms are shown in Figure 1. The role and specificity of each alternative MITF protein isoform has not been analyzed in detail. Most research has focused on the role of the melanocyte specific 1M exon (reviewed in Steingrimsson et al., 2004) and the expression of different variants during eye development (Bharti et al., 2008). Several variants have been detected in different quantities in many cell types (reviewed in Steingrimsson et al., 2004).

Figure 1. Genomic structure of mouse Mitf gene and protein isoforms. A. The genomic location of the nine alternative 5´ exons, exons 2-9 and the 3´UTR sequence are shown on the horizontal line representing the mouse Mitf gene. B. Protein isoforms of MITF.

The Mitf A form is detected in RPE cells of the eye (Amae et al., 1998; Nguyen and Arnheiter, 2000) and has recently been shown to be expressed in both the retina and the RPE throughout the eye developmental process (Bharti et al., 2008). In the RPE, the MITF A form can activate expression of Tyrosinase (Tyr) and tyrosinase-related protein 1 (TYRP1), and is likely to be important for melanogenesis in the RPE layer (Amae et al., 1998). The A form is also detected in both melanocytes and melanoma cells (Fuse et al., 1999). The Mitf J form is expressed in many cell types (Hershey and Fisher, 2005) and has been detected in both the retina and RPE throughout eye development (Bharti et al., 2008). The human Mitf C exon is expressed in the RPE cells and many other cells but is not detected in melanocyte-lineage cells (Fuse et al., 1999). The mouse Mitf C- form as well as the MC-, E- and B-forms were not detected or in very little amounts in both the retina and the RPE layer throughout eye development (Bharti et al., 2008). Expression of the Mitf MC form has been detected in mast cells were it can activate mast cell specific target genes (Takemoto et al., 2002). Expression of the Mitf E exon is also detected in mast cells (Oboki et al., 2002). The Mitf H form is expressed in the heart (Steingrimsson et al., 1994) and is detected in many other cell types including melanocytes and melanoma cells (Amae et al., 1998; Fuse et al., 1999). The H form has also been detected in the RPE (Nguyen and Arnheiter, 2000) where it is preferably expressed during eye development, starting at embryonic time 10.5 and was also detected in the retina

21 (Bharti et al., 2008). The Mitf D form is expressed in osteoclasts, macrophages and the RPE layer but is not detected in cells of the melanocyte-lineage (Takeda et al., 2002). During eye development the D form is only expressed in the RPE layer, starting at E10.5 (Bharti et al., 2008; Nguyen and Arnheiter, 2000). There is little known about the expression of the Mitf B form. It has not been detected in either RPE or melanoma cells (Udono et al., 2000) and it is not detected during eye development (Bharti et al., 2008). The melanocyte specific Mitf M form (Hodgkinson et al., 1993) has been analyzed in most detail and is specifically expressed in melanocytes and melanoma cells. Several transcription factors have been shown to activate Mitf M expression by binding to the M promoter upstream of exon 1 (see chapter 1.5). Expression from the 1M promoter has also been detected in mouse peritoneal mast cells (Oboki et al., 2002) and low levels of Mitf 1M transcript are found in the developing RPE layer but are not found in the adult RPE (Bharti et al., 2008). Recently, a new 5´exon has been identified in the human MITF gene. The exon called 1CM is located 84 kb upstream of the exon coding for the B1b domain. The 1CM exon is expressed in a human mast cell line, in a human basophilic cell line, cord blood derived mast cells as well as in bone marrow mononuclear cells (Shiohara et al., 2009). The human 1CM exon does not have sequence similarity to the mouse 1MC exon (Shiohara et al., 2009). According to these observations, the expression of the different Mitf isoforms is cell specific. In addition to the 5´ alternative forms of Mitf a splice variant within the coding region of Mitf has been identified. This splicing leads to a transcript lacking 18 bp of exon 6 (exon 6a), resulting in a protein without 6 amino acids (N-ACIFPT- C) in front of the basic domain. This is called the – form whereas the full length transcript containing the 6 aa is called the + form. These two alternative MITF proteins are a result of alternative splice acceptor sites in exon 6 and both forms have been found in tissues that express Mitf (Steingrimsson et al., 1994; Yasumoto et al., 1998; Hallsson et al., 2000). The 6 aa have been suggested to stabilize the Mitf-DNA interaction as the DNA binding affinities of the two isoforms are slightly different (Hemesath et al., 1994). Fundamental differences have recently been reported between these two protein isoforms. The +form has inhibitory effects on cell proliferation (Bismuth et al., 2008) and the –form has been shown to be upregulated in melanomas (Primot et al., 2009). The Mitfmi-sp mutation, which lacks exon 6 (Steingrimsson et al., 1994), indicates the functionality of the 6 aa. Mice carrying this mutation show little phenotypic effect unless in heterozygous combination with another Mitf mutation (Hallsson

et al., 2000; Steingrimsson et al., 2003). The lack of phenotype in homozygots suggests that the – form of the protein is functional whereas the heterozygous phenotype suggests that there is a functional impairment compared to the + form. It should be noted, however that most tissues express both forms of the proteins, suggesting that both forms play a role.

1.4 Regulation of Mitf expression Regulation of Mitf expression is mediated through the promoter regions upstream of the nine different 5´first exons of the Mitf gene. The 1M promoter has been studied the most and binding of several different transcription factors to the 1M promoter have been confirmed. Several signaling pathways lead to the activation of Mitf expression. Wnt (wingless-type MMTV integration site family of genes) signaling leads to Mitf activating its own expression in cooperation with LEF1 (Lymphoid enhancer-binding factor 1), involving three LEF1 binding sites (Takeda et al., 2000b; Saito et al., 2002; Widlund et al., 2002). In addition, LEF1 and β-catenin can synergistically affect the expression of the 1M promoter through the LEF1 binding sites (Takeda et al., 2000b). α-MSH (α-melanocyte stimulating hormone) mediated signaling and cyclic AMP (cAMP) are important for melanogenesis (Busca and Ballotti, 2000) (Fig. 2). Binding of α-MSH to the MC1R receptor (Melanocortin 1 receptor) leads to activation of S-coupled G protein and activation of adenyl cyclase. This in turn leads to increase in intracellular cAMP synthesis. cAMP binds to subunits of protein kinase A and a catalytic subunit is released that can phosphorylate cAMP responsive element binding protein (CREB). CREB activates Mitf expression specifically in melanocytes by binding to the CRE (cAMP response element) binding sites in the 1M promoter (Bertolotto et al., 1998a; Price et al., 1998). CREB also depends on the most conserved Sox10 (SRY (sex determining region Y)-box 10) binding site, (So5 in fig. 8 in paper II), suggesting cooperation between CREB and Sox10 in producing a tissue-restricted gene expression of Mitf (Huber et al., 2003). Another transcription factor, PAX3 (paired box gene 3) can bind to the M promoter through two Pax3 binding sites, Pax3-1 (Watanabe et al., 1998) and Pax3-2 (Bondurand et al., 2000). Nine potential Sox10 binding sites are located in the Mitf 1M promoter according to the literature, and in addition, two binding sites are located downstream of the transcription start site (Lee et al., 2000; Potterf et al., 2000; Verastegui et al., 2000; Huber et al., 2003). Some of these

23 sites have been shown to have weak binding affinity (Bondurand et al., 2000) and others strong binding affinity (Lee et al., 2000). These sites potentially work together in activating Mitf expression. Two potential Sox10 binding sites are located around 12 kb upstream of the transcription start site of exon 1M (reviewed in Steingrimsson et al., 2004). It has been shown that a Onecut-2 (Oc- 2) binding site in the human 1M promoter contributes to the transcription of Mitf 1M. On the reverse DNA strand is another Oc-2 binding site which does not show functionality (Jacquemin et al., 2001). An Oc-2 site is also located around 2 kb upstream of the transcription start (reviewed in Steingrimsson et al., 2004).

Figure 2. The α-MSH signaling pathway. α-MSH signaling in melanocytes leads to activation of Mitf transcription by CREB protein binding to the CRE binding site in the M promoter. Binding sites for Pax3 and the most conserved Sox10 binding site are shown. α-MSH: α melanocyte stimulating hormone, MC1R: Melanocortin 1 receptor, cAMP: cyclic AMP, PKA: protein kinase A, CRE: cAMP response element.

In addition, a potential interleukin 6-responsive element (IL6-RE) and two potential GATA transcription factor binding sites have been located in the Mitf 1M promoter (Fuse et al., 1996). The functional importance of the IL6-RE site

has not been verified. Previous studies have shown that all the above-mentioned sites, except GATA-G1, are of functional importance.

1.5 Post-translational modifications Mitf is expressed in many cell types where it has various roles, Mitf is expressed in melanocytes, RPE, mast cells, osteoclasts and other cell types, and recently has been identified as a “lineage survival gene” in melanoma (Garraway et al., 2005). The diverse roles of Mitf in the development of different cell types and its involvement in melanoma suggests that expression of Mitf must be highly regulated. In addition to regulation through the nine different 5´ exons in the Mitf gene, post-translational modifications of the MITF protein affect its function. The MITF protein is phosphorylated at at least four sites, Ser73, Ser298, Ser307 and Ser409. Some of these modifications affect protein stability and transcriptional activation, depending on which Serine residue is phosphorylated (Hemesath et al., 1998; Wu et al., 2000; Takeda et al., 2000a; Mansky et al., 2002b). The Kit-signaling pathway where the Kit receptor (C-Kit, cytokine receptor) is activated by Scf (stem cell factor) leads to activation of the MAP kinase pathway where activated ERKs (Extracellular signal-regulated kinases) phosphorylate Ser73 in MITF (Hemesath et al., 1998). Phosphorylation of MITF at Ser409 through p90RSK (p90 ribosomal S6 kinase) leads to ubiquitin mediated degradation of MITF (Xu et al., 2000; Wu et al., 2000). Mitf has several potential acetylation sites and is possibly acetylated by the histone acetyltransferase p300/CBP (CREB binding protein) (Steingrimsson et al., 2004; Hallsson et al., 2007). Ubiquitination at Lys201 marks MITF for degradation (Xu et al., 2000) and MITF can be sumoylated at two sites, Lys182 and Lys316 (Miller et al., 2005; Murakami and Arnheiter, 2005). The STAT3 (Signal transducer and activator of transcription 3) inhibitor PIAS3 (protein inhibitor of activated STAT) can block the DNA binding activity of MITF both through sumoylation (Levy et al., 2002; Miller et al., 2005) and also independent of sumoylation (Hikata et al., 2009). Cleavage at Asp345 by caspases has been suggested to lead to pro-apoptotic effects in melanoma cells through a production of a C-terminal fragment (Larribere et al., 2005). What the exact roles of these modifications are in MITF function remains to be determined. However, it is clear that post-translational modifications play an important role in MITF protein function.

25 1.6 The Mitf gene in vertebrates and invertebrates Since the observation of the first Mitf mutant mouse in 1942, the cloning of the Mitf gene in mouse (Hodgkinson et al., 1993; Hughes et al., 1993) and human (Tachibana et al., 1994), Mitf has been identified in various species, either by sequence comparison or from mutational analysis. To date, the Mitf gene has been identified in at least 40 species according to the Ensembl database (www.ensembl.org) in both vertebrates and invertebrates. The Mitf gene shows considerable conservation and in many cases a conserved role, at least partly. In mammals and birds, one Mitf gene has been identified that uses several alternative promoters to produce different mRNAs, possibly with different roles (Altschmied et al., 2002). In several other species, two Mitf genes have been identified. Two Mitf genes have been identified in zebrafish (Danio rerio), namely, the nacre/mitfa gene which is important for development of neural crest melanocytes (Lister et al., 1999) and mitfb, which is expressed and may play a role in the developing RPE development (Lister et al., 2001). In general, teleost fish have more duplicated genes than other vertebrate species which is likely to have happened after teleost fish diverged from other vertebrates, 100-120 million years ago (Altschmied et al., 2002). This mechanism of using two alternative Mitf genes in zebrafish seems to be an alternative way of executing several roles as performed by the different variants transcribed from one Mitf gene in other species like mouse and human (Altschmied et al., 2002). Two genes have also been identified in the frog Xenopus laevis (Kumasaka et al., 2004), the freshwater pufferfish Fugu rubripes, Tetraodon nigroviridis (Altschmied et al., 2002) and the small aquarium fish Xiphophorus (Altschmied et al., 2002). Both the gene sequence and the roles of Mitf in these species are conserved, at least partly. Phenotypes caused by Mitf mutations in other species than mouse and humans show that the function of the gene is conserved. Rats homozygous for the mib mutation are depigmented, have microphthalmia, osteopetrosis and neurological defects (Opdecamp et al., 1998). Melanophores are lacking in a nacre homozygous mutant zebrafish whereas the RPE is normal (Lister et al., 1999). The two homologues in Xenopus laevis, XlMitfalpha and XlMitfbeta show high sequence similarity to the mouse M and A forms that are preferentially expressed in melanocytes (M-form) and the retinal pigment epithelium (A-form) (Kumasaka et al., 2004).

Mitf-like genes have been identified in several invertebrates, using sequence comparison including Caenorhabditis elegans, (Rehli et al., 1999) and the ascidian Halocynthia roretzi, which is functionally most similar to the mouse Mitf A form (Yajima et al., 2003).

1.7 Evolution of the eye Because of their different morphology and physiology, eyes were originally believed to have evolved independently 40-60 times in animals. Genetic experiments have now shown that eyes most likely originated from a single photosensitive cell that through time evolved to more complex eye structures (reviewed in Gehring, 2005). There are three different types of eyes found in animals, the camera-type eye, the compound eye and the mirror eye (reviewed in Gehring, 2005). Vertebrates and several other species have camera-type eyes that form an image on the retina. The photoreceptor cells in the retina, the rods and cones subsequently send signals to the brain through the optic nerve. Many insects like Drosophila have compound eyes that are composed of ~750 separate photoreceptors (ommatidia) (Roignant and Treisman, 2009). Mirror eyes, found in scallops and a few deep-sea crustaceans, form images using mirrors and reflect the image to focus at a central point in the retina (Land, 2005). There is considerable gene conservation found between the different eye types. The highly conserved Pax6 (paired box gene 6) gene, a retinal transcription factor is shown to play a critical role early in eye formation both in insects and vertebrates. When the mouse Pax6 gene or its homolog in other species is missing, the eye develops abnormally or the eye is lost (Halder et al., 1995). The Pax6 homolog in the fruitfly, the Eyeless (ey) gene, is able to induce the formation of ectopic eyes on the antennae, legs and wings of Drosophila, when overexpressed in these tissues. The Pax6 gene was shown to be critical for early eye development in insects and mammals (Halder et al., 1995). Other genes important for eye development have also been shown to be conserved and have conserved function between and Drosophila and vertebrates (reviewed in Wawersik and Maas, 2000; Donner and Maas, 2004). In many cases several homologs are found for each gene family. The Drosophila genes ey, twin of eyeless (toy) and eye gone (eyg) are homologs of Pax6. The Drosophila genes sine oculis (so), optix and D-six4 are homologous to six vertebrates genes, Six1- 6. For the Drosophila gene eyes absent (Eya) there are four homologs found in vertebrates, Eya1-4 and for dachshund (dac) two homologs have been found, Dach1 and Dach2 (reviewed in Donner and Maas, 2004).

27 Pigmented cells are found in the eye. Even the most primitive eyes are associated with dark pigment and they are usually located in cells close to the light absorbing photoreceptor cells (Gehring, 2005). The role of pigment in the eye is to shield the photoreceptors cells from light from one direction and not another, thus enabling the eye to detect the angle of incoming light (reviewed in Bharti et al., 2006). Simple eye structures are found for example in the eye of the flatworm Planaria torva which has three photoreceptor cells and one pigment cell. The planarian species Polycelis auricularia has multiple eyes that each consist of one photoreceptor cell and one pigment cell (reviewed in Gehring, 2005). The tadpole larvae of ascidians have two melanin-containing pigment cells, an anterior pigment cell (the otolith) and a posterior type (the ocellus) in a sensory vesicle where homologs of Pax6 and Otx are expressed. The pigment cell precursors in the neural fold express lineage-specific melanogenesis genes and the pigment cells are thought to be evolutionarily homologous to vertebrate RPE cells. A cell population corresponding to vertebrate melanocytes, is however, absent (reviewed in Yajima et al., 2003).

1.8 Eye development in vertebrates The vertebrate eye starts to develop morphologically when the optic vesicle forms with an outpouching of the diencephalon. The optic vesicle contacts the head ectoderm with a subsequent thickening of the lens placode and formation of a lens vesicle that later becomes the lens (reviewed in Wawersik and Maas, 2000). At the same time the optic vesicle folds inwards and forms an optic cup that surrounds the lens vesicle (reviewed in Wawersik and Maas, 2000). The optic cup later partitions into three regions, a distal region that becomes the future retina, a proximal region that gives rise to the optic stalk/optic nerve and a dorsal region that becomes the RPE layer (Fig. 3A). The retina contains the photoreceptors that receive light and send signals to the brain. The RPE layer located adjacent to the retina absorbs the light, not detected by the photoreceptors, forms a blood/retina barrier and is also thought to provide nutritional support to the retina (Bharti et al., 2006). The RPE layer is also thought to be involved in the morphogenesis of the neural retina. If the RPE is ablated, laminar organization of the cells is prevented or lost (Raymond and Jackson, 1995). On their apical side the RPE cells have multiple villi that make direct contact with the photoreceptors (reviewed in Bharti et al., 2006). The RPE is thought to supply signaling molecules that participate in proper patterning and maintenance of the vertebrate retina. It has been shown that factors secreted by the RPE positively

influence the development and maintenance of normal retinal morphology (Gaur et al., 1992; Sheedlo et al., 1992; Sheedlo and Turner, 1998; Jablonski et al., 2000).

1.9 Mitf expression and function in the vertebrate eye In the mouse, Mitf expression is first detected early during eye development at embryonic day 9.5 (E9.5), in the whole optic vesicle that gives rise to both the retina and the retinal pigmented epithelium (RPE layer). At embryonic day 10.5 (E10.5) the expression is restricted to the proximal part of the optic vesicle (Nguyen and Arnheiter, 2000). At the cup stage, Mitf has been excluded from the neural retina and is later restricted to the retinal pigment epithelium (Hodgkinson et al., 1993; Nakayama et al., 1998; Nguyen and Arnheiter, 2000), the ciliary body and the iris (Bora et al., 1998; Nguyen and Arnheiter, 2000) . Early in development expression of the transcription factors Pax6 and Pax2 (paired box gene 2) is observed in the developing eye along with Mitf expression and later as Mitf is located in the RPE, Pax6 is restricted to the retina and Pax2 in the optic stalk (Baumer et al., 2003). Several Mitf mutations causes abnormal eye development resulting from defects in the retinal pigmented epithelium (RPE). In the mouse, the RPE becomes unpigmented, hyperproliferates and takes on a neuroretinal fate and a second retina develops (Nakayama et al., 1998; Bumsted and Barnstable, 2000; Nguyen and Arnheiter, 2000). This is an example of transdifferentiation. When Mitf is upregulated in the retina it can direct the development towards a RPE layer (Rowan et al., 2004; Horsford et al., 2005; Bharti et al., 2006). Recently, it was shown that in vivo, Mitf regulates differentiation and cell proliferation in the RPE layer (Tsukiji et al., 2009). Mitf regulates cell proliferation negatively, directly through regions in the 5´sequence of the cell cycle regulator p27Kip (cyclin-dependent kinase inhibitor 1B) gene (Tsukiji et al., 2009). Recently, Bharti et al., (2008) analyzed which Mitf splice variants are expressed during mouse eye development (Bharti et al., 2008). Five of the nine Mitf first exons, A, J, H, D and M were detected during eye development, with different expression patterns (Bharti et al., 2008). It is clear that Mitf expression is temporally regulated during eye development. Both the future retina and future RPE continue to express the A and J forms during eye development. However, the H and D form seem to be more important for normal eye development than the other isoforms found in the eye. Upregulation of the H and D forms leads to reduced cell proliferation and abnormal pigmentation in the retina (Bharti et al.,

29 2008). In the RPE, the D and H forms are detected at the earliest time point, starting at E10.5 and are detected until time point P0 (post natal day 0, day of birth) (Bharti et al., 2008). In a mouse mutant (Mitfmi-rw) where exons 1H, 1D and 1B are missing, the RPE layer develops abnormally, either by transdifferentiation into a laminated second retina or by acquiring abnormal foldings (Bharti et al., 2008).

Figure 3. Eye development in vertebrates and in Drosophila. A. Eye development in vertebrates. The optic cup folds invards and partions into three areas, the NR, RPE and ON. The lens forms from an inward folding from the ectoderm, OC: optic cup, RPE: retinal pigment epithelium, NR: neural retina, ON: optic nerve, L: lens. B. Eye development in Drosophila. Eye antennal discs are shown in black and a timeline indicating developmental time. Red lines represent the morphogenetic furrow (MF) and black circles posterior to the MF are developing photoreceptors. Above is a schematic figure showing how the disc is two-layered, DP: Disc proper, PL: Peripodial layer and the lumen in between with extensions connecting the layers.

Interestingly, Chx10 (ceh-10 homeodomain containing homolog) which is known to target Mitf and lower its expression (Horsford et al., 2005) shows

strong affinity to the Mitf H and D promoters but low affinity to the Mitf A promoter (Bharti et al., 2008) indicating a direct regulation. In a Chx10 mutant, where pigmentation in the retina is abnormal and proliferation is reduced, the Mitf H and D forms are detected at higher levels (Bharti et al., 2008).

1.10 Eye development in Drosophila The development of the fruitfly (Drosophila melanogaster) occurs in several different stages, the embryonic stage, the 1st, 2nd and 3rd instar larval stages, pupal stage and the adult stage. During the pupal stage the larval tissues go through morphogenesis where they change into the adult structures. The adult Drosophila eye is a compound eye, composed of ~750-800 ommatidia. Each ommatidium is arranged identically with eight photoreceptor cells (R1-R8), four cone cells and two pigment cells that are surrounded by 2° and 3° pigment cells. The photoreceptors project axons into the optic lobes of the brain (reviewed in Roignant and Treisman, 2009). The outer photoreceptors R1-R6 are required for motion detection and the inner, R7-R8, are needed for colour, detection of polarized and UV light as well as for orientation (Erclik et al., 2009). Differentiation of the ommatidia starts in the 3rd instar larval stage when an “indent”, the morphogenetic furrow (MF), appears at the posterior end of the eye-antennal disc (reviwed in Roignant and Treisman, 2009). The MF sweeps across the eye disc towards the anterior end leaving differentiating photoreceptors behind (Fig. 3B). Undifferentiated proliferating cells are located anterior to the MF (reviewed in Erclik et al., 2009). The genetic pathway that controls Drosophila eye development is a complex network of genes involving feedback loops between the genes as well as binding of some of the proteins to their own promoter (reviewed in Kumar, 2009). The genetic pathway includes the Pax6 homolog ey which is at the 3rd instar larval stage only expressed anterior to the MF where undifferentiated cells are located (reviewed in Kumar, 2009). In the anterior area closest to the MF these genes induce the expression of the Six family member sine oculis (so) a homeobox transcription factor important for cell proliferation (reviewed in Wawersik and Maas, 2000; Kumar, 2009). Ey also targets Optix, another retinal determinant gene of the same family as so (reviewed in Kumar, 2009). In the anterior area closest to the MF, ey and decapentaplegic (dpp), a growth factor of the TGFβ family, induce expression of eyes absent (eya), a co-activator that with so is important for regulation of tissue growth and cell specification (reviewed in Wawersik and Maas, 2000; Kumar, 2009). Subsequently, genes involved in the initiation and progression of the MF are activated, including Hedgehog (hh) and dachsund (dac) activated by so, ey and eya (reviewed in Wawersik and Maas, 2000;

31 Kumar, 2001). Posterior to the MF, photoreceptors are differentiating, a process involving signaling molecules activated by hh, including dpp and the bHLH transcription factor atonal (ato). These signaling molecules drive the photoreceptor differentiation that starts with the R8 photoreceptor. The R8 photoreceptor secretes the EGFR (Epidermal growth factor receptor) ligand, Spitz and the Notch ligand Delta and recruits the surrounding cells to differentiate as well (reviewed in Roignant and Treisman, 2009). The larval tissues that develop into some of the external parts of the fly, including the adult eye, antenna, wing and leg are called imaginal discs. During morphogenesis the discs evert in a way so that the appendages lie on the external surface of the adult fly (reviewed in Gibson and Schubiger, 2000; Atkins and Mardon, 2009). The eye-antennal imaginal disc that gives rise to both the adult fly eye, antennae and associated head structures, is a sac-like two-layered epithelium with a disc lumen in between (reviewed in Cho et al., 2000). The two layers are a columnar “disc proper” (DP) cell layer which gives rise to the retina and a cuboidal peripodial cell layer (PL), that forms the cuticle or epidermis (Fig. 3B). The peripodial layer was previously only thought to take part in the morphogenesis process (reviewed in Cho et al., 2000). It has now been shown that proteins necessary for the development and growth of the disc proper, such as Hh, Wingless (Wg) and Dpp are mainly expressed and secreted by peripodial cells prior to neurogenesis (Cho et al., 2000). Microtubules-based cellular extensions that cross the lumen between cell layers and appear to be necessary for proliferation and/or neurogenesis have been reported (Gibson and Schubiger, 2000; Cho et al., 2000). Peripodial cell survival is dependent on Dpp and Dpp has been detected in the lumen (Gibson et al., 2002). Similar signaling between cell layers is found in the vertebrate eye where BMP4 (Bone morphogenetic protein 4) signaling between optic vesicle and surface ectoderm is important for lens induction (Furuta and Hogan, 1998). This functional similarity might indicate conserved function for the RPE and PL.

1.11 Melanocytes There are two kinds of pigment cells found in vertebrates, the melanocytes derived from the neural crest (NC) and the pigment cells located in the retinal pigment epithelium (RPE), derived directly from the optic neuroepithelium (see references in Bharti et al., 2006). The cells of the neural crest differentiate into many cell types including most of the peripheral nervous system, facial skeleton

and pigment cells (reviewed in Bronner-Fraser, 1994). These cells originate during early embryonic development in the dorsal neural tube. Melanoblasts, the cells that develop into melanocytes, are found in an extracellular area, the Migration Staging Area (MSA), between the somite and the dorsal neural tube. From the MSA, melanoblasts migrate along the dorsolateral pathway between the somites and ectoderm to their destinations (reviewed in Thomas and Erickson, 2008). The cells start migrating from the neural crest at embryonic day E9-9.5 and the melanoblasts invade the epidermis and dermis at E16.5 where they differentiate into melanocytes (reviewed in Thomas and Erickson, 2008). Neural crest derived melanocytes are found in several locations including the skin, hair follicles, inner ear, iris and the choroid of the eye (Ganss et al., 1994). Melanocytes produce melanin in order to protect the skin from damage caused by UV-radiation, a process called the tanning response. Melanin is transported in melanosomes from the melanocytes to the adjacent keratinocytes were it protects the skin (reviewed in Mitra and Fisher, 2009). Melanin is believed to absorb free radicals from the cytoplasm and thereby protect the skin (reviewed in Cui et al., 2007). Melanin production starts when UV-radiation leads to the expression of the pro-opiomelanocortin (POMC) gene in keratinoncytes. Recently, it was shown that the expression of POMC is activated by the tumor-suppressor p53 (Cui et al., 2007). α-MSH, a cleavage product of POMC, is released from the keratinocytes and binds to the MC1R receptor on the surface of the melanocytes. In the melanocytes, adenyl cyclase is activated resulting in increased cAMP levels that in turn activate CREB expression. CREB is able to bind to the Mitf promoter, activating its expression (Price et al., 1998) which subsequently targets several pigmentation genes, including Tyrosinase (Tyr), Tyrosinase- related protein 1 (Tyrp1) and 2 (TYRP2/ dopachrome tautomerase, DCT) and therefore increased pigmentation occurs in the skin (Hemesath et al., 1994; Levy et al., 2006; Yasumoto et al., 1994). Many genes have been shown to influence melanin biosynthesis and melanosome biogenesis, and therefore contribute to the variation of skin, hair and eye colour (Sturm, 2009). The amount and type of melanin pigment, eumelanin (black to brown pigment) and pheomelanin (yellow to reddish-brown pigment) are the main determinants of pigmentation. These two types of melanin are derivatives of DOPAquinone which is produced by the tyrosinase enzyme (reviewed in Ito and Wakamatsu, 2008). Variants in the MC1R gene are also a major factor in skin pigmentation variation in Caucasian populations, resulting

33 in red hair, fair skin and increased risk of skin cancer, both non-melanoma and melanoma (Raimondi et al., 2008).

1.12 Mitf expression during development Mitf expression is first detected in the eye (see chapter 1.9). In mice, Mitf positive cells are detected in the neural crest (cephalic neural crest) around embryonic stage 10 (E10) and at E10.5 these cells have started migrating (Nakayama et al., 1998). At E12.5 Mitf positive cells are located in the epithelial layer and at E16.5 in the dermis and epidermis as well as in the future choroid and iris pigment cells behind the optic cup. In addition, they are located in the area that becomes the stria vascularis of the inner ear (reviewed in Nakayama et al., 1998; Tachibana, 2000). After birth, Mitf is mostly found in the hair follicles (Nakayama et al., 1998; Tachibana, 2001). In adults, Mitf expression is found in several cell types, in humans in the melanocytes of the skin and hair and in mice in the hair but not the skin. Mitf expression is found in osteoclasts (Weilbaecher et al., 1998; Mansky et al., 2002a) and in mast cells (reviewed in Kitamura et al., 2002; Steingrimsson et al., 2004). Mitf is expressed in the heart and is detected at low levels in skeletal muscle (Hodgkinson et al., 1993). Mitf expression is also detected in whisker follicles and in the choroid of the eye (Hodgkinson et al., 1993; Nakayama et al., 1998). A melanocyte stem cells niche located in the hair bulge was recently identified (Nishimura et al., 2002). Mitf positve cells are located in the the hair bulge and defective melanocyte stem cell maintenance was reported to cause hair graying (Nishimura et al., 2005).

1.13 Roles of Mitf The role of Mitf in the development of melanocytes and involvement in melanoma progression has been studied extensively. From these studies it is clear that Mitf can play multiple roles and the role it plays may depend on the environment and various factors that affect Mitf regulation. Mitf is important for the survival of early melanoblasts when they emigrate from the neural tube (Hornyak et al., 2001) and during their migration Mitf is also necessary for the cells to stay committed to the melanocyte lineage as well as their proliferation and survival (Opdecamp et al., 1997). Melanoblast differentiation into melanocytes is regulated by Mitf which activates melanocyte determinants (reviewed in Steingrimsson et al., 2004). The roles that have been identified so far for Mitf include differentiation (pigmentation), pro-survival, pro-

proliferation, anti-proliferation and involvement in melanoma progression (reviewed in Mitra and Fisher, 2009).

1.13.1 Differentiation Mitf is necessary for normal melanocyte development and pigmentation as is seen by the phenotype of Mitf mutants (Hodgkinson et al., 1993). In the Mitf null mutant, (Mitfmi-vga9), homozygous mice exhibit microphthalmia and are white due to loss of melanocytes in the skin and hair. These mice are completely without pigmentation and melanin production is absent in the stria vascularis (Tachibana et al., 1992). Heterozygous Mitfmi-vga9 mice, on the other hand, are pigmented and eyes and the inner ear are normal (Tachibana et al., 1992). Other Mitf mutations have various effects on pigmentation and can be arranged in an allelic series (see chapter 1.2.) (reviewed in Steingrimsson et al., 2004). Mitf regulates melanocyte differentiation by activating expression of other known melanocyte determinants including enzymes involved in pigmentation, such as, Tyrosinase (Tyr), Tyrosinase-related protein-1 (Tyrp-1) and DCT/Tyrp-2 (Yasumoto et al., 1994; Yasumoto et al., 1997). A number of other Mitf target genes have been identified that function in melanocytes and the pigmentation process including Silv (PMEL17/gp100) and MLANA (Melan-A/Mart-1) genes, which both are involved in melanosome biology (Du et al., 2003). Recently, 71 new potential Mitf target genes were identified (Hoek et al., 2008b) and of these newly identified genes, three (LYST, PSEN2 and HPS4) have been linked to pigmentation and six have been shown to be involved in melanoma (Hoek et al., 2008b). At least seven of the genes contain the Mitf binding motif, the E-box within their upstream regions (MBP, TNFRSF14, IRF4, RBM35A, PLA1A, APOLD1 and KCNN2) and are therefore very likely Mitf target genes (Hoek et al., 2008b).

1.13.2 Survival and protection from apoptosis Mitf is necessary for the survival of early melanoblasts when they emigrate from the neural tube and immediately afterwards. Melanoblasts will not differentiate into melanocytes if Mitf is missing (Hornyak et al., 2001). During their migration, Mitf is also necessary for the cells to stay committed to the melanocyte lineage as well as their proliferation and survival (Opdecamp et al., 1997). A direct target of MITF is the anti-apoptotic factor Bcl2 (McGill et al., 2002). Interestingly, homozygous mice mutant for Bcl2 (Bcl2-/-) show disrupted pigmentation, as they turn gray in the second hair follicle cycle (Veis et al., 1993). This is very similar to the phenotype resulting from the Mitfvit mutation

35 mentioned earlier (chapter 1.2), were Mitfvit mutants loose their pigmentaion as they age (Lerner et al., 1986; Steingrimsson et al., 2004). Both of these genes MITF and Bcl2 are required for melanocyte and melanoma survival (McGill et al., 2006; McGill et al., 2002). Later it was however shown that the Bcl2-/- mutant mice lose melanocyte number before the appearance of MSCs and that Bcl2 was needed for the emergence of the MSCs rather then their survival in this mutant (Mak et al., 2006). Recently, it was shown that Mitf protects melanocytes from UV-induced apoptosis and the amount of Mitf in the cells is important for this protection (Hornyak et al., 2009). Mice heterozygous for the Mitfmi-Wh and Mitfvga9 mutation, have reduced amount of Mitf and are more sensitive to UV-radiation than wild type cells. This sensitivity was not due to the amount of melanin in the cells, rather to the amount of Mitf within the melanocytes (Hornyak et al., 2009). Higher levels of MITF lead to survival and lower levels of MITF shift the cells to apoptosis (Hornyak et al., 2009) (see fig. 4 for a model of the role of MITF levels in melanocytes and melanoma). It was also shown that in addition to regulating Bcl-2 expression levels, MITF regulates the expression of the pro- apoptotic protein Bad (BCL2-associated agonist of cell death) (Hornyak et al., 2009). The ratio of Bad/Bcl-2 is a determining factor in regulating survival vs. apoptosis and it has been proposed that a higher Bad/Bcl-2 ratio enhances apoptosis in cells with low Mitf levels (Hornyak et al., 2009). Mutations in both Mitf (Nishimura et al., 2005) and Bcl2 (Veis et al., 1993) result in gradual loss of pigmentation in the hair and both of these genes are important for melanocyte stem cell emergence and survival in the hair bulge (Nishimura et al., 2005). Another direct target of MITF is the pro-survival gene Hif-1α (hypoxia inducible factor 1, alpha subunit) and this regulation of Hif-1α leads to increased VEGF (Vascular Endothelial Growth Factor) expression, important for melanoma cell survival (Busca et al., 2005). Cleavage of the MITF protein by caspases has been suggested to lead to pro- apoptotic effects in melanoma cells (Larribere et al., 2005). Furthermore, involvement of MITF in protecting melanocyte from apoptosis is by direct binding to the promoter of the c-met (met proto-oncogene) receptor tyrosine kinase that has been shown to regulate growth, motility and invasion in many cell lines (McGill et al., 2006). It has been shown that Hepatocyte Growth Factor (HGF) protects melanocytes and melanoma cells from apoptosis by binding to the c-met receptor (Beuret et al., 2007) and stimulation of primary

melanocytes with HGF also leads to phosphorylation of MITF through the MAPK (mitogen-activated protein kinase) pathway (McGill et al., 2006) in addition to its direct binding of the c-met promoter (McGill et al., 2006). Thus, it seems fairly well established that Mitf mediates effect on cell survival through various different measures.

1.13.3 Anti-proliferation Mitf seems to be able to play a role in both cycle arrest, necessary for differentiation, as well as cell cycle progression. MITF induces cell cycle arrest by activating cell cyclin dependent kinase inhibitors p16INK4a (cyclin-dependent Cip kinase inhibitor 2A) (Loercher et al., 2005) and p21 (cyclin-dependent kinase inhibitor 1A) (Carreira et al., 2005). p16 is a tumor suppressor protein that causes G1 cell cycle arrest through hyperphosphorylation of Retinoblastoma protein (Rb) which is necessary for melanocyte cell cycle arrest and differentiation (Loercher et al., 2005). In addition, Rb is often found mutated in cancer (reviewed in Mitra and Fisher, 2009). The cell cycle arrest induced by p21Cip is mediated by MITF binding directly to the promoter of p21Cip in cooperation with the retinoblastoma protein Rb1 (Carreira et al., 2005).

1.13.4 Pro-proliferation MITF targets several genes involved in proliferation. Tbx2 (T-box 2) is a pro- proliferation gene targeted by MITF (Carreira et al., 2000) that is necessary for maintaining proliferation and suppressing senescence (Vance et al., 2005). TBX2 prevents cell cycle arrest by maintaining low p21 levels (Vance et al., 2005). Another MITF target gene is CDK2 (cyclin-dependent kinase 2), a cell cycle regulator during G1-S phase transition and S-phase progression (Du et al., 2004) that has been shown to be important for melanoma proliferation. Without CDK2 the melanoma cells go into G1 arrest (Du et al., 2004). Furthermore, MITF activates expression of the DIAPH1 gene that encodes the diaphanous- related formin Dia1 protein, involved in reorganizing the actin skeleton (Carreira et al., 2006). MITF promotes proliferation by activating DIAPH1 gene expression that subsequently leads to degradation of the cell cycle regulator, p27Kip via Dia1, resulting in G1 cell cycle arrest. (Carreira et al., 2006). This connection of MITF and Dia1 also involves regulating the invasive potential of melanoma cells. In melanoma cells high levels of MITF lead to decreased invasiveness whereas lower levels of MITF lead to downregulation of Dia1 resulting in increased invasiveness (Carreira et al., 2006). MITF clearly has

37 multiple roles in both melanocytes and melanoma cells depending on the environment and cell-specific signaling factors.

1.14 Melanoma Malignant melanoma is like other types of cancer, caused by genetic or molecular changes that give the cells a growth and survival advantage over normal cells (reviewed in Miller and Mihm, 2006). It is known that the regulation of melanocyte proliferation and death pathways are deregulated in melanoma (reviewed in Mitra and Fisher, 2009). Proliferation and survival genes may become dominant and developmental genes re-expressed. Melanocytes have, during their development, the ability to migrate to their destinations from their origin in the neural crest. It is possible that melanoma cells re-acquire this ability to migrate, therefore allowing the cells to metastasize to distant sites. The genes involved in this process, as well as genes important for survival and proliferation might be expressed again (reviewed in Mitra and Fisher, 2009). At the same time, expression of genes involving the differentiation and pigmentation process might be decreased. The incidence of cutaneous melanoma has increased rapidly. In the last decade the incidence for women has increased by 4% and 5% for men annually in the last decades (Cornish et al., 2009). The incidence of melanoma is highest in northern and western European contries. In Europe the incidence rate for men and women combined is estimated to be 6.7 per 100.000 people per year, compared to the world incidence of 2.8 per 100.000 people (Ferlay et al., 2010). In Iceland the rate is even higher or 11.7 per 100.000 people and the rate is higher for women (14.8) compared to men (8.9) (Ferlay et al., 2010). The mortality rate is similarily higher in Europe (1.4) compared to the world (0.6) and even higher in Iceland with the rate of 3.2 per 100.000 people (Ferlay et al., 2010). The estimates are from Globocan 2008, available at http://globocan.iarc.fr. When diagnosed early, prognosis is good but declines rapidly for more advanced melanoma (Tsao et al., 2004). Five year survival for intermediate thickness melanoma (1-4 mm in depth) ranges from 63%-89% but is only 33%-55% for melanoma thickness over 4 mm (reviewed in Anger et al., 2010). When the growth of melanoma transits from radial growth to vertical growth the cancer becomes more aggressive (reviewed in Anger et al., 2010) and when melanoma has metastasized to the lymph nodes, survival rates are only 20-40% (Cornish et al., 2009). Sun exposure and sunburn history have been linked to melanoma

formation in epidemiological studies (Gandini et al., 2005) and ultraviolet light (UV) is the main cause in melanoma (reviewed in Palmieri et al., 2009). UV light is composed of UVA and UVB rays that both can cause DNA damage (indirectly and directly, respectively) (Eide and Weinstock, 2005).

1.15 MITF in melanoma Many genes have been linked to melanoma initiation and progression, including MITF. Human tumors where members of the Mitf-Tfe family of transcription factors (Mitf, Tfe3 or TfeB) are deregulated, include melanoma, clear cell sarcoma, papillary renal cell carcinomas and alveolar soft part sarcoma (Davis and Fisher, 2007). Consistent with the different cellular functions MITF is involved in and its essential role in melanocyte development, the role of MITF in melanoma is complex and most likely varies depending on other factors involved in melanoma. Expression of MITF and its target genes is seen in many melanoma cells (Vachtenheim and Novotna, 1999) and loss of MITF expression and its target genes has been reported in a subset of melanoma cell lines (Vachtenheim et al., 2001). The MITF protein levels have been found to be important for melanocytes and melanoma cells. A model of how the levels of MITF are involved in the cellular function has been proposed (Wellbrock and Marais, 2005; Carreira et al., 2006) (Fig. 4). According to the model, high levels of MITF direct the cells towards cell cycle arrest and differentiation (pigmentation) important for normal melanocyte function. Medium levels of MITF direct the cells towards survival and proliferation, important for melanocyte development and for the progression of melanoma. Low MITF levels are associated with cell cycle arrest (Du et al., 2004) and apoptosis (McGill et al., 2002). As mentioned above, one of the known MITF targets is the cell survival factor Bcl2 (McGill et al., 2006; McGill et al., 2002) and MITF has been shown to be involved in stimulating invasive growth potential of melanocytes and melanoma cells downstream of HGF and its receptor c-met (McGill et al., 2006). Another link between MITF and invasiveness is through targeting Dia1 (Carreira et al., 2006), were low levels of MITF lead to increased invasiveness and high levels of MITF reduce invasive abilities of the melanoma cells (Carreira et al., 2006). Consistent with this model, significantly increased levels of MITF reduce melanoma cell proliferation and tumorigenicity (Selzer et al., 2002; Wellbrock and Marais, 2005). Also consistent with this, less MITF is expressed in

39 melanoma cells than in normal melanocytes (Wellbrock and Marais, 2005). Lower expression of MITF has accordingly been correlated with metastasis and poor patient survival (Salti et al., 2000).

Figure 4. MITF protein levels in melanoma. A model has been proposed on how MITF protein levels affect the cellular functions of melanocytes and melanoma cells. High levels direct the cells towards differentation/pigmentation, medium levels towards proliferation and survival and low levels towards apoptosis (Wellbrock and Marais, 2005; Carreira et al., 2006).

The MITF gene has been identified as a “lineage survival oncogene”, as continued expression of MITF is essential for melanoma cell survival and proliferation (Garraway et al., 2005). Amplification of the MITF gene was identified in 6 melanoma cell lines from the NCI60 cell line panel and in 21% of metastatic melanoma tumors but not in benign nevi (Garraway et al., 2005). Analyzing approximately 200 tissue specimens confirmed MITF amplification in metastatic melanoma samples (15.2%) and its absence in benign nevi. The amplification correlated with metastatic disease and decreased 5 year survival as well as resistance to chemotherapeutic agents (Garraway et al., 2005). MITF amplification was confirmed in another study but resistance to chemotherapy was not observed (Ugurel et al., 2007). MITF copy number analysis can be used as a potential diagnostic marker for the metastatic state in melanoma (Ugurel et al., 2007). Other reports find MITF overexpression to result in cell cycle arrest and differentiation towards melanocytes (Wellbrock and Marais, 2005; Loercher et al., 2005). This contrast in the effects of MITF might be explained by the fact that in an analysis of the NCI60 cell lines that displayed amplification of the MITF gene also exhibited inactivation of the p16/CDK4/Rb pathway and BRAF (v-raf murine sarcoma viral oncogene homolog B1) mutation (Kubo et al., 1999;

Garraway et al., 2005). This inactivation allows melanoma cells to escape cell cycle arrest and stay in a proliferation/survival state necessary for melanoma cells (Loercher et al., 2005; Garraway and Sellers, 2006). Melanomas are a heterogeneous collection of cells which might explain their resistance to therapeutic measures. Recently, two transcription signatures were identified in melanoma cell lines, which can be called invasive and proliferative melanoma signatures. Clearly, however, the proliferative cells that are less motile, can switch between these two states. MITF expression was central to the proliferative cells but absent from the invasive cells (Hoek et al., 2006; Hoek et al., 2008a). The suggestion has been made that MITF might be the switch that determines proliferative status. Clearly, the roles that MITF can play in melanoma progression are complex. Accordingly, regulation of MITF expression in melanocytes and melanoma cells is extremely important and the cellular environment plays a crucial role. This is demonstrated well by the link between MITF and the BRAF serine threonine kinase. BRAF is a crucial protein in the ERK/MAPK kinase pathway and is important for proliferation, survival and differentiation (reviewed in Wellbrock and Hurlstone, 2010). Mutations in BRAF are found in 59% of melanoma cell lines and in 6 out of 9 primary melanomas (Davies et al., 2002). The most common BRAF mutation is the BRAFV600E mutation which results in a constitutively active kinase (Davies et al., 2002). The ERK/MAPK kinase pathway is an upstream activator of MITF as phosphorylated ERK phosphorylates the MITF protein at Ser73, resulting in a more active but less stable MITF protein (Wu et al., 2000; Xu et al., 2000). The BRAFV600E mutation is not sufficient to transform normal human melanocytes (Garraway et al., 2005). However, when MITF is overexpressed together with the BRAFV600E mutation, primary human melanocytes were transformed to melanoma cells (Garraway et al., 2005). Wellbrock and colleagues (2008), have presented a dual mechanism in which constitutively active BRAFV600E can influence MITF activity (Wellbrock et al., 2008). First, in cells with mutated BRAFV600E, the MITF protein was downregulated by degradation (Wellbrock and Marais, 2005). Second, they showed that oncogenic BRAF could also upregulate MITF expression through the transcription factor BRN2 (brain-specific homeobox/POU domain protein 2) that binds directly to the MITF promoter (Wellbrock et al., 2008). BRN2 is, however, not expressed with MITF in melanocytes (Wellbrock et al., 2008) so this is a new way of MITF regulation

41 and might be a way for allowing sufficient levels of MITF in order for the melanoma cells to survive and proliferate and at the same time prevent apoptosis (Mitra and Fisher, 2009).

1.16 MicroRNAs MicroRNAs (miRNAs) are small 17-22 nt. long non-coding RNA molecules that can regulate gene expression post-transcriptionally by binding to specific sites in the target gene´s 3´UTR sequence. The binding results in repression of translation and/or mRNA degradation. miRNAs have been proven to be involved in many different cell processes including cell-cycle regulation, differentiation, proliferation and apoptosis (reviewed in Mueller and Bosserhoff, 2009). Their roles might be to fine-tune gene expression and they therefore present an additional way to regulate genes (Ambros, 2003; Bartel and Chen, 2004). Lee and colleagues (1993) first described microRNAs when they identified the lin-4 miRNA that negatively regulates the LIN-14 (abnormal cell LINeage) gene in C. elegans (Lee et al., 1993). Since their discovery, 400 miRNA genes have been identified in the human genome and 140 in Drosophila melanogaster (reviewed in Bartel, 2009) and their link to the regulation of coding genes is being revealed. miRNAs are thought to regulate about one third of coding genes in the human genome (Lewis et al., 2005).

1.17 MicroRNA biogenesis miRNA genes are located either in intergenic regions or in introns of coding genes. The miRNA genes are often clustered together in polycistronic transcripts were they can be transcribed together (Bartel, 2004). miRNAs located in introns might also be regulated by their host gene promoter (Bartel, 2004). The miRNA genes are transcribed by RNA polymerase II, forming a long primary miRNA (pri-miRNA) molecule (Kim et al., 2005) that can consist of one or more hairpin structures (Fig. 5). The pri-miRNA is then cleaved by Drosha, an enzyme of the RNAse-III family and DGCR8, forming a 70 nt precursor-miRNA (pre- miRNA), that can fold into a stem-loop structure (reviewed in Slezak-Prochazka et al., 2010). This pre-miRNA molecule is exported to the cytoplasm by Exportin-5 in a Ran-GTPase dependent manner. In the cytoplasm, the enzyme Dicer cleaves the pre-miRNA to form a mature ~22 bp miRNA duplex molecule, consisting of a miRNA molecule that becomes the mature miRNA and a complimentary miRNA named miRNA*. Only the mature miRNA strand was

believed to be active (Tang, 2005), however recently it has been shown that the miRNA* is also active (Okamura et al., 2008).

Figure 5. The miRNA pathway. miRNAs are transcribed from genomic DNA to form a primary miRNA (pri-miRNA). The pri-miRNA is processed by Drosha to form a precursor miRNA (pre-miRNA) and transported out of the nucleus. The pre-miRNA is processed further by Dicer into a miRNA/miRNA* duplex. The RISC complex, containing an Argonaute (Ago) protein and one mature miRNA molecule, targets a binding sites in the mRNA 3´UTR sequence complimentary to the seed region of the mature miRNA. This results in either translational repression or mRNA degradation leading to less mRNA and/or protein levels in the cell.

43 One of the miRNA strands is assembled into effector complexes called miRNP (miRNA-containing ribonucleo-protein particles) that are similar to the RISC (RNA-induced silencing complex) complex used in the RNAi pathway. The Argonaute proteins 1-4 (Ago1-4) are important for the miRNA processing (reviewed in Slezak-Prochazka et al., 2010) involved in both RISC and miRNPs complexes (Carmell et al., 2002). The miRNA guides the complex to the mRNA target by base pairing with the target mRNA sequence. miRNAs bind to their 3ÚTR binding site through a seed region located at position 2-7 or 2-8 in the 5´region of the mature miRNA sequence (Lewis et al., 2003; Lewis et al., 2005; Tomari and Zamore, 2005). This binding results in the inhibition of protein synthesis and/or reduction of mRNA levels (Bartel, 2004; Lim et al., 2005). Binding outside the seed region has also been observed as well as compensatory pairing to compensate for a mismatch within the seed region (reviewed in Bartel, 2009). miRNAs can also be processed from mirtrons, short intronic hairpins resulting in formation of miRNA molecules similar to pre-miRNAs. Processing of these miRNAs does not include Drosha but includes nuclear export and subsequent processing as with other miRNAs (Ruby et al., 2007). miRNA processing can be influenced by several factors including proteins that regulate transcription, sequence variations in the miRNA genes and the genes coding for proteins involved in the miRNA processing and editing of the RNA transcripts (reviewed in Slezak-Prochazka et al., 2010). Each mRNA can be targeted by multiple miRNAs. Multiple miRNA target sites in the 3ÚTR sequence of a coding gene indicate that the mRNA is targeted by different miRNAs and its regulation might therefore be specific depending on developmental time or the tissues were the miRNAs are expressed (Rajewsky, 2006). In addition, the same miRNA can have multiple sites within the same 3ÚTR sequence which can boost target repression (Vella et al., 2004; Doench and Sharp, 2004; Rajewsky, 2006). This is also true when the binding sites are located in close proximity to each other (Saetrom et al., 2007). In many cases, several different miRNA molecules can potentially bind to the same binding site. For example the miRNAs miR-148a, miR-148b and miR-152 are different miRNAs that have the same seed region in their mature miRNA molecule and are therefore predicted to bind to the same binding sites. Which of the miRNAs binds to the binding site depends on the endogenous expression of the miRNAs. Each mature miRNA can also target many different 3ÚTR sequences (mRNAs) (reviewed in Pillai, 2005) and several miRNAs can act

cooperatively in binding the same target sequence (Krek et al., 2005) increasing the repressive effect on the target gene (Hua et al., 2006). An example of a gene regulated by a different set of miRNAs depending on the cell type is the VEGF angiogenic factor (Hua et al., 2006). In five different cell- types expressing VEGF, the miRNA expression profiles were different, specifically for the miRNAs that have potential target sites in the VEGF 3´UTR sequence (Hua et al., 2006). It has been seen that miRNAs can also bind to sequences within the coding region of genes although this is not common (Duursma et al., 2008). The discovery of miRNAs and their function has added a new level of post-transcriptional gene regulation in the cell (Bartel and Chen, 2004; Giannakakis et al., 2007).

1.18 MicroRNAs in cancer Like coding genes, miRNA genes can function as oncogenes as well as tumor suppressor genes in cancer (Giannakakis et al., 2007) and misexpression of miRNAs is seen in both benign proliferations and malignant cancer (reviewed in Lu et al., 2005; Calin, 2008). Given their role in repressing translation and degradation of mRNAs, the expression of miRNAs and their target genes is most likely negatively related, that is, when the expression of a miRNA is high the expression of its target gene is low and vice versa. Information on cancer related miRNA genes shows that tumor-suppressor miRNAs are often downregulated or deleted in cancer and their target genes are consequently overexpressed (reviewed in Bagnyukova et al., 2006). In addition, it has been shown that forced overexpression of miRNAs can lead to the development of tumors (He et al., 2005). However, the same miRNA gene can act as a tumor suppressive gene in one cell type and as an oncogene in another (Fabbri et al., 2007). miRNAs can have an impact on cancer progression in several ways, including loss of expression of a tumor-suppressor miRNA gene and over-activation of an oncogenic miRNA. Loss of miRNA binding sites in the 3ÚTR sequence of the target genes caused by mutations or translocations is possible. In addition, shortening of 3ÚTR sequences can lead to oncogenic activation (Mayr and Bartel, 2009). It has been reported that two thirds of genes targeted by miRNAs have alternative polyadenylation signals (PAS) and often miRNA binding sites are located close to the PAS (Majoros and Ohler, 2007). Shortening of the 3ÚTR sequence at an alternative PAS may therefore lead to loss of miRNA

45 binding sequences located downstream of the PAS, and therefore subsequently loss of microRNA-mediated regulation. The potential of mapping miRNA expression profiles in cancer tissues vs. normal tissues can be helpful in diagnosing cancer as well as the stage of cancer progression. In one study, miRNA expression profiles could be used to classify the differentiation stage and developmental lineage of solid tumors (Lu et al., 2005). miRNAs can also be beneficial in the development of therapeutic agents either by targeting the mRNAs of genes involved in cancer progression or by targeting directly the miRNAs shown to be involved.

1.19 MicroRNAs and melanoma Studies on miRNAs and melanoma have revealed that miRNA expression differs between melanoma cell lines (Gaur et al., 2007) and recently it was shown that expression of selected miRNAs could predict post-recurrence survival with 80% accuracy (Segura et al., 2010). Several microarray studies have revealed miRNAs involved in melanoma including an extensive comparison study on miRNA expression in normal melanocyte and melanoma cell lines derived from solid tumors and melanoma metastases (Mueller et al., 2009). Some of the miRNAs had not been linked to cancer formation before but other miRNAs had previously been shown to be oncogenic or to contain tumor suppressive potential in other types of cancer (Mueller et al., 2009). Several specific miRNAs have been implicated in melanoma, including miR-221/222 which were shown to be involved in melanoma progression by downregulating c-kit and p27Kip (Felicetti et al., 2008) and miR-15b, overexpressed in melanoma and associated with poor prognosis and tumorigenesis (Satzger et al., 2010). miR-155 has been found to be downregulated in melanoma cells in line with its tumor suppressor function. A higher level of this miRNA inhibited proliferation and induced apoptosis (Levati et al., 2009). miR-34a has also been reported to have tumor suppressor function in melanoma cells (uveal melanoma). miR-34a targets c-met and subsequently inhibits invasion and cell proliferation (Yan et al., 2009).

1.20 MicroRNAs and Mitf Several miRNAs have already been linked to Mitf expression, both in melanocytes and during eye development. The first miRNAs that were identified to target the Mitf-3´UTR sequence were miR-182 and miR-96 which are both expressed in the retina (Xu et al., 2007). The miR-96, miR-182 and miR-183

genes are located in a cluster that is expressed in photoreceptors, retinal bipolar and amacrine cells postnatally with a peak in expression in the adult retina (Xu et al., 2007). This expression pattern is in concordance with Mitf expression in the whole developing eye early in development and its absence later in the retina (Hodgkinson et al., 1993; Nakayama et al., 1998; Nguyen and Arnheiter, 2000). The opposite expression patterns (temporally and spatially) are consistent with the miRNAs being involved in regulating Mitf mRNA expression negatively. Interestingly, the upstream regions of these miRNA genes contain binding sites for several transcription factors expressed in sensory tissues (Xu et al., 2007), including CHX10 known to repress Mitf expression in the retina (Horsford et al., 2005). Recently, miR-182 was also shown to downregulate MITF expression in melanoma cells and subsequently promote migration and survival of the melanoma cells (Segura et al., 2009). The miR-96, 182 and 183 miRNAs have all been shown to be upregulated in different cancers (Navon et al., 2009) indicating oncogenic activity. Other miRNAs targeting MITF are miR-137 shown to downregulate MITF in melanoma cells (Bemis et al., 2008) and miR- 199, upregulated in class 2 uveal melanoma tumors that have high metastatic risk, potentially targets the MITF 3´UTR sequence (Worley et al., 2008). Interestingly, miR-25 was recently reported to downregulate Mitf in melanocytes (Zhu et al., 2009). Furthermore, higher level of miR-25 related to less pigmentation in skin samples with white colour and lower miR-25 level were detected in skin samples with brown colour. The levels of Mitf mRNA showed the opposite pattern with higher level in brown skin samples and less in white skin samples (Zhu et al., 2009). Transcription factors activate miRNA gene expression and sequence analysis accompanied by chromatin immunoprecipitation has revealed that MITF can bind to the promoters of several miRNA genes, some of which have potential binding sites within the Mitf 3´UTR sequence, indicating a feedback loop in expression control (Ozsolak et al., 2008). Thus, it is clear that miRNAs regulate Mitf and play a role in melanocytes and melanoma cells.

47 48

2 AIMS OF THE THESIS

2.1 Mitf in Drosophila i) Analyze the role of Mitf during eye development in the fruitfly Drosophila melanogaster.

2.2 Conservation of Mitf non-coding regions i) Analyze the conservation of promoter regions upstream of the nine different first exons in the Mitf gene and search for potential transcription factor binding sites in the promoter sequences.

ii) Analyze the conservation of 3´UTR sequences and search for potential miRNA binding sites in 3´UTR sequences.

2.3 MicroRNAs affecting Mitf i) Determine whether the conserved miRNA target sites in the Mitf 3´UTR sequence are functionally important.

ii) Study the functional miRNA sites using mutational analysis.

49 50

3 MATERIALS AND METHODS

3.1 RNA in situ hybridization on imaginal discs Drosophila larvae from a wild type fly stock, w; Canton S at 2nd (L2) and 3rd (L3) instar were dissected and the eye-antennal imaginal discs retrieved. Two probes were used to detect the dMitf mRNA in the eye-antennal discs, one probe representing the whole dMitf gene made from cDNA clone LD45277 and a control probe lacking the bHLH-Zip region. The probe was labeled using the Boehringer Mannheim (Indianapolis) DIG RNA labeling kit according to instructions.

3.2 Tissue specific dMitf expression dMitf WT and dMitfEA, a mutated version of dMitf where the well negatively charged glutamic acid (E) within the bHLH region has been changed to a neutral alanine (A), where cloned previously into the pUAST vector expression vector and transgenic fly stocks containing these construct established. The dMitfWT and dMitfEA fly stocks were crossed with the ey-Gal4 fly stock (Hazelett et al., 1998; Kenyon et al., 2003) resulting in progeny expressing the dMitf gene specifically in the expression pattern of the eyeless gene. The dMitf transgenic flies were also crossed to a peripodial Gal4 driver, C311 (Gibson and Schubiger, 2000) resulting in dMitf expression in the peripodial layer. The progeny from these crosses were analyzed with regard to the phenotype of the eye-antennal discs.

3.3 Conservation of the Mitf promoter sequences Conservation of the promoter sequences in front of the nine different first exons of the Mitf gene were analyzed in nine sequenced vertebrate species and location of potential transcription factor binding sites determined. The 1A, 1MC, 1E, 1H, 1D, 1B, and 1M exons from mouse and 1J and 1C from human were used to retrieve the exons in the other species through BLAST (http://www.ncbi.nlm.nih.gov, http://www.ensembl.org) (Altschul, 1990) and BLAT searches (http://genome.ucsc.edu) (Kent, 2002). The sequences were aligned using the ClustalW program (Thompson et al., 1994), as well as the BIOEDIT program version 5.0.9 (http://www.mbio.ncsu.edu/BioEdit/

51 bioedit.html) (Hall, 1999). The Mulan program (http://mulan.dcode.org/) (Ovcharenko et al., 2005) was used to locate potential transcription factor binding sites within conserved areas of the promoter regions.

3.4 Conservation of Mitf 3ÚTR sequences Conservation of 3ÚTR sequences in 11 vertebrate species was analyzed and potential microRNA binding sites identified. The 3ÚTR sequences of the mouse (BG971963) and human (BC011461) Mitf genes were identified in cDNAs containing polyA sequences, The 3ÚTR region was defined as starting from the stop codon to the first nucleotide of the polyA tail. The mouse 3ÚTR sequence was used to obtain the 3ÚTR sequences in the genomes of P. troglodytes (Ptro, chimpanzee), F. catus (Fcat, cat), B. taurus (Btau, cow), C. familaris (Cfam, dog), R. norvegicus (Rnor, rat) and G. gallus (Ggal, chicken) using the NCBI database (http://www.ncbi.nlm.nih.gov). The 3ÚTR sequences in the O. cuniculus (Ocun, rabbit), M. domestica (Mdom, opossum) and L. africana (Lafr, elephant) were retrieved using the USCS Genome Bioinformatics database (http://genome.cse.ucsc.edu). The mouse 3ÚTR sequence was compared with the genomes of the other species using BLAST and genomic contigs obtained. The length of the sequences was estimated using the mouse and human 3ÚTRs guidelines. The sequences were aligned using ClustalW at the SDSC Biology WorkBench website (http://workbench.sdsc.edu). Potential miRNA target sequences in the human MITF 3ÚTR were located using the Targetscan program Release 3.1 (http://www.targetscan.org/) (Lewis et al., 2005; Lewis et al., 2003). These binding sites were compared to areas conserved in all 11 vertebrate species.

3.5 PCR amplification of the 3ÚTR sequence of Mitf The mouse Mitf-3ÚTR sequence was cloned into a Firefly luciferase vector, the Pis0 vector, purchased from Addgene Inc. Cambridge, MA, USA (Addgene plasmid 12178) (Yekta et al., 2004). This vector is a modified PGL3 Control Vector from Promega with added restriction sites at the 3énd of the luciferase gene specifically for cloning of 3ÚTR sequences. The clone was named mouseMitf-3ÚTR- luciferase. The 3ÚTR sequence of the mouse Mitf gene was amplified from BAC clone rpci-23-9a13t7 using Pfu polymerase and primers containing new restriction sites at each end (underlined), 3UTRSacI-Forw: 5´-gag ctc cga gcc tgc ctt gct ctg-3´ and 3UTRNheI-Rev: 5´-gct agc atg tga aaa acc aaa tgc ttt aat ga-3´. miRNA binding sites in the 3ÚTR sequence were mutated using site directed mutagenesis using the mouseMitf-3ÚTR-luciferase clone as a template.

3.6 MicroRNA molecules The mature forms of microRNAs were purchased from Ambion, Inc. The miRNAs are hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa- miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu- miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR- 182 (Product ID:PM11090), Pre-miR-neg#2 (Cat. no. AM17111) and Cy3-labeled Pre-miR Negative Control#1 (Cat. no. AM17120).

3.7 Cell culture conditions Human embryonic kidney cells (HEK293), obtained from ATCC, were cultured in DMEM medium with 10% FBS, 2 mM glutamine and penicillin-streptomycin (50 U/ml). Human 501mel cells were cultured in RPMI medium with 10% FBS and penicillin-streptomycin (50 U/ml). Human MeWo melanoma cells (Bean et al., 1975) were cultured in DMEM medium with 7 % FBS, 2 mM glutamine, penicillin-streptomycin (50 U/ml). Cells were grown at 37°C with 5% CO2.

3.8 Co-transfections To determine if the miRNAs affected luciferase expression, the mouseMitf- 3´UTR-luciferase clone and individual miRNAs were co-transfected into both HEK293 and 501mel cells using Lipofectamine 2000 from Invitrogen (Cat no. 11668-019) and Optimem I +Glutamax-I Reduced Serum Medium from Invitrogen (Cat.no. 51985), according to the manufacturer´s protocol. Cells grown in 96 well plates were co-transfected with 10 ng vector DNA, 0.2 ng Renilla luciferase DNA and a miRNA at either 0.1 pmol, 0.5 pmol or 1 pmol concentration. In co-transfections with the mutated mouseMitf-3´UTR-luciferase clones, miRNAs were transfected at the highest concentration, 1 pmol miRNA.

Cells were incubated for 48 hrs after transfection at 37°C with 5% CO2 before luciferase expression was measured. Experiments were repeated three times in 6 replicates, except when two different miRNAs were co-transfected simultaneously, experiment was done only once in six replicates.

3.9 Luciferase measurements Expression from the luciferase vector and mouseMitf-3´UTR-luciferase was measured on a Wallac Victor 2 1420 Multilabel counter using the Dual Luciferase Reporter Assay System from Promega.

53 3.10 Site directed mutagenesis miRNA binding sites in the mouse Mitf 3´UTR sequence are numbered starting at the first nucleotide after the stop codon in exon 9. To mutate the miRNA binding sites the QuikChange Lightning Site-directed Mutagenesis Kit from Stratagene (Cat.no.#210518) was used. Primers were designed using the Primerdesign program from Promega (Table 1 in Paper III). To eliminate the possibility that new target sites for other miRNAs were formed when the binding sites were mutated, the corresponding new seed region matching the mutated sequence was used to search for predicted targets of novel small RNAs in TargetscanCustom 4.2. (http://www.targetscan.org/vert_42/seedmatch.html). Mutations made in the binding sites are shown in Fig. 1C in paper III.

3.11 Transfection of miRNAs into MeWo cells MeWo melanoma cells were plated at 140-200 x 103 density on 6 well plates and 24 hrs later, 20 pmol miRNA were transfected with Lipofectamin 2000, in triplicate. Total RNA was isolated for qRT-PCR analysis 48 hrs post transfection.

3.12 RNA extraction and cDNA synthesis Total RNA was extracted from MeWo cells 48 hrs after miRNA transfection. The TRIzol Reagent (Invitrogen) was used for the isolation, according to the manufacturer´s protocol. RNA quantity was measured using Nanodrop Spectrophotometer ND-1000 and RNA integrity was determined using Agilent 2100 Bioanalyzer. In all cases the RNA Integrity number was above 7.6. RNA was treated with DNaseI and purified with the RNEasy Minelute kit from Qiagen. Purified RNA was used to synthesize cDNA, using 1 μg RNA in 10 μl reaction with Superscript III

RT (200U/μl), and anchored Oligo(dT)20 primer according to the manufacturer´s protocol. SPUD assay was used to test the RNA samples for absence of inhibitors and no inhibitors were detected (Nolan et al., 2006).

3.13 Quantitative reverse transcription PCR Total RNA samples were extracted from the transfected MeWo cells and the human MITF mRNA level was measured using the human MITF FAM-labeled TaqMan Gene Expression Assay (hs01115560) (Applied Biosystems). Two controls, one without RT and the other without template were included and samples were measured in triplicate using standard conditions for TaqMan reagents. The results

were normalized to total RNA (Log250). qRT-PCR results were analyzed using the GenEx Std. 4.4.2. software from MultiD analyses AB (Sweden).

3.14 Reverse transcription PCR To validate cDNA synthesis before qRT-PCR analysis, RT-PCR was performed with primers spanning the human MITFgene from exon 5-9: hMitf-ex5-9F: 5´-GCCAACCTTCCCAACATAAA-3´ and hMitf-ex5-9R: 5´-GATGCTGAAGGAGGTCTTGG-3´.

3.15 MicroRNA real-time qPCR Total RNA was isolated from all three cell types, HEK293, 501mel and MeWo to measure the endogenous miRNA levels. Real-time qPCR measurements on endogenous miRNAs were performed by Exiqon Services, as contract work. 10 ng of total RNA were reverse transcribed in 10 μl reactions using the miRCURY LNA™ Universal RT microRNA PCR, Polyadenylation and cDNA synthesis kit (Exiqon); each sample was processed in triplicate. The cDNA was diluted 80 fold and 4 µl used in 10 µl PCR reaction according to the protocol for miRCURY LNA™ Universal RT microRNA PCR. Each microRNA was assayed once by qPCR in each triplicate cDNA samples. The amplification was performed in a LightCycler® 480 Real-Time PCR System (Roche) in 384 well plates. Assays were performed: hsa-miR-124 (product#204319), hsa-miR-137 (product#204655), hsa-miR-148a (product #204121), hsa-miR-148b (product #204047), hsa-miR-152 (product#204294), and hsa-miR-506 (product #204539). Reference miRNAs were, hsa-miR-16 (product# 204409), hsa-miR-103 (product#204063) and hsa-miR-192 (product #204099).

3.16 Data pre-processing Cp value for the endogenous miRNA values were determined on the LightCycler® 480 software and amplification- and melting curves generated. LinRegPCR (ver 11.5) software was used to determine the amplification efficiency. The average amplification efficiency was used to correct the Raw Cp values. Reference miRNAs were analyzed for stability using SLqPCR algorithim (similar to geNorm) and a selection of the most stable reference miRNAs were used to normalize all measurements on a well-to-well basis.

55 3.17 Western blot After RNA and DNA had been isolated using the Trizol reagent (Invitrogen), proteins were isolated from the phenol-ethanol supernatant, according to the manufacturers protocol (Chomczynski and Sacchi, 1987). Proteins were separated on a 10% SDS-PAGE polyacrylamide gel and electroblotted onto a PVDF transfer membrane (Thermo Scientific). The transfer membrane was immunoblotted overnight at 4°C with primary antibody, C5 mouse-anti-MITF monoclonal antibody, in Tris-buffered saline with 5% milk. The secondary antibody, horse-radish peroxidase labelled anti-mouse antibody (Jackson), was incubated with the membrane for 1 hr. after washing with TBST. Signals were detected with ECL reagent from Thermo Scientific.

3.18 Statistical analysis T-test analysis (for independent groups) was preformed on results from luciferase expression assays, qRT-PCR analysis of MITF mRNA and endogenous miRNAs.

4 RESULTS

4.1 Mitf in Drosophila (Paper I) In paper I we show that the Mitf gene is conserved between vertebrates and Drosophila and the function of dMitf during eye development is also conserved, at least partly. The Drosophila Mitf gene, is located on chromosome 4 in the Drosophila genome at region 102F8. (Gene annotation symbol: CG17469. Flybase ID: FBgn0067895). The dMitf gene covers over 15 kb. of genomic sequence and has nine exons, one of which is alternatively spliced. The structure and conservation of dMitf is shown in Fig.1 in paper I. The dMitf gene encodes a 729 amino acid protein, which is considerably longer then the longest mouse MITF form which is 525 amino acids. Amino acid conservation is only 31% overall with areas showing higher conservation. The bHLH region has the highest conservation with 17 out of 19 amino acids conserved (89.5%). At the N-end of the dMitf protein, a block of amino acids is highly similar to the mouse A-form, which has been identified as an eye specific form of Mitf (Amae et al., 1998; Nguyen and Arnheiter, 2000; Bharti et al., 2008). Like its mouse homolog (Hemesath et al., 1994) the dMitf protein can activate transcription by binding to an E-box sequence (Fig. 2A in paper I). It has been shown that the mouse MITF and PAX6 proteins can inhibit each others transcription activation potential (Planque et al., 2001). The Drosophila Eyeless/Pax6 protein can similarily hinder the activation potential of the dMitf protein (Fig. 2B in paper I). The earliest sign of dMitf mRNA during Drosophila development is at the precellular stage of embryonic development (maternally deposited mRNA) (Fig. 3 in paper I). Expression then decreases and is low or undetectable at embryonic stages 9-11. At stage 12-15 expression is detected at high levels in the cells surrounding the developing mid- and hindgut. At stage 15 the cuticule is formed and the RNA in situ probe can no longer penetrate the embryo. At the larval stage, the expression pattern of dMitf in the eye-antennal disc shows similarities to the expression of the Mitf gene during vertebrate eye development. Early during development, at 2nd instar larval stage, dMitf is expressed throughout the eye-antennal disc (Fig. 6A), the tissue that develops into the adult eye and

57 antenna. Later, at 3rd instar larval stage when the eye-antennal disc has developed into two specific areas, the eye part and the antennal part, respectively, dMitf appears to be strongly expressed in two locations. In the area between the eye and antennal disc (Fig. 6B) and in the region of the MF (Fig. 6C). Upon closer inspection, the expression of dMitf is significantly enriched in the PL, and transiently upregulated in PL cells that overlie the MF. Expression of Mitf predominantly in the PL is already apparent in early 3rd instar larvarl stage, that is just prior to neurogenesis, by in situ hybridization(Fig. 6C, inset).

Figure 6. The expression of dMitf in Drosophila eye-antennal discs. A. dMitf mRNA is detected in the whole eye-antennal disc at 2nd instar larval stage. B. dMitf mRNA is located in the area between the eye and antennal parts of the eye discs (arrow) at 3rd instar larval stage. C. dMitf mRNA is also located in the peripodial layer (p) over the morphogenetic furrow (MF) at 3rd instar larval stage (arrowhead). Inset shows a cross section of the margin of the eye disc where dMitf mRNA is located in the peripodial layer as opposed to the disc proper (d). D. Shown in comparison, Atonal mRNA is located in the disc proper cell layer in the MF. The eye-antennal discs are orientated with posterior to the left and dorsal up.

In the mouse, Mitf expression is first detected early during eye development in the whole optic vesicle but at the cup stage Mitf expression is restricted to the RPE layer (Hodgkinson et al., 1993; Nakayama et al., 1998; Nguyen and Arnheiter, 2000). To analyze the role of dMitf during eye development the dMitf gene was overexpressed in the eye-antennal disc using the UAS-Gal4 system with the ey- Gal4 driver (Hazelett et al., 1998; Kenyon et al., 2003). The ey-Gal4 driver is expressed in both the disc proper and the peripodial cell layer. After the 2nd instar larval stage, expression becomes restricted to the eye disc and is lost from the antennal part. At the 3rd instar larval stage, expression is lost from the

peripodial layer. Overexpression of wild type Mitf (MitfWT) resulted in lethality. Despite this, the eye-antennal imaginal discs from 3rd instar larval stage were analyzed. The overexpression of MitfWT with ey-Gal4 resulted in abnormal eye development. The eye disc was smaller then normal and the neuronal/photoreceptor field also (Fig. 7B). The MitfEA mutation has the most conserved amino acid in the bHLH region changed and in the related TFEB protein this EA mutation is though to result in a dominant negative form of dimerized proteins (Fisher et al., 1993). Overexpressing MitfEA resulted in larger then normal eye discs with an expanded neuronal/photoreceptor field (Fig. 7C). The effect of dMitf during Drosophila eye development has a resemblance to the effect of Mitf in vertebrates, in both cases Mitf affects the size of the eye tissue (Moore, 1995) and the expression is seen in the cell layer located adjacent to the neural cells in the eye (Hodgkinson et al., 1993; Nakayama et al., 1998; Nguyen and Arnheiter, 2000).

Figure 7. Overexpression of wt dMitf and a dominant negative dMitf. A. A normal eye-antennal disc at 3rd instar larval stage. Discs are stained for the neural marker ELAV. B. Overexpression of wt dMitf results in smaller eye discs and reduced neuronal field. C. Overexpression of a dominant negative dMitf (dMitfEA) results in larger eye discs and expanded neuronal field with folds (arrow). Neuronal development also initiates from the margin of the eye disc (arrowhead). The eye-antennal discs are orientated with posterior to the left and dorsal up.

Since the dMitf mRNA is expressed in the peripodial layer of the eye disc, the dMitf gene was also overexpressed with a specific peripodial driver, c311-Gal4 (Gibson and Schubiger, 2000). The c311 driver is expressed throughout the eye-antennal disc at 2nd instar larval stage but at 3rd instar larval stage expression is not seen in the disc proper, but remains in the peripodial layer. The c311 driver is also expressed in other larval tissues. Overexpression of dMitfWT and dMitfEA with the c311-Gal4 driver resulted in early larval lethality, likely due to expression in other tissues than the

59 imaginal discs. This was not studied further due to lack of better peripodial drivers, which are exclusively expressed in the peripodial layer.

4.2 Conservation of the Mitf gene and protein (Paper II) A detailed analysis of the conservation of the Mitf gene and protein in vertebrates and invertebrates was performed in order to better understand conserved regions of the protein and increase our information about the functional domains of the MITF protein. In addition, the untranslated regions of the gene, the promoter, 5´UTR and the 3´UTR sequences were analyzed in vertebrate species. The MITF protein shows high overall conservation, especially in the bHLH domain (Fig. 1A in paper II). The conservation of the basic domain is 74% and helix 1 has 87% conservation with two amino acids conserved in all species. Helix 2 and the leucine zipper are less conserved and the loop in the fly and yeast sequences contains 6-8 additional amino acids compared to the other species (Fig. 1A in paper II). Other well conserved areas of the MITF protein include the four activation domains that have been identified in the MITF protein, AD1 (Fig. 2A in paper II), AD2, AD3 and AD4. Exon 1B, Exon 2 and Exon 9 show higher conservation then other areas (Figs. 2B, 3A and 3B in paper II, respectively). Many post-translational binding sites in the MITF protein sequence are well conserved. The phosphorylation site Ser73 is conserved in all vertebrate species and in the ascidians sequences (Fig. 4A in paper II). Other known (Ser298, Ser307, Ser325) (Fig. 4E in paper II) and potential (Ser173, Ser409) (Figs. 4B and 4G in paper II, respectively) phosphorylation sites are conserved in the mammalian species. Two sumoylation sites, Lys182 and Lys316 are highly conserved, even though they are located in areas that are less conserved (Figs. 4B, 4E in paper II, respectively). The ubiquitination site at Lys201 is conserved in vertebrates, ascidians and the fly species (Fig. 4C in paper II). Two potential acetylation sites are found in Mitf, Lys205 and Lys272 (Fig. 4C and 4D in paper II, respectively). The Lys205 acetylation site is found in all species analyzed and Lys272 in all species except the flies. A protease 3 caspase cleavage site located at Asp345 is well conserved (Fig. 4F in paper II). The conservation of the Mitf gene was analyzed in several Drosophila species. A block of 150 bp upstream of exon 1B shows high conservation in these species. This conserved sequence presents a new 5´ exon as it has a splice donor in phase with exon 1B.

4.3 Conservation of promoter sequences (Paper II) There are nine different first exons in the mouse Mitf gene that are spliced differentially to the remaining exons 2-9. The conservation of the promoters upstream of each of these nine alternative exons (1A, 1J, 1C, 1MC, 1E, 1H, 1D,1B and 1M) was analyzed in vertebrate species where the sequences were available. All the promoters are well conserved between the species analyzed. The conservation of the promoters are: 1A 46% (8 species), 1J 65% (8 species), 1C 61% (7 species), 1MC 28% (5 species), 1E 51% (7 species), 1H 73% (8 species), 1D 44% (9 species), 1B 25% (9 species), 1M 36% (9 species) (Figs. S1-S8 in paper II for 1A, 1J, 1C, 1MC, 1E, 1H, 1D,1B and Fig. 8 in paper II for 1M). There are several known transcription factor binding sites within the mouse and human Mitf 1M promoter which are all well conserved. Potential transcription factor binding sites were identified in all of the promoters. An overview of all the nine 5´ exons, their conservation and potential transcription factor binding sites is shown in Fig. 7B in paper II.

4.4 Conservation of the Mitf 3ÚTR region (Paper II) The 3ÚTR sequence of the mouse Mitf mRNA is relatively long, consisting of at least 3177 bases. The human MITF 3ÚTR similarily contains 3088 bases. On average, 3ÚTR sequences in humans are 559 bp and 1137 bp in the Ensembl and Ecgene databases (Nam et al., 2005). By comparing the 3ÚTR sequences of the Mitf gene from 11 vertebrate species, we show that this sequence has 35% conservation over the entire region (Fig. 15, in the Appendix). For a non-coding sequence this is unexpectedly high. In comparison, the intron between exons 6 and 7 has 2.5% conserved bases (Fig. 16 in the Appendix) and the intron between exons 7 and 8 has 9% conservation (Fig. 17 in the Appendix). These are the introns that split the exons encoding the best conserved areas of Mitf, the bHLH-Zip domain The Mitf 3‘UTR sequence in Drosophila melanogaster is only 1676 bases long. Aligning this sequence with the human and mouse Mitf 3ÚTR sequences did not reveal much conservation (Fig. 18 in the Appendix).

4.5 Potential miRNA binding sites (Paper II /Paper III) The high conservation of the 3´UTR sequences among vertebrate species suggests its functional importance. A number of potential miRNA target sites are found within the 3´UTR sequence of Mitf. Our analysis revealed seven potential miRNA binding sites conserved in all 11 vertebrate species analyzed (Fig. 8).

61 These are the binding sites for miR-27, miR-25/32/92/363/367, miR-124.2/506, miR-124.1, miR-148/152 (two sites), miR-101 and miR-144 (miR-101 and miR- 144 share the same binding site) (Fig. 8). Interestingly, miR-137 contains four potential binding sites within the 3´UTR sequence, two of which are well conserved. One site is only found in the mouse sequence and another is only found in the mouse and rat sequences.

Figure 8. Conserved potential miRNA binding sites in the Mitf 3´UTR sequence. A. The Mitf 3´UTR sequence showing the location of the conserved potential miRNA binding sites. B. Sequence conservation of the potential miRNA binding sites in 11 vertebrate species. Human (Hsap), chimpanzee (Ptro), mouse (Mmus), rat (Rnor), cow (Btau), dog (Cfam), cat (Fcat), rabbit (Ocun), opossum (Mdom), elephant (Lafr), and chicken (Ggal).

In a more recent version of the Targetscan program (Release 5.1. April 2009), some changes have been made, so that the two less conserved miR-137 binding sites have both been removed and the two miR-124 binding sites, previously labelled miR-124.1 and miR-124/506 (Release 3.1) are now both labelled miR- 124/506. The less conserved binding sites may have had less potential for binding and are therefore excluded. The dMitf 3´UTR sequence in Drosophila melanogaster contains several potential miRNA binding sites according to the Targetscan program (TargetScanFly, Release 5.1. April 2009). Only four of these miRNAs are also predicted to bind to the human and/or mouse Mitf 3´UTR

sequences. miR-92a and miR-92b are predicted to bind to the mMitf and human MITF 3ÚTR; miR-210 is predicted to bind to the human MITF 3ÚTR sequence and miR-33 is predicted to target the mMitf 3ÚTR sequence. The role of these binding sites was not tested.

4.6 Functional miRNA binding sites (Paper III) There are many potential miRNA binding sites within the 3 kb long 3ÚTR sequence of the mouse Mitf gene. miRNA binding sites that are conserved in many species are more likely to be functional targets (reviewed in Bartel, 2009). The binding sites that were predicted by the TargetScan program and were conserved in the 11 vertebrate species analyzed (paper II) were tested for their functionality. In some cases two or more miRNAs can bind to the same target sequence. In these cases only one representative miRNA was chosen to test the functionality of the binding site. The microRNAs tested were miR-27a (binding site located at 229-235 in the mouse Mitf 3ÚTR sequence), miR-25/32/92/363/367 (1491-1497), miR- 101/144 (3023-3029), miR-124/506 (1639-1646) and miR-148/152 (1674-1680 and 2931-2937) (Fig. 8, Fig. 15 in the Appendix). miR-124/506 has a second binding site at 548-554 in the 3ÚTR sequence that is less conserved, and was also tested in our study. miR-137 has four potential binding sites in the mouse Mitf 3ÚTR sequence and was therefore also tested in our analysis. Two of the sites, located in close proximity to each other namely 137C (2842-2848) and 137D (3061-3067) are also well conserved. The other two are less conserved, 137A (2495-2501) is only found in the mouse sequence and 137B (2782- 2788) is conserved in the mouse and rat 3ÚTR sequences. The functionality of all these binding sites was tested in both 501 melanoma cells (Fig. 9A) and HEK293 cells (Fig. 9B). The cells were co-transfected with a luciferase reporter containing the mMitf 3ÚTR sequence (mouse Mitf-3ÚTR-luciferase reporter) and mature microRNA molecules. Two of the microRNAs tested, miR-148 and miR-137 resulted in downregulation of the luciferase reporter construct whereas cotransfection of miR-124 resulted in upregulation (Fig. 9A, B). These three miRNAs were tested further and are discussed below. MicroRNAs miR-27 and miR-32 did not downregulate luciferase expression in the assays. However, miR-101 downregulated luciferase expression at the highest concentration in melanoma cells (miR-101 was not tested further).

63 Figure 9. Effects of miRNAs on the Mitf 3ÚTR-luciferase reporter. A. Effects of miRNAs on the mouseMitf-3ÚTR-luciferase reporter in 501melanoma cells. B. Effects of miRNAs on the mouseMitf-3ÚTR-luciferase reporter in HEK293 cells. Results are presented as mean values +/- SD. Three concentrations of miRNAs were tested: 0.1 pmol, 0.5 pmol and 1 pmol. Difference between the mouseMitf-3ÚTR-luciferase vector with and without co-transfected miRNA was considered statistically significant when p <0.05, shown with an asterisk (T-test, 95% confidence level). P-values are presented in Table S1 in Paper III.

4.6.1 miR-148 There are three miRNAs that can potentially bind to the miR-148/152 binding sites, miR-148a, miR-148b and miR-152. The hsa-miR-148a mature miRNA was used in our experiments to test the functionality of the miR-148/152 binding sites. In 501mel cells, miR-148 was able to downregulate luciferase reporter expression when transfected at higher concentrations (Fig. 9A). When using either 0.5 pmol or 1 pmol expression of the miR-148a miRNA, reporter was reduced to 50% compared to reporter expression with no miRNA transfected. In HEK293 cells miR-148 was able to lower luciferase reporter expression to 13% at the highest concentration used compared to the reporter alone (Fig. 9B). The effects of miR-148 were confirmed on endogenous MITF mRNA. Endogenous MITF mRNA levels were reduced to 50% (Fig. 10A) and MITF protein level was also reduced (Fig. 10B). Simultaneous transfection of anti- miR-148 and miR-148 blocked the effect of miR-148 in both the luciferase assays as well as on endogenous MITF mRNA (Fig. 11A and 11B). Furthermore, we showed that miR-148 mediates the downregulation of Mitf RNA through the miR-148/152 B binding site in the Mitf 3´UTR sequence, as was revealed by mutating the binding sites (Fig. 12). The effects of miR-148 are seen in both 501mel and MeWo melanoma cell lines but in HEK293 cells the effects are only seen when miR-148 is co-transfected at the highest concentration. In order to explain this difference, the endogenous expression of the three miRNAs (miR-148a, 148b and 152) was measured in these three cell lines. The results show that miR-148a and miR-148b have similar expression levels in all cell types and approximately 1.5 fold lower expression in the melanoma cell lines (501mel and MeWo) compared to HEK293 cells (Fig. 6 in paper III). The higher endogenous expression in HEK293 cells might explain why the transfected miR-148 had no effect on reporter gene expression in HEK293 cells, except at the highest concentration used (compare Figs. 9A and 9B). Endogenous expression of miR-152 was much lower than the expression of miR-148a and miR-148b in all cell types (see Table 2 in paper III), and was lowest in 501mel cells where miR-152 expression was 2.7 fold lower than in HEK293 cells.

65 Figure 10. Effects of miRNAs on endogenous MITF. A. Expression of human MITF mRNA in MeWo cells transfected with miR-124, miR-137, miR-148 or miR-137 and miR-148 combined. The figure shows average expression levels of three replicates for each sample relative to untreated cells (No-miR). Negative control is a scramble miRNA sequence. Statistically significant difference between untreated cells and treated cells are shown with an asterisk (T-test, 95% confidence level). P-values are shown in paper III. B. Western blot analysis on MITF protein levels in MeWo cells, when transfected with miR-124, miR-137, miR-148 or miR-137 and miR-148 combined.

Figure 11. Inhibiting the miRNAs blocks their effect. A. Co-transfection of anti-miR-148 and miR-148 simultaneously with the Mitf- 3’UTRluciferase vector inhibits the effect of miR-148. Similarily there is a significant upregulation of luciferase expression when anti-miR-137 is co-transfected with miR-137 compared to miR-137 alone (p<0.001) although miR-137 is not able to significantly lower the luciferase expression (p= 0,071). Results are presented as mean values +/-SD. Expression levels were compared to a sample where no microRNAs were added (No-miR) and were considered statistically significant when p<0.05, shown with an asterisk (T-test, 95% confidence level). P-values are shown in paper III. B. Co-ransfecting miRNAs and anti-miRNAs blocked the effect of the miRNAs on endogenous human MITF mRNA levels in MeWo cells. P-values are shown in paper III.

67 Figure 12. Effects of mutating the miR-148 binding sites. Effects of miR-148 on the mouseMitf-3´UTR-luciferase reporter when the potential binding sites are mutated. Results are presented as mean values +/- SD. Difference between the appropriate vector (labeled on the X-axis) with and without co-transfected miRNA was considered statistically significant when p<0.05, shown with an asterisk (T- test, 95% confidence level). P-values are presented in Table S1 in paper III.

4.6.2 miR-137 Co-transfection with miR-137 and the mMitf-3´UTR luciferase reporter construct in HEK293 cells resulted in significant downregulation of luciferase expression (Fig. 9B). miR-137 was able to lower the expression from the luciferase reporter construct at all concentrations used, 0.1 pmol, 0.5 pmol and 1 pmol. However, miR-137 was not able to lower the luciferase expression in 501mel cells (Fig. 9A). In order to analyze the effect of miR-137 on endogenous MITF levels, miR-137 was transfected into MeWo melanoma cells. MeWo melanoma cells were chosen for this experiment as endogenous levels of MITF are lower compared to 501mel cells and therefore the effects of miR-137 are expected to be more easily detected. Endogenous MITF mRNA level was reduced to 68% when transfected with miR-137 (Fig. 10A) and miR-137 also lowered MITF protein levels (Fig. 10B). The effects of miR-137 on endogenous MITF mRNA were inhibitied with simultaneous transfection of anti-miR-137 and miR-137 (Fig. 11B). miR-137 did not affect the luciferase reporter in 501mel cells, however simultaneous transfection of

anti-miR-137 and miR-137 with the mMitf-3´UTR-luciferase vector blocked the effect of miR-137 in MeWo cells (Fig 11A). Furthermore, we showed that downregulation by miR-137 is mediated through the well-conserved binding sites miR-137C and 137D, as was revealed by mutating the binding sites (Fig. 13). The endogenous expression of miR-137 was measured in all the cell types used in these experiments, HEK293, 501mel and MeWo cell lines. Endogenous miR- 137 expression was only detected in MeWo cells and at low levels. No miR-137 expression was detected in HEK293, 501mel cells or the positive control (a mixture of RNA from 20 different tissues). The rather low levels of miR-137 (average Cp value 34.7 compared to the controls (miR-16 and 103) at 25.9 and 27.8 respectively) in MeWo cells indicates possible involvement in controlling the endogenous levels of MITF in this cell type as MITF is expressed at a lower level in MeWo cells than in 501mel cells. However, the endogenous levels of miR-137 in 501mel cells does not explain why miR-137 does not have an effect using the luciferase system in this cell type.

Figure 13. Effects of mutating the miR-137 binding sites. Effects of miR-137 on the mouseMitf-3´UTR-luciferase reporter when the potential binding sites are mutated. Results are presented as mean values +/- SD. Difference between the appropriate vector (labeled on the X-axis) with and without co-transfected miRNA was considered statistically significant when p<0.05, shown with an asterisk (T- test, 95% confidence level). P-values are presented in Table S1 in paper III.

69 In the luciferase assays, a luciferase reporter without the Mitf -3ÚTR sequence was used as a control in order to show that the effects of the miRNAs were caused by binding to the 3ÚTR sequence and not the empty vector. However, when co-transfecting the empty luciferase construct with miR-137 we observed reduced luciferase expression (Fig. 13). This is likely caused by unspecific binding to the reporter sequence. We therefore had to consider this when analyzing the effects of miR-137 on the mouseMitf-3ÚTR-luciferase reporter and in the constructs where the miR-137 binding sites in the reporter were mutated. Despite this unspecific effect we still measured significant effects of miR-137, which is blocked when the miR-137C and 137D binding sites are mutated. The expression of the luciferase reporter goes back to highest level possible, especially when both sites are mutated simultaneously. Therefore we can conclude that miR-137 can bind to these binding sites within the Mitf- 3ÚTR sequence and have an effect on Mitf post-transcriptionally.

4.6.3 miR-124 Both miR-124 and miR-506 are predicted to target the miR-124/506 binding sites within the Mitf-3´UTR sequence. The mmu-miR-124a was used to analyze the functionality of the two miR-124/506 binding sites, the well conserved binding site 124/506B (1639-1646) and 124/506A (548-554), which is less conserved. In the HEK293 cells, miR-124 surprisingly upregulated expression from the luciferase reporter (Fig. 9B), but did not show any effect on reporter expression in 501mel cells (Fig. 9A). The upregulation of reporter-gene expression by miR-124 was eliminated when the miR-124/506A binding site was mutated, indicating that the effect is mediated through this binding site (Fig. 14). However, it is possible that the effects of miR-124 on luciferase expression are indirect, as upregulation by miRNAs is not the typical role of miRNAs. The effect of miR-124 is not seen in 501mel cells or on endogenous MITF mRNA level in MeWo cells (Fig. 10A). However, upregulation by miR-124 is observed at the MITF protein level (Fig. 10B). miR-124 is a well known neuronally expressed miRNA and is expressed in the retina (Wang and Wang, 2006) and is therefore a potential candidate in downregulation of Mitf in the retina during eye development. It is possible that the system used here does not represent the right environment or the cell types needed to analyze these effects. Endogenous miR-124 levels were measured in HEK293, 501mel and MeWo cells but were too low to be detected.

Figure 14. Effects of mutating the miR-124 binding sites. Effects of miR-124 on the mouseMitf-3´UTR-luciferase reporter when the potential binding sites are mutated. Results are presented as mean values +/- SD. Difference between the appropriate vector (labeled on the X-axis) with and without co-transfected miRNA was considered statistically significant when p<0.05, shown with an asterisk (T- test, 95% confidence level). P-values are presented in Table S1 in paper III.

Endogenous expression of miR-506, that potentially binds to the same binding site as miR-124, was however detected in 501mel and MeWo cells. The expression level was higher in MeWo cells (Cp value 32.9) than in 501mel cells (Cp value 34.7). Lower expression in 501mel cells might be one factor in allowing a high level of MITF expression in this melanoma cell type.

4.7 Synergistic effect of miRNAs (Paper III) Many different miRNAs can affect each mRNA simultaneously (reviewed in Pillai, 2005), depending on the number of functional miRNA binding sites within the 3´UTR sequence and the endogenous miRNA expression in each cell type at a given developmental time. Thus, it was interesting to test the effect of co-transfecting two different miRNAs simultaneously to measure if they had additive effects on reporter gene expression. Combination of every two miRNAs tested earlier were co-transfected simultaneously in HEK293 cells. The results, however, did not show any synergistic effects caused by a combination of two different miRNAs. Interestingly though, always when miR-137 was combined with another miRNA, the effects were equal to the effects observed with miR-

71 137 alone. Also, when miR-124 was combined with other miRNAs, the effects were always equal to the effects observed with miR-124 alone. When miR-124 and miR-137 were combined, the same effect was observed as when miR-137 was transfected alone (Fig. 2C in paper III), suggesting that the effects of miR- 137 are dominant over the effects of miR-124. Other combinations of two different miRNAs did not show increased effects. Thus, we detect no cooperation among the miRNA molecules with respect to effect on Mitf. In addition, miR-137 and miR-148 did not show synergistic effect on endogenous MITF when co-transfected simultaneously in MeWo cells.

5 DISCUSSION

5.1 Mitf in Drosophila (Paper I) The discovery that the Pax6 gene is highly conserved was of great significance. The conservation showed genetically that the eye most likely originated from a common rudimentary ancestral photosensistive organ that later evolved further in different evolutionary lineages giving rise in some cases to very complex organs. The identification of dMitf in Drosophila melanogaster and its conservation in both vertebrates and invertebrates indicated functional conservation and further supports the idea of a common evolutionary origin of eyes. No other Mitf-like-genes were found in a search in the Drosophila genome, indicating that dMitf is the only member of the Mitf-Tfe family of transcription factors in Drosophila, which in vertebrates includes Mitf, Tfec, Tfeb, and Tfe3 in vertebrates. In vertebrates the MITF protein plays an important role during the development of several different cell types. However, little was known about the structure and role of this gene in invertebrates. Our functional analysis on the dMitf gene strongly suggests a potential conserved role during eye development. Overexpression of MitfWT and MitfEA resulted in abnormal eye development. This is consistent with the effect seen in vertebrates were mutations in Mitf results in microphthalmic eyes. Interestingly, expression of dMitf in Drosophila shows similarities to the expression in vertebrates. Early during development Mitf expression is observed in the entire eye tissue and at 3rd instar larval stage, dMitf is located in the peripodial layer, above the MF were the photoreceptors of the retina develop. In vertebrates, Mitf is initially expressed in the entire eye tissue but then gets restricted to the RPE layer. In vertebrates the RPE layer is involved in the morphogenesis of the neural retina (Raymond and Jackson, 1995). In Drosophila, signaling between the two cell layers in the eye, the disc proper and the peripodial layer has been studied in detail and it is now clear that signals from the peripodial layer are important for normal development of the retina (Cho et al., 2000; Gibson and Schubiger, 2000). This similarity again suggests

73 that these two cell layers, the RPE and peripodial layer could have similar function during eye development and in the mature eye. Mitf therefore seems to play a critical role during development in a non-neural cell type that is adjacent to neural cells. Drosophila pigment cells are derived from the eye-antennal epithelium, a cell type with no evolutionary linkage to the neural-crest derived melanocytes of vertebrates. The ancestral role of Mitf is therefore unlikely to be the involved in the establishment of the neural crest derived lineage. The ancestral role of Mitf is likely linked to the eye development, possibly proliferation within the eye. Consistent with this, the dMitf gene is most similar to the Mitf A form in vertebrates which has been shown to be an eye specific Mitf variant (Amae et al., 1998; Nguyen and Arnheiter, 2000; Bharti et al., 2008). The identification of Mitf in Drosophila and Mitf-like genes in other invertebrates shows that the gene must have arisen before the separation of these two phylogenic lineages.

5.2 Conservation of Mitf non-coding regions (Paper II) The Mitf gene has been identified in both vertebrates and invertebrates. Our conservation analysis on the Mitf gene and protein in distantly related species indicate a conserved function as is seen in our previous results regarding the conservation of dMitf in Drosophila and its function during eye development. The high conservation of the promoter and 3ÚTR regions also sheds new light on the conservation of the gene. The MITF protein plays many different roles in several cell types and needs to be highly and accurately regulated. Here we investigated the conservation of the promoter and 3ÚTR sequences of Mitf and add new information on how this transcription factor can potentially be regulated through these regions. The promoter regions in front of the nine 5éxons show high conservation, ranging from 25%-73% for each promoter. It should be taken into account that the promoter sequences were not identified in all the species analyzed. Similarly, potential binding sites for different transcription factors in the promoter regions are conserved, indicating their importance in the regulation of the multiple Mitf variants. The functionality of these transcription factor binding sites was not analyzed further. Interestingly, it has been shown that the CHX10 transcription factor regulates Mitf expression during eye development (Horsford et al., 2005) and it has been shown that there is affinity to the CHX10 binding sites in the 1D promoter (Bharti et al., 2006). In addition, the 1H variant also includes a CHX10

binding site (Bharti et al., 2008) although it was not identified in our conservation analysis. Furthermore, conservation of known, functionally important transcription factor binding sites within the 1M promoter confirms their importance.

5.3 miRNAs affecting Mitf (Paper III) The high conservation of the Mitf 3ÚTR sequence indicates functional importance of the 3ÚTR sequence. We show that at least two of the miRNAs that have conserved binding sites in the 3ÚTR of Mitf in 11 vertebrate species, miR-148 and miR-137, can lower endogenous MITF mRNA and protein levels. Both of these miRNAs have been implicated in melanoma. miR-137 has been shown to target the Mitf 3ÚTR sequence (Bemis et al., 2008), which we confirm with our analysis. miR-148b was inconsistently observed to be downregulated or upregulated in early melanoma progression, depending on the method used (Mueller et al., 2009). Here we provide a direct link between miR- 148 and Mitf. miR-137 can lower the endogenous MITF levels both at the mRNA and protein levels and the effects are inhibited by introducing anti-miR-137. The low endogenous expression of miR-137 in MeWo cells and the lack of miR-137 expression in 501mel cells are consistent with the fact that endogenous levels of MITF are higher in 501mel then in MeWo cells. miR-137 might therefore be a factor in lowering MITF expression in MeWo cells and in allowing higher levels in 501mel cells. Lack of miR-137 expression in HEK293 is consistent with the fact that miR-137 is able to effectively lower luciferase reporter expression in this cell line. However, no reduction is seen from the luciferase reporter in 501mel cells although no miR-137 expression is detected in these cells. It is possible that due to the high amount of MITF mRNA in these cells a higher amount of miR-137 is needed in order to detect changes from the luciferase reporter in this cell line. miR-148 lowers the endogenous MITF mRNA and protein levels in MeWo melanoma cells. The effect of miR-148 on endogenous MITF mRNA is reversed when anti-miR-148 is introduced. The effect of miR-148 is also reveresed when miR-148 and anti-miR-148 are co-transfected with the mMitf-3ÚTR-luciferase vector. Low expression of all three miRNAs that can bind to the miR-148/152 binding sites (miR-148a, miR-148b and miR-152) in both MeWo and 501mel cell lines indicates involvement in enabling high MITF levels in these cell lines.

75 Higher endogenous expression of miR-148a and miR-148b in HEK293 cells is consistent with our observations that overexpression of miR-148 in this cell types does not show an effect on luciferase reporter expression except at the highest level. Although miR-124/506 binding sites are located in the Mitf 3´UTR sequence and are highly conserved, miR-124 was not able to downregulate reporter gene expression or affect endogenous MITF mRNA levels in melanoma cells. A link between miR- 124 and MITF downregulation in melanoma cells was therefore not observed. miR- 124 was however able to upregulate luciferase expression. miR-124 was not able to upregulate Mitf at the mRNA level but incosistantly upregulation was observed at the protein level. It is possible that the miRNA is able to enhance translational efficiency without affecting the stability of the mRNA. miR-124 was not detected in any of the cell types used in our analysis. An interesting link between miR-124 and Mitf is the observation that miR-124 is expressed in the mammalian retina, which indicates a potential role of miR-124 in lowering Mitf expression in this tissue during eye development. Further testing is needed to analyze the role of miR-124 in this context. miR-506 which has also been predicted to bind to the same binding sites as miR- 124, has been linked to melanoma. miR-506 was upregulated during early melanoma progression and downregulated in metastatic melanoma cells (Mueller et al., 2009). Endogenous miR-506 expression was detected in MeWo and 501mel cells although at very low levels. An interesting possibility is that miR-506 might be a factor in regulating MITF levels in melanocytes/melanoma through these binding sites and that the same binding sites are used during eye development by miR-124. Therefore the endogenous miRNA expression in these two miRNAs in different cell types would determine MITF expression levels in the different cell types. This is a highly speculative hypothesis for the roles of these miRNAs and their link to MITF should be tested in more detail for confirmation. The miRNAs miR-27 and miR-32 did not lower Mitf expression in our system. miR-101 might potentially target Mitf, as it was able to lower reporter expression when high levels of miR-101 were used. This needs further testing. There are several ways in which altered miRNA expression and function can affect cancer development and progression in general. Loss of expression of tumor suppressor miRNA genes and overexpression of miRNAs with oncogenic function has been reported in various cancers, including melanoma. Lack of

endogenously expressed miR-137 and low expression of miR-148a, 148b and 152 in melanoma cells analyzed here supports the role of these miRNAs in regulating MITF mRNA levels. These miRNAs would have tumor suppressor roles in this context in keeping the level of MITF at appropriate levels. The absence of these miRNAs would allow higher levels of MITF, a known melanoma “lineage survival oncogene”. A model explaining the roles of MITF in melanocytes and melanomas has been proposed by two different groups (Wellbrock and Marais, 2005; Carreira et al., 2006). According to the model high levels of MITF direct the cells towards cell cycle arrest and differentiation and medium levels of MITF direct the cells towards survival and proliferation. Low MITF levels are associated with cell cycle arrest (Du et al., 2004) and apoptosis (McGill et al., 2002). Clearly, the regulation of MITF needs to be fine- tuned and highly regulated at each developmental time. Proliferation and survival are vital for early development wheras high levels would be necessary for pigmentation production after the melanocytes have invaded the epidermis and other sites where they are located. miRNAs are able to lower MITF levels and their role might therefore be important for regulating the exact levels of MITF needed for each function. During melanoma progression, misexpression of these miRNAs or loss of their binding sites within the Mitf-3ÚTR sequence would lead to disruption of their regulation of the MITF levels. Their low endogenous levels in the melanoma cells tested here would be consistent with this role. The miRNAs can function at different stages in development and melanoma formation and/or progression. Functional analysis is needed to further identify the role of miR-148 and miR-137 in melanocytes and melanoma cells. The role of these miRNAs in melanoma cell progression and metatstatic abilities of melanoma cells are also interesting and important to test for further understanding. Loss of 3ÚTR sequences due to alternative polyadenilation signals (PAS) and therefore loss of the miRNA binding sites might be a factor in leading to loss of miRNA regulation. The functional binding sites identified in our analysis for both miR-137 and miR-148 are located in close proximity to the 3énd of the 3ÚTR sequence. Interestingly, alternative PAS are located close to these binding sites (Fig. 15, in the Appendix and Fig. 1A in paper III) and subsequent loss of the 3ÚTR sequence located downstream of these PAS sites in melanoma cells would result in loss of these funtional binding sites leading to loss of MITF RNA level regulation by these miRNAs. It would be interesting to test if MITF

77 mRNAs of various lengths are present in different melanoma cells as well as in melanocytes and if shorter 3ÚTRs are consistent with MITF mRNA and protein levels in these cells. In fact, recently it was shown that MITF mRNAs with shorter 3ÚTR sequences were more common in melanoma cells than mRNAs with full length 3ÚTRs (Goswami et al., 2010). Here, miR-340 was involved in regulating the shorter transcripts. In addition, the RNA binding protein CRD-BP prevented miR-340 from binding to the 3ÚTR, showing that miRNAs are not acting alone in regulating MITF in this case. Interestingly the MITF protein has been shown to bind to the promoter region upstream of several miRNAs including miRNAs that also have conserved target sites in the Mitf 3ÚTR sequence. These are miR-148b, miR-92-2, miR-92b, miR-363 and miR-25/32/92/363/367 (Ozsolak et al., 2008). The fact that miR- 148 targets Mitf 3ÚTR and MITF can bind to the miR-148b promoter indicates a complex regulation between these two genes/factors, possibly a negative feedback loop where higher amounts of MITF lead to more miR-148 expression which in turn result in lower MITF protein to a desirable levels for the function of MITF. A potential role of miRNAs is to fine-tune mRNA and protein levels and even subtle amounts of miRNAs might lead to biological significance within the cell. This kind of a feedback loop might therefore be one possible method for making sure that the exact amount of MITF that is needed in the relevant cell surroundings is expressed. The discovery of miRNAs is a fascinating addition in the network of regulators that affect mRNA and protein levels in the cells both during development of normal cells and in the progression of cancer. Mitf has many roles in many different cell types and its long 3ÚTR sequence with number of potential miRNA binding sites is consistent with the multiple function of Mitf. The exact role of each of the miRNAs and in which cellular context they affect Mitf needs further analysis. miRNAs have both diagnostic and therapeutic potential and their role in melanoma and other cancer development is increasingly apparent (reviewed in Mirnezami et al., 2009; Mueller and Bosserhoff, 2009). Our analysis on miRNAs and Mitf may thus lead to novel information about the function of Mitf in both development and disease. In this thesis it has been shown the Mitf gene is conserved between vertebrates and Drosophila melanogaster. In Drosophila, dMitf is expressed in the peripodial layer, a cell layer located adjacent to the neural cells in the eye. This is similar to the expression of mouse Mitf in the RPE, a cell layer that is located

adjacent to the neural cells in the eye. The dMitf also has an affect on the eye development as it does in vertebrates. The non-coding regions of the Mitf gene, the 5ÚTR and 3ÚTR sequences are well conserved in vertebrates. Potential transcription factor binding sites were identified in the promoter sequences and potential miRNA binding sites in the 3ÚTR sequence. Several of the potential miRNA binding sites were conserved in all 11 vertebrate species analysed. miR- 148 and miR-137 were able to downregulate Mitf at both mRNA and protein level in melanoma cells and the functional binding sites in the Mitf 3ÚTR region were identified. miR-124 was unexpectively able to upregulate Mitf when analysed using mouseMitf-3ÚTRluciferase reporter construct. miRNA misexpression is observed in cancer. The level of specific or several miRNAs can therefore potentially be used for diagnosis of the cancer and/or cancer progression. miRNAs also have therapeutic potential as they are able to lower the levels of genes involved in cancer formation and progression. Mitf has been identified as a lineage survival gene in melanoma cells and identifying miRNAs that can downregulate its level therefore have a diagnostic and therapeutic potential in melanoma treatment.

79 80

REFERENCES

Altschmied, J., Delfgaauw, J., Wilde, B., Duschl, J., Bouneau, L., Volff, J.N., and Schartl, M. (2002). Subfunctionalization of duplicate mitf genes associated with differential degeneration of alternative exons in fish. Genetics 161, 259-267.

Altschul, S.F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol 215, 403-410.

Amae, S., Fuse, N., Yasumoto, K., Sato, S., Yajima, I., Yamamoto, H., Udono, T., Durlu, Y.K., Tamai, M., Takahashi, K., et al. (1998). Identification of a novel isoform of microphthalmia-associated transcription factor that is enriched in retinal pigment epithelium. Biochem Biophys Res Commun 247, 710-715.

Ambros, V. (2003). MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113, 673-676.

Amiel, J., Watkin, P.M., Tassabehji, M., Read, A.P., and Winter, R.M. (1998). Mutation of the MITF gene in albinism-deafness syndrome (Tietz syndrome). Clin Dysmorphol 7, 17-20.

Anger, M., Friedhofer, H., Fukutaki, M.F., Ferreira, M.C., and Landman, G. (2010). Primary cutaneous melanoma: an 18-year study. Clinics (Sao Paulo) 65, 257-263.

Atkins, M., and Mardon, G. (2009). Signaling in the third dimension: the peripodial epithelium in eye disc development. Dev Dyn 238, 2139-2148.

Bagnyukova, T.V., Pogribny, I.P., and Chekhun, V.F. (2006). MicroRNAs in normal and cancer cells: a new class of gene expression regulators. Exp Oncol 28, 263-269.

Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.

Bartel, D.P., and Chen, C.Z. (2004). Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs. Nat Rev Genet 5, 396-400.

81 Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions. Cell 136, 215-233.

Baumer, N., Marquardt, T., Stoykova, A., Spieler, D., Treichel, D., Ashery-Padan, R., and Gruss, P. (2003). Retinal pigmented epithelium determination requires the redundant activities of Pax2 and Pax6. Development 130, 2903-2915.

Bean, M.A., Bloom, B.R., Herberman, R.B., Old, L.J., Oettgen, H.F., Klein, G., and Terry, W.D. (1975). Cell-mediated cytotoxicity for bladder carcinoma: evaluation of a workshop. Cancer Res 35, 2902-2913.

Bemis, L.T., Chen, R., Amato, C.M., Classen, E.H., Robinson, S.E., Coffey, D.G., Erickson, P.F., Shellman, Y.G., and Robinson, W.A. (2008). MicroRNA-137 targets microphthalmia-associated transcription factor in melanoma cell lines. Cancer Res 68, 1362-1368.

Bentley, N.J., Eisen, T., and Goding, C.R. (1994). Melanocyte-specific expression of the human tyrosinase promoter: Activation by the microphthalmia gene product and role of the initiator. Mol Cell Biol 14, 7996-8006.

Bertolotto, C., Abbe, P., Hemesath, T.J., Bille, K., Fisher, D.E., Ortonne, J.P., and Ballotti, R. (1998a). Microphthalmia gene product as a signal transducer in cAMP-induced differentiation of melanocytes. J Cell Biol 142, 827-835.

Bertolotto, C., Busca, R., Abbe, P., Bille, K., Aberdam, E., Ortonne, J.P., and Ballotti, R. (1998b). Different cis-acting elements are involved in the regulation of TRP1 and TRP2 promoter activities by cyclic AMP: pivotal role of M boxes (GTCATGTGCT) and of microphthalmia. Mol Cell Biol 18, 694-702.

Beuret, L., Flori, E., Denoyelle, C., Bille, K., Busca, R., Picardo, M., Bertolotto, C., and Ballotti, R. (2007). Up-regulation of MET expression by alpha- melanocyte-stimulating hormone and MITF allows hepatocyte growth factor to protect melanocytes and melanoma cells from apoptosis. J Biol Chem 282, 14140-14147.

Bharti, K., Nguyen, M.T., Skuntz, S., Bertuzzi, S., and Arnheiter, H. (2006). The other pigment cell: specification and development of the pigmented epithelium of the vertebrate eye. Pigment Cell Res 19, 380-394.

Bharti, K., Liu, W., Csermely, T., Bertuzzi, S., and Arnheiter, H. (2008). Alternative promoter use in eye development: the complex role and regulation of the transcription factor MITF. Development 135, 1169-1178.

Bismuth, K., Skuntz, S., Hallsson, J.H., Pak, E., Dutra, A.S., Steingrimsson, E., and Arnheiter, H. (2008). An unstable targeted allele of the mouse Mitf gene with a high somatic and germline reversion rate. Genetics 178, 259-272.

Bondurand, N., Pingault, V., Goerich, D.E., Lemort, N., Sock, E., Caignec, C.L., Wegner, M., and Goossens, M. (2000). Interaction among SOX10, PAX3 and MITF, three genes altered in Waardenburg syndrome. Hum Mol Genet 9, 1907-1917.

Bora, N., Conway, S.J., Liang, H., and Smith, S.B. (1998). Transient overexpression of the Microphthalmia gene in the eyes of Microphthalmia vitiligo mutant mice. Dev Dyn 213, 283-292.

Bronner-Fraser, M. (1994). Neural crest cell formation and migration in the developing embryo. FASEB J 8, 699-706.

Bumsted, K.M., and Barnstable, C.J. (2000). Dorsal retinal pigment epithelium differentiates as neural retina in the microphthalmia (mi/mi) mouse. Invest Ophthalmol Vis Sci 41, 903-908.

Busca, R., and Ballotti, R. (2000). Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res 13, 60-69.

Busca, R., Berra, E., Gaggioli, C., Khaled, M., Bille, K., Marchetti, B., Thyss, R., Fitsialos, G., Larribere, L., Bertolotto, C., et al. (2005). Hypoxia-inducible factor 1{alpha} is a new target of microphthalmia-associated transcription factor (MITF) in melanoma cells. J Cell Biol 170, 49-59.

Calin, G.A. (2008). MicroRNAs in cancer: From abnormal biogenesis to druggable targets. MicroRNA Research Fundamentals, Reviews and Perspectives The 2008 Collection Booklet Exiqon, 72-84.

Carmell, M.A., Xuan, Z., Zhang, M.Q., and Hannon, G.J. (2002). The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev 16, 2733-2742.

83 Carreira, S., Liu, B., and Goding, C.R. (2000). The gene encoding the T-box factor Tbx2 is a target for the microphthalmia-associated transcription factor in melanocytes. J Biol Chem 275, 21920-21927.

Carreira, S., Goodall, J., Aksan, I., La Rocca, S.A., Galibert, M.D., Denat, L., Larue, L., and Goding, C.R. (2005). Mitf cooperates with Rb1 and activates p21Cip1 expression to regulate cell cycle progression. Nature 433, 764-769.

Carreira, S., Goodall, J., Denat, L., Rodriguez, M., Nuciforo, P., Hoek, K.S., Testori, A., Larue, L., and Goding, C.R. (2006). Mitf regulation of Dia1 controls melanoma proliferation and invasiveness. Genes Dev 20, 3426-3439.

Cho, K.O., Chern, J., Izaddoost, S., and Choi, K.W. (2000). Novel signaling from the peripodial membrane is essential for eye disc patterning in Drosophila. Cell 103, 331-342.

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156-159.

Cornish, D., Holterhues, C., van de Poll-Franse, L.V., Coebergh, J.W., and Nijsten, T. (2009). A systematic review of health-related quality of life in cutaneous melanoma. Ann Oncol 20 Suppl 6, vi51-58.

Cui, R., Widlund, H.R., Feige, E., Lin, J.Y., Wilensky, D.L., Igras, V.E., D'Orazio, J., Fung, C.Y., Schanbacher, C.F., Granter, S.R., et al. (2007). Central role of p53 in the suntan response and pathologic hyperpigmentation. Cell 128, 853-864.

Davies, H., Bignell, G.R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M.J., Bottomley, W., et al. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949-954.

Davis, I.J., and Fisher, D.E. (2007). MiT transcription factor associated malignancies in man. Cell Cycle 6, 1724-1729.

Doench, J.G., and Sharp, P.A. (2004). Specificity of microRNA target selection in translational repression. Genes Dev 18, 504-511.

Donner, A.L., and Maas, R.L. (2004). Conservation and non-conservation of genetic pathways in eye specification. Int J Dev Biol 48, 743-753.

Du, J., Miller, A.J., Widlund, H.R., Horstmann, M.A., Ramaswamy, S., and Fisher, D.E. (2003). MLANA/MART1 and SILV/PMEL17/GP100 are transcriptionally regulated by MITF in melanocytes and melanoma. Am J Pathol 163, 333-343.

Du, J., Widlund, H.R., Horstmann, M.A., Ramaswamy, S., Ross, K., Huber, W.E., Nishimura, E.K., Golub, T.R., and Fisher, D.E. (2004). Critical role of CDK2 for melanoma growth linked to its melanocyte-specific transcriptional regulation by MITF. Cancer Cell 6, 565-576.

Duursma, A.M., Kedde, M., Schrier, M., le Sage, C., and Agami, R. (2008). miR-148 targets human DNMT3b protein coding region. RNA 14, 872-877.

Eide, M.J., and Weinstock, M.A. (2005). Association of UV index, latitude, and melanoma incidence in nonwhite populations--US Surveillance, Epidemiology, and End Results (SEER) Program, 1992 to 2001. Arch Dermatol 141, 477-481.

Erclik, T., Hartenstein, V., McInnes, R.R., and Lipshitz, H.D. (2009). Eye evolution at high resolution: the neuron as a unit of homology. Dev Biol 332, 70-79.

Fabbri, M., Ivan, M., Cimmino, A., Negrini, M., and Calin, G.A. (2007). Regulatory mechanisms of microRNAs involvement in cancer. Expert Opin Biol Ther 7, 1009-1019.

Felicetti, F., Errico, M.C., Bottero, L., Segnalini, P., Stoppacciaro, A., Biffoni, M., Felli, N., Mattia, G., Petrini, M., Colombo, M.P., et al. (2008). The promyelocytic leukemia zinc finger-microRNA-221/-222 pathway controls melanoma progression through multiple oncogenic mechanisms. Cancer Res 68, 2745-2754.

Ferlay, J., Shin, H.R., Bray, F., Forman, D., Mathers, C., and Parkin, D.M. (2010). Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer.

Fisher, D.E., Parent, L.A., and Sharp, P.A. (1993). High affinity DNA-binding Myc analogs: recognition by an a helix. Cell 72, 467-476.

Furuta, Y., and Hogan, B.L. (1998). BMP4 is essential for lens induction in the mouse embryo. Genes Dev 12, 3764-3775.

85 Fuse, N., Yasumoto, K., Suzuki, H., Takahashi, K., and Shibahara, S. (1996). Identification of a melanocyte-type promoter of the microphthalmia-associated transcription factor gene. Biochem Biophys Res Comm 219, 702-707.

Fuse, N., Yasumoto, K., Takeda, K., Amae, S., Yoshizawa, M., Udono, T., Takahashi, K., Tamai, M., Tomita, Y., Tachibana, M., et al. (1999). Molecular cloning of cDNA encoding a novel microphthalmia-associated transcription factor isoform with a distinct amino-terminus. J Biochem (Tokyo) 126, 1043-1051.

Gandini, S., Sera, F., Cattaruzza, M.S., Pasquini, P., Picconi, O., Boyle, P., and Melchi, C.F. (2005). Meta-analysis of risk factors for cutaneous melanoma: II. Sun exposure. Eur J Cancer 41, 45-60.

Ganss, R., Schutz, G., and Beermann, F. (1994). The mouse tyrosinase gene. Promoter modulation by positive and negative regulatory elements. J Biol Chem 269, 29808-29816.

Garraway, L.A., Widlund, H.R., Rubin, M.A., Getz, G., Berger, A.J., Ramaswamy, S., Beroukhim, R., Milner, D.A., Granter, S.R., Du, J., et al. (2005). Integrative genomic analyses identify MITF as a lineage survival oncogene amplified in malignant melanoma. Nature 436, 117-122.

Garraway, L.A., and Sellers, W.R. (2006). From integrated genomics to tumor lineage dependency. Cancer Res 66, 2506-2508.

Gaur, A., Jewell, D.A., Liang, Y., Ridzon, D., Moore, J.H., Chen, C., Ambros, V.R., and Israel, M.A. (2007). Characterization of microRNA expression levels and their biological correlates in human cancer cell lines. Cancer Res 67, 2456-2468.

Gaur, V.P., Liu, Y., and Turner, J.E. (1992). RPE conditioned medium stimulates photoreceptor cell survival, neurite outgrowth and differentiation in vitro. Exp Eye Res 54, 645-659.

Gehring, W.J. (2005). New perspectives on eye development and the evolution of eyes and photoreceptors. J Hered 96, 171-184.

Giannakakis, A., Coukos, G., Hatzigeorgiou, A., Sandaltzopoulos, R., and Zhang, L. (2007). miRNA genetic alterations in human cancers. Expert Opin Biol Ther 7, 1375-1386.

Gibson, M.C., and Schubiger, G. (2000). Peripodial cells regulate proliferation and patterning of Drosophila imaginal discs. Cell 103, 343-350.

Gibson, M.C., Lehman, D.A., and Schubiger, G. (2002). Lumenal transmission of decapentaplegic in Drosophila imaginal discs. Dev Cell 3, 451-460.

Goswami, S., Tarpore, R.S., Teslaa, J.J., Grinblat, Y., Setaluri, V., and Spiegelman, V.S. (2010). microRNA-340-mediated degradation of microphthalmia- associated transcription factor (MITF) mRNA is inhibited by coding region determinant binding protein (CRD-BP). J Biol Chem.

Halder, G., Callaerts, P., and Gehring, W.J. (1995). Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science 267, 1788-1792.

Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41, 95-98.

Hallsson, J.H., Favor, J., Hodgkinson, C., Glaser, T., Lamoreux, M.L., Magnusdottir, R., Gunnarsson, G.J., Sweet, H.O., Copeland, N.G., Jenkins, N.A., et al. (2000). Genomic, transcriptional and mutational analysis of the mouse microphthalmia locus. Genetics 155, 291-300.

Hallsson, J.H., Haflidadottir, B.S., Schepsky, A., Arnheiter, H., and Stein- grimsson, E. (2007). Evolutionary sequence comparison of the Mitf gene reveals novel conserved domains. Pigment Cell Res 20, 185-200.

Hazelett, D.J., Bourouis, M., Walldorf, U., and Treisman, J.E. (1998). decapentaplegic and wingless are regulated by eyes absent and eyegone and interact to direct the pattern of retinal differentiation in the eye disc. Development 125, 3741-3751.

He, L., Thomson, J.M., Hemann, M.T., Hernando-Monge, E., Mu, D., Goodson, S., Powers, S., Cordon-Cardo, C., Lowe, S.W., Hannon, G.J., et al. (2005). A microRNA polycistron as a potential human oncogene. Nature 435, 828-833.

Hemesath, T.J., Steingrimsson, E., McGill, G., Hansen, M.J., Vaught, J., Hodgkinson, C.A., Arnheiter, H., Copeland, N.G., Jenkins, N.A., and Fisher, D.E. (1994). microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev 8, 2770-2780.

Hemesath, T.J., Price, E.R., Takemoto, C., Badalian, T., and Fisher, D.E. (1998). MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature 391, 298-301.

87 Hershey, C.L., and Fisher, D.E. (2005). Genomic analysis of the Microphthalmia locus and identification of the MITF-J/Mitf-J isoform. Gene 347, 73-82.

Hertwig, P. (1942). Neue Mutationen und Kopplungsgruppen bei der Hausmaus. Z Indukt Abstammungs-Vererbungsl 80, 220-246.

Hikata, T., Takaishi, H., Takito, J., Hakozaki, A., Furukawa, M., Uchikawa, S., Kimura, T., Okada, Y., Matsumoto, M., Yoshimura, A., et al. (2009). PIAS3 negatively regulates RANKL-mediated osteoclastogenesis directly in osteoclast precursors and indirectly via osteoblasts. Blood 113, 2202-2212.

Hodgkinson, C.A., Moore, K.J., Nakayama, A., Steingrimsson, E., Copeland, N.G., Jenkins, N.A., and Arnheiter, H. (1993). Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74, 395-404.

Hoek, K.S., Schlegel, N.C., Brafford, P., Sucker, A., Ugurel, S., Kumar, R., Weber, B.L., Nathanson, K.L., Phillips, D.J., Herlyn, M., et al. (2006). Metastatic potential of melanomas defined by specific gene expression profiles with no BRAF signature. Pigment Cell Res 19, 290-302.

Hoek, K.S., Eichhoff, O.M., Schlegel, N.C., Dobbeling, U., Kobert, N., Schaerer, L., Hemmi, S., and Dummer, R. (2008a). In vivo switching of human melanoma cells between proliferative and invasive states. Cancer Res 68, 650-656.

Hoek, K.S., Schlegel, N.C., Eichhoff, O.M., Widmer, D.S., Praetorius, C., Einarsson, S.O., Valgeirsdottir, S., Bergsteinsdottir, K., Schepsky, A., Dummer, R., et al. (2008b). Novel MITF targets identified using a two-step DNA microarray strategy. Pigment Cell Melanoma Res 21, 665-676.

Hornyak, T.J., Hayes, D.J., Chiu, L.Y., and Ziff, E.B. (2001). Transcription factors in melanocyte development: distinct roles for Pax-3 and Mitf. Mech Dev 101, 47-59.

Hornyak, T.J., Jiang, S., Guzman, E.A., Scissors, B.N., Tuchinda, C., He, H., Neville, J.D., and Strickland, F.M. (2009). Mitf dosage as a primary determinant of melanocyte survival after ultraviolet irradiation. Pigment Cell Melanoma Res 22, 307-318.

Horsford, D.J., Nguyen, M.T., Sellar, G.C., Kothary, R., Arnheiter, H., and McInnes, R.R. (2005). Chx10 repression of Mitf is required for the maintenance of mammalian neuroretinal identity. Development 132, 177-187.

Hua, Z., Lv, Q., Ye, W., Wong, C.K., Cai, G., Gu, D., Ji, Y., Zhao, C., Wang, J., Yang, B.B., et al. (2006). MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia. PLoS ONE 1, e116.

Huber, W.E., Price, E.R., Widlund, H.R., Du, J., Davis, I.J., Wegner, M., and Fisher, D.E. (2003). A tissue-restricted cAMP transcriptional response: SOX10 modulates alpha-melanocyte-stimulating hormone-triggered expression of microphthalmia-associated transcription factor in melanocytes. J Biol Chem 278, 45224-45230.

Hughes, M.J., Lingrel, J.B., Krakowsky, J.M., and Anderson, K.P. (1993). A helix-loop-helix transcription factor-like gene is located at the mi locus. J Biol Chem 268, 20687-20690.

Ito, S., and Wakamatsu, K. (2008). Chemistry of mixed melanogenesis--pivotal roles of dopaquinone. Photochem Photobiol 84, 582-592.

Jablonski, M.M., Tombran-Tink, J., Mrazek, D.A., and Iannaccone, A. (2000). Pigment epithelium-derived factor supports normal development of photoreceptor neurons and opsin expression after retinal pigment epithelium removal. J Neurosci 20, 7149-7157.

Jacquemin, P., Lannoy, V.J., O'Sullivan, J., Read, A., Lemaigre, F.P., and Rousseau, G.G. (2001). The transcription factor onecut-2 controls the microphthalmia-associated transcription factor gene. Biochem Biophys Res Commun 285, 1200-1205.

Kent, W.J. (2002). BLAT--the BLAST-like alignment tool. Genome Res 12, 656-664.

Kenyon, K.L., Ranade, S.S., Curtiss, J., Mlodzik, M., and Pignoni, F. (2003). Coordinating proliferation and tissue specification to promote regional identity in the Drosophila head. Dev Cell 5, 403-414.

Kim, T.H., Barrera, L.O., Zheng, M., Qu, C., Singer, M.A., Richmond, T.A., Wu, Y., Green, R.D., and Ren, B. (2005). A high-resolution map of active promoters in the human genome. Nature 436, 876-880.

89 Kimura, K., Wakamatsu, A., Suzuki, Y., Ota, T., Nishikawa, T., Yamashita, R., Yamamoto, J., Sekine, M., Tsuritani, K., Wakaguri, H., et al. (2006). Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res 16, 55-65.

Kitamura, Y., Morii, E., Jippo, T., and Ito, A. (2002). Regulation of mast cell phenotype by MITF. Int Arch Allergy Immunol 127, 106-109.

Krek, A., Grun, D., Poy, M.N., Wolf, R., Rosenberg, L., Epstein, E.J., MacMenamin, P., da Piedade, I., Gunsalus, K.C., Stoffel, M., et al. (2005). Combinatorial microRNA target predictions. Nat Genet 37, 495-500.

Kubo, A., Nakagawa, K., Varma, R.K., Conrad, N.K., Cheng, J.Q., Lee, W.C., Testa, J.R., Johnson, B.E., Kaye, F.J., and Kelley, M.J. (1999). The p16 status of tumor cell lines identifies small molecule inhibitors specific for cyclin-dependent kinase 4. Clin Cancer Res 5, 4279-4286.

Kumar, J.P. (2001). Signalling pathways in Drosophila and vertebrate retinal development. Nat Rev Genet 2, 846-857.

Kumar, J.P. (2009). The molecular circuitry governing retinal determination. Biochim Biophys Acta 1789, 306-314.

Kumasaka, M., Sato, H., Sato, S., Yajima, I., and Yamamoto, H. (2004). Isolation and developmental expression of Mitf in Xenopus laevis. Dev Dyn 230, 107-113.

Land, M.F. (2005). The optical structures of animal eyes. Curr Biol 15, R319-323.

Larribere, L., Hilmi, C., Khaled, M., Gaggioli, C., Bille, K., Auberger, P., Ortonne, J.P., Ballotti, R., and Bertolotto, C. (2005). The cleavage of microphthalmia-associated transcription factor, MITF, by caspases plays an essential role in melanocyte and melanoma cell apoptosis. Genes Dev 19, 1980-1985.

Lee, M., Goodall, J., Verastegui, C., Ballotti, R., and Goding, C.R. (2000). Direct regulation of the Microphthalmia promoter by Sox10 links Waardenburg-Shah syndrome (WS4)-associated hypopigmentation and deafness to WS2. J Biol Chem 275, 37978-37983.

Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843-854.

Lerner, A.B., Shiohara, T., Boissy, R.E., Jacobson, K.A., Lamoreux, M.L., and Moellmann, G.E. (1986). A mouse model for vitiligo. J Invest Dermatol 87, 299-304.

Levati, L., Alvino, E., Pagani, E., Arcelli, D., Caporaso, P., Bondanza, S., Di Leva, G., Ferracin, M., Volinia, S., Bonmassar, E., et al. (2009). Altered expression of selected microRNAs in melanoma: antiproliferative and proapoptotic activity of miRNA-155. Int J Oncol 35, 393-400.

Levy, C., Nechushtan, H., and Razin, E. (2002). A new role for the STAT3 inhibitor, PIAS3: a repressor of microphthalmia transcription factor. J Biol Chem 277, 1962-1966.

Levy, C., Khaled, M., and Fisher, D.E. (2006). MITF: master regulator of melanocyte development and melanoma oncogene. Trends Mol Med 12, 406-414.

Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., and Burge, C.B. (2003). Prediction of mammalian microRNA targets. Cell 115, 787-798.

Lewis, B.P., Burge, C.B., and Bartel, D.P. (2005). Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, 15-20.

Lim, L.P., Lau, N.C., Garrett-Engele, P., Grimson, A., Schelter, J.M., Castle, J., Bartel, D.P., Linsley, P.S., and Johnson, J.M. (2005). Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433, 769-773.

Lister, J.A., Robertson, C.P., Lepage, T., Johnson, S.L., and Raible, D.W. (1999). nacre encodes a zebrafish microphthalmia-related protein that regulates neural- crest-derived pigment cell fate. Development 126, 3757-3767.

Lister, J.A., Close, J., and Raible, D.W. (2001). Duplicate mitf genes in zebrafish: complementary expression and conservation of melanogenic potential. Dev Biol 237, 333-344.

91 Loercher, A.E., Tank, E.M., Delston, R.B., and Harbour, J.W. (2005). MITF links differentiation with cell cycle arrest in melanocytes by transcriptional activation of INK4A. J Cell Biol 168, 35-40.

Lu, J., Getz, G., Miska, E.A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Sweet- Cordero, A., Ebert, B.L., Mak, R.H., Ferrando, A.A., et al. (2005). MicroRNA expression profiles classify human cancers. Nature 435, 834-838.

Majoros, W.H., and Ohler, U. (2007). Spatial preferences of microRNA targets in 3' untranslated regions. BMC Genomics 8, 152.

Mak, S.S., Moriyama, M., Nishioka, E., Osawa, M., and Nishikawa, S. (2006). Indispensable role of Bcl2 in the development of the melanocyte stem cell. Dev Biol 291, 144-153.

Mansky, K.C., Marfatia, K., Purdom, G.H., Luchin, A., Hume, D.A., and Ostrowski, M.C. (2002a). The microphthalmia transcription factor (MITF) contains two N- terminal domains required for transactivation of osteoclast target promoters and rescue of mi mutant osteoclasts. J Leukoc Biol 71, 295-303.

Mansky, K.C., Sankar, U., Han, J., and Ostrowski, M.C. (2002b). Microphthalmia transcription factor is a target of the p38 MAPK pathway in response to receptor activator of NF-kappa B ligand signaling. J Biol Chem 277, 11077-11083.

Mayr, C., and Bartel, D.P. (2009). Widespread shortening of 3'UTRs by alternative cleavage and polyadenylation activates oncogenes in cancer cells. Cell 138, 673-684.

McGill, G.G., Horstmann, M., Widlund, H.R., Du, J., Motyckova, G., Nishimura, E.K., Lin, Y.L., Ramaswamy, S., Avery, W., Ding, H.F., et al. (2002). Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability. Cell 109, 707-718.

McGill, G.G., Haq, R., Nishimura, E.K., and Fisher, D.E. (2006). c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem 281, 10365-10373.

Miller, A.J., Levy, C., Davis, I.J., Razin, E., and Fisher, D.E. (2005). Sumoylation of MITF and its related family members TFE3 and TFEB. J Biol Chem 280, 146-155.

Miller, A.J., and Mihm, M.C., Jr. (2006). Melanoma. N Engl J Med 355, 51-65.

Mirnezami, A.H., Pickard, K., Zhang, L., Primrose, J.N., and Packham, G. (2009). MicroRNAs: key players in carcinogenesis and novel therapeutic targets. Eur J Surg Oncol 35, 339-347.

Mitra, D., and Fisher, D.E. (2009). Transcriptional regulation in melanoma. Hematol Oncol Clin North Am 23, 447-465, viii.

Moore, K.J. (1995). Insight into the microphthalmia gene. Trends Genet 11, 442-448.

Mueller, D.W., and Bosserhoff, A.K. (2009). Role of miRNAs in the progression of malignant melanoma. Br J Cancer 101, 551-556.

Mueller, D.W., Rehli, M., and Bosserhoff, A.K. (2009). miRNA expression profiling in melanocytes and melanoma cell lines reveals miRNAs associated with formation and progression of malignant melanoma. J Invest Dermatol 129, 1740-1751.

Murakami, H., and Arnheiter, H. (2005). Sumoylation modulates transcriptional activity of MITF in a promoter-specific manner. Pigment Cell Res 18, 265-277.

Murre, C., McCaw, P.S., Vaessin, H., Caudy, M., Jan, L.Y., Jan, Y.N., Cabrera, C.V., Buskin, J.N., Hauschka, S.D., Lassar, A.B., et al. (1989). Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58, 537-544.

Murre, C., Bain, G., van Dijk, M.A., Engel, I., Furnari, B.A., Massari, M.E., Matthews, J.R., Quong, M.W., Rivera, R.R., and Stuiver, M.H. (1994). Structure and function of helix-loop-helix proteins. Biochim Biophys Acta 1218, 129-135.

Nakamura, M., Tobin, D.J., Richards-Smith, B., Sundberg, J.P., and Paus, R. (2002). Mutant laboratory mice with abnormalities in pigmentation: annotated tables. J Dermatol Sci 28, 1-33.

Nakayama, A., Nguyen, M.T., Chen, C.C., Opdecamp, K., Hodgkinson, C.A., and Arnheiter, H. (1998). Mutations in microphthalmia, the mouse homolog of the human deafness gene MITF, affect neuroepithelial and neural crest- derived melanocytes differently. Mech Dev 70, 155-166.

93 Nam, J.W., Shin, K.R., Han, J., Lee, Y., Kim, V.N., and Zhang, B.T. (2005). Human microRNA prediction through a probabilistic co-learning model of sequence and structure. Nucleic Acids Res 33, 3570-3581.

Navon, R., Wang, H., Steinfeld, I., Tsalenko, A., Ben-Dor, A., and Yakhini, Z. (2009). Novel rank-based statistical methods reveal microRNAs with differential expression in multiple cancer types. PLoS One 4, e8003.

Nguyen, M., and Arnheiter, H. (2000). Signaling and transcriptional regulation in early mammalian eye development: a link between FGF and MITF. Development 127, 3581-3591.

Nishimura, E.K., Jordan, S.A., Oshima, H., Yoshida, H., Osawa, M., Moriyama, M., Jackson, I.J., Barrandon, Y., Miyachi, Y., and Nishikawa, S. (2002). Dominant role of the niche in melanocyte stem-cell fate determination. Nature 416, 854-860.

Nishimura, E.K., Granter, S.R., and Fisher, D.E. (2005). Mechanisms of hair graying: incomplete melanocyte stem cell maintenance in the niche. Science 307, 720-724.

Nolan, T., Hands, R.E., and Bustin, S.A. (2006). Quantification of mRNA using real-time RT-PCR. Nat Protoc 1, 1559-1582.

Oboki, K., Morii, E., Kataoka, T.R., Jippo, T., and Kitamura, Y. (2002). Isoforms of mi transcription factor preferentially expressed in cultured mast cells of mice. Biochem Biophys Res Commun 290, 1250-1254.

Okamura, K., Phillips, M.D., Tyler, D.M., Duan, H., Chou, Y.T., and Lai, E.C. (2008). The regulatory activity of microRNA* species has substantial influence on microRNA and 3' UTR evolution. Nat Struct Mol Biol 15, 354-363.

Opdecamp, K., Nakayama, A., Nguyen, M.T., Hodgkinson, C.A., Pavan, W.J., and Arnheiter, H. (1997). Melanocyte development in vivo and in neural crest cell cultures: crucial dependence on the Mitf basic-helix-loop-helix- zipper transcription factor. Development 124, 2377-2386.

Opdecamp, K., Vanvooren, P., Riviere, M., Arnheiter, H., Motta, R., Szpirer, J., and Szpirer, C. (1998). The rat microphthalmia-associated transcription factor gene (Mitf) maps at 4q34-q41 and is mutated in the mib rats. Mamm Genome 9, 617-621.

Ovcharenko, I., Loots, G.G., Giardine, B.M., Hou, M., Ma, J., Hardison, R.C., Stubbs, L., and Miller, W. (2005). Mulan: multiple-sequence local alignment and visualization for studying function and evolution. Genome Res 15, 184-194.

Ozsolak, F., Poling, L.L., Wang, Z., Liu, H., Liu, X.S., Roeder, R.G., Zhang, X., Song, J.S., and Fisher, D.E. (2008). Chromatin structure analyses identify miRNA promoters. Genes Dev 22, 3172-3183.

Palmieri, G., Capone, M., Ascierto, M.L., Gentilcore, G., Stroncek, D.F., Casula, M., Sini, M.C., Palla, M., Mozzillo, N., and Ascierto, P.A. (2009). Main roads to melanoma. J Transl Med 7, 86.

Pillai, R.S. (2005). MicroRNA function: multiple mechanisms for a tiny RNA? Rna 11, 1753-1761.

Planque, N., Leconte, L., Coquelle, F.M., Martin, P., and Saule, S. (2001). Specific Pax-6/microphthalmia transcription factor interactions involve their DNA-binding domains and inhibit transcriptional properties of both proteins. J Biol Chem 276, 29330-29337.

Potterf, S.B., Furumura, M., Dunn, K.J., Arnheiter, H., and Pavan, W.J. (2000). Transcription factor hierarchy in Waardenburg syndrome: regulation of MITF expression by SOX10 and PAX3. Hum Genet 107, 1-6.

Price, E.R., Horstmann, M.A., Wells, A.G., Weilbaecher, K.N., Takemoto, C.M., Landis, M.W., and Fisher, D.E. (1998). alpha-Melanocyte-stimulating hormone signaling regulates expression of microphthalmia, a gene deficient in Waardenburg syndrome. J Biol Chem 273, 33042-33047.

Primot, A., Mogha, A., Corre, S., Roberts, K., Debbache, J., Adamski, H., Dreno, B., Khammari, A., Lesimple, T., Mereau, A., et al. (2009). ERK- regulated differential expression of the Mitf 6a/b splicing isoforms in melanoma. Pigment Cell Melanoma Res.

Raimondi, S., Sera, F., Gandini, S., Iodice, S., Caini, S., Maisonneuve, P., and Fargnoli, M.C. (2008). MC1R variants, melanoma and red hair color phenotype: a meta-analysis. Int J Cancer 122, 2753-2760.

Rajewsky, N. (2006). microRNA target predictions in animals. Nat Genet 38 Suppl, S8-13.

95 Raymond, S.M., and Jackson, I.J. (1995). The retinal pigmented epithelium is required for development and maintenance of the mouse neural retina. Curr Biol 5, 1286-1295.

Read, A.P., and Newton, V.E. (1997). Waardenburg Syndrome. J Med Genet 34, 656-665.

Rehli, M., Den Elzen, N., Cassady, A.I., Ostrowski, M.C., and Hume, D.A. (1999). Cloning and characterization of the murine genes for bHLH-ZIP transcription factors TFEC and TFEB reveal a common gene organization for all MiT subfamily members. Genomics 56, 111-120.

Roignant, J.Y., and Treisman, J.E. (2009). Pattern formation in the Drosophila eye disc. Int J Dev Biol 53, 795-804.

Roundy, K., Kollhoff, A., Eichwald, E.J., Weis, J.J., and Weis, J.H. (1999). Microphthalmic mice display a B cell deficiency similar to that seen for mast and NK cells. J Immunol 163, 6671-6678.

Rowan, S., Chen, C.M., Young, T.L., Fisher, D.E., and Cepko, C.L. (2004). Transdifferentiation of the retina into pigmented cells in ocular retardation mice defines a new function of the homeodomain gene Chx10. Development 131, 5139-5152.

Ruby, J.G., Jan, C.H., and Bartel, D.P. (2007). Intronic microRNA precursors that bypass Drosha processing. Nature 448, 83-86.

Saetrom, P., Heale, B.S., Snove, O., Jr., Aagaard, L., Alluin, J., and Rossi, J.J. (2007). Distance constraints between microRNA target sites dictate efficacy and cooperativity. Nucleic Acids Res 35, 2333-2342.

Saito, H., Yasumoto, K., Takeda, K., Takahashi, K., Fukuzaki, A., Orikasa, S., and Shibahara, S. (2002). Melanocyte-specific microphthalmia-associated transcription factor isoform activates its own gene promoter through physical interaction with lymphoid-enhancing factor 1. J Biol Chem 277, 28787-28794.

Salti, G.I., Manougian, T., Farolan, M., Shilkaitis, A., Majumdar, D., and Das Gupta, T.K. (2000). Micropthalmia transcription factor: a new prognostic marker in intermediate-thickness cutaneous malignant melanoma. Cancer Res 60, 5012-5016.

Satzger, I., Mattern, A., Kuettler, U., Weinspach, D., Voelker, B., Kapp, A., and Gutzmer, R. (2010). MicroRNA-15b represents an independent prognostic parameter and is correlated with tumor cell proliferation and apoptosis in malignant melanoma. Int J Cancer 126, 2553-2562.

Segura, M.F., Hanniford, D., Menendez, S., Reavie, L., Zou, X., Alvarez-Diaz, S., Zakrzewski, J., Blochin, E., Rose, A., Bogunovic, D., et al. (2009). Aberrant miR-182 expression promotes melanoma metastasis by repressing FOXO3 and microphthalmia-associated transcription factor. Proc Natl Acad Sci U S A 106, 1814-1819.

Segura, M.F., Belitskaya-Levy, I., Rose, A.E., Zakrzewski, J., Gaziel, A., Hanniford, D., Darvishian, F., Berman, R.S., Shapiro, R.L., Pavlick, A.C., et al. (2010). Melanoma MicroRNA signature predicts post-recurrence survival. Clin Cancer Res 16, 1577-1586.

Selzer, E., Wacheck, V., Lucas, T., Heere-Ress, E., Wu, M., Weilbaecher, K.N., Schlegel, W., Valent, P., Wrba, F., Pehamberger, H., et al. (2002). The melanocyte-specific isoform of the microphthalmia transcription factor affects the phenotype of human melanoma. Cancer Res 62, 2098-2103.

Sheedlo, H.J., Li, L., and Turner, J.E. (1992). Effects of RPE-cell factors secreted from permselective fibers on retinal cells in vitro. Brain Res 587, 327-337.

Sheedlo, H.J., and Turner, J.E. (1998). Immunocytochemical characterisation of proteins secreted by retinal pigment epithelium in retinas of normal and Royal College of Surgeons dystrophic rats. J Anat 193, 223-232.

Shiohara, M., Shigemura, T., Suzuki, T., Tanaka, M., Morii, E., Ohtsu, H., Shibahara, S., and Koike, K. (2009). MITF-CM, a newly identified isoform of microphthalmia-associated transcription factor, is expressed in cultured mast cells. Int J Lab Hematol 31, 215-226.

Slezak-Prochazka, I., Durmus, S., Kroesen, B.J., and van den Berg, A. (2010). MicroRNAs, macrocontrol: Regulation of miRNA processing. RNA.

Smith, S.D., Kelley, P.M., Kenyon, J.B., and Hoover, D. (2000). Tietz syndrome (hypopigmentation/deafness) caused by mutation of MITF. J Med Genet 37, 446-448.

97 Steingrimsson, E., Moore, K.J., Lamoreux, M.L., Ferre-D'Amare, A.R., Burley, S.K., Zimring, D.C., Skow, L.C., Hodgkinson, C.A., Arnheiter, H., Copeland, N.G., et al. (1994). Molecular basis of mouse microphthalmia (mi) mutations helps explain their developmental and phenotypic consequences. Nat Genet 8, 256-263.

Steingrimsson, E., Nii, A., Fisher, D.E., Ferre-D'Amare, A.R., McCormick, R.J., Russell, L.B., Burley, S.K., Ward, J.M., Jenkins, N.A., and Copeland, N.G. (1996). The semidominant Mi(b) mutation identifies a role for the HLH domain in DNA binding in addition to its role in protein dimerization. EMBO J 15, 6280-6289.

Steingrimsson, E., Tessarollo, L., Reid, S.W., Jenkins, N.A., and Copeland, N.G. (1998). The bHLH-Zip transcription factor Tfeb is essential for placental vascularization. Development 125, 4607-4616.

Steingrimsson, E., Arnheiter, H., Hallsson, J.H., Lamoreux, M.L., Copeland, N.G., and Jenkins, N.A. (2003). Interallelic complementation at the mouse Mitf locus. Genetics 163, 267-276.

Steingrimsson, E., Copeland, N.G., and Jenkins, N.A. (2004). Melanocytes and the microphthalmia transcription factor network. Annu Rev Genet 38, 365-411.

Steingrimsson, E. (2008). All for one, one for all: alternative promoters and Mitf. Pigment Cell Melanoma Res 21, 412-414.

Sturm, R.A. (2009). Molecular genetics of human pigmentation diversity. Hum Mol Genet 18, R9-17.

Tachibana, M., Hara, Y., Vyas, D., Hodgkinson, C., Fex, J., Grundfast, K., and Arnheiter, H. (1992). Cochlear disorder associated with melanocyte anomaly in mice with a transgenic insertional mutation. Mol Cell Neurosci 3, 433-445.

Tachibana, M., Perez-Jurado, L.A., Nakayama, A., Hodgkinson, C.A., Li, X., Schneider, M., Miki, T., Fex, J., Francke, U., and Arnheiter, H. (1994). Cloning of MITF, the human homolog of the mouse microphthalmia gene and assignment to chromosome 3p14.1-p12.3. Hum Mol Genet 3, 553-557.

Tachibana, M. (2000). MITF: a stream flowing for pigment cells. Pigment Cell Res 13, 230-240.

Tachibana, M. (2001). Cochlear melanocytes and MITF signaling. J Investig Dermatol Symp Proc 6, 95-98.

Takebayashi, K., Chida, K., Tsukamoto, I., Morii, E., Munakata, H., Arnheiter, H., Kuroki, T., Kitamura, Y., and Nomura, S. (1996). The recessive phenotype displayed by a dominant negative microphthalmia-associated transcription factor mutant is a result of impaired nucleation potential. Mol Cell Biol 16, 1203-1211.

Takeda, K., Takemoto, C., Kobayashi, I., Watanabe, A., Nobukuni, Y., Fisher, D.E., and Tachibana, M. (2000a). Ser298 of MITF, a mutation site in Waardenburg syndrome type 2, is a phosphorylation site with functional significance. Hum Mol Genet 9, 125-132.

Takeda, K., Yasumoto, K., Takada, R., Takada, S., Watanabe, K., Udono, T., Saito, H., Takahashi, K., and Shibahara, S. (2000b). Induction of melanocyte-specific microphthalmia-associated transcription factor by Wnt- 3a. J Biol Chem 275, 14013-14016.

Takeda, K., Yasumoto, K., Kawaguchi, N., Udono, T., Watanabe, K., Saito, H., Takahashi, K., Noda, M., and Shibahara, S. (2002). Mitf-D, a newly identified isoform, expressed in the retinal pigment epithelium and monocyte-lineage cells affected by Mitf mutations. Biochim Biophys Acta 1574, 15-23.

Takemoto, C.M., Yoon, Y.J., and Fisher, D.E. (2002). The identification and functional characterization of a novel mast cell isoform of the microphthalmia- associated transcription factor. J Biol Chem 277, 30244-30252.

Tang, G. (2005). siRNA and miRNA: an insight into RISCs. Trends Biochem Sci 30, 106-114.

Thomas, A.J., and Erickson, C.A. (2008). The making of a melanocyte: the specification of melanoblasts from the neural crest. Pigment Cell Melanoma Res 21, 598-610.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680.

99 Tomari, Y., and Zamore, P.D. (2005). MicroRNA biogenesis: drosha can't cut it without a partner. Curr Biol 15, R61-64.

Tsao, H., Atkins, M.B., and Sober, A.J. (2004). Management of cutaneous melanoma. N Engl J Med 351, 998-1012.

Tsukiji, N., Nishihara, D., Yajima, I., Takeda, K., Shibahara, S., and Yamamoto, H. (2009). Mitf functions as an in ovo regulator for cell differentiation and proliferation during development of the chick RPE. Dev Biol 326, 335-346.

Udono, T., Yasumoto, K., Takeda, K., Amae, S., Watanabe, K., Saito, H., Fuse, N., Tachibana, M., Takahashi, K., Tamai, M., et al. (2000). Structural organization of the human microphthalmia-associated transcription factor gene containing four alternative promoters. Biochim Biophys Acta 1491, 205-219.

Ugurel, S., Houben, R., Schrama, D., Voigt, H., Zapatka, M., Schadendorf, D., Brocker, E.B., and Becker, J.C. (2007). Microphthalmia-associated transcription factor gene amplification in metastatic melanoma is a prognostic marker for patient survival, but not a predictive marker for chemosensitivity and chemotherapy response. Clin Cancer Res 13, 6344-6350.

Vachtenheim, J., and Novotna, H. (1999). Expression of genes for microphthalmia isoforms, Pax3 and MSG1, in human melanomas. Cell Mol Biol (Noisy-le-grand) 45, 1075-1082.

Vachtenheim, J., Novotna, H., and Ghanem, G. (2001). Transcriptional repression of the microphthalmia gene in melanoma cells correlates with the unresponsiveness of target genes to ectopic microphthalmia-associated transcription factor. J Invest Dermatol 117, 1505-1511.

Vance, K.W., Carreira, S., Brosch, G., and Goding, C.R. (2005). Tbx2 is overexpressed and plays an important role in maintaining proliferation and suppression of senescence in melanomas. Cancer Res 65, 2260-2268.

Veis, D.J., Sorenson, C.M., Shutter, J.R., and Korsmeyer, S.J. (1993). Bcl-2- deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell 75, 229-240.

Vella, M.C., Choi, E.Y., Lin, S.Y., Reinert, K., and Slack, F.J. (2004). The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3'UTR. Genes Dev 18, 132-137.

100

Verastegui, C., Bille, K., Ortonne, J.P., and Ballotti, R. (2000). Regulation of the microphthalmia-associated transcription factor gene by the Waardenburg syndrome type 4 gene, SOX10. J Biol Chem 275, 30757-30760.

Wang, X., and Wang, X. (2006). Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res 34, 1646- 1652.

Watanabe, A., Takeda, K., Ploplis, B., and Tachibana, M. (1998). Epistatic relationship between Waardenburg syndrome genes MITF and PAX3. Nature Genetics 18, 283-286.

Wawersik, S., and Maas, R.L. (2000). Vertebrate eye development as modeled in Drosophila. Hum Mol Genet 9, 917-925.

Weilbaecher, K.N., Hershey, C.L., Takemoto, C.H., Horstmann, M.A., Hemesath, T.J., Tashjian, A.H., and Fisher, D.E. (1998). Age-resolving osteopetrosis: A rat model implicating microphthalmia and the related transcription factor TFE3. J Exp Med 187, 775-785.

Wellbrock, C., and Marais, R. (2005). Elevated expression of MITF counteracts B- RAF-stimulated melanocyte and melanoma cell proliferation. J Cell Biol 170, 703-708.

Wellbrock, C., Rana, S., Paterson, H., Pickersgill, H., Brummelkamp, T., and Marais, R. (2008). Oncogenic BRAF regulates melanoma proliferation through the lineage specific factor MITF. PLoS One 3, e2734.

Wellbrock, C., and Hurlstone, A. (2010). BRAF as therapeutic target in melanoma. Biochem Pharmacol 80, 561-567.

Widlund, H.R., Horstmann, M.A., Price, E.R., Cui, J., Lessnick, S.L., Wu, M., He, X., and Fisher, D.E. (2002). Beta-catenin-induced melanoma growth requires the downstream target Microphthalmia-associated transcription factor. J Cell Biol 158, 1079-1087.

Worley, L.A., Long, M.D., Onken, M.D., and Harbour, J.W. (2008). Micro- RNAs associated with metastasis in uveal melanoma identified by multiplexed microarray profiling. Melanoma Res 18, 184-190.

101 Wu, M., Hemesath, T.J., Takemoto, C.M., Horstmann, M.A., Wells, A.G., Price, E.R., Fisher, D.Z., and Fisher, D.E. (2000). c-Kit triggers dual phosphorylations, which couple activation and degradation of the essential melanocyte factor Mi. Genes Dev 14, 301-312.

Xu, S., Witmer, P.D., Lumayag, S., Kovacs, B., and Valle, D. (2007). MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster. J Biol Chem 282, 25053-25066.

Xu, W., Gong, L., Haddad, M.M., Bischof, O., Campisi, J., Yeh, E.T., and Medrano, E.E. (2000). Regulation of microphthalmia-associated transcription factor MITF protein levels by association with the ubiquitin- conjugating enzyme hUBC9. Exp Cell Res 255, 135-143.

Yajima, I., Sato, S., Kimura, T., Yasumoto, K., Shibahara, S., Goding, C.R., and Yamamoto, H. (1999). An L1 element intronic insertion in the black-eyed white (Mitf mi-bw) gene: the loss of a single Mitf isoform responsible for the pigmentary defect and inner ear deafness. Human Molecular Genetics 8, 1431-1441.

Yajima, I., Endo, K., Sato, S., Toyoda, R., Wada, H., Shibahara, S., Numakunai, T., Ikeo, K., Gojobori, T., Goding, C.R., et al. (2003). Cloning and functional analysis of ascidian Mitf in vivo: insights into the origin of vertebrate pigment cells. Mech Dev 120, 1489-1504.

Yan, D., Zhou, X., Chen, X., Hu, D.N., Dong, X.D., Wang, J., Lu, F., Tu, L., and Qu, J. (2009). MicroRNA-34a inhibits uveal melanoma cell proliferation and migration through downregulation of c-Met. Invest Ophthalmol Vis Sci 50, 1559-1565.

Yasumoto, K., Yokoyama, K., Shibata, K., Tomita, Y., and Shibahara, S. (1994). Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene. Mol Cell Biol 14, 8058-8070.

Yasumoto, K., Yokoyama, K., Takahashi, K., Tomita, Y., and Shibahara, S. (1997). Functional analysis of microphthalmia-associated transcription factor in pigment cell-specific transcription of the human tyrosinase family genes. J Biol Chem 272, 503-509.

102

Yasumoto, K., Amae, S., Udono, T., Fuse, N., Takeda, K., and Shibahara, S. (1998). A big gene linked to small eyes encodes multiple Mitf isoforms: many promoters make light work. Pigment Cell Res 11, 329-336.

Yekta, S., Shih, I.H., and Bartel, D.P. (2004). MicroRNA-directed cleavage of HOXB8 mRNA. Science 304, 594-596.

Zhu, Z., He, J., Jia, X., Jiang, J., Bai, R., Yu, X., Lv, L., Fan, R., He, X., Geng, J., et al. (2009). MicroRNA-25 functions in regulation of pigmentation by targeting the transcription factor MITF in Alpaca (Lama pacos) skin melanocytes. Domest Anim Endocrinol 38, 200-209.

103 104

APPENDIX

Figure 15. Conservation of the Mitf 3´UTR sequence in vertebrate species. Conserved miRNA binding sites and polyadenilation signals are shown in boxes. Conserved bases are shown with dots, lines: corresponding bases are not found in that sequence.

105

106

miR-27

miR-124/506 A

107

108

miR-25/32/92/363/367

miR-124/506 B

miR-148//152 A

109

110

miR-137 A

miR-137 B

PAS miR-137 C

miR-148/152 B

111 miR-101/144

miR-137 D PAS

112

Figure 16. Conservation of intron 6 in the Mitf gene.

Conserved bases are shown with dots, lines: corresponding bases are not found in that sequence.

113 Figure 17. Conservation of intron 7 in the Mitf gene.

Conserved bases are shown with dots, lines: corresponding bases are not found in that sequence.

114

115 Figure 18. Conservation of the dMitf 3´UTR sequence

Conserved bases are shown with dots, lines: corresponding bases are not found in that sequence.

116

117 118

119

120

ORIGINAL PAPERS

121

122

Paper I

123 124 Copyright  2004 by the Genetics Society of America

The Basic Helix-Loop-Helix Leucine Zipper Transcription Factor Mitf Is Conserved in Drosophila and Functions in Eye Development

Joń H. Hallsson,*,† Benedikta S. Haflidado´ttir,*,‡ Chad Stivers,§ Ward Odenwald,§ Heinz Arnheiter,† Francesca Pignoni‡,1 and Eirı´kur Steingrı´msson* *Biochemistry and Molecular Biology, Faculty of Medicine, University of Iceland, 101 Reykjavı´k, Iceland, †Laboratory of Developmental Neurogenetics, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20892, ‡Harvard Medical School and Massachusetts Eye and Ear Infirmary, Boston, Massachusetts 02114 and §Neural Cell-Fate Determinants Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20892 Manuscript received July 23, 2003 Accepted for publication January 20, 2004

ABSTRACT The MITF protein is a member of the MYC family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors and is most closely related to the TFE3, TFEC, and TFEB proteins. In the mouse, MITF is required for the development of several different cell types, including the retinal pigment epithelial (RPE) cells of the eye. In Mitf mutant mice, the presumptive RPE cells hyperproliferate, abnormally express the retinal transcriptional regulator Pax6, and form an ectopic neural retina. Here we report the structure of the Mitf gene in Drosophila and demonstrate expression during embryonic development and in the eye- antennal imaginal disc. In vitro, transcriptional regulation by Drosophila Mitf, like its mouse counterpart, is modiﬁed by the Eyeless (Drosophila Pax6) transcription factor. In vivo, targeted expression of wild-type or dominant-negative Drosophila Mitf results in developmental abnormalities reminiscent of Mitf function in mouse eye development. Our results suggest that the Mitf gene is the original member of the Mitf- Tfe subfamily of bHLH-Zip proteins and that its developmental function is at least partially conserved between vertebrates and invertebrates. These ﬁndings further support the common origin of the vertebrate and invertebrate eyes.

YE development in both vertebrates and inverte- tionships are conserved (reviewed in Wawersik and E brates involves precise patterning and cell fate deci- Maas 2000). Thus, early aspects of retinal development sions that require the activities of several evolutionarily in both vertebrates and invertebrates may be regulated conserved transcription factors. Among these, the Pax6 by a conserved set of transcription factors. gene provides a striking example (Quiring et al. 1994; An important regulator of early eye development in Halder et al. 1995). The DNA-binding domains of Pax6 the mouse is the microphthalmia-associated transcription (paired box and homeodomain) are highly conserved factor (Mitf). The Mitf gene is a member of the MYC through evolution and mutations in the gene affect eye supergene family of basic helix-loop-helix leucine zipper development in species as diverse as humans, mice, and (bHLH-Zip) transcription factors (Hodgkinson et al. Drosophila (reviewed in Gehring and Ikeo 1999). In 1993; Hughes et al. 1993) and can regulate target gene addition to Pax6, other genes expressed and/or required transcription through the canonical CANNTG E-box during early eye development are conserved between sequence (Hemesath et al. 1994). Mitf function is re- flies and vertebrates, including the transcription factors quired not only during eye development but also in sine oculis, optix, eyes absent, and dachshund (reviewed in different cell types, including melanocytes, osteoclasts, Wawersik and Maas 2000). Genetic, molecular, and and mast cells (reviewed in Moore 1995). Mitf has biochemical investigations suggest that some of these been shown to regulate genes controlling pigment syn- nuclear factors assemble into transcriptional complexes thesis, such as tyrosinase, tyrosinase-related protein-1 and -2 and form a specific hierarchy involved in the establish- (reviewed by Goding 2000), osteoclast-specific genes, ment of a “retinal” fate. Studies performed in mamma- such as TRAP (Luchin et al. 2000) and cathepsin-K lian systems suggest that some of these regulatory rela- (Motyckova et al. 2001), and mouse mast cell proteases (Kitamura et al. 2000). Although the role of this gene during eye development has been characterized, no tis- Sequence data from this article have been deposited with the sue-specific targets of Mitf have been identified. EMBL/GenBank Data Libraries under accession no. AY271259. The lack of Mitf function during mouse eye develop- 1Corresponding author: Department of Ophthalmology, Harvard Med- ment results in reduced eye size or microphthalmia in the ical School and Massachusetts Eye and Ear Infirmary, #507, 243 Charles St., Boston, MA 02114. adult animal. In mouse embryos homozygous for loss- E-mail: [email protected] of-function mutations at the locus (such as Mitf mi-vga9 and

Genetics 167: 233–241 (May 2004)

125 234 J. H. Hallsson et al.

Mitf mi-eyless-white), formation of the optic vesicle and cup taining the 5Ј part of Mitf and a totally unrelated cDNA. By occurs at the expected stage. However, the partitioning blasting the full-length LD45277 cDNA against the Drosophila genome, the structure of the Drosophila Mitf gene was recon- of the eye tissue into neural retina and retinal pigment structed; the 5Ј exon 1 was discovered on genomic clone epithelium (RPE) is disturbed, leading to the transfor- AE003846, which encodes the first 153 nucleotides of the mation of regions of the RPE into stratified neural ret- cDNA. This exon had been annotated as a possible open ina; mutant RPE cells hyperproliferate and acquire co- reading frame and had received the identification number lumnar shapes as compared with the cuboidal shape CG17469. Clone AE003846 had been assigned to the chromosome 4 region 102E-F, while genomic clone AE003163, which observed in wild-type and form cells, which express contains the rest of the Dmel/Mitf coding region, has yet to neuroretinal marker genes (Nguyen and Arnheiter be assigned a chromosomal location. On the basis of this, we 2000). Thus, Mitf appears to play a role in the establish- presume that the Dmel/Mitf gene is located on chromosome 4. ment of the RPE within the presumptive eye region. Cotransfection studies: The full-length Drosophila Mitf EA Recently, it was shown that Mitf interacts with Pax6 cDNA as well as the Mitf mutant version were cloned into the pCDNA3.1 eukaryotic expression vector. In Mitf EA, the in vitro, resulting in transcriptional inhibition (Planque negatively charged glutamic acid (E) within the basic region et al. 2001). The significance of these effects to in vivo is changed to a neutral alanine (A). The mutation was created gene function is unknown. During eye development the using mutagenic primers and a two-step PCR approach (Ho Mitf and Pax6 genes are initially expressed across the et al. 1989). The clone was then ligated into the BglII-XhoI- entire optic vesicle (including both presumptive retina digested pcDNA3.1 vector. The reporter construct MBpluc contains six tandem M boxes (generously donated by Kenji and RPE regions) and are then restricted in expression Kasai); each M box contains an E box, which Mitf can bind such that Pax6 is expressed in neuroretinal cells while to and from which it can activate transcription. For performing Mitf is restricted to RPE cells (Bora et al. 1998; Naka- the assay, 293 cells were grown to 80% confluency (as judged yama et al. 1998; Nguyen and Arnheiter 2000). These by eye) in six-well plates in Dulbecco’s Modified Eagle’s Me- expression patterns suggest that the transcriptional inhi- dium (DMEM) with fetal BSA but without antibiotics. Before transfection, the BSA was washed off using DMEM and the cells bition observed in vitro may be involved in determining were then transfected using LipoFectamin-PLUS (Invitrogen, neural vs. nonneural fate. San Diego) according to manufacturer’s instructions. Each Here we report the identification of the Drosophila pool of DNA was transfected in triplicate and the luciferase Mitf (Dmel/Mitf) gene and show that transcriptional acti- activity assayed using the Promega dual luciferase kit on a 2 vation by Drosophila Mitf is inhibited by Pax6 in vitro, Wallac Victor luminometer (Perkin-Elmer Life Sciences), 12 hr after transfection. For normalizing the assay, a cytomegalo- similarly to the vertebrate proteins. Expression of Dmel/ virus-driven Renilla luciferase was used. A total of 800 ng of Mitf in the developing fly eye raises the possibility that each DNA was used and, where appropriate, empty pCDNA3.1 it is yet another conserved component in the genetic vector was used to bring the total amount of DNA to equal control of early eye development in fly and vertebrates. levels. Moreover, its expression in the peripodial membrane, Expression analysis: Embryonic in situ hybridization was a tissue that is continuous with and overlies the presum- carried out with two different probes, a full-size probe made from the cDNA clone LD45277 and a shorter probe that lacks tive retinal epithelium, suggests that peripodial and RPE an MfeI fragment containing the basic helix-loop-helix leucine tissue may be evolutionarily related. Targeted expres- zipper domains. The latter probe was used to prevent false sion of wild-type and dominant-negative Mitf confirms signals due to cross-reactions with other mRNAs coding a likely role for the gene in the development of eye- bHLH-Zip proteins. The probe was labeled using the Boeh- antennal disc derivatives. This evidence lends further ringer Mannheim (Indianapolis) DIG RNA labeling kit according to instructions. Whole-mount in situs on embryos were support to the proposal that vertebrate and invertebrate performed according to Brody et al. (2002). Both probes eyes share a common origin. resulted in the same expression pattern. Imaginal disc in situ hybridizations were also carried out with both probes, and no difference was seen between the two probes. The sense probe MATERIALSANDMETHODS was used as a negative control and did not show any specific staining in either embryos or discs. Dmel/Mitf genomic structure: The Drosophila melanogaster ge- In vivo expression studies: A pUAS-Mitf WT construct was gen- nome sequence (Adams et al. 2000) was available in GenBank erated by introducing the BglII-XhoI fragment of the LD45277 through the National Center for Biotechnology Informa- cDNA clone into BglII-XhoI-digested pUAST vector DNA tion (http://www.ncbi.nlm.nih.gov) and was searched using (Brand and Perrimon 1993). For pUAS-Mitf EA, cloning into tBLASTn (Altschul et al. 1990). Using the bHLH domain pUAST was at the NotI-XhoI sites and the Mitf sequence was of the mouse Mitf gene, a Drosophila genomic region was mutagenized as described above (see Cotransfection studies). identified (within clone AE003163) that showed considerable Transgenic lines carrying these constructs were generated by homology to the mouse Mitf sequence. By using the resulting P-element transformation. Expression was achieved using the Drosophila genomic region in a further blast search, several Gal4/UAS system (Brand and Perrimon 1993) by crossing cDNA clones were identified. The Berkeley Drosophila Genome Gal4 driver lines to flies carrying pUAS-Mitf WT or pUAS-Mitf EA Project cDNA clones LP03467 and LD45277 showed consider- transgenes as described in the results. Immunostaining with able identity to the genomic sequences and were obtained mouse monoclonal anti-ELAV Ab (Iowa Developmental Hy- and sequenced in full. Clone LD45277 turned out to be a full- bridoma Bank) was carried out using standard protocols size clone, which included a 5Ј ATG with a continuous open (Wolff 2000). Few adult escapers were also observed in the reading frame as well as the poly(A) tail of a mature mRNA. cross to the ey-gal4 driver. These flies displayed eye phenotypes The other cDNA clone (LP03467) was a chimeric clone con- consistent with the effects seen in the developing discs, i.e.,

126 Drosophila Mitf in Eye Development 235

Figure 1.—Conservation of the Mitf gene in Drosophila. (A) The genomic clones described in the study and the exon-intron structure of the Dmel/Mitf gene: exons are shown as boxes. The unsequenced gap region is indicated and the sizes of the different exons and introns are shown. Note that the total size of the Dmel/Mitf genomic region is currently not known due to the gap between the two clones. The exon/intron splice sites that are conserved between mouse and Drosophila are indicated by brackets. The exons containing the bHLH-Zip region are shaded. Note that the vertebrate melanocyte-specific alternative first exon (Exon 1M) is not found in the Drosophila gene (see discussion for comments on this finding). (B) Conservation of the Dmel/Mitf amino acid sequence. The bHLH-Zip regions of the Drosophila Mitf gene are compared to the Mitf gene in most species where the sequence is currently known as well as to the mouse Tfe3, Tfeb, and Tfec genes. Shaded residues indicate amino acids conserved (identical and similar) between Drosophila and the mouse Mitf, Tfe3, Tfec, and Tfeb genes. The amino acids are numbered on the basis of the full-length Dmel/Mitf protein and on the mouse melanocyte-specific M form (Hodgkinson et al. 1993). Arrows above the Tfe sequences indicate differences between the Mitf and the Tfe genes. The arrow labeled EA indicates the amino acid changed to produce a dominant-negative form of Dmel/Mitf. (C) The amino acid sequence of the first three exons of Dmel/ Mitf compared to the amino terminus of the mouse Mitf A form. This conservation suggests that the A exon is the ancestral 5Ј exon. The arrowheads indicate splice junctions.

reduced eyes (pUAS-Mitf WT) and split or enlarged eyes (pUAS- clones (A0E03846 and AE003164) are repetitive ele- EA Mitf ). ments, which, when aligned, show an extensive sequence overlap. However, the end sequences of the two clones do not allow perfect alignment and all attempts RESULTS at closing the gap using PCR have so far failed. The Sequence and genomic structure of the Drosophila Dmel/Mitf gene is composed of nine exons, at least one Mitf gene: The Drosophila Mitf gene was identiﬁed by of which is alternatively spliced (exon 4) as judged from comparing the mouse Mitf amino acid sequence (bHLH comparing the two cDNA clones LP03467 and LD45277. domain) to the D. melanogaster genome sequence (Adams Alternative splicing is a feature previously demonstrated et al. 2000) translated in all six reading frames using to be both common and important for the mouse Mitf tBLASTn (Altschul et al. 1990). The structure of the gene (Hallsson et al. 2000) as well as for other mem- Drosophila Mitf gene is shown in Figure 1A. The gene bers of the mouse Mitf-Tfe family (Roman et al. 1991). covers at least 5.5 kb of genomic sequence. However, The alternatively spliced isoforms (a and b) of Dmel/ the total genomic size could not be determined due to Mitf maintain the same open reading frame and can a gap in the sequence in the intron between exons 1 therefore give rise to protein products that differ only and 2 (Figure 1A). At the adjacent ends of the two in the ﬁrst 19 amino acids of exon 4 (Figure 1A). No

127 236 J. H. Hallsson et al. functional domains have been identified in this part of Mitf transcripts in the mouse, also referred to as the the protein and currently it is not clear if these splice eye-specific form (Amae et al. 1998; Figure 1C). Included forms represent functionally important alternative in this region is a glutamine-rich domain. Although no mRNAs. functional importance has been assigned to this portion By aligning the cDNA of Drosophila Mitf with mouse of the protein, the conservation of the second splice Mitf and considering the splice junctions, it can be seen junction supports the idea that this exon is conserved that three of eight splice junctions present in the Dro- and may be relevant for normal protein function. A sophila cDNA are conserved between the two species. block of conserved amino acids is found in Drosophila One of these is the splice junction between exons 2 and exon 3 and shows homology to mouse exon 2A (Figure 3 in Drosophila (corresponding to exons 1B and 2 in 1C). Of the first 30 amino acids of this exon, 17 are the mouse counterpart). The other conserved junctions identical in the two proteins and 7 additional amino are between exons 6 and 7 and 7 and 8, which in both acids represent conservative substitutions. No particular organisms contain the highly conserved basic and HLH function has been assigned to this region of the protein. domains (Figure 1A). The Dmel/Mitf counterpart to mouse serine 73, an amino Conservation of the functional domains of the Mitf acid shown to be phosphorylated by mitogen-activated protein: The Dmel/Mitf gene encodes a 729-amino-acid protein (MAP) kinases in response to extracellular sig- protein, all exons included. This is considerably longer nals, is conserved. Furthermore, serine amino acids cor- than the 525 amino acids encoded by the A form of responding to both Ser298 and Ser409 are conserved the mouse Mitf gene, the longest known mouse form. even though not much conservation is found sur- Although overall amino acid homology is only 31%, rounding these amino acids (not shown). Close to the certain domains of the protein have considerably higher C terminus of the protein (25 amino acids from the conservation. As expected, the greatest amino acid ho- end of mouse Mitf and 50 amino acids from the end mology between mouse and Drosophila is found in the of Dmel/Mitf) is a stretch of 6 conserved amino acids bHLH-Zip domain. In both cases the basic domain is (DPLLSS). The function of these amino acids has not contained within exons 6 and 7; of 19 amino acids in been determined. Finally, a short stretch of amino acids this region, 17 are conserved between the two species. of Dmel/Mitf (DDIFDDIL) is remarkably similar to the The 2 amino acids that differ are conservative substitu- DDVIDEII sequence, which in the TFE3 protein has tions: glutamate (at position 202) in the mouse vs. aspar- been suggested to play a role in transcriptional activa- tate in Drosophila and leucine (at position 211) in the tion (Beckmann et al. 1990). Although the similarity of mouse vs. methionine in Drosophila (Figure 1B). The these regions suggests functional importance, aligning first helix of the HLH domain is completely conserved the two regions creates a big gap in the overall alignment while in the loop 8 of 14 amino acids are conserved. A of Drosophila and mouse MITF proteins and thus de- striking difference between the two proteins is the length creases the overall homology of the alignment. Conser- of the loop. The mouse loop is 14 amino acids while in vation of a domain may be more important than conser- Dmel/Mitf it is 20 amino acids long. The second helix vation of its exact location in the protein. contains 16 amino acids and, of those, 11 are conserved Dmel/Mitf functions as a transcriptional activator: Co- between the two species. Interestingly, the leucine zip- transfection experiments were performed to determine per of Dmel/Mitf consists of only two leucines while the if the Drosophila Mitf gene can activate gene expression mouse zipper is generally considered to consist of four. from promoter elements known to be regulated by the A possible explanation for this difference might be that mouse and human Mitf genes. The wild-type Dmel/Mitf the longer zipper evolved in vertebrates to increase the cDNA and a mutant version of Dmel/Mitf were cloned specificity of protein-protein interactions as more di- into the eukaryotic expression vector pCDNA3.1. The merization partners such as the related Tfe proteins mutant version, Mitf EA (arrow in Figure 1B, labeled EA), became available. Although multiple differences exist changes the most conserved amino acid within the DNA- between the Dmel/Mitf genes in D. melanogaster and D. binding domain. This amino acid is known to be essen- pseudoobscura (data not shown), the bHLH-Zip domains tial for the DNA-binding ability of the related Tfeb pro- are highly similar in the two species (Figure 1B). Compar- tein and, since bHLH proteins are known to bind DNA ing Drosophila Mitf to known homologs in other verte- as dimers, this mutation is thought to result in a domi- brate species leads to the same conclusion as little diversity nant-negative protein (Fisher et al. 1993). is found in the bHLH region of the protein. Species as The constructs were cotransfected into 293T human diverse as humans and zebrafish show almost total conser- embryonic kidney cells together with a reporter con- vation of the bHLH domains (Figure 1B). struct containing six tandem M boxes. The M box is an Additional small regions of conservation are present 11-bp sequence that contains an E box; the mouse Mitf outside the bHLH-Zip region. A block of amino acids protein is known to bind to and activate gene expression at the amino terminus of the Dmel/Mitf protein shows from this site. As can be seen from Figure 2A, the wild- considerable homology to the mouse A form, the splice type Drosophila Mitf construct is able to activate gene version proposed to be the most ancient of the different expression sevenfold compared to the empty vector,

128 Drosophila Mitf in Eye Development 237

Figure 2.—Dmel/Mitf activates gene expression. (A) Cotrans- fection experiments were performed in 293T cells with wild- type and mutant versions of the Dmel/Mitf gene and a promoter element containing six M boxes. Each column is based on four individual transformations and two measurements of Figure 3.—Expression of the Drosophila Mitf gene during each sample. Renilla was used as a control for transfection embryonic development. Whole-mount in situ hybridizations: efﬁciency. The results are shown as fold induction as com- anterior is left in all views and developmental staging is ac- pared to empty vector. (B) The Eyeless/Pax6 protein inter- cording to Hartenstein and Campos-Ortega (1984). (A feres with transcription activation by Dmel/Mitf. Cotransfection and B) Maternal Mitf transcripts are detected throughout experiments were performed in 293T cells with the wild-type pregastrula Drosophila embryos. (C–F) During gastrulation Dmel/Mitf and Eyeless/Pax6 genes and a promoter element and through germ-band extension there is a progressive loss containing six M boxes. of in situ hybridization signal in all tissues such that, by late stage 10, little or no Mitf transcript is detected. (G–R) Zygotic expression is ﬁrst detected in cells surrounding the developing while the mutant version is unable to activate gene ex- midgut and hindgut during late stage 12. By embryonic stage pression. Thus, clearly, the Drosophila MITF protein 15, Mitf transcripts are observed in most, if not all, midgut can activate gene expression from this regulatory ele- and hindgut epithelial cells. ment, just as the vertebrate factors do. Also, when the Mitf EA mutant version and wild-type Mitf constructs are cotransfected with the reporter, less activation is ob- lacking the bHLH-Zip region. The in situs revealed strong served (Figure 2B), as would be expected if the EA Dmel/Mitf expression in the precellular stages of embry- mutant version acts in a dominant-negative fashion by onic development (Figure 3), representing maternally interfering with DNA binding of the normal protein. deposited Mitf message. As cellularization progresses, In cotransfection assays, the mouse MITF and PAX6 the amount of Mitf message decreases and is consider- proteins interact and mutually inhibit transcription acti- ably reduced by gastrulation. During embryonic stages vation (Planque et al. 2001). To test if this was also true 9–11 expression is very low or undetectable. Expression for the Drosophila MITF and PAX6 (Eyeless) proteins, then reappears by early stage 12 in the gut and stays high expression constructs containing the two genes were until stage 15, at which time the probe can no longer cotransfected into 293T cells together with the 6xM- penetrate the embryo due to cuticular formation. Strong box reporter construct and p300. As shown in Figure expression is seen in the epithelium of the midgut and 2B, the presence of the ey gene interferes with the tran- hindgut, even though the possibility cannot be excluded scription activation potential of the Dmel/Mitf gene. We that the signal is in the thin layer of visceral mesoderm conclude that the function of Dmel/Mitf as a transcrip- surrounding the gut epithelium. No signal was detected tion activator is conserved between vertebrates and in- using the sense control probe. vertebrates, as is its potential interaction with Eyeless/ In the eye-antennal imaginal disc, Dmel/Mitf shows a Pax6. dynamic pattern of expression during the second and Dmel/Mitf is expressed in the embryo and in the eye- third larval stages (L2 and L3). In L2 discs, Dmel/Mitf antennal imaginal disc: To determine the expression transcripts were detected throughout the eye region pattern of Dmel/Mitf during Drosophila development, (Figure 4A). In L3 discs, Dmel/Mitf expression was re- in situ hybridizations were carried out on embryos and stricted to two distinct domains. One expression domain eye-antennal imaginal discs. Two different probes were lies between the eye and antennal regions (Figure 4B). used, one representing the full-length cDNA and another The second domain (Figure 4C) is located in the region

129 238 J. H. Hallsson et al.

Figure 4.—Expression of Mitf in Drosophila eye-antennal discs. Discs are oriented with dorsal up and posterior to the left. Dmel/Mitf and atonal mRNAs were detected by in situ hybridization. (A) L2 disc. (B–D) Late L3 discs. In addition to the domains of expression described below, Mitf expression was also detected in the antennal region. However, expression within this region was highly variable from disc to disc, suggesting that expression in this region is dynamic. (A) Mitf is expressed broadly across the eye region (bracket). (B) Mitf expression is seen in a domain (arrow) lying between the eye (e) and the antennal (a) regions of the disc. (C) A second domain is present in the peripodial cell layer over the morphogenetic furrow (arrowhead). Inset shows a cross-section of the margin of the disc in the area of Mitf expression; staining is found in the peripodial cell layer (p) as opposed to the disc proper cell layer (d); compare to inset in D. (D) Staining for atonal, a gene expressed within the MF in the disc proper cell layer, is shown for comparison. Inset shows a cross-section of the margin of the disc in the area of atonal expression; staining is found in the disc proper cell layer (d) as opposed to the peripodial cell layer (p). of the morphogenetic furrow (MF), where cells of the marker ELAV, was always reduced and occasionally ab- disc proper layer stop dividing and a subset commit to sent (compare disc in Figure 5B to wild type in Figure a neuronal fate. Posterior to the MF, cells do not divide 5A). On the contrary, the eye regions of discs expressing and neurons differentiate into photoreceptors; anterior the MitfEA mutant protein were enlarged as compared to the MF, cells are uncommitted and proliferating. to wild type and the developing photoreceptor field In this second domain, Dmel/Mitf is expressed in the appeared correspondingly expanded (compare disc in peripodial membrane, i.e., the cell layer that overlies Figure 5C to wild type in Figure 5A). the disc proper (inset in Figure 4C). Expression of dominant-negative Dmel/Mitf in the larval disc interferes with eye development: To investigate DISCUSSION the potential role of Dmel/Mitf in fly eye development, Here we describe the identification and initial charac- we expressed the wild-type (Mitf WT) or dominant-nega- terization of Dmel/Mitf, the Drosophila homolog of the tive (Mitf EA) forms in the developing eye-antennal disc. vertebrate bHLH-Zip transcription factor gene Mitf. Like As expression of endogenous Dmel/Mitf appears to be its vertebrate counterpart, Dmel/Mitf can activate a restricted to the peripodial layer, we tested two Gal4 known Mitf reporter in vitro and this transcriptional drivers to activate expression from UAS transgenes. The activation is sensitive to regulation by Eyeless/Pax6. Tar- c311 driver (Gibson and Schubiger 2000; data not geted expression of wild-type or dominant-negative forms shown) expresses throughout the peripodial layer of of Dmel/Mitf results in opposite effects on the develop- the eye-antennal disc at the L2 stage and is still expressed ment of the eye-disc region and suggests that Mitf’s in the peripodial membrane over the antennal region, role in eye development is at least partially conserved but not the eye region, in late L3. The ey-Gal4 (Hazelet between fly and vertebrates. We discuss below the impli- et al. 1998; Kenyon et al. 2003) driver expresses through- cations of this conservation at the molecular and devel- out the disc proper and peripodial cell layers until mid opmental levels. L2. Thereafter, expression is progressively lost from the Conservation of Mitf at the DNA and protein levels: antennal region and becomes restricted to the peripod- Despite extensive genome-wide searches for basic-helix- ial and disc proper layers of the eye region. In L3, ey- loop-helix proteins in the Drosophila genome, no Mitf Gal4 expression decreases in the peripodial layer but or Mitf-related genes were found in previous analyses continues to be robustly expressed in the disc proper. (Moore et al. 2000; Peyrefitte et al. 2001). This sug- Both drivers are also expressed in other larval tissues. gests that the Dmel/Mitf gene described here is the only Expression of Drosophila Mitf WT or Mitf EA under the family member found in the Drosophila genome. This peripodial driver resulted in early larval lethality likely is in sharp contrast to vertebrate genomes, which, in due to expression in tissues other than the imaginal addition to Mitf, contain the three other closely related discs. Larvae expressing Drosophila Mitf WT or Mitf EA un- genes Tfeb, Tfe3, and TfeC (discussed below). Further- der ey-Gal4 control most often died later and could be more, the zebrafish genome contains two Mitf genes analyzed at the L3 stage. Expression of Mitf WT resulted in (nacre/Mitfa and Mitfb; Lister et al. 1999, 2001) in addi- eye-antennal discs with smaller eye regions but generally tion to a presumed unknown number of Tfe genes. Other normal or nearly normal antennal regions. Neuronal fish species, including Xiphophorus, Fugu rubripes, and morphogenesis, as detected by expression of the neural Tetraodon nigroviridis, also contain two Mitf genes in their

130 Drosophila Mitf in Eye Development 239

Figure 5.—Targeted expression of wild-type and dominant-negative Mitf. Discs are oriented with dorsal up and posterior to the left. De- velopment of the photoreceptor neurons is detected by staining for the pan-neural marker ELAV. (A) L3 wild-type disc. Neuronal development in the eye field initiates at the posterior margin (arrowhead) and progresses anteriorly. (B) L3 ey- Gal4 UAS-Mitf WT disc. Disc size is reduced and neuronal field is similarly affected. (C) L3 ey-Gal4 UAS-Mitf EA disc. Discs are larger than wild type and often display folds (arrow) within the eye field epithelium. The neuronal field is similarly expanded. Occasionally, neuronal development also initiates from the ventral margin of the disc (arrowhead) as well as from the posterior. genomes, suggesting a gene duplication event in teleost served in Dmel/Mitf. Thus, regulation of Dmel/Mitf func- fish after their separation from the bird/mammalian tion may involve phosphorylation at this site. lineage (Altschmied et al. 2002). Studies on Mitf func- Significant differences also exist between vertebrate tion should therefore be greatly simplified in Drosoph- and fly Mitf. Most notably, in the mouse, an additional ila as compared to studies in vertebrate species. first exon (1M) codes for 11 amino acids and is included Within the MYC supergene family of basic bHLH- in a melanocyte-specific form of the Mitf mRNA, the M Zip transcription factors, the Mitf gene is most closely form. We have not been able to find sequences corre- related to the Tfeb, Tfec, and Tfe3 genes. Together these sponding to exon 1M near the Dmel/Mitf gene. If we four proteins form the Mitf-Tfe subfamily of bHLH-Zip assume that the order of exons in the gene is conserved proteins. All four proteins share almost identical basic between mouse and Drosophila, then exon 1M would regions and very similar HLH and Zip regions; the se- be situated between exons 2 and 3. However, the intron quence is quite divergent outside these domains. It is between exons 2 and 3 in Drosophila is only 51 nucleo- likely that the Mitf gene is most closely related to the tides long and does not include an ATG. This lack of ancestral form of the Mitf-Tfe family of proteins since conservation is not unexpected. Vertebrate melanocytes there are more similarities between Dmel/Mitf and the originate from the neural crest, a cell lineage with no mouse Mitf genes than between Dmel/Mitf and any of counterpart in Drosophila. Although the Drosophila the three Tfe genes (arrows in Figure 1B). For example, eye does contain pigment cells, these arise from the eye- the mouse Tfec and Mitf genes differ at two positions in antennal epithelium and their pigment granules (om- the helix 1 domain (YNINY in Tfec vs. FNIND in Mitf ) mochromes and drosopterins) are chemically distinct whereas the mouse and fly Mitf genes are identical. from the melanosomes (melanins) of vertebrates. Hence, Similarly, the mouse Mitf and Tfe3 genes are different fly pigment cells are not evolutionarily related to mela- in one position in the basic domain (LLKE in Tfe3 vs. nocytes. In this respect, exon 1M may reflect an evolu- LAKE in Mitf) and the Mitf and Tfeb genes are different tionary modification of the ancestral Mitf gene that in one position in helix 1 (LGML in Tfeb vs. LGTL in arose specifically in the vertebrate lineage. Consistent Mitf ). All these residues are conserved in the mouse with that, none of the related Tfe genes have an M-like and fly Mitf genes, suggesting that the Mitf gene is the exon, suggesting that this exon arose after the Tfe genes common ancestor and that the Tfe3, Tfeb, and Tfec genes had arisen from the ancestral Mitf gene. Although the arose from the ancestral gene after the separation of recently characterized Mitf gene of the ascidian Halocyn- the vertebrate and invertebrate lineages. thia roretzi is expressed in pigment lineage blastomeres, The Drosophila Mitf protein is considerably larger it does not appear to contain sequences that resemble than its vertebrate counterpart. In addition to the highly exon 1M (Yajima et al. 2003). Interestingly, the ascidian conserved bHLH-Zip domains, several other conserved Mitf gene is expressed maternally, like its Drosophila regions were identified, suggesting that they represent counterpart. regions of functional importance. These include a gluta- RPE vs. peripodial epithelia—a case of common ances- mine-rich region at the amino terminus, an amphi- try? The Mitf gene is expressed in the mouse eye during pathic helical region with a transcription activation the optic vesicle and optic cup stages of eye development function, and a stretch of six amino acids at the carboxy and is required for the normal formation and mainte- end. In addition, a serine amino acid—which in the mouse nance of the RPE. The RPE is a single layer of cuboidal MITF protein is phosphorylated by the MAP kinase path- cells, which basally displays numerous infoldings while way (Hemesath et al. 1998; Wu et al. 2000)—is also con- apically abundant microvilli enclose and interdigitate

131 240 J. H. Hallsson et al. with rod outer segments (Braekevelt and Hollen- tion (cuticle/peripodial vs. eye) within the epithelium. berg 1970; Braekevelt 1988, 1990). In Mitf mi/mi mutant As vertebrate Mitf has been implicated in proliferation mice, the RPE apical microvilli are absent and elongated and RPE specification (Nguyen and Arnheiter 2000), rod outer segments do not develop (Bumsted et al. our observations strongly suggest significant conserva- 2001). During development, the retina and RPE cell tion of Mitf ’s role in eye development. Further invest- layers are closely juxtaposed and recent evidence sup- igation of Dmel/Mitf function awaits the generation of ports an early role for the RPE in morphogenesis of the Dmel/Mitf mutant alleles and better peripodial-specific neural retina. Genetic ablation of the RPE cells early drivers. Nonetheless, the similarities we have uncovered during eye formation prevents lamination of the retina, between the peripodial membrane of the fly eye-anten- and later ablation results in loss of laminar organization nal disc and the RPE of the vertebrate optic vesicle/ (Raymond and Jackson 1995). In addition, factors se- cup are very intriguing. The expression of Mitf in both creted by the RPE have been shown to positively influ- epithelia raises the possibility that these tissues are evolu- ence the development and maintenance of normal reti- tionarily related. In such a scenario, the ancestral tissue nal morphology (Gaur et al. 1992; Sheedlo et al. 1992; from which the eye eventually formed may have already Sheedlo and Turner 1998; Jablonski et al. 2000). displayed a partition into two fields: a nonneural Mitf ϩ/ Thus, the RPE is thought to be a source of signaling Pax6Ϫ field and a neural Mitf Ϫ/Pax6ϩ field. Moreover, molecules that lead to proper patterning and mainte- development of these two fields may have already in- nance of the vertebrate retina. volved inductive events between juxtaposed cell layers. The Drosophila eye, albeit structurally very different Parallel investigations of Mitf function in mouse and fly from the mouse eye, also develops from a bilayered epithe- will provide useful insights in evaluating these hypotheses. lial structure. The progenitor epithelium that gives rise We thank Einar Arnason for comments on the manuscript, Gina to the adult fly eye and associated head cuticle consists Decene for assistance with fly genetics and immunostaining, the of a flattened sac with a columnar “disc proper” cell layer Bloomington Drosophila Stock Center for fly stocks, and the Iowa (from which the retina develops) and a noncolumnar Developmental Hybridoma Bank for antibodies. This work was sup- “peripodial” cell layer (from which mostly cuticle, or ported by a grant from the Icelandic Research Council, the Helga Jonsdottir and Sigurlidi Kristjansson Memorial Fund, the University epidermis, will form). Until recently the peripodial cell of Iceland Science Fund (E.S. and J.H.H.), The Ruth and Milton layer was not thought to be directly involved in retinal Steinbach Fund (F.P.), and the Massachusetts Lyons Eye Research morphogenesis and it does not in fact contribute di- Fund (F.P.). F.P. is a recipient of the Research to Prevent Blindness rectly to any part of the adult eye (as mentioned above, Career Development Award and National Institutes of Health grant these cells give rise to head cuticle). However, two R01 EY13167 from the National Eye Institute. groups (Cho et al. 2000; Gibson and Schubiger 2000) have recently shown that peripodial cells are in fact LITERATURECITED required for proper development of the retina. In addition, Schubiger and colleagues (Gibson and Schubiger Adams, M. D., S. E. Celniker, R. A. Holt, C. A. Evans, J. D. Gocayne et al., 2000 The genome sequence of Drosophila melanogaster. 2001; Gibson et al. 2002) have shown that cellular pro- Science 287: 2185–2195. jections, named “transluminal” projections, extend from Altschmied, J., J. Delfgaauw, B. Wilde, J. Duschl, L. Bouneau et one layer to the other and provide a mechanism for direct al., 2002 Subfunctionalization of duplicate mitf genes associated with differential degeneration of alternative exons in fish. Genet- interactions between these two layers. Thus, it is now ics 161: 259–267. thought that signaling occurs between cells of peripodial Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman, and disc proper layers and that these interactions are 1990 Basic local alignment search tool. J. Mol. Biol. 215: 403– 410. essential for proper retinal development. The expres- Amae, S., N. Fuse, K. Yasumoto, S. Sato, I. Yajima et al., 1998 Identi- sion of Dmel/Mitf in the peripodial cell layer, specifi- fication of a novel isoform of microphthalmia-associated tran- cally in the portion of the peripodial membrane that scription factor that is enriched in retinal pigment epithelium. Biochem. Biophys. Res. Commun. 247: 710–715. overlooks the site of photoreceptor neuron formation Beckmann, H., L.-K. Su and T. Kadesch, 1990 TFE3: A helix-loop- (MF), suggests that Mitf may be involved in this process. helix protein that activates transcription through the immuno- To investigate the potential role of Dmel/Mitf in eye globulin enhancer ␮E3 motif. Genes Dev. 4: 167–179. Bora, N., S. J. Conway, H. Liang and S. B. Smith, 1998 Transient development, we expressed the wild type and dominant- overexpression of the Microphthalmia gene in the eyes of Mi- negative Mitf EA mutant in the developing eye-antennal crophthalmia vitiligo mutant mice. Dev. Dyn. 213: 283–292. disc. Discs expressing wild-type Dmel/Mitf were variably Braekevelt, C. R., 1988 Retinal fine structure in the European eel Anguilla anguilla. VII. Pigment epithelium of the sexually mature reduced in size and neuronal morphogenesis was always silver eel stage. Anat. Anz. 166: 33–41. reduced and occasionally absent. On the contrary, discs Braekevelt, C. R., 1990 Fine structure of the retinal pigment epi- expressing the Mitf EA mutant version were larger than thelium of the mallard duck (Anas platyrhynchos). Histol. Histo- pathol. 5: 133–138. wild-type discs and the developing photoreceptor field Braekevelt, C. R., and M. J. Hollenberg, 1970 Development of appeared correspondingly expanded. The striking ef- the retinal pigment epithelium, choriocapillaris and Bruch’s fect on disc size likely reflects changes in proliferation, membrane in the albino rat. Exp. Eye Res. 9: 124–131. Brand, A. H., and N. Perrimon, 1993 Targeted gene expression as a whereas the variation in neuronal field size may be sec- means of altering cell fates and generating dominant phenotypes. ondary to this or result from effects on primordia forma- Development 118: 401–415.

132 Drosophila Mitf in Eye Development 241

Brody, T., C. Stivers, J. Nagle and W. F. Odenwald, 2002 Identi- factor as a regulator of mast cell differentiation. Int. J. Hematol. fication of novel Drosophila neural precursor genes from a differ- 71: 197–202. ential embryonic head cDNA screen. Mech. Dev. 113: 41–59. Lister, J. A., J. Close and D. W. Raible, 2001 Duplicate mitf genes Bumsted, K. M., L. J. Rizzolo and C. J. Barnstable, 2001 Defects in zebrafish: complementary expression and conservation of mel- in the MITF(mi/mi) apical surface are associated with a failure anogenic potential. Dev. Biol. 237: 333–344. of outer segment elongation. Exp. Eye Res. 73: 383–392. Lister, J. A., C. P. Robertson, T. Lepage, S. L. Johnson and D. W. Cho, K. O., J. Chern, S. Izaddoost and K. W. Choi, 2000 Novel Raible, 1999 nacre encodes a zebrafish microphthalmia-related signaling from the peripodial membrane is essential for eye disc protein that regulates neural-crest derived pigment cell fate. De- patterning in Drosophila. Cell 103: 331–342. velopment 126: 3757–3767. Fisher, D. E., L. A. Parent and P. A. Sharp, 1993 High affinity Luchin, A., G. Purdom, K. Murphy, M. Y. Clark, N. Angel et al., DNA-binding Myc analogs: recognition by an ␣ helix. Cell 72: 2000 The microphthalmia transcription factor regulates expres- 467–476. sion of the tartrate-resistant acid phosphatase gene during termi- Gaur, V. P., Y. Liu and J. E. Turner, 1992 RPE conditioned medium nal differentiation of osteoclasts. J. Bone Miner. Res. 15: 451–460. stimulates photoreceptor cell survival, neurite outgrowth and Moore, A. W., S. Barbel, L. Y. Jan and Y. N. Jan, 2000 A genome- differentiation in vitro. Exp. Eye Res. 54: 645–659. wide survey of basic helix-loop-helix factors in Drosophila. Proc. Gehring, W. J., and K. Ikeo, 1999 Pax 6: mastering eye morphogene- Natl. Acad. Sci. USA 97: 10436–10441. sis and eye evolution. Trends Genet. 15: 371–377. Moore, K. J., 1995 Insight into the microphthalmia gene. Trends Gibson, M. C., and G. Schubiger, 2000 Peripodial cells regulate Genet. 11: 442–448. proliferation and patterning of Drosophila imaginal discs. Cell Motyckova, G., K. N. Weilbaecher, M. Horstmann, D. J. Rieman, 103: 343–350. D. Z. Fisher et al., 2001 Linking osteopetrosis and pycnody- Gibson, M. C., and G. Schubiger, 2001 Drosophila peripodial cells: sostosis: regulation of cathepsin K expression by the microphthalmia transcription factor family. Proc. Natl. Acad. Sci. USA 98: More than meets the eye? BioEssays 23: 691–697. 5798–5803. Gibson, M. C., D. A. Lehman and G. Schubiger, 2002 Lumenal Nakayama, A., M.-T. T. Nguyen, C. C. Chen, K. Opdecamp, C. A. transmission of decapentaplegic in Drosophila imaginal discs. Hodgkinson et al., 1998 Mutations in microphthalmia, the mouse Dev. Cell 3: 451–460. homolog of the human deafness gene MITF, affect neuroepithe- Goding, C., 2000 Mitf from neural crest to melanoma: signal trans- lial and neural crest-derived melanocytes differently. Mech. Dev. duction and transcription in the melanocyte lineage. Genes Dev. 70: 155–166. 14: 1712–1728. Nguyen, M., and H. Arnheiter, 2000 Signaling and transcriptional Halder, G., P. Callaerts and W. J. Gehring, 1995 Induction of regulation in early mammalian eye development: a link between ectopic eyes by targeted expression of the eyeless gene in Dro- FGF and MITF. Development 127: 3581–3591. sophila. Science 267: 1788–1792. Peyrefitte, S., D. Kahn and M. Haenlin, 2001 New members of Hallsson, J. H., J. Favor, C. Hodgkinson, T. Glaser, M. L. Lamor- the Drosophila Myc transcription factor subfamily revealed by a eux et al., 2000 Genomic, transcriptional and mutational analy- genome-wide examination for basic helix-loop-helix genes. Mech. sis of the mouse microphthalmia locus. Genetics 155: 291–300. Dev. 104: 99–104. Hartenstein, V., and J. A. Campos-Ortega, 1984 Early neurogen- Planque, N., L. Leconte, F. M. Coquelle, P. Martin and S. Saule, esis in wild type Drosophila melanogaster. Roux’s Arch. Dev. Biol. 2001 Specific Pax6/Microphthalmia transcription factor inter- 193: 308–325. actions involve their DNA-binding domains and inhibit transcrip- Hazelet, D. J., M. Bourouis, U. Walldorf and J. Treisman, 1998 tional properties of both proteins. J. Biol. Chem. 276: 29330– decapentaplegic and wingless are regulated by eyes-absent and 29337. eyegone and interact to direct the pattern of retinal differentia- Quiring, R., U. Walldorf, U. Kloter and W. J. Gehring, 1994 tion in the eye disc. Development 125: 3741–3751. Homology of the eyeless gene of Drosophila to the Small eye Hemesath, T. J., E. Steingrı´msson, G. McGill, M. J. Hansen, J. gene in mice and Aniridia in humans. Science 265: 785–789. Vaught et al., 1994 microphthalmia, a critical factor in melano- Raymond, S. M., and I. J. Jackson, 1995 The retinal pigmented cyte development, defines a discrete transcription factor family. epithelium is required for development and maintenance of the Genes Dev. 8: 2770–2780. mouse neural retina. Curr. Biol. 5: 1286–1295. Hemesath, T. J., E. R. Price, C. Takemoto, T. Badalian and D. E. Roman, C., L. Cohn and K. Calame, 1991 A dominant negative Fisher, 1998 MAP kinase links the transcription factor Mi- form of transcription activator mTFE3 created by differential crophthalmia to c-Kit signalling in melanocytes. Nature 391: 298– splicing. Science 254: 94–97. 301. Sheedlo, H. J., and J. E. Turner, 1998 Immunocytochemical charac- Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen and L. R. Pease, terisation of proteins secreted by retinal pigment epithelium in 1989 Site-directed mutagenesis by overlap extension using the retinas of normal and Royal College of Surgeons dystrophic rats. polymerase chain reaction. Gene 77: 51–59. J. Anat. 193: 223–232. Hodgkinson, C. A., K. J. Moore, A. Nakayama, E. Steingrı´msson, Sheedlo, H. J., L. Li and J. E. Turner, 1992 Effects of RPE-cell N. G. Copeland et al., 1993 Mutations at the mouse microph- factors secreted from permselective fibers on retinal cells in vitro. thalmia locus are associated with defects in a gene encoding a Brain Res. 587: 327–337. novel basic-helix-loop-helix-zipper protein. Cell 74: 395–404. Wawersik, S., and R. L. Maas, 2000 Vertebrate eye development Hughes, M. J., J. B. Lingrel, J. M. Krakowsky and K. P. Anderson, as modeled in Drosophila. Hum. Mol. Genet. 9: 917–925. 1993 A helix-loop-helix transcription factor-like gene is located Wolff, T., 2000 Histological techniques for the Drosophila eye, pp. 201–227 in , edited by W. Sullivan, M. at the mi locus. J. Biol. Chem. 268: 20687–20690. Drosophila Protocols Ashburner and R. S. Hawley. Cold Spring Harbor Laboratory Jablonski, M. M., J. Tombran-Tink, D. A. Mrazek and A. Iannac- Press, Cold Spring Harbor, NY. cone, 2000 Pigment epithelium-derived factor supports normal Wu, M., T. J. Hemesath, C. M. Takemoto, M. A. Horstmann, A. G. development of photoreceptor neurons and opsin expression Wells et al., 2000 c-Kit triggers dual phosphorylations, which after retinal pigment epithelium removal. J. Neurosci. 20: 7149– couple activation and degradation of the essential melanocyte 7157. factor Mi. Genes Dev. 14: 301–312. Kenyon, K. L., S. S. Ranade, J. Curtiss, M. Mlodzik and F. Pignoni, Yajima, I., K. Endo, S. Sato, R. Toyoda, H. Wada et al., 2003 Clon- 2003 Coordinating proliferation and tissue specification to pro- ing and functional analysis of ascidian Mitf in vivo: insights into mote regional identity in the Drosophila head. Dev. Cell 5: 403– the origin of vertebrate pigment cells. Mech. Dev. 120: 1489–1504. 414. Kitamura, Y., E. Morii, T. Jippo and A. Ito, 2000 mi-transcription Communicating editor: C. A. Kozak

133

Paper II

135 136 Pigment Cell Res. 20; 185–200 ORIGINAL ARTICLE

Evolutionary sequence comparison of the Mitf gene reveals novel conserved domains

Jo´ n Hallsteinn Hallsson1,2†, Benedikta S. Received 7 November 2006, revised and accepted for Haﬂidado´ ttir1,†, Alexander Schepsky1, Heinz publication 13 February 2007 2 1* Arnheiter and Eirı´kur Steingrı´msson doi: 10.1111/j.1600-0749.2007.00373.x

1Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Iceland, Vatnsmyrarvegur 16, 101 Reykjavik, Iceland 2Laboratory of Developmental Neurogenetics, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Introduction Bethesda, Maryland 20892-3706, USA Transcription factors of the basic helix–loop–helix *Address correspondence to Eirı´kur Steingrı´msson, e-mail: [email protected] (bHLH) protein family are important regulatory compo- Current address: Jo´n Hallsteinn Hallsson, Department of Natural nents in transcriptional networks of many developmen- Resources, Agricultural University of Iceland, Keldnaholt, 112 Reykja- tal pathways. They are involved in the regulation of vik, Iceland. neurogenesis (neurogenin-2) (Zirlinger et al., 2002), my- ogenesis (MyoR) (Lu et al., 2002), cell proliferation and differentiation (MyoD) (Li and Olson, 1992), and other Summary essential processes in organisms ranging from yeast to mammals. These proteins are characterized by the com- The microphthalmia-associated transcription factor mon possession of well conserved bipartite domains for (MITF) is a member of the MYC family of basic DNA binding and protein–protein interactions (Murre helix–loop–helix leucine zipper transcription factors. et al., 1989, 1994). A motif of mainly basic residues The corresponding gene was initially discovered in allows bHLH proteins to bind to their target sequences the mouse based on mutations which affect the in DNA regulatory regions (Voronova and Baltimore, development of several different cell types, inclu- 1990). A second motif, the helix–loop–helix domain, pri- ding melanocytes and retinal pigment epithelium marily composed of hydrophobic residues, allows these cells. Subsequently, it was shown to be associated proteins to interact and form homo- and/or heterodi- with deafness and hypo-pigmentation disorders in mers (Murre et al., 1994). The dimerization motif con- humans. More recently, the gene has been shown tains about 50 amino acids and produces two to be critical in melanoma formation and to play a amphipathic a-helices separated by a loop of variable role in melanocyte stem cell maintenance. Thus, the length. A subgroup of bHLH proteins contain an addi- mouse Mitf gene represents an important model tional dimerization motif called leucine zipper (Zip) that system for the study of human disease as well as is positioned C-terminal to the bHLH domain. Among an interesting model for the study of transcription the bHLH–Zip proteins are Mitf and the three closely factor function in the organism. Here we use the related genes, Tfe3, Tfeb and Tfec that together form evolutionary relationship of Mitf genes from numer- the so-called Mitf-Tfe gene family of interacting tran- ous distantly related species, including vertebrates scription factors. Members of the mouse Mitf-Tfe fam- and invertebrates, to identify novel conserved ily share an almost identical DNA binding domain and domains in the Mitf protein and regions of possible very similar helix–loop–helix and leucine zipper domains. functional importance in the 3¢ untranslated region. This similarity enables them to bind the E-box DNA We also characterize the nine different 5¢ exons of sequence (5¢ CATGTG 3¢) as either homodimers or as the Mitf gene and identify a new 5¢ exon in the Dro- heterodimers with each other (Carreira et al., 2005; sophila Mitf gene. Our analysis sheds new light on Hemesath et al., 1994). In addition to having high levels the conservation of the Mitf gene and protein and of homology in the most prominent functional domains opens the door for further functional analysis. of the protein, the overall amino acid homology is also Key words: Mitf/transcription factor/melanocyte/conser- considerable (48% overall homology between Mitf and vation/domains TfeC proteins in mice). Furthermore, these transcription factors share similar exon–intron structures (Rehli et al., †Authors contributed equally to this work. 1999).

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 185

137 Hallsson et al.

Numerous mutations are known in the Mitf gene in 2002; Steingrimsson et al., 1994; Takeda et al., 2002). several vertebrate species. More than 25 mutations are This has been demonstrated to be important for tissue known in the mouse (reviewed in Steingrimsson et al., specific expression and to affect the transcriptional acti- 2004 and Arnheiter et al., 2006), eight mutations are vation potential of the resulting proteins (Takemoto known in humans (Lalwani et al., 1998; Nobukuni et al., et al., 2002; Udono et al., 2000). In addition to alternative 1996; Takeda et al., 2000a), two in the hamster (Graw usage of 5¢ exons, splice forms have been described et al., 2003; Hodgkinson et al., 1998) and one each in rat that would lead to different Mitf proteins through the (Opdecamp et al., 1998), quail (Kawaguchi et al., 2001; alternative uses of exons 2 through 9. An alternative Mochii et al., 1998), and zebrafish (Lister et al., 1999). splice product, lacking 18bp of exon 6 (exon 6a) leads Common to nearly all Mitf mutations in the mouse are to a protein missing 6 amino acids (N-ACIFPT-C) in front defects in neural-crest-derived melanocytes, manifested of the basic domain. This RNA isoform has been found by a lack of pigment in the coat and inner ear. Most in all mouse tissues that express Mitf and the corres- mutations also produce defects in retinal pigment epithe- ponding protein has been shown to affect DNA binding lial cells, which in turn results in abnormal eye develop- potential (Hemesath et al., 1994). Analysis of the Mitfmi- ment. A few of the mutations also induce osteoclast sp mouse that lacks exon 6a in all of its transcripts has defects, which can lead to severe osteopetrosis, as well revealed that this exon is indeed functionally important, as mast cell defects (Roundy et al., 2003). Approximately although the effect of the mutation is relatively mild. half the mouse Mitf mutations are semidominantly inher- Other alternatively spliced mRNAs have been reported ited and show white spotting and/or coat color dilution for the mouse Mitf gene; the functional importance of when heterozygous with wild type. The remaining muta- most of these splice forms remain to be verified. tions are classified as recessive since they only exhibit a The unique characteristics of Mitf and the related Tfe coat color phenotype in the homozygous condition or, genes make them an important model for the study of like the Mitfmi-spotted (Mitf mi-sp) mutation, only in combi- transcription factor function and control. Here we present nation with another mutation at the locus (reviewed in a detailed analysis of Mitf gene structure and amino acid Steingrimsson et al., 2004). The phenotypes of Mitf sequence in numerous distantly related species to better mutations in other species show that the role of the understand the structure of the Mitf protein. Through this gene is conserved. Analysis of the mib (microphthalmia- effort we have improved our understanding of Mitf blanc) rat showed that it affects the development of a protein domains, identified a new exon in flies and provi- similar subset of cells as the mouse Mitf gene. Animals ded information for future functional analysis. homozygous for the mib mutation are characterized by depigmentation, microphthalmia, osteopetrosis and neu- Results and discussion rological disorders (Opdecamp et al., 1998). The fact that the mutation is a large deletion might suggest a case of Analysis of the Mitf-Tfe bHLH–Zip domain contiguous gene syndrome, thus explaining the neuro- We compared the bHLH–Zip domains of Mitf proteins logical disorder that is not seen in Mitf mutations in any from many eukaryotic species, vertebrate and inverteb- other vertebrate species so far analyzed. Zebrafish rate alike. The Rtg3p protein from Saccharomyces cere- homozygous for the nacre mutation (a Mitf mutation visiae was used as the basal protein based on the idea found in the fish) lack melanophores throughout develop- that it represents the ancestral Mitf-Tfe gene (Rehli ment and do not express early melanoblast markers. et al., 1999) (Figure 1A and data not shown). The align- However, development of the pigmented epithelium of ment starts with the first amino acid of the basic the retina is normal (Lister et al., 1999). Mitf-Tfe ortho- domain of mouse Mitf (as defined in Hodgkinson et al., logs have recently been identified in Caenorhabditis ele- 1993) and spans 92 amino acids, ending two amino gans (Rehli et al., 1999) and Drosophila melanogaster acids downstream of the 4th leucine in the leucine (Hallsson et al., 2004); no mutations have so far been zipper. The alignment of the bHLH domain introduces a identified in these two organisms. Mutations in the MITF gap in many species due to six or eight additional amino gene in humans are the cause of two dominant pigment acids in the loop of Mitf in flies and yeast (Figure 1A). cell syndromes, Waardenburg syndrome type IIA Not surprisingly, conservation is highest in the basic (WSIIA) (Hughes et al., 1994; Read and Newton, 1997; domain and helix 1. In the basic domain, 14 of 19 amino Tassabehji et al., 1994, 1995) and Tietz syndrome (Amiel acids (74%) are either fully conserved (12 of 19) or con- et al., 1998; Smith et al., 2000). Both syndromes are pig- servative substitutions (2/19) and the five non-conserved ment cell disorders, characterized by hypo-pigmentation amino acids (at positions 199, 200, 204, 208, and 211) and deafness. are predicted not to contact DNA (Ferre-D’Amare et al., Genomic sequencing of Mitf in vertebrates has 1993). Amino acid conservation is also high in helix 1, revealed a complex intron-exon structure with several with 13 amino acids of 15 conserved or conservative widely spaced 5¢ exons, which are expressed from dif- substitutions (87%) (Figure 1A). In the loop, only two ferent promoters, giving rise to protein products with amino acids are fully conserved in all species, Lys233 different N-termini (Amae et al., 1998; Oboki et al., and Asn242, located at either end of the loop; conserva-

186 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

138 Conservation of Mitf tion of the rest of the amino acids varies between dif- that, due to an intronic mutation, lacks the 18 bp from ferent groups of organisms. The fly species differ from all Mitf transcripts (Steingrimsson et al., 1994). These the rest of the species analyzed here in that the loop is 18 bp are found only in mammals and the two bird spe- considerably longer; six amino acids longer in Apis melli- cies analyzed here (G. gallus and C. coturnix) and not in fera and the Drosophila species and eight amino acids any of the Tfe genes analyzed (data not shown), sug- in Anopheles gambiae (Figure 1A). Examination of the gesting that this is a relatively new addition to exon 6 in intron-exon structure shows that the intron which splits the evolutionary history of the Mitf-Tfe family. the loop in vertebrate Mitf genes is not present in the The 3D structures of the bHLH–Zip domains of the fly Mitf genes (Hallsson et al., 2004). The fly Mitf genes Max and Usf1 proteins have been characterized and are the only group of genes lacking this intron (not inclu- shown to consist of two a-helices divided by a loop of ding S. cerevisiae) suggesting a case of intron loss in variable length (Ferre-D’Amare et al., 1993). One side of the fly group. The different loop lengths in A. mellifera the helix makes DNA contacts, whereas the other does and the Drosophila species compared with A. gambiae not (Figure 1B). This is in good accord with the conser- might be explained with a change in splice junctions, vation seen in Figure 1A, where the non-conserved incorporating or losing nucleotides at the end of exons. amino acids fall on the side of the helix predicted not to Conservation is considerably lower in helix 2 and the make DNA contacts. Not surprisingly, most of the muta- leucine zipper than in the basic domain and helix 1. In tions in and around the Mitf bHLH domain in mice helix 2, 10 of the 22 amino acids are conserved or affect residues on the DNA facing side of the helix (Fig- conservative substitutions in the species analyzed here. ure 1A, B), with the notable exception of three Mitf Based on crystal structure analysis of the related MAX mutations which occur on the ‘no contact’ side of the protein, six of these amino acids are believed to be continuous helix forming the basic domain and helix 1. important for dimerization (D below the alignment in Two of these mutations, MitfMi-wh (Ile212Asn) and Figure 1A–C) (Ferre-D’Amare et al., 1993). The leucine Mitfmi-enu198 (Asp207Gly) occur close to the boundaries zipper in the mammalian Mitf-Tfe proteins has been between the contact and no-contact sides of the helix, defined as consisting of four leucine residues separ- suggesting that these changes affect the protein–DNA ated by six amino acids; the leucine residues aggre- interface, whereas the third mutation, Mitfmi-vit gate on one side of an a-helix (Figure 1A, C). The (Asp222Asn) is not predicted to make DNA contacts. zipper is the least conserved part of the bHLH–Zip This mutation results in animals which gradually lose domain, with an amino acid stretch around the fourth coat color pigmentation with age (reviewed in Stein- leucine (N-RIQELE-C) representing the best conserved grimsson et al., 2004), possibly due to effects on mel- part of the zipper. Moreover, the mammalian species anocyte stem cell maintenance (Nishimura et al., 2005). are the only group of species where all four leucines This might suggest that the phenotype associated with are conserved, with conservation being particularly Mitfmi-vit is due to an effect on protein–protein interac- poor in the invertebrate lineage. In the Drosophila spe- tions, possibly with b-catenin (Schepsky et al., 2006). cies, leucines 3 and 4 are conserved, in A. gambiae Based on the crystal structure of the Max protein and A. mellifera leucines 2, 3 and 4 are conserved. In (Ferre-D’Amare et al., 1993) five amino acids of helix 1 the Caenorhabditis species, leucines 2 and 4 are con- are important for dimerization (see Figure 1A, B). served and in the Ciona species leucines 1, 3 and 4 Helix 2 and the leucine zipper have been shown to be are conserved (Figure 1A). This may suggest that the important for dimerization of the Mitf-Tfe protein, as leucine zipper is not an original feature of the Mitf pro- well as for interactions with other proteins, such as tein. The data suggest a gradual accretion of leucine Ubc9 and Pias Xa (Murakami and Arnheiter, 2005). A amino acids to the zipper, with leucines 2 and 4 being helical wheel projection of helix 2 and the leucine zipper most ancestral of the four. For instance, leucine 1 is shows that most of the conserved amino acids in helix found only in ascidians and vertebrates, and most pre- 2 aggregate on one side of the helical wheel (Lys243, sumably originated in a common ancestor of these Ile246, Leu247, Ser250, Tyr253, Ile254, and Leu257). taxa (Figure 1A). These observations are consistent These amino acids are predicted to make protein con- with the conclusions of Atchley and Fitch who showed tacts important for dimerization (labeled as dimerization that the bHLH leucine zipper proteins do not represent region in Figure 1C) (Ferre-D’Amare et al., 1993). Simi- a mono-phyletic group within the bHLH super-family larly, the four leucines of the zipper (labeled L1–L4 in rather they appear several times in evolution (Atchley Figure 1C) form a distinct patch on one side of the helix. and Fitch, 1997) therefore constituting an example of Interestingly, none of the three mouse loss-of-function convergent molecular evolution. mutations in this part of the protein affect residues pre- An interesting aspect of the Mitf gene function in sumed to be important for dimerization. This might mammals is the alternative splicing of an 18 base pair mean that these residues have other functions, that part of exon 6, the exon encoding the basic domain. they are structurally important or that the structure of This alternative splicing has been shown to be function- Mitf cannot be accurately modeled based on the Max or ally important through studies on the Mitfmi-sp mouse USF proteins.

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 187

139 Hallsson et al.

Analysis of the Mitf activation domains homology with sequences from the adenoviral E1A pro- Another well conserved part of the Mitf protein is the tein (Sato et al., 1997). The AD1 activation domain has acidic activation domain (AD1) that has been shown to been suggested to form an amphipathic a-helix, with consist of amino acids 114–132, encoded by exon 4 in alternating acidic (aspartic acid and glutamic acid) and the mammalian Mitf genes (Sato et al., 1997). This part neutral hydrophobic (valine, isoleucine, and methionine) of the Mitf protein has been well characterized and amino acids (Figure 2A) (Sato et al., 1997). Comparing demonstrated to be important for interactions with the the acidic activation domain encoded by mouse exon 4 transcription co-activator protein p300 and to share and homologous sequences in several additional species

188 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

140 Conservation of Mitf

Figure 2. Analysis of conserved domains in the Mitf protein. (A) A comparison of the AD1 region from 25 Mitf-Tfe genes. The Mitf acidic activation domain (AD1) is the primary Mitf activation domain and is encoded by exon 4 in mouse. The numbering below the alignment is according to mouse Mitf–1M amino acid sequence. The predicted a-helices are shown as bars above the alignment. (B) Analysis of the Q-rich domain encoded by mammalian exon 1B. In mammals, exon 1B contains a well conserved domain located in the N-terminus of the Mitf protein which is predicted to form an a-helix, shown as a bar above the alignment. Numbering is from the first amino acid encoded by Mitf exon 1A. A helical wheel diagram of this domain shows a rather uniform distribution of the conserved amino acid residues around the helix (data not shown). Abbreviation of species names are as in Figure 1. Amino acid residues are shown white on black where identical residues are found in 11 or more species (>45%), amino acid residues are shown black on gray where similar residues are found in 11 or more species. shows considerable level of conservation, with the groups as vertebrates and flies (Leu135, Leu143, and exception of the two nematode species (Figure 2A). Asn147). The size of exon 4 is similar in all species, This lack of conservation in nematodes is consistent except in the Drosophila species where this domain is with the poor overall conservation of nematode Mitf encoded by the same exon that encodes the basic gene and amino acid sequence. If nematodes are exclu- domain (Hallsson et al., 2004; data not shown). Struc- ded from our analysis, three amino acids (Asp118, tural prediction suggests that exon 4 encodes two heli- Asp122, and Ile123) are seen to be conserved in Mitf in ces and that the three conserved amino acids, Leu135, all species, and several conserved in one or more spe- Leu142, and Asn146, are a part of the second helix cies in all the different groups of species analyzed. Sev- where they line up on one side of the helix (data not eral amino acids that fall outside the regions initially shown). This raises the possibility that the AD1 domain identified as AD1 (Sato et al., 1997) are very well con- is more complex than originally proposed and that the served in most of the species analyzed here, three of additional conserved amino acids may be important for those are conserved between such distantly related transcription activation.

Figure 1. The basic helix–loop–helix leucine zipper domain is the most important functional part of the protein and the best conserved. (A) An alignment of 27 bHLH–Zip domains from Mitf and Tfe proteins. Lines above the alignment indicate the different parts of the bHLH–Zip domain and ‘Ls’ indicate the leucines of the leucine zipper. Numbering is according to the Mus musculus Mitf–1M form. Amino acids are color coded based on side chain properties. Assignment of amino acids to different parts of the bHLH–Zip domain is based on the crystal structure of the Max protein (Ferre-D’Amare et al., 1993) and on structure predictions; basic domain extends from 199 to 217, helix 1 from 218 to 238, helix 2 from 243 to 265, and the zipper from 267 to 288. Amino acids predicted to make base and phosphobackbone contacts are indicated under the alignment with B and P, respectively. Known mouse mutations are shown below the alignment; D207G represents the Mitfmi-enu198 mutation, H209R represents the Mitfmi-enu5/bcc2 mutations, I212N represents MitfMi-Wh, R216K is Mitfmi-or, R217del is Mitfmi, D222N is Mitfmi-vit, I224F is Mitfmi-enu122, G244E is Mitfmi-b, R263stop is Mitfmi-di/ce, and D266Y is Mitfmi-rorp. Three known human mutations are shown, numbered according to OMIM http://(www.ncbi.nlm.nih.gov/omim). The species used for the comparison are Mus musculus (Mmus; Mouse), Rattus norvegicus (Rnor; Rat), Homo sapiens (Hsap, Human), Pan troglodytes (Ptro, Chimpanzee), Gallus gallus (Ggal, Chicken), Coturnix coturnix (Ccot, Common quail), Xenopus laevis (a and b) (Xlae a/b, African clawed frog), Danio rerio (A and M) (DrerA/ DrerM, Zebrafish), Tetraodon nigroviridis (A and M) (TnigA/TnigM, Puffer fish), Ciona intestinalis (Cint, Ascidian), Ciona savignoy (Csav, Ascidian), Drosophila melanogaster (Dmel, Fruitfly), D. yakuba (Dyak), Apis mellifera (Amel, Honeybee), Caenorhabditis elegans (Cele, Nematode), C. briggsae (Cbri, Nematode), and Saccharomyces cerevisiae (Scer, Baker’s yeast). Anopheles gambiae (Agam, African malaria mosquito) was included in the analysis of the bHLH, but left out of the rest of the sequence analysis due to very low levels of conservation in domains other than the bHLH. (B) A helical wheel drawing showing the basic domain and helix 1. The variable amino acids are situated on the side of the helix predicted to turn away from DNA. Amino acids predicted to make base and phosphobackbone contacts are indicated with B and P, respectively. Fully conserved amino acids are shown as white letters on black background, conservative substitutions are shown as black letters on gray background, and non-conserved amino acids are shown as black letters on white background. (C) A helical wheel drawing showing helix 2 and the leucine zipper. The amino acids important for dimerization aggregate on one side of the helix and are labeled specially and referred to as ‘dimerization region’. The leucine zipper forms a well-defined domain on one side of the helix. Labeling as in (A).

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 189

141 Hallsson et al.

In addition to AD1 encoded by exon 4, three other buted around the helix. Many transcriptional regulators activation domains in Mitf have been proposed. These contain glutamine rich domains and based on this are AD2, encoded by exon 5 (Mansky et al., 2002), AD3 we propose that this domain is important for trans- encoded by exon 9 (Takeda et al., 2000a), and AD4 criptional activation. This needs to be tested experi- encoded by exon 1A (Saito et al., 2003). The amino acid mentally. sequences encoded by mammalian exon 5 (AD2) are well conserved in all vertebrates, and similar sequences Conservation in the domain encoded by mammalian are also found in ascidians. However, there is no con- exon 2 servation found in other metazoans, such as flies or Another highly conserved domain is encoded by the 5¢ nematodes, suggesting that this activation domain is end of exon 2 and is found in vertebrates, ascidians, chordate specific. The AD3 activation domain resides in and flies. We define this conserved domain (Cd2) as the C-terminus of the mammalian Mitf protein (Takeda amino acids 11–39; this stretch is identical between et al., 2000a) but its boundaries have not been mapped mouse and humans (Figure 3A). The conservation precisely complicating analysis of its evolutionary con- between mammalian and ascidian species is 69% servation. Finally, a fourth activation domain (AD4) is (mouse versus H. roretzi) and over 60% between mam- encoded by exon 1A (Saito et al., 2003) which is of spe- mals and flies (mouse versus D. melanogaster). This cial interest since parts of exon 1A are conserved in all degree of conservation is comparable with the bHLH– vertebrates and in a majority of the fly species studied, Zip domain and exceeds the conservation observed for indicating common ancestry (Hallsson et al., 2004). the activation domain encoded by exon 4 (AD1) (Fig- ure 2A). Parts of this domain are predicted to form a- Conservation in the domain encoded by exon 1B helices, and helical wheel diagrams indicate that it has Parts of the region encoded by the alternatively an equal overall distribution of conserved amino acids spliced exon 1B (mouse exon 1B or homologous ex- around the helices (data not shown). In addition to being ons in other species) show high levels of conservation well conserved in Mitf, a portion of this domain shows between vertebrates and flies (53% conservation homology to the UL17 protein from meleagrid herpesvi- between M. musculus and A. mellifera, 60% including rus 1 (NP_073310) (Figure 3A). Although, the role of conservative substitutions) (Figure 2B). This conserved Cd2 is still unknown, the closeness to Serine amino acid domain (referred to as conserved domain 1 or Cd1) is 73 and mutations in and around exon 2 (Hallsson et al., rich in glutamine and a part of it is predicted to form 2000) support the idea of a functional importance for an a-helix; conserved amino acids are uniformly distri- this part of the Mitf protein.

Figure 3. Analysis of conserved domains in the Mitf protein. (A) Comparison of the amino acid sequence encoded by parts of exon 2 from 25 different Mitf-Tfe proteins. This part of the protein shows a higher than average conservation, with some amino acids conserved in all species, except nematodes. Below is the sequence from the UL17 protein from Meleagrid herpesvirus 1 (MeUL17) (AAG30056). (B) An alignment of a stretch of highly conserved amino acids encoded by mammalian Mitf exon 9. Abbreviation of species names are as in Figure 1. Amino acid residues are shown white on black where identical residues are found in 11 or more species (>45%), amino acid residues are shown black on gray where similar residues are found in 11 or more species. Below are sequences from the UL17 proteins from meleagrid herpesvirus 1 (AAG30056) and gallid herpesvirus 3 (GaUL17) (NP_066847).

190 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

142 Conservation of Mitf

Parts of the C-terminus are well conserved for correct targeting of capsids and major and minor Comparison of Mitf amino acid sequences identified capsid proteins to the DNA replication compartment in two short stretches of amino acids C-terminal to the cells (Taus et al., 1998). The conservation of these bHLH–Zip region that are well conserved in distantly domains between Mitf and a viral protein, especially related species, one region with 55% conserva- one important in DNA handling and nuclear localization (Cd3) and another with 58% conservation (Cd4) tion, may help reveal novel functional insights into (Figure 3B). Conserved domain 3 (Cd3) is possibly a Mitf protein function. part of the previously identified activation domain (AD3) which has been proposed to consist of amino Conservation of sites important for post- acids 324–369 (Takeda et al., 2000a). The Cd4 domain translational modification is well conserved in Mitf in vertebrates, nematodes, Recent studies have shown that post-translational modi- and flies (Figure 3B). Using this domain in a database fications such as phosphorylation, ubiquitination, and search yielded, in addition to the expected Mitf-Tfe SUMOylation, can affect the activity of the Mitf tran- proteins, two UL17 viral proteins, from Gallid herpesvi- scription factor (reviewed in Steingrimsson et al., 2004). rus 1 (BAA82911) and meleagrid herpesvirus 1 The known post-translational modification sites are (NP_073310) (data not shown). Interestingly, a differ- shown in Figure 4. The best studied of these events is ent region from the UL17 protein from meleagrid the phosphorylation of Mitf on Serine 73 by the Erk2 herpesvirus 1 shows homology to the well conserved MAP kinase. This has been shown to affect Mitf protein part of exon 2 (Cd2) (Figure 3A). The UL17 protein is stability and recruitment of p300 (Hemesath et al., 1998; known to be essential for virus replication and is Xu et al., 2000). The conservation of Serine 73 is consid- required for cleavage and packaging of viral DNA in erable among the species analyzed here; it is found herpes simplex virus type 1 (Salmon et al., 1998) and conserved in all vertebrates as well as in ascidians

Figure 4. Analysis of the conservation of post-translational modification sites. (A) Alignment of amino acids surrounding Serine 73. (B) Alignment of amino acids in front of the basic domain, showing a possible SUMOylation site (K182) and a possible phosphorylation site, Serine 173. The SUMO site is well conserved and fits the SUMOylation consensus site, IKXE. (C) An alignment of a possible acetylation site found in the basic domain of Mitf of all species analysed. The Ubiquitination site is K201. (D) An alignment of a second acetylation site located in the zipper domain. In most species analyzed, both sites fit the consensus sequence RXKK. (E) Alignment of the second SUMOylation site and three surrounding phosphorylation sites, serines 298, 307, and 325. (F) An alignment of the Caspase site at Asp345. (G) Alignment of the p90Rsk phosphorylation site at Serine 409. Drosophila simulans has been added to the alignment (Dsim).

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 191

143 Hallsson et al.

(Figure 4A). Two SUMOylation sites are present on 409 is relatively well conserved in the species analyzed either side of the bHLH domain (Lys182 and Lys316) in here, it is found in all vertebrate species as well as in the mouse Mitf protein (Miller et al., 2005; Murakami the Drosophila species, but is not found in ascidians and Arnheiter, 2005) (Figure 4B, E). Despite a relatively and nematodes (Figure 4G). Furthermore, the Serine low level of conservation in these regions of the Mitf 173 is found conserved in all vertebrates as well as in protein, these SUMOylation-sites are conserved in both the ascidian species analyzed. It is not found in other vertebrates and invertebrates, consistent with functional invertebrate species. The remaining phosphorylatable importance (Miller et al., 2005; Murakami and Arnheiter, serine amino acids, Serines 298, 307, and 325 (a puta- 2005). Interestingly, Drosophila and Caenorhabditis Mitf tive ATM/ATMR phosphorylation site) are not well con- proteins appear to have lost one SUMOylation site each served, suggesting that these phosphorylation sites in the course of evolution (Figure 4B, E). Drosophila has could be species-specific. Alternatively, this may indi- retained the SUMOylation site in front of the bHLH–Zip cate that the recognition sites are not easily identified domain (Lys182) while in Caenorhabditis the C-terminal using our approach or that other serine amino acids in (Lys316) motif persisted. The Mitf protein is targeted for the protein function as the acceptors of these signals proteosomal degradation through ubiquitination at amino and can have the same functional consequences. acid Lys201 (Xu et al., 2000). Amino acid Lys201 is con- Recently, it has been shown that Mitf is a substrate served in all vertebrate Mitf genes and in the majority of for the caspase 3 protease and that the cleavage site is ascidians and flies analyzed here (Figure 4C); this amino positioned right after Asp345. The C-terminal fragment acid could well be conserved simply due to its presence released after cleavage has a pro-apoptotic activity that in the important basic domain. sensitizes melanoma cells to death signals (Larribere Two potential acetylation sites are present in the Mitf et al., 2005). Asp345 is very well conserved in the spe- protein, one in the basic domain (Lys205) and one in cies analyzed here (Figure 4F), although the surrounding the leucine zipper (Lys272) domain (Figure 4C, D). sequences are not particularly well conserved. Lys205 is found in all species analyzed and the four amino acid acetylation motif is found fully conserved in A novel exon in Drosophila Mitf? all vertebrate and Drosophila species analyzed here, but In order to explore the levels of nucleotide conservation not in nematodes and the ascidian species. This site is in Drosophila, we compared the genomic sequences of embedded in the well-conserved DNA binding domain different Drosophila Mitf genes using the VISTA analysis (Figure 4C). According to the crystal structure of the tool (Frazer et al., 2004). In addition to high levels of Max protein, this amino acid is predicted to make phos- conservation seen in the known exons, a high level of phobackbone contacts (Ferre-D’Amare et al., 1993) sug- conservation was also observed about 150 base pairs gesting that regulated acetylation of Lys205 may affect upstream of exon 1B (data not shown). This is especi- DNA binding (see Figure 1A, B). Due to the importance ally evident in comparisons between distantly related of the basic domain for DNA binding, it will be difficult, Drosophila species such as D. melanogaster and D. viri- however, to disentangle this experimentally. The second des (data not shown). This approximately 150 nucleotide possible acetylation site (Lys272) is in the leucine zipper sequence is among the best conserved parts of the region and is found in all species except the flies, the gene; only exons 5 and 6 (encoding the AD1 and basic four amino acid motif is poorly conserved in species domain and helix 1) match this level of conservation. other than the vertebrates (Figure 4D). In the helical Although the only cDNA showing homology to the open wheel projection, this amino acid is localized on the reading frame encoded by this exon (NM_001038720) is same side of the helix as the amino acids important for non-spliced, the ORF does include an open reading dimerization. It is therefore possible that acetylation of frame and the amino acid sequence is conserved in all this amino acid affects dimerization properties of the the Drosophila species examined (Figure 5). In addition, protein. Thus, through acetylation of the Mitf protein, a all insertions and deletions are multiples of three nucleo- mechanism may exist to change both DNA binding and tides (i.e. whole codons), and the splicing donor is in dimerization abilities of the Mitf protein, at least in phase with exon 1B. This suggests that this may be a mammalian species. new alternatively used 5¢ exon where splicing goes In mammals, the Mitf protein has been postulated or from this putative exon (termed exon 1I) to exon 1B. In shown to be phosphorylated on at least five Serines our opinion, this evidence strongly suggests that the (173, 298, 307, 325, and 409) in addition to the previ- Drosophila Mitf gene is transcriptionally more complex ously mentioned Serine 73 (see Figure 7A for the posi- than previously reported (Hallsson et al., 2004). tion of known post-translational modification sites) (reviewed in Bronisz et al., 2006; Steingrimsson et al., Conservation of 3¢ untranslated regions 2004). Although the six phosphorylation sites are con- The Mitf gene in the mouse has over 3 kb of untranslat- served in mammals and in some non-mammalian verte- ed regions (UTR) at the 3¢ end, extending from the stop brates, they are not conserved in all groups of species codon in exon 9 to the polyA sequence of the cDNA used in our analysis (see Figure 4A, B, E, and G). Serine (Hallsson et al., 2000). We compared this sequence to

192 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

144 Conservation of Mitf

Figure 5. A novel putative 5¢ exon in the Drosophila Mitf gene. A comparative analysis of gene sequence of Drosophila Mitf was used to look for regions of high conservation. This analysis revealed a single site of unknown function and high conservation upstream of exon 1B (data not shown). In order to further investigate this region of high conservation, several Drosophila species were analyzed for open reading frames. This sequence turned out to have a continuous open reading frame in all ﬂy species and the splice junction would fuse this exon (referred to as exon 1I) to exon 1B, while maintaining the normal reading frame. The alignment consists of sequences from Drosophila melanogaster, D. sechellia, D. yakuba, D. erecta, D. pseudoobscura, D. ananassae, D. mojavensis, D. virilis, and D. persimilis. corresponding sequences in other vertebrate species to miR-25/32/92/363/367, miR-124.2/506, miR-124.1, two determine if it contained conserved elements. Surpris- sites for miR-148/152 and miR-101 and miR-144 have the ingly, the 3¢UTR region showed considerable conserva- same target site (see Figure 6A, B). The conservation of tion; 35% of the bases in the mouse 3¢UTR sequence the 3¢UTR of Mitf is dispersed over the entire sequence, are conserved in all the species compared. A similar yet concentrated around the areas where miRNA targets comparison of other non-coding sequences, in two are found. The exact role of these conserved miRNA introns which split the bHLH–Zip domain of the gene, target sites in Mitf is currently unknown, although this representing the most conserved exons, shows low conservation in multiple species suggests functional conservation. The intron between exons 6 and 7 shows importance. The miRNA binding sites are also found in 2.3% conservation and the intron between exons 7 and many other target genes besides Mitf, as seen using 8 shows 9% conservation. This difference in conserva- the TARGETSCAN program (www.targetscan.org). tion of non-coding sequences suggests that the most Only a few miRNAs have known biological activity. It conserved sequence, the 3¢UTR, might have a func- has been shown that animal miRNAs downregulate the tional role in gene regulation. expression of their target mRNAs (Lim et al., 2005) by MicroRNAs (miRNAs) are 17–24 nucleotide noncoding inhibiting translation (Cheng et al., 2005). Recent studies single stranded RNA molecules (Bartel, 2004) that can have demonstrated that miRNAs cannot only repress regulate gene expression by binding to the 3¢UTRs of translation of mRNAs but can also induce their degrada- mRNAs (Calin and Croce, 2006). A number of potential tion (Bagga et al., 2005; Lim et al., 2005). Indication of miRNA target sites are found within the 3¢UTR sequence the biological function of miRNAs 124 and 152 was of Mitf. The sites that are conserved in the 11 vertebrate found when they were inhibited in HeLa cells and species analyzed here are the miRNA families of miR-27, shown to result in decreased cell growth. Moreover,

Figure 6. Potential miRNA target sites in the Mitf 3¢UTR sequence. (A) Bars represent miRNA sites conserved in all species. (B) Sequence conservation of the potential miRNA target sites in human (Hsap), chimpanzee (Ptro), mouse (Mmus), rat (Rnor), cow (Btau), dog (Cfam), cat (Fcat), rabbit (Ocun), opossum (Mdom), elephant (Lafr), and chicken (Ggal). The mir-27 target sequence is located closest to exon 9, then miR-25/32/ 92/363/367, miR-124.2/506 and 124.1, miR-148/152, miR-148/152 and at the 3¢ end are miR-101 and miR-144- with the same target sequence.

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 193

145 Hallsson et al. inhibition of mir-148 resulted in an increase in the level in Figure 8. Conservation and potential binding sites in of apoptosis (Cheng et al., 2005). miRNA 124 has four the 5¢ region upstream of exons 1A, 1J, 1C, 1MC, 1E, 1H, target sites (two are shown in Figure 6B) in the Mitf 1D, and 1B are shown in Supplementary Figures S1–S8 3¢UTR. It has been shown in several cases that multiple and an overview of all the nine 5¢ exons and potential sites for the same miRNA can boost target repression transcription factor binding sites in Figure 7B. (Rajewsky, 2006). Different miRNA target sites in the The 1M promoter of Mitf is specifically used in melano- 3¢UTR might on the other hand indicate that the mRNA cytes. A number of transcription factors have been is regulated specifically in different tissues or at differ- shown to bind to the 1M promoter to regulate its expres- ent times during development (Rajewsky, 2006). The sion, including the transcription factors LEF-1, Pax3, role of miRNAs in Mitf regulation is currently unknown. Sox10, CREB, Onecut-2 in addition to Mitf itself (Bertolot- to et al., 1998; Bondurand et al., 2000; Jacquemin et al., Conservation of promoter elements and binding 2001; Lee et al., 2000; Potterf et al., 2000; Price et al., sites 1998; Saito et al., 2002; Takeda et al., 2000b; Verastegui The Mitf gene has nine different 5¢ exons that are sepa- et al., 2000; Watanabe et al., 1998; Widlund et al., 2002). rately spliced to exons 2–9 (Figure 7). The exons are 1A In order to begin the analysis of conserved Mitf promoter (Amae et al., 1998), 1J (Hershey and Fisher, 2005), 1C elements, 500 bp upstream of exon 1M of the mouse (Fuse et al., 1999), 1MC (Takemoto et al., 2002), 1E (Oboki Mitf sequence was used to find corresponding et al., 2002), 1H (Amae et al., 1998; Steingrimsson et al., sequences from the genomes of human, chimpanzee, 1994), 1D (Takeda et al., 2002), 1B (Udono et al., 2000), rhesus macaque, rat, cow, dog, opossum, and chicken. and 1M (Hodgkinson et al., 1993). The conservation of Sequence comparison showed considerable conserva- the 1M promoter and the known and potential binding tion among these species (see Figure 8). Of the 500bp sites as located by the TARGETSCAN program are shown human Mitf–1M promoter, 181 bases are conserved in all

Figure 7. (A) A schematic drawing showing positions of protein domains in Mitf, as well as the position of known and predicted post- translational modification sites and regions important for protein–protein interactions. The best conserved part of this protein family is the bHLH–Zip domain (shown in orange). At least four activation domains have been suggested in the Mitf protein, although only AD1 has been mapped precisely; the others have been suggested on the basis of large deletions. Their approximate positions are shown with red boxes and they are labeled AD1-4. The conserved domains described here are shown as gray boxes and labeled Cd1-4. It is possible that some of the conserved domains coincide with previously identified activation domains. For example it is possible that Cd4 is actually AD3. Additionally the pathways that lead to post-translational modifications of the Mitf protein are shown and the amino acids are labeled specifically. (B) Summary of the 5¢ exons found in different genomes and potential transcription factor binding sites. Boxes show exons present in the genomes. An X indicates were the appropriate exon was not found with BLAST or BLAT searches using the mouse or human exons as a reference. Potential transcription factor binding sites are indicated as colored boxes.

194 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

146 Conservation of Mitf

Figure 8. Conservation of the 1M exon and upstream sequences. The start of the known cDNA is shown by a line above the sequences. The open reading frame of the mouse 1M exon is used as a reference and is highlighted in a yellow box (Hodgkinson et al., 1993). Conserved bases are marked by a vertical bar. Transcription factor binding sites are indicated in boxes or underlined. Potential binding sites are LEF, VJUN/ATF/CREB, S8, CHX10 and PAX4. Other binding sites shown are previously known binding sites (see text for details). the species (36%). When the most distantly related spe- own expression through physical interaction with LEF1 cies is excluded, 290bp are conserved (58%). Binding and this self-activation depends on three Lef1 binding sites of known regulators of Mitf expression are located sites found in the 1M promoter (Saito et al., 2002; Takeda in the domains where the most conservation is found. et al., 2000b; Widlund et al., 2002). The three Lef1 bind- The MITF–1M promoter serves as a target as well as a ing sites are well conserved. The ﬁrst Lef1 site, Lef1–1 nuclear mediator of Wnt signaling. MITF regulates its (LBS218 in Saito et al., 2002) is conserved in all species

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 195

147 Hallsson et al. except the rhesus macaque and chicken. The second tions in the So4 binding site (Sx2 in Potterf et al., 2000) Lef1 binding site, Lef1-2 (LBS201 in Saito et al., 2002), is result in a significant decrease in activation by Sox10 conserved in the primate species, cow, and dog and the (Potterf et al., 2000). Some of the Sox10 sites have been third site Lef1-3 (LBS195 in Saito et al., 2002) is con- shown to be important in combination with other Sox10 served in all species except chicken. All three Lef1 sites sites. So6/7 has been shown to have either a weak bind- have been shown to be important for the activation of ing affinity (Bondurand et al., 2000) or a strong binding the 1M promoter in the mouse (Saito et al., 2002; Takeda activity. Lee et al. (2000) showed that Sox10 binds et al., 2000b). Studies in melanocytes have also indicated strongly to the So6/7 (C/D in Lee et al., 2000) sites and that LEF-1 and b-catenin synergistically affect the expres- that mutations in So6/7 combined with mutation in the sion of the 1M promoter through the Lef1 binding sites So5 site severely impaired the activation of Mitf expres- (Takeda et al., 2000b). In each species at least two Lef1 sion. They concluded that these sites are likely to act sites are conserved, whereas in human, rhesus maca- together in the activation of Mitf expression. The So8, que, cow and dog all three sites are conserved. Two sites So9, and So2 sites have shown minimal activity as seem to be sufficient for the activation in some but not Sox10 binding sites. Sox10 shows weak binding ability all of the species. to the So3 (Bondurand et al., 2000), So6, So8/9 (Lee Mitf is a part of the major mammalian pigmentation et al., 2000) sites and none for the So2 site (Bondurand signaling pathway stimulated by the a-melanocyte-sti- et al., 2000). The So8/9 site is well conserved, although mulating hormone (MSH) through a cAMP mediated sig- not in all species. So2 is only conserved between the pri- nal. The cAMP responsive element binding (CREB) mates and dog sequences and So1 is only conserved in transcription factor activates Mitf expression specifically the primate species (S2 in Bondurand et al., 2000). In in melanocytes by binding to the cAMP responsive ele- Bondurand et al. (2000) another potential Sox10 site has ment (CRE) binding site in the 1M promoter. CRE is been located at )518/)512 (not shown here); its import- located between )147 and )140 upstream of the ance has not been determined. Another two potential human Mitf–1M transcription initiation site (Bertolotto Sox10 binding sites are located around 12 kb upstream et al., 1998; Price et al., 1998) and is completely con- of the transcription start site of exon 1M (reviewed served in all species shown (Figure 8), confirming its Steingrimsson et al., 2004). importance. The cAMP mediated pathway also depends A binding site for the transcription factor Onecut-2 is on the most conserved Sox10 binding site, So5, sug- located in the 1M promoter of the human Mitf gene gesting cooperation between CREB and Sox10 in produ- (Jacquemin et al., 2001). Adjacent to the site is another cing a tissue-restricted gene expression of Mitf (Huber Oc-2 site on the reverse strand (OC-2 rev). Both of et al., 2003). these sites are conserved in the primate species but Pax3 has been shown to activate Mitf expression not in any of the other species analyzed here. Jacque- through two Pax3 binding sites, Pax3-1 (Watanabe min et al. (2001) showed that in 397-mel melanoma et al., 1998) and Pax3-2 (Bondurand et al., 2000) in the cells the proximal site contributes to the transcription of 1M promoter. These sites are both completely con- Mitf–1M, whereas the distal one does not (Jacquemin served in all species except the most distantly related et al., 2001). An Oc-2 site is also located around 2kb species, the chicken (Figure 8). This confirms the upstream of the transcription start (reviewed in Stein- importance of Pax3 in mediating the expression of Mitf. grimsson et al., 2004). Experiments have shown that the Pax3-1 site alone is In addition to the binding sites previously mentioned, not sufficient to drive Pax3 dependent stimulation of a potential interleukin 6-responsive element (IL6-RE) and Mitf expression. However, when the Pax3-2 site or both two potential GATA binding sites (G1 and G2) have binding sites (Pax3-1 and Pax3-2) are destroyed, the been located in the Mitf–1M promoter (Fuse et al., Pax3 depended expression is abolished (Bondurand 1996). The functional importance of the IL6-RE site has et al., 2000) suggesting that these sites are used in a not been verified; however, this site is conserved in all synergistic manner. species except the rat and chicken. The GATA-G1 site According to the literature, there are nine potential is conserved in all species except in the chicken and Sox10 binding sites in the Mitf–1M promoter and two GATA-G2 in all the species except the cow, opossum have been located downstream of the transcription start and chicken. site (Huber et al., 2003; Lee et al., 2000; Potterf et al., The So5, Pax3-1, Pax3-2, CRE, and G1 binding sites 2000; Verastegui et al., 2000). As the exact location of seem to be the most conserved sites in the Mitf–1M these sites is not consistent in the literature, they are promoter. In fact, most of the conservation is concen- labeled So1–So11 in Figure 8. The So5 site has been trated around the known binding sites. Previous studies identified as very important for the Sox10 mediated acti- have shown that all the above-mentioned sites, except vation of Mitf expression (Huber et al., 2003; Lee et al., GATA-G1, are of functional importance. 2000; Potterf et al., 2000; Verastegui et al., 2000 – labe- Analysis of the black-eyed white mutation in the micr- led Sx3 in Potterf et al., 2000 and B in Lee et al., 2000) ophthalmia gene (Mitfmi-bw) showed that this mutation and is conserved in all the species shown here. Muta- is caused by the integration of a 7.2 kb L1 element into

196 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

148 Conservation of Mitf intron 3 (Yajima et al., 1999). Since these mice lack melanocytes in the skin and inner ear but have normally pig- Materials and methods mented RPE, it seemed likely that the insertion Sequence retrieval interrupts an important melanocyte-specific regulatory All the sequences used in this study, except some of the mouse region. We compared intron 3 in nine different verteb- and Drosophila sequences, were retrieved from public databases. rate species to see if this region contained conserved Sequences of previously described Mitf genes were retrieved from elements. The primate species show considerable con- NCBI databases (http://www.ncbi.nlm.nih.gov) using sequence identification numbers. When searching for previously unidentified servation (data not shown), whereas the conservation is Mitf genes, cDNA or genomic sequences were identified based on minimal when all the species are compared. A block of homology to Mitf in closely related species. This was done using 100–150 nucleotides, located about 800 bases upstream tBLASTn. The resulting DNA fragments were then used in a nuc- of exon 4 are more conserved than the rest of the leotide BLAST search and the identified fragments assembled into intron. Since the location of this conservation is about contigs. For this purpose, traceBLAST and tBLASTn searches were 700 nucleotides upstream of the L1 integration site, it is carried out on different Whole Genome Shotgun (WGS) databases unlikely to be involved in melanocyte-specific regulation (http://www.ncbi.nlm.nih.gov/BLAST/mmtrace) or, when possible, using BLAT searches (http://genome.cse.ucsc.edu/). The searches of Mitf. for WGS sequences most often yielded 300–800 nucleotide fragments which were used for further BLAST searches in the same Conclusion database (in silico genome walking), until the contigs originating from individual exons could be assembled into larger sequences We have used sequence analysis of the evolutionary representing whole genes. conserved Mitf gene/protein product to gain insight into Mitf regulation and protein domain structure. We have Sequencing analyzed previously identified protein domains and iden- All de novo sequencing of the mouse and Drosophila Mitf genes was carried out using Big-Dye Chemistry on an automated ABI tified new domains in the Mitf protein which exhibit a PRISM 377 DNA sequencer from Perkin Elmer (PE Applied Biosys- high degree of sequence conservation (see Figure 7A tems, Foster City, CA, USA). Sequencing primers were manually for an overview). The results support a model of designed and ordered from TAG Copenhagen (TAG Copenhagen dynamic evolution of the Mitf protein structure in meta- AS, Copenhagen, Denmark) or MWG (MWG Biotech AG, Ebers- zoans. For instance, a confirmed activation domain, berg, Germany). Individual clones were assembled into contigs TM AD2, has been gained in the lineage leading to verte- using Sequencer 3.0 from Gene Codes Corporation (Ann Arbor, brates as it is not found in any of the invertebrate spe- MI, USA) and further adjusted by eye. cies. Furthermore, two putative SUMOylation sites appear to be ancestral features of the Mitf protein Amino acid sequence analysis Amino acid sequence alignments were carried out using ClustalW (Lys182 and Lys316), but in Drosophila (Lys182) and at the SDSC Biology WorkBench website (http://workbench. C. elegans (Lys316) only one site has been retained. sdsc.edu). Each position in the protein alignment can get one of Studies of Mitf protein function in different model three scores: fully conserved, conservative substitution, or non-con- organisms must take these evolved features of the served. An amino acid position is described as a conservative sub- domain structure into consideration. stitution when amino acid residues at that particular site have Several miRNA target sequences are found to be very similar biochemical properties. Amino acid numbering is based on the mouse Mitf–1M protein (accession number Z23066 Hodgkinson well conserved in the 3¢UTR of Mitf. So far, little is et al., 1993). Helical wheel projections were created using BIOEDIT know about the biological function of specific miRNAs. version 5.0.9 (Hall, 1999). In general, animal miRNAs have been shown to downregulate translation of their target mRNAs. Of the miR- miRNA target sequence identification NAs found in the 3¢UTR of Mitf, miR-124 and miR-152 The 3¢UTR sequences of the mouse and human Mitf genes were have been found to be involved in cell growth and miR- identified in cDNAs which contain polyA sequences (mouse: 148 in apoptosis, when tested in HeLa cells (Cheng BG971963; human: BC011461). The 3¢UTR was defined as the et al., 2005). It has also been shown that the tissue spe- region extending from the stop codon to the first nucleotide of the cific pattern of downregulated genes have the opposite polyA tail. The mouse 3¢UTR sequence was used to locate the corresponding sequences in the genomes of P. troglodytes (Ptro, expression pattern from that of the miRNAs targeting chimpanzee), F. catus (Fcat, cat), B. taurus (Btau, cow), C. familaris the gene (Lim et al., 2005), emphasizing their role as (Cfam, dog), R. norvegicus (Rnor, rat) and G. gallus (Ggal, chicken) downregulators. It has been demonstrated that the in the NCBI database (http://www.ncbi.nlm.nih.gov) and in the endogenous expression of several highly specific O. cuniculus (Ocun, rabbit), M. domestica (Mdom, opossum) miRNAs is typically negatively correlated with the and L. africana (Lafr, elephant) in the USCS Genome Bioinfor- endogenous mRNA levels of their targets (Farh et al., matics database (http://genome.cse.ucsc.edu). The mouse 3¢UTR 2005; Sood et al., 2006; Stark et al., 2005). The discovery sequence was compared with the genomes of each species using BLAST and the corresponding genomic contigs retrieved. The of miRNA target sequences in the Mitf gene suggests mouse and human 3¢UTRs were used as a guideline for estimating that the regulation of the gene is more complex then pre- length. The sequences were aligned using ClustalW at the SDSC viously thought. Further research on this subject will add Biology WorkBench website (http://workbench.sdsc.edu). The to the understanding of the regulation of Mitf. TARGETSCAN program Release 3.1 (http://www.targetscan.org/) (Lewis

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 197

149 Hallsson et al. et al., 2003, 2005) was used to locate conserved miRNA target Bronisz, A., Sharma, S.M., Hu, R., Godlewski, J., Tzivion, G., sequences in the human Mitf 3¢UTR. Mansky, K.C., and Ostrowski, M.C. (2006). Microphthalmia-associated transcription factor interactions with 14–3-3 modulate dif- Conservation of promoter elements and binding ferentiation of committed myeloid precursors. Mol. Biol. Cell. 17, sites 3897–3906. Calin, G.A., and Croce, C.M. (2006). MicroRNA-cancer connection: The 1A, 1MC, 1E, 1H, 1D, 1B, and 1M exons from mouse and 1J the beginning of a new tale. Cancer Res. 66, 7390–7394. and 1C from human were used to locate the exons in the other Carreira, S., Goodall, J., Aksan, I., La Rocca, S.A., Galibert, M.D., species through BLAST (http://www.ncbi.nlm.nih.gov, http:// Denat, L., Larue, L., and Goding, C.R. (2005). Mitf cooperates www.ensembl.org) (Altschul et al., 1990) and BLAT searches with Rb1 and activates p21Cip1 expression to regulate cell cycle (http://genome.ucsc.edu) (Kent, 2002). ClustalW was used to align progression. Nature 433, 764–769. the sequences (Thompson et al., 1994), through BIOEDIT, version Cheng, A.M., Byrom, M.W., Shelton, J., and Ford, L.P. (2005). Anti- 5.0.9 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) (Hall, 1999) sense inhibition of human miRNAs and indications for an involve- and the program Mulan (http://mulan.dcode.org/) (Ovcharenko ment of miRNA in cell growth and apoptosis. Nucleic Acids Res. et al., 2005) was used to find the potential binding sites in the 33, 1290–1297. 5¢UTR regions. Farh, K.K., Grimson, A., Jan, C., Lewis, B.P., Johnston, W.K., Lim, L.P., Burge, C.B., and Bartel, D.P. (2005). The widespread impact Acknowledgements of mammalian MicroRNAs on mRNA repression and evolution. Science 310, 1817–1821. We thank Francesca Pignoni, Arnar Palsson, and Einar Arnason Ferre-D’Amare, A.R., Prendergast, G.C., Ziff, E.B., and Burley, S.K. for critically reading the manuscript. This work was supported by (1993). Recognition by Max of its cognate DNA through a dimeric grants from the Helga Jonsdottir and Sigurlidi Kristjansson b/HLH/Z domain. Nature 363, 38–45. Memorial Fund, the Research Fund of the University of Iceland, Frazer, K.A., Pachter, L., Poliakov, A., Rubin, E.M., and Dubchak, I. the Icelandic Research Fund and by the Intramural Research (2004). VISTA: computational tools for comparative genomics. Program of the NIH, NINDS. We would also like to thank Nucleic Acids Res. 32, W273–W279. all those involved in the many sequencing projects being carried Fuse, N., Yasumoto, K., Suzuki, H., Takahashi, K., and Shibahara, S. out around the globe, whose work is a prerequisite for our (1996). Identification of a melanocyte-type promoter of the analysis. microphthalmia-associated transcription factor gene. Biochem. Biophys. Res. Commun. 219, 702–707. Fuse, N., Yasumoto, K., Takeda, K., Amae, S., Yoshizawa, M., References Udono, T., Takahashi, K., Tamai, M., Tomita, Y., Tachibana, M. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. and Shibahara, S. (1999). Molecular cloning of cDNA encoding (1990). Basic local alignment search tool. J. Mol. Biol. 215, 403– a novel microphthalmia-associated transcription factor isoform 410. with a distinct amino-terminus. J. Biochem. (Tokyo) 126, 1043– Amae, S., Fuse, N., Yasumoto, K., Sato, S., Yajima, I., Yamamoto, 1051. H., Udono, T., Durlu, Y.K., Tamai, M., Takahashi, K. and Graw, J., Pretsch, W., and Loster, J. (2003). Mutation in intron 6 of Shibahara, S. (1998). Identification of a novel isoform of the hamster Mitf gene leads to skipping of the subsequent exon microphthalmia-associated transcription factor that is enriched in and creates a novel animal model for the human Waardenburg retinal pigment epithelium. Biochem. Biophys. Res. Commun. syndrome type II. Genetics 164, 1035–1041. 247, 710–715. Hall, T.A. (1999). BioEdit: a user-friendly biological sequence align- Amiel, J., Watkin, P.M., Tassabehji, M., Read, A.P., and Winter, ment editor and analysis program for Windows 95/98/NT. Nucl. R.M. (1998). Mutation of the MITF gene in albinism-deafness Acids Symp. Ser. 41, 95–98. syndrome (Tietz syndrome). Clin. Dysmorphol. 7, 17–20. Hallsson, J.H., Favor, J., Hodgkinson, C., Glaser, T., Lamoreux, Arnheiter, H., Hou, L., Nguyen, M.T.T., Bismuth, K., Csermely, T., M.L., Magnusdottir, R., Gunnarsson, G.J., Sweet, H.O., Cope- Murakami, H., Skuntz, S., Liu, W., and Bharti, K. (2006) Mitf-a land, N.G., Jenkins, M.A. and Steingrimsson, E. (2000). Genomic, matter of life and death for the developing melanocyte. In From transcriptional and mutational analysis of the mouse microphthal- Melanocytes to Malignant Melanoma: The Progression to Malig- mia locus. Genetics 155, 291–300. nancy, V. Hearing, S.P.L. Leong, eds. (Totowa, N.J.: Humana Hallsson, J.H., Haflidadottir, B.S., Stivers, C., Odenwald, W., Arnhe- Press), pp. 27–49. iter, H., Pignoni, F., and Steingrimsson, E. (2004). The basic Atchley, W.R., and Fitch, W.M. (1997). A natural classification of helix–loop–helix leucine zipper transcription factor Mitf is con- the basic helix–loop–helix class of transcription factors. Proc. served in Drosophila and functions in eye development. Genetics Natl. Acad. Sci. U. S. A. 94, 5172–5176. 167, 233–241. Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J., Eachus, R., Hemesath, T.J., Steingrimsson, E., McGill, G., Hansen, M.J., and Pasquinelli, A.E. (2005). Regulation by let-7 and lin-4 miRNAs Vaught, J., Hodgkinson, C.A., Arnheiter, H., Copeland, N.G., results in target mRNA degradation. Cell. 122, 553–563. Jenkins, N.A., and Fisher, D.E. (1994). microphthalmia, a critical Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, factor in melanocyte development, defines a discrete transcrip- and function. Cell. 116, 281–297. tion factor family. Genes Dev. 8, 2770–2780. Bertolotto, C., Abbe, P., Hemesath, T.J., Bille, K., Fisher, D.E., Hemesath, T.J., Price, E.R., Takemoto, C., Badalian, T., and Fisher, Ortonne, J.P., and Ballotti, R. (1998). Microphthalmia gene prod- D.E. (1998). MAP kinase links the transcription factor Microph- uct as a signal transducer in cAMP-induced differentiation of mel- thalmia to c-Kit signalling in melanocytes. Nature 391, 298–301. anocytes. J. Cell. Biol. 142, 827–835. Hershey, C.L., and Fisher, D.E. (2005). Genomic analysis of the Bondurand, N., Pingault, V., Goerich, D.E., Lemort, N., Sock, E., Microphthalmia locus and identification of the MITF-J/Mitf-J Caignec, C.L., Wegner, M., and Goossens, M. (2000). Interaction isoform. Gene 347, 73–82. among SOX10, PAX3 and MITF, three genes altered in Waarden- Hodgkinson, C.A., Moore, K.J., Nakayama, A., Steingrimsson, E., burg syndrome. Hum. Mol. Genet. 9, 1907–1917. Copeland, N.G., Jenkins, N.A., and Arnheiter, H. (1993). Muta-

198 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

150 Conservation of Mitf

tions at the mouse microphthalmia locus are associated with pathway in response to receptor activator of NF-kappa B ligand defects in a gene encoding a novel basic-helix–loop–helix-zipper signaling. J. Biol. Chem. 277, 11 077–11 083. protein. Cell 74, 395–404. Miller, A.J., Levy, C., Davis, I.J., Razin, E., and Fisher, D.E. (2005). Hodgkinson, C.A., Nakayama, A., Li, H., Swenson, L.B., Opde- Sumoylation of MITF and its related family members TFE3 and camp, K., Asher, J.H. Jr, Arnheiter, H., and Glaser, T. (1998). TFEB. J. Biol. Chem. 280, 146–155. Mutation at the anophthalmic white locus in Syrian hamsters: Mochii, M., Mazaki, Y., Mizuno, N., Hayashi, H., and Eguchi, G. haploinsufficiency in the Mitf gene mimics human Waardenburg (1998). Role of Mitf in differentiation and transdifferentiation of syndrome type 2. Hum. Mol. Genet. 7, 703–708. chicken pigmented epithelial cell. Dev. Biol. 193, 47–62. Huber, W.E., Price, E.R., Widlund, H.R., Du, J., Davis, I.J., Wegner, Murakami, H., and Arnheiter, H. (2005). Sumoylation modulates M., and Fisher, D.E. (2003). A tissue-restricted cAMP transcrip- transcriptional activity of MITF in a promoter-specific manner. tional response: SOX10 modulates alpha-melanocyte-stimulating Pigment Cell Res. 18, 265–277. hormone-triggered expression of microphthalmia-associated tran- Murre, C., McCaw, P.S., Vaessin, H., Caudy, M., Jan, L.Y., scription factor in melanocytes. J. Biol. Chem. 278, 45 224– Jan, Y.N., Cabrera, C.V., Buskin, J.N., Hauschka, S.D., Lassar, 45 230. A.B., Weintraub, H., and Baltimore, D. (1989). Interactions Hughes, A.E., Newton, V.E., Liu, X.Z., and Read, A.P. (1994). A between heterologous helix-loop-helix proteins generate com- gene for Waardenburg syndrome type 2 maps close to the plexes that bind specifically to a common DNA sequence. Cell human homologue of the microphthalmia gene at chromosome 58, 537–544. 3p12-p14.1. Nat. Genet. 7, 509–512. Murre, C., Bain, G., van Dijk, M.A., Engel, I., Furnari, B.A., Massari, Jacquemin, P., Lannoy, V.J., O’Sullivan, J., Read, A., Lemaigre, M.E., Matthews, J.R., Quong, M.W., Rivera, R.R., and Stuiver, F.P., and Rousseau, G.G. (2001). The transcription factor onecut- M.H. (1994). Structure and function of helix–loop–helix proteins. 2 controls the microphthalmia-associated transcription factor Biochim. Biophys. Acta 1218, 129–135. gene. Biochem. Biophys. Res. Commun. 285, 1200–1205. Nishimura, E.K., Granter, S.R., and Fisher, D.E. (2005). Mecha- Kawaguchi, N., Ono, T., Mochii, M., and Noda, M. (2001). Sponta- nisms of hair graying: incomplete melanocyte stem cell mainten- neous mutation in Mitf gene causes osteopetrosis in silver ance in the niche. Science 307, 720–724. homozygote quail. Dev. Dyn. 220, 133–140. Nobukuni, Y., Watanabe, A., Takeda, K., Skarka, H., and Tachibana, Kent, W.J. (2002). BLAT – the BLAST-like alignment tool. Genome M. (1996). Analyses of loss-of-function mutations of the MITF Res. 12, 656–664. gene suggest that haploinsufficiency is a cause of Waardenburg Lalwani, A.K., Attaie, A., Randolph, F.T., Deshmukh, D., Wang, C., syndrome type 2A. Am. J. Hum. Genet. 59, 76–83. Mhatre, A., and Wilcox, E. (1998). Point mutation in the MITF Oboki, K., Morii, E., Kataoka, T.R., Jippo, T., and Kitamura, Y. gene causing Waardenburg syndrome type II in a three-genera- (2002). Isoforms of mi transcription factor preferentially tion Indian family. Am. J. Med. Genet. 80, 406–409. expressed in cultured mast cells of mice. Biochem. Biophys. Larribere, L., Hilmi, C., Khaled, M., Gaggioli, C., Bille, K., Auberger, Res. Commun. 290, 1250–1254. P., Ortonne, J.P., Ballotti, R., and Bertolotto, C. (2005). The clea- Opdecamp, K., Vanvooren, P., Riviere, M., Arnheiter, H., Motta, R., vage of microphthalmia-associated transcription factor, MITF, by Szpirer, J., and Szpirer, C. (1998). The rat microphthalmia-associ- caspases plays an essential role in melanocyte and melanoma ated transcription factor gene (Mitf) maps at 4q34-q41 and is cell apoptosis. Genes Dev. 19, 1980–1985. mutated in the mib rats. Mamm. Genome. 9, 617–621. Lee, M., Goodall, J., Verastegui, C., Ballotti, R., and Goding, C.R. Ovcharenko, I., Loots, G.G., Giardine, B.M., Hou, M., Ma, J., (2000). Direct regulation of the Microphthalmia promoter by Hardison, R.C., Stubbs, L., and Miller, W. (2005). Mulan: Sox10 links Waardenburg-Shah syndrome (WS4)-associated multiple-sequence local alignment and visualization for studying hypopigmentation and deafness to WS2. J. Biol. Chem. 275, function and evolution. Genome Res. 15, 184–194. 37 978–37 983. Potterf, S.B., Furumura, M., Dunn, K.J., Arnheiter, H., and Pavan, Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., and W.J. (2000). Transcription factor hierarchy in Waardenburg syn- Burge, C.B. (2003). Prediction of mammalian microRNA targets. drome: regulation of MITF expression by SOX10 and PAX3. Cell 115, 787–798. Hum. Genet. 107, 1–6. Lewis, B.P., Burge, C.B., and Bartel, D.P. (2005). Conserved seed Price, E.R., Horstmann, M.A., Wells, A.G., Weilbaecher, K.N., pairing, often flanked by adenosines, indicates that thousands of Takemoto, C.M., Landis, M.W., and Fisher, D.E. (1998). alpha- human genes are microRNA targets. Cell 120, 15–20. Melanocyte-stimulating hormone signaling regulates expression Li, L., and Olson, E.N. (1992). Regulation of muscle cell growth and of microphthalmia, a gene deficient in Waardenburg syndrome. differentiation by the MyoD family of helix–loop–helix proteins. J. Biol. Chem. 273, 33 042–33 047. Adv. Cancer Res. 58, 95–119. Rajewsky, N. (2006). microRNA target predictions in animals. Nat. Lim, L.P., Lau, N.C., Garrett-Engele, P., Grimson, A., Schelter, Genet. 38 (Suppl.), S8–S13. J.M., Castle, J., Bartel, D.P., Linsley, P.S., and Johnson, J.M. Read, A.P., and Newton, V.E. (1997). Waardenburg syndrome. (2005). Microarray analysis shows that some microRNAs down- J. Med. Genet. 34, 656–665. regulate large numbers of target mRNAs. Nature 433, 769– Rehli, M., Den Elzen, N., Cassady, A.I., Ostrowski, M.C., and 773. Hume, D.A. (1999). Cloning and characterization of the murine Lister, J.A., Robertson, C.P., Lepage, T., Johnson, S.L., and Raible, genes for bHLH-ZIP transcription factors TFEC and TFEB reveal a D.W. (1999). nacre encodes a zebrafish microphthalmia-related common gene organization for all MiT subfamily members. protein that regulates neural-crest-derived pigment cell fate. Genomics 56, 111–120. Development 126, 3757–3767. Roundy, K., Smith, R., Weis, J.J., and Weis, J.H. (2003). Overex- Lu, J.R., Bassel-Duby, R., Hawkins, A., Chang, P., Valdez, R., Wu, pression of RANKL implicates IFN-beta-mediated elimination of H., Gan, L., Shelton, J.M., Richardson, J.A., and Olson, E.N. B-cell precursors in the osteopetrotic bone of microphthalmic (2002). Control of facial muscle development by MyoR and cap- mice. J. Bone. Miner. Res. 18, 278–288. sulin. Science 298, 2378–2381. Saito, H., Yasumoto, K., Takeda, K., Takahashi, K., Fukuzaki, A., Mansky, K.C., Sankar, U., Han, J., and Ostrowski, M.C. (2002). Orikasa, S., and Shibahara, S. (2002). Melanocyte-specific Microphthalmia transcription factor is a target of the p38 MAPK microphthalmia-associated transcription factor isoform activates

ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard 199

151 Hallsson et al.

its own gene promoter through physical interaction with lym- Taus, N.S., Salmon, B., and Baines, J.D. (1998). The herpes sim- phoid-enhancing factor 1. J. Biol. Chem. 277, 28 787–28 794. plex virus 1 UL 17 gene is required for localization of capsids and Saito, H., Takeda, K., Yasumoto, K., Ohtani, H., Watanabe, K., major and minor capsid proteins to intranuclear sites where viral Takahashi, K., Fukuzaki, A., Arai, Y., Yamamoto, H., and DNA is cleaved and packaged. Virology 252, 115–125. Shibahara, S. (2003). Germ cell-specific expression of micro- Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL phthalmia-associated transcription factor mRNA in mouse testis. W: improving the sensitivity of progressive multiple sequence J. Biochem. (Tokyo) 134, 143–150. alignment through sequence weighting, position-specific gap Salmon, B., Cunningham, C., Davison, A.J., Harris, W.J., and penalties and weight matrix choice. Nucleic Acids Res. 22, Baines, J.D. (1998). The herpes simplex virus type 1 U(L)17 gene 4673–4680. encodes virion tegument proteins that are required for cleavage Udono, T., Yasumoto, K., Takeda, K., Amae, S., Watanabe, K., Saito, and packaging of viral DNA. J. Virol. 72, 3779–3788. H., Fuse, N., Tachibana, M., Takahashi, K., Tamai, M. Sato, S., Roberts, K., Gambino, G., Cook, A., Kouzarides, T., and Shibahara, S. (2000). Structural organization of the human and Goding, C.R. (1997). CBP/p300 as a co-factor for the microphthalmia-associated transcription factor gene containing Microphthalmia transcription factor. Oncogene 14, 3083– four alternative promoters. Biochim. Biophys. Acta 1491, 205–219. 3092. Verastegui, C., Bille, K., Ortonne, J.P., and Ballotti, R. (2000). Regu- Schepsky, A., Bruser, K., Gunnarsson, G.J., Goodall, J., Hallsson, lation of the microphthalmia-associated transcription factor gene J.H., Goding, C.R., Steingrimsson, E., and Hecht, A. (2006). The by the Waardenburg syndrome type 4 gene, SOX10. J. Biol. microphthalmia-associated transcription factor Mitf interacts with Chem. 275, 30 757–30 760. beta-catenin to determine target gene expression. Mol. Cell. Biol. Voronova, A., and Baltimore, D. (1990). Mutations that disrupt DNA 26, 8914–8927. binding and dimer formation in the E47 helix–loop–helix protein Smith, S.D., Kelley, P.M., Kenyon, J.B., and Hoover, D. (2000). map to distinct domains. Proc. Natl. Acad. Sci. U. S. A. 87, Tietz syndrome (hypopigmentation/deafness) caused by mutation 4722–4726. of MITF. J. Med. Genet. 37, 446–448. Watanabe, A., Takeda, K., Ploplis, B., and Tachibana, M. (1998). Sood, P., Krek, A., Zavolan, M., Macino, G., and Rajewsky, N. Epistatic relationship between Waardenburg syndrome genes (2006). Cell-type-specific signatures of microRNAs on target MITF and PAX3. Nat. Genet. 18, 283–286. mRNA expression. Proc. Natl. Acad. Sci. U. S. A. 103, 2746–2751. Widlund, H.R., Horstmann, M.A., Price, E.R., Cui, J., Lessnick, Stark, A., Brennecke, J., Bushati, N., Russell, R.B., and Cohen, S.L., Wu, M., He, X., and Fisher, D.E. (2002). Beta-catenin- S.M. (2005). Animal MicroRNAs confer robustness to gene induced melanoma growth requires the downstream target expression and have a significant impact on 3¢UTR evolution. Cell Microphthalmia-associated transcription factor. J. Cell Biol. 158, 123, 1133–1146. 1079–1087. Steingrimsson, E., Moore, K.J., Lamoreux, M.L., Ferre-D’Amare, Xu, W., Gong, L., Haddad, M.M., Bischof, O., Campisi, J., Yeh, A.R., Burley, S.K., Zimring, D.C., Skow, L.C., Hodgkinson, C.A., E.T., and Medrano, E.E. (2000). Regulation of microphthalmia- Arnheiter, H., Copeland, N.G., and Jenkins, N.A. (1994). Molecular associated transcription factor MITF protein levels by association basis of mouse microphthalmia (mi) mutations helps explain their with the ubiquitin-conjugating enzyme hUBC9. Exp. Cell Res. developmental and phenotypic consequences. Nat. Genet. 8, 256– 255, 135–143. 263. Yajima, I., Sato, S., Kimura, T., Yasumoto, K., Shibahara, S., Go- Steingrimsson, E., Copeland, N.G., and Jenkins, N.A. (2004). Mel- ding, C.R., and Yamamoto, H. (1999). An L1 element intronic anocytes and the microphthalmia transcription factor network. insertion in the black-eyed white (Mitf[mi-bw]) gene: the loss of Annu. Rev. Genet. 38, 365–411. a single Mitf isoform responsible for the pigmentary defect and Takeda, K., Takemoto, C., Kobayashi, I., Watanabe, A., Nobukuni, inner ear deafness. Hum. Mol. Genet. 8, 1431–1441. Y., Fisher, D.E., and Tachibana, M. (2000a). Ser298 of MITF, a Zirlinger, M., Lo, L., McMahon, J., McMahon, A.P., and Anderson, mutation site in Waardenburg syndrome type 2, is a phosphoryla- D.J. (2002). Transient expression of the bHLH factor neurogenin- tion site with functional significance. Hum. Mol. Genet. 9, 125– 2 marks a subpopulation of neural crest cells biased for a sen- 132. sory but not a neuronal fate. Proc. Natl. Acad. Sci. U. S. A. 99, Takeda, K., Yasumoto, K., Takada, R., Takada, S., Watanabe, K., 8084–8089. Udono, T., Saito, H., Takahashi, K., and Shibahara, S. (2000b). Induction of melanocyte-specific microphthalmia-associated transcription factor by Wnt-3a. J. Biol. Chem. 275, 14 013–14 016. Supplementary material Takeda, K., Yasumoto, K., Kawaguchi, N., Udono, T., Watanabe, K., The following supplementary material is available for this Saito, H., Takahashi, K., Noda, M., and Shibahara, S. (2002). Mitf-D, a newly identified isoform, expressed in the retinal pig- article online from http://www.blackwell-synergy.com/ ment epithelium and monocyte-lineage cells affected by Mitf doi/full/10.1111/j.1600-0749.2007.00373.x mutations. Biochim. Biophys. Acta. 1574, 15–23. Figure S1. Takemoto, C.M., Yoon, Y.J., and Fisher, D.E. (2002). The identifica- Figure S2. tion and functional characterization of a novel mast cell isoform Figure S3. of the microphthalmia-associated transcription factor. J. Biol. Figure S4. Chem. 277, 30 244–30 252. Tassabehji, M., Newton, V.E., and Read, A.P. (1994). Waardenburg Figure S5. syndrome type 2 caused by mutations in the human microphthal- Figure S6. mia (MITF) gene. Nat. Genet. 8, 251–255. Figure S7. Tassabehji, M., Newton, V.E., Liu, X.Z., Brady, A., Donnai, D., Kra- Figure S8. jewska-Walasek, M., Murday, V., Norman, A., Obersztyn, E., Please note: Blackwell Publishing is not responsible Reardon, W., Rice, J.C., Trembath, R., Wieacker, P., Whiteford, for the content or functionality of any supplementary M., Winter, R., and Read, A.P. (1995). The mutational spectrum materials supplied by the authors. in Waardenburg syndrome. Hum. Mol. Genet. 4, 2131–2137.

200 ª 2007 The Authors, Journal Compilation ª 2007 Blackwell Munksgaard

152 Supplementary figure legends.

S1. Conservation of exon 1A and upstream sequences. The start of a known mouse cDNA is shown by a line above the sequences. The open reading frame in the mouse 1A exon is indicated in a yellow box (Amae et al., 1998). Potential transcription factor binding sites are indicated in boxes or underlined. No binding sites were found when all the species were compared. When the opossum (Mdom) was excluded, several conserved transcription factor binding sites were found. Conserved bases are shown with a vertical line. The species used for the comparison in S1-S8 are Homo sapiens (Hsap; Human),

Pan troglodytes (Ptro; Chimpanzee), Macaca mulatta (Mmul; Rhesus monkey), Mus musculus (Mmus; Mouse), Rattus norvegicus (Rnor; Rat), Bos taurus (Btau; Cow), Canis familiaris (Cfam; Dog), Monodelphis domestica (Mdom; Opossum), Gallus gallus (Ggal;

Chicken).

S2. Conservation of the 1J exon and upstream sequences. The start of a known mouse cDNA is shown by a line above the sequences; there is no open reading frame in exon 1J

(Hershey and Fisher, 2005). Potential transcription factor binding sites are indicated in boxes or underlined. Conserved bases are shown with a vertical line.

S3. Conservation of the 1C exon and upstream sequences. The start of a known cDNA is shown by a line above the sequences. The open reading frame in the human 1C exon is indicated in a yellow box (Fuse et al., 1999). The start of the open reading frame in the potential mouse exon is shorter, underlined in the mouse sequence (Hershey and Fisher,

153 2005). Potential transcription factor binding sites are indicated in boxes or underlined.

Conserved bases are shown with a vertical line.

S4. Conservation of the 1MC exon and upstream sequences. The start of a known cDNA is shown by a line above the sequences (Takemoto et al., 2002). The open reading frame in the mouse 1MC exon is indicated in a yellow box (Takemoto et al., 2002). The primate sequences (Hsap, Ptro, and Rhes) show considerable conservation. The mouse and rat sequences show considerable conservation but are quite different from the primate sequences. A transcription factor binding site for HNF4 was found in the primate sequences but is not conserved in the mouse and rat sequences and are not shown in the figure. Conserved bases are shown with a vertical line.

S5. Conservation of the 1E exon and upstream sequences. The start of a known cDNA is shown by a line above the sequences; there is no open reading frame in exon 1E (Oboki et al., 2002). Potential transcription factor binding sites are indicated in boxes. Conserved bases are shown with a vertical line.

S6. Conservation of the 1H exon and upstream sequences. The start of a known cDNA is shown by a line above the sequences (Steingrimsson et al., 1994). The mouse 1H open reading frame is indicated in a yellow box (Amae et al., 1998). Potential transcription factor binding sites are indicated in boxes. Conserved bases are shown with a vertical line.

154 S7. Conservation of the 1D exon and upstream sequences. The start of a known cDNA is shown by a line above the sequences; there is no open reading frame in exon 1D (Takeda et al., 2002). Potential transcription factor binding sites are indicated in boxes. Conserved bases are shown with a vertical line.

S8. Conservation of the 1B exon and upstream sequences. The start of the longest cDNA is shown by a line above the sequences. Other shorter cDNAs exist, one of which is located downstream of the potential transcription factor binding sites shown. The open reading frame in the mouse exon 1B is indicated in a yellow box (Udono et al., 2000).

The two parts of exon 1B, B1a and B1b are indicated by a vertical line (Udono et al.,

2000). Potential transcription factor binding sites are shown in boxes or underlined. No conserved binding sites were found when all sequences were used in the search. When the chicken sequence (Ggal) was exluded, one conserved binding site was found,

POU3F2. When the dog sequence (Cfam) was also exlcuded, we also found a binding site for GATA but it is located upstream of the sequences shown here. Other transcription factor binding sites found are shown in boxes. Conserved bases are shown with a vertical line.

155 S1: 10 BEL1 20 30 40 50 MYCMAX60 70 80STAT 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | ... . | .... | .. .. | .... | .... | .... | .... | .. .. | .... | .... | Hsap 1A GAGCTGCTGACATTGACAATGAATCCAAACAGGAGTTGCAC-TAGCGGTGTCCACCACGTTGCCTCTCCCCC-GCCTGGCCTTCTGGGAGCTGTAGTTTT Ptro 1A |||||||||||||||||||||||||||||||||||||||||-||||||||||||||||||||||||||||||-||||||||||||||||||||||||||| Mmul 1A |||||||||||||||||||||||||||||||||||||||||-||||||||||||||||||||||G|||||||C||T|A|||||||||||||||||||||| Mmus 1A |||||||||||||||||||G||||||||||||||C||||||-||T|C||||A||||||||||T||||||||G-|TT||A|||||||||||T||||||||| Rnor 1A |||||||||||||||||||G||||||||||||||C||||||-||T||||||A|||||||||||||||||||G-|TT|||||||||||||AT||||||||| Btau 1A |||||||||||||||||||||||||||||||||||||||||-||||||||||T||||||||||||||G|||TC||T|A|||||||||||AT||||||||| Cfam 1A ||||||||||||||||||||||T|||||||||||||||||A-|||||||||||||||||||||||||G||||C|||||||||||||||||T||||||||| Mdom 1A ||||CC|||||||||||||A||G||T|||||A|||||||||ACGC||||||||||T||||||||||GAGG||-||TC|T|||G||||||CT||||||C||

110 120 130 140 150 160 170 MAZR180 SP1 190 200 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .. .. | .... | Hsap 1A CGTGGGAGCGGCTCCCCAGGCGAGCTGGGAATGCCCCGCCCGGGC-CGAACTACAGATCCCAGGCGGCGCTCGGCCGCCAGCCCCTCCCGCCCGGGTGCG Ptro 1A |||||||||||||||||||||||||||||||||||||||||||||-|||||||||||||||||||||||||||||G|||G|||||||||||||||||||| Mmul 1A A||||T||AT|||||A|||||||||||||||||||||A|||||||-|||||||||||||||||||||||||||||||||G|||||||||||||||||AG| Mmus 1A T|C||A|||T|A|AT||T||A|||||||-TG|||T|T||||A|||-G||||C|||A||||||||GC||A|CG|||--T|||||||||||||T|T||||T| Rnor 1A -|C||A|||T|A|AT||T||A|||||||-T||||TGG|||T||||-A||||C|||A|||||||AGC||A|CG|||--||G|||||||||||||T||||T| Btau 1A GTGTC||||||||||T|T|||A||TC|||T||A|T|G||||||CTGTTG||||||||||||||A||||A|CG|||A|~|C||||||||||T||CT||T|| Cfam 1A ||C||||||||||||||C|||||||C|||C|C||||||T||||||-|||||||||||||||||||A||||C|C||||||C|||||||||||||||||||| Mdom 1A A|G||||||CA||TT||GA||TGA|G|||GGA||GGG||T|CT|GTG|||||||||C|||||||GA||||C|||||| ||C||||GCT|||GGT|A|A|T| ETF, MAZ 210 KROX220 E2F230 240 250 cDNA260 start 270 280 290 300 .... | .... | ...... | | .... | . ... | .. .. | .... | .... | .... | .... | . ... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1A AGTGTAAACTCCCCGCGCT----GGGGC--GGGCGGCCGCGAGCCGGCGAGCGGGCAGAGCTCGGCACTGCGCCGGGGCGCA------CGGCTCGGG--- Ptro 1A |||||||||||||||||||----|||||--||||||||||||||||||||||||||||||||||||||||||||||||||||------|||||||||--- Mmul 1A |||||||||||||||||||----|||||--||||||||||||||||||||||||||||||||||||G||||||G||||||||------|||||||A|--- Mmus 1A ||A||||||||A||||||C----|||||--|||||||||------||T|||||||T|||TGG||||||||||-|||||||G------|||||T|||--- Rnor 1A ||A||||||||A||||||C----|||||--||||A||G|------||T|||||||T|||TGG|||||||A||-|||||||G------||T||T|||--- Btau 1A |||||||||||||G||||C----|||||--|||||||||||C||G|||C|||||A|T||||||T||||G||TTG|||||A||------|C|||||||--- Cfam 1A |||||||||||G||||||C----|||||--|||||||||||C||G|||||||||||T|||||G|||G||||||G||||||||------|||||||||CG- Mdom 1A --||||||||AAG||A||CCTAG||A||AG|||A||A|AA|G|GGA|G|||T||||T|T|GCT|||||||||AG|||||||CGGGCGC||T|C|T||CCC

310 320 330 340 350 360 370 380 390 400 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1A ------GGACCC-AGGCC-CAGCTACCTTCCCT----CCGC------CCCCGGGCTCTGTTCTCACTTTCCAGCA Ptro 1A ------||||||-|||||-||||||||||||||----||||------|||||||||||||||||||||||||||| Mmul 1A ------||||||-|||||-||||C|||||||G|----||||------|||||||||||A||||||||||||||T| Mmus 1A ------|T||||G|||||-|--|CCATC|TT||----|A|GT------G||||||T||||G||CA|G|CC|A|||| Rnor 1A ------|T||||G|||||-|TC|CCATC|TTG|----|A|GT------G||||||T||||G||CA|G|CC|A|||| Btau 1A ------||||||-|||||-|C||C||||C||||----|||------A||||||||||G|||||||G|||GG|||| Cfam 1A ------GGGGGGG|A||||-|||||-|C||C|||||||||----||||CCCC------CG||||||||||||||||||||||G||||C Mdom 1A CTCCCCGCCGCGCCCCCG||CT||T||||TG|C||CG||GCTG||GCTG||||TGCCGCTGCTGCTGCTGCG|TT|||CT|G||CGTG|G||CCG|TC|T

410 420 430 440 450 460 470 480 490 500 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1A GTGGAAGGACG-GGAAGCGGGAGCCATGCAGTCCGAATCGGGGATCGTGCCGGATTTCGAAGTCGGGGAGGAGTTTCATGAAGAGCCCAAAACCTATTAC Ptro 1A |||||||||||-|||||||||||||||||||||||||||||||||T|||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1A |||||||||||-||||||A||||||||||||||G|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmus 1A |||||||-CG|-|C|||A|||||T||||||||||||||||||A||||||G||||||||||||||||||||||||||||C|||||A||||||||||||||| Rnor 1A ||||||||CG|-|C||||A||||T|||||||||T||||||||A||||||G||||||||||||||||||||||||||||C|||||A||||||||||||||| Btau 1A C||CG||||||-||||||T||||||||||||||G|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Cfam 1A ||||||||||T-||G||||||||||||||||||G||||||||||||||||||||||||||||||||||||||||||||C||||||||||||||||||||| Mdom 1A |CC|GGC|C||C|CGGT|A||||||||||||||||||||A|||||A||||||||||||||||||||||||||||||||C||G||||||||G|||||||||

510 520 .... | .... | .... | .... | .... | .... Hsap 1A GAACTCAAAAGTCAACCGCTGAAGAGCAG Ptro 1A ||||||||||||||||||||||||||||| Mmul 1A ||||||||||||||||||||||||||||| Mmus 1A |||||||||||||||||T||||||||||| Rnor 1A |||||||||||||||||T||||||||||| Btau 1A |||||||||||||||||TT|||||||||| Cfam 1A |||||||||||||||||T||||||||||| Mdom 1A |||||G||G|||||G||T|||||AT||||

156 S2: FREAC-2 HLF 10 20 FOXO4 30 40 50 60 E4BP470 80 90 100 .... | .... | .... | .... | .... | .... | ....FOXJ2| .... | .... | .... | .... | ....C/EBP| .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J GCCAGTCTGTTCCATTCTGGACTGTTTATCTTTGGCATGCCAGAGGTCTTTAAACATCATAATGTTGTGTAATGAGCATAACTTCTGCCTTGACTTGTGG Ptro 1J ||||||||||||||||||||||||||||||||||||||||||||||||||G||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1J ||||||||||||||||||||||||||||||||||||||||||||||||||G||||||||||||||||||||||||||||||||||||||||||||||||| Mmus 1J ||||||G||||||C||T|||||||||||||||||A||||||||||T||||G||||||||||||A|||||||||||||C||||||||||||||||A||||| Rnor 1J ||||||G||||||C||T|||||||||||||||C|A||||||||||T||||G||||||TG||||||||||||||||||C||||||||||||||||A||||| Btau 1J |T||||||A||A|G||||||||||||||||||||A-||||||A|||||||G||||||||||||A|||||||||||A||||||||||||||||||A||||| Cfam 1J ||||||T|A|||||||||||||||||||||||||A-||||||A|||||||G||||||||||||||||||||||||A||||||||||||||||||A||||| Mdom 1J ||T|T||GAG||TG|C||||GG|||||||||G||||G||||||||||T||GG||||||CCC||||||C|||||||-----||||||||||||||||||||

cDNA start 110 AP1 120 130 140 150 160 170 180 190 200 ....TBX5| .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J GTGTTAAGAGCATTAGTCAGTGCAAAGTATTGAGTTAAATATTTTCAATAAAAGGATATAATGATCTAGCAGAGA---AGAAGTTATAAAAAATCCTAGT Ptro 1J |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||---|||||||||||||||||||||| Mmul 1J |||||||||||G|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||---||||||||||||||-|||C||| Mmus 1J ||||||||C||||||||||T|||||||C|||||||||||||||||||||||||||T|G||||||||||A||||||GGA|||||C|G||||CC-G||CG|| Rnor 1J ||||||||C||||||||||T|||||||C|||||||||||||||||||||||||||T|G||||||||||A||||||GGA|||||C|G||||CT-GG|CG|| Btau 1J |||||||||AT||||||||T|||||||||||A||||||||||||||||||||||||||||||||||||AT|||||GGA||||||||||||||-|T|||A| Cfam 1J |||||||||||||||||||T||||||||||||||||||||||||||||||||||||||||C|||||||AT|||||GGA||||||||||||||-|A||||| Mdom 1J ||||G|G|||||||||||||||A||||||||||||||||C||CG|||||T|||A|G||||||CG||||AGG||||---|||||||CG|||GC--T|||||

210 220 230 240 250 260 270 280 290 300 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J TAATGGCTTTAATGGTGAGCC--ATATATTTAGTGGGTTCTATCAGTGATGAGTTAGAGATTCACAGAATGAATGTAAAAGCATTCTTACTTTTAATTAA Ptro 1J |||||||||||||||||||||--||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1J ||||||||||C||||||||||--|||||||||||||||||||C|||||||||||||||||||||||A||||||||||||||||||||||||||||||||| Mmus 1J |G|||||||||||||G|||||--||G||C||||||T|||TCCC||--AGCA||||||-|||C||T||CTCAC|||C|C|||GC|||C||||C|GC|-||G Rnor 1J |G|||||||||||||G|||||--||G||C||||||||||-CCC||--AGCA|||C||-|||C||T||C|CAG||AC|C||||C|||---||C|GTG-||G Btau 1J |G|||C||||||C|A|||A||--|||||CAC|||||||||C|G|||CA|||G|||||||||||T||||||||||||||TG|||||T||||||||T||||G Cfam 1J |GG|||||||||||||A|||TCTG||||||||||||||||C|||||GA|||G|C||||C|||T||||||C|||CA|||||A||||||||A|CC|T|C||G Mdom 1J CT|----||C|G||||||AGT---|G|G|---|||T||------G||T||GT|T|TG|GTGT|TG||TG||||||||TC|A|C|G||C||T|-|GG

310 320 330 340 350 360 370 380 390 400 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J TGAGAGAGGAGAAAGAAAAACAATAATAAGAAAAAAA-GGACT-TGATTCTCATCCATACCAAGAAAAGTGTAAAC-ATCCAAGTTCCC--AGTGATTCT Ptro 1J |||||||||||||||||||||||||||||||||||||-|||||-||||||||||||||||||||||||||||||||-||||||||||||--||||||||| Mmul 1J |||||||||||||||||||||||||||||||||||||A|||||-||||||C||||||||A||||||||||||||||-||||||||||||--||||||||| Mmus 1J ||G||||||||------|GAG||GGAC||TTC|||G-|||||-|T|||G|||CA|G|G--|||G||||CACC|||CG||||||||T||--||A|C|CT| Rnor 1J ||G||||||||------|GAG||GGAC||TTC|||G-|||||-|T|||G|||CA|G|G--||||||||CACC|||TG||||||||T||--||A|C|CT| Btau 1J ||GA|||||||||||---GC|||C|||||A|GG||||CAC|||-|A||||||||GT||||T|||||||A||A||||C||TTG||||TT|--||C|C|||| Cfam 1J ||G|||||------|C|||||G||G|||G||||-ACG||-G||||||TC|A||||||G|A|GG|AGA|||||C|||TG||||T|TGG||||C|||| Mdom 1J G||||A|TC|A|------|CA|GAC|C||CTCCG|TCCA||||G|CC||AA||CTTT|TAT|G|T||TCAAG|||TGGGG||||ACGTG----|CTC|GA

410 420 430 440 450 460 470 480 490 500 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J AACCCTGATTCATTACCTTGCATGTGTCTTTA----ACTACCACAAGAAATGTTTAAGATTTCCATTGAGATATTATCGACAGGGACTCCTGGGCTGCAT Ptro 1J ||||||||||||||||||||||||||||||||----|T|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1J ||||||||||||||||||||||||||||||||----|T||||||||||C||||||||||||||||||||||||||||T|||||||||||||||||-|||| Mmus 1J GCT|||||A||C|||T||GT||C||A|||C||----|||C||||GG||||||||A|||CC|||TGG-||||C||||||A|T||T|||||T|||||||AG| Rnor 1J GCT|||||G||C|||T||GT||C||A||||||----|||C|||||G||||||||AG||CC|||TGG-||||C||||||||T||||||||T|||||||TG| Btau 1J GCT|||||||T|G|||||CA||||CA||||||----|||G|||T||A||G||||GG||||||||||------||||||||||| Cfam 1J GCT|TCC|||T|||T|||CA||||CA||||||CCTA|||||||||||||TA|||GC||C|||||||-||||||||TA|AGT||||G|||||||||||||| Mdom 1J G|||TG||A|GT|GG|T||T||||-AC|A|G|TGGT|A|TAAGGT||GGTC|GAAG||GC||TTT|AC|TTGGA|||TTC|||A|--|TG||||T|TGT|

510 520 530 540 550 560 570 580 590 600 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J CATAAGCCTGATTGAAAGCCTTTAGCCTTGTAATGATCTCTTTTT------GGAGGACAATCAGGGAATTCTTTGCAC---CTTTATCAGAGAGTCAGGG Ptro 1J ||||||||||||||||||||||||||||||||||||||||||C||------|||||||||||||||||||||||||||---||||||||||||||||||| Mmul 1J ||||G|||||||||||||||||||||||||||||||||||||C||------|||||||C||||||||||||||||||G---||C|G|||||||||||||| Mmus 1J |T|||||||C|||A||G|||C|C|||||||||||AG|GATCAGCCAGTATT||||AG|C|C||||||G||||CCA||G---|AC|G|-G||A||CT||A| Rnor 1J |T|||||||C|||A||G|||C|||||||||||||A||GATCAG|CAGTATT||||AG|CG|G|||||G||||CCA||G---|AC|G|-G||A||C|||A| Btau 1J |------T|||CA|C|||||C|||TT||||C||||||||G||||C-----T||||AGT-G|||||TC||C|A|||||A---|ACC|||||||||C||||| Cfam 1J |------T||T|G|||||||CC|C||T||A||||C||T||||C||TTCTTT||||AG|CG||||||C||A-||||||A---|ACC|||T|||||C||||| Mdom 1J TT----|G|A||G||T|||||C|CT||||TG||AAGAGCT||C||-----T||GAA||C|G|||||GC|C||AA|A|GGCA|CC|T||TCT|GTC|||AT

610 620 630 640 650 660 670 680 690 700 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1J CTTTCCTGAGCAAACAAACTAGG----TCTTTACCTATGGAGCTGATTT-TATGAAGAGTTTTGGTCAGCATTAGTCATTGTGAAACCATGGGCCTCCTG Ptro 1J |||||||||||||||||||||||----||||||||||||||||||||||-||||||||||||||||||||||||||||||||||||||||||------Mmul 1J |||||||||||||||||||||||----||||||||||||||||||||||-|||||||||||||||||||||||||||||||||||||T|||||||||||| Mmus 1J -----||||ATG|CA|||ACG------C||GC||||||CA||T||G|||-|||||||||||||A|G||||||||C|||C|A||||||T|||TT|||GT|| Rnor 1J -----||||ATG|-A|||ACG------C||GC||||||C|||T||G|||-|||||||||||||||G||||||||C|||C|A||||||T|||TT|||GT|A Btau 1J T|||||||||||||T||G|||||TAGG|||||C|A|G|T|||T||||||-|||T||||||||||||||A|||||||||||A||||||T|||T||||G||| Cfam 1J AC|||||||||||||G|GA|GTT----|||||||||G|||||T||||||-|||||||||||||||||||||||||||||||||||||T|||TA|||G||| Mdom 1J GA||||CT|TGGG||T||G|CT|----C||||||||G|AA||T|C|||CGC|A|||T||C|||A||||CTC||CT|GGC||||||||G|||TT|ACAAA|

710 720 730 740 750 760 770 780 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | ... Hsap 1J CCCTGGTTTATCTCGACAGTCATCTCCCTACAGCAGAAGATTGAATCCTCATCTCTCCATGAGTCTGAGCATCTA-AAGATGTTAGAG Ptro 1J ------Mmul 1J |||||||||||||||||||||||||||||||||||||||G||||||||||||||||A||||||||||||||||||-|||||||||||| Mmus 1J ||||||||||||||C||||A||||||T|C|TG|||||||G||||C|A||TG||||G||G||TC||||G||||||G-||||||G|T||| Rnor 1J ||||||||||||||C||||A|G||||T|C|TG|||||||G||||C|T||TG|||||||G||TC||||G||||||G-||||||G|T||| Btau 1J ||||||||||||||TGT||A||||||T|C|TG|||||||||G|||||||TG|||||T||||TC|||AG|||||AG-|||||||||||| Cfam 1J |||||||||||||--GT||A|||||||||GTG||||||||||||||||||||||||||C||TC||||G|||||||-|||||||||||| Mdom 1J ||G||C|C|||AATA|T|A|A||A-----|T|AT|AT|ATA|T|GCTAC|||T|TGAG|AC|C|TG||ATG|T|GC|||GCAC|TTGT

157 S3: 10 20 30 40 50 60 70 CREBA80TF 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | ....CREB| .... | .... | ....BE| ....L1 | .... | .... | Hsap 1C TTTATTTAATGT---TATTAACTGAATCTATAGATAAAGAGG----TAGTTTTG-----GAGCCAAGTAACCTGTTGATGTAAAGTCTATTTT-ACCTTT Ptro 1C -|||||||||||---|||A|||||||||||||||||||||||----||||||||-----||||||||||||||||||||||||||||||||||-|||||| Mmul 1C ||||||||C|||---|||||||||||||||||||||||||||----||||||||AATGA|||||||||||T||||||||||||||||||||||-|||||| Mmus 1C |GG||||GTCT|CCCC|||CC||||||||||||||G|G|GA|AACAC|C|||||AATGG|||||C||G|G||||||||||||||||G|C||||T|||||| Rnor 1C |||||||GTCT|CCCC||CCC||||G|||||||||G|G|G----CAC|C|||||AATGG|||||C|||||||||||||||||||||ACC||||-|||||| Btau 1C |||||||GC|A|CAT||||||T|||||G|G|||||||G||||----|T|A||||AATGA||||||||C||||||||||||||||||||T||||T|||||| Cfam 1C |A||A||GT|||CAT|||||||||||||C|C|||||||||A|----||||||||AATGC|||||||||||||||||||||||||||||G||||-||||||

MSX1 110 120 TFII-I 130 140 MEI150S1 160 170 EN1 180 190 200 .... | .... | .... | .... | .. .. | .... | .... | .... | .... | .... | .. .. | .... | .... | ..NC.. |X.. .. | .... | .... | .... | .... | .... | Hsap 1C TATGATTACCATC--TAGCACCTCCCTCCTTCCTGGCTGAATTCCCTGTCATTTTAAGTAGGCA~~~~~~GCAATTACTGGTTTGCTAAAGAAGCCAGCT Ptro 1C |||||||||||||--|||||||||||||||||||||||||||||||||||||||||||||||||~~~~~~|||||||||||||||||||||||||||||| Mmul 1C |||||||||||||--|||||||||||||||||||||||||||||||||||||||||||||||||GCAATT|||||||||||||||T||||||||||C||| Mmus 1C ||A||||||||||GT||||||||||||||||||||||||GG|||||||||||||||||C|||||~~~~~~||||||||A||||||||||||||||TG||| Rnor 1C ||A||||||||||GT||||||||||||||G|||||||||GGC||||||||||||||||C|||||~~~~~~||||||||A||||||||||||||||TG||| Btau 1C |||||||C||||TGT||||||||||||||||G|||||||G||||||||||||||||||||||||~~~~~~|||||||||||||||T|C||||||TTG||| Cfam 1C |||||||C|||||AT||||G||||||||||||||||||C|||C|||||||||||||||||||||~~~~~~|||||||||||||||||||||||||TG|||

210 220 NKX6-2 230 240 250 260 270 280 290 300 .... | .... | .... | .... | . ... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1C CCTGCTGCCAAGGATCCTGTTAATTATCACTCTATCTCTAATTTAGCCTTCCTAGTGTTGAGAGAAGGTGCACGTAAGCGTGTGGCAGAACGTCTGCAAT Ptro 1C |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1C |||A|||||||||||||||||||||||||||||C|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmus 1C T||||||||||||C||||A||||||||||||||||||||||||||||||||TC|||||||||||||||CA||T||||||C|TCT||T|G|G|GT|||||| Rnor 1C T||||||||||||C||||A|||||||||||||||||||||||||||||||||CT-|||||||||||||CA||T||G|||C|TCT||T|||G|G|||||T| Btau 1C |||||||||||T||||||A||||||||||||TC||||||C|||||AG||||T|||||||||||||G||||||T||||||C||||||CA|G|AG||A||G| Cfam 1C ||||||||||||||||||A|||||||||||||||||||||||||||||||||||||||||||||||||||||T||||||||||||||||G|AGT||||||

310 320 330 340 350 E2F3601 370 380 390 400 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .. .. | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1C CGCA-TCTT---TGTAATAATCTCCTTTCTGAGACGGTTCAGTGGACTCAATGTTCCGCCAAAGGGCCAAGGCAGCCCTGGTGAGTGTTTTCAGCTCTCT Ptro 1C ||||-||||---|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1C ||||-||||---||||||||C|||||||||||||||||||||||||||||||||||||||||||||||G|T||G||||||||||||||||C||||||||| Mmus 1C GAG|-|||C---CA||G|C|C||T|||||||||C|||||GT||A|||||T||||||A||||||||||||G||TG||||||||||||||||||GT||T||| Rnor 1C GAA|A|||C---CA||||||C||T|||||||||G|||||GT||||||||T||||||A||||||||||||G||TG||||||||||||||||||GT||T||| Btau 1C |A||-|||C---C|||||C|||||||||T||T|||A||||||CA|G||||||||||A||||||||||TG|||||||||||||||||C||||||A|||--| Cfam 1C ||||-||||CTT||||||||||||||||||||||||||||||C|||||||||||||A||||||||||TG||||G|||||||||||||||||||CA||--|

410 420 430 440 450 460 470 480 490 500 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1C TCTGTAGCTTGTTTGGTCAGTCGAGTTTGGTGTGATTG------T---CCTCTCCTTTTGCTTCTGACCTAAGTAAAA-GCT Ptro 1C ||||||||||||||||||||||||||||||||||||||------|---||||||||||||||||||||||||||||||-||| Mmul 1C |||||||||C|||||||||||||||||||A||||||||------|---||||||||||||||||||||||||||||||-||| Mmus 1C ||CA||AG|||||||||AGT|||TA|||A|CA||G|||TGGGTTTTGTTGTTGTTGTTGTTG|TGTTT|T|||||C||A|||||G|||G|||||G|---- Rnor 1C ||CA|||G|||||||||TGT||AT||||A|CA||G|||------GTTT|A|||||C||A|||||G|||G|||||G|---- Btau 1C |||||||G|||||CC||||||T||||||||||||G||T------|---|T|T|||C|C||AC||||G|T|C|||||||-C|| Cfam 1C |||||||G|||||||A|AG|||AG||||||G|||G||T------|---|TA||G|C||||AC||||||||G|C|||||A|||

510 520 cDNA530 start 540 550 560human ATG 570 580 590 600 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1C AATGGTTGG-CATTAATCTTGGGAATTCAGACCTATTCCGC-TCCATCTCTGAA-GTCAAATGG-GACACCTTGAAAATACTTCAGTGGTTTTCCCACGA Ptro 1C |||||||||-|||||||||||||||||||||||||||||||-||||||||||||-|||||||||-||||||||||||||||||||||||||||||||||| Mmul 1C |||||||||-||||||||||||||||||||||||||||T||-||||||||||||-|||||||||-||||||||||||||||||||||||||||||||||| Mmus 1C |TCAAA|AAG|C||T|C|||||||TC||||||TG|||T|CAG||TG|TCT||||CC|A|||||AA||||G||||||||C|TG|A||||A|||||||||C| Rnor 1C |TCAAA|AAG|C||T|C|||||||TC|||||||||||T|C|G||TG|TGT||||TC|A|G|||AA|G||A||||||||C|TA|A||C|A|||||||||C| Btau 1C CT|||||||-||||TG|G|G||||G||||A||||G|||||GG|||||||G||||-C|||G||||-|||||TG||||||||||GGGA||A|||||T||GA| Cfam 1C G||||||||G||||T||G|||||G|||||||||||C||TCAGC|TG|||G|||G-C|||C||||-||G||||||||||||||GTG||||||||||||T||

610 620 630 mouse 640ATG 650 660 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .. Hsap 1C GCTATTTTCTCTCTCTGTG----AAAAGGAAACCAGGAAATTGACTCTGTGCCTGTTTTCAA-GAAG Ptro 1C |||||||||||||||||||----|||||||||||||||||||||||||||||||||||||||-|||| Mmul 1C ||||||||||||||G||||----||||||||||||||G||||||||||||||||||||||||-|||| Mmus 1C |||GA||C||||ACGG|||AAGAG|||A||G||||T|G|||||||||GA|||||C|C|||C|-|||| Rnor 1C |||GA||C||||G|GG|||AAGAGT|GA|-G||G|T|G|||||||C||A|||||C|C|||C|-|||| Btau 1C |||G||||T||||||||G|G---||||||CC||||T|G||||||||||T||T|A||C|||||A|||| Cfam 1C A|C|||||||||ACG||G|----C||||||G|G|GTAG|||||||C||A|||||||CC||||-||||

158 S4:

10 20 30 40 50 60 70 80 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC AGAGCTTAGACTAAAGGCCACGACTCACACATTCCAAATACATATAGGCTTGAAGTTATCCTATTATAAAACAGTTACCACATTCATGTAAATGGCCAGG Ptro 1MC ||||||||||||||||||||||||||||||||||||||||||||C||||||||||||||||||||||||||||||||||||||||||A|||||||||||| Mmul 1MC ||||||||||||||||A||||||||||||||||||||||||TCGC|||||||||||||||||||||C|||||||||||||||||||||||||||||TG|| Mmus 1MC GT||GC|||GTACTT|T|TGTT||CTCT|AGA||T||G|---|GAG||T||AGG|AG|CGGCTC|G|TGGTA||A|G||CGCA|G|GT|TGG|TC|||AA Rnor 1MC GC||GG||TGTACT||T|TTTTC|CTCTGAGA|||||G|---GGAG||T||AGG|AG||GGC-C|G|TGGTAG|A|G||CGCA|G|GT|T|G|TTT||A|

110 120 130 140 150 160 170 180 190 200 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC CAAAGGTCAAAATAT----GAGCAACATTATTTGTAGCTCAGTGAGAGATTTGATGTTCAAAGTCTGTCAGCATTTGTCAGAAGACTGATATTGTCAATG Ptro 1MC |||||||||||||||----||||||||||||||||||||||||||||||||||||A|||||||||||||||||||||||||||||||||||||||||||| Mmul 1MC |||||||||||||||----||||C|T|||||||||||||||||||||||||||||A||||||||||||||||||||||||||||||||G||||||||||| Mmus 1MC ||GCCA|GTG|||||CCGT|T|T|GTGG|GG|||G|A|AAT|CC||||CAGA|G|AA|AG|||CAG||--||||CCC|GGAGC------|||CC Rnor 1MC ||TCCA|GC||||G|CCACAT|TGGTGG|G|||CA|A|AACTCC||||CAGA|G|AA|AC|G|CAG|C--|A||CCC|GGAGCTTTCTGAGAA|C|||CT

210 220 230 240 250 260 270 280 290 300 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC GCTGTTTCAGATTAAGACCAACTAAAAAGTGATTTGGTGTGAACTCAGAATATAGGGAAAATAAGACAATTTGAATGTACCCCAGGAAACAAG--AGCCC Ptro 1MC ||||||||||||||||||||||||||||||||||||||A||||||||||||||||||||||||||||||||||||||||||||||||||||||--||||| Mmul 1MC ||||||C||||||||||||||||||||-||||||||||A||||||||||||||||A|||||||||||||||||||||||||||||||||||||--||||| Mmus 1MC TAG|CAGTCTGCG|GCT|||GT|TC||T|A||---|ACCCTGC||||A||G|C|AA|||C|A||C|AC|ACA|G|-|C|A|AA|AACCC||||CC|ATGT Rnor 1MC |AGCCAGTCTG|G|GCT|||GT|TC|GG|G||---|ACCCT|C||||A||A|C|AA|||G|A||C|A||ACA------A|AA|----C||||CCG|TAT

310 320 330 340 350 360 370 380 390 400 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC TGCACTTGACTCCAAAAGGAGTTCTATT---ATTCTGGCTG----TTTCCAGAC---TTTATTGTATCTTGAGAAGAGAACTGTTTTCCCTCTAAATCAG Ptro 1MC ||||||||||||||||||||||||||||---||||||||||----|||||||||---||||||||||||||||||||||||||||||||||||||||||| Mmul 1MC ||||||||||||||||||||||||||||---|||||||||A----|||||||||---|||C|||||||||||T|||||||T|T|||C||||T|||||||| Mmus 1MC G|AGAG|||G|G||G||A|CACCTG|C|TTG|||T||A||ACTGA||||||C|TGGG||AGA|A|G|||ATGT|TA|C|CTCA|G|A||A|GC|T|-||A Rnor 1MC G|A|AG|||G|G||G||A|CACCTG|C|TTG|||T||A|CACTGC||||T|C|TGGG||AGA|A|||GCCTGT|TACC|CTCACA|A||ACA||T|-||A

410 420 430 440 450 460 470 480 490 500 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC TTTCATCATCTGTATCCAGGGTAGTACTCACAAGAACATGTCAATATCAATAGCATGCATATGGGGTGTTGGATTCTTAGAACTTATTGCAATTGCTTCC Ptro 1MC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1MC |||T||||||CA||||||||A||||T|||||||||||||A|||||||||||G|||||||||||||||||||||NNNNNNNNNNNNNNNNNNNNNNNNNNN Mmus 1MC A|GAG|ATA||A||CA||T-AC|AA|A|GGGG|A|||||AGA|GAC||||ATT|||C|---|T|AC|A||T||GCTA|GA||A|AGG||TGGGCC|||TA Rnor 1MC ACGA||ATA|CA||CG||T-AC|AA|A|GGG||A||||CAGA|GACC|||ATT|||C|---|T|AC|||CT||GCTA|GA||A|AGG||||GA|C|||TA

510 520 530 540 550 560 570 580 590 600 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC TCTAGGTTCTATGATGATTATCAATTTATTGCCTCTCAGGTCCAAATTCACCCTTTATTGTCTGCTCTGTGAAAATGGACCTGAACTCTTTAAATGGTAT Ptro 1MC |||||||||||||||||||||||||||||||||||||||||||||||||||T|||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1MC NN------Mmus 1MC GA|||----||CA|||C|C|G|T||G|C------|G|||||||||G||C|A|||G||A|C|C Rnor 1MC GA|||----||CA|||T|C|G|T||G|C------|GG|A|||||AG||A|A|||G||||C|C

610 620 630 640 650 660 670 680 690 700 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC GATGTTAAGGTTTGGCAGGAGAGGGTGCTGGAGAGAAGTCACAGGAAGAAGGGGTTTTCCTTCTTAAATCTGGCGTGCATTCTCACGTGGCTTCTGCAGC Ptro 1MC ||||||||||||||||||||||||||||||||||||T|||||||||||||||||||||||||||||||||||||||||G|||||||||||||G||||||| Mmul 1MC ------Mmus 1MC AG||||C||TCAATCAG||G----A|||||||||||CA|TG|||||GA||||T|GCC||||C|CA----TCC|G||A|||G|||||TCAA|||||||||| Rnor 1MC |G||||C||TCAGTC|||||----A|||||||||||CA|TG|||||G||||AT|G|C|||||||A----TCT|G||||||G|||||T||A|G||||TG||

710 720 730 740 750 760 770 780 790 800 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC ATCCATGGCTTCTCCAGGACCTGGCTCTTGCAGCACCGGAGACATCTCCAGGGCTTGTTTCCCACAGCACTTGTGGCTTCTCTAGCACCATGTTCC--TC Ptro 1MC ||||||||||||||||||||||||||||||||||||T|||||||||||||||||||||||||||||||||||||||||||||C|||||||||||||--|| Mmul 1MC ------||||||||T||||||||||||||||||||||||||||||C|||||||C|||||--|| Mmus 1MC |CT|C||||||||||GT|GTG||||||GG|A||||TG|||A|G||GG||||T||||||||||TG|C|TGGA||||A|C|TATCTC|TAG||C|CA|AG|G Rnor 1MC ||T|C|A|||||||||T|GTT||T||||G|A||||TG|||A|G||TG||||T||||||C|||TGT|CTGAA||||A|||TATC--|TAGT|C|CA|AG|G

810 820 830 840 850 860 870 880 cDNA start890 900 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC CAGGGCTCTGGCTTCACTAGTGCCTGGC---CCCTGCAGTGCATAGTGGCCACAGCCGCACCTGGTAGCCAGCAGCTTCCTTTGGCACCTCTCCTTGGGC Ptro 1MC |T|TC|||||||||||||||||||||||---||A|||||||||||||||||||||||||||||||||||||||G|||||||||||||||||||||||||| Mmul 1MC |||T||||||||||||||||||A|||||---T||||||||||G||||||||||||||||||||||||||||||||T|||||||||||||||||||||||| Mmus 1MC TG||TGG||CT|C|||TC||A|||CTC|CACT|||||T|||||CGC||C|||AG|TT|A|||CA|||-TT||||||G|||C|||AAGG------Rnor 1MC TG||AGG||TTTG|||TC||A|TTCTC|------|||T|||||C|C||C|||AG|TT|T||||A|||-TT||||||||||C|||A||A|A||||||||AT

910 920 930 940 950 960 970 980 990 1000 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1MC TGTTTTGTAGCAGGGTGCCTCTGGTGGGACACCTCCCTGTGAACAGC--TTCCCTGAAACCCTAGAGGATGGAT------TCCAGTAAGCTCCAC Ptro 1MC |||||||||||||||||||||||||||||||||||||||||||||||--|||||||||||||||||||||||||------||||||||||||||| Mmul 1MC |||||||||||||||||||||||||A|||||||||||||||||||||--|||||||||||||||||||||||||TCCAGCAGGAT|||||C||||||||| Mmus 1MC -----||||||||A||C|||TGCT|||A|||AG|T||CA|||||C|GCT||T||||GC|G|T|T||||||||||------||T|||C|TG||||| Rnor 1MC |||AA||||T|||A||C|||TGTT|||||||AG|T||CA|||-|CA|CT||T|||||C|G|T||||||||||||------||T||||||A|||||

1010 1020 1030 1040 1050 1060 1070 1080 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | . Hsap 1MC CACTGAAGCACCACAGCAACTTCCCTGCCTCCAGATTTCTGGCTCTTAGCCCTGGGGATAAAGGCTCTCCCTTGGGCCCTG Ptro 1MC ||||||||||||||||||||||||||||||||||GGA|||||||||||||||||||||||||||||||||||||||||--- Mmul 1MC ||||||||||||||G||||||||||||T||||||GGA|||||||||||||||||||||||||||||||------Mmus 1MC AGAGA|||||TTG|T|||GTGGTGAG|TT|A|||--C|GAA|AGGGA||G|||TC--|C|C|A||C||A|||CA|AA||A| Rnor 1MC AGAG||CA||T|||CT||GGGATGAG|TT|A|||--C|AA|AAGAGA||G|||TCT-GC|C|AATCG|A||||A|AG||A|

159 S5: CMAF 10 20 30 40 50 60 70 80 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1E ACACAGAATAGTCAGTCTCCTGCCTTTTGGACACT-ATATGCATGCCCAGGTGGCAGGGAATTTACGTCAGCAAAAGC~~~~~~~~~~~~~~~~~~~~~~ Ptro 1E |||||||||||G|||C|||||||||||||||||||-||||||||||||||||||||||||||||||A|||||||||||~~~~~~~~~~~~~~~~~~~~~~ Mmul 1E |||||||||C|G|G|C|||||||||||||||||A|-||G|||G|||||T|||||||||||||||||A|||||||||||~~~~~~~~~~~~~~~~~~~~~~ Mmus 1E |||||A||C||||||AT||||||||C|||||||A~~~~~~~~~~~~~~~~~G|A|||||||||G||A|||||||||AAAAAAAAACAAAAAAAAACAAAA Rnor 1E |||||A||CG|G|||CT||||T|||C|C|||||A~~~~~~~~~~~~~~~~~G|A|||||||||G||A|||||||||CA------Btau 1E G||||C|TC|CG|||C||GT|||||||||||T|A|-G|G||||||AT|TA|||A|||A||||||||A|||||||||A|~~~~~~~~~~~~~~~~~~~~~~ Cfam 1E GT|||C|CC||G||AC||A||||||||||||T|A|-||G|||||||TTTA||||T|||||||||G|A|||||||||AA------~~~~~~~~~

110 120 130 140 150 160 170 180 190 200 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1E ~~~~~~~~~~ACTAATTTTGCTAAAAAAAAAAAAAATAGAGGCACACAAAAATGTGATGAGTAAATGAAACAACTGTTATTAGTGACGGATTTGGCATGT Ptro 1E ~~~~~~~~~~||||||||||||||||||||||||--||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||G||| Mmul 1E ~~~~~~~~~~|||||||||||||||||||||G|||-|T||||||||||||||||||||||||||||||||||||||||||A|||||T|||||||||G||| Mmus 1E AAAAAAAACC|G||||||CA|||||G||||T|||--||A|A|||||T|||||||CCG||||||G|||||||TG|CC||CC||||||T||G|||||||||| Rnor 1E -----~~~CC|G||||||CA|||||G||||T|C|--||A|A|||||T||||||TCAG||||||||||||||TG|CC||CC||||||T||G||||||||C| Btau 1E ~~~~~~~~~~G|||||||||||T|||||||T||||-|CA||||||T|||||||||||||||||||||||||T||||||||||||||T||G|||||||||| Cfam 1E ~~~~~~~~~C||||||||C|T|T|G|||||T||||-||A|||||GT|||||||||||||||||||||||||T||||||||||||||T||G||||||||||

210 220BACH2 230 240cDNA start 250 260 270 280 290 300 .... | .... | ....AP|1.... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1E TTTACGAAGTCTGAATGATTACTCATCCACTGTACATTTGCAGAAGTT-CTTTAATAAAAACCAGACGCATATGTAGTAGCAGGGGTTAGTAGGTGGATG Ptro 1E ||||||||||||||||||||||||||||||||||||||||||||||||-|||||||||||G||||||||||||||||||||||||||||||||||||||| Mmul 1E |||||A|||||||||||||||||||||||||||||G||||||||||||-||||||C||||G||||||||C||C|||||G||||||||||||||||||||| Mmus 1E ||||TA|||||GCC|C|||||||||||||||A|||G||||||||||||-||||TTC||||G|||||TA||C|GAC|||CA|||A|||||||||||||||| Rnor 1E ||||T||||||GCCGC||||||||||||||CA||||||||||||||||-||||TTC||||G|||||TA||C|G|CT||CAT||||||||||||||||||| Btau 1E |||||||||||||||C||||||||||||T||||||G|||||||||||GG|||C||C||||G|||||T|||||C|||C||||||||||C|||||||||||| Cfam 1E |||||||||||||||G||||||||||||||||||TG||||||||||||-||||||C||||G|||||T|||||C|||||||||||||||||||||||||||

310 320 330 340 350 360 370 380 390 400 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1E GGAGGATTAAACCCTGTGCGTTTCTGGAGCATTGG-TTTGTAACTGTTTTTTGGCTTGTCAACAGGCTATTTTTCTGAGTCAGCCTATAGGATGGCTTCC Ptro 1E ||||||||||||||||||A||||||||||||||||-|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1E T|||||||||G|||||||A||||||||C|||||||-||G||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmus 1E |||A||||||G|||A|||A|G||AC|T|T|------|||||C|||||||GC|C|||||T||||||||||G||||||||||| Rnor 1E |||A||||||G|||A|||A|G||ACAT|T|------|||||||||||||G|GC|||||T||||||||||G||||||||||| Btau 1E A|||||||||||||C|||A||||T||||||-CC||G||||||G||||||||-||||||||G||||||||C|||A||||||||||||||||||||C||||| Cfam 1E A|||||||||||||A|C|A||||T|||||||||||T|||AA||||||||||-||||||||||||||||||||||||||||||||||||||||||||||||

410 420 430 440 450 460 470 480 490 500 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1E CAGGGTAAGTCTGATTTTGCTTTTCTGGTTTTAAAATATAAAGTGGTAATGGAGAGCTGACTAGTTGCTCTCT-----GCATTAGATTCTGTAAATCAAT Ptro 1E |||||||||||||||||||||||||||||||||||||||||||||||||||||||T|||||||||||||||||-----|||||||||||||||||||||| Mmul 1E AG||||||||||T-|||||||||||||A|||||||||||||||||||||||||||T|||||G|||||||||||-----|||||C||||||||||||||G| Mmus 1E |||||||||||||||||||||||C-----|CCT|TGG||||-||A|C|GA|A||G|T||GGC|||CT|CT|T|-----|||-|G|G||G|||||G||GCC Rnor 1E ||C||||||||||||||||||||C-----|C|T|TGG||||-||||C|GA|A|C|T|||GGC|||C||CT|T|-----|||-|G|G||G||||CG|||C| Btau 1E |||||||||||||C|||||||||||||AG|||||||||||C-|||||C|A|||||||C||||C|||||CT|T|-----|||C|G||||GC||TTG|T||C Cfam 1E ||||||||||||||||||||||||||||G||||||||||||-|||||G|A||||GT||||||||||||CT|T|TTTTT|||CCG||||||||||||T||C

510 520 530 540 550 560 570 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... Hsap 1E ATTGCCTGCATTTCTT-CTGTAAGAAAGACATTGGTCGCATTTCAGCATATTCTAGTGTTCCTGCTGCTCATTT Ptro 1E ||||||||||||||||-||||||||--||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1E |||T|T||||||||||-|||||||||||||G||||||A|||||||||G||||||G||||||||C|||||G|||| Mmus 1E |------|||||||-TA||G||||G|GTG||CA|T|G|CCC|||||||||||G|G||||T||||T|CTGGC| Rnor 1E G------|||||||-TA||G||||G|G|G||TAA||G|CCC|||||||||||G|G|||||||T|T|CTTGC| Btau 1E |G||||||TG|G||||T||||G|||||||||||TA||TT|||C|||||||||||G|||C|||||||A||GG||| Cfam 1E |G||||CA|T||||||-||||G|||||||||||TA||CT||AC||||||||||||||||||T|||||T|G|C||

160 S6: 10 20 30 40 50 CP2 60 70 80 EF-C 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1H TGTGGTGTGAGGCAGCG--TTTT--TGTCCTGCAGGTACAGTAGGTACTGGATTAAACAGGTCTGCTGTTGCAGACAGAAACCAGG-CACCGTTCTAGCA Ptro 1H |||||||||||||||||--||||--|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||-||||||||||||| Mmul 1H ||||||||||||||||A--||||--||||||||||||||||||||||||||||||||||||||||||||||||||||||C||||||-||||||||||||| Mmus 1H ||CA|ATC||||-||T|---C|G--||C||CT|||||G|CA|||||||||||||||G||||||||||A|||||||||||C||||||-|T||A|||||T|G Rnor 1H ||CA|AACA|||-||||---C||--||C||CT|||||T|CA|||||||||||||||G||||||||||A|||||||||||C||||||-|T||A|||||||G Btau 1H ||CA|G||||||||||AGT||||--||||||||||||||||||||||||||||||||||||||||||||||||||||||C|||G||-|||||||G||||| Cfam 1H ||CA||||||||||||A--||||--||||||||||||||||||||||||||||||||||||||||||||||||||||||C||||||-||||||||||||| Mdom 1H ||CA|CC||G|||TTTTTT||||CC|TC|||T||||||T|||||||G||||||||||||||||||||AA||||||||||C||||||G||||||||AGA|G

MEIS1 110 COM120P1 130 AH140RANT 150 160 170 180 190 200 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1H CAGAGCTGTGTTTGGATTGGAGTTTCCAGGGCCTTATCAGGAGCCACCCCTAGTGACA----CAGCCAGTGCCAGAACTAACTTTGACTTTCACTCTTCG Ptro 1H ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||----|||||||||||||||||||||||||||||||||||||| Mmul 1H ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||----|||||||||||||||||||||||||||||||||||||| Mmus 1H TG||||||||||||||||||||||||||||||||||||||||||||||||||||||||----|||||G|||||||||G|||||||||||||||||||||| Rnor 1H TG||||||||||||||||||||||||||||||||||||||||||||||||||||||||----|||||G|||||||||G|||||||||||||||||||||| Btau 1H |G-|||||||||||||||||||||||||||||||||||||||||||||||||||||||----|||||||||||||||||||||||||||||||||||||| Cfam 1H |G-|||||||||||||||||||||||||||||||||||||||||||||||||||||||----|||||||||||||||||||||||||||||||||||||| Mdom 1H ||||||CTG|CC||||||||C|||G|||A||||||G|||A||||||||||||||||||GACA||T||CC||||||||G|T|G|||||||||||||A||||

210cDNA start220 230 240 250 260 270 280 290 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | . Hsap 1H CCAAGGGCTTGCAGAACACCTTAAAGGAA-AAAAGATGGAGGCGCTTAGAGTTCAGATGTTCATGCCATGCTCCTTTGAAAGCTTGTATCT Ptro 1H |||||||||||||||||||||||||||||-||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1H |||||||||||||||||||||||||||||-|||||||||||||||||||||||||||||||||||||||||||||||||||||||A||||| Mmus 1H |||||||||||||||||||||||||||||-G|||||||||||||||||||T||G|||||C||||C||C|||||||||||||||||||G||| Rnor 1H |||||||||||||||||||||||||||||AG||||||||||A||||||||T||G|||||C||||T||CC|||||||||||||||||||||| Btau 1H |||||||||||||||||||||||||||||-|||||||||||||||||||||||||||||||||||||T||T||||||||||||||T||C|| Cfam 1H |||||||||||||||||||||||||||||-|||||||||||||||||||||||||||||||||||||C||||||||||||||||||||||| Mdom 1H ||||||||||||||||||||||||C||||-GG|||||||||||CT|G||||||||||||||||||||T|A|||||||||||||||C|G|||

161 S7:

10 20 30 40 50 60 70 80 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1D AATGATATTGTTGTCGACTTTCACG--TATG------AAGACTTAGTGCAGTTGATAACTAGAAATTTTAATTTAAGATGTCTTAAGAATGCTTTACTGT Ptro 1D |||||||||||||||||||||||||--||||------||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1D |||||||||||||||||||||||||--||||------|G||||||C|||G||||G||||||||||||||||||||||||||||||||||||||||||||| Mmus 1D ||||||G|||||A|T|TGG||G|A|--C|||------|||C|||||||AGC|||C|||||||TC||||||||||-----||||CC||G||||||||||A| Rnor 1D ||||||G||T||A|T|TGG||A|A|--||||------|||C|||||||GGC|||C|||||||TC||||||||||-----||||CTG|G|||||AG|||A| Btau 1D |||||||C||||||T|||||GA|A|--|C||------C||C|||||A|--||||||G|||||T||||||||C|||||||||||C|||||||||||||||| Cfam 1D ||||G|||C|||||GA||||-A|A|--|C||------|||C|||||||TG|||||||||CG|T||||||||||||||||||||C|||||||||||||||| Mdom 1D ||AA|A|AA|CCAG|TT|||AA|ATGCCC||TCACCTG|ACT||TC||A|||CAGG||GC|CTG|||||G||G|||||||CT||||||||A||||||||| Ggal 1D ||||GGGACTC||AGTGGC|CGGATG-|G||----CTC|||TGC||A||||CCAGG||AC||GCTGCAAGGC|C----||ATGGG||||||||C|G-|A|

110 120 130 140 150 160 170S8 180 190 200 .... | .... | .... | .... | .... | .... | .... | .... | .... | ... CHX10. | .... | .... | .... | ... . | .. .. | .... | .... | .... | .... | .... | Hsap 1D TAATTGAAAGGATTTCTT---CCCCCAGTATCACAGCCAATGACTCGTCTTGAGCAGCTAATTAGTGCGATTATTCCACAGCTGCATTTGCTACAGCACA Ptro 1D ||||||||||||||||||---||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1D ||||||||||||||||||---|||T|C||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmus 1D |||||||||||||||TCC----|||TG||||TG||||||G||||G|||||||T||||T|||||||CA|||||||G||||||||C|T||||||C|T||||| Rnor 1D |||||||||||||||TCC----|||TG||||TG||||||G||||||||||||T||||T|||||||CA||||||G|||||||||C|C||||||C|T||||| Btau 1D |||||||||||||||T||TTT||||TG|||||||||||||||G||T||||||||||||||||||||||||||T||||||||||||||||||C|AG||||| Cfam 1D |||||||||||||||T||--C|||||||||||||||||||||G||T|||||||||||||||||||||||||||||||||||||||||||||||||||||| Mdom 1D |||||||||||||||TCC---||||A||||||||||T||||||T|T|C||G|||A||||||||||||||||||||||C||||CC|G||A|T||||||||| Ggal 1D ||||||GG|||G|GGTG|T-TTTG|A||||||||||T||T|||||T||||||||||||||||||||||||||||||||||||||||||A|T|T||C||||

cDNA start 210 GATA220 230 240 250 260 270 .... | .... | .... | .... | .. .. | .... | .... | .... | .... | .... | .... | .... | .... | .... | . Hsap 1D AAGGTTTGCTTCTGTTTTTATCAAAAGGATCAGTCTCTCTGGGAATGTTTTAACCTGACAGGCTTTGAATA Ptro 1D ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1D ||||||||||C|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmus 1D ||||||||||CT||||||||||||||||||||T||||||C|A|||||||GGG||||||||||||C|||||| Rnor 1D ||||||||||C|||||||||||||||||||||T||||||||A|||||C||GG|T||||||||||C|||||| Btau 1D ||||||||||C|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Cfam 1D ||||||||||C|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mdom 1D G||||||T||CT||||||-||||||||||||||||||C||||||||||||C|||||||||||||||||||| Ggal 1D |||||||T||CT||||||-|||||||||||||||G|||||AT||||||||C|||||||||||TC||A||||

162 S8:

10 20 AHRANT30 40 50 60 70 80 90 100 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1B ATTTATTTTTAAATGTG----GAAATTTGGGTG------CCATTAAGATGCTTTGCTTCTTGGCAGTGCATATGGT----GGCGCTATATTTGG Ptro 1B |||||||||||||||||----||||||||||||------||||||||||||||||||||||||||||||||||||C----|||||||||||||| Mmul 1B |||||||||||||||||----A|||||||||||------|||||||||||||||||||||||||||||||||||||----|||||||||||||| Mmus 1B ||||G|||||GTC||||----||G|G|||CT||------|||||G|||CCAA|G|||C||ATTTGT||GT|||ATC----|||AT|C||||CA| Rnor 1B ||||GG|||||TC||||----CCG|G|||C|||------||||GG|||CCAA|G|||C||A|TTGT||GG|G|ATC----A||AT||||||CA| Btau 1B |A||||||||||G||||----A||C|C|||||A------||||||||||C|C|||||||||||||C|T|||||||C----A||A|||||||||| Cfam 1B |||||||||||||||||----|||||C||||||------|||||||||C||AC||||||||||||C|T|||||||C----|||||||||||||| Mdom 1B GCC|||A|||||GG|||A-AA|||||A|AC|||TGAAAAAATAGT||CC|||||A|||CGAT|||A||T||TCA|||||||C----A|TAT|||||||AC Ggal 1B |GC|GGC|CAGC|GACTTTGGA||GGG||CC|ACTTTCATGGAA-GAGG||GAC|TA|||AT|C|GA|CT||GTG||TA|ACCTAGA|TAT|G|C|G|AC

cDNA110 start 120 130 140 150 160 170 180 190 200 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1B -TGGTGATGAGTAGTGTGCAGCAT----AAA---ATGTAAAAAAAAAAAAA-TTAAAAAAATTAAGCCGCCTGATAAAAA----TGCCTTGATGCAATCA Ptro 1B -|||||||||||||||||||||||----|||---|||||||||||||||||A||||||||||||||||||||||||||||----|||||||||||||||| Mmul 1B -|||||||||||||||||||||||----|||---||-||||||||||||||-----||||GA||||||||||||||||||----|||||A|||||||||| Mmus 1B -|||||||T|ACC|||||TG||||----|||---G|A|CG||||G|||------||||TGATT|||||||||-----C||CA|||||||||| Rnor 1B -|||C|||||ACT|||C|TG|T|C----|||---||||C|||||G|||------||||TGATT|||||||||AAAA|C|||A|||||||||| Btau 1B -||||||||||||||AG||GAT||----|||---||||C||||||||||------|||||T|TA|||||||||----|||||A|||||||||| Cfam 1B -||||||||||||||A||TG|T||----|||---||||T|||||||||T------||||||T|A|||||||||----|||||A|||||||||| Mdom 1B -||T|A|||||||||||TTG|T|G----|||---||TCTT||G|||CC|C|-----C|CGT||||||T||A|A|||||||----|||||GC|||T||||| Ggal 1B C|CTCA||||ACGCAA|T||TTC|TCCC|||CTT||T|T||||||||TT|TGAAT|TG|GTGCCT||T||TATC||T|||A---|CA||||T|TTTC||| AP1 210 POU3F2220 230 240 250 260 270 280 290 300 RORA.... 2 | .... | .... | .. .. | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1B -AGCTGACTTATTTTAA--TTCAACTACTAATGACTTAAATCCTGTCACCTCTTGAT------TTTCAATTATGTGGAG-TACCATTCTG Ptro 1B -||||||||||||||||--||||||||||||||||||||||||||||||||||||||------||||||||||||||||-|||||||||| Mmul 1B -||||||||||||||||--||||||||||||||||||||||||||||||||||||||------||||||||||||||||-|||||||||| Mmus 1B -GC||||||||||||||--||TT|||C||||||||||G|||||||||||||||||||------||C||||||CA|||||-|G||||G|C| Rnor 1B -GC||||||||||||||--|C|||||C|||||||||CG||||||||||||||C||||------||||||||||A|||||-|G||||G|CA Btau 1B -|||C||||||||||||--||||||||||G||||||||||||||||||G||||||||------|||||||||G|||||A-|||||C|||| Cfam 1B -||||||||||||||||--|||||||C||||||||||||||||||||||||||||G|------|||||||||C||||CA-|||||||||| Mdom 1B -||T|A|||||||||||--|||||||||||||||||A||||||GA|||G|||||||A------||C|||||||||T|||-|G|||||T|| Ggal 1B TG|T||G||GC|G|A||AC||G||A||G|G|G|CA|GTTT|||A|CTGGA|G|||G|GTTTATGAGAGGTTGG||G||G|C|A||TA||GC|G|||AA||

OTX310 GZF1320 330 340 350 360 370 380 390 400 .... | .... | .... | .. .. | ... . | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1B TGACTTGATTAT-ATTTGCGCAGACTCATTT-----TATAGTTTGGTGCA--ATTTAGGAT---ACCC------CCAAAGTGCAAACGAAGGGTCTCA Ptro 1B ||||||||||||-||||||||||||||||||-----||||||||||||||--|||||||||---||||------|||||||||||||||||||||||| Mmul 1B ||||||||||||-||||||A|||||||||||-----|||||||||A||||--|||||||||---||||------|-|||||||||||||||||||||| Mmus 1B ||C|||||||||-||C||T|||||||||CC|-----CC||||||||||GC--|||||||||---||||------||GCGA||||GGT||T|||||||| Rnor 1B ||C|||||||||-|||||T|||||||||CC|-----CC||||||||||GC--|||||||||---||||------|-GCGA||||GGT||T|||||||C Btau 1B C||TC|||||||AT|||||A|G|G|||||||-----C|||||||||||||--|||||||||---||||------||||A||||||T|||A||||||| Cfam 1B CA||||||||||-C|||||A|||GA||||||-----C||||||||||A||--|||||||||---|T||T------||G||A||||||||||A||||||| Mdom 1B |T||-|||||||-||||||AA|AGT|A||||-----C|||||||AA|AT|--||||CA|C|---||||CCTTTTCC||CCCA||||||A||G|C||T||| Ggal 1B CAG|-||C|A|GT|CCCA|AGTAGG|||GCCATGCACCCGTC||A||||GGC||||CC|T|CGG|TT|TGCTCTG-|GGTTC|||||||CCT|A|AGCA|

410 420 430 440 450 460 470 480 490 500 .... | .... | .... | .... | .... | .... | .... | .... | ....B1| ....a |B1....b | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1B TTAGGAAACT---AAATGTTGTA----TGCATTTTGGTTTTCCCACAGCAGTTCCGCCGAGCATCCTGGGGCCTCCAAGCCTCCGATAAGCTCCTCCAGT Ptro 1B ||||||||||---||||||||||----||||||||||||||||||||||||||||||G|||||||||||||||||||||||||||||||||||||||||| Mmul 1B ||||||||||---||||||||||----|||C||||||||||||||||||||||||||G|||||||||||||||||||||||||||||||||||||||||| Mmus 1B |C||||T|||---|||||C|||G----|||C||C||||||C|||||||||||||T||A||||||T||||||||||||||||||||T||||||||||||C| Rnor 1B |C||||T|||---|||||C|||G----|||C||C||||||C|||||||||||||T||A||||||T||||||||||||||||||||T||||||||||||C| Btau 1B |||||||-||---C|||||-||G------TT|||CT||||C|||||||||||||||AG|||||||||||||||||||||||||||||||||||||||||| Cfam 1B ||||||||||---|||||||||GCC--|TTT||||TT|||||||||||||||||||AG|||||||||||||||||||||||||||||||||||||||||| Mdom 1B |||||G||T|---C|C|||-||G------|TC|||T|GC|C|||C||||||||||A|G||||||||||||||T||||||||||||C|||||||||||||| Ggal 1B |GGA|CCC||GGT|G|A|C||AGCCGTCT|TC|C||C|C|||||||||||A||||---|||||||||||C||T|||||||||||CT|||||||||||||C

510 520 530 540 550 560 570 580 590 600 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | Hsap 1B ATGACATCACGCATCTTGCTACGCCAGCAACTCATGCGTGAGCAGATGCAGGAGCAGGAGCGCAGGGAGCAGCAGCAGAAGCTGCAGGCGGCCCAGTTCA Ptro 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||A|||| Mmus 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||A|||||||||| Rnor 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||A|||||||||| Btau 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||A|||||||||||||||||||||||||||||||||||||||| Cfam 1B ||||||||||||||||||||||||||||||||||||||||||||A||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mdom 1B |||||||||||G||T|||||||||||||||||||||||||||||||||||||||||A||||||C||||||||||A|||||A|A|||A||T|||||||||| Ggal 1B |||||C|||||A|||C|||||||G|||||G||||||||||||||||||||||||||||||||TC||||||||||||||||||A|||A||A||||||||||

610 620 630 640 650 660 670 680 690 .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | .... | ... Hsap 1B TGCAACAGAGAGTGCCCGTGAGTCAGACACCAGCCATAAACGTCAGTGTGCCCACCACCCTTCCCTCTGCCACGCAGGTGCCGATGGAAGTCCTTAAG Ptro 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Mmul 1B |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||C|||||||||||||||||||||||| Mmus 1B ||||||||||||||G|||||||||||||||||||||||||||||||C||||||||||||||||||||||||||C|||||||||||||||||||||||| Rnor 1B ||||||||||||||G|||||||||||||||||||||||||||||||C||||||||||||||||||||||||||C||||||||||||||||||||C||| Btau 1B ||||||||||||||||T|||||||||||T|||||||||||||||||C||||||||||||||C|||||||||||C|||||||||||||||||||||||| Cfam 1B ||||||||||||||||T|||||C|||||C|||||||||||||||||C||||||||||||||||||||||||||C||||||||||||||||||||C||| Mdom 1B |||||||||||||C||||||||||||||||||||T||T|||||||||||C|||T|T|G|||||||C||||T||C||||||||A||||||||||||||| Ggal 1B |||||||||||||T|||||C||C||||||||T|||||C||||||||C||||||G|||G|||G|||C|||||||||||||A||C|||||G|||||C|||

163

Paper III

165 166 miR-148 Regulates Mitf in Melanoma Cells

Benedikta S. Haflidado´ ttir, Kristı´n Bergsteinsdo´ ttir, Christian Praetorius, Eirı´kur Steingrı´msson* Department of Biochemistry and Molecular Biology, Biomedical Center, Faculty of Medicine, University of Iceland, Reykjavik, Iceland

Abstract The Microphthalmia associated transcription factor (Mitf) is an important regulator in melanocyte development and has been shown to be involved in melanoma progression. The current model for the role of Mitf in melanoma assumes that the total activity of the protein is tightly regulated in order to secure cell proliferation. Previous research has shown that regulation of Mitf is complex and involves regulation of expression, splicing, protein stability and post-translational modifications. Here we show that microRNAs (miRNAs) are also involved in regulating Mitf in melanoma cells. Sequence analysis revealed conserved binding sites for several miRNAs in the Mitf 39UTR sequence. Furthermore, miR-148 was shown to affect Mitf mRNA expression in melanoma cells through a conserved binding site in the 39UTR sequence of mouse and human Mitf. In addition we confirm the previously reported effects of miR-137 on Mitf. Other miRNAs, miR-27a, miR-32 and miR-124 which all have conserved binding sites in the Mitf 39UTR sequence did not have effects on Mitf. Our data show that miR-148 and miR-137 present an additional level of regulating Mitf expression in melanocytes and melanoma cells. Loss of this regulation, either by mutations or by shortening of the 39UTR sequence, is therefore a likely factor in melanoma formation and/or progression.

Citation: Haflidado´ttir BS, Bergsteinsdo´ttir K, Praetorius C, Steingrı´msson E (2010) miR-148 Regulates Mitf in Melanoma Cells. PLoS ONE 5(7): e11574. doi:10.1371/ journal.pone.0011574 Editor: Dong-Yan Jin, University of Hong Kong, Hong Kong Received December 18, 2009; Accepted June 14, 2010; Published July 14, 2010 Copyright: ß 2010 Haflidado´ttir et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by grants from the Icelandic Research Fund (www.rannis.is) and the University of Iceland Research Fund (www.hi.is/en/ research_degrees). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction cells [21,22]. Continued expression of MITF has been shown to be essential for melanoma cell proliferation and survival and, in fact, The MITF (Microphthalmia associated transcription factor) protein is a MITF has been proposed to act as a lineage survival oncogene in master regulator of melanocyte development and is important in melanoma [23]. Significantly increased levels of MITF, however, several other cell types including the retinal pigment epithelium reduce melanoma cell proliferation and tumorigenicity [24,25]. (RPE) of the eye, osteoclasts and mast cells [1]. More recently, Consistent with this, there is less MITF expressed in melanoma MITF was shown to play a role in melanocyte stem cells in the cells than in normal melanocytes [25]. Therefore, it has been hair follicle [2]. The Mitf gene encodes a bHLH-Zip transcription proposed that MITF levels dictate functional outcome such that factor of the Myc family [3,4] which regulates melanocyte high levels result in cell cycle arrest and differentiation, differentiation by activating other known melanocyte determi- intermediate levels promote proliferation and tumorigenesis nants, including Tyrosinase (Tyr), Tyrosinase-related protein-1 whereas low levels lead to cell cycle arrest and apoptosis. (Tyrp-1) and DCT/Tyrp-2 [5,6]. In addition to regulating According to this model, it is extremely important to regulate differentiation, MITF is required for melanocyte cell survival MITF expression in melanoma cells. [7,8], proliferation and cell cycle progression [9,10,11,12,13]. The miRNAs have been proven to be involved in many different cell diverse roles that MITF plays in the development of different cell processes including cell-cycle regulation, differentiation, prolifer- types suggests that the expression and function of Mitf must be ation and apoptosis [reviewed in 26]. miRNAs are thought to highly regulated. In fact, Mitf is regulated at multiple levels, regulate about 30% of coding genes in the human genome and to including transcription, alternative splicing, post-translational date 677 miRNA genes have been discovered in the human modifications and protein stability. The Mitf gene has at least genome and 491 in the mouse (www.microRNA.org) [27]. nine different promoters, each with a unique 59exon which is Misexpression of miRNA genes has been seen in both benign alternatively spliced to the remaining exons 2 through 9 resulting and malignant cancer and miRNA genes can act as either tumor in several different Mitf isoforms [reviewed in 1]. At the protein suppressors or oncogenes as is seen for the role of coding genes in level, MITF is modified post-transcriptionally and has been shown cancer progression. Studies have shown that miRNA expression to be phosphorylated at multiple sites leading to either increase in differs between melanoma cell lines [28] and that miRNA transcriptional activation or decrease in protein stability expression profiles can be used to classify solid tumors in terms [14,15,16,17]. In addition, ubiquitination marks MITF for of their differentiation stage and developmental lineage [29]. In an degradaton [18] and sumoylation has been shown to affect DNA extensive comparative study on miRNA expression in normal binding specificity [19,20]. melanocyte and melanoma cell lines derived from solid tumors In addition to its essential role in melanocyte development, and melanoma metastases, various miRNAs were found to be expression of Mitf and its target genes is seen in many melanoma differentially regulated in melanoma cells compared to normal

PLoS ONE | www.plosone.org 1 July 2010 | Volume 5 | Issue 7 | e11574

167 Mitf and miRNAs melanocytes [30]. Many had not been linked to cancer formation Medium from Invitrogen (Cat.no. 51985), according to the before. Other miRNAs had been shown to be oncogenic or to manufacturers protocol. Cells were grown in 96 well plates. In contain tumor suppressive potential in other types of cancer [30]. each well 10 ng vector DNA, 0.2 ng of Renilla luciferase DNA A few miRNAs have already been linked to Mitf expression. and an miRNA at either 0.1 pmol, 0.5 pmol or 1 pmol Bemis et al. (2008) showed that miR-137 downregulates MITF in concentration were co-transfected. A negative control was melanoma cells [31]. In addition, it has been shown that miR-182 included in all co-transfections. For co-tranfection with the targets Mitf 39UTR sequence in the retina [32], and recently mutated 39UTR clones we analysed the highest concentration in Segura et al. (2009) showed that miR-182 promotes migration and each case, or 1 pmol miRNA. miRNA inhibitors were transfected survival of melanoma cells by downregulating Mitf expression [33]. at concentration of 1 pmol miRNA. Transfected cells were Here we study miRNAs with conserved binding sites in the Mitf incubated for 48 hrs. at 37uC with 5% CO2 before luciferase 39UTR sequence and characterize their effects on Mitf using a expression was measured. Experiments were repeated three times reporter construct. Effects on the endogenous human MITF gene in 6 replicates, except experiments when two different miRNAs were also determined in melanoma cells. Our results show that were co-transfected simultaneously which was done only once in miRNAs play an important role in regulating MITF mRNA in six replicates. melanoma through conserved sites in the 39UTR. Luciferase measurements Materials and Methods The Dual Luciferase Reporter Assay System from Promega was used to measure luciferase expression on a Wallac Victor 2 1420 PCR amplification of the 39UTR sequence of Mitf Multilabel counter. A reporter gene construct was generated which contains the mouse Mitf-39UTR sequence downstream of the luciferase reporter gene. The construct was termed mouseMitf-39UTR- Mutagenesis luciferase. To do this, the 39UTR sequence of the mouse Mitf gene Locations of miRNA binding sites were determined using the (which is contained in a single exon) was amplified from BAC mRNA sequence of mouse Mitf 39UTR and are numbered starting clone rpci-23-9a13t7 using Pfu polymerase and the primers at the first nucleotide after the stop codon. Quikchange Lightning 3UTRSacI-Forw: 59-gag ctc cga gcc tgc ctt gct ctg-39 and Site-directed Mutagenesis Kit from Stratagene (Cat.no.#10518) 3UTRNheI-Rev: 59-gct agc atg tga aaa acc aaa tgc ttt aat ga-39. was used to mutate the miRNA binding sites in the mouse Mitf The primers included new restriction sites, SacI at the 59end and 39UTR sequence. Primers were designed using the Primerdesign NheI at the 39end (underlined bases). The restriction sites were program from Promega (Table 1). In order to avoid the possibility used for cloning into the Pis0 vector, a Firefly luciferase vector, that the mutated sequence itself forms a microRNA target, the modified from the PGL3 Control Vector from Promega by adding corresponding ‘‘new’’ seed region was used to search for predicted restriction sites to the 39end. The Pis0 vector was purchased from targets of novel small RNAs in TargetscanCustom 4.2. (http:// Addgene Inc. Cambridge, MA, USA (Addgene plasmid 12178) www.targetscan.org/vert_42/seedmatch.html). [34]. Site directed mutagenesis was used to alter the miRNA target sites using the mouseMitf-39UTR-luciferase clone as a template. Transfection of miRNAs into MeWo cells Cells were plated at 1.4226105 density on 6 well plates. The MicroRNA molecules following day, 20 pmol miRNA or 20 pmol miRNA together with MicroRNAs used in this study were purchased from Ambion, 20 pmol of the anti-miRNA were transfected in triplicate with Inc. and are the following: hsa-miR-27a (Product ID:PM10939), Lipofectamin 2000 and total RNA isolated for qRT-PCR analysis hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product 48 hrs. post transfection. Subsequently, proteins were extracted ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu- and analyzed. miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. (Product ID:PM11090), Pre-miR- RNA extraction and cDNA synthesis neg#2 (Cat. no. AM17111), Cy3-labeled Pre-miR Negative Total RNA was extracted from MeWo cells using TRIzol Control#1 (Cat. no. AM17120). Reagent (Invitrogen), according to the manufacturers protocol [35]. RNA quantity was measured using Nanodrop Spectropho- MicroRNA inhibitors tometer ND-1000 and RNA integrity was determined using anti-microRNA where purchased from Ambion and are the Agilent 2100 Bioanalyzer. RNA Integrity number was above 7.6 following: anti-miR-137 (Product ID: AM10513) and anti-miR- in all cases. RNA was treated with DNAseI and purified with the 148 (Product ID: AM10263). RNEasy Minelute kit from Qiagen. Purified RNA (1 mg in 10 ml reaction) was used for cDNA synthesis with Superscript III RT Cell culture conditions (200 U/ml), and anchored Oligo(dT)20 primer according to the Human embryonic kidney cells (HEK293) were cultured in manufacturers protocol. The RNA samples were tested for DMEM medium with 10% FBS, penicillin-streptomycin (50 U/ absence of inhibitors using the SPUD assay - no inhibitors were ml) and 2 mM glutamine. 501mel melanoma cells were cultured in detected [36]. RPMI medium with 10% FBS and penicillin-streptomycin (50 U/ ml). MeWo melanoma cells were cultured in DMEM medium Quantitative reverse transcription PCR with 7% FBS, penicillin-streptomycin (50 U/ml) and 2 mM Human MITF mRNA was measured in total RNA samples glutamine. Cells were grown at 37uC with 5% CO2. extracted from MeWo cells, using the human MITF FAM-labelled TaqMan Gene Expression Assay (hs01115560) (Applied Biosys- Co-transfection tems). Samples were measured in triplicate. Two controls were DNA and miRNAs were co-transfected into HEK293 and included, one without RT and the other without template. 501mel cells with Lipofectamine 2000 from Invitrogen (Cat Standard conditions for TaqMan reagents were used. The results no. 11668-019) in Optimem I + Glutamax-I Reduced Serum were normalized to total RNA (Log250). b-actin was used as a

PLoS ONE | www.plosone.org 2 July 2010 | Volume 5 | Issue 7 | e11574

168 Mitf and miRNAs

Table 1. Primers used for mutagenesis.

Primer name Sequence

miR-124 (548-554)F 59-ggcaatttcctggtactcgggcccagacacagtgccc-39 miR-124 (548-554)R 59-gggcactgtgtctgggcccgagtaccaggaaattgcc-39 miR-124 (1639-1646)F 59-gcataccctttcagaatgaagccgggccaaaatctcagcagtctc-39 miR-124 (1639-1646)R 59- gagactgctgagattttggcccggcttcattctgaaagggtatgc-39 miR-137 (2495-2501)F 59-gctgggagaggcaggccccgggcttagaggtgacaacataggg-39 miR-137 (2495-2501)R 59-ccctatgttgtcacctctaagcccggggcctgcctctcccagc-39 miR-137 (2782-2788)F 59-gccaaaaactgtgccccgggcctggtcatacccagagcatgatgcag-39 miR-137 (2782-2788)R 59-ctgcatcatgctctgggtatgaccaggcccggggcacagtttttggc-39 miR-137 (2842-2848)F 59-ggttgtttgtaaacaataaccgggccagaataaacaaaatgcacagg-39 miR-137 (2842-2848)R 59-cctgtgcattttgtttattctggcccggttattgtttacaaacaacc-39 miR-137 (3061-3067)F 59-gccccccgctgttgggtacccgggccctttctgtatggtccgc-39 miR-137 (3061-3067)R 59-gcggaccatacagaaagggcccgggtacccaacagcggggggc-39 miR-148/152 (1674-1680)F 59-cagcagtctcttttggaccagcagcccctgaactgtaactaggag-39 miR-148/152 (1674-1680)R 59-ctcctagttacagttcaggggctgctggtccaaaagagactgctg-39 miR-148/152 (2931-2937)F 59-gttaatatttctgaaaaaaaaccgggccgggagaagttgatgttg-39 miR-148/152 (2931-2937)R 59-caacatcaacttctcccggcccggttttttttcagaaatattaac-39

Mutated bases are bold and underlined. doi:10.1371/journal.pone.0011574.t001 control for the miRNA inhibitor experiment. qRT-PCR results Results were analysed using the GenEx Std. 4.4.2. software from MultiD analyses AB (Sweden). The Mitf 39UTR sequence and potential microRNA binding sites Western blot The mouse and human Mitf 39UTR sequences are unusually Proteins were isolated from the phenol-ethanol supernatant long or over 3 kb in length. This is considerably larger than the after RNA and DNA had been isolated using the Trizol reagent average mouse and human 39UTR sequences which are 559 and (Invitrogen), according to the manufacturers protocol [35]. The 826 nucleotides, respectively [37]. The overall conservation of the proteins were separated on a 10% SDS-PAGE polyacrylamide gel. Mitf 39UTR sequence in 11 vertebrate species is 36% [38] which is The proteins were electroblotted onto a PVDF transfer membrane very high for a non-coding region. This suggests a functional (Thermo Scientific). The membrane was immunoblotted over- relevance of the 39UTR sequence of Mitf. Using the TargetScan night at 4uC with primary antibody, (C5 mouse-anti-Mitf program (www.targetscan.org), we identified several miRNA monoclonal antibody), in Tris-buffered saline with 5% milk. The binding sites located in the most conserved areas of the 39UTR C5 mouse-anti-Mitf monoclonal antibody is raised against the N- region. We tested the effects of microRNAs which have conserved terminus of MITF. This antibody detects all isoforms of MITF and binding sites in the 39UTR region of Mitf, including miR-27a does not differentiate between them. A horse-radish peroxidase (located at 229–235 in the mouse Mitf 39UTR sequence), miR-25/ labelled anti-mouse secondary antibody (Jackson) was incubated 32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR- with the membrane for 1 hr. after washing with TBST. Signals 124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931– were detected with ECL reagent from Thermo Scientific. 2937) (Fig. 1A and 1B). miR-124/506 also has a less conserved binding site at 548–554, and was therefore also tested in our study. Endogenous miRNA expression In addition, the potential binding sites for miR-137 were tested as Total RNA was isolated from MeWo, 501mel and HEK293 the mouse and human Mitf 39UTR sequences both contain two cells as before and samples in triplicate were sent to Exiqon for well conserved miR-137 binding sites located in close proximity to analysis using the miRCURY LNA microRNA PCR system. PCR each other, 137C (2842–2848) and 137D (3061–3067). Two assays for hsa-miR-137 (MIMAT0000429), hsa-miR-124 (MI- additional less conserved miR-137 binding sites were found, one MAT0000422), hsa-miR-506 (MIMAT0002878), hsa-miR-148a only in the mouse 39UTR, namely 137A (2495–2501) and one (MIMAT0000243), hsa-miR-148b (MIMAT0000759) and hsa- conserved in the mouse and rat 39UTR sequences, 137B (2782– miR-152 (MIMAT0000438) were used to measure endogenous 2788). It has been shown that single miRNAs with multiple miRNA expression. binding sites in a 39UTR sequence have increased effects as compared to miRNAs with only a single binding site [39,40]. This Statistical analysis is also true when the binding sites are located in close proximity to T-test analysis (for independent groups) was performed on each other [41]. In some cases, several different miRNA molecules results from the luciferase assays, qRT-PCR results from can potentially bind to the same binding site. In these cases only transfection in MeWo cells and endogenous miRNA expression one representative miRNA molecule was chosen to test the analysis. functionality of that specific binding site. If the representative

PLoS ONE | www.plosone.org 3 July 2010 | Volume 5 | Issue 7 | e11574

169 Mitf and miRNAs

Figure 1. Schematic presentation of the mouse Mitf -39UTR sequence. A. The line indicates the 39 UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, miR-137 and miR-101/ 144 in the mMitf 39UTR sequence are indicated below the line and potential PAS sites above. Positions are based on the mouse Mitf 39UTR sequence and are numbered starting at the first nucleotide after the stop codon. Black bars: miR-124/506 binding sites, dark grey bars: miR-137 binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. B. The conservation of potential miRNA

PLoS ONE | www.plosone.org 4 July 2010 | Volume 5 | Issue 7 | e11574

170 Mitf and miRNAs

binding sites in the Mitf 39UTR sequence. Dots represent a conserved base, short lines represent absence of a sequence at this location. C. Mutations made in the Mitf 39UTR sequence. The wild type mouse Mitf mRNA sequence is shown with potential binding sites indicated in red. The mature miRNA sequence and potential binding between the miRNA seed region to the 39UTR sequence are shown and mutated bases are indicated above the mRNA sequence. doi:10.1371/journal.pone.0011574.g001 miRNA was able to downregulate via the binding site, it indicates 137 were combined, the same effect was observed as when miR- that the other potential miRNAs may also be able to regulate Mitf 137 was transfected alone (Fig. 2C). Other combinations of two expression. miR-182 has been shown previously to target the miRNAs did not show increased effects. Thus, we detect no 39UTR of Mitf and was used as a positive control [32]. cooperation among the miRNA molecules with respect to effects on Mitf. miR-148/152 affects mMitf RNA in melanoma cells To test the functionality of the miRNA binding sites, the mouse Roles of individual miRNA target sites revealed through Mitf 39UTR sequence was cloned downstream of a luciferase mutagenesis reporter gene. This vector was then co-transfected into cells To confirm that the miRNAs which show effects on the together with single miRNA molecules and effects of the specific mouseMitf-39UTR-luciferase reporter are in fact operating miRNAs on expression determined by measuring luciferase through the predicted potential binding sites, the miRNA binding activity. In 501mel cells, miR-148 had significant effects on sites were mutated in the mouseMitf-39UTR-luciferase vector and expression of the mouseMitf-39UTR-luciferase reporter (Fig. 2A). the vector then co-transfected into cells together with the specific Co-transfection with miR-101 resulted in some downregulation of miRNAs, as before. miRNAs bind to their 39UTR binding site the reporter whereas other miRNAs tested did not show through a seed region located at position 2–7 or 2–8 in the mature statistically significant effects compared to the mouseMitf- miRNA sequence [27,42]. We mutated all 7 bases in the 39UTR 39UTR-luciferase vector alone. When determining how effective binding site matching the seed region of the mature miRNAs in each miRNA was in our assay, the expression from the vector order to abolish completely the binding of the miRNA. In the case when co-transfected with the miRNA was compared to the of one of the miR-148 binding site, 148/152A, only 4 bases were expression from the vector alone. mutated as a clone with the fully mutated binding site was not generated successfully. The mutations are shown in Fig. 1C and miR-137 and miR-124/506 affect mMitf RNA in HEK293 the primers used for mutagenesis in Table 1. cells Role of the miR-148/152 target sites. There are two target The luciferase assay experiments were also performed in human sites for miR-148/152 in the mouse Mitf 39UTR sequence. Each embryonic kidney cells (HEK293), which do not express Mitf at of the two sites were mutated, 148/152A located at 1674–1680, significant levels. The effects of the miRNAs in HEK293 cells are and 148/152B located at 2931–2937 (Fig 1A). In these different from the effects seen in 501mel melanoma cells. In experiments, we define the expression level of the vector alone HEK293 cells the microRNA miR-137 negatively affected the as 100%. When determining how effective each mutation was in mouseMitf-39UTR-luciferase reporter construct, compared to the our assays, expression of luciferase from the mutated vector alone reporter construct alone (Fig. 2B). miR-148 affected the reporter was compared to expression from the mutated vector when co- only when transfected at the highest concentration (1pmol) transfected with the appropriate miRNA. When both binding sites (Fig. 2B). miR-124, however resulted in significant increase in were functional miR-148 downregulated reporter gene expression reporter gene expression. The other miRNAs tested, miR-27, to 50–60% compared to expression from the vector alone in miR-32 and miR-101 did not show significant effects on luciferase 501mel cells (p = 0.0140) (Fig. 3A). When the 148/152A binding expression in this assay (Fig. 2B). This is surprising as the binding site was mutated, miR-148 downregulated reporter gene sites for these three miRNAs are very well conserved. All Mitf expression to 47% (p = 0.0049). However, when the 148/152B 39UTR sequences in 11 vertebrate species analysed contain the binding site was mutated, miR-148 was no longer able to miR-27, miR-25/32/92/363/367 and the miR-101/144 binding downregulate reporter gene expression (p = 0.3929). When both sites (Fig. 1B). In addition, seven species contain a conserved binding sites were mutated, reporter gene expression was the same second miR-101/144 binding site. Despite this conservation, these as when 148/152B was mutated (118%, p = 0.4918). These results sites do not seem to be regulated by miRNAs in our assays. indicate that miR-148 is able to downregulate Mitf expression by The different results in melanoma cells as compared to binding to the 148/152B binding site. HEK293 cells might be explained by different levels of Role of the miR-137 target sites. The four target sites for endogenous miRNA expression in these cell types. If one of the miR-137 in the Mitf 39UTR sequence, 137A (2495–2501), 137B miRNAs tested has high endogenous expression in one of the cell (2782–2788), 137C (2842–2848) and 137D (3061–3067) were types it would affect the expression of the reporter alone. Adding mutated seperatly. In addition, a double mutant was created more of the miRNA would presumably not make a major where the most conserved sites 137C and 137D were changed difference. Thus, the effects of the transfected miRNA would be simultaneously, a triple mutant with 137B, 137C and 137D masked by the endogenous expression of the miRNA. mutated and a mutant where all four potential binding sites were Many different miRNAs can bind simultaneously to a specific changed (Fig. 1C). The mutated mouseMitf-39UTR-luciferase 39UTR sequence and affect expression. Thus, we tested if constructs were co-transfected together with the miRNAs in transfecting two different miRNAs simultaneously would reveal HEK293 cells. When all the miR-137 binding sites are functional, additive effects. The results are compared to expression by the miR-137 reduced expression from the luciferase reporter to only mouseMitf-39UTR-luciferase reporter alone. When miR-137 was 10% (p = 0.0015) compared to the vector alone (Fig. 3B). combined with other miRNAs, the effects were always equal to the When miR-137 was co-transfected with a reporter construct effects observed with miR-137 alone. Also, when miR-124 was containing the mutant site 137A, expression from the luciferase combined with other miRNAs, the effects were always equal to the reporter was 7% compared to the vector alone (p,0.0001). This is effects observed with miR-124 alone. When miR-124 and miR- similar reduction as was seen with the wild type construct,

PLoS ONE | www.plosone.org 5 July 2010 | Volume 5 | Issue 7 | e11574

171 Mitf and miRNAs

PLoS ONE | www.plosone.org 6 July 2010 | Volume 5 | Issue 7 | e11574

172 Mitf and miRNAs

Figure 2. Effects of microRNAs on the Mitf-39UTR-luciferase reporter. A. Effects of miRNAs on the mouseMitf-39UTR-luciferase reporter in 501melanoma cells. Three concentrations of miRNAs were tested: 0.1 pmol, 0.5 pmol and 1 pmol. Results in all panels are presented as mean values 6SD. Difference between the mouseMitf- 39UTR-luciferase vector with and without co-transfected miRNA was considered statistically significant when p,0.05, shown with an asterisk (T-test, 95% confidence level). P-values are presented in Table S1. B. Effects of miRNAs on the mouseMitf- 39UTR-luciferase vector in HEK293 cells. Three concentrations of miRNAs were tested: 0.1 pmol, 0.5 pmol and 1 pmol. C. Effects of miRNAs when transfected in combination with another miRNA on the reporter. Concentration of each miRNA is 0.5 pmol. doi:10.1371/journal.pone.0011574.g002 suggesting that this site has no role in the response to miR-137 binding sites were mutated, miR-124 did not result in increased (Fig. 3B). Mutating the 137B site resulted in 16% expression expression of the luciferase reporter, at least not as effectively as (p,0.0001) which is a little less reduction than was seen when all when both potential binding sites were functional (146% the potential binding sites were functional. When the more expression, p = 0.1864). These results suggest that miR-124 leads conserved site 137C was mutated, expression from the mouseMitf- to positive effects on the Mitf mRNA by binding to the 124/506A 39UTR-luciferase reporter was reduced to 19% (p = 0.0001) binding site. At present, it is not clear how miR-124 mediates this (Fig. 3B), indicating a functional role of miR-137C. Mutating upregulation. The effects of miR-506, that binds to the same target the other well conserved binding site 137D resulted in reduction to site, were not tested. 23% expression (p = 0.0001) of the mutated mouseMitf-39UTR- luciferase reporter (Fig. 3B), again indicating a functional target miR-148 and miR-137 affect expression of the site. When the two best conserved binding sites (137C and 137D) endogenous MITF were simultaneously mutated, reporter expression was 32% In order to test if these miRNAs affect the level of endogenous (p = 0.0001) compared to expression from the mutated vector MITF mRNA in melanoma cells, we used qRT-PCR to determine alone, suggesting that sites C and D play a major role in the MITF mRNA expression after transfecting MeWo melanoma cells response to miR-137. Surprisingly, when miR-137 was co- with the miRNAs miR-124, miR-137 and miR-148. MeWo cells transfected with a reporter construct lacking the 39UTR sequence express less MITF than the 501mel cells used previously. of Mitf, miR-137 downregulated luciferase expression to 27% Therefore, the difference in expression upon treatment was more (Fig. 3B). This suggests that the luciferase vector has binding sites easily detected with the amount of miRNA used. The results, for miR-137. Indeed, our search for miR-137 binding sites in the normalized to total RNA, are shown in Fig. 4A and confirm our luciferase gene itself resulted in 3 matching sequences. There are previous findings. When miR-137 was transfected into MeWo reports showing that binding sites within the coding regions of cells, the level of MITF mRNA was reduced to 68% (Cp value genes can result in effects on gene expression [43]. It is also 22.3, p = 0.0069) compared to 100% in untreated cells (No-miR, possible that the miR-137 is affecting other components (genes/ Cp value 21.7). Similarily, when miR-148 was transfected into transcripts) that are involved in the transcription of the luciferase these cells, MITF mRNA level was reduced to 48% (Cp value gene. Thus, when sites 137C and 137D were mutated simulta- 22.8, p = 0.0051) compared to untreated cells. Simultaneous neously, the expression of the reporter was reduced to 32% which transfection with miR-137 and miR-148 did not result in further is very similar to the level of expression when all miR-137 binding effects on MITF expression as it reduced expression to 67% (Cp sites are funcional (27%), suggesting that all the effects of miR-137 value 22.3, p = 0.0051), which is similar to the reduction seen with on the mouseMitf-39UTR-luciferase are mediated through these miR-137 alone (Fig. 4A). Thus, these miRNAs do not seem to two sites. When three or all four miR-137 binding sites were work synergistically in downregulating MITF. mutated simultaneously, the mutated vector alone was unable to Similar to what we observed using the luciferase-reporter assay, express the luciferase gene (data not shown). One possible miR-124 was able to upregulate MITF expression in the MeWo explanation for this might be that the structure of the 39UTR is cells. The expression was increased to 122% (Cp value 21.5) altered when 21 or 28 conserved bases are mutated, leading to compared to untreated cells; however, this difference is not reduced stability or effects on translation of the message. miR-137 statistically significant (p = 0.2228). The same experiment was has previously been shown to target Mitf by acting through the best performed once in 501mel cells, the only signifant downregulation conserved miR-137 target sites [31]. However, in that study, only was by miR-137 when compared to transfection with a scramble a portion of the Mitf 39UTR sequence was used in the analysis miRNA (data not shown). These results show that the miR-137 [31]. In our analysis, however, the entire 39UTR sequence from and miR-148 have the same effects on expression of the mouse Mitf (over 3 kb) was used to analyse the role of the binding endogenous MITF gene as seen using the luciferase reporter sites. This more closely resembles the endogenous situation. Our assay. The effects of miRNAs on MITF protein level were also results therefore confirm the role of miR-137 in regulating Mitf tested in MeWo cells and confirmed our previous findings (Fig. 4B). expression. When the cells were transfected with either miR-137, miR-148 or Role of the miR-124/506 target sites. There are two simultaneously with both miR-137 and miR-148, MITF protein binding sites for miR-124/506 in the mouse Mitf 39UTR levels were reduced. Also, when miR-124 was transfected, higher sequence. Site 124/506A is located at 548-554 and site 124/ MITF protein levels were observed (Fig. 4B). 506B at 1639-1646 in the mMitf 39UTR sequence. When both In order to test the specificity of the miRNAs, we used specific binding sites are functional, miR-124 positively affects luciferase anti-miRNAs to inhibit the effects of the miRNAs used in our expression up to 3 fold compared to expression from the vector experiments. Consistent with previous results, cells simultaneously alone in HEK293 cells (p = 0.0086) (Fig. 3C). We mutated each transfected with the luciferase vector construct, the miR-148 and target site alone and also made a double mutation changing both the anti-miR-148 showed that the anti-miR148 molecule effec- sites. When the 124/506A binding site was mutated, miR-124 no tively inhibited the effects of miR-148 (Fig. 5A). Similarly, the longer affected expression of the reporter gene. The expression effects of miR-137 and miR-148 on endogenous MITF mRNAs was only 81% compared to 315% in the vector alone (P = 0.1376). are inhibited when MeWo cells were co-transfected with anti- When the 124/506B binding site was mutated, miR-124 still miRNAs (Fig. 5B). These results further verifies that the effects on upregulated lucifease expression to 240% (p = 0.0030). When both Mitf mRNA are specific to these microRNAs.

PLoS ONE | www.plosone.org 7 July 2010 | Volume 5 | Issue 7 | e11574

173 Mitf and miRNAs

PLoS ONE | www.plosone.org 8 July 2010 | Volume 5 | Issue 7 | e11574

174 Mitf and miRNAs

Figure 3. Mutating miRNA binding sites affects the Mitf mRNA. A. Effects of miR-148 on the mouseMitf-39UTR-luciferase reporter when the potential binding sites are mutated. Results in all panels are presented as mean values 6SD. Difference between the appropriate vector (labeled on the X-axis) with and without co-transfected miRNA was considered statistically significant when p,0.05, shown with an asterisk (T-test, 95% confidence level). P-values are presented in Table S1. B. Effects of miR-137 on the mouseMitf-39UTR-luciferase reporter when the potential binding sites are mutated. C. Effects of miR-124 on the mouseMitf-39UTR-luciferase reporter when the potential binding sites are mutated. doi:10.1371/journal.pone.0011574.g003

Endogenous miRNA expression miR-148 and miR-152. The microRNAs miR-148a and The expression of miRNAs 137, 124, 506, 148a, 148b and 152 miR-148b have similar expression levels in all the cell types tested. was determined in the HEK293, 501mel and MeWo cell lines. Expression in the melanoma cell lines 501mel and MeWo was The expression of the miRNAs was measured using the MiRcury around 1.5 fold less than expression in HEK293 cells (Fig. 6). LNA Universal RT microRNA PCR method. An RNA pool from Higher endogenous expression in HEK293 cells might explain 20 different tissues was used as a positive control and the results why transfected miR-148 had no effect on reporter gene were normalized to the expression of miR-16 and miR-103. Cp expression in HEK293 cells, except at the highest concentration. values (crossing point) are shown in Table 2. miR-148 affected reporter gene expression more significantly in

Figure 4. Effects of miRNAs on endogenous MITF. A. Expression of human MITF mRNA in MeWo cells transfected with miR-124, miR-137, miR- 148 or miR-137 and miR-148 combined. The figure shows average expression levels of three replicates for each sample relative to untreated cells (No- miR). Negative control is a scramble miRNA sequence (scramble). Statistically significant difference between untreated cells and treated cells are shown with an asterisk (T-test, 95% confidence level). P-values are: Scramble = 0.0396; miR-124 = 0.2228; miR-137 = 0.0069; miR-148 = 0.0051; miR- 137+148 = 0.0051. B. Western blot analysis on MITF protein levels in MeWo cells, when transfected with miR-124, miR-137, miR-148 or miR-137 and miR-148 combined. doi:10.1371/journal.pone.0011574.g004

PLoS ONE | www.plosone.org 9 July 2010 | Volume 5 | Issue 7 | e11574

175 Mitf and miRNAs

Figure 5. Inhibiting the miRNAs blocks their effect. A. Co-transfection of anti-miR-148 and miR-148 simultaneously with the Mitf-39UTR- luciferase vector inhibits the effect of miR-148. Results are presented as mean values 6SD. Expression levels were compared to a sample where no microRNAs were added (No-miR) and were considered statistically significant when p,0.05, shown with an asterisk (T-test, 95% confidence level). The p-values are; miR-neg = 0.14 miR-148 = 0.007, miR-148+anti-miR-148 = 0.119. B. Transfecting miRNAs and anti-miRNAs blocked the effect of the miRNAs on endogenous human MITF mRNA levels in MeWo cells. P-values when compared to the no-miR sample are: Neg control = 0.064, miR- 137 = 0.006, miR-137 + anti-miR-137 = 0.854, miR-148 = 0.004, miR-148 + anti-miR-148 = 0.632. doi:10.1371/journal.pone.0011574.g005

501mel cells. Expression of miR-152 in 501mel was 2.7 fold lower MeWo cells but at a lower level than in 501mel cells which is than in HEK293 cells and was much lower then the expression of consistent with the expression of miR-137 in MeWo cells and its miR-148a and miR-148b in all cell types (see Table 2). Low absence in 501mel cells. miR-137 affected reporter gene expression of miR-148a, 148b and 152 in the melanoma cell lines expression in HEK293 cells, which is in line with the absence of is therefore consistent with the relatively high level of MITF endogenous miR-137 in this cell type. It is unclear why transfected expression in these cells. miR-137 did not affect reporter gene expression in 501mel cells miR-137. Endogenous miR-137 was only detected in MeWo where endogenous miR-137 was not detected. The absence of cells, not in HEK293, 501mel or the positive control. Expression miR-137 in 501mel cells might be explained by mutations in the in the MeWo cells, although at rather low levels (average Cp value miR-137 gene itself as has been shown to be the case in other 34.7 compared to the controls (miR-16 and 103) at 25.9 and 27.8 melanoma cells [31], thus allowing high levels of MITF expression. respectively), indicates possible involvement in regulating the miR-124 and miR-506. The level of miR-124 expression was endogenous levels of MITF in this cell type. MITF is expressed in considered to be too low to be detected in all cell types. We

PLoS ONE | www.plosone.org 10 July 2010 | Volume 5 | Issue 7 | e11574

176 Mitf and miRNAs

tested, miR-27 and miR-25/32/92/363/367 have highly con- Table 2. Cp values for determining endogenous miRNA served binding sites but did not have an effect on reporter gene expression. expression in HEK293 or 501mel cells. The microRNA miR-101 has a highly conserved binding site but did not affect reporter gene Positive expression in HEK293 cells. However in 501mel cells, miR-101 miRNA HEK293 501mel MeWo contr. downregulated reporter gene expression at the two highest concentrations used suggesting that it may play a role in miR-137 ND (1/9) ND (0/9) 34.69 (7/9) 37.39 (1/3) melanocytes or melanoma cells. miR-124 34.37 (9/9) 34.73 (5/9) 35.09 (2/9) 32.68 (3/3) The roles of miR-137 and miR-148 were analysed further by miR-506 35.19 (2/9) 34.73 (3/9) 32.87 (9/9) ND (0/9) mutating the binding sites in the mouseMitf-39UTR-luciferase miR-148a 27.90 (9/9) 28.29 (9/9) 28.82 (9/9) 33.12 (3/3) reporter construct. The results of this analysis suggest direct effects miR-148b 28.37 (9/9) 28.65 (9/9) 29.37 (9/9) 35.19 (1/3) on the Mitf mRNA. When the 148/152B binding sites were mutated, the effects of miR-148 were eliminated. When the most miR-152 34.08 (9/9) 35.12 (9/9) 34.26 (9/9) 35.05 (2/3) conserved binding sites for miR-137 (137C and D) were mutated, miR-16 contr. 26.19 (9/9) 25.72 (9/9) 25.92 (9/9) 31.83 (3/3) the effects of miR-137 were eliminated. None of the miR-137- miR-103 contr. 27.07 (9/9) 26.76 (9/9) 27.81 (9/9) 33.09 (3/3) mutations restore luciferase expression to the level observed with the negative control. This might indicate that all the miR-137 Cp values for average normalised values are shown for each miRNA tested in HEK293, 501mel and MeWo cells as well as the positive control. Each assay was binding sites contribute to the regulation of Mitf. However, it preformed in triplicate for three RNA samples from each cell type. The number should be noted that miR-137 can target the luciferase construct of samples that each miRNA was detected in, is shown in parenthesis. ND = not lacking the 39UTR sequence such that in the presence of miR-137, detected. luciferase expression cannot reach the same level of expression as doi:10.1371/journal.pone.0011574.t002 is seen with the negative control (miR-neg#2). The effects of the miRNAs were further confirmed by therefore can not definitely conclude anything about the transfecting the microRNAs into MeWo melanoma cells and then expression of miR-124 in our samples. miR-506 was detected in measuring the endogenous MITF mRNA and protein levels. miR- 501mel and MeWo cells. The expression level was higher in 137 and miR-148 both led to reduced levels of MITF mRNA and MeWo cells (Cp value 32.9) compared to 501mel cells (Cp value protein. Simultaneous transfection with anti-miR-148 blocked the 34.7). Lower expression in 501mel might be a factor allowing a effect of miR-148 in both the luciferase reporter assays and on the high level of MITF expression in this melanoma cell type. endogenous MITF mRNA. Transfection with anti-miR-137 similarly blocked the effects of miR-137 on the endogenous MITF Discussion mRNA (Fig. 5B). miR-137 did not significantly affect the luciferase reporter in melanoma cells. However, simultaneous transfection of We have tested the role of six different miRNAs with conserved anti-miR-137 and miR-137 with the Mitf-39UTR luciferase in potential binding sites in the Mitf 39UTR sequence for their ability MeWo cells blocked the effect of miR-137 (data not shown). to affect Mitf mRNA expression. We show that miR-137 and miR- Combining both miR-137 and miR-148 did not result in added 148 negatively affect Mitf mRNA in melanoma cells through effects on endogenous MITF mRNA levels. Possible explanations conserved binding sites in the 39UTR sequence. Other miRNAs for this might be that the maximum effects are reached with one of

Figure 6. Endogenous miRNA expression. Expression of endogenous miRNAs miR-148a, miR-148b and miR-152 in HEK293, 501mel and MeWo cells. The figure shows average expression levels of three replicates for each sample relative to HEK293 cells. Expression was normalized to miR-16 and miR-103. Statistically significant levels of expression in MeWo and 501mel compared to HEK293 (p,0.05) are shown with an asterisk. P-values are: miR-148a expression in 501mel = 0.0940 and in MeWo = 0.0148. miR-148b expression in 501mel = 0.0023 and in MeWo = 0.0065. miR-152 expression in 501mel = 0.0054 and in MeWo = 0.9316. doi:10.1371/journal.pone.0011574.g006

PLoS ONE | www.plosone.org 11 July 2010 | Volume 5 | Issue 7 | e11574

177 Mitf and miRNAs the miRNAs and adding another does not increase the effects. 124 is interesting considering its expression in the retina [54], as Another explanation for the lack of additive effects is that the Mitf plays an important role in eye development. Mitf is expressed miRNAs might not be able to bind simultaneously to the 39UTR in the retina early in development and is later downregulated in sequences. The 137C, 137D and 148/152B binding sites are all this tissue [55,56,57]. The mechanisms that mediate this located in close proximity to each other in the Mitf-39UTR downregulation have not been described and may involve miR- sequence (Fig. 1A). Accessibility might be limited by one of the 124. However, our results show upregulation by miR-124 in miRNAs. A third possibility is that specific binding proteins block melanoma cells, rather than downregulation. The possible role of the other sites when one is occupied. Specific RNA binding miR-124 in regulating the expression of Mitf during eye proteins have been show to block the binding of miRNAs to the development needs to be tested further. Although miRNAs are MITF mRNA [44]. The fact that miR-137 has an effect in MeWo better known for downregulating target genes, there have been cells (q-RT-PCR) and not in 501mel cells might be due to the fact reports on effects through upregulation by miRNAs by binding to that MITF mRNA levels are higher in 501mel cells than in MeWo their promoter region [58,59]. However, this is unlikely to play a cells. Thus, more miR-137 might be needed in 501mel cells then role in regulating Mitf mRNA through effects on the 39UTR since in MeWo cells. The effects of miR-137 and miR-148 when our reporter construct only contained 39UTR sequences. transfected seperatly, are blocked when the cells are transfected It has been shown that two thirds of genes targeted by miRNA with miR-137 and miR-148 inhibitors. miR-124 resulted in have alternative 39UTRs. The microRNAs miR-137 and miR-148 increased luciferase expression as seen using the reporter gene have many other potential target genes according to online construct in HEK293 cells. Furthermore, we observed upregula- prediction programs (Targetscan). In humans, miR-137 has 857 tion of the endogenous MITF in MeWo cells at both mRNA and conserved targets, with a total of 949 conserved sites and 120 protein levels; the upregulation of MITF mRNA was not poorly conserved sites. miR-148 has 536 conserved targets, with a statistically significant. The effects of miR-124 might be an artifact total of 581 conserved sites and 134 poorly conserved sites. Of of the reporter system. The effects on endogenous MITF could not these potential target genes, 66 are common targets of both miR- be measured in HEK293 cells as there is no endogenous MITF 137 and miR-148. It is therefore unlikely that these miRNAs expression in those cells. exclusively affect Mitf expression. As mentioned earlier, miR-137 has previously been shown to As miRNA binding sites are often located close to polyadenyl- target MITF in melanoma cells [31]. Interestingly, searching for ation signals (PAS) [60], shortening of the 39UTRs may lead to loss miR-137 binding sites within the Mitf 39UTR sequence of 11 of miRNA binding sequences and thus loss of microRNA- vertebrate species revealed that all species have at least two miR- mediated regulation. The mouse Mitf 39UTR sequence contains 137 binding sites and some species have three or four binding sites. twelve potential PAS sequences (two are AAUAAA, four All species contain either 137C or 137D and nine contain them AUUAAA, four AAGAAA and two UAUAAA, there is no both (data not shown). miR-137 expression has been shown to be AGUAAA sequence). Comparing these potential PAS sites in the affected in cancer. It is silenced by DNA methylation in colorectal 39UTR sequences of Mitf from 11 vertebrate species revealed a cancer [45] and oral carcinogenesis [46], suggesting tumor well conserved PAS located at 2837-2842, adjacent to the miR- suppressor abilities. In addition, both miR-137 and miR-124 137 C binding site (Fig. 1A). Ten species contain a PAS at this induced differentiation of adult mouse neural stem cells and were location. The PAS located closest to the 39end is conserved in all able to induce cell cycle arrest of glioblastoma multiforme cells species and represents the signal for the longest mRNA version. [47]. Upregulation of miR-137 in lymph node metastasis in colon Several other PAS’s are well conserved whereas others are less cancer has also been observed [48]. conserved. miRNAs can have an impact on cancer progression in The 39UTR sequences of Mitf in 11 vertebrate species all several ways, including loss of expression of a tumor-suppressor contain the two conserved miR-148/152 binding sites. In six miRNA gene and over-activation of an oncogenic miRNA. Loss of vertebrate species there is an additional conserved binding site miRNA binding sites in 39UTR sequences of the target genes (data not shown). It has not been shown previously that miR-148 caused by mutations or translocations are also possible. Shortening and/or miR-152 can target Mitf. However, both miRNAs have of the 39UTR sequence, and therefore loss of miRNA binding been shown to be downregulated in melanoma cells [30]. sites, can lead to oncogenic activation [61]. The conservation of Microarray analysis revealed that miR-148b is downregulated in several of the alternative polyadenylation signals found in the early melanoma progression, although it was not confirmed using 39UTR sequences of Mitf suggests their significance. Thus, Mitf qRT-PCR [30]. Similarly, miR-152 was shown to be downreg- might be able to evade miRNA-mediated regulation using the ulated in a highly invasive melanoma cell line (Mel Im) [30]. Other alternative polyadenylation sites, thus leading to a shorter studies have suggested that miR-148 and miR-152 can play a role transcript lacking the miRNA binding sequences. It was recently as tumor suppressors. miR-148 expression has been shown to be shown that MITF mRNAs with shorter 39UTR sequences are downregulated in tissue samples from undifferentiated gastric more abundant in melanoma cell lines than transcripts with full- cancer compared to normal tissue [49]. Similarly, hypermethyla- length 39UTR sequences [44]. In this case the miR-340 is involved tion of the miR-148, 124a3 and miR-152 genes was found in 34- in regulating the shorter transcript and, interestingly, the RNA 86% of primary human breast cancer specimens [50]. binding protein CRD-BP prevents binding of the miRNA. Thus, The binding sites for microRNAs miR-124/506 are very well in the case of MITF, microRNAs do not act alone in mediating conserved in the Mitf 39UTR sequence. Ten vertebrate species regulation through the 39UTR sequences. Interestingly, the MITF contain both miR-124/506 binding site; the Loxodonta africana protein has been shown to bind to the promoter of miR-148b that sequence only contains 124/506B. It has not been shown is shown there to have functional target site within the Mitf 39UTR previously that miR-124 and/or miR-506 can affect Mitf mRNA. sequence [62]. This indicates a possible negative feedback loop However, miR-506 was shown to be upregulated in early where higher amounts of MITF would lead to more miR-148 melanoma progression and downregulated later in metastatic expression which in turn adjusts MITF protein at desirable levels. melanoma [30] and may therefore play an important role in this It is clear that miRNA function is diverse and its role in cancer cell type. miR-124 is predominantly expressed in the brain, and other disease is complex. Some miRNAs seem to have a specifically in differentiating and mature neurons [51,52,53]. miR- tissue-specific function like miR-124 in neurons wheras other

PLoS ONE | www.plosone.org 12 July 2010 | Volume 5 | Issue 7 | e11574

178 Mitf and miRNAs miRNAs are found more universally. Mitf functions in diverse cell Found at: doi:10.1371/journal.pone.0011574.s001 (0.02 MB types and may therefore be regulated by different miRNAs in the PDF) different tissues. In melanoma cells, Mitf is regulated by miR-137 and miR-148/152. As MITF is a lineage survival oncogene in Acknowledgments melanoma [23] whose expression needs to be maintained at a certain level, it is likely that these miRNAs play an important role We thank Corine Bertolotto for kindly providing us with MeWo melanoma in regulating MITF mRNA levels in this cell type. Dysregulation of cells and Alexander Schepsky for comments on the manuscript. these microRNAs, or loss of the binding sites in the 39UTR, might lead to increased expression of Mitf, thus leading to differentiation Author Contributions and cell-cycle arrest. As the miRNAs involved may have Conceived and designed the experiments: BSH ES. Performed the significant therapeutic potential, it will be important to character- experiments: BSH KB CP. Analyzed the data: BSH. Wrote the paper: ize this regulation in more detail in further studies. BSH ES.

Supporting Information Table S1 P-values for data presented in Figures 2 and 3.

References 1. Steingrimsson E, Copeland NG, Jenkins NA (2004) Melanocytes and the 21. Vachtenheim J, Novotna H (1999) Expression of genes for microphthalmia microphthalmia transcription factor network. Annu Rev Genet 38: 365–411. isoforms, Pax3 and MSG1, in human melanomas. Cell Mol Biol (Noisy-le-grand) 2. Nishimura EK, Granter SR, Fisher DE (2005) Mechanisms of hair graying: 45: 1075–1082. incomplete melanocyte stem cell maintenance in the niche. Science 307: 22. Vachtenheim J, Novotna H, Ghanem G (2001) Transcriptional repression of the 720–724. microphthalmia gene in melanoma cells correlates with the unresponsiveness of 3. Hodgkinson CA, Moore KJ, Nakayama A, Steingrimsson E, Copeland NG, target genes to ectopic microphthalmia-associated transcription factor. J Invest et al. (1993) Mutations at the mouse microphthalmia locus are associated with Dermatol 117: 1505–1511. defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74: 23. Garraway LA, Widlund HR, Rubin MA, Getz G, Berger AJ, et al. (2005) 395–404. Integrative genomic analyses identify MITF as a lineage survival oncogene 4. Hughes MJ, Lingrel JB, Krakowsky JM, Anderson KP (1993) A helix-loop-helix amplified in malignant melanoma. Nature 436: 117–122. transcription factor-like gene is located at the mi locus. J Biol Chem 268: 24. Selzer E, Wacheck V, Lucas T, Heere-Ress E, Wu M, et al. (2002) The 20687–20690. melanocyte-specific isoform of the microphthalmia transcription factor affects 5. Hemesath TJ, Steingrimsson E, McGill G, Hansen MJ, Vaught J, et al. (1994) the phenotype of human melanoma. Cancer Res 62: 2098–2103. microphthalmia, a critical factor in melanocyte development, defines a discrete 25. Wellbrock C, Marais R (2005) Elevated expression of MITF counteracts B-RAF- transcription factor family. Genes Dev 8: 2770–2780. stimulated melanocyte and melanoma cell proliferation. J Cell Biol 170: 6. Yasumoto K, Yokoyama K, Shibata K, Tomita Y, Shibahara S (1994) 703–708. Microphthalmia-associated transcription factor as a regulator for melanocyte- 26. Mueller DW, Bosserhoff AK (2009) Role of miRNAs in the progression of specific transcription of the human tyrosinase gene. Mol Cell Biol 14: malignant melanoma. Br J Cancer 101: 551–556. 8058–8070. 27. Lewis BP, Burge CB, Bartel DP (2005) Conserved seed pairing, often flanked by 7. McGill GG, Horstmann M, Widlund HR, Du J, Motyckova G, et al. (2002) Bcl2 adenosines, indicates that thousands of human genes are microRNA targets. Cell regulation by the melanocyte master regulator Mitf modulates lineage survival 120: 15–20. and melanoma cell viability. Cell 109: 707–718. 28. Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, et al. (2007) 8. McGill GG, Haq R, Nishimura EK, Fisher DE (2006) c-Met expression is Characterization of microRNA expression levels and their biological correlates regulated by Mitf in the melanocyte lineage. J Biol Chem 281: 10365–10373. in human cancer cell lines. Cancer Res 67: 2456–2468. 9. Loercher AE, Tank EM, Delston RB, Harbour JW (2005) MITF links 29. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, et al. (2005) MicroRNA differentiation with cell cycle arrest in melanocytes by transcriptional activation expression profiles classify human cancers. Nature 435: 834–838. of INK4A. J Cell Biol 168: 35–40. 30. Mueller DW, Rehli M, Bosserhoff AK (2009) miRNA expression profiling in 10. Carreira S, Goodall J, Aksan I, La Rocca SA, Galibert MD, et al. (2005) Mitf melanocytes and melanoma cell lines reveals miRNAs associated with formation cooperates with Rb1 and activates p21Cip1 expression to regulate cell cycle and progression of malignant melanoma. J Invest Dermatol 129: 1740–1751. progression. Nature 433: 764–769. 31. Bemis LT, Chen R, Amato CM, Classen EH, Robinson SE, et al. (2008) 11. Carreira S, Goodall J, Denat L, Rodriguez M, Nuciforo P, et al. (2006) Mitf MicroRNA-137 targets microphthalmia-associated transcription factor in regulation of Dia1 controls melanoma proliferation and invasiveness. Genes Dev melanoma cell lines. Cancer Res 68: 1362–1368. 20: 3426–3439. 32. Xu S, Witmer PD, Lumayag S, Kovacs B, Valle D (2007) MicroRNA (miRNA) 12. Carreira S, Liu B, Goding CR (2000) The gene encoding the T-box factor Tbx2 transcriptome of mouse retina and identification of a sensory organ-specific is a target for the microphthalmia-associated transcription factor in melanocytes. miRNA cluster. J Biol Chem 282: 25053–25066. J Biol Chem 275: 21920–21927. 33. Segura MF, Hanniford D, Menendez S, Reavie L, Zou X, et al. (2009) Aberrant 13. Du J, Widlund HR, Horstmann MA, Ramaswamy S, Ross K, et al. (2004) miR-182 expression promotes melanoma metastasis by repressing FOXO3 and Critical role of CDK2 for melanoma growth linked to its melanocyte-specific microphthalmia-associated transcription factor. Proc Natl Acad Sci U S A 106: transcriptional regulation by MITF. Cancer Cell 6: 565–576. 1814–1819. 14. Hemesath TJ, Price ER, Takemoto C, Badalian T, Fisher DE (1998) MAP 34. Yekta S, Shih IH, Bartel DP (2004) MicroRNA-directed cleavage of HOXB8 kinase links the transcription factor Microphthalmia to c-Kit signalling in mRNA. Science 304: 594–596. melanocytes. Nature 391: 298–301. 35. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid 15. Wu M, Hemesath TJ, Takemoto CM, Horstmann MA, Wells AG, et al. (2000) guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: c-Kit triggers dual phosphorylations, which couple activation and degradation of 156–159. the essential melanocyte factor Mi. Genes Dev 14: 301–312. 36. Nolan T, Hands RE, Bustin SA (2006) Quantification of mRNA using real-time 16. Takeda K, Takemoto C, Kobayashi I, Watanabe A, Nobukuni Y, et al. (2000) RT-PCR. Nat Protoc 1: 1559–1582. Ser298 of MITF, a mutation site in Waardenburg syndrome type 2, is a 37. Wren JD, Forgacs E, Fondon JW, 3rd, Pertsemlidis A, Cheng SY, et al. (2000) phosphorylation site with functional significance. Hum Mol Genet 9: 125–132. Repeat polymorphisms within gene regions: phenotypic and evolutionary 17. Mansky KC, Sankar U, Han J, Ostrowski MC (2002) Microphthalmia implications. Am J Hum Genet 67: 345–356. transcription factor is a target of the p38 MAPK pathway in response to 38. Hallsson JH, Haflidadottir BS, Schepsky A, Arnheiter H, Steingrimsson E (2007) receptor activator of NF-kappa B ligand signaling. J Biol Chem 277: Evolutionary sequence comparison of the Mitf gene reveals novel conserved 11077–11083. domains. Pigment Cell Res 20: 185–200. 18. Xu W, Gong L, Haddad MM, Bischof O, Campisi J, et al. (2000) Regulation of 39. Vella MC, Choi EY, Lin SY, Reinert K, Slack FJ (2004) The C. elegans microphthalmia-associated transcription factor MITF protein levels by associ- microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 ation with the ubiquitin-conjugating enzyme hUBC9. Exp Cell Res 255: 39UTR. Genes Dev 18: 132–137. 135–143. 40. Doench JG, Sharp PA (2004) Specificity of microRNA target selection in 19. Miller AJ, Levy C, Davis IJ, Razin E, Fisher DE (2005) Sumoylation of MITF translational repression. Genes Dev 18: 504–511. and its related family members TFE3 and TFEB. J Biol Chem 280: 146–155. 41. Saetrom P, Heale BS, Snove O, Jr., Aagaard L, Alluin J, et al. (2007) Distance 20. Murakami H, Arnheiter H (2005) Sumoylation modulates transcriptional constraints between microRNA target sites dictate efficacy and cooperativity. activity of MITF in a promoter-specific manner. Pigment Cell Res 18: 265–277. Nucleic Acids Res 35: 2333–2342.

PLoS ONE | www.plosone.org 13 July 2010 | Volume 5 | Issue 7 | e11574

179 Mitf and miRNAs

42. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB (2003) Prediction 52. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, et al. (2005) of mammalian microRNA targets. Cell 115: 787–798. Microarray analysis shows that some microRNAs downregulate large numbers 43. Duursma AM, Kedde M, Schrier M, le Sage C, Agami R (2008) miR-148 of target mRNAs. Nature 433: 769–773. targets human DNMT3b protein coding region. RNA 14: 872–877. 53. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, et al. (2002) 44. Goswami S, Tarpore RS, Teslaa JJ, Grinblat Y, Setaluri V, et al. (2010) Identification of tissue-specific microRNAs from mouse. Curr Biol 12: 735–739. microRNA-340-mediated degradation of microphthalmia-associated transcrip- 54. Arora A, McKay GJ, Simpson DA (2007) Prediction and Verification of miRNA tion factor (MITF) mRNA is inhibited by coding region determinant binding Expression in Human and Rat Retinas. Invest Ophthalmol Vis Sci 48: protein (CRD-BP). J Biol Chem. 3962–3967. 45. Bandres E, Agirre X, Bitarte N, Ramirez N, Zarate R, et al. (2009) Epigenetic 55. Nguyen M, Arnheiter H (2000) Signaling and transcriptional regulation in early regulation of microRNA expression in colorectal cancer. Int J Cancer. mammalian eye development: a link between FGF and MITF. Development 46. Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J (2008) Exploration of tumor- 127: 3581–3591. suppressive microRNAs silenced by DNA hypermethylation in oral cancer. 56. Bora N, Conway SJ, Liang H, Smith SB (1998) Transient overexpression of the Cancer Res 68: 2094–2105. Microphthalmia gene in the eyes of Microphthalmia vitiligo mutant mice. Dev Dyn 213: 283–292. 47. Silber J, Lim DA, Petritsch C, Persson AI, Maunakea AK, et al. (2008) miR-124 57. Nakayama A, Nguyen MT, Chen CC, Opdecamp K, Hodgkinson CA, et al. and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce (1998) Mutations in microphthalmia, the mouse homolog of the human deafness differentiation of brain tumor stem cells. BMC Med 6: 14. gene MITF, affect neuroepithelial and neural crest-derived melanocytes 48. Huang ZM, Yang J, Shen XY, Zhang XY, Meng FS, et al. (2009) MicroRNA differently. Mech Dev 70: 155–166. expression profile in non-cancerous colonic tissue associated with lymph node 58. Janowski BA, Younger ST, Hardy DB, Ram R, Huffman KE, et al. (2007) metastasis of colon cancer. J Dig Dis 10: 188–194. Activating gene expression in mammalian cells with promoter-targeted duplex 49. Katada T, Ishiguro H, Kuwabara Y, Kimura M, Mitui A, et al. (2009) RNAs. Nat Chem Biol 3: 166–173. microRNA expression profile in undifferentiated gastric cancer. Int J Oncol 34: 59. Li LC, Okino ST, Zhao H, Pookot D, Place RF, et al. (2006) Small dsRNAs 537–542. induce transcriptional activation in human cells. Proc Natl Acad Sci U S A 103: 50. Lehmann U, Hasemeier B, Christgen M, Muller M, Romermann D, et al. 17337–17342. (2008) Epigenetic inactivation of microRNA gene hsa-mir-9-1 in human breast 60. Majoros WH, Ohler U (2007) Spatial preferences of microRNA targets in 39 cancer. J Pathol 214: 17–24. untranslated regions. BMC Genomics 8: 152. 51. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, et al. (2004) 61. Mayr C, Bartel DP (2009) Widespread shortening of 39UTRs by alternative Expression profiling of mammalian microRNAs uncovers a subset of brain- cleavage and polyadenylation activates oncogenes in cancer cells. Cell 138: expressed microRNAs with possible roles in murine and human neuronal 673–684. differentiation. Genome Biol 5: R13. 62. Ozsolak F, Poling LL, Wang Z, Liu H, Liu XS, et al. (2008) Chromatin structure analyses identify miRNA promoters. Genes Dev 22: 3172–3183.

PLoS ONE | www.plosone.org 14 July 2010 | Volume 5 | Issue 7 | e11574

180 Figure 2A. P-values miR-182 0,1 pmol = 0.7937; 0,5pmol = 0.2103; 1 pmol = 0.6109. miR-neg#1 0,1 pmol = 0.2123; 0,5pmol = 0.3279; 1 pmol = 0.4472. miR-27 0,1 pmol = 0.1583; 0,5 pmol = 0.0190; 1 pmol = 0.2792. miR-32 0,1 pmol = 0.4246; 0,5 pmol = 0.1268; 1 pmol = 0.1216. miR-101 0,1 pmol = 0.1646; 0,5 pmol = 0.0282; 1 pmol = 0.0147. miR-124 0,1 pmol = 0.5204; 0,5 pmol = 0.216; 1 pmol = 0.3813. miR-137 0,1 pmol = 0.2495; 0,5 pmol = 0.1241; 1 pmol =0.4852. miR-148 0,1 pmol = 0.0540; 0,5 pmol = 0.0037; 1 pmol = 0.0015. Figure 2B. P-values miR-182 0,1 pmol = 0.0047; 0,5 pmol = 0.0013 and 1 pmol = 0.0057. miR-27 0,1 pmol = 0.0041; 0,5 pmol = 0.2825 and 1 pmol = 0.1265. miR-32 0,1 pmol = 0,1293; 0,5 pmol = 0.0271; 1 pmol = 0.2190. miR-101 0,1 pmol = 0,838; 0,5 pmol = 0.8558; 1 pmol = 0.3407. miR-124 0,1 pmol = 0.0444; 0,5 pmol = 0.0001; 1 pmol = 0.0015. miR-137 0,1 pmol = 0.0002; 0,5 pmol = < 0.0001;1 pmol = 0.0001. miR-148 0,1 pmol = 0.8978; 0,5 pmol = 0.1053 and 1 pmol p-value= 0.0046. Figure 2C. P-values 124+27 <0.0001; 124+32 = 0.0002; 124+101 <0.0001; 124+137 = 0.0063; 124+148 = 0.0001; 124+182 = 0.0227; 137+27 = 0.0007; 137+32 <0.0001; 137+101 = 0.0016; 137+148 = 0.0013; 137+182 = 0.0008; 148+27 = 0.0005; 148+32= 0.0252; 148+101 = 0.1101; 148+182 = 0.2513; 27+32 = 0.2761; 27+101 = 0.2468; 27+182 = 0,4290; 32+101 = 0.3511; 32+182 = 0.6395; 101+182 = 0.0400. Figure 3A. P-values Luciferase (without the Mitf-3ÚTR sequence) + miR-148 = 0.3771. Mitf-3ÚTR-luciferase + miR-148 = 0.0140. Mitf-3ÚTR-luciferase + miR-neg#2 = 0.0829. Mitf-3ÚTR-luciferase + miR-182 = 0.6294. Mitf-3ÚTR-luciferase mut 148/152A + miR-148 = 0.0049. Mitf-3ÚTR-luciferase mut 148/152B + miR-148 = 0.3929. Mitf-3ÚTR-luciferase mut 148/152A+B + miR-148 = 0.4918. Figure 3B. P-values Luciferase (without the Mitf-3ÚTR sequence) + miR-137 = 0.0002. Mitf-3ÚTR-luciferase + miR-137 = 0.0015. Mitf-3ÚTR-luciferase + miR-neg#2 = 0.1071. Mitf-3ÚTR-luciferase + miR-182 = 0.0064. Mitf-3ÚTR-luciferase mut 137 A + miR-137 <0.0001. Mitf-3ÚTR-luciferase mut 137 B + miR-137 <0.0001. Mitf-3ÚTR-luciferase mut 137 C + miR-137 = 0.0001. Mitf-3ÚTR-luciferase mut 137 D + miR-137 = 0.0001. Mitf-3ÚTR-luciferase mut 137 C+D + miR-137 <0.0001. Figure 3C. P-values Luciferase (without the Mitf-3ÚTR sequence) + miR-124 = 0.0152. Mitf-3ÚTR-luciferase + miR-124 = 0.0086. Mitf-3ÚTR-luciferase + miR-neg#2 = 0.9666. Mitf-3ÚTR-luciferase + miR-182 = 0.0509. Mitf-3ÚTR-luciferase mut 124/506A + miR-124 = 0.1376. Mitf-3ÚTR-luciferase mut 124/506B + miR-124 = 0.0030. Mitf-3ÚTR-luciferase mut 124/506A+B + miR-124 = 0.1864.

181