Furine and Pyrimidine Enzymic Programs and Nucleotide Pattern in Sarcoma1
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Journal of Biotechnology 193 (2015) 37–40
Journal of Biotechnology 193 (2015) 37–40 Contents lists available at ScienceDirect Journal of Biotechnology j ournal homepage: www.elsevier.com/locate/jbiotec Short communication Blockage of the pyrimidine biosynthetic pathway affects riboflavin production in Ashbya gossypii 1 1 ∗ Rui Silva , Tatiana Q. Aguiar , Lucília Domingues CEB – Centre of Biological Engineering, University of Minho, 4710-057 Braga, Portugal a r t i c l e i n f o a b s t r a c t Article history: The Ashbya gossypii riboflavin biosynthetic pathway and its connection with the purine pathway have Received 10 September 2014 been well studied. However, the outcome of genetic alterations in the pyrimidine pathway on riboflavin Received in revised form 6 November 2014 production by A. gossypii had not yet been assessed. Here, we report that the blockage of the de novo Accepted 7 November 2014 pyrimidine biosynthetic pathway in the recently generated A. gossypii Agura3 uridine/uracil auxotrophic Available online 15 November 2014 strain led to improved riboflavin production on standard agar-solidified complex medium. When extra uridine/uracil was supplied, the production of riboflavin by this auxotroph was repressed. High concen- Keywords: trations of uracil hampered this (and the parent) strain growth, whereas excess uridine favored the A. Ashbya gossypii gossypii Agura3 growth. Considering that the riboflavin and the pyrimidine pathways share the same Pyrimidine pathway precursors and that riboflavin overproduction may be triggered by nutritional stress, we suggest that Riboflavin production Uridine/uracil auxotrophy overproduction of riboflavin by the A. gossypii Agura3 may occur as an outcome of a nutritional stress Nutritional stress response and/or of an increased availability in precursors for riboflavin biosynthesis, due to their reduced consumption by the pyrimidine pathway. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
DOI: 10.2478/V10129-011-0033-Y
PLANT BREEDING AND SEED SCIENCE Volume 64 2011 DOI: 10.2478/v10129-011-0033-y Wolfgang Schweiger 1,* , Barbara Steiner 2, Apinun Limmongkon 2, Kurt Brunner 3, Marc Lemmens 2, Franz Berthiller 4, Hermann Bürstmayr 2, Gerhard Adam 1 1Department of Applied Genetics and Cell Biology, University of Natural Resources and Applied Life Sciences, A-1190 Vienna, Austria; 2Institute of Biotechnology in Plant Production, Department of Agrobiotechnology, University of Natural Resources and Applied Life Sciences, A-3430 Tulln, Austria; 3Institute of Chemical Engineering, Vienna University of Technology, A-1060 Vienna, Austria; 4Center for Analytical Chemistry, Depart- ment of Agrobiotechnology, University of Natural Resources and Applied Life Sciences, A-3430 Tulln, Austria; * Author to whom correspondence should be addressed. e-mail: [email protected] ; CLONING AND HETEROLOGOUS EXPRESSION OF CANDIDATE DON-INACTIVATING UDP-GLUCOSYLTRANFERASES FROM RICE AND WHEAT IN YEAST ABSTRACT Fusarium graminearum and related species causing Fusarium head blight of cereals and ear rot of maize produce the trichothecene toxin and virulence factor deoxynivalenol (DON). Plants can detoxify DON to a variable extent into deoxynivalenol-3-O-glucoside (D3G). We have previously reported the DON inactivat- ing glucosyltransferase (UGT) AtUGT73C5 from Arabidopsis thaliana (Poppenberger et al , 2003). Our goal was to identify UGT genes from monocotyledonous crop plants with this enzymatic activity. The two selected rice candidate genes with the highest sequence similarity with AtUGT73C5 were expressed in a toxin sensitive yeast strain but failed to protect against DON. A full length cDNA clone corresponding to a transcript derived fragment (TDF108) from wheat, which was reported to be specifically expressed in wheat genotypes contain- ing the quantitative trait locus Qfhs.ndsu-3BS for Fusarium spreading resistance (Steiner et al , 2009) was reconstructed. -
Ijms-20-05263-V2
Delft University of Technology Leloir Glycosyltransferases in Applied Biocatalysis A Multidisciplinary Approach Mestrom, Luuk; Przypis, Marta; Kowalczykiewicz, Daria; Pollender, André; Kumpf, Antje; Marsden, Stefan R.; Szymańska, Katarzyna; Hanefeld, Ulf; Hagedoorn, Peter Leon; More Authors DOI 10.3390/ijms20215263 Publication date 2019 Document Version Final published version Published in International Journal of Molecular Sciences Citation (APA) Mestrom, L., Przypis, M., Kowalczykiewicz, D., Pollender, A., Kumpf, A., Marsden, S. R., Szymańska, K., Hanefeld, U., Hagedoorn, P. L., & More Authors (2019). Leloir Glycosyltransferases in Applied Biocatalysis: A Multidisciplinary Approach. International Journal of Molecular Sciences, 20(21), [5263]. https://doi.org/10.3390/ijms20215263 Important note To cite this publication, please use the final published version (if applicable). Please check the document version above. Copyright Other than for strictly personal use, it is not permitted to download, forward or distribute the text or part of it, without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license such as Creative Commons. Takedown policy Please contact us and provide details if you believe this document breaches copyrights. We will remove access to the work immediately and investigate your claim. This work is downloaded from Delft University of Technology. For technical reasons the number of authors shown on this cover page is limited to a maximum of 10. International Journal of Molecular Sciences Review Leloir Glycosyltransferases in Applied Biocatalysis: A Multidisciplinary Approach Luuk Mestrom 1, Marta Przypis 2,3 , Daria Kowalczykiewicz 2,3, André Pollender 4 , Antje Kumpf 4,5, Stefan R. Marsden 1, Isabel Bento 6, Andrzej B. -
Multi-Enzymatic Cascades in the Synthesis of Modified Nucleosides
biomolecules Article Multi-Enzymatic Cascades in the Synthesis of Modified Nucleosides: Comparison of the Thermophilic and Mesophilic Pathways Ilja V. Fateev , Maria A. Kostromina, Yuliya A. Abramchik, Barbara Z. Eletskaya , Olga O. Mikheeva, Dmitry D. Lukoshin, Evgeniy A. Zayats , Maria Ya. Berzina, Elena V. Dorofeeva, Alexander S. Paramonov , Alexey L. Kayushin, Irina D. Konstantinova * and Roman S. Esipov Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry RAS, Miklukho-Maklaya 16/10, 117997 GSP, B-437 Moscow, Russia; [email protected] (I.V.F.); [email protected] (M.A.K.); [email protected] (Y.A.A.); [email protected] (B.Z.E.); [email protected] (O.O.M.); [email protected] (D.D.L.); [email protected] (E.A.Z.); [email protected] (M.Y.B.); [email protected] (E.V.D.); [email protected] (A.S.P.); [email protected] (A.L.K.); [email protected] (R.S.E.) * Correspondence: [email protected]; Tel.: +7-905-791-1719 ! Abstract: A comparative study of the possibilities of using ribokinase phosphopentomutase ! nucleoside phosphorylase cascades in the synthesis of modified nucleosides was carried out. Citation: Fateev, I.V.; Kostromina, Recombinant phosphopentomutase from Thermus thermophilus HB27 was obtained for the first time: M.A.; Abramchik, Y.A.; Eletskaya, a strain producing a soluble form of the enzyme was created, and a method for its isolation and B.Z.; Mikheeva, O.O.; Lukoshin, D.D.; chromatographic purification was developed. It was shown that cascade syntheses of modified nu- Zayats, E.A.; Berzina, M.Y..; cleosides can be carried out both by the mesophilic and thermophilic routes from D-pentoses: ribose, Dorofeeva, E.V.; Paramonov, A.S.; 2-deoxyribose, arabinose, xylose, and 2-deoxy-2-fluoroarabinose. -
Leloir Glycosyltransferases in Applied Biocatalysis: a Multidisciplinary Approach
International Journal of Molecular Sciences Review Leloir Glycosyltransferases in Applied Biocatalysis: A Multidisciplinary Approach Luuk Mestrom 1, Marta Przypis 2,3 , Daria Kowalczykiewicz 2,3, André Pollender 4 , Antje Kumpf 4,5, Stefan R. Marsden 1, Isabel Bento 6, Andrzej B. Jarz˛ebski 7, Katarzyna Szyma ´nska 8, Arkadiusz Chru´sciel 9, Dirk Tischler 4,5 , Rob Schoevaart 10, Ulf Hanefeld 1 and Peter-Leon Hagedoorn 1,* 1 Department of Biotechnology, Delft University of Technology, Section Biocatalysis, Van der Maasweg 9, 2629 HZ Delft, The Netherlands; [email protected] (L.M.); [email protected] (S.R.M.); [email protected] (U.H.) 2 Department of Organic Chemistry, Bioorganic Chemistry and Biotechnology, Silesian University of Technology, B. Krzywoustego 4, 44-100 Gliwice, Poland; [email protected] (M.P.); [email protected] (D.K.) 3 Biotechnology Center, Silesian University of Technology, B. Krzywoustego 8, 44-100 Gliwice, Poland 4 Environmental Microbiology, Institute of Biosciences, TU Bergakademie Freiberg, Leipziger Str. 29, 09599 Freiberg, Germany; [email protected] (A.P.); [email protected] (A.K.); [email protected] (D.T.) 5 Microbial Biotechnology, Faculty of Biology & Biotechnology, Ruhr-Universität Bochum, Universitätsstr. 150, 44780 Bochum, Germany 6 EMBL Hamburg, Notkestraβe 85, 22607 Hamburg, Germany; [email protected] 7 Institute of Chemical Engineering, Polish Academy of Sciences, Bałtycka 5, 44-100 Gliwice, Poland; [email protected] 8 Department of Chemical and Process Engineering, Silesian University of Technology, Ks. M. Strzody 7, 44-100 Gliwice Poland.; [email protected] 9 MEXEO Wiesław Hreczuch, ul. -
Discontinuous Variability, in the Form of a Geometric Progression, Of
Proc. Nat. Acad. Sci. USA Vol. 71, No. 5, pp. 2062-2066, May 1974 Discontinuous Variability, in the Form of a Geometric Progression, of Albumin Production in Hepatoma and Hybrid Cells (reiterated genes/control of gene expression and differentiation) JERRY A. PETERSON* Centre de Gbnbtique Molkculaire, C.N.R.S., 91, Gif-sur-Yvette, France Communicated by Daniel Mazia, February 7, 1974 ABSTRACT A clonal rat hepatoma cell line (Fu5) activation of a gene(s) that was repressed during differentia- produces rat serum albumin at a constant rate over at least tion. These results have been confirmed in other interspecific 3 months of continuous cultivation. Ten hybrid cell clones derived from the fusion of Fu5 cells and mouse fibroblasts, hybrid cells (6, 7). The reappearance in hybrids of enzymes as well as 14 hepatoma subclones of Fu5 cells, all produce that were lost during cultivation in vitro of one of the parental albumin but at different rates, ranging from about 0.09 to cell lines has also been observed (8, 9). 36.7 Mg/mg of protein per 72 hr. Despite this variability in- The present paper deals with the other example of pheno- albumin production, the distribution of clones is not in and hybrid cells, namely a random but discontinuous, with both hepatoma and typic variability hepatoma hybrid clones clustering around discrete values that can be variation in constitutive level of albumin production. fitted to the geometric progression: a, a(V/2)1, a(V22)2..... MATERIALS AND METHODS a(V/2)". The values of the majority of clones fall into alternate members of this geometric progression, which Cells were cultured in a modified Ham's F12 medium supple- differ by a factor of 2. -
A Path Towards SARS-Cov-2 Attenuation: Metabolic Pressure on CTP Synthesis Rules the Virus Evolution
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.162933; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 A path towards SARS-CoV-2 attenuation: metabolic pressure on CTP synthesis rules the virus evolution Zhihua Ou1,2, Christos Ouzounis3, Daxi Wang1,2, Wanying Sun1,2,4, Junhua Li1,2, Weijun Chen2,5*, Philippe Marlière6, Antoine Danchin7,8* 1. BGI-Shenzhen, Shenzhen 518083, China. 2. Shenzhen Key Laboratory of Unknown Pathogen Identification, BGI-Shenzhen, Shenzhen 518083, China. 3. Biological Computation and Process Laboratory, Centre for Research and Technology Hellas, Chemical Process and Energy Resources Institute, Thessalonica 57001, Greece 4. BGI Education Center, University of Chinese Academy of Sciences, Shenzhen, 518083, China. 5. BGI PathoGenesis Pharmaceutical Technology, BGI-Shenzhen, Shenzhen, China. 6. TESSSI, The European Syndicate of Synthetic Scientists and Industrialists, 81 rue Réaumur, 75002, Paris, France 7. Kodikos Labs, Institut Cochin, 24, rue du Faubourg Saint-Jacques Paris 75014, France. 8. School of Biomedical Sciences, Li KaShing Faculty of Medicine, Hong Kong University, 21 Sassoon Road, Pokfulam, Hong Kong. * To whom correspondence should be addressed Tel: +331 4441 2551; Fax: +331 4441 2559 E-mail: [email protected] Correspondence may also be addressed to [email protected] Keywords ABCE1; cytoophidia; innate immunity; Maxwell’s demon; Nsp1; phosphoribosyltransferase; queuine bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.162933; this version posted June 21, 2020. -
Receptor-Like Kinase (RLK) As a Candidate Gene Conferring Resistance to Hemileia Vastatrix in Coffee
DOI: http://doi.org/10.1590/1678-992X-2020-0023 ISSN 1678-992X Research Article Receptor-Like Kinase (RLK) as a candidate gene conferring resistance to Hemileia vastatrix in coffee Dênia Pires de Almeida1 , Isabel Samila Lima Castro1 , Tiago Antônio de Oliveira Mendes2 , Danúbia Rodrigues Alves1 , Geleta Dugassa Barka1 , Pedro Ricardo Rossi Marques Barreiros1 , Laércio Zambolim3 , Ney Sussumu Sakiyama4 , Eveline Teixeira Caixeta5* 1Universidade Federal de Viçosa/Instituto de Biotecnologia ABSTRACT: The biotrophic fungus Hemileia vastatrix causes coffee leaf rust (CLR), one of the Aplicada à Agropecuária – BioCafé, Av. Peter Henry Rolfs, most devastating diseases in Coffea arabica. Coffee, like other plants, has developed effective s/n – 36570-900 – Viçosa, MG – Brasil. mechanisms to recognize and respond to infections caused by pathogens. Plant resistance 2Universidade Federal de Viçosa – Depto. de Bioquímica e gene analogs (RGAs) have been identified in certain plants as candidates for resistance (R) Genetics and Plant Breeding Biologia Molecular, Av. Peter Henry Rolfs, s/n – 36570-900 genes or membrane receptors that activate the R genes. The RGAs identified in different plants – Viçosa, MG – Brasil. possess conserved domains that play specific roles in the fight against pathogens. Despite the 3Universidade Federal de Viçosa – Depto. de Fitopatologia, importance of RGAs, in coffee plants these genes and other molecular mechanisms of disease Av. Peter Henry Rolfs, s/n – 36570-900 – Viçosa, MG – resistance are still unknown. This study aimed to sequence and characterize candidate genes Brasil. from coffee plants with the potential for involvement in resistance to H. vastatrix. Sequencing 4Universidade Federal de Viçosa – Depto. de Fitotecnia, Av. was performed based on a library of bacterial artificial chromosomes (BAC) of the coffee clone Peter Henry Rolfs, s/n – 36570-900 – Viçosa, MG – Brasil. -
Supplementary Information
Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle. -
Pyrimidine Nucleoside Phosphorylase Activity in Tumour and Matched Normal Gastrointestinal Mucosa
Gut: first published as 10.1136/gut.23.12.1072 on 1 December 1982. Downloaded from Gut, 1982, 23, 1072-1076 Pyrimidine nucleoside phosphorylase activity in tumour and matched normal gastrointestinal mucosa B HIGLEY, JANE OAKES, J DE MELLO, and G R GILES From the University Department ofSurgery, St. James's University Hospital, Leeds SUMMARY 5-Fluorouracil (5-FU) requires activation to the metabolites FdUMP and FUTP for its cytotoxic effect. This activation involves the intracellular enzymes uridine and thymidine phosphorylase. We have assayed the levels of these enzymes in colorectal and gastric cancers and have shown that, in the majority of cases, the enzyme levels were higher than in the adjacent normal mucosa. It is suggested that, while the ratio tumour/normal mucosa enzyme activity may give some indication of the relative toxicity of 5-FU in these tissues, the absolute activities of the phosphorylases in tumour tissue could give a better indication of tumour responsiveness. 5-Fluorouracil (5-FU) remains the most effective of (Figure). Thymidine phosphorylase and kinase and the currently available cytotoxic drugs for use ribonucleotide reductase are more exclusively against gastrointestinal tumours.l-3 Only 20% of involved with activation to FdUMP. In this study we patients with advanced cancer, however, show a have assayed the levels of two of these activating definitive response which, although short-lived, enzymes uridine and thymidine phosphorylase does double the mean survival time of responders within gastrointestinal mucosa and within matched over non-responders or untreated patients. As such samples of gastrointestinal carcinomas to determine a small percentage of patients respond to 5-FU whether the enzymes display a markedly different therapy it is clearly desirable to identify those activity in the two tissues. -
Genetic Factors Influencing Pyrimidine- Antagonist Chemotherapy
The Pharmacogenomics Journal (2005) 5, 226–243 & 2005 Nature Publishing Group All rights reserved 1470-269X/05 $30.00 www.nature.com/tpj REVIEW Genetic factors influencing Pyrimidine- antagonist chemotherapy JG Maring1 ABSTRACT 2 Pyrimidine antagonists, for example, 5-fluorouracil (5-FU), cytarabine (ara-C) HJM Groen and gemcitabine (dFdC), are widely used in chemotherapy regimes for 2 FM Wachters colorectal, breast, head and neck, non-small-cell lung cancer, pancreatic DRA Uges3 cancer and leukaemias. Extensive metabolism is a prerequisite for conversion EGE de Vries4 of these pyrimidine prodrugs into active compounds. Interindividual variation in the activity of metabolising enzymes can affect the extent of 1Department of Pharmacy, Diaconessen Hospital prodrug activation and, as a result, act on the efficacy of chemotherapy Meppel & Bethesda Hospital Hoogeveen, Meppel, treatment. Genetic factors at least partly explain interindividual variation in 2 The Netherlands; Department of Pulmonary antitumour efficacy and toxicity of pyrimidine antagonists. In this review, Diseases, University of Groningen & University Medical Center Groningen, Groningen, The proteins relevant for the efficacy and toxicity of pyrimidine antagonists will Netherlands; 3Department of Pharmacy, be summarised. In addition, the role of germline polymorphisms, tumour- University of Groningen & University Medical specific somatic mutations and protein expression levels in the metabolic Center Groningen, Groningen, The Netherlands; pathways and clinical pharmacology