Exploring Polymorphisms and Associations of the Bovine MOGAT3 Gene with Growth Traits

1 Exploring polymorphisms and associations of the bovine MOGAT3 gene with growth traits

Jiajie Sun, Chunlei Zhang, Xianyong Lan, Chuzhao Lei, and Hong Chen

Abstract: Monoacylglycerol acyltransferase (MGAT3, also known as MOGAT3) catalyzes the synthesis of diacylglycerol (DAG) using 2-monoacylglycerol and fatty acyl coenzyme A. This enzymatic reaction is believed to be an essential and rate-limiting step for the absorption of dietary fat in the small intestine. However, similar research for the bovine MOGAT3 gene is lacking. Therefore, in this paper, polymorphisms of the bovine MOGAT3 gene were detected in 1145 individuals from five cattle breeds by DNA pooling, PCR–RFLP, and DNA sequencing methods. The results showed that 26 novel SNPs were identified, which included 16 mutations in the coding region and the others in the introns. Additionally, association analysis between two missense mutations, g.A229G and g.G1627A, and growth traits in Nanyang cattle up to 2 years of age and adult Qinchuan cattle was performed. The results indicated that polymorphisms were significantly associated with Nanyang cattle, but no convincing associations were observed for Qinchuan cattle for the studied traits. Key words: cattle, growth traits, MOGAT3 gene, PCR–RFLP, SNP association. Résumé : La monoacylglycérol acyltransférase (MGAT3, aussi connue comme MOGAT3) catalyse la synthèse du diacylgly- cérol (DAG) à partir de 2-monoacylglycérol et d’acyl coenzyme A. Cette réaction enzymatique serait une étape essentielle et limitante pour l’absorption des lipides alimentaires dans l’intestin grêle. Cependant, des études semblables manquent pour le gène MOGAT3 chez les bovins. Dans ce travail, les polymorphismes au sein du gène MOGAT3 des bovins ont été détec- tés chez 1145 individus provenant des cinq races en étudiant des composites d’ADN par PCR–RFLP et par séquençage. Vingt-six nouveaux SNP ont été identifiés incluant 16 mutations au sein de régions codantes, les autres mutations étant dans des introns. De plus, des analyses d’association entre deux mutations faux-sens, g.A229G et g.G1627A, et des caractè- res de croissance chez les bovins Nanyang âgé de moins de deux ans et chez des bovins Qinchuan adultes ont été réalisées. Les résultats indiquent que les polymorphismes étaient significativement associés chez les bovins Nanyang, tandis qu’aucune association convaincante n’a été obtenue chez les bovins Qinchuan. Mots‐clés : bovins, caractères de croissance, gène MOGAT3, PCR–RFLP, associations des SNP. [Traduit par la Rédaction] For personal use only.

Introduction have been made in the identification and characterization of In mammals, the synthesis of triacylglycerol (TAG) serves the enzymes of the two pathways, as well as in the elucida- a critical function in multiple important physiological proc- tion of underlying mechanisms that regulate TAG synthesis, esses, including intestinal nutrition absorption, surplus energy as a result of rapid progress in genomics, bioinformatics, storage in cells, lactation, attenuation of lipotoxicity, lipid and transgenics. To date, three members of mammalian transportation, and signal transduction (Smith et al. 2000; MGAT enzymes have been identified, and they can be Listenberger et al. 2003; Coleman and Lee 2004; Toker roughly divided into MGAT1, MGAT2, and MGAT3 (Yen 2005). The probable rate-limiting step of TAG synthesis is et al. 2002; Cao et al. 2003a). Additionally, it was recently the formation of diacylglycerol (DAG) from 2-monoacylgly- reported that a novel MGAT, which is identical with lyso- cerol and fatty acyl coenzyme A substrates, catalyzed by phosphatidylglycerol acyltransferase1 (LPGAT1), plays a acyl coenzyme A: monoacylglycerol acyltransferase (MGAT) significant role in hepatic TAG synthesis (Hiramine et al. 2010). In detail, the MGAT1 mRNAs are detected mainly

Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12 (Phan and Tso 2001). MGAT is the enzyme that initiates the monoacylglycerol pathway (Lykidis et al. 1995; Lehner and from stomach, kidney, and adipose tissue, whereas MGAT2 Kuksis 1996). It should be noted that the MGAT pathway ac- and MGAT3 exhibit highest expression in the small intes- counts for 75% of TAG synthesis in the intestine, while the tine (Cheng et al. 2003; Yen and Farese 2003). Compared remainder is presumably mediated by the glycerol-3-phosphate with MGAT1 and MGAT2 genes, the MGAT3 gene only ex- pathway (Coleman and Lee 2004). Recently, great strides ists in higher mammals and humans and not in rodents.

Received 5 August 2011. Accepted 28 October 2011. Published at www.nrcresearchpress.com/gen on XX December 2011. Paper handled by Associate Editor J. Bell. J. Sun, X. Lan, C. Lei, and H. Chen. College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling, Shaanxi 712100, China. C. Zhang. Institute of Cellular and Molecular Biology, Xuzhou Normal University, Xuzhou, Jiangsu 221116, China. Corresponding author: Hong Chen (e-mail: [email protected]).

Genome 55:1–7 (2012) doi:10.1139/G11-077 Published by NRC Research Press 2 Genome, Vol. 55, 2012

Table 1. Primer pairs information of the bovine MOGAT3 gene.

Locus Primer sequence (5′–3′) Size (bp) Tm (°C) Primer position M1 F: AGGCACCTCGTCTTTATCT 1524 60 g.–358 to 1166 R: TAATCGCTCAGGTGTTTCC M2 F: TATCAGGGAGACAGGCAACG 1560 61 g.642 to 2201 R: AGGGTAGACGACCAGACACT M3 F: GAGTTGAGTGACAGAGGGTG 1599 68 g.1659 to 3257 R: AAGCAGTAGCATGGCAGTCG M4-MSPI F: AGGCACCTCGTCTTTATCT 668 62 g.–358 to 310 R: CCTTACCCAGGAAGAGGAAAC M5-HaeIII F: CTGTTCCCAGGGCTTCGGTT 180 66 g.1566 to 1745 R: CCAATTCAAGCCAAGTGCCTG Note: Primer positions are in reference to GenBank No. NC_007326.4.

Fig. 1. The sequencing maps of 16 novel SNPs in the coding region of the bovine MOGAT3 gene. Note: The SNP positions are shown according to GenBank No. NC_007326.4. For personal use only. Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12

Although the MGAT3 gene was named according to its ini- tion is believed to be an essential and rate-limiting step for tially discovered MGAT activity, the MGAT3 enzyme ac- the absorption of dietary fat in the small intestine. However, tually shares higher sequence homology with DGAT2 than related studies mainly focus on the functions, expression, and with MGAT1 and MGAT2, suggesting that the enzyme regulation of the MOGAT3 gene, and only a few gene poly- may possess significant DGAT activity (Cao et al. 2007). morphisms have been reported. In the case of bovine, only a In humans, MOGAT3 encodes a 36-kDa transmembrane single nucleotide sequence of the bovine MOGAT3 gene has protein that catalyzes the synthesis of DAG using 2-mono- been reported (GenBank accession No. NC_007326.4), acylglycerol and fatty acyl coenzyme A. This enzymatic reac- which encodes a putative 363-amino-acid polypeptide.

Published by NRC Research Press Sun et al. 3

Table 2. The SNP information of the bovine MOGAT3 gene.

Locus SNP Mutation site Allele AA coded DPS(nt) NCBI_ss# M1 g.G168A EX1_168G>A TCG/TCA p.S56S 0 405178434 g.A229G EX1_229A>G AGC/GGC p.S77G 61 405178435 g.A275G EX1_275A>G TAC/TGC p.Y92C 46 405178436 g.A592G IVS1+288A>G 317 405178437 g.G622C IVS1+318G>C 30 405178438 g.G698C IVS1+394G>C 76 405178439 g.C887T IVS2_38C>T 189 405178440 g.G955A IVS2_106G>A 68 405178441 g.C1045T IVS2_196C>T 90 405178442 M2 g.T1597C EX4_152T>C GTG/GCG p.V212A 550 405178443 g.G1598A EX4_153G>A GTG/GTA p.V212V 1 405178444 g.C1610A EX4_165C>A CTC/CTA p.L216L 12 405178445 g.G1617A EX4_172G>A GTG/ATG p.V219M 7 405178446 g.T1626C EX4_181T>C TGT/CGT p.C222R 9 405178447 g.G1627A EX4_182G>A TGT/TAT p.C222Y 1 405178448 g.A1638T EX4_193A>T ATT/TTT p.I226F 11 405178449 g.G1648T EX4_203G>T TGT/TTT p.C229F 10 405178450 M3 g.A1701G IVS4+51A>G 53 405178451 g.G1900T IVS4+250G>T 199 405178452 g.C1963T EX5_4C>T ACA/ATA p.T231I 63 405178453 g.A2034G EX5_75A>G ATG/GTG p.M255V 71 405178454 g.A2064G EX5_105A>G ACC/GCC p.T265A 30 405178455 g.G2730A EX6_17G>A GTG/ATG p.V294M 666 405178456 g.T2731C EX6_18T>C GTG/GCG p.V294A 1 405178457 g.C2979T IVS6+63C>T 248 405178458 g.C2992T IVS6+76C>T 13 405178459

Note: DPS(nt), distance from previous sequence variants in nucleotides (nt); The bases in bold font indicate mutations in reference to GenBank No. NC_007326.4.

Hence, in this paper, we systematically analyzed potential diet. The traits under study were the live mass at birth, variation of all exons and exon/intron junctions of the bovine 6 months, 12 months, 18 months, and 2 years. For personal use only. MOGAT3 gene using DNA pooling, PCR–RFLP, PCR– SSCP, and DNA sequencing analysis and attempted to estab- Oligonucleotides and PCR condition lish an association between mutations of the bovine MOGAT3 Using Primer software (version 5.0) and based on the nu- gene and performance traits. cleotide sequence of the bovine MOGAT3 gene (GenBank accession number NC_007326.4), three pairs of polymerase Materials and methods chain reaction (PCR) primers (M1,M2, and M3) were designed to amplify the entire gene sequence, and two reverse Cattle populations, genomic DNA isolation, and data primers (M4-MSPI and M5-HaeIII) were designed for PCR– collections RFLP (Table 1). Each amplification reaction was carried out In this study, 1145 cattle (without genetic relationships) in a 15 µL reaction mixture containing 50 ng genomic DNA, belonging to the Nanyang (199), Qinchuan (226), Jiaxian 10 pmol/L of each primer, 1× buffer (including 1.5 mmol/L Red (398), Caoyuan Red (212), and Luxi (110) breeds were MgCl2), 0.2 mmol/L dNTPs (dATP, dTTP, dCTP, and included. The Nanyang cattle were from the breeding centre dGTP), and 0.60 U Taq DNA polymerase (MBI fermentas, of Nanyang cattle (Nanyang city, Henan Province, China); USA). The cycling protocol was 5 min at 94 °C, 32 cycles Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12 the Jiaxian cattle were from the breeding farm of Jiaxian cat- of denaturing at 94 °C for 45s, annealing at selected temper- tle (Jiaxian county, Henan Province, China); the Qinchuan atures for 1 min (see Table 1), extension at 72 °C for 45s, animals were from the reserved farm (Weinan city, Shaanxi with a final extension at 72 °C for 10 min. Province, China), the breeding farm, and the seed centre of Qinchuan cattle (Fufeng county, Shaanxi Province, China); DNA pooling, PCR–RFLP, and DNA sequencing Caoyuan cattle were form the reserved farm (Tongyu county, DNA of 100 randomly chosen individuals from the same Jilin Province, China); and the Luxi animals were from the breed were mixed to one DNA pool, so five pools from five reserved farm (Heze city, Shandong Province, China). Blood different breeds were prepared (Bansal et al. 2002). In detail, samples were obtained from these cattle populations and ge- DNA from selected individuals were measured by using Flu- nomic DNA was extracted from the blood samples using oroskan Ascent (Thermo Labsystems, Franklin, Massachu- standard methods (Sambrook and Russell 2001). Addition- setts) and Picogreen reagents and kits (Molecular Probes, P- ally, the animals were weaned at an average of 6 months age 7589). The selected DNAs were diluted to a standard concen- and raised from weaning to slaughter on a corn–corn silage tration (50 ng/µL) and transferred into a single tube to ensure

Published by NRC Research Press 4 Genome, Vol. 55, 2012

Table 3. Genotype distribution, allelic frequencies, and Hardy–Weinberg equilibrium values of polymorphic MOGAT3 gene g.A229G and g.G1627A loci in five bovine breeds.

Genotype Allele frequency c2 Locus Breeds A1A1 A1G1 G1G1 Total A1 G1 (HWE) g.A229G Qinchuan 45 135 46 226 0.498 0.502 8.568** Nanyang 57 112 30 199 0.568 0.432 4.285* Jiaxian 105 238 55 398 0.563 0.437 18.420** Caoyuan 154 45 13 212 0.833 0.167 12.08** Luxi 36 56 18 110 0.582 0.418 0.235 Genotype Allele frequency c2 Locus Breeds A2A2 A2G2 G2G2 Total A2 G2 (HWE) g.G1627A Qinchuan 37 108 81 226 0.403 0.597 0.010 Nanyang 38 104 57 199 0.452 0.548 0.599 Jiaxian 98 178 122 398 0.470 0.530 4.162* Caoyuan 100 86 26 212 0.675 0.325 1.228 Luxi 19 62 29 110 0.455 0.545 2.055 Note: HWE, Hardy–Weinberg equilibrium; ** and * means differ at a value of P< 0.01 and P< 0.05, respectively.

that a constant amount of each DNA sample was transferred Fig. 2. Electrophoresis patterns of PCR–RFLP analysis of M4-MSPI to the pool. The pools were then mixed gently and requanti- locus (a) and M5-HaeIII locus (b) in the bovine MOGAT3 gene. fied before further dilution to a working concentration of 5 ng/µL. DNA sequencing was applied to screen the variations within the amplified regions in the five DNA pools constructed, and the sequences were imported into the Bi- oXM software (version 2.6) to search for SNPs. The PCR–RFLP method was used to detect missense mutations, g.A229G and g.G1627A, in the MOGAT3 gene. Ali- quots of 10 µL PCR products were digested with 10 U AluI (MBI Fermentas) for 5h at 37 °C following the supplier’s directions. The digested products were detected by electrophoresis in 2.5% agarose gel containing 200 ng/mL ethidium bromide, and the gels were run at a constant voltage (100V)

For personal use only. for 1.0–1.5 h. Finally, PCR products of different electrophoresis patterns were sequenced by the DNA sequencer (Ap- plied Biosystems 3730 Genetic Analyser, USA) from both directions, and the results were analysed by DNAMAN software (version 5.2.2).

Data analyses Gene frequencies were determined for each breed by direct counting, and the Hardy-Weinberg equilibrium was tested based on likelihood ratio for different locus–population com- binations by POPGENE software (version 3.2). Statistical analysis was performed on records of growth traits in Qin- chuan and Nanyang cattle breeds. The relationships between the variations of the MOGAT3 gene and growth traits were

Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12 analysed by ANOVA (SPSS software GLM procedure) using the following model: Yijk =µ+Agei +Markerj +Breedk +eijk where Yij is the observation of the trait, µ is the least square mean, Agei is the effect of age, Markerj is the effect of marker genotype, Breedk is the effect of breed, and eij is the residual effect. DNA amplification fragments were sequenced and the results revealed 26 novel mutations (CDS mutations were shown in Results and discussion Fig. 1). In addition, the SNPs were submitted in GenBank The bovine MOGAT3 gene maps to chromosome 25, with accession numbers ss405178434 to ss405178459; the which consists of seven exons and six introns. In the present nature and distribution of MOGAT3 variations are shown in study, genomic DNA of all five cattle breeds were success- Table 2. fully amplified using primer pairs for the MOGAT3 gene. To At the EX1_229A>G locus, the mutation showed a trans- better understand the detailed genetic variation, the pooled version, A > G, at position 229, which resulted in a missense

Published by NRC Research Press Sun et al. 5

Table 4. Association of genotypes at the MOGAT3 gene g.A229G locus with growth traits in Qinchuan cattle.

Genotype (mean ± SD)

Growth trait A1A1 A1G1 G1G1 Withers height (cm) 129.81±1.134 131.29±0.723 128.52±1.212 Body length (cm) 146.39±1.419 147.20±0.905 145.12±1.517 Heart girth (cm) 182.68±4.113 190.20±2.623 189.29±4.397 Hip width (cm) 47.68±0.893 47.98±0.570 48.24±0.955 Hucklebone width (cm) 31.31±0.526 30.66±0.335 31.59±0.562 Rump length (cm) 50.04±0.593 50.29±0.378 50.33±0.634 Height at hip cross (cm) 129.06±0.972 129.27±0.620 126.47±1.039 Body mass (kg) 474.15±15.110 473.61±9.637 477.14±16.153

Table 5. Association of genotypes at the MOGAT3 gene g.A229G locus with growth traits in Nanyang cattle.

Genotype (mean ± SD)

Age Growth trait A1A1 A1G1 G1G1 Birth Body mass (kg) 29.63±0.403 29.75±0.277 29.75±0.740 6 months Body mass (kg) 155.03a±3.691 156.35a±2.540 137.13b±6.781 Withers height (cm) 104.48ab±0.988 105.39a±0.680 101.25b±1.814 Body length (cm) 104.55±1.133 104.12±0.780 100.63±2.081 Heart girth (cm) 127.33±1.369 127.00±0.942 121.62±2.515 Hucklebone width (cm) 18.37±0.241 18.08±0.166 17.75±0.442 Average daily gain (kg) 0.69a±0.020 0.70a±0.014 0.5 9b±0.036 12 months Body mass (kg) 220.66±4.033 224.88±2.776 210.87±7.409 Withers height (cm) 112.70±0.702 113.79±0.483 112.62±1.289 Body length (cm) 114.44±1.346 116.32±0.926 112.50±2.472 Heart girth (cm) 139.51±1.430 140.16±0.984 135.50±2.627 Hucklebone width (cm) 20.71±0.289 20.42±0.199 19.87±0.531 Average daily gain (kg) 0.36±0.023 0.38±0.016 0.41±0.043 18 months Body mass (kg) 289.00±5.693 297.95±3.918 290.75±10.459 Withers height (cm) 120.11±1.323 121.35±0.911 119.25±2.431 Body length (cm) 126.93±1.364 128.44±0.938 124.62±2.505 Heart girth (cm) 153.19±1.458 154.33±1.004 149.12±2.679 For personal use only. Hucklebone width (cm) 23.02±0.322 23.02±0.222 22.37±0.592 Average daily gain (kg) 0.38±0.026 0.41±0.018 0.44±0.047 2 years Body mass (cm) 354.07±7.142 364.35±4.915 342.62±13.120 Withers height (cm) 125.48±0.819 125.98±0.564 125.00±1.505 Body length (cm) 135.88±1.469 136.40±1.011 134.00±2.699 Heart girth (cm) 165.77±1.762 166.93±1.213 160.12±3.238 Hucklebone width (cm) 25.03±0.413 25.21±0.284 24.50±0.759 Average daily gain (kg) 0.36±0.022 0.36±0.015 0.28±0.041 Note: a and b denote values that differ significantly at P < 0.05.

mutation, Ser > Gly, at position 77 (363 aa) according to Genotypic frequencies and the most common allelic fre- XM_002698120.1. Furthermore, MSPI PCR–RFLP was quencies were directly calculated and are shown in Table 3. firstly used to detect the SNP, g.A229G, in exon 1 of the bo- At the MOGAT3-MSPI locus, three RFLP genotypes were vine MOGAT3 gene, which will overcome the inaccuracy, the identified as A A ,AG , and G G . The frequency of geno- Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12 1 1 1 1 1 1 complicated technical demands, slow speed, and unstable re- type A1G1 (allele A1) was dominant in the tested populations, producibility. Namely, the 668-bp PCR products digestion although only the Luxi cattle was in Hardy–Weinberg equili- MSP MO- with I demonstrated one fragment (668 bp) for the brium (P > 0.05). Obviously, genotype A2G2 (allele G2)was GAT3 MSPI-AA allele, two fragments (585 and 83 bp) for dominant at the MOGAT3-HaeIII locus, and the genotype the MOGAT3 MSPI-GG allele, and three fragments (668, distributions of Jiaxian cattle deviated significantly from 585, and 83 bp) for the MOGAT3 MSPI-AG allele (Fig. 2a). Hardy–Weinberg equilibrium (P < 0.05). Strangely, geno- At the EX4_182G>A locus, the 180-bp PCR products diges- types A1A1 and A2A2 were dominant only in Caoyuan cattle, tion with HaeIII demonstrated two fragments (152 and 28 bp) which might represent (i) a smaller bovine sample size and for the MOGAT3 HaeIII-G allele and one fragment (180 bp) (or) (ii) a selection history resulting in diversity. Nanyang, for the MOGAT3 HaeIII-A allele. Three unique banding Qinchuan, Jiaxian, and Luxi cattle are four of the most repre- patterns were marked as A2A2,A2G2, and G2G2 (Fig. 2b). sentative native draft and beef dual-purpose bovine (Bos tau- However, the 83- and 28-bp fragments are too short to be rus) breeds in China, and they have been designated as visible in Figure 2. nationally protected resources owing to their excellent per-

Published by NRC Research Press 6 Genome, Vol. 55, 2012

Table 6. Association of genotypes at the MOGAT3 gene g.G1627A locus with growth traits in Qinchuan cattle.

Genotype (mean ± SD)

Growth trait A2A2 A2G2 G2G2 Withers height (cm) 128.86±1.289 130.77±0.758 130.65±1.026 Body length (cm) 143.71±1.574 147.28±0.925 147.15±1.253 Heart girth (cm) 187.36±4.677 188.49±2.749 188.48±3.722 Hip width (cm) 47.31±0.994 48.54±0.584 47.31±0.791 Hucklebone width (cm) 30.60±0.596 31.18±0.350 30.91±0.474 Rump length (cm) 49.89±0.662 50.06±0.389 50.78±0.527 Height at hip cross (cm) 127.42±1.113 129.06±0.654 128.70±0.886 Body mass (kg) 454.28±16.754 484.91±9.847 468.03±13.333

Table 7. Association of genotypes at the MOGAT3 gene g.G1627A locus with growth traits in Nanyang cattle.

Genotype (mean ± SD)

Age Growth trait A2A2 A2G2 G2G2 Birth Body mass (kg) 30.75±0.531 29.91±0.336 29.33±0.560 Six months Body mass (kg) 157.30ab±4.380 159.56a±2.770 147.55b±4.617 Withers height (cm) 105.60±1.194 105.56±0.755 103.11±1.258 Body length (cm) 105.90±1.347 104.48±0.852 102.61±1.420 Heart girth (cm) 127.20±1.550 128.24±0.981 124.44±1.634 Hucklebone width (cm) 18.32±0.291 18.27±0.184 17.94±0.307 Average daily gain (kg) 0.70ab±0.024 0.72a±0.015 0.65b±0.025 Twelve months Body mass (kg) 221.70±4.808 222.64±3.041 221.33±5.069 Withers height (cm) 113.65±0.907 113.72±0.574 113.33±0.956 Body length (cm) 115.95±1.541 116.14±0.975 114.00±1.624 Heart girth (cm) 139.70±1.691 140.82±1.069 138.05±1.782 Hucklebone width (cm) 20.97±0.338 20.61±0.214 20.25±0.356 Average daily gain (kg) 0.35±0.027 0.35±0.017 0.41±0.028 Eighteen months Body mass (kg) 297.70ab±6.070 302.62a±3.839 286.77b±6.398 Withers height (cm) 121.50±1.543 121.68±0.976 119.89±1.627

For personal use only. Body length (cm) 129.15±1.527 128.94±0.965 126.61±1.609 Heart girth (cm) 155.90ab±1.858 155.62a±1.175 150.94b±1.959 Hucklebone width (cm) 22.95ab±0.397 23.24a±0.251 22.19b±0.419 Average daily gain (kg) 0.42±0.035 0.44±0.022 0.36±0.037 Two years Body mass (kg) 363.55±8.729 369.56±5.520 348.77±9.201 Withers height (cm) 127.05±0.944 126.34±0.597 125.61±0.996 Body length (cm) 137.10±1.708 137.46±1.080 135.55±1.800 Heart girth (cm) 169.07±2.183 167.89±1.381 162.94±2.301 Hucklebone width (cm) 25.12±0.515 25.36±0.326 24.16±0.543 Average daily gain (kg) 0.36±0.028 0.37±0.017 0.34±0.029 Note: a and b denote values that differ significantly at P < 0.05.

formance traits and fleshy characteristics. For a period of SPSS software (version 17.0). Regrettably, no convincing as- time, some artificial selection and breeding from draft usage sociations were identified in the 226 Qinchuan population- Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12 to beef production has been practiced in these cattle breeds, based studies (P > 0.05) (Tables 4 and 6). In the Nanyang which might have lead to different variations of Caoyuan cat- population, statistical results showed that the animals with tle. genotypes A1A1 and A1G1 had significantly greater body Two missense mutation, g.A229G and g.G1627A, exist in mass, withers height, and average daily gain than those with exon 1 and exon 4 of the bovine MOGAT3 gene, and these genotype G1G1 (P < 0.01 or P < 0.05) at 6 months old, dem- mutations change the amino acid sequence of proteins, which onstrating that allele A1 might be associated with an increase may affect the level of translation efficiency, thereby altering in body mass, withers height, and average daily gain at their function, expression, and regulation of MOGAT3. 6 months old in the population. The animals with A2G2 gen- Therefore, we proposed the hypothesis that the polymorphic otypes had significantly greater body mass and average daily site identified within the bovine MOGAT3 gene might be as- gain than those with G2G2 genotypes at 6 months old, fur- sociated with growth traits. Concomitantly, the relationships thermore the animals with A2G2 genotypes had significantly between genotypes and growth traits of Nanyang cattle up to greater body mass, heart girth, and hucklebone width than 2 years of age and adult Qinchuan cattle were analyzed using those with G2G2 genotypes at 18 months old (Tables 5 and 7).

Published by NRC Research Press Sun et al. 7

In conclusion, according to DNA pooling and DNA se- Coleman, R.A., and Lee, D.P. 2004. Enzymes of triacylglycerol quencing methods, 26 novel polymorphisms in the bovine synthesis and their regulation. Prog. Lipid Res. 43(2): 134–176. MOGAT3 gene were observed in this study, which confirmed doi:10.1016/S0163-7827(03)00051-1. PMID:14654091. that DNA pooling is a simple and sensitive means of detect- Hiramine, Y., Emoto, H., Takasuga, S., and Hiramatsu, R. 2010. ing DNA polymorphisms. In addition, association analysis Novel acyl-coenzyme a: monoacylglycerol acyltransferase plays an between MOGAT3 gene polymorphisms and growth traits important role in hepatic triacylglycerol secretion. J. Lipid Res. 51 was performed. The results indicated that two missense muta- (6): 1424–1431. doi:10.1194/jlr.M002584. PMID:20018982. tions, g.A229G and g.G1627A, were significantly associated Lehner, R., and Kuksis, A. 1996. Biosynthesis of triacylglycerols. with Nanyang cattle, but no convincing associations were ob- Prog. Lipid Res. 35(2): 169–201. doi:10.1016/0163-7827(96) served for the Qinchuan population for the studied traits. 00005-7. PMID:8944226. However, these results were preliminary ones, and further in- Listenberger, L.L., Han, X., Lewis, S.E., Cases, S., Farese, R.V., Jr, vestigations would be essential. Ory, D.S., and Schaffer, J.E. 2003. Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc. Natl. Acad. Acknowledgements Sci. U.S.A. 100(6): 3077–3082. doi:10.1073/pnas.0630588100. PMID:12629214. This study was supported by the National Natural Science Lykidis, A., Mougios, V., and Arzoglou, P. 1995. Kinetics of the two- Foundation of China (Grant No. 30972080), National Key step hydrolysis of triacylglycerol by pancreatic lipases. Eur. J. Technology R&D Program (Grant No. 2008ADB2B03-19), Biochem. 230(3): 892–898. doi:10.1111/j.1432-1033.1995. Keystone Project of Transfergene in China (Grant No. tb20633.x. PMID:7601150. 2009ZX08009-157B, 2008ZX08007-002, and Phan, C.T., and Tso, P. 2001. Intestinal lipid absorption and transport. 2009ZX08007-005B-07), and the Program of National Beef Front. Biosci. 6(1): D299–D319. doi:10.2741/Phan. PMID: Cattle Industrial Technology System (CARS-38). 11229876. Sambrook, J., and Russell, D.W. 2001. Molecular cloning: a References laboratory manual. 3rd ed. Vol. 3. Cold Spring Harbor Laboratory Bansal, A., van den Boom, D., Kammerer, S., Honisch, C., Adam, G., Press, New York. Cantor, C.R., et al. 2002. Association testing by DNA pooling: an Smith, S.J., Cases, S., Jensen, D.R., Chen, H.C., Sande, E., Tow, B., effective initial screen. Proc. Natl. Acad. Sci. U.S.A. 99(26): 16 et al. 2000. Obesity resistance and multiple mechanisms of – 871–16 874. doi:10.1073/pnas.262671399. PMID:12475937. triglyceride synthesis in mice lacking Dgat. Nat. Genet. 25(1): 87 Cao, J., Burn, P., and Shi, Y. 2003a. Properties of the mouse intestinal 90. doi:10.1038/75651. PMID:10802663. acyl-CoA: monoacylglycerol acyltransferase, MGAT2. J. Biol. Toker, A. 2005. The biology and biochemistry of diacylglycerol Chem. 278(28): 25 657–25 663. doi:10.1074/jbc.M302835200. signalling. EMBO Rep. 6(4): 310–314. doi:10.1038/sj.embor. PMID:12730219. 7400378. PMID:15791268. Cao, J., Cheng, L., and Shi, Y. 2007. Catalytic properties of MGAT3, Yen, C.-L.E., and Farese, R.V., Jr.. 2003. MGAT2, a monoacylgly- a putative triacylgycerol synthase. J. Lipid Res. 48(3): 583–591. cerol acyltransferase expressed in the small intestine. J. Biol. – For personal use only. doi:10.1194/jlr.M600331-JLR200. PMID:17170429. Chem. 278(20): 18 532 18 537. doi:10.1074/jbc.M301633200. Cheng, D., Nelson, T.C., Chen, J., Walker, S.G., Wardwell-Swanson, PMID:12621063. J., Meegalla, R., et al. 2003. Identification of acyl coenzyme A: Yen, C.-L.E., Stone, S.J., Cases, S., Zhou, P., and Farese, R.V., Jr.. monoacylglycerol acyltransferase 3, an intestinal specific enzyme 2002. Identification of a gene encoding MGAT1, a monoacylgly- implicated in dietary fat absorption. J. Biol. Chem. 278(16): 13 cerol acyltransferase. Proc. Natl. Acad. Sci. U.S.A. 99(13): 8512– 611–13 614. doi:10.1074/jbc.C300042200. PMID:12618427. 8517. doi:10.1073/pnas.132274899. PMID:12077311. Genome Downloaded from www.nrcresearchpress.com by IOWA STATE UNIVERSITY on 01/04/12

Published by NRC Research Press