Norepinephrine Spares Adipose Tissue in Ovine Fetuses Complicated with Placental Insufficiency
Item Type text; Electronic Thesis
Authors Luna Ramirez, Rosa Icela
Publisher The University of Arizona.
Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction, presentation (such as public display or performance) of protected items is prohibited except with permission of the author.
Download date 28/09/2021 21:38:34
Link to Item http://hdl.handle.net/10150/634270
NOREPINEPHRINE SPARES ADIPOSE TISSUE IN OVINE FETUSES COMPLICATED WITH PLACENTAL INSUFFICIENCY
By
Rosa Icela Luna Ramirez
______Copyright © Rosa Icela Luna Ramirez 2019
A Thesis Submitted to the Faculty of the SCHOOL OF ANIMAL AND COMPARATIVE BIOMEDICAL SCIENCES
In Partial Fulfillment of the Requirements For the Degree of
MASTER OF SCIENCE
Animal Science
In the Graduate College
THE UNIVERSITY OF ARIZONA
2019
2
ACKNOWLEDGEMENTS
First of all, I would like to thank my mentor and advisor, Dr. Sean Limesand for helping me accomplish one of my biggest goals, doing my Master’s. Your support and motivation were very important in this journey because it made me believe that I could do anything as long as I was strongly committed to it. Working with someone as important as you made me realize that hard work and dedication is key for success. I will always be grateful to you for believing in me and giving me the opportunity to learn by your side.
Secondly, I would like to express my gratitude to my committee, Dr. Zelieann Craig and
Dr. Ravi Goyal. The knowledge I received from each of you contributed to my research and graduate experience.
Thirdly, I would like to thank my family for the support I received in this important stage of my life. Without your love and unconditional help, this wouldn't have been possible. You supported me in this dream and always motivated me to accomplish it.
Lastly, I would like to thank everyone in the Limesand laboratory with special consideration for Miranda Anderson. Besides being my colleague, you also played an important role in this achievement. You were always there to help me and to teach me new things. I'm very grateful for your patience and your desire to help me learn.
3 DEDICATION
I would like to dedicate my Master’s to my family that was always there for me throughout this journey. To my dad, for believing in my ability to accomplish this milestone in my life and helping me learn valuable knowledge and lessons throughout my life. Also, for being my role model and showing me that with dedication and effort goals are achieved. To my mother, for helping me grow as a strong woman and giving me her unconditional love since the day I was born. Finally, to my sister, for showing me that I will always have an unconditional friend in her willing to do anything for my happiness.
4 TABLE OF CONTENTS
LIST OF FIGURES………………………………………………………………………………………………………….6 LIST OF TABLES…………………………………………………………………………………………………….………7 Abstract….…………………………………………………………………………………………………………...….....8 CHAPTER 1: LITERATURE REVIEW……………………………………………………………………………..…10 Introduction…………………………………………………………………………………………………..……….10 Placental development………………………………………………………………………………………13 Adipose tissue development……………….……………………………………………………..…….15 Adipose tissue development in humans……..……………………………………..………15 Adipose tissue development in sheep………………………………………………..………16 Proliferative phase in early-mid gestation…………………………………………..……..17 Preparative phase………………………………………………………………………………….…..17 Birth and non-shivering thermogenesis………………………………………………………17 The loss of UCP1 and accumulation of lipid within the perirenal -abdominal depot……………………………………………………………………………………....18 Physiology of adipose tissue…………………..………………………………………………….……...18 Hormone regulation of adipose tissue……………………………………………………………….20 Leptin………………………………………………………………………………….……………….…....20 Adiponectin…………………………………………………………………………...….……….………20 Developmental origins of adult disease………………………………………………………………21 Humans evidence that links to obesity.……………………………………………….……...22 Evidence in rodents that links to obesity………………….…………………………...…….23 Evidence in sheep that links to obesity……………………………………………………..….24 Adipose tissue programming……………………………………………………………………….………24 PPAR signaling pathway………………………………………………………………………..……..25 Epigenetics of the adipose tissue…………………………………………………………………..……26 In utero conditions that affect fetal developmental in fetal sheep with IUGR……………………………………………………………………………………………………….………..28 Action of catecholamines…………………………………………………………………………..…….…29 Conclusion…………………………………………………………………………………………………..……..30 CHAPTER 2. NOREPINEPHRINE SPARES ADIPOSE TISSUE IN OVINE FETUSES COMPLICATED WITH PLACENTAL INSUFFICIENCY………………………………………………………………………………..31 Introduction…………………………………………………………………………………………..……….….……31 Materials and Methods…………………………………………………………………………………..……....33 Results…………………………………………………………………………………………………………….….…..40 Discussion……………………………………………………………………………………………………….…...... 55 REFERENCES………………………………………………………………………………………………………….……..61
5 LIST OF FIGURES
FIGURE 1. Postmortem fetal and adipose tissue weights……………………………………………………..41
FIGURE 2. DNA and triglyceride content………………………………………………………………………………42
FIGURE 3A. Multi-Dimensional Scaling (MDS) is a visualization technique for proximity data, that is, data in the form of N × N dissimilarity matrices……………………………………………………………….44
FIGURE 3B. Dendrogram of Gene Expression Similarity between RNAseq samples based on normalized gene expression…………………………………………………………………………………………………45
FIGURE 4. Volcano plots of genes detected by RNAseq in fetal perirenal adipose tissue…………………..………………………………………………………………………………………………………………46
FIGURE 5. Differentially expressed genes with the largest fold changes (positive and negative) in the CON-SH vs. IUGR-SH comparison…………………………………………………………………………………..47
FIGURE 6. Venn Diagram of differentially expressed genes of primary comparison………………………..………………………………………..……………………………………………………..48
FIGURE 7. Relative mRNA expression for adipogenesis genes in fetal perirenal adipose tissue…………………………………………………..………………………………………..…………………………………..52
FIGURE 8. Relative mRNA expression for metabolic genes in fetal perirenal adipose tissue ...... 52
6 LIST OF TABLES
Table 1. Oligonucleotide primer sequences and quantitative PCR parameters for ovine genes………..……………………………………………………………………………………………………………………….38
Table 2. Fetal blood measurements for experimental groups...... 40
Table 3. Differentially expressed genes from enriched pathways identified by RNAseq……..50
Table 4. Significantly enriched canonical pathways using all DE genes for group comparisons in
KOBAS and KEGG public databases…………………………………………………………………………………….53
7 Abstract
Placental insufficiency (PI) causes hypoxemia and hypoglycemia, which elevates norepinephrine
(NE) concentrations throughout the final third of gestation, leading to intrauterine growth restriction (IUGR). The conditions causing IUGR also disrupt fetal adipose tissue, which is postulated to increases the risk of developing metabolic diseases. The sustained high NE concentrations lower adrenergic receptor β2 responsiveness in adipose tissue postnatally. Our objective was to characterize alterations in the perirenal adipose transcriptome and identify adrenergic programming responses from other conditions of IUGR.
PI-IUGR was created with maternal hyperthermia during mid gestation. At 65% gestation, fetuses were randomly assigned to a sham (SH) or bilateral adrenal demedullation (AD) surgical procedure. Perirenal adipose tissue was collected from control (CON) and IUGR fetuses at 90% gestation. Physiological assessments were used to confirm AD. RNAseq (n=4/group) was performed on adipose mRNA to determine differentially expressed (DE) genes in adipose tissue among Control-Sham (CON-SH), IUGR-Sham (IUGR-SH), Control-AD (CON-AD) and IUGR-AD
(IUGR-AD) groups. Three primary comparisons were analyzed to define IUGR specific genes and
NE specific genes: CON-SH vs IUGR-SH, IUGR-SH vs IUGR-AD, and CON-AD vs IUGR-AD.
Differentially expressed transcripts were modeled into functional pathways used to define genes of interest. Gene expression was confirmed with qPCR in an expanded cohort (n=7/group) and analyzed by ANOVA and post hoc LSD test.
8 IUGR-AD had lower plasma NE concentrations than IUGR-SH fetuses despite being hypoxemic and hypoglycemic. IUGR-AD fetuses weighed more than IUGR-SH (2.2±0.3 vs 1.3±0.1kg, P<0.05).
Perirenal adipose weight relative to body weight was greater in IUGR-SH fetuses compared to
IUGR-AD and CON groups. The IUGR-SH adipose tissue also had a higher DNA content. RNAseq identified 593 DE genes in IUGR-SH compared to CON-SH, 297 DE genes in IUGR-SH compared to
IUGR-AD, and 225 DE genes in CON-AD compared to IUGR-AD. Metabolism and PPAR signaling were enriched pathways in DE genes across comparisons. DE genes within enriched pathways were measured with qPCR and the majority of genes were increased in IUGR-SH compared to
CON-SH. The expression of two metabolic regulators with a known role in adipose tissue, ADIRF and GLUT1, were decreased in IUGR-AD compared to IUGR-SH, indicating NE-dependent IUGR response.
In conclusion, the adipose phenotype in intact IUGR fetuses indicated that there is higher relative adipose tissue mass due to hyperplasia. Furthermore, upregulation of ADIRF and GLUT1 expression may promote adipogenesis in response to NE.
9 CHAPTER 1. LITERATURE REVIEW
Introduction
Intrauterine growth restriction (IUGR) is one of the leading causes of perinatal-neonatal morbidity and mortality and contributes to non-communicable long-term diseases. The most common cause of IUGR is fetal undernutrition due to placental insufficiency. Substantial epidemiological evidence shows that there is a strong association between adaptations in the developmental trajectory of the fetus and metabolic complications such as type 2 diabetes (T2D) and obesity in adulthood. Animal studies have also shown that fetal undernutrition produces an adaptation that leads to altered structure and function of developing organs and increases risk of disease. This association is termed “developmental programming” or the “developmental origins of adult health and disease”.
Barker and Osmond (1986) reported an association between small for gestational birth weight an adverse intrauterine environment and adult cardiometabolic disease in humans. The heart is highly vulnerable to changes in the uterine environment because is the first organ to develop and function during gestation (Burton et al., 2018). Cardiac remodeling in IUGR offspring causes cardiac hypertrophy characterized by a thickened intraventricular septum and increased pressure overload causing both systolic and diastolic dysfunction and premature aging (Cruz-Lemini et al.,
2016). In contrast, epidemiological data from the Dutch famine demonstrated that undernutrition during early gestation was linked with adult hypertension (Ravelli et al., 2010), while undernutrition during late gestation was associated with increased adiposity, impaired
10 glucose tolerance, and T2D (Ravelli et al., 1999; Roseboom et al., 2001). These studies provide evidence for the developmental programming hypothesis and the risk for developing cardiovascular disease with age. Also, undernutrition exposure in IUGR fetuses causes oxidative stress and mitochondrial dysfunction in key tissues, which accelerate adipogenesis and impair energy sensing, affecting neurodevelopment, liver, pancreas, and skeletal muscle and leading to metabolic disorder during adulthood such as T2D and obesity (Padmanabham et al. 2016;
Friedman, 2018).
IUGR has been associated with altered development of fetal adipose tissue (Yajnik et al., 2002).
Remarkably, work over the past several years has provided evidence from epidemiological studies in humans and experimental studies in animal models of fetal growth restriction that link adverse in utero environments to postnatal adipose tissue accumulation (Sarr et al., 2012).
Alterations in the appetite/metabolic regulatory system have been reported for offspring from dams undernourished during pregnancy that receive a high-fat diet postnatal. These offspring had no change in mRNA levels of the orexigenic factor NPY (Iwasa et al., 2017) and decrease leptin sensitivity (Coupé et al., 2012) leading to obesity. IUGR also caused adipose tissue dysfunction that predisposes the fetus to developing T2D and obesity in adulthood (Vaiserman
& Lushchak, 2019). Thus, adipose tissue may play an important role linking poor fetal growth to subsequent development of adult diseases (Jaquet et al., 2005).
Placental insufficiency alters the fetal miIieu, which promotes aspects of organ sparing at the expense of other tissues, and such adaptations are thought to cause the developmental origins
11 of adult diseases. Fetuses with placental insufficiency and IUGR develop hypoglycemia, hypoxia and elevated plasma catecholamines (epinephrine (E) and norepinephrine (NE)) concentrations
(Limesand et al., 2007; Leos et al., 2010). Adaptive changes also include alterations in glucose- insulin metabolism such as reduced insulin secretion and increased insulin resistance, which may result in a greater capacity for fat storage (Vaiserman & Lushchak, 2019). These conditions in the
IUGR fetus provoke additional endocrine responses that lower plasma insulin and insulin-like growth factor 1 concentrations and likely other growth promoting hormones (Brown et al., 2016;
Economides et al., 1989; Jonker et al., 2018). Conversely, endocrine responses that slow somatic growth rates have also been shown in IUGR fetuses, and one primary example is higher plasma catecholamines (Davis et al., 2015).
Evidence from animal studies show that increased prenatal lipogenesis and preadipocyte differentiation promotes the development of obesity later in life in IUGR offspring. These effects include early induction of adipose peroxisome proliferator-activated receptor-γ (PPARg) activity and upregulation of transcription factors such as CCAAT/enhancer binding proteins a,b,d
(C/EBPa,b,d) and the retinoid X receptor (RXR) (Desai & Ross, 2011). Recent studies of adipose tissue biology have begun to explore developmental adaptations to the materno-fetal environment and these effects on body composition in offspring with IUGR at birth. Chronic adrenergic stimulation caused by conditions from placental insufficiency has been proposed as a programming mechanism because adipose tissue in IUGR fetuses becomes desensitized to catecholamines, lowering adrenergic stimulated lipolysis and promoting fat storage (Chen et al.,
2010). In this chapter, we summarize epidemiological and animal studies linking insults in utero
12 environment to prenatal and postnatal adipose tissue accumulation. We also highlight potential adaptation mechanisms of adipose tissue to detect the role of NE in gene expression in a sheep model of placental insufficiency and IUGR.
Placental development
In sheep, the uterus contains the caruncles, which are specialized regions of well vascularized, but non-glandular endometrium (Stegeman, 1974). During pregnancy, the developing chorionic epithelium joins to the raised surface of the caruncles, and this association provides the foundation for placentation in sheep. The sheep placenta has several of these discrete attachment sites comprised of the fetal cotyledon and maternal caruncle that are known as placentomes. At day 15 post coitus (p.c.), the allantois is expanded from the hind-gut allowing fusion with the chorion and providing placental vascularization in the areas of the caruncular projections (Stegeman, 1974). The placentomes continue to grow, as pregnancy progresses, and develop deeply branched crypts into which the fetal villi branch and project within the maternal crypts (Steven, 1975). The villous tree of the sheep cotyledon can be divided into stem, intermediate and terminal villi (Leiser et al., 1997), and the fetal vessels within the villi are comprised of stem arteries and veins, intermediate arterioles and venules, and terminal capillaries.
Insufficient placental growth has been associated with a reduction in the number of placental villous as well as diameter and surface area, along with reductions in villous arterial number, diameter and degree of branching. This altered placental villi morphology is associated with
13 deficient placental vascular development characterized by an initial phase of vasculogenesis, followed by branching and then non-branching angiogenesis (Benirschke et al., 2012).
The placenta is a metabolically active organ that utilizes nutrients and oxygen at rates similar to the fetus allowing its own growth. Then, an adequate nutrient transfer capacity of the placenta is needed for placental development and growth and plays a critical role in fetal growth to reach its potential.
Even though the human does not have a cotyledonary placenta, it has a large discoid area which possess a similar structural division. Moreover, in both species the villous tree is structurally similar because it can be divided into stem, intermediate and terminal villi, and within the villi, the fetal vessels are comprised of stem arteries and veins, intermediate arterioles and venules, and terminal capillaries (Leiser et al., 1997). These similarities in fetal placenta vascular structure allows the sheep to serve as a useful model of placental vascular development and placental nutrient exchange, especially in compromised pregnancies where the study of maternal-fetal interactions are highly relevant (Barry & Anthony, 2008). For instance, the pregnant ewe is a long- standing animal model to study IUGR in fetuses induced by placental insufficiency due to undernutrition. Like humans, IUGR sheep fetuses have lower circulating concentrations of anabolic hormones such as IGF1 and IGF2 leading to a 15-50% reduction in birth weight followed by accelerated neonatal catch-up growth (Estal et al., 2016). Moreover, similar to humans, IUGR offspring sheep have enhanced fat deposition in early life, which may contribute to later development of diseases such as T2D due to impaired insulin secretion and poor insulin sensitivity (De Blasio, et al., 2007).
14 Adipose tissue development
Adipose tissue development in humans
The development of adipose tissue begins in utero, with the adipocyte lineage being derived from stem cell precursors, which can become white adipose tissue (WAT) or brown adipose tissue
(BAT) (Smas & Sul, 2015). Both of these forms of adipose tissue have critical functions. BAT can generate large amounts of heat while WAT represents an endogenous energy storage that secretes hormones that regulate appetite and energy homeostasis (Friedman & Halaas, 1998).
The fat lobules are the earliest fat structures that can be identified before the appearance of vacuolated fat cells. As demonstrated in humans, formation of adipose tissue occurs between the 14th and 16th week of gestation and is found in breast, neck, and abdominal wall. Perirenal fat develops by the 15th week of gestation around the fascia and the aorta, and is completely differentiated after the 21st week of gestation (Poissonnet et al., 1984). Development of fat lobules over back and shoulders occurs by 15 weeks of gestation. After the 23rd week, preadipocytes proliferation occurs, while from 23rd and 29th week, the growth of adipose tissue is determined by an increase in size in fat lobules. In contrast, adipocytes are detectable at 28th weeks of gestation (Poissonnet et al., 1983). In humans, mean fetal fat volume at 34 weeks was
541±348 cm3 and calculated fetal weights was 2430±270 gr (Anblagan et al., 2013). BAT composes only 2-4% of total body weight at birth, given that the high energy cost of fat deposition together with its thermogenic capacity are maximal at birth (Clarke et. al., 2017).
15 Adipose tissue development in sheep
Lipid locules are seen in the cells of the perirenal region on day 70. Locules are formed in the endoplasmic reticulum of the pre-adipose cell surrounding the capillaries. At this time, lower number of mitochondria are seen but increase by day 90. Lipid locules increased in number and size from day 70 to day 90. The number of lipid filled cells increases from day 90 until day 130.
BAT and WAT adipocytes mature up to term and are characterized as containing both unilocular and multilocular cells. BAT reverts to WAT postnatally as the need for non-shivering thermogenesis decreases (Rutter et al., 1972). As an example, lambs are born with almost 100%
BAT (Gemmell et al., 1972) and majority of adipose tissue is located around the kidneys (Symonds et al., 2012; Symonds et al., 2003).
In sheep, fetal adipose tissue deposition occurs primarily during late gestation (Symonds and
Stephenson, 1999), with approximately 20-30 gr of adipose tissue at birth mostly around perirenal-abdominal region, constituting at least 80% of total fat stores postnatally. Precocial offspring such as humans and sheep that are born after a long gestation demonstrate maturation of the hypothalamic-pituitary-adrenal (HPA) axis before birth and following cold exposure from the extra-uterine environment rapidly switch on nonshivering thermogenesis (Symonds et. al.,
2005). There are four phases of adipose tissue transition; initial early proliferative period that is followed by a preparative phase pre-empting the imminent thermogenic requirement. In the third phase uncoupling protein (UCP1) 1 is highly expressed. Lastly, UCP1 expression is lost, and transition of BAT to WAT occurs, exhibiting lipid accumulation and endocrine regulation.
16 Proliferative phase in early-mid gestation
Appearance of fetal adipose tissue is characterized by rapid cellular multiplication accompanied with maximal expression of KI-67, a marker of cellular proliferation (Scholzen & Gerdes, 2000).
The perirenal depot becomes established from precursor cells, and replication of preadipocytes increases the cell pool resulting in increased depot size. Lower numbers of adipocyte marker genes are expressed in this stage (Pope et al., 2014).
Preparative phase
Growth of perirenal-abdominal depot up to term (Lynne Clarke, Bryant, Lomax, & Symonds,
2005) is mediated by PRDM16 and C/EBPβ, which form a transcriptional complex critical for adipogenesis (Kajimura et al., 2009). This phase is primarily characterized by higher expression of
UCP1. This process is enhanced by appearance of endocrine stimulatory factors including adrenergic receptors and triiodothyronine, which act to maximize the amount and thermogenic potential of UCP1 (Symonds et al., 1995).
Birth and non-shivering thermogenesis
Before birth, the adipose depot contains a large number of lipid filled cells, which become depleted postnatally when heat production is maximized (Clarke et al., 2017). Subsequently, expression of adiponectin, leptin and receptor-interacting protein 140 (RIP140) falls significantly and marked loss of prolactin receptor (PRLR). This phase is also characterized by peak abundance of UCP1 (Pope et al., 2014). This process is coincident with an increase in C/EBPβ and Bone morphogenetic protein 4 (BMP4) that could be indicative of the transition to a WAT-like
17 phenotype (Li, 2004).
The loss of UCP1 and accumulation of lipid within the perirenal-abdominal depot
The final phase from 7 to 30 days of age coincides with the loss of UCP1 expression (Clarke et. al.,
1997) and the depot develops WAT characteristics like lipid filled adipocytes. Adipocyte size increases and peak expression for a number of genes characteristic of mature adipocyte occurs, including leptin, adiponectin, and RIP140, together with PPARγ, BMP7, the glucorticoid receptor
(GR2) and HOXC9. The loss of UPC1 is accompanied by a decline in genes associated with BAT
(Hallberg et al., 2008). PPARγ may play a role in depot whitening due to capacity to induce mesenchymal progenitor cells to differentiate into white adipocytes (Ahfeldt et al., 2012).
Increase in cell size together with the loss of a BAT phenotype are seen in this phase (Pope et al.,
2014).
Physiology of adipose tissue
Adipose tissue regulates various physiological and pathological processes by functioning as an endocrine and paracrine organ. WAT composes between 3% and 70% of body total weight and it develops during late gestation. WAT is distributed through the body in two major fat depots: subcutaneous and visceral (Mirza, 2011). In humans, subcutaneous depots consist of fat under the skin, particularly in abdomen, thighs and buttlocks. Visceral, depots consist in fat located in omental, perirenal, retroperitoneal, mesenteric and pericardial fat stores (Cook & Cowan, 2009).
Increased visceral adipose tissue is associated with obesity and metabolic abnormalities (Parlee et al., 2014). WAT adipocytes regulate energy balance, by storing triacylglycerol that provides long-term fuel reserve and can be mobilized during starvation and release fatty acids for
18 oxidation in other organs (Large et al., 2004; Lefterova & Lazar, 2009). WAT is mainly composed of unilocular adipocytes containing a large lipid droplet that pushes the cell nucleus to the edge of the membrane (Albright & Stern, 1998). Mature WAT can be characterized by an increased expression of insulin sensitive glucose transporters (GLUT4), and enzymes like glycerol-2- phosphate dehydrogenase and fatty acid synthase (FAS) (Spiegelman et al., 1983).
BAT is specialized on dissipation of energy through the production of heat and, thus in energy expenditure and body weight regulation (Cannon & Nedergaard, 2004; Large et al., 2004). BAT is the primary site for thermogenesis in mammals (Cannon & Nedergaard, 2004), especially cold- induced thermogenesis in humans. BAT is activated by cold, which is mediated by sympathetic nervous system. BAT is capable of producing up to 300 times more heat per unit mass compared to different tissues (Power, 1989). Additionally, BAT is characterized by the dark color compared to WAT that comes from its greater vascularization and mitochondria content (Afzelius, 1970;
Saely et al., 2011). BAT is composed of multilocular adipose cells that contain many small vacuoles of lipid and large mitochondria with packed parallel cristae (Napolitano, 2004), where
UCP1 resides. In sheep, it is essential that BAT is mature immediately after birth as the onset of non-shivering thermogenesis is essential to prevent hypothermia. UCP1 is a BAT-specific marker
(Borensztein et al., 2012) because it makes BAT capable of altering energy expenditure by allowing the mitochondria membrane potential to be transduced to heat (Porter, 2017). Also,
BAT appears to have denser nerve supply compared to WAT (Cinti, 2009).
19 Hormone regulation of adipose tissue
Leptin
Leptin is synthesized and secreted by adipose tissue to regulate satiety and feeding behavior.
Leptin stimulates a negative energy balance by reducing food intake, increasing energy expenditure (Ahima & Flier, 2000) and normalizing blood glucose levels. It acts by binding to specific central and peripheral receptors in adipose tissue, liver, hypothalamus, and β-cells
(Auwerx & Staels, 1998). Leptin receptors are expressed in a number of specific brain regions, which binds to neuropeptide Y (NPY) neurons producing a feeling of satiety and inhibit food intake. The hypothalamus plays a critical role in the control of energy balance and control of appetite (Wang et al., 2013). Under normal physiological conditions, plasma leptin concentrations reflect adiposity and in obese individuals elevated plasma leptin concentrations are present (Garibotto et al., 1998).
Studies have shown that appetite dysregulation contributes to the obese phenotype in IUGR newborns (Coupé, Amarger, Grit, Benani, & Parnet, 2010). Also, previous studies on IUGR indicate dysfunction at several aspects of the satiety pathways, as evidenced by reduced satiety and cellular signaling response to leptin (Desai, Gayle, Han, & Ross, 2007). In obesity, higher levels of leptin are seen, and brain does not respond to leptin, thus, leptin no longer adequately regulates energy expenditure and become leptin resistant.
Adiponectin
Adiponectin is produced by both the placenta and the fetus suggesting that this adipokine may play an important role regulating fetal growth (Tsai et al., 2004). Adiponectin is predominantly
20 expressed and secreted from adipose tissue and has several functions: it increases energy expenditure, insulin sensitivity, fatty acid oxidation and glucose production in the liver (Fruebis et al. 2001, Qi et al. 2004, Yamauchi et al., 2001). It mediates fatty acid metabolism by induction of AMP-activated protein kinase (AMPK) phosphorylation and increasing peroxisome proliferative-activated receptor (PPAR)-α expression through adiponectin receptor (AdipoR) 1 and AdipoR2. Activating PPAR gamma coactivator 1 alpha (PGC-1 α) and upregulating the uncoupling proteins are involved in energy consumption (Y. Kim & Park, 2019).
Adiponectin acts on adipocytes to increase glucose uptake and promote adipose expansion. Luo
(2005) proposed that adiponectin acts locally to maintain adipocyte size and mass around an equilibrium set point. Therefore, after weight loss, smaller adipocytes secrete more adiponectin, thus, returning adipocytes to their baseline size by promoting adipocyte differentiation and accumulation. The high fetal adiponectin concentrations may be attributed to the lack of negative feedback on production of adiponectin, resulting from the lack of adipocyte hypertrophy, low percentage of body fat, or a different distribution of fetal fat depots (Kotani et al., 2004)
Developmental origins of adult disease
Hales and Barker (1992) proposed the “thrifty phenotype” hypothesis to explain adaptive sparing responses when fetal nutrition was poor. This response optimizes the growth of key body organs to the detriment of others and results in an altered metabolism, which enhances survival during periods of undernutrition (Hales & Barker, 1992) . However, the thrifty phenotype becomes detrimental if the fetal environment is not matched after birth. Therefore, developmental
21 adaptations in metabolic and/or hormonal milieu increases the susceptibility to obesity by perturbing homeostatic regulatory mechanisms (Barker et al., 2002; Hales & Barker, 2001).
Therefore, insulin resistance, elevated triglycerides and hypertension, characterize obesity and these disorders are linked by a dysregulation of adipogenesis and lipid metabolism (Reilly &
Rader, 2003). Although the thrifty phenotype does not explain all aspects of fetal programming, the hypothesis has been expanded to the developmental origins of adult diseases (Gluckman et al., 2016).
Developmental plasticity rather than fetal programming may be more appropriate to explain the adaptive response in the fetus. Developmental plasticity is defined as the ability of a single genotype to produce more than one alternative form of structure, physiological state, or behavior in response to environmental conditions (Barker, 2004). The plastic or programmed responses made during development that have immediate adaptive advantage act to limit the range of postnatal adaptive responses to a new environment (Gluckman & Hanson, 2004).
Plasticity may alter metabolic regulations on how humans and animals, expend and store energy leading to obesity.
Human evidence that links to obesity
Obesity is an accumulation of excessive body fat. Adiposity is associated with a state of low-grade inflammation, which interferes with adipocyte differentiation. These affects action of adiponectin and leptin and adipose tissue begins to be dysfunctional (Paniagua, 2016). Previous evidence showed that increased prenatal adipocyte differentiation and lipogenesis promotes the
22 development of obesity in IUGR offspring (Desai & Ross, 2011). Additionally, a reduction in the abundance of brown fat or an increase in white fat in early life would increase the risk of later obesity, especially if it is accompanied by increased adipocyte cell number. Studies have shown that dysregulated appetite contributes to obese phenotype in IUGR newborns (Desai & Ross,
2011). Targeted changes in utero nutritional environment could contribute to early perturbations in insulin/glucose signaling.
Evidence in rodents that links to obesity
Rodent models are highly used to study IUGR because the outcomes found in rodents closely resemble those in humans, with similar genes, biochemical pathways, organs, and physiology affected. In rats, uterine artery ligation (UAL) has been used extensively to study IUGR outcomes, as well as their mechanistic basis and intervention strategies. A severe restriction of nutrient and oxygen delivery to fetuses can be surgically induced through uni- or bi-lateral uterine artery ligation in late gestation (day 17 or 18, term ~day 21). A 15% reduction in placental weights has been reported in UAL rats. The placental restriction in nutrient supply to the fetus reduces transfer of glucose and amino acids and circulating IGF-I; also, a proportional reduction in pancreas weight and β-cell mass is observed. A reduced size at birth is followed by catch-up growth and increased fat deposition, although such effects on postnatal growth patterns are influenced by nutrition during lactation (Siebel et al., 2008; Simmons et al., 2001).
23 Evidence in sheep that links to obesity
Placental restriction (PR) leads to IUGR in the sheep, and it can be induced by maternal hyperthermia, maternal under- or overnutrition, administration of glucocorticoids (GC), utero- placental embolization, and carunclectomy (excision of uterine epithelium or caruncles).
Placental blood flow after PR is reduced between 40–70%; consequently, there is a reduction in fetal supplies of oxygen (25-40%) and nutrients such as plasma glucose (50%), and 50–60% reduction in fetal glucose turnover (Gatford et al., 2010). The ovine PR fetus has reduced circulating levels and expression of anabolic hormones such as IGF-I and IGF-II lowering 25% the size of birth. However, it is followed by accelerated neonatal catch-up growth, which occurs in association with increased insulin action (De Blasio et. al., 2007). In early postnatal IUGR sheep whole-body insulin sensitivity is not impaired, and glucose metabolism is enhanced in conjunction with catch-up growth; then, the enhanced insulin sensitivity of adipose tissue in these animals may contribute to their increased fat deposition (De Blasio, Gatford, Robinson, &
Owens, 2007).
Adipose tissue programming
Human and animal studies have focused on several intrauterine mechanisms that may program the fetal adipose tissue for later obesity. Studies included changes in fetal adipose tissue metabolism and morphology, altered appetite pathways, and modification of hormone levels and epigenome in the fetus that have been previously highlighted as critical regulators in obesity development following IUGR (Sarr et al., 2012). Although studies limited for adipocytes in IUGR offspring, programming of the adipose tissue is proposed to impact expression of PPARγ signaling
24 pathway which promotes adipose tissue differentiation. Furthermore, expression of adipogenic and lipogenic transcription factors such as PPARγ, PPARδ, the sterol regulatory element-binding protein 1 (SREBP1), C/EBPα, β, δ, and the expression of specific lipid-metabolizing enzymes such as FAS are all indicators of adipogenesis. These factors are part of a cascade in which PPARγ is the master regulator of adipogenesis (Ailhaud, 2002; Gregoire, 2017; MacDougald & Lane, 2003)
This review will help us understand how in utero environmental insults might generate endocrine responses, like elevated catecholamines affect fetal development.
PPAR signaling pathway
There are three PPARs: PPAR β/δ(NR1C2), PPARα(NR1C1) and PPARγ (NR1C3). By forming an heterodimeric complex with RXR, the PPAR- responsive regulatory elements control the expression of genes involved in lipid metabolism, adipogenesis, maintenance of metabolic homeostasis and inflammation (Barish et al., 2006). PPARα is predominately expressed in liver, heart and BAT where it plays a major role regulating fatty acid oxidation (Evans et al., 2004;
Poulsen et al., 2012). PPAR β/δ is expressed heart, liver and skeletal muscle regulating fatty acid oxidation (Barish et al., 2006; Poulsen et al., 2012). PPARγ is highly expressed in BAT and WAT and plays an important role regulating adipocyte differentiation. PPARγ is also a potent modulator of whole-body lipid metabolism and insulin sensitivity (Barak et al., 1999; Evans et al.,
2004). PPARγ controls the transcriptional activation of adipogenesis through ligand binding and interactions with coactivators and transcription corepressors (Rosen & MacDougald, 2006).
PPARγ is required for mature adipocyte function, as revealed by adipocyte death after few days of PPARγ ablation in mature adipocytes in mice (He et al., 2003; Imai et al., 2004). In mutant
25 animals, PPARγ null adipocyte die and be efficiently replaced by newly differentiated adipocytes
(He et al., 2003). In addition, PPARγ controls gene networks involved in glucose homeostasis, including increasing expression of c-Cnl-associated protein (CAP) to move into lipid raft on the cell surface and glucose transporter 4 (Glut4). PPARγ controls expression of factors secreted from adipose tissue such as resistin, leptin, adiponectin and tumor necrosis factor-α (TNF-α) and influence insulin sensitivity in adipocytes (Hollenberg et. al, 1997; Tomaru et. al, 2009).
Epigenetics of the Adipose Tissue
The thermogenic function of the adipocytes in response to various environmental stimuli relies on the activation of gene programming that are coordinately controlled by a set of unique transcriptional and epigenetic regulators (Inagaki et al., 2016). The principal adipogenic regulators involved in the differentiation of adipocytes are the PPARγ and (C/EBPβ) (Rosen &
Spiegelman, 2014). Expression of C/EBPβ and C/EBPδ is quickly induced within 4 hours post- differentiation in the mouse 3T3-L1 pre-adipocyte cell line (one of the best-characterized models of adipogenesis), and subsequently activates the transcription of PPARγ and CEBPα. A number of genes that define terminally differentiated adipocyte phenotypes are then coordinately induced when PPARγ and C/EBPα activate each other’s expression, and both PPARγ and C/EBPα are also important regulators of the adipocyte thermogenic programming (Kajimura, Seale, &
Spiegelman, 2010). Approximately 50 transcriptional and epigenetic regulators have been identified recently, which regulate positively or negatively the adipocyte development. Such regulators function mainly through four transcriptional regulators: PPARγ, C/EBPβ, PPARγ co- activator-1α (PGC1α) and PR domain zinc-finger protein 16 (PRDM16) (Inagaki et al., 2016).
26 Therefore, epigenetic mechanisms are considered of key relevance for adipose tissue development and remodeling, because the epigenome is characterized by its dynamic integration and memory of environmental signals and metabolic changes (Janke et al., 2015).
Environmental or external stimuli such as temperature and nutritional status modulate the expression and activity of epigenetic effectors. The transcription of thermogenic genes and adipocyte metabolic enzymes are affected by addition of chromatin-modifying enzymes (writers) or removing of epigenetic marks (erasers) on lysine (K) residues of histone H3, such as histone methylation (Me) or acetylation (Ac). Therefore, activation (+) or repression (−) of the thermogenic adipose program is modulated by epigenetics which allows the integration of various external stimuli contributing to energy homeostasis. Epigenetics and thermogenesis are regulated by intracellular metabolic pathways (Sambeat et al., 2017). Then, environmental signals can be sensed by adipose tissue that elicit lasting changes that affect systemic energy metabolism by different epigenetic mechanisms such as changes in histone modifications, DNA methylation patterns, and small noncoding RNA expression (Sun et al. , 2019). In human samples of adipose tissue, genome-scale DNA methylation analysis detected variably methylated regions that exhibited covariation with body mass index (BMI); also, these regions were located in close proximity or within genes known to regulate body weight (Feinberg et al., 2010).
27 In utero conditions that affect fetal developmental in fetal sheep with IUGR
A major cause of human IUGR and programming of health in later life is placental dysfunction.
Sheep models have been extensively used to directly test the role of restricted placental growth and function in later disease. Sheep models of PR show strikingly similar outcomes, particularly in regard to insulin action in later life, despite differences between sheep and human (De Blasio et al., 2007; Gatford et al., 2010). IUGR sheep and human offspring have reduced circulating levels and expression of anabolic hormones including IGF-I and –II; although size at birth is reduced, this is followed by accelerated neonatal catch-up growth in both species. Moreover, IUGR human and sheep have enhanced fat deposition in early postnatal life, which may contribute to later development of disease (De Blasio et al., 2007). Also, an insufficient insulin secretion relative to demand for insulin have been recently reported in IUGR sheep and human.
In sheep fetuses with placental insufficiency and IUGR, placental and fetal weights are reduced by approximately 50% near term when pregnant ewes are exposed to heat stress during mid- gestation. The placental weight reduction is a consequence of placentomes size not in number
(Thureen et al., 1992). There is an increase in fetal to placental weight ratio and relative sparing of fetal heart growth, also an increase in the ratio of brain to liver weight (Galan et al., 2001;
Regnault et al., 1999). Fetal arterial oxygen concentrations are lower in the IUGR fetus of the hyperthermic ewe, and fetal hypoxemia is commonly found in both sheep models of placental insufficiency and human fetuses with PR (Anthony et al., 2003). Glucose is the primary substrate for both human and sheep fetuses (Battaglia, 1986). The fetal glucose supply is dependent on placental glucose transport, which is reduced in IUGR sheep fetuses with hyperthermia-induced
28 placental insufficency (Thureen et al., 2017). Lower oxygen and glucose concentrations contribute to lower plasma insulin concentrations in IUGR fetuses (Limesand et al., 2006). In contrast, plasma NE and E concentrations are significantly higher in IUGR fetuses (Limesand et al., 2006).
Action of Catecholamines
Endocrine factors, such as catecholamines, may play an important role in fetal nutrient redistribution and impact postnatal metabolism (Green et al., 2010; Leos et al., 2010). IUGR chronically elevated catecholamine concentrations during placental insufficiency (Leos et al.,
2010; Limesand et al., 2006). This response may cause adrenergic desensitization in adipose tissue, lowering adrenergic stimulated lipolysis, which can result in increased risk for childhood obesity (Chen et al., 2010b). Alternatively, catecholamines inhibit insulin secretion in the PI-IUGR fetus (Yates et al., 2011). Inhibition of insulin secretion is due to activation of the α2-adrenergic receptors on pancreatic β-cells (Jackson et al, 2000; Leos et al., 2010). These implicate both direct and indirect action may be involved in catecholamine regulation of glucose metabolism.
Catecholamines are released from the adrenal medulla and serve as major regulators of intermediary metabolism and stimulate energy mobilization (Carmen & Víctor, 2006). In contrast to hypothalamic stimulation via the splanchic nerve, low oxygen levels stimulate chromaffin cells in adrenal medulla via inactivation of oxygen-sensitive potassium channels (Adams & McMillen,
2000). Previous studies have shown the presence of oxygen-sensitive K+ channels in chromaffin
29 cells (Rychkov et al., 1998). Catecholamine exocytosis is due to a change in potassium concentration which favors membrane depolarization (Comline & Silver, 2017).
Conclusion
The pregnant sheep is a well defined model for studying human intrauterine conditions, fetal development, and neonatal outcomes. The relative developmental milestones of the sheep fetuses are similar to those of the human fetus. Additionally, the sheep fetus is tolerant of surgical and experimental manipulation due to high placental progesterone production in late gestation, and their large size allows for greater volume and frequency of blood and tissue sampling
(Anthony et al., 2003). Sheep model recapitulates pathologies of the IUGR human fetuses.
Maternal hyperthermia produces placental insufficiency, thus recreating the most common cause of IUGR in humans and animals. Fetal adipose tissue deposition occurs primarily in late gestation (Symonds & Stephenson, 1999) and serves as an endocrine and paracrine organ.
Adipose tissue regulates energy balance by storing triacylglycerol that provides fuel for other organs during starvation and serves as a primarily source of heat production. Thus, adipose tissue development is important for later functions. Catecholamines regulate fatty acids release by enhancing lipolysis. Understanding the importance of catecholamines effect of adipose tissue development could help us understand adipose tissue dysfunction exposed to higher concentrations of catecholamines in late gestation.
30 CHAPTER 2. NOREPINEPHRINE SPARES ADIPOSE TISSUE IN OVINE FETUSES COMPLICATED WITH PLACENTAL INSUFFICIENCY
Introduction
Placental insufficiency often causes intrauterine growth restriction (IUGR) resulting in fetal hypoglycemia and hypoxia (Hay et al., 2013). IUGR is a common obstetrical complication that is a major cause of perinatal and neonatal morbidity and mortality, but also contributes to greater long-term risk of cardiovascular disease and metabolic syndrome (Kesavan & Devaskar, 2019). In addition, at the onset of fetal hypoxemia and hypoglycemia, plasma catecholamines such as epinephrine and norepinephrine (NE) concentrations are elevated (Limesand et al., 2007; Leos et al., 2010) which provoke endocrine responses that lower plasma insulin concentrations
(Economides et al., 1989; Leos et al., 2010).
Chronically elevated catecholamine concentrations in the IUGR fetus causes adrenergic desensitization in adipose tissue, lowering adrenergic stimulated lipolysis and provoking fat storage (Chen et al., 2010). Adipose tissue serves as lipid storage and has endocrine functions such as synthesis and secretion of adiponectin and leptin, which regulate glucose and fatty acids to maintain energy balance and metabolism. Alterations in adipose tissue deposition increase the risk of developing obesity, especially if this is accompanied by greater numbers of adipocyte cells (Spalding et al., 2008). Impairment in lean growth after birth predicts greater adiposity later on life (Cameron & Demerath, 2002).
Increasing evidence indicates that high concentration of NE regulates adipose tissue metabolism.
Such regulation is supposed to involve several genes associated to NE biological activity.
31 The peroxisome proliferator-activated receptors (PPAR) is a group of ligand-activated nuclear receptors that play a vital role in fetal programming involving a variety of tissues and organs (Vo
& Hardy, 2012). For instance, PPARγ is highly expressed in brown adipose tissue (BAT) and white adipose tissue (WAT), which plays an important role regulating adipocyte differentiation and is a potent modulator of whole-body lipid metabolism and insulin sensitivity (Barak et al., 1999; Evans et al., 2004).
The objective of this study was to identify molecular mechanisms underlying the effects of elevated NE concentrations on perirenal adipose tissue from PI-IUGR fetuses. Our hypothesis states that genes from the PPAR signaling pathway underlie molecular effects of NE on adipose tissue from PI-IUGR fetuses. In order to test the hypothesis, PI-IUGR was induced by maternal hyperthermia from days 40 to 90 of gestation. IUGR and control fetuses at 65 % gestation were randomly assigned to a sham or bilateral adrenal demedullation. High-throughput RNA sequencing (RNAseq) was performed to identify differentially expressed genes among groups.
These genes will enable to detect molecular basis underlying the role of NE on adipose tissue and will serve to model functional pathways.
Then, transcriptome analyses and PCR gene expression should be performed to identify molecular pathways and genes that regulates NE function on adipose tissue from fetuses exposed to IUGR.
32 Materials and Methods
Ethical Approval
All animal protocols were approved by the Institutional Animal Care and Use Committee and were conducted in accordance with the Guide for the Care and Use of Laboratory animals. Animal experiments were performed at The University of Arizona Agricultural Research Complex
(Tucson, AZ, USA) in facilities approved by the Association for Assessment and Accreditation for
Laboratory Animal Care International.
Animal Preparation
Columbia-Rambouillet cross-bred ewes carrying singleton pregnancies confirmed by ultrasound were purchased from Nebeker Ranch. Ewes were randomly assigned to one of two experimental groups, control (n=7) or IUGR (n=7). Control group was maintained in a thermoneutral environment (25°C), and placental insufficiency was induced in IUGR group by exposing pregnant ewes to environmental hyperthermia (40°C for 12h; 35°C for 12h; relative humidity of 40±5%) from 39±2 to 96±5 days of gestational age (term=150dGA) (Macko et al., 2016). Both groups of ewes were pair-fed Standard-Bread alfalfa pellets (Sacate Pellet Mills) to eliminate dietary effects and had libitum access to water.
Surgical Preparation for Adrenal Demedullation
Control and IUGR ewes were randomly assigned to undergo bilateral adrenal demedullation (AD) or a sham (intact) surgical procedure at 98±1 dGA. To perform the AD, adrenal glands were
33 isolated via retroperitoneal incisions and cauterized the inner medullary tissue with a straight electrode. The cortex remained intact and was confirmed by immunohistochemistry (Macko et al., 2016). At 121±1 dGA, a second surgery was performed to place indwelling arterial and venous catheters for blood sampling. Ewes were allowed to recover for at least one week prior to the in vivo experimental procedures.
Postmortem Examination
Ewes and fetuses were euthanized on 134±1 dGA with intravenous concentrated sodium pentobarbital (86mg/kg) and phenytoin sodium (11mg/kg, Euthasol; Virbac Animal Health). Fetal body weights and organ weights were measured and perirenal adipose tissue was collected. All tissues collected were snap frozen in liquid nitrogen and stored at -80C until RNA and protein were extracted.
Biochemical Analysis
Arterial blood was collected in EDTA-lined syringes (Sigma-Aldrich Co). Glucose concentration was determined with YSI model 2700 SELECT Biochemistry Analyzer (Yellow Springs Instruments,
Yellow Springs, OH, USA) and blood gases were analyzed with an ABL 720 (Radiometer,
Copenhagen, Denmark).
Plasma hormone concentrations were measured and determined by an ELISA for norepinephrine
(Labor Diagnostika Nord GmbH & Co., KG, Germany); intra- and interassay coefficients of variations, 6% and 14%; sensitivity 25pg/ml), cortisol (Oxford Biomedical Research; sensitivity
34 0.07 ng/mL; intra- and interassay coefficients of variation, 3% and 6%), and epinephrine (Labor
Diagnostika Nord; sensitivity 8.3 pg/mL; intra and interassay coefficients of variation, 11% and
17%) (Macko et al., 2016).
RNAseq analysis
RNA was isolated using a Microprep RNeasy (Qiagen, Hilden, Germany). High throughput sequencing was performed by the University of Arizona Genetics Core in RNA samples. Cluster generation was conducted with the Illumina TruSEquation 100bp PE (paired end) cluster kit before running on the Illumina HiSeq2500 (four subjects/lane; two control and two IUGR).
Double-stranded complementary DNA (cDNA) libraries were generated by the RNA template by reverse transcriptase. cDNA with ligated sequencing adapters were constructed using the
Illumina TruSeq RNA Sample Prep Kit (Illumina Inc., San Diego, CA).
Alignment of cDNA sequencing reads was performed in TopHat. Subsequently, transcriptome assembly and differential gene expression were performed in Cufflink programs following a standard protocol. Bowtie2 (version 2.1.0) and TopHat (version 2.0.1) were used to align paired- ends reads to the reference ovine (Ovis_aries.Oar_v3.1.74.toplevel.fa, Ensembl release 74) and bovine (bos taurus, UMD 3.1, Illumina iGenomes) genomes. To improve overall read mapping rate and pair mapping without inflating multiple alignments, titration was determined following parameters: anchor mismatch (-1), anchor length (-15), mismatch (-3), intron length (-50,000), and read gap length (-4). Furthermore, additional TopHat parameters were selected for the final analysis including read-edit-distance (-7) and read-realign-edit-distance (-0). The pair-read numbers were ranged from 30 to 60 million pairs and were mapped with 86% to 88% overall
35 mapping rate, with 76% to 79% concordant pair alignments. All aligned reads were assembled into transcripts base on Ensembl Ovis Aries release-74 using Cufflinks, version 2.1.1. Transcripts were assembled using only release 74 annotated transcripts without novel transcript discovery.
The maximum number of reads allowed for a single locus (parameter: max-bundle-frags) was set to 25 million to capture the highly abundant transcripts expected from specialized endocrine organs. The program CuffDiff was used to determine differential gene expression using the fragment bias correction and a minimum alignment count of 24. For statistical analysis, library normalization used the geometric method, and the cross-replicate dispersion estimation used the pooled method. The significance cutoff after multiple testing correction (Q value) was 0.05.
The bioconductor package CummeRbund was used to visualize the results. The normalized gene expression is represented as fragments per kilobase exon per million reads mapped (FPKM).
Gene ontology terms and pathways for differentially expressed (DE) genes were identified with
KOBAS, version 2.0. Results were performed using Fisher’s exact test with the Benjamini
Hochberg correction, and significance is presented as P<0.05. Thus, DE genes were further analyzed with online tools agriGO and ReviGO.
Quantitative real-time PCR (qPCR)
Synthetic oligonucleotide primers were designed from the sheep genome in Primer Blast.
Synthetic oligonucleotide primer sequences and gene accession numbers are provided in Table
1. Optimal annealing temperatures for primers were determined with PCR. The primer specificity at this temperature was confirmed by nucleotide sequencing the cloned PCR product (pCR 2.1-
36 TOPO vector, catalog no. K451020; Thermo Fisher Scientific Life Sciences, Waltham, MA). Primer efficiencies were measured with serial cDNA dilutions.
RNA was isolated from tissue using a RNeasy Lipid Tissue Mini kit (Qiagen, 74804). RNA concentrations were determined with a NanoDrop spectrometer. RNA clean up of perirenal adipose tissue was performed with RNeasy kit (Qiagen 74104). The relative expression of PDK4,
PFKFB4, ME3, HMOX1, GLUT1, IGFBP5, IGFBP7, ADIRF, PCK2, SCP2, PPP1R1B, ACOX2, SLC27A6,
C/EBPa, SREBF1 and PPARg mRNA transcripts was measured by reverse transcriptase polymerase chain reaction (RT-PCR) using SYBR Green (Qiagen, Valencia, CA, USA) in an iQ5 Real-Time PCR
Detection System (Bio-Rad Laboratories, Hercules, CA, USA). After the initial denaturation (95°C for 15 min), all reactions went through 40 cycles of 96°C (30s), annealing temperature (30s; Table
1), and 72°C (10s), at which point the fluorescence intensity was measured. Melt curve analysis, starting at 60°C with an increase of 0.2°C every 6s to 96°C, was performed at the end of the amplification to confirm product homogeneity. Optimal annealing temperature gradient (54-
62°C) was used.
PCR efficiency was determined with gene-specific plasmid DNA, for which threshold cycles (Ct) were linear over concentrations varying by eight orders of magnitude. Samples were ran in triplicate. All the results were normalized to the reference genes (GAPDH, S15 and TBP) using the comparative Ct method (Ct gene of interest – Ct reference genes mean), and fold change was determined.
37 Table 1. Oligonucleotide primer sequences and quantitative PCR parameters for ovine genes Product Annealing Gene name Foward (5'->3') Reverse (5'->3') length (bp) temperature ACOX2 CAGCGCTTGGCTGTTATGATG GGCTCTCCGGCCTTGTAATAG 131 62 CCC AGA GGA CCA AAA GG GGG TCA GCT GTA CAG GCA PDK4 126 62 CAT TC ADIRF CCCCTGGTCTGGGTAAGGTAG GTGGCCTGATCCACCACTTG 166 62 TTG TCG AGT CCA TCT GTG TAA TAC AC GATG CGG CTC PFKFB4 262 62 TGG TGG GAA GTT CCT GCC CAT CGT TCG TCT TCT GGC CAA GAG ME3 147 60 GTA TTC PPP1R1B CCACCTCAAGTCGAAGAGACC TCACCCACATTGCTGATGGAC 108 55 AACATCTGAGGAGCAACTGG SCP2 TGTGTCTTGGCTCTTGGGTTT 146 55 G AGTGCTTGTGGCAAGACAAA PCK2 TGTCAAACCTCATCCAGGCAA 100 60.6 C SLC27A6 TCCCTTCTTTGGCTATGCTGG GTCTCCAATCCGGTCCCAAAA 151 60.6 C/EBPα CCCCGACAGGAGCAAGGT GGTTCAAAGCCCCAAGT 114 55 ATGAGACATCCCCACAGCAA PPARγ GAAGAGCCTTCCAACTCCCTC 234 62 G TACATCCGCTTCCTTCAGCACA SREBF1 TCCACCACCTCGGGCTTCAT 164 62 G CTCCTGGAGTCGCTGAACATA HMOX1 GGAGAACCCTGTCTACACTCC 154 55 G GAG CTG ATT CCC AAG TGT AAA TCC TGG AGC CGT TAA GLUT1 195 62 GAG TGT TCG TGC GGC GTC TAC ACT GAG TAG GTC TCC TCC GCC IGFBP5 203 61 GAG ATC TGG TGC CCA GGT GTA TTT TCT GAA TGG CCA GGT TGT IGFBP7 140 62 GAG CTC TGG AGG GAC TTA TGA CCA GAPDH AGC CTA GAA TGC CCT TGA GAG 60 CTG ATC ATT CTG CCC GAG ATG TGC TTT ACG GGC TTG TAG S15 134 60 GTG GTG AGA ATA AGA GAG CCC CGC TTC ACA TCA CAG CTC CCC TBP 188 60 AC AC
DNA extraction and measurement of perirenal adipose tissue triglyceride
Total DNA was extracted with DNeasy blood and tissue kits (Qiagen 69504). The DNA products were re-suspended in AE buffer and the integrity and concentrations were measured by spectrophotometry with a Nano Drop Spectrophotometer ND-100 (Thermo Fisher Scientific).
38 Total DNA concentration of perirenal adipose tissue was calculated per grams of tissue (DNA/g).
Perirenal adipose tissue was used to measure triglyceride accumulation using an enzyme (lipase)- coupled colorimetric assay kit (MAK040, Sigma-Aldrich), according to the manufacturer's instructions. The amount of triglyceride present in samples was determined from plotting a standard curve and was calculated in mmole per miligram of tissue (mmole/mg).
Statistical Analyses
A mixed effects model was used to analyze oxygen, glucose, insulin, epinephrine, norepinephrine, and cortisol, as well as fetal, perirenal weight and perirenal to fetal weight ratio between groups (control and IUGR) and treatments (sham and adrenal demedullation); the model included groups and treatments as fixed terms, and lamb as random effect. Significant differences among treatments were analyzed by ANOVA and post hoc LSD test utilizing general linear means procedures in the Statistical Analysis System (SAS Institute, Cary, NC, v9.2, 2008). Statistical analysis of qPCR data was performed on the DCt values.
39 RESULTS
Fetal measurements
Fetal arterial blood oxygen content and plasma glucose, epinephrine, NE, insulin, and cortisol concentrations are presented in Table 2. Between control groups, adrenal demedullation had no effect on oxygen, glucose, insulin, epinephrine, NE and cortisol concentrations. Blood oxygen content was lower (p<0.05) in IUGR-SH and IUGR-AD fetuses compared to control groups. IUGR-
SH fetuses had lower plasma glucose and insulin concentrations compared to control-SH.
Epinephrine and NE concentrations were higher in IUGR-SH compared to IUGR-AD and controls and not different between IUGR-AD and control groups. Plasma cortisol concentrations were not different among groups.
Table 2. Fetal blood measurements for experimental groups. Values are means (±SEM) different superscripts denote statistically significant differences among groups (p<0.05)
Treatment groups Control-SH(n=8) Control-AD(n=8) IUGR-SH(n=8) IUGR-AD(n=7)
Oxygen mmol/l 3.6±0.2 a 2.9±0.3 b 1.9±0.2 c 2.0±0.2 b Glucose mmol/L 1.1±0.1 a 1.0±0.11 a 0.64±0.1 b 0.67±0.1 b Insulin ng/mL 0.4±0.1 a 0.32±0.05 ac 0.11±0.02 b 0.2±0.1 bc Epinephrine pg/mL 19.9±5.2 a 12.91±6.1 a 202.36±30.8 b 27.94±15.2 a Norepinephrine pg/mL 708.2±180.2 a 221.3±23.8 a 3242.5±622.4 b 611.79±100.1 a Cortisol ng/mL 10.5±1.3 7.5±1.5 12.4±3.1 12.4±3
Body weights were lower (p<0.05) in IUGR-SH and IUGR-AD fetuses compared to control-SH fetuses. The IUGR-AD fetuses weighed more than IUGR-SH. Perirenal adipose tissue mass was less (p<0.05) in IUGR-SH fetuses compared to controls. However, perirenal adipose weight
40 relative to total body weight (g/kg) was greater (p<0.05) in IUGR-SH fetuses compared to IUGR-
AD and control fetuses (Figure 1).
Figure 1. Postmortem fetal and adipose tissue weights. Means (±SEM) for fetal bodyweight (A), perirenal adipose tissue weight (B), and perirenal adipose tissue weight relative to bodyweight (C) are graphed for control-sham (SH), control-adrenal demedullation (AD), intrauterine growth restriction (IUGR)-sham (SH), and IUGR-AD groups. Error bars represent the SEM, and different superscripts denote statistically significant differences among groups (p<0.05).
41 Perirenal Adipose Tissue DNA and triglycerol content
The DNA content per gram of tissue was greater in IUGR-SH perirenal adipose tissue compared to control-SH, control-AD and IUGR-AD, which were not different among each other. Triglycerol
(TG) content was not different among experimental groups.
Figure 2. DNA and triglycerides content. The average DNA (µg) content (A) and tryglycerides (mmole) content (B) per gram of tissue in perirenal adipose are graphed for control-sham (SH), control-adrenal demedullation (AD), intrauterine growth restriction (IUGR)-sham (SH), and IUGR- AD groups. Error bars represent the SEM, and different superscripts denote statistically significant differences among groups (p<0.05).
Transcriptomes of Perirenal Adipose Tissue from IUGR and control fetuses.
High-throughput RNA sequencing results from control and IUGR fetal adipose detected 12,147 expressed genes that were annotated in the sheep genome. Data have been deposited in the
National Center for technology Information’s Gene Expression Omnibus (accession no.
42 GSE132734). Perirenal adipose tissue had abundant relative expression of genes associated with fat trafficking and lipid storage, consistent with expectations that the majority of gene expression represents adipocytes. Variation in gene expression was visualized using a multidimensional scaling (MDS) plot (Figure 3A) that revealed separation between controls and IUGR samples with the exception of one control sample that had gene expression more similar to IUGR samples. This control did not have any remarkable differences in fetal measurements, gestational age, or fetal weight. The similarity of gene expression measured by the Jensen-Shannon distance is similar to the MDS plot (Figure 3B). Sex effects were not evaluated because control and IUGR samples were all from male fetuses but the inclusion of a single female in the IUGR-AD group did not appear to influence global transcriptome expression.
43
Figure 3A. Multi-Dimensional Scaling (MDS) is a visualization technique for proximity data, that is, data in the form of N × N dissimilarity matrices. MDS converts N dimensional description of the relationship between samples into a lower dimensional plot that can be easily visualized. Samples with similar characteristics are in close spatial proximity than less similar samples.
44
Shannon Distance) Shannon - Relative Similarity (Jensen Similarity Relative
Figure 3B. Dendrogram of Gene Expression Similarity between RNAseq samples based on normalized gene expression. The dendrogram visualizes the Jensen-Shannon distances between conditions based on whole transcriptome, normalized gene expression. The Jensen-Shannon divergence for one Control-Sham and one IUGR-DM clustered more closely with the other groups, but was not attributed to fetal sex, age, or fetal weight.
In IUGR-SH adipose tissue compared to control-SH tissue, there were 594 (Figure 6) differentially expressed (DE) genes (4.8% of the total number of annotated genes expressed in adipose tissue).
There were 325 genes downregulated and 266 genes upregulated in perirenal adipose tissue from IUGR-SH fetuses compared to controls as represented in a volcano plot (Figure 4). Of the
DE genes, 47 were identified only as novel transcripts, but the majority of these genes were subsequently defined using ortholog database search to bovine or human.
Functional analysis of 593 DE genes in the IUGR-SH versus control-SH comparison revealed significant enrichments in GO terms related to fat cell differentiation, lipid metabolic process and fatty acid transport. Pathway analysis revealed 23 significantly enriched pathways in genes altered by IUGR-SH.
45
Figure 4. Volcano plots of genes detected by RNAseq in fetal perirenal adipose tissue. The condition comparison is specified by title. Fold change is presented on the x-axis (Log Base 2) and the P-value (negative Log Base 10) is represented on the y-axis. Each dot represents a gene, with red dots denoting genes with significant (Corrected P<0.05) differential expression between conditions.
Genes with the greatest fold change are presented in Figure 5. Fatty acid binding protein 4
(FABP4) was the most differentially expressed (DE) gene between control-SH and IUGR-SH comparison. The DE genes with the greatest reduction in IUGR-SH include collagens and two genes involved with thyroid hormone signaling. The first, thyroid hormone responsive (THRSP) is associated with lipogenic regulation due to its role in biosynthesis of medium chain triacylglycerides. The second, iodothyronine deiodinase 1 (DIO1) encodes an enzyme responsible for converting thyroxine (T4) to triiodothyronine (T3), the biologically active thyroid hormone.
The enrichment results for the biological process GO category showed that upregulated genes in
IUGR-SH and Control-SH were primarily involved in fat cell differentiation, lipid metabolic process and adipogenesis.
46
COL3A1 COL1A1 GPR153 COL1A2 IGFBP5 DIO1 NREP THRSP SLC6A4 Control CFB GPX3 IUGR TFPI2 ACOX2 STAR SERPINA1 ATP4A AHSG
0 200 400 600 800 1000 2000
Normalized gene expression (FPKM)
Figure 5. Differentially expressed genes with the largest fold changes (positive and negative) in the CON-SH vs. IUGR-SH comparison. Genes were filtered for expression levels of at least 50 FPKM in the group with the lower expression. Gene symbols are presented to the left of their comparison. Each bar represents average transcript expression (FPKM) for that gene in adipose isolated from fetuses with IUGR-SH (gray bars) and CON-SH (black bars)
Catecholamines response genes in perirenal adipose tissue
DE genes from three primary comparisons were compared to determine overlap and define the catecholamine responsive genes that explain the mechanisms for the phenotype in IUGR-SH fetuses (Figure 6). The primary comparison of IUGR-SH and control-SH was followed by IUGR-SH
47 compared to IUGR-AD to define genes within the IUGR pathology that may be regulated by sustained high norepinephrine concentrations. The comparison between IUGR-SH and IUGR-AD adipose tissue identified 297 DE genes (163 downregulated and 134 upregulated genes; Figure
4). The comparison between IUGR-SH and IUGR-AD found 107 DE genes overlapping compared to Control-SH and IUGR-SH comparison to evaluate the effect of IUGR in presence of norepinephrine. The third comparison was between Control-AD versus IUGR-AD to evaluate the gene changes from aspects of IUGR such as hypoxia and hypoglycemia that are independent of elevated norepinephrine concentrations. The comparison between Control-AD and IUGR-AD adipose tissue identified 225 DE genes (70 downregulated and 155 upregulated genes; Figure 3).
Control-AD compared to IUGR-AD had 35 genes overlapping with last two comparisons, this overlapping represents independent of IUGR and norepinephrine.
Figure 6. Venn Diagram of differentially expressed genes of primary comparison. Overlapping genes were identified between the three primary comparisons that defined the DE genes.
48
In the second comparison of IUGR-SH versus IUGR-AD, functional analysis of 297 DE genes identified 7 significantly enriched pathways for the IUGR-SH versus IUGR-AD comparison. In the third comparison of Control-AD versus IUGR-AD, there were 9 enriched pathways for the 225 DE genes (Table 2). Integration of the pathway analysis among three comparisons revealed three overlapping pathways: PPAR signaling pathways, Focal adhesion, and complement and coagulation cascades. Metabolic pathways were present in the Control-SH versus IUGR-SH and
IUGR-SH versus IUGR-AD, which indicates high catecholamines regulate aspect of metabolism in
IUGR perirenal adipose tissue.
Based on genes in the pathway comparisons and 107 overlapping DE genes for Control-SH versus
IUGR-SH and IUGR-SH versus IUGR-AD list, we identified important norepinephrine genes. DE genes that regulate cell proliferation and differentiation included, ADIRF, C/EBPa, SREBP1,
PPARg, ACOX2, SCP2 and PPP1R1B, were upregulated in IUGR-SH fetuses compared to control-
SH and downregulated in IUGR-AD compared to IUGR-SH. Genes involved in cell proliferation and differentiation were not different in IUGR-AD compared to control-AD, except ADIRF and SREBP1.
DE genes involved in metabolism included, IGFBP5, IGFBP7, PCK2, SLC2A1, PFKFB4, HMOX1,
SLC27A6, ME1 and PDK4 were upregulated in IUGR-SH fetuses compared to control-SH, were downregulated in IUGR-AD compared to IUGR-SH and were not different between IUGR-AD and control-AD except for PFKFB4.
49 Quantitative PCR validation of mRNA expression in perirenal adipose tissue
Based on the comparisons above seven genes of interest were selected to validate the catecholamine phenotype for adipogenesis and nine genes for metabolism (Table 3). Our target genes were ADIRF, SREBP1, C/EBPa and PPARg, which are involved in cell differentiation process, and Glut 1, which is involved in glucose metabolism. In the RNA-seq analysis these genes were upregulated in IUGR-SH vs control-SH and downregulated in IUGR-AD vs IUGR-SH, indicating an upregulation by presence of catecholamines. Furthermore, we investigated whether ADIRF had any effect on the early-acting genes in adipogenesis at the transcriptional level since previous reports indicated that overexpression of ADIRF upregulated the transcription levels of C/EBPa and PPARg , thus promoting adipogenesis (Chen et al., 2013). For such reason, we focused on the relationship of ADIRF and other known early-acting genes like C/EBPa, SREBP1, and PPARg.
SREBP1 is a lipogenesis factor that causes the cell to produce ligand(s) for PPARg enhancing adipogenesis (Kim et. al., 2002).
Table 3. Differentially expressed genes from enriched pathways identified by RNAseq. Pathway Gene Name (Symbol) Metabolic Pathway Pyruvate Dehydrogenase Kinase 4 (PDK4) 6-Phosphofructo-2-Kinase/Fructose-2,6- Biphosphatase 4 (PFKFB4) Malic Enzyme 3 (ME3) Heme Oxygenase 1 (HMOX1) Insulin Like Growth Factor Binding Protein 5 (IGFBP5) Solute Carrier Family 2 Member 1 (SLC2A1) Insulin Like Growth Factor Binding Protein 7 (IGFBP7) Phosphoenolpyruvate Carboxykinase 2 (PCK2) Solute Carrier Family 27 Member 6 (SLC27A6)
50 Peroxisome Proliferator Activated Receptor (PPAR signaling pathway) Adipogenesis Regulatory Factor (ADIRF) Acyl-CoA Oxidase 2 (ACOX2) Sterol Carrier Protein 2 (SCP2) Protein Phosphatase 1 Regulatory Inhibitor Subunit 1B (PPP1R1B) CCAAT Enhancer Binding Protein Alpha (C/EBPa) Sterol Regulatory Element Binding Transcription Factor 1 (SREBP1) Peroxisome Proliferator Activated Receptor Gamma (PPARg)
All genes of interest were cloned from fetal sheep perirenal adipose mRNA, and their relative mRNA concentrations were determined between groups (Figure 8). GLUT1 mRNA concentrations were higher (p<0.05) in IUGR-SH adipose tissue compared to control-SH and IUGR-AD adipose tissue. GLUT1 was not different between control-AD and IUGR-AD. In IUGR-SH fetuses, ADIRF mRNA concentrations were higher (p<0.05) than in Control-SH and IUGR-AD adipose tissue. The
PPARg mRNA concentrations were higher (p<0.05) in IUGR-SH than control-SH, but no difference was observed among IUGR-SH, IUGR-AD and control-AD (Figure 7).
51 Control-SH v. IUGR-SH IUGR-SH v. IUGR-AD Control-AD v. IUGR-AD 20 * 0 0 -1 -1 * 15 * -2 * * -2 10 -3 -3 * -4 5 * -4 * * -5 Relative Fold Change Relative Fold Change Relative Fold Change * 0 -6 -5 *
SCP2 ADIRF SCP2 SCP2 ADIRF ACOX2 PPARy ADIRFACOX2 PPARy ACOX2 C/EBPa PPARy C/EBPaSREBP1 C/EBPaSREBP1 SREBP1 PPP1R1B PPP1R1B PPP1R1B
Figure 7. Relative mRNA expression for adipogenesis genes in fetal perirenal adipose tissue. mRNA concentrations for genes listed were normalized to the geometric mean of the reference genes (S15, TBP and GAPDH) and expressed as fold change from control-SH (A), IUGR-SH (B), or control-AD (C). The fold change was calculated by the 2-DDCt. Mean (±SEM) fold change for the comparisons are presented. Significance differences were determined for the group comparisons and are indicated by * (P<0.05).
Control-SH v. IUGR-SH IUGR-SH v. IUGR-AD Control-AD v. IUGR-AD 135 * 0 0
-1 60 * * -10 * -2 * 40 -3 * -20 20 * * -4 Relative Fold Change Relative Fold Change Relative Fold Change * * * 0 -30 -5
ME3 ME3 PDK4 PCK2 ME3 PDK4 PCK2 PDK4 PCK2 PFKFB4 HMOX1IGFBP5SLC2A1IGFBP7 HMOX1IGFBP5 IGFBP7 PFKFB4 HMOX1IGFBP5SLC2A1IGFBP7 SLC27A6 PFKFB4 SLC2A1 SLC27A6 SLC27A6
Figure 8. Relative mRNA expression for metabolic genes in fetal perirenal adipose tissue. mRNA concentrations for genes listed were normalized to the geometric mean of the reference genes (S15, TBP and GAPDH) and expressed as fold change from control-SH(A), IUGR-SH (B), or control-AD (C). The fold change was calculated by the 2-DDCt in perirenal adipose tissue. Mean (±SEM) fold change for the comparisons are presented. Significance differences were determined for the group comparisons and are indicated by * (P<0.05).
52 Table 4. Significantly enriched canonical pathways using all DE genes for group comparisons.
Control-SH versus IUGR-SH Number of DE P value genes (% of annotated) Complement and coagulation cascades 12(2.2) 3.54x10-5 PPAR signaling pathway 11(2) 1.43x10-4 Steroid biosynthesis 6(1.1) 6.24x10-4 Biosynthesis of antibiotics 19(3.5) 7.24x10-4 Arrhythmogenic right ventricular 10(1.8) 1.04x10-3 cardiomyopathy Hypertrophic cardiomyopathy (HCM) 10(1.8) 2.05x10-3 Dilated cardiomyopathy 10(1.8) 3.4x10-3 Focal adhesion 17(3.1) 3.5x10-3 Fructose and mannose metabolism 6(1.1) 5.6x10-3 HTLV-I infection 18(3.3) 0.01 Metabolic pathways 60(11) 0.01 NF-kappa B signaling pathway 9(1.7) 0.01 Axon guidance 11(2) 0.01 MAPK signaling pathway 17(3.3) 0.02 PI3K-Akt signaling pathway 21(3.9) 0.03 ECM-receptor interaction 8(1.5) 0.03 Terpenoid backbone biosynthesis 4(0.7) 0.04 Staphylococcus aureus infection 6(1.1) 0.05 Platelet activation 10(1.8) 0.05 Synthesis and degradation of ketone bodies 3(0.6) 0.05 Sulfur metabolism 3(0.6) 0.05
IUGR-SH versus IUGR-AD Number of DE P value genes (% of annotated Complement and coagulation cascades 11(4.1) 1.11 x 10-6 PPAR signaling pathway 10(3.7) 7.43 x 10-6 ECM-receptor interaction 10(3.7) 6.31 x 10-5 Focal adhesion 10(3.7) 0.02 Cell adhesion molecules (CAMs) 8(3) 0.02 Metabolic pathways 34(12.6) 0.05 Type I diabetes mellitus 4(1.5) 0.05
53 Control-AD versus IUGR-AD Number of DE P value genes (% of annotated Arginine biosynthesis 4(2) 3.6 x 10-3 Complement and coagulation cascades 6(3) 4.6 x 10-3 Phagosome 8(4) 0.01 AMPK signaling pathway 7(3.5) 0.01 PPAR signaling pathway 5(2.5) 0.02 2-Oxocarboxylic acid metabolism 3(1.5) 0.02 Biosynthesis of amino acids 5(2.5) 0.02 Arginine and proline metabolism 4(2) 0.04 Rap1 signaling pathway 8(4) 0.04
54 Discussion
In this study, we show that adaptations in the adipose tissue transcriptome of the IUGR fetus was regulated by sustained hypercatecholaminemia, which was shown previously to promote asymmetric growth during placental insufficiency-induced IUGR (Davis et al., 2015).
Perirenal adipose tissue from IUGR fetuses with an intact adrenal gland had greater mass relative to body weight, which indicates that this adipose depot is spared compared to control groups and IUGR-AD fetuses without hypercatecholaminemia. Higher DNA per gram of adipose tissue was also identified in IUGR-SH. This phenotype in intact IUGR fetuses indicated that the higher relative adipose tissue mass was due to hyperplasia because no differences in lipid content was found.
Enriched functional pathways identified from transcriptomic profiles that overlapped between group comparisons were PPAR signaling and metabolic pathways. Based on pathway comparisons, we identified differentially expressed genes within those pathways and also genes from the overlap between IUGR-SH vs control-SH and IUGR-SH vs IUGR-AD lists. Genes were selected based on association to PPAR signaling and metabolic pathways due to IUGR phenotype of increased mass. Thus, we identified alterations in mRNA expression that define underlying causes of perirenal adipose tissue dysfunction and expansion in response to catecholamines in
IUGR-SH fetuses. Transcriptomic approaches identified genes that affect cellular metabolism, preadipocytes growth, and proliferation pathways in IUGR-SH perirenal adipose tissue. The results included upregulation of genes encoding known factors related to adipogenesis, diabetes- relevant signaling molecules, and lipid metabolism. ADIRF, C/EBPa,PPARg, SREBP1 and SCP2 are involved in adipogenesis and were upregulated in IUGR-SH compared to other experimental
55 groups. Furthermore, only ADIRF was downregulated in IUGR-AD compared to IUGR-SH indicating catecholamines regulation might be promoting cellular replication.
During acute episodes of hypoxemia or other stressors, the adrenal medulla secretes epinephrine and norepinephrine, which act through the b2-adrenergic receptors (AR) on adipocytes to stimulate hormone sensitive lipase (HSL) and mobilize free fatty acids and glycerol
(Carmen & Víctor, 2006). Previous work in IUGR fetal sheep that were chronically hypoxemic has demonstrated reductions in b2-AR mRNA and protein concentrations. Of importance, the reductions in b2-AD persist in lambs born with IUGR causing AR desensitization that impairs catecholamine-induced lipolysis (Chen et al., 2010). These findings indicate that chronic hypercatecholaminemia programs the adipose tissue responsiveness and promotes lipid storage instead of lipid release. Furthermore, this adaptation may explain the increased adiposity in IUGR fetuses with an intact adrenal medulla. Greater adiposity is also a pathological response in offspring with IUGR, and it is reasonable to consider that these adaptations in adrenergic signaling could represent a programming mechanism for adipose tissue.
Placental insufficiency slows fetal growth, lowering body weight and organ weights, but growth restriction is not symmetric in PI-IUGR cases. Model of PI-IUGR increased perirenal adipose tissue in IUGR-SH compared to controls and IUGR-AD, concordant with observed associations with IUGR in humans (De Blasio et al., 2006). Here, we show that IUGR-SH fetuses have a greater ratio of adipose tissue to body weight. These findings suggest that possible b2-AR desensitization is occurring in adipose tissue hence increased mass in IUGR fetuses due to inhibition of lipolysis. Alternatively, previous work has demonstrated that norepinephrine
56 enhances adipocyte proliferation via adrenergic receptors (Lee, Petkova, Konkar, & Granneman,
2015). Thus, the maturation of the adrenal gland activity in late gestation maintains AR stimulation, even though AR desensitization develops to predispose IUGR fetuses to adiposity postnatally (Desai & Ross, 2011).
We identified FABP4 as the major abundant gene in DE genes in perirenal adipose. FABP4 plays a major role in the intracellular fatty acid transport and metabolism, especially in maintaining lipid and glucose homeostasis (Elmasri et al., 2009) and is induced by peroxisome proliferator-activated receptor (PPAR) g (Furuhashi & Hotamisligil, 2008). Previous studies have shown that patients with obesity have higher FABP4 plasma concentrations (Cabré et al., 2010) and it is considered an early marker of metabolic syndrome development and T2D (Xu et al.,
2007).
Functional analysis for DE genes revealed 23 significantly enriched pathways which included upregulation of cellular metabolism and preadipocytes differentiation and proliferation mechanism as predominant processes in IUGR-SH adipose tissue. We found upregulation of
ADIRF in IUGR-SH and downregulation in IUGR-AD fetuses indicating enhanced cellular proliferation due to higher NE concentrations. This might explain adipose tissue expansion and
NE could be enhancing adipose tissue sparing.
ADIRF was a recently characterized nuclear factor that can inhibit apoptosis and promote cell differentiation, possibly by initiating the transcription of genes that regulate adipogenesis.
ADIRF is overexpressed in obesity (Ni et al., 2013). Also, ADIRF shows an expression pattern that is clearly enriched in human adipose tissue and was shown to help transcriptionally activate
PPARg and C/EBPa expression in the early events of adipogenesis (Ni et al., 2013). Any factor
57 that activates C/EBPa and PPARg will promote the differentiation of preadipocytes to mature adipocytes. PPARg initiates adipogenesis in cells that have not committed to the adipocyte lineage, thus demonstrating its capability as the master adipogenesis factor (Gregoire, Smas, &
Sul, 1998). Thus, by high concentration of NE, which enhances proliferation and ADIRF expression, we hypothesize that upregulation of ADIRF will also promote adipogenesis in intact
IUGR fetuses.
We also found upregulation of GLUT1 in IUGR and downregulation in IUGR-AD, indicating that upregulation may be driven by effects of catecholamines. Enhanced glucose transport activity in IUGR-SH adipocyte might lead to obesity after glucose concentration are normalized postnatally. Our data indicates that the IUGR phenotype increases glucose transport into adipocytes, when norepinephrine concentrations are high, by upregulating GLUT1. Previous studies have shown upregulation in GLUT 1 in 3T3-L1 adipocytes (Clancy & Czech, 1990) during chronic exposure to cAMP (Hajduch et al., 1992). Higher GLUT1 concentrations could be responsible for shunting glucose into adipose tissue in IUGR-SH, despite fetal hypoglycemia.
We identified ADIRF and GLUT1 as genes regulated by catecholamines. ADIRF and GLUT1 were upregulated in IUGR-SH and downregulated in IUGR-AD, suggesting that enrichment of expression is influenced by catecholamines. Comparison between control-SH and IUGR-SH identified genes upregulated by IUGR pathologies such as hypoxia, hypoglycemia and hypercatecholaminemia, thus suggesting that ADIRF and GLUT1 are influenced by IUGR. Then, comparison between IUGR-SH and IUGR-AD identified genes regulated by presence of
58 catecholamines within the IUGR phenotype. Lastly, comparison between control-AD and IUGR-
AD identified genes that were independent of catecholamines since we eliminated that effect with demedullation. These findings suggest that cell differentiation, lipid metabolic process and fatty acid transport are functional categories enriched in DE genes of IUGR adipose tissue and are consistent with greater fat mass in IUGR fetuses.
Triacylglycerol contents were not different among groups suggesting that adiposity in
IUGR-SH fetuses is primarily a result of hyperplasia and not hypertrophy. Previous studies have shown that SCP2 expression alters the lipid composition of isolated lipid droplets due to its high affinity for fatty acids and cholesterol by separating them from lipid droplets (Atshaves et al.,
2001). We found upregulation of SCP2 in IUGR-SH and downregulation in IUGR-AD, suggesting decrease in lipid content in adipocytes. We identified 2 genes in our transcriptomic data, previously correlated to adipocyte size. Collagen type 1 alpha 1 (COL1A1) and collagen type 1 alpha 2 (COL1A2) are positively correlated with adipocyte size (Jernas et al., 2006). Both genes were downregulated in IUGR-SH compared to control-SH and no difference was found between
IUGR-SH and IUGR-AD. In addition, solute carrier family 7, member 2 (SLC27A2) has been inversely associated with adipocyte size (Heinonen et al., 2014) and upregulation in IUGR-SH compared to IUGR-AD. These findings provide insights into the role of catecholamines to reduce cell size while promoting cell proliferation.
In conclusion, our study provides strong evidence to support the programming effects during placental insufficiency induced IUGR through chronic adrenergic stimulation that causes adipocyte proliferation and adipogenesis. Indeed, our results suggest that early metabolic
59 programming could contribute to alteration in cellular metabolism and preadipocytes differentiation and proliferation pathways, indicating higher cellular activity and increasing adipose mass. These alterations indicate that upregulation of ADIRF and GLUT1 might promote adipogenesis in response to NE. Our results suggest that prenatal insults causing IUGR could play a major role in determining the long-term metabolic dysfunction.
60 References
Adams, M. B., & McMillen, I. C. (2000). Actions of hypoxia on catecholamine synthetic enzyme mRNA expression before and after development of adrenal innervation in the sheep fetus. Journal of Physiology. https://doi.org/10.1111/j.1469-7793.2000.00519.x Ahfeldt, T., Schinzel, R. T., Lee, Y. K., Hendrickson, D., Kaplan, A., Lum, D. H., … Cowan, C. A. (2012). Programming human pluripotent stem cells into white and brown adipocytes. Nature Cell Biology. https://doi.org/10.1038/ncb2411 Ahima, R. S., & Flier, J. S. (2000). Adipose tissue as an endocrine organ. Trends in Endocrinology and Metabolism. https://doi.org/10.1016/S1043-2760(00)00301-5 Ailhaud, G. (2002). Cellular and Molecular Aspects of Adipose Tissue Development. Annual Review of Nutrition. https://doi.org/10.1146/annurev.nutr.12.1.207 Atshaves, B. P., Storey, S. M., McIntosh, A. L., Petrescu, A. D., Lyuksyutova, O. I., Greenberg, A. S., & Schroeder, F. (2001). Sterol Carrier Protein-2 Expression Modulates Protein and Lipid Composition of Lipid Droplets. Journal of Biological Chemistry. https://doi.org/10.1074/jbc.M100560200 Auwerx, J., & Staels, B. (1998). Review article Leptin. The Lancet. Barak, Y., Nelson, M. C., Ong, E. S., Jones, Y. Z., Ruiz-Lozano, P., Chien, K. R., … Evans, R. M. (1999). PPARγ is required for placental, cardiac, and adipose tissue development. Molecular Cell. https://doi.org/10.1016/S1097-2765(00)80209-9 Barish, G. D., Narkar, V. A., & Evans, R. M. (2006). PPARδ: A dagger in the heart of the metabolic syndrome. Journal of Clinical Investigation. https://doi.org/10.1172/JCI27955 Barker, D. J. P. (2004). Developmental origins of adult health and disease. Journal of Epidemiology & Community Health. https://doi.org/10.1136/jech.58.2.114 Barker, D. J. P., Eriksson, J. G., Forsén, T., & Osmond, C. (2002). Fetal origins of adult disease : strength of. International Journal of Epidemiology. Barker, D. J. P., & Osmond, C. (1986). INFANT MORTALITY, CHILDHOOD NUTRITION, AND ISCHAEMIC HEART DISEASE IN ENGLAND AND WALES. The Lancet. https://doi.org/10.1016/S0140-6736(86)91340-1 Barry, J. S., & Anthony, R. V. (2008). The pregnant sheep as a model for human pregnancy. Theriogenology. https://doi.org/10.1016/j.theriogenology.2007.09.021 Benirschke, K., Burton, G. J., & Baergen, R. N. (2012). Pathology of the human placenta, sixth edition. In Pathology of the Human Placenta. https://doi.org/10.1007/978-3-642-23941-0 Borensztein, M., Viengchareun, S., Montarras, D., Journot, L., Binart, N., Lombès, M., & Dandolo, L. (2012). Double Myod and Igf2 inactivation promotes brown adipose tissue development by increasing Prdm16 expression. FASEB Journal. https://doi.org/10.1096/fj.12-208496 Brown, L. D., Davis, M., Wai, S., Wesolowski, S. R., Hay, W. W., Limesand, S. W., & Rozance, P. J. (2016). Chronically increased amino acids improve insulin secretion, pancreatic vascularity, and islet size in growth-restricted fetal sheep. Endocrinology. https://doi.org/10.1210/en.2016-1328 Cabré, A., Lázaro, I., Cofán, M., Jarauta, E., Plana, N., Garcia-Otín, A. L., … Masana, L. (2010). FABP4 plasma levels are increased in familial combined hyperlipidemia. Journal of Lipid Research. https://doi.org/10.1194/jlr.m900066-jlr200
61 Cameron, N., & Demerath, E. W. (2002). Critical periods in human growth and their relationship to diseases of aging. Yearbook of Physical Anthropology. https://doi.org/10.1002/ajpa.10183 Cannon, B., & Nedergaard, J. (2004). Brown Adipose Tissue: Function and Physiological Significance. Physiological Reviews. https://doi.org/10.1152/physrev.00015.2003 Carmen, G. Y., & Víctor, S. M. (2006). Signalling mechanisms regulating lipolysis. Cellular Signalling. https://doi.org/10.1016/j.cellsig.2005.08.009 Chen, L., Zhou, X. G., Zhou, X. Y., Zhu, C., Ji, C. B., Shi, C. M., … Guo, X. R. (2013). Overexpression of C10orf116 promotes proliferation, inhibits apoptosis and enhances glucose transport in 3T3-L1 adipocytes. Molecular Medicine Reports. https://doi.org/10.3892/mmr.2013.1351 Chen, X., Fahy, A. L., Green, A. S., Anderson, M. J., Rhoads, R. P., & Limesand, S. W. (2010a). β2- Adrenergic receptor desensitization in perirenal adipose tissue in fetuses and lambs with placental insufficiency-induced intrauterine growth restriction. The Journal of Physiology, 588(Pt 18), 3539–3549. https://doi.org/10.1113/jphysiol.2010.192310 Chen, X., Fahy, A. L., Green, A. S., Anderson, M. J., Rhoads, R. P., & Limesand, S. W. (2010b). β2- Adrenergic receptor desensitization in perirenal adipose tissue in fetuses and lambs with placental insufficiency-induced intrauterine growth restriction. Journal of Physiology. https://doi.org/10.1113/jphysiol.2010.192310 Cinti, S. (2009). Transdifferentiation properties of adipocytes in the adipose organ. American Journal of Physiology-Endocrinology and Metabolism. https://doi.org/10.1152/ajpendo.00183.2009 Clancy, B. M., & Czech, M. P. (1990). Hexose transport stimulation and membrane redistribution of glucose transporter isoforms in response to cholera toxin, dibutyryl cyclic AMP, and insulin in 3T3-L1 adipocytes. Journal of Biological Chemistry. Clarke, L., Buss, D. S., Juniper, D. T., Lomax, M. A., & Symonds, M. E. (1997). Adipose tissue development during early postnatal life in ewe-reared lambs. Experimental Physiology. https://doi.org/10.1113/expphysiol.1997.sp004077 Clarke, L., Heasman, L., Firth, K., & Symonds, M. E. (2017). Influence of route of delivery and ambient temperature on thermoregulation in newborn lambs. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. https://doi.org/10.1152/ajpregu.1997.272.6.r1931 Clarke, Lynne, Bryant, M. J., Lomax, M. A., & Symonds, M. E. (2005). Maternal manipulation of brown adipose tissue and liver development in the ovine fetus during late gestation. British Journal of Nutrition. https://doi.org/10.1079/bjn19970086 Comline, R. S., & SILVER, M. (2017). DEVELOPMENT OF ACTIVITY IN THE ADRENAL MEDULLA OF THE FOETUS AND NEW-BORN ANIMAL. British Medical Bulletin. https://doi.org/10.1093/oxfordjournals.bmb.a070430 Coupé, B., Amarger, V., Grit, I., Benani, A., & Parnet, P. (2010). Nutritional programming affects hypothalamic organization and early response to leptin. Endocrinology. https://doi.org/10.1210/en.2009-0893 Davis, M. A., Macko, A. R., Steyn, L. V., Anderson, M. J., & Limesand, S. W. (2015). Fetal adrenal demedullation lowers circulating norepinephrine and attenuates growth restriction but not reduction of endocrine cell mass in an ovine model of intrauterine growth restriction. Nutrients. https://doi.org/10.3390/nu7010500
62 De Blasio, M. J., Gatford, K. L., McMillen, I. C., Robinson, J. S., & Owens, J. A. (2007). Placental restriction of fetal growth increases insulin action, growth, and adiposity in the young lamb. Endocrinology. https://doi.org/10.1210/en.2006-0653 De Blasio, M. J., Gatford, K. L., Robinson, J. S., & Owens, J. A. (2006). Placental restriction of fetal growth reduces size at birth and alters postnatal growth, feeding activity, and adiposity in the young lamb. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. https://doi.org/10.1152/ajpregu.00430.2006 De Blasio, M. J., Gatford, K. L., Robinson, J. S., & Owens, J. A. (2007). Placental restriction of fetal growth reduces size at birth and alters postnatal growth, feeding activity, and adiposity in the young lamb. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. https://doi.org/10.1152/ajpregu.00430.2006 Desai, M., Gayle, D., Han, G., & Ross, M. G. (2007). Programmed hyperphagia due to reduced anorexigenic mechanisms in intrauterine growth-restricted offspring. Reproductive Sciences. https://doi.org/10.1177/1933719107303983 Desai, M., & Ross, M. G. (2011). Fetal programming of adipose tissue: Effects of intrauterine growth restriction and maternal obesity/high-fat diet. Seminars in Reproductive Medicine. https://doi.org/10.1055/s-0031-1275517 Economides, D. L., Proudler, A., & Nicolaides, K. H. (1989). Plasma insulin in appropriate- and small-for-gestational-age fetuses. American Journal of Obstetrics and Gynecology. https://doi.org/10.1016/0002-9378(89)90167-1 Elmasri, H., Karaaslan, C., Teper, Y., Ghelfi, E., Weng, M., Ince, T. A., … Cataltepe, S. (2009). Fatty acid binding protein 4 is a target of VEGF and a regulator of cell proliferation in endothelial cells. The FASEB Journal. https://doi.org/10.1096/fj.09-134882 Evans, R. M., Barish, G. D., & Wang, Y. X. (2004). PPARs and the complex journey to obesity. Nature Medicine. https://doi.org/10.1038/nm1025 Feinberg, A. P., Irizarry, R. A., Fradin, D., Aryee, M. J., Murakami, P., Aspelund, T., … Fallin, M. D. (2010). Personalized epigenomic signatures that are stable over time and covary with body mass index. Science Translational Medicine. https://doi.org/10.1126/scitranslmed.3001262 Friedman, J. M., & Halaas, J. L. (1998). Leptin and the regulation of body weight in mammals. Nature. https://doi.org/10.1038/27376 Furuhashi, M., & Hotamisligil, G. S. (2008). Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nature Reviews Drug Discovery. https://doi.org/10.1038/nrd2589 Garibotto, G., Russo, R., Franceschini, R., Robaudo, C., Saffioti, S., Sofia, A., … Barreca, T. (1998). Inter-organ leptin exchange in humans. Biochemical and Biophysical Research Communications. https://doi.org/10.1006/bbrc.1998.8819 Gatford, K. L., Simmons, R. A., De Blasio, M. J., Robinson, J. S., & Owens, J. A. (2010). Review: Placental Programming of Postnatal Diabetes and Impaired Insulin Action after IUGR. Placenta. https://doi.org/10.1016/j.placenta.2009.12.015 Gemmell, R. T., Bell, A. W., & Alexander, G. (1972). Morphology of adipose cells in lambs at birth and during subsequent transition of brown to white adipose tissue in cold and in warm conditions. American Journal of Anatomy. https://doi.org/10.1002/aja.1001330203 Gluckman, P. D., & Hanson, M. A. (2004). The developmental origins of the metabolic
63 syndrome. Trends in Endocrinology and Metabolism. https://doi.org/10.1016/j.tem.2004.03.002 Gluckman, P. D., Hanson, M. A., & Low, F. M. (2019). Evolutionary and developmental mismatches are consequences of adaptive developmental plasticity in humans and have implications for later disease risk. Philosophical Transactions of the Royal Society B: Biological Sciences. https://doi.org/10.1098/rstb.2018.0109 Green, A. S., Rozance, P. J., & Limesand, S. W. (2010). Consequences of a compromised intrauterine environment on islet function. Journal of Endocrinology. https://doi.org/10.1677/joe-09-0399 Gregoire, F M, Smas, C. M., & Sul, H. S. (1998). Understanding adipocyte differentiation. Physiological Reviews. https://doi.org/10.1152/physrev.1998.78.3.783 Gregoire, Francine M. (2017). Adipocyte Differentiation: From Fibroblast to Endocrine Cell. Experimental Biology and Medicine. https://doi.org/10.1177/153537020122601106 H.L., G., T.R.H., R., T.D., L. C., R.W., T., R.V., A., & R.B., W. (2001). Cotyledon and binucleate cell nitric oxide synthase expression in an ovine model of fetal growth restriction. Journal of Applied Physiology. Hajduch, E. J., Guerre-Millo, M. C., Hainault, I. A., Guichard, C. M., & Lavau, M. M. (1992). Expression of glucose transporters (GLUT 1 and GLUT 4) in primary cultured rat adipocytes: Differential evolution with time and chronic insulin effect. Journal of Cellular Biochemistry. https://doi.org/10.1002/jcb.240490307 Hales, C., & Barker, D. (1992). Diabetologia Type 2 (non-insulin-dependent) diabetes mellitus: the thrifty phenotype hypothesis*. Diabetologia. Hales, C. N., & Barker, D. J. P. (2001). The thrifty phenotype hypothesis. British Medical Bulletin. https://doi.org/10.1093/bmb/60.1.5 Hallberg, M., Morganstein, D. L., Kiskinis, E., Shah, K., Kralli, A., Dilworth, S. M., … Christian, M. (2008). A Functional Interaction between RIP140 and PGC-1 Regulates the Expression of the Lipid Droplet Protein CIDEA. Molecular and Cellular Biology. https://doi.org/10.1128/MCB.00504-08 Hay, W. W., Limesand, S. W., Macko, A. R., Rozance, P. J., Anderson, M. J., & Kelly, A. C. (2013). Reductions in insulin concentrations and β-cell mass precede growth restriction in sheep fetuses with placental insufficiency. American Journal of Physiology-Endocrinology and Metabolism. https://doi.org/10.1152/ajpendo.00435.2012 He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., … Evans, R. M. (2003). Adipose-specific peroxisome proliferator-activated receptor knockout causes insulin resistance in fat and liver but not in muscle. Proceedings of the National Academy of Sciences. https://doi.org/10.1073/pnas.2536828100 Heinonen, S., Saarinen, L., Naukkarinen, J., Rodríguez, A., Frühbeck, G., Hakkarainen, A., … Pietiläinen, K. H. (2014). Adipocyte morphology and implications for metabolic derangements in acquired obesity. International Journal of Obesity. https://doi.org/10.1038/ijo.2014.31 Imai, T., Takakuwa, R., Marchand, S., Dentz, E., Bornert, J.-M., Messaddeq, N., … Metzger, D. (2004). Peroxisome proliferator-activated receptor is required in mature white and brown adipocytes for their survival in the mouse. Proceedings of the National Academy of Sciences. https://doi.org/10.1073/pnas.0400356101
64 Inagaki, T., Sakai, J., & Kajimura, S. (2016). Transcriptional and epigenetic control of brown and beige adipose cell fate and function. Nature Reviews Molecular Cell Biology. https://doi.org/10.1038/nrm.2016.62 Jackson, B. T., Piasecki, G. J., Cohn, H. E., & Cohen, W. R. (2000). Control of fetal insulin secretion. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology. https://doi.org/10.1152/ajpregu.2000.279.6.R2179 Janke, R., Dodson, A. E., & Rine, J. (2015). Metabolism and Epigenetics. Annual Review of Cell and Developmental Biology. https://doi.org/10.1146/annurev-cellbio-100814-125544 Jaquet, D., Deghmoun, S., Chevenne, D., Collin, D., Czernichow, P., & Lévy-Marchal, C. (2005). Dynamic change in adiposity from fetal to postnatal life is involved in the metabolic syndrome associated with reduced fetal growth. Diabetologia. https://doi.org/10.1007/s00125-005-1724-4 Jernås, M., Palming, J., Sjöholm, K., Jennische, E., Svensson, P.-A., Gabrielsson, B. G., … Lönn, M. (2006). Separation of human adipocytes by size: hypertrophic fat cells display distinct gene expression. The FASEB Journal. https://doi.org/10.1096/fj.05-5678fje Kajimura, S., Seale, P., Kubota, K., Lunsford, E., Frangioni, J. V., Gygi, S. P., & Spiegelman, B. M. (2009). Initiation of myoblast to brown fat switch by a PRDM16-C/EBP-β transcriptional complex. Nature. https://doi.org/10.1038/nature08262 Kajimura, S., Seale, P., & Spiegelman, B. M. (2010). Transcriptional Control of Brown Fat Development. Cell Metabolism. https://doi.org/10.1016/j.cmet.2010.03.005 Kesavan, K., & Devaskar, S. U. (2019). Intrauterine Growth Restriction: Postnatal Monitoring and Outcomes. Pediatric Clinics of North America. https://doi.org/10.1016/j.pcl.2018.12.009 Kim, J. B., Wright, H. M., Wright, M., & Spiegelman, B. M. (2002). ADD1/SREBP1 activates PPAR through the production of endogenous ligand. Proceedings of the National Academy of Sciences. https://doi.org/10.1073/pnas.95.8.4333 Kim, Y., & Park, C. W. (2019). Mechanisms of Adiponectin Action: Implication of Adiponectin Receptor Agonism in Diabetic Kidney Disease. International Journal of Molecular Sciences. https://doi.org/10.3390/ijms20071782 Kotani, Y., Yokota, I., Kitamura, S., Matsuda, J., Naito, E., & Kuroda, Y. (2004). Plasma adiponectin levels in newborns are higher than those in adults and positively correlated with birth weight. Clinical Endocrinology. https://doi.org/10.1111/j.1365- 2265.2004.02041.x Large, V., Peroni, O., Letexier, D., Ray, H., & Beylot, M. (2004). Metabolism of lipids in human white adipocyte. Diabetes and Metabolism. https://doi.org/10.1016/S1262- 3636(07)70121-0 Lee, Y. H., Petkova, A. P., Konkar, A. A., & Granneman, J. G. (2015). Cellular origins of cold- induced brown adipocytes in adult mice. FASEB Journal. https://doi.org/10.1096/fj.14- 263038 Lefterova, M. I., & Lazar, M. A. (2009). New developments in adipogenesis. Trends in Endocrinology and Metabolism. https://doi.org/10.1016/j.tem.2008.11.005 Leiser, R., Krebs, C., Ebert, B., & Dantzer, V. (1997). Placental vascular corrosion cast studies: A comparison between ruminants and humans. Microscopy Research and Technique. https://doi.org/10.1002/(SICI)1097-0029(19970701/15)38:1/2<76::AID-JEMT9>3.0.CO;2-S
65 Leos, R. A., Anderson, M. J., Chen, X., Pugmire, J., Anderson, K. A., & Limesand, S. W. (2010). Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction. American Journal of Physiology-Endocrinology and Metabolism. https://doi.org/10.1152/ajpendo.00494.2009 Li, P. (2004). Cidea, brown fat and obesity. Mechanisms of Ageing and Development. https://doi.org/10.1016/j.mad.2004.01.002 Limesand, S W, Rozance, P. J., Smith, D., & Hay Jr., W. W. (2007). Increased insulin sensitivity and maintenance of glucose utilization rates in fetal sheep with placental insufficiency and intrauterine growth restriction. Am J Physiol Endocrinol Metab, 293(6), E1716-25. https://doi.org/10.1152/ajpendo.00459.2007 Limesand, Sean W., Rozance, P. J., Zerbe, G. O., Hutton, J. C., & Hay, W. W. (2006). Attenuated insulin release and storage in fetal sheep pancreatic islets with intrauterine growth restriction. Endocrinology. https://doi.org/10.1210/en.2005-0900 M.J., D. B., K.L., G., J.S., R., & J.A., O. (2007). Placental restriction of fetal growth reduces size at birth and alters postnatal growth, feeding activity, and adiposity in the young lamb. American Journal of Physiology - Regulatory Integrative and Comparative Physiology. https://doi.org/10.1152/ajpregu.00430.2006 MacDougald, O. A., & Lane, M. D. (2003). Transcriptional Regulation of Gene Expression During Adipocyte Differentiation. Annual Review of Biochemistry. https://doi.org/10.1146/annurev.bi.64.070195.002021 Macko, A. R., Yates, D. T., Chen, X., Shelton, L. A., Kelly, A. C., Davis, M. A., … Limesand, S. W. (2016). Adrenal demedullation and oxygen supplementation independently increase glucose-stimulated insulin concentrations in fetal sheep with intrauterine growth restriction. Endocrinology, 157(5), 2104–2115. https://doi.org/10.1210/en.2015-1850 Martín-Estal, I., De La Garza, R. G., & Castilla-Cortázar, I. (2016). Intrauterine growth retardation (IUGR) as a novel condition of insulin-like growth factor-1 (IGF-1) deficiency. Reviews of Physiology, Biochemistry and Pharmacology. https://doi.org/10.1007/112_2015_5001 Mirza, M. S. (2011). Obesity, Visceral Fat, and NAFLD: Querying the Role of Adipokines in the Progression of Nonalcoholic Fatty Liver Disease. ISRN Gastroenterology. https://doi.org/10.5402/2011/592404 Napolitano, L. (2004). The Fine Structure of Brown Adipose Tissue in the Newborn Mouse and Rat. The Journal of Cell Biology. https://doi.org/10.1083/jcb.4.6.685 Ni, Y., Ji, C., Wang, B., Qiu, J., Wang, J., & Guo, X. (2013). A Novel pro-adipogenesis factor abundant in adipose tissues and over-expressed in obesity acts upstream of PPARγ and C/EBPα. Journal of Bioenergetics and Biomembranes. https://doi.org/10.1007/s10863-012- 9492-6 Paniagua, J. A. (2016). Nutrition, insulin resistance and dysfunctional adipose tissue determine the different components of metabolic syndrome. World Journal of Diabetes. https://doi.org/10.4239/wjd.v7.i19.483 Parlee, S. D., Lentz, S. I., Mori, H., & MacDougald, O. A. (2014). Quantifying size and number of adipocytes in adipose tissue. In Methods in Enzymology. https://doi.org/10.1016/B978-0- 12-411619-1.00006-9 Pictet, R. L., Clark, W. R., Williams, R. H., & Rutter, W. J. (1972). An ultrastructural analysis of the developing embryonic pancreas. Developmental Biology. https://doi.org/10.1016/0012-
66 1606(72)90083-8 Poissonnet, C M, Burdi, A. R., & Bookstein, F. L. (1983). Growth and development of human adipose tissue during early gestation. Early Human Development. Poissonnet, Claude Michéle, Burdi, A. R., & Garn, S. M. (1984). The chronology of adipose tissue appearance and distribution in the human fetus. Early Human Development. https://doi.org/10.1016/0378-3782(84)90106-3 Pope, M., Budge, H., & Symonds, M. E. (2014). The developmental transition of ovine adipose tissue through early life. Acta Physiologica. https://doi.org/10.1111/apha.12053 Porter, C. (2017). Quantification of UCP1 function in human brown adipose tissue. Adipocyte. https://doi.org/10.1080/21623945.2017.1319535 Poulsen, L. la C., Siersbæk, M., & Mandrup, S. (2012). PPARs: Fatty acid sensors controlling metabolism. Seminars in Cell and Developmental Biology. https://doi.org/10.1016/j.semcdb.2012.01.003 Power, G. G. (1989). Biology of temperature: the mammalian fetus. Journal of Developmental Physiology. R.V., A., A.N., S., & C.D., W. (2003). Ruminant models of prenatal growth restriction. Reproduction (Cambridge, England) Supplement. Ravelli, A. C. J., Van Der Meulen, J. H. P., Osmond, C., Barker, D. J. P., & Bleker, O. P. (1999). Obesity at the age of 50 y in men and women exposed to famine prenatally. American Journal of Clinical Nutrition. Ravelli, G.-P., Stein, Z. A., & Susser, M. W. (2010). Obesity in Young Men after Famine Exposure in Utero and Early Infancy. New England Journal of Medicine. https://doi.org/10.1056/nejm197608122950701 Regnault, T. R. H., Orbus, R. J., Battaglia, F. C., Wilkening, R. B., & Anthony, R. V. (1999). Altered arterial concentrations of placental hormones during maximal placental growth in a model of placental insufficiency. Journal of Endocrinology. https://doi.org/10.1677/joe.0.1620433 Reilly, M. P., & Rader, D. J. (2003). The metabolic syndrome: More than the sum of its parts? Circulation. https://doi.org/10.1161/01.CIR.0000088846.10655.E0 Roseboom, T. J., Van der Meulen, J. H. P., Ravelli, A. C. J., Osmond, C., Barker, D. J. P., & Bleker, O. P. (2001). Effects of prenatal exposure to the Dutch famine on adult disease in later life: An overview. Molecular and Cellular Endocrinology. https://doi.org/10.1016/S0303- 7207(01)00721-3 Rosen, E. D., & MacDougald, O. A. (2006). Adipocyte differentiation from the inside out. Nature Reviews Molecular Cell Biology. https://doi.org/10.1038/nrm2066 Rosen, E. D., & Spiegelman, B. M. (2014). Review What We Talk About When We Talk About Fat. Cell. https://doi.org/10.1016/j.cell.2013.12.012 Rychkov, G. Y., Adams, M. B., McMillen, I. C., & Roberts, M. L. (1998). Oxygen sensing mechanisms are present in the chromaffin cells of the sheep adrenal medulla before birth. Journal of Physiology. https://doi.org/10.1111/j.1469-7793.1998.887bm.x Saely, C. H., Geiger, K., & Drexel, H. (2011). Brown versus white adipose tissue: A mini-review. Gerontology. https://doi.org/10.1159/000321319 Sambeat, A., Gulyaeva, O., Dempersmier, J., & Sul, H. S. (2017). Epigenetic Regulation of the Thermogenic Adipose Program. Trends in Endocrinology and Metabolism. https://doi.org/10.1016/j.tem.2016.09.003
67 Sarr, O., Yang, K., & Regnault, T. R. H. (2012). In Utero Programming of Later Adiposity: The Role of Fetal Growth Restriction . Journal of Pregnancy. https://doi.org/10.1155/2012/134758 Scholzen, T., & Gerdes, J. (2000). The Ki-67 protein: From the known and the unknown. Journal of Cellular Physiology. https://doi.org/10.1002/(SICI)1097-4652(200003)182:3<311::AID- JCP1>3.0.CO;2-9 Siebel, A. L., Mibus, A., De Blasio, M. J., Westcott, K. T., Morris, M. J., Prior, L., … Wlodek, M. E. (2008). Improved lactational nutrition and postnatal growth ameliorates impairment of glucose tolerance by uteroplacental insufficiency in male rat offspring. Endocrinology. https://doi.org/10.1210/en.2008-0128 Simmons, R. A., Templeton, L. J., & Gertz, S. J. (2001). Intrauterine Growth Retardation Leads to the Development of Type 2 Diabetes in the Rat. Diabetes. https://doi.org/10.2337/diabetes.50.10.2279 Smas, C. M., & Sul, H. S. (2015). Control of adipocyte differentiation. Biochemical Journal. https://doi.org/10.1042/bj3090697 Spalding, K. L., Arner, E., Westermark, P. O., Bernard, S., Buchholz, B. A., Bergmann, O., … Arner, P. (2008). Dynamics of fat cell turnover in humans. Nature. https://doi.org/10.1038/nature06902 Spiegelman, B. M., Frank, M., & Green, H. (1983). Molecular cloning of mRNA from 3T3 adipocytes. Regulation of mRNA content for glycerophosphate dehydrogenase and other differentiation-dependent proteins during adipocyte development. Journal of Biological Chemistry. Sun, W., von Meyenn, F., Peleg-Raibstein, D., & Wolfrum, C. (2019). Environmental and Nutritional Effects Regulating Adipose Tissue Function and Metabolism Across Generations. Advanced Science. https://doi.org/10.1002/advs.201900275 Symonds, M., Bird, J., Clarke, L., Gate, J., & Lomax, M. (1995). Nutrition, temperature and homeostasis during perinatal development. Experimental Physiology. https://doi.org/10.1113/expphysiol.1995.sp003905 Symonds, M. E., Mostyn, A., & Stephenson, T. (2005). Cytokines and cytokine receptors in fetal growth and development. Biochemical Society Transactions. https://doi.org/10.1042/bst0290033 Symonds, M. E., Pope, M., Sharkey, D., & Budge, H. (2012). Adipose tissue and fetal programming. Diabetologia. https://doi.org/10.1007/s00125-012-2505-5 Symonds, Michael E., Mostyn, A., Pearce, S., Budge, H., & Stephenson, T. (2003). Endocrine and nutritional regulation of fetal adipose tissue development. Journal of Endocrinology. https://doi.org/10.1677/joe.0.1790293 Thureen, P. J., Trembler, K. A., Meschia, G., Makowski, E. L., & Wilkening, R. B. (2017). Placental glucose transport in heat-induced fetal growth retardation. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. https://doi.org/10.1152/ajpregu.1992.263.3.r578 Tsai, P. J., Yu, C. H., Hsu, S. P., Lee, Y. H., Chiou, C. H., Hsu, Y. W., … Chu, C. H. (2004). Cord plasma concentrations of adiponectin and leptin in healthy term neonates: Positive correlation with birthweight and neonatal adiposity. Clinical Endocrinology. https://doi.org/10.1111/j.1365-2265.2004.02057.x Vaiserman, A., & Lushchak, O. (2019). Prenatal malnutrition-induced epigenetic dysregulation
68 as a risk factor for type 2 diabetes. International Journal of Genomics. https://doi.org/10.1155/2019/3821409 Wang, S., Chen, J., Yue, G., Bai, M., Kou, M., & Jin, Z. (2013). Neuropeptide Y and leptin receptor expression in the hypothalamus of rats with chronic immobilization stress. Neural Regeneration Research. Xu, A., Tso, A. W. K., Cheung, B. M. Y., Wang, Y., Wat, N. M. S., Fong, C. H. Y., … Lam, K. S. L. (2007). Circulating adipocyte-fatty acid binding protein levels predict the development of the metabolic syndrome: A 5-year prospective study. Circulation. https://doi.org/10.1161/CIRCULATIONAHA.106.647503 Yajnik, C. S., Lubree, H. G., Rege, S. S., Naik, S. S., Deshpande, J. A., Deshpande, S. S., … Yudkin, J. S. (2002). Adiposity and hyperinsulinemia in Indians are present at birth. Journal of Clinical Endocrinology and Metabolism. https://doi.org/10.1210/jc.2002-020434 Yamauchi, T., Kamon, J., Waki, H., Terauchi, Y., Kubota, N., Hara, K., … Kadowaki, T. (2001). The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nature Medicine. https://doi.org/10.1038/90984
69