PLoS BIOLOGY A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in Drosophila

Eli Arama1,2¤, Maya Bader1,2, Gabrielle E. Rieckhof1,2, Hermann Steller1,2* 1 Strang Laboratory of Cancer Research, The Rockefeller University, New York, New York, United States of America, 2 Howard Hughes Medical Institute, The Rockefeller University, New York, New York, United States of America

In both insects and mammals, spermatids eliminate their bulk cytoplasm as they undergo terminal differentiation. In Drosophila, this process of dramatic cellular remodeling requires apoptotic proteins, including caspases. To gain further insight into the regulation of caspases, we screened a large collection of sterile male flies for mutants that block effector caspase activation at the onset of spermatid individualization. Here, we describe the identification and characterization of a testis-specific, Cullin-3–dependent ubiquitin ligase complex that is required for caspase activation in spermatids. Mutations in either a testis-specific isoform of Cullin-3 (Cul3Testis), the small RING protein Roc1b, or a Drosophila orthologue of the mammalian BTB-Kelch protein Klhl10 all reduce or eliminate effector caspase activation in spermatids. Importantly, all three genes encode proteins that can physically interact to form a ubiquitin ligase complex. Roc1b binds to the catalytic core of Cullin-3, and Klhl10 binds specifically to a unique testis-specific N- terminal Cullin-3 (TeNC) domain of Cul3Testis that is required for activation of effector caspase in spermatids. Finally, the BIR domain region of the giant inhibitor of apoptosis–like protein dBruce is sufficient to bind to Klhl10, which is consistent with the idea that dBruce is a substrate for the Cullin-3-based E3-ligase complex. These findings reveal a novel role of Cullin-based ubiquitin ligases in caspase regulation.

Citation: Arama E, Bader M, Rieckhof GE, Steller H (2007) A ubiquitin ligase complex regulates caspase activation during sperm differentiation in Drosophila. PLoS Biol 5(10): e251. doi:10.1371/journal.pbio.0050251

Introduction studies in Drosophila. Drosophila IAP1 (Diap1) encodes an E3 ubiquitin ligase that is strictly required to prevent inappro- Caspases are a family of cysteine proteases that have priate caspase activation and apoptosis [24–27]. In live cells, received considerable attention because of their critical roles Diap1 promotes the ubiquitination and degradation of the in inflammation and apoptosis [1–4]. Caspases are expressed apoptotic initiator caspase Dronc, and mutations in the RING as weakly active zymogens in virtually all cells of higher domain of Diap1 that abrogate E3-ligase activity lead to a metazoans, and their conversion to the active enzyme is dramatic increase of Dronc protein, effector caspase activa- tightly controlled by many different signaling pathways. tion, and cell death [28,29]. On the other hand, in cells that Historically, most efforts to understand the mechanism of are destined to undergo apoptosis, Diap1 is inactivated by caspase regulation have focused on activator proteins, such as Reaper-family (RHG) proteins [24,26,27]. Reaper stimulates Apaf-1 and FADD, which promote the assembly of active the self-conjugation and degradation of Diap1, thereby initiator caspase protein complexes [5–9]. Once activated, irreversibly removing this critical caspase inhibitor [30]. apoptotic initiator caspases cleave and activate effector Likewise, induction of apoptosis in thymocytes induces the caspases, which in turn cleave a variety of important cellular auto-ubiquitination and degradation of mammalian IAPs targets, thereby promoting the execution of cell death [10,11]. [31]. These and other observations reveal a critical role of the Given the widespread expression of pro-caspases that have ubiquitin pathway in the regulation of apoptosis [30,32–37]. the potential to auto-activate in a proteolytic cascade, one Ubiquitin-mediated protein degradation is a tightly regulated might expect that efficient mechanisms exist to prevent process, in which proteins are tagged with ubiquitin moieties inappropriate caspase activation in cells that should live. Furthermore, activation of apoptotic effector caspases does not always result in cell death. For example, apoptotic Academic Editor: Erica Bach, New York University, United States of America caspases have been shown to play a critical role for cell Received March 26, 2007; Accepted July 25, 2007; Published September 18, 2007 differentiation, proliferation, NF-jB signaling, and dendritic Copyright: Ó 2007 Arama et al. This is an open-access article distributed under the pruning [1,3,12–21]. At this time, the mechanisms that terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author prevent unwanted cell killing by restricting caspase activity and source are credited. are poorly understood, but there are strong reasons to Abbreviations: BTB, Broad-complex, Tramtrack, and Bric-a-Brac; IAP, inhibitor of explore the role of inhibitory proteins. One important family apoptosis protein; IC, individualization complex; mds, medusa; ORF, open reading of caspase inhibitors are the inhibitor of apoptosis proteins frame; TeNC, testis-specific N-terminal Cullin-3; UTR, untranslated region (IAPs), which can bind to and inhibit active caspases in both * To whom correspondence should be addressed. E-mail: [email protected] insects and mammals [22,23]. The most compelling evidence ¤ Current address: Department of Molecular Genetics, Weizmann Institute of for a critical role of IAPs in caspase regulation has come from Science, Rehovot, Israel

PLoS Biology | www.plosbiology.org2270 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Author Summary an apoptotic corpse without the nucleus. Another example where apoptotic proteins are used for cellular remodeling is Caspases are a family of proteases that play important roles in the caspase-dependent pruning of neurites [14,51]. Like in programmed cell death (apoptosis). These enzymes also have spermatid individualization, the apoptotic machinery is used nonlethal functions, for example, in inflammation, cell differentia- in a spatially restricted way to destroy only parts of a cell tion, and cellular morphogenesis. During maturation, sperm cells [14,51–54]. In our screen, we isolated several cullin-3 alleles eliminate the majority of their cytoplasm and organelles as they are with mutations in a testis-specific N-terminal Cullin-3 (TeNC) transformed into highly specialized DNA delivery vehicles. Although domain. We show that the small RING domain protein, Roc1b, caspase activation does not kill the entire cell in this case, sperm maturation resembles apoptosis in the sense that many cellular interacts with Cullin-3 in spermatids to promote effector structures are degraded. An important unresolved question is how caspase activation. We also identified a BTB-domain protein, the lethal activity of apoptotic caspases is regulated to prevent the Klhl10, that selectively binds to the testis-specific form of unwanted death of cells. Here, we show that a Cullin-3–based Cullin-3, but not to somatic Cullin-3. Mutant alleles of klhl10 enzyme complex is required for caspase activation during sperm were isolated that block effector caspase activation and cause differentiation in Drosophila. Cullins are known to target cellular male sterility. Finally, the giant IAP-like protein dBruce binds proteins for degradation, but their role in caspase regulation was to Klhl10 in S2 cells, suggesting that dBruce may be a substrate not previously recognized. Our results suggest that a specific Cullin- for the Cullin-3–dependent ubiquitin ligase complex. Togeth- 3 enzyme complex activates caspases by degrading potent caspase er, these results define a novel Cullin-3–dependent E3 inhibitors, thereby providing a model for how apoptotic proteins are regulated during cellular remodeling. Importantly, components of ubiquitin ligase complex that regulates effector caspase this Cullin-3 enzyme complex are also required for fertility in mice activation in Drosophila spermatids. Given the conserved and humans, indicating that this mechanism has been conserved in nature of these proteins, our findings may have important evolution from fruit flies to humans. implications for caspase regulation in other systems.

Results through a series of enzymatic reactions involving an E1- Mutants Defective in Effector Caspase Activation during activating enzyme, E2-conjugating enzyme, and E3 ubiquitin Spermatid Individualization ligase, which determines substrate specificity. Tagged pro- During sperm development in Drosophila, a group of 64 post- teins are then degraded by the 26S proteasome [38–40]. meiotic spermatids remain initially interconnected by cyto- However, thus far no other E3 ligases besides IAPs have been plasmic bridges that result from incomplete cytokinesis [55]. implicated in the direct regulation of caspases. These spermatids are later separated from each other by the Here we provide evidence that a Cullin-3–based multi- caudal movement of an actin-based individualization complex protein complex plays a critical role in caspase activation in (IC) in a process termed ‘‘individualization.’’ During spermatid Drosophila. Cullins are major components of another type of individualization, the majority of the cytoplasm and cellular E3 ubiquitin ligase that serve as scaffolds for two functional organelles are removed and get deposited into ‘‘waste bags’’ modules: a catalytic module, composed of a small RING [55–58]. This process shares several features with apoptosis and domain protein that recruits the ubiquitin-conjugating requires apoptotic effector caspases [12,15,50,59]. To gain enzyme, and a substrate recognition module that binds to insight into the regulation of caspases in this system, we the substrate and brings it within proximity to the catalytic screened for mutants that lack staining for an antibody module [41,42]. The human genome encodes seven different detecting processed caspase-3 (CM1) [15,50,60–62]. We Cullins: Cullin-1, 2, 3, 4A, 4B, 5, and 7 [41,42]. The SCF screened a collection of more than 1,000 male-sterile mutant (Skp1-Cullin-1-F-box) complexes are, so far, the best-charac- lines defective in spermatid individualization that were terized Cullin-dependent E3 ligases. More recently, the previously identified among 12,326 viable mutants [63,64]. molecular composition and function of the Cullin-3–depend- Testes from each line were stained with CM1, and 33 CM1- ent E3 ligase complex has also been described [43–48]. In this negative alleles representing 22 different complementation complex, Broad-complex, Tramtrack and Bric-a-Brac (BTB) groups were identified. However, the vast majority of male- domain-containing proteins mediate binding of the Cullin to sterile mutants were CM1-positive, even though many displayed the substrate, whereas the Skp1/F-box heterodimer fulfill this severe defects in spermatid individualization. Therefore, function in the SCF complex [41,42,49]. During the past consistent with our earlier observations, caspase activation at decade Cullins have been implicated in a variety of cellular the onset of spermatid individualization is independent of activities [41]. However, very little is known about their many other aspects of sperm differentiation [12,50]. involvement in the regulation of caspase activation and To distinguish mutants that specifically affect caspase-3 apoptosis. Here, we describe the identification of cullin-3 activation from ones that affect general aspects of spermatid mutants from a genetic screen for mutants that abrogate differentiation, we used a monoclonal antibody that detects effector caspase activation during terminal differentiation of polyglycylated axonemal tubulin (AXO 49) as an advanced Drosophila spermatids. In this process, also known as spermatid differentiation marker [65,66]. In wild-type spermatids, the individualization, spermatids eliminate the majority of their pattern of AXO 49 staining is identical to that of CM1 (Figure cytoplasm and organelles in an apoptosis-like process that S1). While mutants in eight of our complementation groups requires canonical cell death proteins, including apoptotic abrogated AXO 49 staining, mutations in the remaining 14 caspases [12,50]. Although caspase activation in this system groups retained AXO 49 staining, indicating that these genes does not lead to death of the entire cell, sperm individualiza- act downstream of the general signal(s) required for the tion resembles apoptosis in the sense that many cellular initiation of spermatid individualization. One of these structures are removed into the ‘‘waste bag,’’ which resembles complementation groups was represented by five different

PLoS Biology | www.plosbiology.org2271 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase alleles that we termed ‘‘medusa’’ (mds; in Greek mythology, and Methods for details about the cDNA clones). While both Medusa represents both life and death). mds1 is AXO 49– isoforms share extensive similarity (exons 3–11), cul3Soma positive but completely negative for CM1 as a homozygote or in contains a unique, 20-amino-acid-long N-terminal polypep- trans to deficiencies that cover the corresponding region tide (encoded by exon 2), and cul3Testis contains a unique, 181- (Figure 1B–1D and Figure S2). The remaining four mds alleles amino-acid-long TeNC domain encoded by exon 1D (Figure retained various levels of CM1 staining but failed to comple- 2A and 2B; part of exon 1D is incorrectly annotated in FlyBase ment the sterility of mds1, suggesting that they are hypomor- as an independent gene, CG31829). We also identified three phic alleles. All these mutations were later mapped to the different mRNA isoforms of cul3Soma, but these only differ in Drosophila cullin-3 gene and were thus designed cul3mds1–5 (Zuker their 59 UTRs (encoded by exons 1A, 1B, and 1C, Figure 2A). lines Z2–1089, Z2–4870, Z2–4061, Z2–1270, and Z2–1062, Cullins were previously thought to be universally expressed. mds2 respectively; Figure 1E–1G). cul3 contains an unrelated Therefore, to the best of our knowledge, cul3Testis represents lethal mutation in the background and therefore was analyzed the first tissue-specific Cullin identified in any organism. in trans to the other alleles or deficiencies in the region. To determine the molecular nature of the mds alleles, we Drosophila apoptotic effector caspases, such as drICE and sequenced PCR-amplified genomic fragments of the cullin-3 Dcp-1, can display DEVD cleaving activity [67–69]. We have locus from these mutants. As expected from the genetic previously shown that wild-type adult testes also contain analysis, all mds alleles contained mutations in or near exon DEVDase activity and that this activity is reduced in cyt-c-d 1D and hence affect only the testis-specific isoform: cul3mds1 mutant testes [50]. To provide independent evidence for a has a 181-bp deletion that eliminates part of 59 UTR of requirement of Cullin-3 in caspase activation, we measured cul3Testis (orange brackets in Figure 2A and 2C). The two DEVDase activity in cul3mds1 mutant testes. Whereas lysates of hypomorphic alleles, cul3mds3 and cul3mds4, contain a C-to-T wild-type testes displayed significant levels of DEVDase transversion at positions 341 and 347, which convert activity, activity in cul3mds1 mutant testes was reduced to glutamine to stop codons at amino acids 8 and 10, background levels, comparable to the reduction achieved respectively. As a result, translation may initiate downstream with the potent caspase inhibitor Z-VAD.fmk (Figure 1I and of the normal translation initiation site (orange stars in 1J). These results confirm that cullin-3 is required for the Figure 2A and Figure S3). cul3mds2 contains a G-to-A trans- activation of effector caspases in spermatids. version of a splice donor site in the intron that is flanked by exons 1D and 3; this presumably abrogates splicing between Genetic and Molecular Characterizations of the cullin-3 Locus these exons (Figure 2A). cul3mds5 has a G114-to-A transversion To map the mds alleles, we first searched for genomic within the 59 UTR of cul3Testis (Figure 2A). In contrast, three of deletions that failed to complement the sterility of the mds the lethal gft alleles that failed to complement the sterility of males. Utilizing the ‘‘deficiency kit’’ from FlyBase, the male- mds/ males—cul3gft[GR18], cul3gft4, and cul3gft2—contain muta- sterility was mapped to genomic segment 35C1-35D1 on the tions in exons 4, 10, and 11, respectively, that are shared by left arm of the second chromosome (Figure S2). We then both isoforms of cullin-3 (purple stars in Figure 1A; [71]). performed similar complementation tests with available Transheterozygous combinations between cul3mds1 and four mutants in this region and found that lethal cullin-3 mutants strong gft alleles—cul3gft2, cul3gft[GR18], cul3gft1, and cul3gft[d577]— [70,71] failed to complement the sterility of mds mutant males, were sterile, and their elongated spermatids were CM1- suggesting that the mds alleles may represent a unique class of negative but AXO 49–positive (Figure 2E, 2G, 2H, Table S1, mutations in the cullin-3 gene (see below, Table S1). Because and unpublished data). Other mds/gft combinations with the Drosophila cullin-3 gene was previously termed gft [71], we weaker alleles produced reduced levels of cleaved caspase-3 gft will henceforth refer to the lethal cullin-3 alleles as cul3 .To staining, wild-type levels of axonemal tubulin polyglycylation, determine the molecular nature of the mds mutations, we and decreased fertility (Figures 1H, 2I, Table S1, Figure S4, analyzed first the cullin-3 genomic organization. The cullin-3 and unpublished data). Collectively, these results suggest that gene consists of 14 exons, 11 of which contain coding a testis-specific isoform of cullin-3 is required for effector sequences (Figure 2A; a partial genomic map was provided caspase activation and spermatid individualization. in [71]). Our genetic and molecular analyses identified a new exon, 1D, and suggested that the cullin-3 gene codes for two Expression of cul3Testis Is Restricted to the Male Germline major isoforms that are somatic and testis specific (Figure 2A Our genetic analyses suggested the existence of two and 2B). A lethal P-element insertion in the 59 untranslated functionally distinct isoforms of cullin-3, cul3Testis, and cul3Soma. region (UTR) of the cullin-3 gene, cul3 gft[06430], which failed to One possible explanation for this is that the two isoforms are complement the lethality of other gft alleles, complemented differentially expressed. To test this idea, we examined the the sterility of the mds alleles, suggesting that these noncoding distribution of cullin-3 transcripts in the testis and the soma. sequences are only required for the somatic function of cullin-3 Comparative RT-PCR experiments were performed using (Figure 2A, Table S1, and unpublished data). Additionally, specific primers in the unique 59 UTRs of cul3Soma and cul3Testis genomic PCR followed by sequencing analysis revealed that and a reverse primer in their common 39 UTR (black arrows the mds1 mutant contains a deletion in the intron that is in Figure 3A). cul3Soma was the only isoform detectable in the flanked by exon 2 and exon 3, suggesting that this intron soma of adult females (which lack testes), and cul3Testis was the contains sequences that are only required for the function of major isoform in testes (Figure 3B). Dissected testes contain cullin-3 in spermatids (Figure 2A and 2C). Finally, reverse- both germ cells and somatic cells, such as the testicular wall, transcriptase (RT)-PCR as well as sequence analyses of several muscles cells, and cyst cells. To determine whether cul3Testis is independent clones from adult testis and somatic cDNA germ-cell specific, we also analyzed RNA from a mutant libraries confirmed the presence of two major cullin-3 mRNA lacking germ cells. Both the somatic and testis forms of cullin- isoforms, cul3Soma and cul3Testis (Figure 2A and 2B; see Materials 3 were expressed in wild type, but only cul3Soma was detected

PLoS Biology | www.plosbiology.org2272 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 1. Mutations in cul3Testis Block Caspase Activation and Spermatid Individualization, but Not Axonemal Tubulin Polyglycylation (A–H) Visualization of active drICE with anti-cleaved caspase-3 antibody (CM1; green) and axonemal tubulin polyglycylation with anti-glycylated tubulin monoclonal antibody (AXO 49; red). These figures are composed of a green layer only in the left panel, and green and red layers combined in the right panel. (A) Wild-type individualizing spermatids stain positively for active effector caspase and polyglycylated axonemal tubulin (white arrows pointing at cystic bulges [CBs] and red arrow pointing at a waste bag [WB]). Elongated spermatids from (B) homozygotes for the null cul3mds1 allele or (C and D) transheterozygotes for cul3mds1 and two different deficiencies that cover the cullin-3 gene, DF(2L)ED3 and DF(2L)Exel8034, respectively, stain for polyglycylation but not for active effector caspase. mds5 mds3 mds4 (E–G) Homozygote mutants for three hypomorphic cul3Testis alleles, cul3 , cul3 , and cul3 , respectively, have spermatid individualization defects but still display some levels of active effector caspase expression. (H) However, the level of active effector caspase expression was dramatically reduced in spermatids from transheterozygote mutants for the null cul3mds1 and either of the hypomorphic alleles, such as cul3mds4. All the figures are in the same magnification; scale bar 200 lm. (I) The diagram depicts a DEVDase activity assay for cul3mds1/ testes. Caspase-3–like (DEVDase) activity is detected in wild-type testes and is blocked either after treatment with the caspase-3 inhibitor Z-VAD.fmk or in cul3mds1/ testes. DEVDase activity, presented as relative luminescence units (RLUs), was determined on Ac-DEVD-pNA substrate in testis extracts made of 180 wild-type (yw)orcul3mds1/ testes treated with Z-VAD or left untreated (DMSO). Readings were obtained every 2 min, and each time interval represents an average (mean 6 SEM) of five readings. Note that the level of DEVDase activity in cul3mds1/ testes is highly similar to the corresponding level in wild-type testes that were treated with Z-VAD. (J) A Western blot analysis for the assessment of the relative protein amounts used in (I). A portion of the testis extracts in (I) were used as controls to determine the relative amounts of total protein in each extract using the anti-b-Tubulin antibody. doi:10.1371/journal.pbio.0050251.g001

PLoS Biology | www.plosbiology.org2273 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 2. The cul3mds1–5 Alleles Contain Mutations in a New Exon of the cullin-3 Gene (A) Genomic organization of the cullin-3 locus. Thick bars indicate exons and dotted lines indicate introns. Solid bars indicate coding sequences, whereas open bars indicate UTRs. The Drosophila cullin-3 gene contains 14 exons, nine of which encode the bulk of the protein (exons 3–11) and are shared by both the somatic and testis-specific isoforms. While the three somatic isoforms (cul3Soma) differ in their 59 UTRs, each beginning with a unique first exon (exons 1A, 1B, and 1C), they share a second, somatic-only exon that contains a start codon (exon 2, green bar). The testis isoform, cul3Testis, begins with a unique first exon (1D, blue bar) that includes both 5’ UTR and coding sequences, including a start codon. The relative locations of the mds1–5 gft2, 4, GR18 molecular lesions in cul3Testis (orange, cul3 alleles) and cul3Soma (purple, cul3 alleles) are shown with stars (see the main text for more details on the precise molecular lesions of the cul3mds1–5 alleles). The molecular alterations of the cul3gft alleles were reported in [71]: cul3gft06430 contains a PZ element insertion 228 nucleotides from exon 2 (the insertion is indicated by a purple triangle). cul3gft[GR18] is missing a single nucleotide causing a premature stop codon at amino acid 167. cul3gft4 bears a C-to-T transversion, which results in an A710-to-V conversion. cul3gft2 contains a five- nucleotide deletion that results in a premature stop codon at amino acid 748 that removes half of the C-terminal Cullin homology domain (CHD). (B) A scheme of the two major mRNA isoforms of cullin-3, cul3Testis, and cul3Soma. (C) Genomic PCR and sequencing analyses of the cullin-3 locus revealed a 181-bp deletion in cul3mds1 (the arrows in A depict the relative locations of the primers used in this gPCR; yw and Canton S strains were used as wild-type controls). (D) For positive control, wild-type spermatids were stained for cleaved caspase-3 expression (green). (E) Consistent with the idea that both the mds and gft alleles affect the same gene, cullin-3, cul3mds1/cul3gft2 transheterozygote mutant spermatids displayed defects in individualization and negatively stained for cleaved caspase-3 (left panel). Spermatids were counter-stained with phalloidin that binds to F-actin in the spermatids’ tail (right panel, red; the strong red staining at the bottom corresponds to remnants of the testis sheath). (F–I) Spermatids were stained for cleaved caspase-3 (green in left panels) and for axonemal tubulin polyglycylation (red in right panels). (F) Wild-type control testis positively stained for cleaved caspase-3 and axonemal tubulin polyglycylation. (G–I) Whereas transheterozygous combinations between cul3mds1 and the strong cul3gft[GR18] (G) or cul3gft1 (H) alleles displayed spermatid individualization defects and stained negatively for cleaved caspase-3 and positively for polyglycylation, mutant spermatids from cul3mds1 in trans to the hypomorphic cul3gft4 allele also exhibited individualization defects but displayed reduced level of cleaved caspase-3 expression (I). All the figures were taken at the same magnification; scale bars, 200 lm. doi:10.1371/journal.pbio.0050251.g002

PLoS Biology | www.plosbiology.org2274 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 3. The Expression of cul3Testis Is Restricted to Male Germ Cells

(A) Schematic structures of the Drosophila cullin-3 gene (I) and of cul3Testis (II) and cul3Soma (III) mRNAs. Exons and introns are indicated by thick and thin bars, respectively. Thick black bars indicate coding sequences, whereas open bars indicate UTRs. The locations of the primers used in the comparative RT–PCR experiments in (B and C) are indicated by arrows, and the expected length sizes of the amplified fragments are indicated above each scheme. (B) Analysis of cul3Testis versus cul3Soma expression in the testis and the soma. The above primers (arrows in A) to amplify either a 2,997-bp cul3Testis or a 2,642-bp cul3Soma cDNA fragment were added to one reaction master-mix. The reaction was stopped at different cycle points to identify the linear amplification phase (30 and 35 cycles are indicated). The ‘‘RT’’ columns represent reverse transcriptase followed by PCR reactions, and the ‘‘Taq’’ are the control, PCR-only, reactions. Note that the cul3Testis expression levels were much higher in the wild-type (WT) testes than these of cul3Soma. On the other hand, only cul3Soma transcripts were detected in somatic tissues, which are represented by adult female flies. In addition, no cul3Testis transcripts were mds1 detected in cul3 mutant testes, confirming that this is a null cul3Testis allele. (C) The expression of cul3Testis is restricted to the male germ cells. While the expression of cul3Soma was not affected in sons of oskar agametic testes, no cul3Testis expression was detected. mds1 (D) Consistent with the RT-PCR analysis, no Cul3Testis protein was detected in cul3 mutant testes on Western blot. Note, however, that expression of mds1 the Cul3Soma protein in cul3 mutant testes was unaffected. doi:10.1371/journal.pbio.0050251.g003 in the germ-cell–less reproductive tracts of adult males types (male sterility versus lethality) of the different classes of / derived from oskar mothers (Figure 3C). Since cul3Testis is cullin-3 mutations. not detectable in adult females, this indicates that cul3Testis The TeNC Domain in Cul3Testis Is Required for Caspase expression is restricted to male germ cells, and that cul3Soma expression is mainly, if not exclusively, restricted to somatic Activation and Male Fertility cells (Figure 3B and 3C). Finally, consistent with the idea that The N-terminal region of Cullins is thought to mediate promoter and 5’ UTR sequences of cul3Testis are absent in binding to a specific substrate recognition module [41,42] mds1 cul3 mutants (Figure 2A), neither cul3Testis transcripts nor (Figure 9). To test whether the unique TeNC domain is mds1/ mds1 protein were detected in cul3 testes. Therefore, cul3 required for the function of Cul3Testis, we tested whether has both the genetic and molecular properties of a cul3Testis expression of Cul3Soma, which lacks a TeNC domain, was able null allele (Figure 3B and 3D). These results suggest that to functionally substitute for the loss of Cul3Testis in differential expression of cul3Testis in the male germline and developing spermatids. For this purpose, we generated cul3Soma in somatic tissues accounts for the distinct pheno- transgenic flies that express the coding regions of either

PLoS Biology | www.plosbiology.org2275 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 4. cul3Testis but Not cul3Soma Can Restore Caspase Activation and Spermatid Individualization to cul3Testis Null Mutants / (A) Schematic structure of the rescue constructs for cul3Testis male sterile flies. The constructs tr-cul3Testis and tr-cul3Soma are composed of the cul3Testis isoform’s promoter region (dark blue, consists of the intronic sequences flanked by exons 2 and 1D) and 59 UTR (light blue) that were fused upstream of the coding regions (ORFs) of either cul3Testis or cul3Soma followed by the 39 UTR of cul3Testis. (B and C) Transcriptional expression from the transgenes was confirmed by RT–PCR analyses on RNA from testes of the indicated genotypes. The relative locations of the primers are indicated with black arrows in (A). ‘‘RTþTaq’’ and ‘‘Taq’’ indicate reactions with reverse transcriptase or without it, respectively, to control for possible genomic DNA contamination. (B) To differentiate between the cul3Testis endogenous (endog.) and transgenic (transg.) cDNAs, we cleaved the RT-PCR fragments with XhoI, a unique mds1 restriction site in the transgene. Note that the RT-PCR product from cul3 ; tr-cul3Testis but not from WT testes was cleaved by XhoI, confirming its transgenic source. (C) Transgenic expression of cul3Soma (tr-cul3Soma) in adult testis. Note the absence of the endogenous cul3Testis cDNA band and in contrast, the presence mds1 of the transgenic cul3Soma band in cul3 ; tr-cul3Soma/þ testes. (D–I) Testes stained for cleaved caspase-3 (CM1, green) and spermatid’s tail and ICs (phalloidin, red). mds1/ (D) Mutant spermatids for cul3Testis (cul3 ) manifest a block in caspase activation and spermatid individualization. mds1/ (E) Either one or (F) two copies of transgenic cul3Testis (tr-cul3Testis) restores caspase activation, spermatid individualization, and fertility of cul3 male flies. (G) Wild-type control testes. Note the CBs and WBs (green oval structures). (H–I) In contrast, dramatically reduced CM1-positive cysts are found in cul3mds1 mutants, which ectopically express (H) one or (I) two copies of the cul3Soma transgene (tr-cul3Soma). These spermatids failed to individualize, no CBs and WBs are detected and the males are sterile. Scale bars 200 lm. doi:10.1371/journal.pbio.0050251.g004

cul3Testis or cul3Soma under the control of the cul3Testis promoter these transgenes to rescue caspase activation, spermatid and 5’ and 3’ UTRs (Figure 4A; see also Materials and individualization and male sterility of cul3mds1 flies. As Methods). At least three independent transgenic lines for expected, transgenes with either one or two copies of the mds1 each of these constructs were crossed to cul3 flies, and cul3Testis open reading frame (ORF) fully rescued CM1- proper expression of the transgenes was confirmed by RT- staining, spermatid individualization, and male fertility PCR analysis (Figures 4B and 4C). We examined the ability of (Figure 4E and 4F; note the reappearance of cystic bulges

PLoS Biology | www.plosbiology.org2276 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

alleles, such as cul3mds3, also display some level of CM1 staining. (C) However, spermatids mutants for both roc1b and cul3Testis manifest a complete block in caspase activation during individualization. doi:10.1371/journal.pbio.0050251.g005

and waste bags). This proves that both the caspase and sterility phenotypes seen in cul3mds1 mutant flies are due to the loss of cullin-3 function. We next tested the ability of cul3Soma to functionally substitute for the loss of cul3Testis. Neither one nor two copies of cul3Soma rescued spermatid individualization or male fertility, although we observed very low levels of CM1-staining (Figure 4H and 4I). Since the cul3Soma and cul3Testis ORF transgenes were expressed under the same promoter and at comparable levels, we conclude that the TeNC domain is necessary for efficient caspase activation and spermatid individualization.

roc1b Genetically Interacts with cul3Testis To Facilitate Effector Caspase Activation Cullins contain a C-terminal cullin homology domain (CHD) that can bind small RING domain proteins, which in turn recruit a ubiquitin-conjugating enzyme (E2) to generate the catalytic module [42,49,72]. The Drosophila genome contains three small RING domain proteins, Roc1a, Roc1b, and Roc2, all of which are capable of activating ubiquitin conjugation in vitro [73]. Loss of Roc1a function causes lethality, and targeted disruption of roc1b was previously reported to cause male sterility [73,74]. Furthermore, Cullin-3 preferentially co-immunoprecipitates with Roc1b, indicating that both proteins form a complex [74]. We therefore examined whether loss of roc1b function affects caspase activation and individualization of spermatids. We found that roc1bdc3/ spermatids displayed reduced levels of CM1 staining and failed to individualize (Figure 5A). To test whether roc1b genetically interacts with cul3Testis, we generated double mutants between roc1bdc3 and the hypomorphic cul3mds alleles. Homozygous mutants for either cul3mds or roc1bdc3 showed moderate levels of CM1 staining (Figure 1E–1G and Figure 5B). In contrast, CM1 staining was completely abolished in spermatids of the double mutants, demonstrat- ing that cul3Testis genetically interacts with roc1b to promote caspase activation in spermatids (Figure 5C). These results support the idea that Roc1b is a functionally relevant partner of Cullin-3 in vivo.

Cul3Testis Preferentially Interacts with the BTB Domain Protein Klhl10 in Yeast Cullin-3–dependent E3 ligases use BTB domain containing proteins for substrate recognition [44,45,49]. The number of genes encoding BTB domain containing proteins is very large, with an estimated 140–250 proteins in Drosophila [42,49]. We performed a yeast two hybrid (Y2H) screen using the coding region of Cul3Testis as bait to identify potential protein partners for Cul3Testis in a library of adult Drosophila cDNAs (Figure 6; see also Materials and Methods). Several cDNA clones, which encode for Drosophila orthologues of three BTB domain–containing proteins, Spop (CG9924), Ipp Figure 5. Double Mutants for cul3Testis and roc1b Block Caspase (CG9426), and Klhl10 (CG12423), were isolated in this screen Activation During Spermatid Differentiation (Figure 6). Notably, both mouse Klhl10, which shares 46% Testes stained for cleaved caspase-3 (CM1, green) and spermatid’s tail identity with its Drosophila counterpart and mouse Spop as (phalloidin, red). (A) Spermatids in roc1b mutant flies (roc1bdc3/) display severe individualization defects and still display some levels of CM1 well as Drosophila Spop were previously shown to interact with staining. (B) Similarly, spermatids in flies homozygous for weak cul3Testis Cullin-3 [44,75–78]. Given our previous results implicating

PLoS Biology | www.plosbiology.org2277 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 6. Klhl10, a BTB and Kelch Domains Protein, Preferentially Interacts with Cul3Testis and Not with Cul3Soma

(A) Three BTB-domain proteins, the Drosophila orthologues of Spop, Ipp, and Klhl10, were found to interact with Cul3Testis in a yeast-two-hybrid screen. b-galactosidase filter assay demonstrates that whereas Spop and Ipp can also interact with Cul3Soma, Klhl10 only interacts with Cul3Testis. While the TeNC domain of Cul3Testis is required for this interaction, it is not sufficient to mediate the interaction with Klhl10. (B) Similarly, in a nutrient-omitted medium assay, yeasts with both Cul3Testis and Klhl10 grew rapidly (2 d) on plates that lacked, in addition to leucine and tryptophan (2), also histidine and adenine (4 plates). However, yeast with Klhl10 and Cul3Soma grew very poorly on 4 plates. Even after two weeks of incubation, the colony is only partially established. Note that the results for the auxotrophy rescue of Klhl10 are shown not after 2 d but rather after 14 d in order to reflect the weak interaction between Klhl10 and Cul3Soma. (C) Schematic representations of Spop, Ipp, and Klhl10, and the relative locations of their major domains. The BTB-domains of all these proteins are sufficient for binding to Cullin-3. doi:10.1371/journal.pbio.0050251.g006

the TeNC domain in Cul3Testis function, we asked whether the function of this E3 complex and thus block caspase any of these proteins bind preferentially to this domain. For activation. To test this hypothesis, we searched for loss-of- this, we examined interactions between these BTB domain– function mutations in this gene. Genetic analysis of the klhl10 containing proteins and Cul3Testis, Cul3Soma, or the TeNC gene is complicated because of its position within a domain alone in two different yeast strains. Whereas Spop heterochromatic, cytologically unmapped portion on the and Ipp interacted with either Cul3Testis or Cul3Soma, Klhl10 2nd chromosome. However, we were able to identify seven 1–7 interacted with Cul3Testis only (Figure 6A and 6B). However, klhl10 alleles (klhl10 ) in our collection of CM1-defective the TeNC domain alone was not able to bind to any of the mutants. All alleles were defective in spermatid individualiza- BTB domain–containing proteins in this assay. We conclude tion, were recessive male-sterile, failed to complement each that the TeNC domain is required but not sufficient for BTB other, lacked CM1 staining but were AXO 49–positive (Figure protein binding. These results identify Klhl10 as a potential 7A–7F and unpublished data). This phenotype is virtually partner of Cul3Testis in spermatids. identical to the loss of Cul3Testis function. By using RT-PCR and sequence analyses, we identified mutations in six of these Mutations in klhl10 Abrogate Effector Caspase Activation klhl10 alleles (Figure 7I and 7J). Five of these alleles, klhl102–6 during Spermatid Individualization (Zuker lines Z2–1331, Z2–0960, Z2–2739, Z2–3284, and Z2–4385) If Klhl10 is indeed a physiologically relevant Cullin-3 have mutations in highly conserved amino acids of the Kelch binding partner in vivo, mutations in klhl10 should affect repeats, a domain that mediates interaction with the substrate

PLoS Biology | www.plosbiology.org2278 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 7. Mutations in klhl10 Block Caspase Activation and Spermatid Individualization, but Not Axonemal Tubulin Polyglycylation (A–H) Visualization of active effector caspase with anti-cleaved caspase-3 antibody (CM1; green) and (A–F) axonemal tubulin polyglycylation with anti- glycylated tubulin monoclonal antibody (AXO 49; red) or (G–H) F-actin, which stains the ICs and the spermatids’ tails (phalloidin; red). These figures are composed of combined green and red layers. (A) Wild-type individualizing spermatids positively stain for cleaved caspase-3 and polyglycylated axonemal tubulin. (B–F) In a variety of klhl10/ alleles, elongated spermatids stain for polyglycylation but not for cleaved caspase-3. (G and H) Transgenic klhl10 construct (tr-klhl10, composed of cul3Testis promoter and 59 UTR, klhl10 coding region, and cul3Testis 39 UTR) restores caspase activation, spermatid individualization, and fertility to klhl10/ male flies. (I) Schematic representation of the Klhl10 protein. The relative locations of the BTB, BACK, and Kelch domains are depicted by thick bars. Different colored stars depict the locations of the different mutations, and the colors correspond to the colored amino-acids in (J). The molecular nature of the mutations and their color code are as follows: klhl102 (Z2–1331) carries a G1801-to-A transversion that converts glutamic acid (E601, red) to lysine at repeat VI. klhl103 (Z2–0960) carries a G1119-to-A transversion that converts tryptophan (W373, purple) to stop codon, resulting in a deletion of most of the Kelch domain. klhl104 (Z2–2739) carries a C1237-to-T transversion that converts arginine (R413, yellow) to stop codon, which also deletes most of the Kelch repeats. klhl105 (Z2–3284) carries a G1486-to-A transversion that converts glycine (G496, blue) to arginine at repeat IV. klhl106 (Z2–4385) carries a C1439-to-T transversion that converts serine (S480, green) to phenylalanine at repeat IV. On the other hand, klhl107 (Z2–3353) carries a G508-to-A transversion that converts a highly conserved alanine (A170) to threonine in the BTB domain (gray star). (J) Alignment of the six Kelch repeats of Klhl10. The alignment is based on the crystal structure of the Keap1 Kelch domain which folds into a b-propeller structure with 6 blades. The residue range for each blade is indicated at the left. The four conserved b-strands in each blade are indicated above the sequences by arrows. Residues conserved in all six blades are highlighted with dark gray and appear in upper case in the consensus line, whereas residues that are conserved in at least three blades appear in lower case. Any two and above conserved residues are highlighted with light gray. Color highlighted residues are mutated in the various klhl10/ alleles and correspond to the stars in (I). doi:10.1371/journal.pbio.0050251.g007

(colored stars and amino acid residues in Figure 7I and 7J, mutant alleles (Figures 7G and 7H). Collectively, these results respectively; more details on the molecular nature of these suggest that Cul3Testis interacts functionally and physically mutations are in the legends for Figure 7). A sixth mutation, with Roc1b and Klhl10 to promote caspase activation and klhl107 (Z2–3353) contains a G508-to-A transversion that spermatid individualization in Drosophila. converts a highly conserved alanine (A170) to threonine in the BTB domain (gray star in Figure 7I). No mutations were Elevated Level of Ubiquitinated Protein Expression in identified in the ORF of klhl101 (Z2–1827), suggesting that this Individualizing Spermatids Requires an Intact allele carries a mutation in a regulatory region. To prove that Cul3-Roc1b-Klhl10 Complex these mutations are indeed responsible for the observed Our results suggest that a Cul3-Roc1b-Klhl10 E3 ubiquitin phenotypes, we conducted transgenic rescue experiments. ligase complex functions at the onset of spermatid individu- Expression of the klhl10 coding region under the control of alization. To explore this further, we investigated the level the cul3Testis promoter (together with cul3Testis 59 and 39 UTRs, and spatiotemporal distribution of ubiquitinated proteins see Materials and Methods) completely restored CM1 staining during spermatid individualization, and the consequences of and rescued all the sterility phenotypes associated with klhl10 loss of Cul3Testis and Klhl10 function on this pattern. For this

PLoS Biology | www.plosbiology.org2279 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 8. The Cul3-Roc1b-Klhl10 Complex Promotes Protein Ubiquitination during Spermatid Individualization Testes were stained with the anti–multi-ubiquitin monoclonal antibody (FK2) that detects ubiquitinated proteins (green), phalloidin, which marks the individualization complex (IC, red), and DAPI to visualize the nuclei (blue). (A) Before the formation of an IC, very low levels of ubiquitinated proteins are detected (yellow arrowhead). Once a mature IC is assembled in the vicinity of the nuclei, a steep gradient of ubiquitinated protein staining is detected from the very bottom of the nuclei to the tip of the spermatids’ tails (yellow arrows). After the caudal translocation of the IC, ubiquitinated proteins are no longer detectable in the post-individualized portion of the spermatids (the region between the nuclei, indicated by a white arrowhead, and an early CB, indicated by a white arrow). (B and C) When the bulk cytoplasm of the spermatids accumulates in a cystic bulge (CB), ubiquitinated proteins are prominent within the CB and the pre-individualized region (white asterisks). (D) Once all the cytoplasm is stripped away, ubiquitinated proteins are detectable only in the waste bag (WB). (E and F) Elongated spermatids from either cul3mds1 or klhl104 mutants, respectively, did not stain for ubiquitinated proteins. (G) Protein ubiquitination is detected in nuclei of early elongating spermatids. (H and I) The pattern of protein ubiquitination at earlier stages of spermatid maturation is not affected in cul3mds1 and klhl104 mutants. Scale bars, 100 lm. doi:10.1371/journal.pbio.0050251.g008 purpose, we stained wild-type testes with the FK2 monoclonal spermatid maturation was not significantly affected in / / antibody, which specifically detects ubiquitin-conjugated cul3Testis and klhl10 flies (Figure 8G–8I). These results proteins but not free ubiquitin. At the onset of individualiza- show that protein ubiquitination during spermatid individu- tion, a steep gradient of ubiquitinated protein expression is alization is largely mediated by the Cul3-Klhl10 complex. detected from the nuclear heads of the spermatids to the tips Therefore, we conclude that the Cul3-Roc1b-Klhl10 complex of their tails (yellow arrows in Figure 8A). During the caudal is functionally active as an E3 ubiquitin ligase to promote translocation of the IC, ubiquitinated proteins became protein ubiquitination during spermatid individualization. completely depleted from the newly individualized portion dBruce, a Giant IAP-Like Protein, Can Bind the Substrate- of the spermatids (the region that is flanked by a white Recognition Protein Klhl10 arrowhead and a white arrow in Figure 8A). The staining Our results suggest a simple working model in which the Cul3- remained abundant, however, in the pre-individualized Roc1b-Klhl10 complex promotes caspase activation via ubiq- portion of the spermatids, with the highest levels seen in uitination and degradation of a caspase inhibitor (Figure 9). The the cystic bulge (CB; Figure 8A–8C). At the end of best-characterized family of endogenous caspase inhibitors is individualization, the newly formed waste bag (WB) contained the IAP family [23,79]. Diap1 is essential for the survival of most, high levels of ubiquitinated proteins (Figure 8D). This if not all somatic cells [24,27,28,30,32,80,81]. However, it appears spatiotemporal pattern of protein ubiquitination is very that Diap1 is not the major caspase inhibitor in this context. If similar to the distribution of active effector caspase (compare Diap1 was a substrate for Cullin-3–mediated protein degrada- Figure 8A–8D to Figure S1B and S1E or to Figure 2 in [12]). tion, we would have expected to see an increase of this protein in This striking correlation supports the idea that protein cul3 mutants. However, no significant differences in Diap1 / / ubiquitination facilitates effector caspase activation in protein levels between wild-type and cul3Testis and klhl10 individualizing spermatids. Next, to test whether the observed mutant testes were detected (Figure 10A). ubiquitination process depends on an intact Cul3-Klhl10 Another candidate is the giant, 4852–amino acid-long, IAP- complex, we stained cul3Testis and klhl10 mutant spermatids like protein dBruce. dBruce function is necessary to protect with the FK2 antibody. The overall level of protein sperm against unwanted caspase activity, because loss of dbruce ubiquitination was dramatically decreased in elongated function causes degeneration of spermatid nuclei and male spermatids from both mutants (Figure 8E and 8F). Further- sterility [12,24]. To further investigate possible interactions more, this reduction was specific to late elongated sperma- between dBruce and the Cul3-Roc1b-Klhl10 complex, we tids, because protein ubiquitination during early stages of tested whether the substrate recruitment protein Klhl10 can

PLoS Biology | www.plosbiology.org2280 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure 9. Working Model for a Cullin-3–Based Ubiquitin Ligase Complex in the Testis The diagram represents the assembly of the testis-specific Cullin-3–containing ubiquitin ligase (E3) and its proposed function in caspase activation during spermatid individualization. (A) The model suggests that once an active Cul3Testis-Roc1b-Klhl10 E3 ubiquitin ligase complex is assembled, it recruits a caspase inhibitor ‘‘CI’’ protein (red) via the Kelch domain of the substrate recruitment protein Klhl10 (yellow). A candidate for this caspase inhibitor is dBruce, a giant BIR-domain- containing ubiquitin-conjugating enzyme [12,35,36,103,104]. dBruce can physically interact via its BIR domain with Klhl10 (see Figure 10), and loss of dbruce function leads to spermatid death [12]. Therefore, dBruce has biochemical and genetic properties expected for the postulated ‘‘CI’’ protein. (B) Next, the ubiquitin-conjugating enzyme (E2, blue), which is recruited by the RING finger protein Roc1b (purple), ubiquitinates the ‘‘CI’’ protein. (C) Subsequent degradation of this inhibitor allows the activation of caspases at the onset of spermatid individualization process. doi:10.1371/journal.pbio.0050251.g009 bind to dBruce. For this purpose, we expressed tagged versions required for activation of effector caspase, but not for other of Klhl10 and portions of dBruce in S2 cells and performed co- individualization events, such as axonemal tubulin polygly- immunoprecipitation (co-IP) experiments (Figure 10B and cylation. Cullin-3–based E3 ubiquitin ligase complexes were 10C). In this system, Klhl10 efficiently immunoprecipitated previously implicated in various biological processes, includ- both a dBruce ‘‘mini gene’’ (consisting of the first N-terminal ing cell-cycle control and both Hedgehog and Wnt signaling 1,622 amino acids, including the BIR domain, and the last C- [78,82–85]. However, a role of these proteins in caspase terminal 446 amino acids that contain the UBC domain; Figure regulation has not yet been reported. A simple working 10B). Furthermore, a tagged peptide with the first N-terminal model to explain our results is that the Cul3-Roc1b-Klhl10 387 amino acids of dBruce that includes the BIR domain complex promotes caspase activation via ubiquitination and (amino acids 251–321) is sufficient to bind to Klhl10 in this degradation of a caspase inhibitor (Figure 9). This model is assay (Figure 10C). These data are consistent with the idea that further supported by the findings that the Cullin-3–based dBruce is a substrate for the Cullin-3-based E3-ligase complex. complex and effector caspases are activated in a very similar spatiotemporal pattern in individualizing spermatids, which Discussion is consistent with a direct link between effector caspase activation and protein ubiquitination in this system. In the present study, we show a physiological requirement of a cullin-3–based E3-ubiqutin ligase complex for caspase A Testis-Specific Cullin-3 Isoform Is Exclusively Expressed activation and sperm differentiation in Drosophila. In this in the Male Germline system, canonical apoptotic proteins are used to dramatically We identified four different cullin-3 transcripts, three of remodel cell structure by eliminating many organelles and which are somatic and share the same coding region, and one the majority of cytoplasm [12,50]. Loss-of-function mutations male germ-cell–specific transcript. The latter is transcribed in either a testis-specific isoform of cullin-3, the small RING from a separate promoter and contains a unique first exon that protein Roc1b, or the BTB-Kelch protein Klhl10, all reduce encodes the N-terminal TeNC domain. This result is somewhat or eliminate effector caspase activation in spermatids, are surprising, because there have been no previous reports of defective in spermatid individualization, and are male-sterile. tissue-specific expression of different Cullin isoforms with Although mutations in many genes are known to affect male distinct biochemical and functional properties. Our results fertility, several observations indicate that the genes de- indicate that the testis-specific TeNC domain plays an scribed here play a direct and important role in caspase important role for binding to the substrate recognition regulation. First, only 3% of the male-sterile lines (33 out of protein, Klhl10. The substrate specificity of Cullin-based E3 1,100) examined were negative for cleaved caspase-3 (CM1) complexes is generally achieved through a variety of substrate staining, and many other mutants that block spermatid recognition adaptors that may be differentially available in individualization and/or terminal differentiation remained different cell types [41,49,72]. Similar to the SCF and ECS caspase-positive. This confirms our earlier result that caspase complexes, the BTB-containing substrate recognition proteins activation in this system is independent of general differ- bind via their BTB domains to the N-terminal region of Cullin- entiation events [12]. Secondly, mutations in any of the three 3 [49]. In the Drosophila Cul3Testis isoform reported here, the cullin-3 complex genes retain AXO 49 staining, which has a TeNC domain is required for strong binding to Klhl10, caspase temporal pattern of expression virtually identical with CM1- activation, spermatid individualization, and fertility. Cul3Soma, staining. This shows that the Cul3-Roc1b-Klhl10 complex is which lacks the TeNC domain but is otherwise nearly identical

PLoS Biology | www.plosbiology.org2281 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

TeNC domain (see below). Therefore, it is possible that other factor(s) can substitute for the TeNC domain to promote the assembly of a similar Cullin-3–based E3 complex in species or tissues that do not express the TeNC domain. Role of the Ubiquitin-Proteasome System in Caspase Regulation and Cellular Remodeling Ubiquitin pathway proteins have well-established roles in the regulation of the cell cycle, DNA damage checkpoint, signal transduction, and in the regulation of apoptosis [37,87– 91]. Cullin-3–based E3 ubiquitin ligase complexes were previously implicated in various biological processes, includ- ing cell-cycle control, Hedgehog signaling, and Wnt signaling [78,82–85]. Our current study points to a previously unknown link between the ubiquitin-proteasome protein degradation system and caspase activation during late spermatogenesis. It is unlikely that the Cullin-3–based complex regulates caspases at the mRNA level, because transcripts of effector caspase drice and initiator caspase dronc are present in cul3mds1 mutant testes (Figure S5). A more likely model is that the Cul3-Roc1b-Klhl10 complex promotes degradation of a caspase inhibitor (Figure 9). According to this model, the ubiquitination and degrada- tion of this hypothetical caspase inhibitor at the onset of spermatid individualization would de-repress effector cas- pases and promote sperm differentiation. Whereas Diap1 is an essential caspase inhibitor in most somatic cells in Drosophila, it appears that it is not a major substrate for the Cul3-Roc1b- Figure 10. Diap1 Levels Are Not Affected in the Absence of the Klhl10 complex, because no significant differences in Diap1 / / Functional Cul3-Roc1b-Klhl10 Complex, but dBruce Can Interact with the protein levels between wild-type and cul3Testis and klhl10 Substrate Recruitment Protein Klhl10 in S2 Cells mutant testes were detected (Figure 10A). On the other hand, (A) Diap1 protein levels were not affected in cul3mds1 and klhl103 mutant the BIR domain region of another IAP-like protein, dBruce, testes, as assessed by Western blotting of protein extracts from dissected can bind to the substrate recruitment protein Klhl10 in S2 testes. Therefore, Diap1 does not appear to be a major target for the Cul3- based E3-ligase complex. b-tubulin protein levels served as loading control. cells (Figure 10B and 10C). These results suggest that dBruce is (B andC) Co-IP experiment in S2 cells indicate that Klhl10 can bind to the at least one of the substrates for the Cullin-3–based E3-ligase BIR domain of dBruce. The immunoprecipitate (IP) is shown at the top, complex. Importantly, it has been previously shown that loss and pre-incubation of whole lysates are shown at the bottom (Input). of dbruce function causes degeneration of spermatid nuclei Cell lysates were incubated with IgG beads which bind to Protein A (PrA). For Western blotting of IPs, (B) anti-dBruce antibody or (C) anti-HA and male sterility, suggesting that dBruce function in antibody were used. spermatids is tightly controlled to prevent unrestrained (B) Cells were co-transfected with a dbruce ‘‘mini gene’’ (consisting of the caspase activity [12,24]. first N-terminal 1,622 amino acids, including the BIR domain, and the last C-terminal 446 amino acids that contain the UBC domain) and (lane 1) Another interesting question raised by our results is how PrA-klhl10 or (lane 2) PrA-GFP (see Materials and Methods for details). spermatids can survive high levels of apoptotic effector (C) Cells were co-transfected with HA-tagged dBruce-BIR peptide caspase activity. Since transgenic ectopic expression of the containing the first N-terminal 387 amino acids of dBruce that includes the BIR domain region (amino acids 251–321). This motif is sufficient to effector caspase drICE leads to spermatid death (EA, MB, HS, bind to Klhl10 in S2 cells (see Materials and Methods for details). unpublished results), we propose that caspase activity in doi:10.1371/journal.pbio.0050251.g010 spermatids is restricted to specific subcellular compartments. A related phenomenon has been observed during the to Cul3Testis, bound much more weakly to Klhl10 and failed to caspase-dependent pruning of neurites [14,51]. This process / rescue spermatid individualization and fertility of cul3Testis is similar to spermatid individualization in that it uses the flies. We conclude that the TeNC domain is important for apoptotic machinery for the destruction of parts of a cell proper binding of Cul3Testis to Klhl10. However, this domain is [14,51–54]. Interestingly, a requirement for the ubiquitin- not sufficient for binding to Klhl10, indicating that additional proteasome system in the process of axon pruning was also sequences shared between Cul3Testis and Cul3Soma also con- reported [53]. These similarities suggest that the processes of tribute to this interaction. The TeNC domain is highly axon pruning and spermatid individualization may use conserved among eight different Drosophila species with an similar mechanisms to restrain the activity of apoptotic evolutionary divergence of up to 40 million years (Figure S3). proteins for cellular remodeling. In neurons, synaptic activity Spermatozoa of D. melanogaster are 300 times longer than can lead to local remodeling of synaptic proteins by localized human spermatozoa, and other Drosophilids can produce even proteasome-mediated degradation [92]. Likewise, it is possi- longer sperm, with a length up to 6 cm [86]. It is possible that ble that the proposed caspase inhibitor is only locally the TeNC domain of Cul3Testis evolved to facilitate coordinated degraded, which would allow for localized caspase activity regulation of caspase activation along the entire length of these in developing spermatids. giant spermatids. However, there is some indication that There is some evidence that the somatic isoforms of Cullin- Cullin-3 can regulate caspases in tissues that do not contain a 3 may also regulate caspase activity in other tissues. Loss of

PLoS Biology | www.plosbiology.org2282 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase cullin-3 function causes an increase in the number of with added NsiIandStuI restriction sites, respectively) and the BDGP’s Drosophila sensory organ precursors and external sensory EST clone AT07783 (forward primer GGCCCACAAAAAGTAGCA and reverse primer AGAGAATATCAAGAAATATATTAGAGGG with organs [71]. This phenotype is reminiscent of decreased added NheI and Acc65I restriction sites, respectively), and subcloned in activity of the apoptotic proteins Ark, Dronc, Dcp-1, or a sequential order into the PstIþStuI and SpeIþAcc65I sites, respectively, cytochrome C-d [93–97]. Therefore, Cullin-3 may also play a of the CaSpeR-4 vector (from V. Pirrotta). Subsequently, the complete coding regions of cul3Testis (a 2,817-bp fragment) and cul3Soma (a 2,336-bp role to regulate caspase activity in other non-apoptotic fragment) were PCR amplified from the BDGP’s EST clones AT07783 processes [13,81]. However, based on our results, we would (using the forward primer ATGCAAGGCCGCGATCCCCG and reverse expect that substrate recognition in the soma is mediated by primer TTAGGCCAAGTAGTTGTACA with added XhoI and NheI proteins other than Klhl10. restriction sites, respectively) and SD20020 (using forward primer ATGAATCTGCGGGGAAATCC and reverse primer TTAGGCCAAG A recent report suggest that mammalian KLHL10 and TAGTTGTACA with added XhoI and NheI restriction sites, respectively), Cullin-3 can interact in vitro and that Cullin-3 is highly and ligated into the XhoI and XbaI restrictions sites between the cul3Testis expressed during late murine spermatogenesis [77]. In 59 and 39 UTRs within the CaSpeR-4 vector, to generate tr-cul3Testis and tr-cul3Soma, respectively. addition, KLHL10 was shown to be exclusively expressed in To generate the tr-klhl10 rescue construct, the ORF of klhl10 (a the cytoplasm of developmentally advanced murine sperma- 2,320-bp fragment) was PCR amplified from the BDGP’s EST clone tids, and mice carrying a null klhl10 allele are infertile due to AT19737 (using the forward primer ATGAGTCGTAATCAAAACG and reverse primer CTATGTACGACGACGAATTT with added SalI defects during late spermatid maturation [98]. These data and XbaI restriction sites, respectively), and ligated into the XhoI suggest that a similar E3 complex may function in late and XbaI restriction sites between the cul3Testis 59 and 39 UTRs within mammalian spermatogenesis and that the defects in klhl10 the above vector. mutant mice may be due to lack of caspase-3 activity. Despite Standard Drosophila techniques were used to generate transgenic lines from these constructs. apparent anatomical differences between insect and mamma- Genetic screen of the Zuker male-sterile collection lines. The lian spermiogenesis, there are similarities in the removal of technical details of the screen were described in the supplementary 4 bulk spermatid cytoplasm. Like in insects, intracellular section in [50]. Antibody staining. Cleaved effector caspase antibody staining of bridges between spermatids and the bulk of the cytoplasm young (0–2 d old) adult testes was carried out as described in [12] using are eliminated during mammalian spermatogenesis. In a rabbit polyclonal anti-cleaved Caspase-3 (Asp175) antibody (CM1, addition, residual bodies, which contain the extruded Cell Signaling Technology, Cat. # 9661; http://www.cellsignal.com) diluted 1:75. The only changes are that the subsequent TRITC- cytoplasm of the mammalian spermatids show high levels of phalloidin (Sigma; http://www.sigmaaldrich.com) incubation for stain- active caspase-3 expression and may be homologous to the ing of the actin filaments was carried out for 5 min in room insect waste bag [99,100]. Furthermore, targeted deletion of temperature, and the slides were subsequently rinsed twice for 10 min the mouse Sept4 locus, which encodes the pro-apoptotic in PBS. Axonemal tubulin polyglycylation antibody staining was carried out using the mouse monoclonal antibody AXO 49 (a kind gift protein ARTS, causes defects in the elimination of residual from Marie-Helene Bre, University of Paris-Sud, France) diluted cytoplasm during sperm maturation [99]. Finally, a recent 1:5,000. The mouse anti-multi ubiquitin monoclonal antibody (FK2, study reported a high frequency of mutations in klhl10 from Stressgen; http://www.assaydesigns.com) was used at a dilution of 1:100. Isolation of genomic DNA and sequencing of the mutant alleles. infertile oligozoospermic men [101]. These intriguing ana- Genomic DNA was isolated from 25–50 adult flies using the High tomical and molecular similarities between spermatid indi- Pure PCR Template Preparation Kit (Roche; http://www.roche.com). vidualization processes in Drosophila and mammals suggest Genomic DNA (2 lg) was used to amplify overlapping fragments from the cullin-3 or klhl10 loci in wild-type and homozygote mutant lines. that further studies on the link between the ubiquitin- PCR reactions were carried out using DyNAzyme EXT DNA proteasome system and apoptotic proteins during sperm polymerase (Finnzymes; http://www.finnzymes.fi), according to the differentiation in Drosophila may provide new insights into the manufacturer instructions. The products were purified using the etiology of some forms of human infertilities. High Pure PCR Product Purification Kit (Roche), concentrated by evaporation, and sequenced in a GENEWIZ sequencing facility. DEVDase activity assay. 180 testes were dissected from newly Materials and Methods eclosed wild-type or cul3mds1 homozygote males, collected into 0.5 ll standard skirted tubes (Fisherbrand #05-669-25; http://www.fischersci. Fly strains and expression vectors. yw flies were used as wild-type com), standing on ice and containing 70 ll of testis buffer (10 mM controls. The Zuker mutants Z2–1089 (cul3mds1), Z2–4870 (cul3mds2), Tris-HCl [pH 6.8], 183 mM KCl, 47 mM NaCl, 1mM EDTA, and 1mM Z2–4061 (cul3mds3), Z2–1270 (cul3mds4), Z2–1062 (cul3mds5), Z2–1827 PMSF), homogenized using a Pellet Pestle Motor (Kontes; http://www. (klhl101), Z2–1331 (klhl102), Z2–0960 (klhl103), Z2–2739 (klhl104), kimble-kontes.com/), and subsequently transferred into three new 5 6 7 tubes (30:30:10 ll). The tubes with 10 ll of the testes extracts were Z2–3284 (klhl10 ), Z2–4385 (klhl10 ), and Z2–3353 (klhl10 ) were used for Western blot analysis to control for the protein amount in obtained from C.S. Zuker (University of California at San Diego, the samples by probing with anti-b-tubulin antibody (E7; 1:1000; gft1 gft2 gft3 gft4 gftGR18 United States); the gft mutants cul3 , cul3 , cul3 , cul3 , cul3 , Hybridoma Bank; http://dshb.biology.uiowa.edu/). Either Z-VAD (20 and cul3gftd577 from M. Ashburner (University of Cambridge, United lM final concentration; Enzyme Systems Products; http://www.mpbio. Kingdom); the osk[301]/TM3 and osk[CE4]/TM3 lines from R. Lehmann com/landing.php) or DMSO was added to each of the 30 ll tubes, and (Skirball Institute, NYU School of Medicine, New York, United States); the samples were transferred to a 96-well assay white plate (Costar dc3 #3610, Corning; http://www.corning.com), and allowed to incubate for roc1b from R.J. Duronio (University of North Carolina at Chapel 10 min at RT. Caspase-Glo 3/7 reagent (Promega; http://www.promega. Hill, North Carolina, United States); the deficiency lines DF(2L)ED3 com) was added to a final volume of 200 ll and the signal was detected from the Bloomington Stock Center; and the deficiency line with a multiwell plate reader (SPECTRA max M2, Molecular Devices; DF(2L)Exel8034 from Exelixis. http://www.moleculardevices.com). Luminescence readings were ob- The following BDGP’s cul3Testis EST clones: AT08710, AT10339, tained every 2 min; therefore, each time interval in the figure AT08501, AT07783, AT21182, AT19493, and AT03216 and the represents an average of five readings. Three experiments were cul3Soma EST clones SD20020 and RE58323 were either completely performed that gave similar results. or partially sequenced, and some of them were used as templates in RNA isolation and RT-PCR. Total RNA was extracted by using the PCR reactions for subcloning. Micro-to-Midi Total RNA Purification System (Invitrogen; http://www. The tr-cul3Testis and tr-cul3Soma rescue constructs were generated as invitrogen.com) according to the manufacturer’s recommendations. follows: a 979-bp fragment of the presumed promoter region and 59 Ten–twenty young adult testes or male reproductive tracts and ten UTR and a 345-bp fragment from the 39 UTR of cul3Testis were PCR adult females were used to obtain enough RNA for 5–10 RT-PCR amplified from genomic DNA (forward primer CACATTGGAG reactions. The samples were collected into 1.5-ml Eppendorf tubes CATCGTTAAA and reverse primer GAGATTGCTACGCTGGTCCA that were standing on ice and containing 300 ll of the Invitrogen kit’s

PLoS Biology | www.plosbiology.org2283 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase lysis buffer and 3 ll of 2-mercaptoethanol, homogenized using a Forty to sixty testes from wild-type and mutant adult males were used Pellet Pestle Motor (Kontes), and subsequently purified using the to prepare extracts in 30 ll of cell lysis buffer (20 mM HEPES–KOH same kit. In cases when the genomic DNA had to be removed, the 30 [pH 7.6], 150 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, ll of the RNA was incubated with 4 ll of RQ1 DNase and 3.8 llof 13 protease inhibitor cocktail, and 1 mM DTT). Total protein was appropriate buffer (Promega; http://www.promega.com) for 1.5 h at used for Western blot analysis using either mouse anti-CUL-3 37 8C, and subsequently purified again with the Invitrogen kit. The (1:1,000; BD Transduction Laboratories, cat #611848; http://www. RNA was stored in 80 8C or immediately used for RT-PCR reactions bdbiosciences.com) [102] or rabbit anti-Diap1 antibody [30]. using the SuperScriptTM III One-Step RT–PCR System with To generate the anti-dBruce antibody, sequence encoding the Platinums Taq DNA polymerase (Invitrogen). The Mastercycler C-terminal 446 amino acids of dBruce was cleaved from the T1A-ClaI Gradient PCR machine (Eppendorf; http://www.eppendorf.com) was cDNA clone (see above) using SalI and XmaI and then cloned into the programmed as follows: 50 8C for 30 min for the RT step followed by XhoI and XmaI sites of a derivative plasmid of the pET14b (Novagen; 94 8C for 2 min, and the amplification steps of 94 8C for 30 s, 60 8C for http://www.novagen.com). The expression plasmid was then trans- 30 s, and 68 8C for 1 min. A master-mix was prepared and aliquoted formed into BL21/DE3/pLys, followed by 2-h IPTG induction to to five tubes, each of which was amplified for 17, 20, 25, 30, or 35 express His6-dBruce-C-term. This protein was purified by nickel cycles. Absence of genomic DNA in RNA preparations was verified by affinity chromatography and used to raise rat polyclonal antibody replacing the RT/Taq mix with only Taq DNA polymerase (Invitro- (Covance; http://www.covance.com). This antibody recognizes the gen). The comparative RT–PCR reactions in Figure 3 were performed dBruce ‘‘mini gene’’ band on a Western blot (1:1,000). using two pairs of primers in a same reaction mix: For cul3Testis the For immunoprecipitation reactions, S2 cells were co-transfected forward primer TCTCATGCAAGGCCGCGATC and the reverse with Actin-Gal4, UAS-PrA-klhl10, and either UAS-dbruce ‘‘mini gene’’ or primer CGGGTTATTGGCTGGCGGTC amplified a 2,997-bp cDNA UAS-HA-(dbruce)BIR plasmids. For negative controls, S2 cells were co- fragment (and a 3,715-bp genomic fragment), whereas for cul3Soma, the transfected as above but with UAS-PrA-GFP instead of UAS-PrA-klhl10. forward primer CATTGATTGCCGCCGAGGAA and the reverse Cells were lysed 48 h post-transfection, and the extracts were then primer CGGGTTATTGGCTGGCGGTC amplified a 2,642-bp cDNA incubated with Dynabeads which are conjugated to rabbit IgG (Dynal, fragment (and a 4,911-bp genomic fragment). Invitrogen) at 4 8C for 1.5 h. Bound proteins were eluted by boiling in 3 For amplification of the 868-bp fragment of the transgenic tr- 3 SDS loading buffer and detected with anti-dBruce antibody (for the cul3Testis (and the 858-bp endogenous fragment) in Figure 4B, the presence of dBruce ‘‘mini gene’’) or anti-HA antibody (for the forward primer GAGACCCGAATCGCGAGTAG and the reverse presence of HA-(dBruce)BIR). primer GCATTCTTTAAGCTGGCCCA were used. For amplification of the 335-bp fragment of the transgenic tr-cul3Soma in Figure 4C, the forward primer GAGACCCGAATCGCGAGTAG (specific for cul3Testis Supporting Information promoter) and the reverse primer CATTTTGCCCTCCTTCTTGG Figure S1. The Spatiotemporal Expression Patterns of Axonemal (specific for cul3Soma) were used. To simultaneously amplify a 496-bp Tubulin Polyglycylation and Effector Caspase Activation at the Onset fragment of the endogenous cul3Testis, the reverse primer of Spermatid Individualization Are Identical GGAGGCGTTGGGCACATTGA was also used in the same reaction. For amplification of the 538-bp fragment from drice mRNA in (A–D) Quadruple staining of wild-type spermatids with the anti- Figure S5A, the forward primer GCCCACCTTGAAGTCTCGCG and glycylated tubulin monoclonal antibody AXO 49 (red, [66]); CM1, the reverse primer CAGGATGTCCAGCCGCTTGC were used. For which detects cleaved caspase-3 (green); phalloidin, which marks the amplification of the 527-bp fragment from dronc mRNA in Figure individualization complex (IC, magenta); and DAPI, to visualize the S5B, the forward primer CCACCGCCTATAACCTGCTG and the nuclei (blue). (A) Red layer, (B) green layer, (C) magenta and blue reverse primer CTGCACATACGACGAGGAGG were used. layers, and (D) all 4 layers. Before or at the early assembly of an IC, Plasmid construction, yeast strains, and cDNA library screening. neither tubulin polyglycylation nor cleaved caspase-3 is detected (yellow arrowhead). Once a mature IC is formed at the vicinity of the The Cul3Testis and Cul3Soma ‘‘bait’’ constructs were generated as nuclei and is about to begin its caudal translocation, steep cascades of follows: a 2,817-bp fragment containing the entire Cul3Testis coding region was PCR amplified from the BDGP’s EST clone AT19493 both tubulin polyglycylation on the axoneme and cleaved caspase-3 (forward primer CAAGGCCGCGATCCCCG and reverse primer expression in the cytoplasm are observed from the nuclei to the tip of TTAGGCCAAGTAGTTGTACA with added EcoRI and PstI restriction the tails (green arrowheads). sites, respectively), and a 2,336-bp fragment containing the entire (A–G) When the IC moves caudally and the bulk cytoplasm of the Cul3Soma coding region was PCR amplified from the BDGP’s EST spermatids accumulates in a cystic bulge (CB, white arrowheads), cleaved clone SD20020 (forward primer AATCTGCGGGGAAATCCTC and caspase-3 is removed from the post-individualized portion of the reverse primer TTAGGCCAAGTAGTTGTACA with added EcoRI and spermatids (the region between the nuclei and the CB, yellow arrows), PstI restriction sites, respectively). Both were subcloned in frame to but it is still prominent within the CB and the pre-individualized region the GAL4 DNA-binding domain using the EcoRI and PstI sites of the (the region between the CB and the tip of the tail, white arrows). Cleaved pGBKT7 vector (Matchmaker, Clontech; http://www.clontech.com). caspase-3 is eventually eliminated from mature spermatozoa. On the For the TeNC domain ‘‘bait’’ construct, a 600-bp fragment containing other hand, polyglycylation of the axonemal tubulin persists during the entire TeNC ORF was PCR amplified from wild-type genomic spermatid individualization and in mature spermatozoa (green arrow- DNA (forward primer CAAGGCCGCGATCCCCG and reverse primer head, yellow arrows and data not shown). Scale bars in (A–D), 100 lm; in GGGATATTAAGACTTTCGCT with added EcoRI and BglII restric- (E and F), 40 lm; and in (G), 200 lm. tion sites, respectively) and subcloned in frame to the GAL4 DNA Found at doi:10.1371/journal.pbio.0050251.sg001 (10.2 MB TIF). binding domain using the EcoRI and BamHI sites of the pGBKT7 vector (Matchmaker, Clontech). Figure S2. Mapping of the mds1 Mutation Two hybrid screens were performed using Saccharomyces cerevisiae The thick bar represents the cytological region between 35B1 and strain AH109 and an adult Drosophila cDNA library (Matchmaker, 35F7. The relative nucleotide positions of this region within the second Clontech). Selection was accomplished on synthetic complete chromosome are indicated above the bar. Thin bars depict available medium lacking tryptophan, leucine, and adenine for 3–7 d at 30 deficiencies in this region (red flanked by gray, Bloomington’s 8 ‘‘ ’’ C. To test for LacZ activity, positive prey cDNA clones were deficiencies; green, DrosDel’s deficiency; blue, Exelixis’ deficiencies). isolated and transformed into the Y187 yeast strain, which was pre- The mds1 mutants were crossed to all the deficiency lines from transformed with the appropriate ‘‘bait’’ constructs. FlyBase’s second chromosome ‘‘kit’’ and the trans-heterozygotes were The UAS-dbruce ‘‘mini gene’’ was generated as follows: a 5,022-bp tested for male fertility. The deficiency line Df(2L)TE35BC-24, which fragment encoding the N-terminal 1,622 amino acids of dBruce contains a large chromosomal deletion (cytological region 35B4/6– (including the BIR domain) was cleaved by EcoRI and XhoI from the 35E1/2) failed to complement the sterility of mds1 males, suggesting BDGP’s EST clone LD31268 and subcloned into the EcoRI and XhoI sites of the pUASt vector to generate the UAS-dbruce-59 vector. Next, that this region covers the mds1 mutation. Additional smaller deletion a 1,990-bp fragment encoding the C-terminal 446 amino acids of lines in this region were subsequently analyzed. The deficiencies dBruce (including the UBC domain) was cleaved with SalI and XbaI shown in purple, Df(2L)ED3 and Df(2L)Exel8034, failed to comple- from clone T1A-ClaI (originally identified as clone T1A in the T. ment, whereas the deficiencies shown in black complemented the Hazelrigg testis cDNA library by J. Agapite and was further cleaved mds1 sterility. This genetic analysis restricted the mds1 mutation to a with ClaI to remove the first 357 bp and then self ligated), and 54-kb genomic interval comprising nine genes (from the gft gene in subcloned in frame into the XhoI and XbaI sites of the UAS-dbruce-59 35C1 to the nht gene in 35D1). See details in the main text on the final vector to generate the UAS-dbruce ‘‘mini gene’’ plasmid. mapping of the mds1 to cullin-3. Western blotting of adult testis, antibodies, and immunoprecipitation. Found at doi:10.1371/journal.pbio.0050251.sg002 (524 KB TIF).

PLoS Biology | www.plosbiology.org2284 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

Figure S3. The TeNC Domain Has Been Highly Conserved Through- scriptase or without it, respectively, to control for possible genomic out Drosophila Phylogeny DNA contamination (see Materials and Methods for details about the primers that were used). The TeNC domains of Cul3Testis from eight Drosophila species were aligned using the ClustalW program (Dmel, melanogaster; Dsim, Found at doi:10.1371/journal.pbio.0050251.sg005 (181 KB TIF). simulans; Dyak, yakuba; Dere, erecta; Dana, ananassae; Dpse, pseudoobscura; gft Dmoj, mojavensis; Dvir, virilis). Identical or similar amino acids are Table S1. cul3 Lethal Mutants Failed to Complement the Sterility of mds depicted by the same color. In the consensus (cons.) lines, asterisks cul3 Mutant Males represent residues that are identical in all the species. Square dots Found at doi:10.1371/journal.pbio.0050251.st001 (28 KB DOC). appear above every tenth residue, and the total numbers of amino acid in each domain appear on the right of every line in the final block. Although conservation appears throughout the domain, two Acknowledgments regions of high conservation in the beginning and in the very end of the domain are revealed. Note that the divergence time distance We are deeply indebted to Charles Zuker for sending us their mutant between D. melanogaster and D. mojavensis or D. virilis is 40 million years. collection, to Barbara Wakimoto for providing us with the annotated Found at doi:10.1371/journal.pbio.0050251.sg003 (12.3 MB TIF). list of mutants, and to Maureen Cahill for collecting and shipping the stocks. We are grateful to E.M. Ashburner, M.H Bre, R.J. Duronio, R. Figure S4. The Expression Level of Cleaved Effector Caspase is Lehmann,H.Mistry,J.Roote,J.B.Skeath,Exelixis,andthe cul3Testis Dose-Dependent Bloomington stock center for providing additional stocks and (A–F) Cleaved caspase-3 is visualized by CM1 (green). In (C–F), the reagents. We greatly appreciate R. Cisse for her technical support in spermatids were also counter-stained with phalloidin, which detects generating the transgenics. We acknowledge A. Persaud for assisting F-actin (red). (C–F) Each figure is composed of a green layer alone with the screen. We thank the Steller lab members for encouragement (left panels) and combined green and red layers (right panels). (A) and advice, S. Shaham for critically reading the manuscript, A. Wild-type control spermatids display cleaved caspase-3 expression. Ciechanover for fruitful discussions during early stages of this project, (B) Spermatids from the hypomorphic cul3mds mutants, such as and J. Sohnis for drawing our attention to the paper by Bingol and cul3mds5, also display readable levels of cleaved caspase-3 expression. Schuman. EA was a fellow of the Charles H. Revson Foundation. EA is (C–F) However, a dramatic decrease in the level of cleaved caspase-3 currently the incumbent of the Corinne S. Koshland Career Develop- expression is observed upon reduction of cullin-3 gene copy or ment Chair and is supported by an Alon Fellowship at the Weizmann functionality by (C, D) crossing the hypomorphic cul3mds mutants, Institute of Science. EA also acknowledges The Morasha Program of such as cul3mds2, cul3mds4,orcul3mds5, to deficiencies that cover the The Israel Science Foundation for its support. HS is an Investigator cullin-3 locus, such as DF(2L)ED3, or to (E, F) the strong cul3/ alleles, with the Howard Hughes Medical Institute. such as cul3gft2, respectively. All figures were taken at the same Author contributions. EA and HS conceived and designed the magnification. Scale bar, 200 lm. experiments, analyzed the data, and wrote the paper. EA performed Found at doi:10.1371/journal.pbio.0050251.sg004 (7.8 MB TIF). the experiments, except for Fig. 10 which was designed and performed by MB. MB and GER participated in the genetic screens. Figure S5. Both drice and dronc Transcripts Are Present in cul3mds1 MB helped with the experiments shown in Figs. 1I-J, 3D, 5, and S5. Mutant Testes Funding. Part of this work was supported by the National Institutes Transcriptional expressions of (A) drice and (B) dronc were confirmed of Health grant RO1 GM60124 to HS. by RT-PCR analyses on RNA from wild-type and cul3mds1 mutant Competing interests. The authors have declared that no competing testes. ‘‘RTþTaq’’ and ‘‘Taq’’ indicate reactions with reverse tran- interests exist.

References 17. De Botton S, Sabri S, Daugas E, Zermati Y, Guidotti JE, et al. (2002) Platelet 1. Abraham MC, Shaham S (2004) Death without caspases, caspases without formation is the consequence of caspase activation within megakaryocytes. death. Trends Cell Biol 14: 184–193. Blood 100: 1310–1317. 2. Degterev A, Boyce M, Yuan J (2003) A decade of caspases. Oncogene 22: 18. Sordet O, Rebe C, Plenchette S, Zermati Y, Hermine O, et al. (2002) 8543–8567. Specific involvement of caspases in the differentiation of monocytes into 3. Lamkanfi M, Festjens N, Declercq W, Berghe TV, Vandenabeele P (2007) macrophages. Blood 100: 4446–4453. Caspases in cell survival, proliferation and differentiation. Cell Death 19. Ishizaki Y, Jacobson MD, Raff MC (1998) A role for caspases in lens fiber Differ 14: 44–55. differentiation. J Cell Biol 140: 153–158. 4. Budihardjo I, Oliver H, Lutter M, Luo X, Wang X (1999) Biochemical 20. Wride MA, Parker E, Sanders EJ (1999) Members of the bcl-2 and caspase pathways of caspase activation during apoptosis. Annu Rev Cell Dev Biol families regulate nuclear degeneration during chick lens fibre differ- 15: 269–290. entiation. Dev Biol 213: 142–156. 5. Salvesen GS, Dixit VM (1999) Caspase activation: The induced-proximity 21. Zermati Y, Garrido C, Amsellem S, Fishelson S, Bouscary D, et al. (2001) model. Proc Natl Acad Sci U S A 96: 10964–10967. Caspase activation is required for terminal erythroid differentiation. J Exp 6. Jiang X, Wang X (2004) Cytochrome C-mediated apoptosis. Annu Rev Med 193: 247–254. Biochem 73: 87–106. 22. Goyal L (2001) Cell death inhibition: Keeping caspases in check. Cell 104: 7. Cohen GM (1997) Caspases: The executioners of apoptosis. Biochem J 326: 805–808. 1–16. 23. Salvesen GS, Duckett CS (2002) IAP proteins: Blocking the road to death’s 8. Boatright KM, Salvesen GS (2003) Mechanisms of caspase activation. Curr door. Nat Rev Mol Cell Biol 3: 401–410. Opin Cell Biol 15: 725–731. 24. Goyal L, McCall K, Agapite J, Hartwieg E, Steller H (2000) Induction of 9. Shi Y (2004) Caspase activation: Revisiting the induced proximity model. apoptosis by Drosophila reaper, hid and grim through inhibition of IAP Cell 117: 855–858. function. EMBO J 19: 589–597. 10. Hengartner MO (2000) The biochemistry of apoptosis. Nature 407: 770–776. 25. Hay BA, Wassarman DA, Rubin GM (1995) Drosophila homologs of 11. Thornberry NA, Lazebnik Y (1998) Caspases: Enemies within. Science 281: baculovirus inhibitor of apoptosis proteins function to block cell death. 1312–1316. Cell 83: 1253–1262. 12. Arama E, Agapite J, Steller H (2003) Caspase activity and a specific 26. Lisi S, Mazzon I, White K (2000) Diverse domains of THREAD/DIAP1 are cytochrome C are required for sperm differentiation in Drosophila.Dev required to inhibit apoptosis induced by REAPER and HID in Drosophila. Cell 4: 687–697. Genetics 154: 669–678. 13. Kanuka H, Kuranaga E, Takemoto K, Hiratou T, Okano H, Miura M (2005) 27. Wang SL, Hawkins CJ, Yoo SJ, Muller HA, Hay BA (1999) The Drosophila Drosophila caspase transduces Shaggy/GSK-3beta kinase activity in neural caspase inhibitor DIAP1 is essential for cell survival and is negatively precursor development. EMBO J 24: 3793–3806 regulated by HID. Cell 98: 453–463. 14. Kuo CT, Zhu S, Younger S, Jan LY, Jan YN (2006) Identification of e2/e3 28. Wilson R, Goyal L, Ditzel M, Zachariou A, Baker DA, et al. (2002) The ubiquitinating enzymes and caspase activity regulating Drosophila sensory DIAP1 RING finger mediates ubiquitination of Dronc and is indispensable neuron dendrite pruning. Neuron 51: 283–290. for regulating apoptosis. Nat Cell Biol 4: 445–450. 15. Muro I, Berry DL, Huh JR, Chen CH, Huang H, et al. (2006) The Drosophila 29. Ryoo HD, Gorenc T, Steller H (2004) Apoptotic cells can induce caspase Ice is important for many apoptotic cell deaths and for spermatid compensatory cell proliferation through the JNK and the Wingless individualization, a nonapoptotic process. Development 133: 3305–3315. signaling pathways. Dev Cell 7: 491–501. 16. Clarke MC, Savill J, Jones DB, Noble BS, Brown SB (2003) Compartmen- 30. Ryoo HD, Bergmann A, Gonen H, Ciechanover A, Steller H (2002) talized megakaryocyte death generates functional platelets committed to Regulation of Drosophila IAP1 degradation and apoptosis by reaper and caspase-independent death. J Cell Biol 160: 577–587. ubcD1. Nat Cell Biol 4: 432–438.

PLoS Biology | www.plosbiology.org2285 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

31. Yang Y, Fang S, Jensen JP, Weissman AM, Ashwell JD (2000) Ubiquitin 61. Srinivasan A, Roth KA, Sayers RO, Shindler KS, Wong AM, et al. (1998) In protein ligase activity of IAPs and their degradation in proteasomes in situ immunodetection of activated caspase-3 in apoptotic neurons in the response to apoptotic stimuli. Science 288: 874–877. developing nervous system. Cell Death Differ 5: 1004–1016. 32. Hays R, Wickline L, Cagan R (2002) Morgue mediates apoptosis in the 62. Yu SY, Yoo SJ, Yang L, Zapata C, Srinivasan A, et al. (2002) A pathway of Drosophila melanogaster retina by promoting degradation of DIAP1. Nat signals regulating effector and initiator caspases in the developing Cell Biol 4: 425–431. Drosophila eye. Development 129: 3269–3278. 33. Lotan R, Rotem A, Gonen H, Finberg JP, Kemeny S, et al. (2005) Regulation 63. Koundakjian EJ, Cowan DM, Hardy RW, Becker AH (2004) The Zuker of the proapoptotic ARTS protein by ubiquitin-mediated degradation. J collection: A resource for the analysis of autosomal gene function in Biol Chem 280: 25802–25810. Drosophila melanogaster. Genetics 167: 203–206. 34. Shmueli A, Oren M (2005) Life, death, and ubiquitin: Taming the mule. 64. Wakimoto BT, Lindsley DL, Herrera C (2004) Toward a comprehensive Cell 121: 963–965. genetic analysis of male fertility in Drosophila melanogaster. Genetics 167: 35. Hao Y, Sekine K, Kawabata A, Nakamura H, Ishioka T, et al. (2004) Apollon 207–216. ubiquitinates SMAC and caspase-9, and has an essential cytoprotection 65. Bre MH, Redeker V, Vinh J, Rossier J, Levilliers N (1998) Tubulin function. Nat Cell Biol 6: 849–860. polyglycylation: Differential posttranslational modification of dynamic 36. Bartke T, Pohl C, Pyrowolakis G, Jentsch S (2004) Dual role of BRUCE as cytoplasmic and stable axonemal microtubules in paramecium. Mol Biol an antiapoptotic IAP and a chimeric E2/E3 ubiquitin ligase. Mol Cell 14: Cell 9: 2655–2665. 801–811. 66. Bre MH, Redeker V, Quibell M, rmanaden-Delorme J, Bressac C, et al. 37. Yang Y, Yu X (2003) Regulation of apoptosis: The ubiquitous way. FASEB J (1996) Axonemal tubulin polyglycylation probed with two monoclonal 17: 790–799. antibodies: Widespread evolutionary distribution, appearance during 38. Glickman MH, Ciechanover A (2002) The ubiquitin-proteasome proteo- spermatozoan maturation and possible function in motility. J Cell Sci lytic pathway: Destruction for the sake of construction. Physiol Rev 82: 109: 727–738. 373–428. 67. Fraser AG, McCarthy NJ, Evan GI (1997) drICE is an essential caspase 39. Ardley HC, Robinson PA (2005) E3 ubiquitin ligases. Essays Biochem 41: required for apoptotic activity in Drosophila cells. EMBO J 16: 6192–6199. 15–30. 68. Song Z, McCall K, Steller H (1997) DCP-1, a Drosophila cell death protease 40. Hershko A, Ciechanover A (1998) The ubiquitin system. Annu Rev essential for development. Science 275: 536–540. Biochem 67: 425–479. 69. Song Z, Guan B, Bergman A, Nicholson DW, Thornberry NA, et al. (2000) 41. Willems AR, Schwab M, Tyers M (2004) A hitchhiker’s guide to the cullin Biochemical and genetic interactions between Drosophila caspases and the ubiquitin ligases: SCF and its kin. Biochim Biophys Acta 1695: 133–170. proapoptotic genes rpr, hid,andgrim. Mol Cell Biol 20: 2907–2914. 42. Petroski MD, Deshaies RJ (2005) Function and regulation of cullin-RING 70. Ashburner M, Thompson P, Roote J, Lasko PF, Grau Y, et al. (1990) The ubiquitin ligases. Nat Rev Mol Cell Biol 6: 9–20. genetics of a small autosomal region of Drosophila melanogaster containing 43. Pintard L, Willis JH, Willems A, Johnson JL, Srayko M, et al. (2003) The the structural gene for alcohol dehydrogenase. VII. Characterization of the BTB protein MEL-26 is a substrate-specific adaptor of the CUL-3 region around the snail and cactus loci. Genetics 126: 679–694. ubiquitin-ligase. Nature 425: 311–316. 71. Mistry H, Wilson BA, Roberts IJ, O’Kane CJ, Skeath JB (2004) Cullin-3 44. Xu L, Wei Y, Reboul J, Vaglio P, Shin TH, et al. (2003) BTB proteins are regulates pattern formation, external sensory organ development and cell substrate-specific adaptors in an SCF-like modular ubiquitin ligase survival during Drosophila development. Mech Dev 121: 1495–1507. containing CUL-3. Nature 425: 316–321. 72. Cardozo T, Pagano M (2004) The SCF ubiquitin ligase: Insights into a 45. Geyer R, Wee S, Anderson S, Yates J, Wolf DA (2003) BTB/POZ domain molecular machine. Nat Rev Mol Cell Biol 5: 739–751. proteins are putative substrate adaptors for cullin 3 ubiquitin ligases. Mol 73. Noureddine MA, Donaldson TD, Thacker SA, Duronio RJ (2002) Drosophila Cell 12: 783–790. Roc1a encodes a RING-H2 protein with a unique function in processing the 46. Furukawa M, He YJ, Borchers C, Xiong Y (2003) Targeting of protein Hh signal transducer Ci by the SCF E3 ubiquitin ligase. Dev Cell 2: 757–770. ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat Cell Biol 5: 74. Donaldson TD, Noureddine MA, Reynolds PJ, Bradford W, Duronio RJ 1001–1007. (2004) Targeted disruption of Drosophila Roc1b reveals functional differ- 47. Wilkins A, Ping Q, Carpenter CL (2004) RhoBTB2 is a substrate of the ences in the Roc subunit of Cullin-dependent E3 ubiquitin ligases. Mol mammalian Cul3 ubiquitin ligase complex. Genes Dev 18: 856–861. Biol Cell 15: 4892–4903. 48. Figueroa P, Gusmaroli G, Serino G, Habashi J, Ma L, et al. (2005) 75. Hernandez-Munoz I, Lund AH, van der SP, Boutsma E, Muijrers I, et al. Arabidopsis has two redundant Cullin3 proteins that are essential for (2005) Stable X chromosome inactivation involves the PRC1 Polycomb embryo development and that interact with RBX1 and BTB proteins to complex and requires histone MACROH2A1 and the CULLIN3/SPOP form multisubunit E3 ubiquitin ligase complexes in vivo. Plant Cell 17: ubiquitin E3 ligase. Proc Natl Acad Sci U S A 102: 7635–7640. 1180–1195. 76. Kwon JE, La M, Oh KH, Oh YM, Kim GR, et al. (2006) BTB domain-containing 49. Pintard L, Willems A, Peter M (2004) Cullin-based ubiquitin ligases: Cul3- speckle-type POZ protein (SPOP) serves as an adaptor of Daxx for BTB complexes join the family. EMBO J 23: 1681–1687. ubiquitination by Cul3-based ubiquitin ligase. J Biol Chem 281: 12664–12672. 50. Arama E, Bader M, Srivastava M, Bergmann A, Steller H (2006) The two 77. Wang S, Zheng H, Esaki Y, Kelly F, Yan W (2006) Cullin3 is a KLHL10- Drosophila cytochrome C proteins can function in both respiration and interacting protein preferentially expressed during late spermiogenesis. caspase activation. EMBO J 25: 232–243. Biol Reprod 74: 102–108. 51. Williams DW, Kondo S, Krzyzanowska A, Hiromi Y, Truman JW (2006) 78. Zhang Q, Zhang L, Wang B, Ou CY, Chien CT, et al. (2006) A hedgehog- Local caspase activity directs engulfment of dendrites during pruning. Nat induced BTB protein modulates hedgehog signaling by degrading Ci/Gli Neurosci 9: 1234–1236. transcription factor. Dev Cell 10: 719–729. 52. O’Leary DD, Koester SE (1993) Development of projection neuron types, 79. Bergmann A, Yang AY, Srivastava M (2003) Regulators of IAP function: axon pathways, and patterned connections of the mammalian cortex. Coming to grips with the grim reaper. Curr Opin Cell Biol 15: 717–724. Neuron 10: 991–1006. 80. Ditzel M, Meier P (2005) Ubiquitylation in apoptosis: DIAP19s 53. Watts RJ, Hoopfer ED, Luo L (2003) Axon pruning during Drosophila (N-)en(d)igma. Cell Death Differ 12: 1208–1212. metamorphosis: Evidence for local degeneration and requirement of the 81. Kuranaga E, Kanuka H, Tonoki A, Takemoto K, Tomioka T, et al. (2006) ubiquitin–proteasome system. Neuron 38: 871–885. Drosophila IKK-related kinase regulates nonapoptotic function of caspases 54. Awasaki T, Tatsumi R, Takahashi K, Arai K, Nakanishi Y, et al. (2006) via degradation of IAPs. Cell 126: 583–596. Essential role of the apoptotic cell engulfment genes draper and ced–6 in 82. Singer JD, Gurian-West M, Clurman B, Roberts JM (1999) Cullin-3 targets programmed axon pruning during Drosophila metamorphosis. Neuron 50: cyclin E for ubiquitination and controls S phase in mammalian cells. Genes 855–867. Dev 13: 2375–2387. 55. Fuller MT (1993) Spermatogenesis in Drosophila. In: Bate M, Arias AM, 83. Pintard L, Kurz T, Glaser S, Willis JH, Peter M, et al. (2003) Neddylation and editors. The development of Drosophila melanogaster. Cold Spring deneddylation of CUL-3 is required to target MEI-1/Katanin for degrada- Harbor (New York): Cold Spring Harbor Laboratory Press. pp. 71–147. tion at the meiosis-to-mitosis transition in C. elegans. Curr Biol 13: 911–921. 56. Tokuyasu KT, Peacock WJ, Hardy RW (1972) Dynamics of spermiogenesis 84. Ou CY, Lin YF, Chen YJ, Chien CT (2002) Distinct protein degradation in Drosophila melanogaster. I. Individualization process. Z Zellforsch Mikrosk mechanisms mediated by Cul1 and Cul3 controlling Ci stability in Anat 124: 479–506. Drosophila eye development. Genes Dev 16: 2403–2414. 57. Fabrizio JJ, Hime G, Lemmon SK, Bazinet C (1998) Genetic dissection of 85. Angers S, Thorpe CJ, Biechele TL, Goldenberg SJ, Zheng N, et al. (2006) sperm individualization in Drosophila melanogaster. Development 125: The KLHL12-Cullin-3 ubiquitin ligase negatively regulates the Wnt-beta- 1833–1843. catenin pathway by targeting Dishevelled for degradation. Nat Cell Biol 8: 58. Noguchi T, Miller KG (2003) A role for actin dynamics in individualiza- 348–357. tion during spermatogenesis in Drosophila melanogaster. Development 130: 86. Pitnick S, Spicer GS, Markow TA (1995) How long is a giant sperm? 1805–1816. Nature 375: 109. 59. Huh JR, Vernooy SY, Yu H, Yan N, Shi Y, et al. (2004) Multiple apoptotic 87. Nakayama KI, Nakayama K (2006) Ubiquitin ligases: Cell-cycle control and caspase cascades are required in nonapoptotic roles for Drosophila cancer. Nat Rev Cancer 6: 369–381. spermatid individualization. PLoS Biol 2: E15. 88. Jesenberger V, Jentsch S (2002) Deadly encounter: Ubiquitin meets 60. Baker NE, Yu SY (2001) The EGF receptor defines domains of cell cycle apoptosis. Nat Rev Mol Cell Biol 3: 112–121. progression and survival to regulate cell number in the developing 89. Hershko A (1997) Roles of ubiquitin-mediated proteolysis in cell cycle Drosophila eye. Cell 104: 699–708. control. Curr Opin Cell Biol 9: 788–799.

PLoS Biology | www.plosbiology.org2286 October 2007 | Volume 5 | Issue 10 | e251 Caspase Regulation by a Cullin Ubiquitin Ligase

90. Pagano M (1997) Cell cycle regulation by the ubiquitin pathway. FASEB J 98. Yan W, Ma L, Burns KH, Matzuk MM (2004) Haploinsufficiency of kelch- 11: 1067–1075. like protein homolog 10 causes infertility in male mice. Proc Natl Acad Sci 91. Isaksson A, Musti AM, Bohmann D (1996) Ubiquitin in signal transduction U S A 101: 7793–7798. and cell transformation. Biochim Biophys Acta 1288: F21–F29. 99. Kissel H, Georgescu MM, Larisch S, Manova K, Hunnicutt GR, et al. (2005) 92. Bingol B, Schuman EM (2006) Activity-dependent dynamics and seques- The Sept4 septin locus is required for sperm terminal differentiation in tration of proteasomes in dendritic spines. Nature 441: 1144–1148. mice. Dev Cell 8: 353–364. 93. Kanuka H, Sawamoto K, Inohara N, Matsuno K, Okano H, et al. (1999) 100. Blanco-Rodriguez J, Martinez-Garcia C (1999) Apoptosis is physiologically Control of the cell death pathway by Dapaf-1, a Drosophila Apaf-1/CED-4- restricted to a specialized cytoplasmic compartment in rat spermatids. related caspase activator. Mol Cell 4: 757–769. Biol Reprod 61: 1541–1547. 94. Rodriguez A, Oliver H, Zou H, Chen P, Wang X, et al. (1999) Dark is a 101. Yatsenko AN, Roy A, Chen R, Ma L, Murthy LJ, et al. (2006) Non-invasive Drosophila homologue of Apaf-1/CED-4 and functions in an evolutionarily genetic diagnosis of male infertility using spermatozoal RNA: KLHL10 conserved death pathway. Nat Cell Biol 1: 272–279. mutations in oligozoospermic patients impair homodimerization. Hum 95. Chew SK, Akdemir F, Chen P, Lu WJ, Mills K, et al. (2004) The apical Mol Genet 15: 3411–3419. caspase dronc governs programmed and unprogrammed cell death in 102. Wu JT, Lin HC, Hu YC, Chien CT (2005) Neddylation and deneddylation Drosophila. Dev Cell 7: 897–907. regulate Cul1 and Cul3 protein accumulation. Nat Cell Biol 7: 1014–1020. 96. Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, et al. (2006) 103. Hauser HP, Bardroff M, Pyrowolakis G, Jentsch S (1998) A giant ubiquitin- Systematic in vivo RNAi analysis of putative components of the Drosophila conjugating enzyme related to IAP apoptosis inhibitors. J Cell Biol 141: cell death machinery. Cell Death Differ 13: 1663–1674 1415–1422. 97. Mendes CS, Arama E, Brown S, Scherr H, Srivastava M, et al. (2006) 104. Vernooy SY, Chow V, Su J, Verbrugghe K, Yang J, et al. (2002) Drosophila Cytochrome c-d regulates developmental apoptosis in the Drosophila Bruce can potently suppress Rpr- and Grim-dependent but not Hid- retina. EMBO Rep 7: 933–939. dependent cell death. Curr Biol 12: 1164–1168.

PLoS Biology | www.plosbiology.org2287 October 2007 | Volume 5 | Issue 10 | e251