CHARACTERIZATION OF AN NTN-HYDROLASE, PvdQ, AND AN L-ORNITHINE N5-MONOOXYGENASE, PvdA, INVOLVED IN PYOVERDINE BIOSYNTHESIS IN

PSEUDOMONASAERUGINOSA PAOl.

A Thesis

Presented to The Faculty of Graduate Studies

of The University of Guelph

by

LAURA J. RICE

In partial fulfillment of requirements For the degree of

Master of Science

August, 2010

©Laura J. Rice, 2010 Library and Archives Bibliothèque et ?F? Canada Archives Canada Published Heritage Direction du Branch Patrimoine de l'édition 395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada

Your file Votre référence ISBN: 978-0-494-71488-1 Our file Notre référence ISBN: 978-0-494-71488-1

NOTICE: AVIS: The author has granted a non- L'auteur a accordé une licence non exclusive exclusive license allowing Library and permettant à la Bibliothèque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l'Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans le loan, distribute and sell theses monde, à des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, électronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriété du droit d'auteur ownership and moral rights in this et des droits moraux qui protège cette thèse. Ni thesis. Neither the thesis nor la thèse ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent être imprimés ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.

In compliance with the Canadian Conformément à la loi canadienne sur la Privacy Act some supporting forms protection de la vie privée, quelques may have been removed from this formulaires secondaires ont été enlevés de thesis. cette thèse. While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.

1+1 Canada ABSTRACT

CHARACTERIZATION OF AN NTN-HYDROLASE, PVDQ, AND AN L- ORNITHINE N5-MONOOXYGENASE, PVDA, INVOLVED IN PYOVERDINE

BIOSYNTHESIS IN PSEUDOMONAS AER UGINOSA PAOl.

Laura J. Rice Advisor:

University of Guelph, 20 10 Dr. Stephen Seah

Pyoverdine is a siderophore and virulence factor produced by Pseudomonas aeruginosa, an opportunistic pathogen affecting the immunocompromised. Previous attempts to disrupt pyoverdine synthesis have resulted in pyoverdine negative phenotypes and a subsequent reduction in P. aeruginosa virulence. The components of the pyoverdine biosynthesis pathway therefore represent attractive antibiotic targets, however, not all aspects of this pathway are understood. This thesis investigated two enzymes involved in pyoverdine synthesis in an attempt to increase understanding of the biosynthesis process.

PvdQ is an Ntn-hydrolase with an unknown function that has been implicated in pyoverdine biosynthesis. Previous pvdQ knockout studies have resulted in the disruption of pyoverdine production, however, intact gene complementation was not completed. pvdQ complementation was completed in this thesis illustrating that lack of pyoverdine production was due to the pvdQ knockout mutation. Unsuccessful attempts were made to overexpress and purify PvdQ. Expression in E. coli resulted in insoluble proteins and there was no significant expression in P. aeruginosa.

We sought to increase the structure - functional understanding of PvdA, an L- ornithine N5-hydroxylase involved in the derivation of pyoverdine peptide amino acids, via mutagenesis of genes encoding several residues conserved amongst N-hydroxylating monooxygenases. The positive charge of the K69 residue appears to be important for substrate binding as an alanine substitution exhibited unusual kinetics in that at least 6 mM of L-ornithine is required to enhance its NADPH oxidation activity. A 5-fold decrease in NADPH oxidation activity in the presence of L-ornithine, was also observed, which could be somewhat restored with an arginine variant. H 189 appears to be important to catalysis as an alanine variant had a 12-fold decrease in NADPH oxidation activity compared to wild-type PvdA as well as an approximately 3000-fold decrease in the rate of formation of the hydroperoxyflavin production. Acknowledgements

First I would like to thank Dr. Stephen Seah for the opportunity to work in his lab.

Without his invaluable knowledge, patience, and guidance I would not have been able to complete this project. I am eternally grateful. I would also like to thank Dr. Lucy

Mutharia for being a member of my committee and for her guidance throughout my course of study. Past and present members of the Seah lab have provided an interesting and helpful lab environment, which allowed me to grow as a graduate student (and to stay entertained). I am grateful to my family and friends for endless love and support throughout my time at the University of Guelph. I would especially like to mention Filomena Ng, Dan Pan, Julian Tarling, and AtIi Magnusson for their support with science related matters and otherwise.

1 Table of Contents

Acknowledgements i

List of Tables vii

List of Figures ix

Glossary of Abbreviations xiii

Chapter 1 Literature Review 1

1 . 1 Importance of Iron 2

1.2 Bacterial Iron and Siderophores 2

1 .3 Pseudomonas aeruginosa and Iron Acquisition 4

1 .4 Structure and Synthesis of Pyoverdine 7

1.5PvdQ 18

1.6 Flavin-Dependant Monooxygenases 20

1.7PvdA 25

1.8 Research Objectives and Hypotheses 29

1 .9 Signignificance of research 34

Chapter 2 Materials and Methods 35 2.1 Chemicals 35

2.2 Media and Solutions 35

2.3 Bacterial Strains and Plasmids 35

2.4 Plasmid DNA Purification for DNA Sequencing and Cloning 36

2.5 Removal of the pvdQ Signal Peptide Sequence and Insertion of 36

Truncated pvdQ into pET28a

2.6 Creation of/?vcM_K69R Mutant 37

2.7 Transformation by Electroporation 38

2.8 Analysis of Plasmid DNA Transformants by Restriction Digest 39

2.9 Agarose Gel Electrophoresis 39

2. 10 Protein Expression 39

2. 10. 1 Mini Expression Studies 39

2.10.2 Large Scale Protein Overexpression 40

2.11 Purification of PvdA or PvdQ Contained in pET28a 4 1 by Ni-NTA Chromatography

2. 12 Sodium Dodecyl Sulfate-polyacrylamide Gel Electrophoresis 41

2. 13 Determination of Protein Concentration 42

111 2. 14 Detection of Pyoverdine in the Presence and Absence 42

of PvdQ via Spectrophotometric Analysis and UV illumination

2.15 Kinetic Assays of PvdA 43

2.16 Determination of Stoichiometry of Hydrogen Peroxide 44

or N -hydroxyornithine Production

2.16.1 Hydrogen Peroxide Detection 44

2.16.2 N -hydroxyornithine Detection 45

2. 17 Dissociation Constants for Cofactors NADP+ and FAD + 45

2.18 Spectral scans of PvdA wild-type and H189A variant enzyme 46

Reaction

2.19 Homology Modeling 46

Chapter 3 Cloning ofpvdQ and expression and analysis of PvdQ 47

3.1 Analysis of Pyoverdine Production in pvdQ Knockout Strain of 48

P. aeruginosa PAOl

3.2 Creation of Truncated pvdQ and Subcloning into pET28a 49

3.3 Mini-Expression Studies ofpvdQ Expression Systems 53

iv 3.4 Discussion 58

Chapter 4: Purification and Characterization of K69A, K69R, H189A, 61 and Wild-type PvdA

4. 1 Creation of the PvdA K69R Replacement 6 1

4.2 Expression and Purification of PvdA Wild-type and Mutants 63

4.3 Substrate Specificity and Kinetic Parameters of PvdA Wild-type, 68

K69A, and K69R Mutants

4.4 N5-hydroxyornithine and Hydrogen Peroxide Production Efficiency 78

for PvdA wildtype, K69A, and K69R Variants

4.5 Dissociation Constants for Cofactors NADPH and FAD+ in the K69 79

Variants of PvdA

4.6 Kinetic Parameters and Cofactor Dissociation Constants in the 83

H 189A PvdA Variant

4.7 N5-hydroxyornithine and Hydrogen Peroxide Production Efficiency 83

for H 189A Variant

4.8 Determination of Reduced Flavin Stability in H 189A Mutant 86 4.9 Homology Modeling 90

4.10 Discussion 95

Chapter 5 General Conclusions and Future Work 98

References 100

Appendix I Expression of a D70N PvdA Variant 112

Appendix II Amino Acid Sequence of PvdQ 114

Appendix III Media and Solutions 115

Vl List of Tables

Table 3.1: Pyoverdine production in P. aeruginosa PAOl. 52

Table 4. 1 : Yield of purified soluble wild-type, K69A and, H189A PvdA. 64

Table 4.2: Specific activity of PvdA wild-type, K69A, and K69R mutant 69 with a variety of substrates.

Table 4.3: Kinetic parameters in the presence of L-ornithine for PvdA 70 wild-type and K69R mutant.

Table 4.4: Kinetic parameters in the presence of L-lysine for PvdA 71 wild-type and K69R mutant.

Table 4.5: Kinetic parameters of cofactors NADPH and FAD+ for 77

PvdA wild-type, K69A, and K69R mutants.

Table 4.6: N5-hydroxyornithine and hydrogen peroxide production efficiency. 80

Table 4.7 : Dissociation constants of NADP+ and FAD+ for PvdA wild-type, 81

K69A, K69R, and H189A mutants determined via fluorescence titration.

Table 4.8: NADPH oxidation activity of PvdA H189A variant. 84 Table 4.9: Kinetic parameters in the presence of L-lysine for PvdA 85

H189A mutant.

Table 4. 10: PvdA Models generated by the Phyre structural prediction 92 web server. List of Figures

Figure 1.1: Siderophores representing different structural categories 5 and their natural producers.

Figure 1.2: Siderophore-mediated iron uptake in Gram negative 6 and Gram positive bacteria.

Figure 1.3: Three Pyoverdine variants typed by their peptide chain 9 and the P. aeruginosa strains from which they were first isolated.

Figure 1.4: The pyoverdine locus of P. aeruginosa PAOl. 12

Figure 1.5: Model of pyoverdine biosynthesis showing the putative roles 13 of various gene products.

Figure 1.6: Reactions catalyzed by PvdA and PvdF during pyoverdine 14 synthesis.

Figure 1.7: Model of non-ribosomal peptide synthetases (NRPSs) 15 involved in pyoverdine type I biosynthesis in P. aeruginosa PAOl.

Figure 1.8: Structural diagram of pyoverdine intermediate ferribactin. 16

Figure 1.9: Reactions of Baeyer-Villiger monooxygenases. 24 Figure 1.10: Proposed mechnism of the iV5-hydroxylation of L-ornithine 27 catalyzed by PvdA.

Figure 1.11: Creation of plasmid constructs to knockoutpvdQ. 30

Figure 1.12: Amino acid sequence alignment of Bacterial N-hydroxylating 32

Monooxygenases (NMOs).

Figure 3.1: Analysis of fluorescence in the supernatant of P. aeruginosa 50

PAOl in iron limiting media.

Figure 3.2: Spectral scans of culture supernatant of P. aeruginosa PAOl. 51

Figure 3.3: Agarose gel electrophoresis of NdeVHindlII restriction 54 digest of the recombinant plasmid pET28a containing?vdQ with the signal peptide sequence removed.

Figure 3.4: Coomassie-Blue stained SDS-Polyacrylamide gel showing 55 the BPERII mini-expression of full length PvdQ from pT7-7 in E. coli Rosetta 2 (DE3). 60

Figure 3.5: Coomassie-Blue stained SDS-polyacrylamide gel showing the 56

BPERII mini-expression of truncated PvdQ from pET28a in E. coli

BL21(DE3). Figure 3.6: Coomassie-Blue stained SDS-Polyacrylamide gel showing 57 the BPERII mini-expression of PvdQ from pVLT31 in P. aeruginosa.

Figure 4.1: Agarose gel electrophoresis of Ndel/Hindlll restriction 62 digest of the recombinant plasmid pET28a containing?vdA with the lysine 69 codon replaced with an arginine codon.

Figure 4.2: Coomassie-Blue stained SDS-polyacrylamide gel showing 65 the mini-expression studies of variant PvdA enzymes.

Figure 4.3: Coomassie-Blue stained SDS-polyacrylamide gel showing 67 purified PvdA wild-type and K69A, K69R, and H189A variant enzymes.

Figure 4.4: Example of a progress curve of the PvdA NADPH oxidation 72 activity.

Figure 4.5: Example plot of initial velocity versus L-ornithine 73 concentration for PvdA wild-type.

Figure 4.6 Kinetic analysis of K69A activity in the presence of L-ornithine. 75

Figure 4.7: Kinetic analysis of K69A activity in the presence of L-lysine. 76

Xl Figure 4.8: Example plot of change in fluorescence versus FAD+ 82 concentration for PvdA wild-type.

Figure 4.9: Spectral scans of PvdA wild-type enzyme reaction. 87

Figure 4. 10: Spectral scans of the H189A PvdA variant enzyme reaction. 88

Figure 4.11: Plot of absorbance versus time at 450 nm in the H189A 89 variant catalyzed reaction.

Figure 4. 12: Structural superimposition of Phenylacetone monooxygenase 93

(PAMO) from Thermobifidafusca and a model of PvdA from

P. aeruginosa PAOl.

Figure 4. 13: Interface between putative NADP and FAD binding 94 domains in a model of PvdA based on the crystal structure of

PAMO (PDB 1W4X).

XIl Glossary of Abbreviations

ABC transporters ATP-Binding Casette NAD/H nicotinamide transporters adenine dinucleotide AHL acyl- NADP/H nicotinamide homoserine adenine lactone dinucleotide phosphate AIDS acquired NMO N-hydroxylating immunodeficiency monooxygenase syndrome ATP Adenosine NRPS non-ribosomal triphosphate peptide synthetase BVMO Baeyer-Villiger Ntn-hydrolase N-terminal monooxygenase nucleophilic hydrolase CAS casamino acid ORF open reading frame CFU colony forming unit PAGE Polyacrylamide gel electrophoresis CHMO cyclohexanone PAMO phenylacetone monooxygenase monooxygenase DNA deoxyribonucleic PCP peptidyl carrier acid protein dNTP deoxynucleoside PCR polymerase chain triphosphate reaction DTT Dithiothreitol PVD Pyoverdine FAD flavin adenine SDS sodium dodecyl dinucleotide sulfate FMN flavin TAE tris-acetic acid- mononucleotide EDTA FMO flavin-containing monooxygenase GAT glutamine PRPP amidotransferase HAPMO 4-hydroxy acetophenone monooxygenase IPTG Isopropyl-ß-D-thio galactopyranoside kDa Kilodalton Kbp Kilobasepair LB Luria-Bertani

XlIl Chapter 1 Literature Review

1.1 Importance of iron

Iron is reported as an element essential for growth of almost all organisms, except for Lactobacillus sp. and Borrelia burgdorferi (Archibald, 1983; Posey & Gherardini, 2000). As the fourth most common transition element in the earth crust, it is not surprising that iron is involved in a vast number of biological processes including nitrogen fixation, cellular respiration, nucleoside and amino acid synthesis and DNA biosynthesis (Winkelmann, 1991; Wandersman & Delepelaire, 2004). Iron, in its ferrous form (Fe2+) is found in anaerobic reducing environments, such as the intestinal tract, and is soluble (Andrews et al, 2003). Ferrous iron can therefore be absorbed by cation transport systems and utilized (Walsh, 1979). Iron in the ferric form (Fe3+) is much less soluble and is found in aerobic non-reducing environments such as the lungs and soil.

Under oxic conditions ferric iron forms a precipitate (ferric hydroxide) with limited solubility and subsequently no bioavailability (Winkelmann & Carrano, 1997). As such, organisms have developed means to scavenge, store, solubilize, and utilize iron in attempt to meet their own iron requirements.

The free iron concentration in mammals is kept at a relatively low level, approximately 10"18 M in the ferric form (Bullen et al, 1978) to keep iron from invading microorganisms, to maintain iron stores for times of iron depletion, and to prevent iron toxicity, the latter of which can lead to free radical oxidative damage to organs and tissues, produced through the Fenton reaction (Wandersman & Delepelaire, 2004). Low free iron concentrations are achieved by binding iron to several proteins such as

1 lactoferrin, transferrin, and ferritin (Williams & Griffiths, 1992). Heme, an iron-binding prosthetic group, and hemoglobin, a protein made up of four heme molecules, are involved in iron storage and transport (Wandersman & Delepelaire, 2004). Other proteins such as haptoglobin and hemopexin are able to bind hemoglobin and heme respectively to further reduce iron concentrations. Pathogenic bacteria require an iron concentration of approximately 10"7 M. Thus in order to survive within their mammalian hosts they have developed methods to scavenge iron.

1.2 Bacterial iron acquisition and siderophores

Bacteria employ several direct and indirect iron acquisition methods. A small number of microorganisms are able to reduce ferric iron, allowing for the uptake of ferrous iron (Woolridge & Williams, 1993). This direct method of iron uptake is often achieved by the secretion of a reductase, such as the 9-kDa reductase employed by Listeria monocytogenes to reduce ferric iron bound to transferrin proteins (Cowart & Foster,

1985). Extracellular reduction of iron is not always involved, however, as bacteria more commonly bind host protein-iron complexes to specific outer membrane receptors.

Transferrin and lactoferrin are specific to membrane receptors TbpA and LbpA respectively which are found in bacteria such as Neisseria meningitides (Cornelissen, 2003). N. meningitides also possesses outer membrane receptors for heme related proteins; the HpuA outer membrane receptor binds both haptoglobin and hemoglobin while the HmbR outer membrane receptor is responsible for binding hemoglobin

(Wandersman & Delepelaire, 2004). Binding of host proteins to their specific receptors results in proteolytic cleavage, which disrupts Fe (III) binding sites and allows for ferric iron to be internalized. Indirect iron-uptake methods involve the secretion of iron-

2 chelating molecules such as siderophores, hemophores, and citrate (Wandersman & Delepelaire, 2004). Siderophores are low molecular weight iron chelators with a high ferric iron affinity (Kaff > 10 ) as reviewed in Byers & Arceneaux, 1998. Over five hundred different siderophores have been discovered to date, making up three main siderophore classes: catechol ring siderophores, such as enterobactin, hydroxamate siderophores, such as ferrichrome, and hydroxyacid siderophores, such as pyochelin

(Wandersman & Delepelaire, 2004) (Figure 1.1). These molecules are produced and secreted into the environment where they employ donor atoms such as oxygen, and less commonly nitrogen and sulphur to bind and extract iron from host proteins (Winkelmann

& Carrano, 1997; Marx 2002). The siderophore-ferric iron complex then returns to the bacterial surface where it interacts with high specificity to membrane bound receptors, such as the FhuA receptor for ferrichrome in E. coli, to transport the complex into the bacterial cell. This transport is dependant on energy coupling to the TonB complex and an intact proton motive force across the cytoplasmic membrane (Clarke et al., 2001).

How iron is released from the siderophore after internalization is only understood in a limited number of cases. It is proposed that once in the periplasmic space in Gram negative bacteria a periplasmic binding protein, such as FbpA from Haemophilus and

Neisseria species, transfers the ferric iron complex from the siderophore to an ABC transporter. Gram positive bacteria lack this periplasmic binding protein, and they therefore transfer the siderophore-iron complex directly from the siderophore receptor to the cytoplasmic ABC permease. In the cytoplasm Fe3+ is reduced to Fe2+, which then dissociates from the siderophore. The siderophore may be recycled back into the

3 extracellular environment for further iron acquisition. These general mechanisms are depicted in Figure 1.2.

1.3 Pseudomonas aeruginosa and iron acquisition

Pseudomonas aeruginosa is a Gram negative bacterium that is found ubiquitously in the environment. As an opportunistic pathogen P. aeruginosa often causes infection in the immunocompromised, such as patients with AIDS or severe burns (Lyczak et al, 2000). In addition P. aeruginosa is the leading pathogen in cystic fibrosis infections, which can cause mortality rates over 50%. This pathogen has the ability to form biofilms and also possesses several virulence factors including PrpL endoprotease, an alkaline protease that functions to remove iron from host proteins and Exotoxin A, an extracellularly released toxin that inhibits protein synthesis (Poole & McKay, 2003). P. aeruginosa has the ability to utilize a wide range of siderophores for iron acquisition, including those from other bacterial and fungal species, such as enterobactin from Escherichia coli (Poole & McKay, 2003). P. aeruginosa also produces two siderophores: pyochelin, a hydroxyacid siderophore, and pyoverdine, a mixed hydroxymate-catecholate siderophore (Cornells & Matthijs, 2002; Wandersmann & Delepelaire, 2004). Two molecules of pyochelin are required to bind one ferric iron molecule with a formation constant of 105 while one pyoverdine molecule can bind one iron molecule with a formation constant of 1032.

4 NH ?

COOHI* OH* * HOOC

OH* N

ri-, il »0-^^NH OH /--NH *HO. \_nhJ^/ > [O]* [OH]* 0. /"^ N....NH NH,NH' HN 1 OH NH O=I, H2C "^ NH H. M- / HN NH m- *mfy™^hm HN , NnE)M

/-OH

Figure 1.1: Siderophores representing different structural categories and their natural producers. (A) Catecholate enterobactin produced by enteric bacteria and Streptomyces spp. (B) Carboxylate staphyloferrin produced by Staphylococcus spp. (C) Phenolate yersiniabactin produced by Yersinia pestis and Yersinia enterocolitica. (D) Hydroxymate alcaligin produced by Alcaligenes denitrificans, Bordetella pertussis, and Bordetella bronchiseptica. (E) Mixed hydromate-catecholate pyoverdine type I produced by Pseudomonas aeruginosa PAOl. Chemical groups forming the basis of categorization are boxed. Asterisks are beside groups interacting with Fe3+.

5 B Fe3+ Outer-membrane ^ receptor OM

Pe ri ?!asmic- Fe3' ^ f M binding protein Membrane-associated Q binding protein ^ ? ABC transporte CM I I—ATP-binding f-ATP-binding casette proteins casette proteins

ADPAT+ Pi _^A? V Fe3+ Cytoplasm 4

Fe2+ X,

degradation export outside degradation A export outside cell for re-use cell for re-use

Figure 1.2: Siderophore-mediated iron uptake in Gram negative and Gram positive bacteria. Gram negative (A) bacteria bind ferri-siderophores through a specific outer membrane (OM) receptor. The process is driven by cytosolic membrane (CM) potential and mediated by the energy transducing TonB-ExbB-ExbD complex. Ferri-siderophores are then shuttled via periplasmic binding protein to CM ATP-binding cassette (ABC) transporters, which serve to transfer ferri-siderophores to the cytosol. Ferri-siderophore complexes are then most likely dissociated via reduction. Gram positive (B) bacteria lack the OM and subsequently do not depend on specific OM receptors or TonB-ExbB-ExbD complexes. Ferri-siderophores are transferred across the CM via a lipoprotein binding protein that is tethered to the external surface of the CM and ABC transporters analogous to those observed in the Gram negative system. Further significance of pyoverdine is the fact that binding of a pyoverdine-ferric iron complex to its outer membrane receptor FpvA increases the transcription and secretion of pyoverdine as well as other virulence factors of P. aeruginosa, such as exotoxin A and PrpL proteases. Meyer et al. (1996) created and grew P. aeruginosa pyoverdine-deficient mutant strains along with the P. aeruginosa PAOl wild-type strain in bicarbonate succinate medium to which apotransferrin had been added. Full inhibition of mutant strain growth was observed but was restored with the addition of pyoverdine to the medium. In addition when the P. aeruginosa PAOl wild-type strain was grown at a temperature at which pyoverdine is not produced (43 0C) growth inhibition was observed.

In media containing iron bound to ferri-transferrin, pyoverdine mutants exhibited growth inhibition while pyochelin mutants were not affected (Ankenbauer et al, 1985).

Furthermore when pyoverdine-deficient mutant strains were injected subcutaneously into a burned mice model at 102 CFU, a dosage, which is normally lethal for the wild-type, it did not cause any death in the mice (Meyer et al, 1996).

1.4 Structure and synthesis of pyoverdine

Pyoverdine is made up of two major components: a 4,5-diamino-8,9- dihydroxyquinoline chromophore covalently linked to a peptide chain that can be cyclic, partially cyclic, or linear. The chromophore structure provides a yellow-green fluorescence and contributes two vicinal hydroxyl groups that are involved in ferric iron chelation. In addition, a dicarboxylic acid is amide linked to the amino group of the chromophore. This N-substituent of unknown function can be a-ketoglutarate, glutamate, succinamide, malate, succinate or maleamide, depending on the growth phase of the bacterial cells (Budzikiewicz, 1997). Though the chromophore remains conserved

7 between Pseudomonas species or strains, the length and composistion of the peptide chain varies. Specifically P. aeruginosa strains have three types of pyoverdine with different amino acid composition (Figure 1.3).

The genes (pvd) involved in pyoverdine synthesis in P. aeruginosa (and other fluorescent Pseudomonads) are not all contiguous (Ravel & Cornells, 2003) (Figure 1.4). In addition the pvd locus is the most divergent locus within the genome of various P. aeruginosa strains, reflecting how pyoverdine peptide structure is strain specific (Spencer et al, 2003; Visca et ai, 2006). In fact it has been demonstrated that many pvd genes are more similar to genes from other soil Pseudomonads than between P. aeruginosa strains

(Smith et ai, 2005). The functions of a number of pyoverdine biosynthetic proteins are not known, however, there has been a proposed mechanism of pyoverdine biosynthesis

(Visca et al, 2006) (Figure 1.5). Genes thought to be involved in pyoverdine biosynthesis have been identified based on the lack of production of fluorescent pyoverdine when the respective genes has been knocked out (Ochsner et al., 2002; Lamont & Martin, 2003).

However, these results must be interpreted with caution since the knockouts were not created by in-frame insertions and complementation of pyoverdine synthesis defects with the respective intact genes have not been demonstrated. For example, pvdM, N and O were previously reported to be essential for pyoverdine synthesis (Ochsner et al, 2002), but our lab has shown that in-frame insertion knockouts of each of these genes did not abolish the formation of the fluorescent pyoverdine (Firlit, 2006). Many pyoverdine synthesis genes are regulated by two extracytoplasmic sigma factors PvdS and Fpvl (Ravel & Cornells, 2003). These sigma factors are ultimately controlled by the Fur repressor, which responds to intracellular Fe(II) levels.

8 Type 1 - P. aeruginosa PAOl

\^??^? ???

HN I! h 0. H2C CH2-CH2 CH2 JNH H_.N^nH] U0J\ hn' \0Y ïY 0H ^h* Ji NH OH ??,^^? -^ \ HN^ /^-^\^NNíP HO'^^^^NHR O / O H /"OH

Type 2 - P. aeruginosa ATCC 27853

HN. .0

OH

HN NH HO / \ O=!. H^Y>kN0H H»?*' H,C "T^ 0? H0^a?^ß,??'N-^NH HN. H0's%5/Xííí*-NHR^Nl· HO. .OH O --?N r^ "N"

Type 3 - P. aeruginosa R and Pai

HN-U-° Lr 1Ili1 /-OH N H NH 0Y N H 0=1.. HN \.^*N^0 H^-^ HpN 3t^???^G OAhN OHI HO'^S^v^NHR,^ ., ^, V/^0?2-0?2-??2CH-V¿ HN-S H HOOC-^J °

Figure 1.3: Three Pyoverdine variants typed by their peptide chain and the P. aeruginosa strains from which they were first isolated. Fpvl regulates the fpvA pyoverdine membrane receptor gene, but not pyoverdine synthesis genes directly. Upstream from PvdS regulated genes or gene clusters exists a consensus "iron-starvation (IS)" box found approximately 30 to 40 base pairs from the transcription start. All putative pyoverdine biosynthesis genes contain the iron starvation box in their promotor region.

Although the synthesis pathway of pyoverdine is not fully elucidated, several elements have been determined. The synthesis of the pyoverdine peptide and chromophore are thought to be a catalyzed by non-ribosomal peptide synthetases (NRPSs) augmented with "finishing" reactions catalyzed by additional enzymes, resulting in the mature pyoverdine molecule (Ackerley & Lamont, 2004). The unusual amino acids that are found in pyoverdine, such as A^-formyl-A^-hydroxyornithine and L- 2,4-diaminobutyrate, are synthesized by separate Pvd enzymes. Specifically the peptidic moiety of the mature pyoverdine siderophore possesses two molecules of N5-formyl-N5- hydroxyornithine, which are derived from ornithine via a hydroxylase, PvdA, and a formylase, PvdF (Figure 1.6) before being incorporated into the pyoverdine peptide via NRPSs (Vandenende et al, 2004; Li & Seah, 2005). NRPSs are multimodular enzymes that synthesize a variety of microbial secondary metabolites (Visca et al, 2006). Each NRPS module is responsible for the addition of a single amino acid into a growing peptide product and thus the number of NRPS modules directly correlates with the number of amino acids found in a peptide chain.

Genes encoding NRPSs involved in pyoverdine peptide chain differ between strains, which correlate with differing amino acids within the peptides. The NRPSs involved in peptide synthesis in P. aeruginosa PAOl, which produces pyoverdine type I,

10 are PvdD, Pvdl, and PvdJ (Figure 1.7) (Ackerley & Lamont, 2004; Lehoux et al, 2000). Through experimentation with amino acid labeling and the isolation of a non-fluorescent pyoverdine intermediate, termed ferribactin (Figure 1.8), it was inferred that the pyoverdine chromophore is produced by a condensation reaction between D-tyrosine and L-2,4-diaminobutyrate, catalyzed by NRPS, PvdL (Hohlneicher et al, 2001; Visca et al, 2006). Ferribactin differs from mature pyoverdine in that the former contains a tripeptide L-Glu-D-Tyr-L-Dab in place of a chromophore (Visca et al, 2006). Therefore ferribactin and mature pyoverdine have identical peptide chains, supporting the idea that a peptide back-bone is synthesized before chromophore maturation occurs. Though pvd genes involved in peptide synthesis exhibit strain diversity, pvdL is well conserved between Pseudomonas strains (Ravel & Cornells, 2003). An additional four gene cluster, pvcABCD, located approximately 240 kb away from pvdS were initially thought to be essential pyoverdine chromophore synthesis (Stintzi et al, 1996, 1999), however, pvc mutants were later found to produce pyoverdine when grown in iron limiting media and are thus unlikely to be necessary for pyoverdine synthesis (Lamont & Martin, 2003).

Examination of the PvdL sequence illustrates that this NRPS has four rather than the anticipated three modules with the second, third, and fourth modules thought to activate L-glutamate, tyrosine, and L-2,4-diaminobutyrate respectively (Mossialos et al, 2002). Module 1 contains an atypical adenylation domain that is homologous to the first module of a synthetase thought to be involved in adding a long chain fatty acid in the assembly of the lipopeptide antibiotic mycosubtilin in Bacillus subtilis ATCC6633 (Duitmaneia/., 1999).

11 PA2385 FÄ2386 PA23S7 PA2388 PA2388 PA23SG PA2391 PA2392 PA2393 PÄ2394 PA2395 PA2396 PA2397

pvdQ pvdA fpvl fp¥R pvdP pvdM pvdN pvdO pvdF pvdE

??23"? F,\ PA2«0rt PA2402

fpvA pvctO pvdJ pvdl

PA24Ì2

PA24M PA2413 PA24Í7 PA2424 PA242S PA242Ì

W I JjEi

pvdH pvdL pvtìG pvdS

Figure 1.4: The pyoverdine locus of P. aeruginosa PAOl. Gene names as well as the orientations of open reading frames (ORFs) are indicated with numbers corresponding to those in the P. aeruginosa genome. The position of PvdS-dependent promoters are indicated with white arrow heads. Genes of interest to this thesis are bolded.

12 OUTERMEMBRANE- i R'

HO XXXNHR

PvdN? hydrolytic cleavage by PvdQ

PvdP? R'

NH ???^^^^? ÑH HO^\^5^^^ ?·?^N^n ^NH. HO O. ^NH ho^^An_l.GIU ^^AN_L. GIu Acyl

PEPRIPLASM

CYTOPLASMIC MEMBRANE-

CYTOPLASM HN- L-Glu-Acyl H I (membrane targeting '^ ^^ , acyl moiety)

PvdA L-ornith¡ne —— N5-hydroxylornithine IPvdF N5-formyl-N5-hydroxyornithine

PvdH Non-ribosomal peptide synthetases aspartate semialdehyde ¦- L-2,4-diaminobutyrate- PvdL, I, J, D

L-tyrosine, L-serine, L-arginine, L-lysine L-threonine

Figure 1 .5: Model of pyoverdine biosynthesis showing the putative roles of various gene products. R' represents the pyoverdine peptide chain which is (D-Ser)-(L-Arg)-(D- Ser)-(D-Arg)-(N5-formyl-N5-hydroxyornithine)-(L-lysine)-(N5-formyl-N5- hydroxyornithine)-(L-threonine)-(L-threonine). R represents the small N-substituent, which can be L-glutamate, succinate, succinnamide or malate. It is not clear if cyclization of diaminobutyrate to from the pyrimidine ring occurs in the cytoplasm or periplasm.

13 ÍÁJ

H '"i ,,OH N'' .N NAOPk* M* IAD * O2 PVdA ' \ "QOC NH3 H2O ooc Nl b MADP +FADH N"-îiydroxy-L-aîrntfi.ne t ornilhint»

H *\ .OH It OH H' N

N ' y· formy itetfa^yöroftsate

NH *· Ui ? : ™ ? lelitiíiydiofu'ute N' hycir&sry I -orntlhin« N'Mormyl-W-iiyiitoxy L -ornithine

Figure 1.6 Reactions catalyzed by PvdA and PvdF during pyoverdine synthesis. (A) PvdA catalyzes the N5-hydroxylation of L-ornithine via FAD+ reduction and NADPH consumption. (B) N5-hydroxyornithine is then formylated to produce In- fornivi- N5-hydroxy-L-ornithine, in a reaction that is catalyzed by PvdF and consumes cofactor N l °-formyltetrahydrofolate .

14 PvdL ? ~~~~ ~~~~~~ ~~~~~ ~~~i

SH SH SH SH *-^> * «—¦¦· - -t. * ' « ' FaUyAeM L-GIu D-Tyr L-Dab

Pvdl PvdJ PvdD r——~—~—^--^^^^ ? —i r_—___—_i

SH SH SH SH SH SH SH SH t v 1 "—m * D-Sw L*Aig D-Sw L-fOHOm L-Lyi L fOHOrn L-Thr L-TTir

Figure 1.7: Model of non-ribosomal peptide synthetases (NRPSs) involved in pyoverdine type I biosynthesis in P. aeruginosa PAOl. Four NRPSs are involved in producing a mature pyoverdine molecule: PvdL, which is thought to be involved with chromophore production. Pvdl, PvdJ and PvdD produce the peptide chain. NRPSs are multimodular and are further divided into several domains: A, adenylation domain (ATP dependent activation of the amino acid), PCP, peptidyl carrier protein domain (PCP, where the activated amino acid is covalently linked to the phosphopanteinyl prosthetic group on the enzyme), C, condensation or transpeptidylation domain (peptide bond formation between amino acids), Epim, epimerase domain (converts L-amino acids to D- amino acids) and TE, thioesterase domain (cleaves the peptide covalently linked to the PCP domain) as illustrated above.

15 peptide

NH Glu

Figure 1.8: Structural diagram of pyoverdine intermediate ferribactin. Ferribactin contains a tripeptide LGlu-D-Tyr-L-Dab in place of the chromophore found in mature pyoverdine.

16 The gene encoding the adenylation domain encoding module 1 of pvdL from P. aeruginosa PAOl has been PCR amplified, expressed and purified and subsequently shown using a coupled assay to activate long chain palmitic and myristic acids while noactivity was observed for the shorter chain dodecanoic acid (Seah, unpublished results). Therefore it is possible that pyoverdine is synthesized as a long-chain fatty acyl containing precursor that undergoes fatty acyl cleavage at the N-terminal end to produce the mature pyoverdine molecule. However, to date, pyoverdine precursor containing fatty acyl substituents have not been isolated. Conversely module 1 may be skipped entirely with peptide synthesis beginning at module 2, however, this is a rare and unlikely phenomenon.

If no module skipping occurs, what would be the function of a pyoverdine fatty acyl precursor? Modification of siderophores by fatty acids has been observed previously in marine bacterial species such as Halomonas aquamarina and Marinobacter species that produce amphiphilic siderophores (aquachelins and marinobactins respectively)

(Martinez et al, 2000). This allows the siderophore to stay partitioned in the bacterial cell membrane and prevent diffusion of these siderophores into the ocean. The only terrestrial siderophores to date that share this unique structure are the mycobactins produced by Mycobacterium tuberculosis. M. tuberculosis can survive within host macrophages after being phagocytosed (Krithika et al, 2006). Membrane bound mycobactins containing acyl substituents interact with the secreted carboxymycobactins (also produced by M. tuberculosis) to relay iron from the macrophage iron stock into the bacterial cell (Krithika et al, 2006). Membrane bound mycobactins may also act as extracellular iron storage molecules while remaining associated to the M. tuberculosis cell membrane. Though P.

17 aeruginosa does not face environmental challenges akin to M. tuberculosis or Marinobacter species, perhaps a pyoverdine containing an acyl substituent would have similar functions to aid in iron acquisition. However, centrifuged cultures of P. aeruginosa grown in iron limiting media revealed that fluorescence was found only in the culture supernatant and not the cell pellet. An alternative function of the acyl substituent would be to target the pyoverdine precursor synthesized in the cytoplasm to the cytoplasmic membrane, where it will be flipped to the periplasmic face of the membrane by a putative ABC transporter (PvdE) and further processed to form mature, fluorescent pyoverdine (Visca et al., 2006). Indeed, some gene products thought to be essential for pyoverdine biosynthesis, including PvdP and PvdQ, contain signal peptides that predict their periplasmic location.

This thesis will focus on the periplasmic protein PvdQ and the L-ornithine N5 hydroxylase, PvdA. The known properties of these proteins are discussed in more detail below.

1.5 PvdQ

PvdQ shares 23% amino acid sequence similarity to penicillin G acylase from E. coli, 53% and 32% sequence similarity to N-homoserine lactone acylase from Ralstonia species (AiiD) and Streptomyces lividans (AhIM), respectively (Huang et al, 2003; Park et al. 2004). Penicillin G acylase and homoserine lactone acylase are members of an enzyme superfamily termed the N-terminal nucleophilic (Ntn) hydrolases (EC 3.5.1). Other members include penicillin V acylase, proteasomes, glutamine PRPP amidotransferases (GAT), glycosylasparaginases, ?-Glutamyltranspeptidase, and the

18 conjugated bile acid hydrolases (Brannigan et al, 1995; Kumar et al, 2007). Each of the enzymes is encoded by a single gene and is translated to form a single peptide, which is subsequently autocatalytically cleaved to produce an a and a ß subunit (Lin et al, 2003). AU Ntn hydrolases catalyze amide bond hydrolysis by using the amino-terminal residue side chain of the a subunit as the nucleophile in a catalytic attack at the carbonyl carbon. This N-terminal residue could be cysteine in GAT, threonine in proteasomes, and serine in penicillin acylase (Brannigan et al, 1995). The Ntn-hydrolase nucleophile is post- translationally activated or "uncovered" through autocatalytic processes from inactive precursors. This process is not well characterized. However, it has been suggested that several amino acids in the inactive precursor are removed to reveal a free and catalytically active a-amino group (Brannigan et al, 1995). For example the structure of Penicillin V acylase exhibits an N-terminal cysteine residue while the gene sequence predicts an N-terminal sequence of Met-Leu-Gly-Cys, alluding to the fact that the first three amino acids preceding the cysteine nucleophile are auto-catalytically removed (Suresh et al, 1999). It is thought that the peptide may aid to properly fold or activate Ntn-hydrolases in the correct cellular location prior to being cleaved. Though there is limited sequence similarity among Ntn- hydrolases, they possess conserved and unusual four layer aßßa-core structure (Oinonen & Rouvinen, 2000).

SDS-PAGE analysis of purified PvdQ expressed in E. coli reveal an a and a ß subunit approximately 18 and 60 kDa in size, respectively (Sio et al, 2006). The open reading frame (ORF) of the pvdQ gene encodes a 726-amino-acid, 84 kDa protein, of which post-translational sub-unit cleavage characteristic of the Ntn-hydrolases, would yield the predicted subunit sizes (Sio et al, 2006). N-Terminal peptide sequencing

19 revealed that the a-subunit has the sequence Asp-Met-Pro-Arg-Pro, suggesting that the first 23 amino acids of this subunit are removed as expected for their predicted function as part of a signal peptide. This signal sequence terminates with Val-Gln-Ala, which is a variation of the characteristic Ala-X-Ala motif found in most Sec-type signal sequences (Sio et al., 2006). The Sec pathway translocates non-folded protein precursors through the cytoplasmic membrane (de Keyzer et al, 2003).

Due to its sequence similarity to penicillin acylase, PvdQ has been tested but was found to have no activity toward various ß-lactam compounds with a range of aliphatic and aromatic side chains (Sio et al, 2006). However, PvdQ has been shown to have acyl homoserine lactones (AHLs) acylase activity. AHLs are autoinducers that bacteria utilize for quorum sensing. The function of PvdQ in pyoverdine biosynthesis is however currently not known.

1.6 Flavin-dependant monooxygenases

Monooxygenases are able to oxygenate organic substrates through the activation of molecular oxygen, often through the use of a transition metal and/or organic cofactor. A sub-group of monooxygenases, termed the flavin-dependant monooxygenases (EC 1.14.13), for which PvdA is a member, achieve this activation via a tightly bound flavin cofactor in the reduced form (Massey, 1994). These flavin-dependant monooxygenases are a diverse class of flavoproteins found in both mammals and microorganisms and are involved in a vast number of biological processes such as antibiotic and siderophore production, biodégradation, regulation of plant hormone synthesis, and drug detoxification (Ballou et al, 2005). Hundreds of flavin-dependant monooxgenases have

20 been discovered and described, exhibiting a vast range of selectivities and reactivities including hydroxylations, epoxidations, Baeyer-Villiger oxidations, and sulfoxidations

(Berkel et al, 2006). The general mechanism of this group of enzymes involves the reduction of the tightly bound and electron rich (reduced) flavin cofactor by NADH or

NADPH, followed by the formation of a covalent adduct between the C(4a) of the flavin and molecular oxygen to produce a C(4a)-hydroperoxy flavin intermediate. This intermediate is unstable and typically decays into oxidized flavin and hydrogen peroxide

(Berkel et al, 2006). However, the flavin-dependant monooxgenases are able to stabilize the C(4a)-hydroperoxy flavin intermediate, and activates the substrate allowing the insertion of an oxygen atom (Entsch & van Berkel, 1995; Ballou et al, 2005). Flavin- dependant monooxgenases can be subdivided into single-component and two-component systems, which share no sequence or structural similarities, perhaps indicative of independent evolution. In the two-component system flavin reduction is catalyzed by an oxidoreductase, and the reduced flavin is transferred to a separate monooxygenase protein, which then reacts with molecular oxygen and hydroxylates a substrate.

Flavin-dependant monooxygenases can be further classified based on variety of criteria such as topology or sequence homology, the nature of oxidizing and reducing substrates, and the type of chemical reaction that is catalyzed (Massey, 2000). Berkel et al. (2006) classify flavin-dependant monooxygenases into six sub-groups A-F according to sequence and structural data. Class B flavin-dependant monooxygenases, also referred to as the multifunctional flavin-dependant monooxygenases as they are able to oxidize both carbon atoms and other (hetero) atoms, are of interest to this thesis because they contain enzymes involved in bacterial siderophore synthesis. The general characteristics

21 uniting members of Class B include the possession of a tightly bound cofactor, dependence on NADPH, tightly bound NADPH/NADP+ throughout catalysis, composed of two dinucleotide binding domains for FAD and NADPH binding, and presence of the

Rossmann fold structural motif, which functions to bind nucleotides (Berkel et al., 2006).

Class B is made up of three sub-families: flavin-containing monooxygenases (FMOs),

Baeyer-Villiger monooxygenases (Type I BVMOs), and microbial N-hydroxylating monooxygenases (NMOs) (Fraaije et al., 2002; Berkel et al, 2006).

FMOs were first isolated in hog liver microsomes and later found to be ubiquitous in mammals, other eukaryotic organisms, and bacteria. These enzymes are involved in xenobiotic detoxification and are generally substrate promiscuous, hydroxylating a vast number of nucleophilic substrates including phosphorous, selenium, iodine, and sulfur containing groups as well as primary, secondary and tertiary amines (Cashman & Zhang, 2006; Palfey & Massey, 1998). Structural characteristics of FMOs differ between organisms as mammalian FMOs are membrane bound tetramers/octamers and unicellular eukaryotic and bacterial FMOs are cytoplasmic dimers (Choi et al, 2003; Schlenk, 1998; Palfey & Massey, 1998).

The Baeyer -Villiger reaction, discovered in 1899 by Anton von Baeyer and Victor Villiger, involves the conversion of ketones into esters or cyclic ketones into lactones (Baeyer & Villiger, 1899). Baeyer-Villiger monooxygenases (BVMOs) catalyze the addition of an oxygen atom at the carbonyl carbon of a ketone with the use of cofactors NADPH or NADH (Malito et al, 2004). These monooxygenases are also able to oxygenate various heteroatoms such as nitrogen, selenium, phosphorous, and sulfur (Walsh & Chen, 1988). These enzymes are desirable in industry due to their high

22 specificity and catalytic efficiency and the conversion of the ketone into an ester can be utilized to synthesize various fine chemicals with the environmentally friendly byproduct water (Stewart et al, 1998). BVMOs are produced by numerous bacterial species (genera such as Rhodococcus, Pseudomonas, and Acinetobacter) as well as several species of fungi (genera such as Cumularía and Aspergillus) (Roberts & Wan, 1998; Willetts, 1997). Two sub-groups exist: Type I BVMOs contain cofactor flavin adenine dinucleotide (FAD), derive electrons from NADPH, and have identical sub-units while

Type II BVMOs contain cofactor flavin mononucleotide (FMN), utilize NADH as an electron source, with an a2ß trimer structure (Willetts, 1997). The first crystal structure of a Class B flavin-dependent monooxygenase determined was that of BVMO phenyacetone monooxygenase (PAMO) from the thermophile Thermobifida fusca (Malito et al, 2004). PAMO, a type 1 BVMO, catalyzes the conversion of phenylacetone to phenylacetate and exhibits two Rossman fold domains for binding NADPH and FAD. Though structurally similar to other flavin-dependant monooxygenases, BVMO dinucleotide binding domains are flanked by two helical domains unique to this group of monooxygenases (Berkel et al., 2006). Another distinctive feature of BVMOs is the production of the "Criegee" intermediate during catalysis. A peroxyflavin intermediate is produced when the reduced flavin interacts with molecular oxygen and the "Criegee" intermediate is a result of peroxyflavin attack on the substrate to be oxygenated (Malito et al, 2004). Examples of BVMO catalyzed reactions are illustrated in Figure 1.9.

23 NADPH + NADP* H* +0, + H,0

\

CHMO

cvclohexanone caprolactone

HAPMO V

HO- HO- / \ \ r~\

4-hydroxyacetophenone 4-hydroxyphenyl acetate

PAMO S***.

phenylacetone phenylacetate

Figure 1.9: Reactions of Baeyer-Villiger monooxygenases. A) General scheme of a Baeyer-Villiger oxygenation. B) Examples of several BVMOs and the reactions they catalyze; cyclohexanone monooxygenase (CHMO), 4-hydroxyacetophenone monooxygenase (HAPMO), phenylacetone monooxygenase (PAMO).

24 Microbial N-hydroxylating monooxygenases (NMOs) are involved in the biosynthesis of many bacterial and fungal siderophores (Berkel et al, 2006). The general reaction catalyzed by these monooxygenases is the N-hydroxylation of primary amines.

However, limited biochemical data has been determined for these enzymes (Berkel et al , 2006; Stehr et ai, 1998). Members include the L-lysine N6-hydroxylase, IucD, from E. coli and L-ornithine N5-hydroxylase, PvdA, from P. aeruginosa. These NMOs are involved in the production of siderophores aerobactin and pyoverdine respectively.

1.7 PvdA

The pvdA gene in P. aeruginosa PAOl is 1278 bp in length and codes for a 426 amino acid peptide with predicted molecular mass of 51.6 kDa (Visca et ai, 1994; Li & Seah, 2006). pvdA has been shown to be essential for pyoverdine synthesis through knock out experiments (Visca et al., 1994). The pvdA mutants lacked L-ornithine N5- hydroxylase activity and do not produce fluorescent pyroverdine. Addition of N5- hydroxyornithine in culture media restored pyoverdine synthesis, illustrating that hydroxylation of L-ornithine is an early step in pyoverdine synthesis, prior to incorporation into the growing pyoverdine peptide by NRPSs. An N-terminal histidine tagged PvdA was first successfully overexpressed in E. coli Rosetta 2 (DE3) cells and purified via Ni2+-nitrilotriacetic acid chromatography (Li & Seah, 2006). Purified PvdA was subjected to SDS-PAGE yielding a 51 kDa subunit, corresponding to the predicted molecular mass. Gel filtration estimated the native molecular mass of PvdA to be 236.6 kDa, alluding to the formation of tetrameric or pentameric quaternary structure. PvdA catalyzes the N5-hydroxylation of L-ornithine in the presence of NADPH

25 and FAD+. PvdA is specific to cofactors NADPH and FAD+ as NADH and flavin mononucleotide (FMN) gave negligible activity. Flavin-dependent monooxygenases employ various methods of control to unproductive reduction of FAD+, which can lead to the formation of hydrogen peroxide or other reactive oxygen species in the absence of substrate (Ballou et al, 2005). For example, in PHBH flavin cofactor reduction can only occur when the substrate binds. Alternatively, in FMOs, catalytic control depends on the enzyme stabilization of C(4a)-hydroperoxyflavin intermediate in the absence of substrate. The flavin is reoxidized to FAD+ only when the substrate binds (Beaty & Ballou, 1981).

It is through comparison with these analogous enzymes that a putative reaction mechanism of PvdA was deduced whereby binding of L-ornithine by PvdA is proposed to trigger the addition of O2 to the reduced flavin (Figure 1.10) (Meneely et al, 2009).

26 NADPH H N N N N Or ^r NH ^ NH N N >^ ?^ H

?,, Om OmOH, H2O S Y

H H N N N N 0T 0Y NH NH N N \ OH H \ 0 H 0 \ ? H OH 0 N OH H N OH H NH2 H NH2

N N T ^^ NH N VT H \ OH r ? H N OH H NH2

Figure 1.10 Proposed mechnism of the iV5-hydroxyIation of L-ornithine catalyzed by PvdA. FAD+ is reduced by NADPH and the addition of molecular oxygen is triggered in the presence of L-ornithine. The peroxyflavin intermediate is protinated, possibly by L- ornithine, to produce a hydroperoxyflavin species. L-ornithine is hydroxylated leaving a hydroxyflavin which through dehydration returns to the original oxidized flavin (Meneeley & Lamb, 2009).

27 However the structural basis for the regulation of PvdA activity by the substrate is not known since no crystal structures of PvdA or its homologues are available. PvdA exhibits optimum NADPH oxidation activity at a pH of 8.0 with an oxidation rate of 0.24 ± 0.02 µp??? min-1 mg-1 (Li & Seah, 2006; Macheroux et al, 1993). This NADPH oxidation activity was enhanced by approximately 5-fold in the presence 4mM L- ornithine. However, it was not activated by D-ornithine, indicating the specifity of PvdA towards the L-isomer. The coupling efficiency of NADPH oxidation and N5- hydroxyornithine production was determined to be 96% ± 2%, with negligible hydrogen peroxide production (Li & Seah, 2006). Interestingly NADPH oxidation was enhanced

3.9-fold in the presence of 4mM L-lysine, which is one carbon longer than L-ornithine, though the majority of NADPH utilized was channeled towards hydrogen peroxide production (90% ±1%) and no N -hydroxylysine were produced. Fluorescence titration allowed the determination of the equilibrium dissociation constant for FAD+ (9.9 ±

0.3µ?) (Li & Seah, 2006).

The structure-function relationship of many N-hydroxylating FMOs, including

PvdA, is not well understood. There have been inferences concerning cofactor and substrate binding sites based on three areas of conserved regions determined through

CLUSTALX and MACAW sequence alignments of various N-hydroxylating siderophore biosynthetic enzymes and mammalian N-hydroxylating dimethylaniline monooxygenases (Stehr et al, 1998). The FAD binding motif was predicted as a N-terminal GXGXXG/P and the NADPH binding motif as a central GXGXXG/A/S. The substrate-binding motif is predicted at C-terminus as L/FATGY (siderophore synthesis/mammalian and IucD).

However, without experimental evidence, these predicted putative substrate/cofactor

28 binding motifs are speculative.

1.8 Research Objectives and Hypotheses

The objectives of this project are to determine if PvdQ is involved in pyoverdine biosynthesis and to characterize PvdA.

From knock-out studies in P. aeruginosa PAOl, the pvdQ gene was thought to be essential for pyoverdine biosynthesis (Ochsner et al, 2002; Lamont & Martin, 2003).

However, complementation of pyoverdine synthesis defects with the intact pvdQ gene have not been performed with the knock-out mutants in those studies. Other genes previously implicated in pyoverdine biosynthesis, based on the same knockout studies, have been refuted upon further analysis. These include the pvc gene cluster andpvdM, N and O genes (Clarke-Pearson & Brady, 2008; Firlit, 2006). Given that PvdQ has only been shown to hydrolyze the the quorum sensing molecule N-acyl homoserine lactone and its role in pyoverdine biosynthesis is unclear, the first objective of this thesis is to analyse the knockout mutant of pvdQ in P. aeruginosa PAOl and ensure that it is indeed essential for pyoverdine biosynthesis. pvdQ knockout strains were created previously in the lab as summarized in Figure 1.11.

29 &*53?

/Jtfeí / HfHSl'f f"

pUCGM prr-t

/ / / Amo

-— ¦ — ,.--' stimi I Bcoflp /

¿ Ugatô ?a?? *" Untai Xml ,JfV1SNP"^

pri-T SacB ^ I PEXMT=

*MW ,,;.i,Gin HnUK/

—*- BìpaMitfai mating 'Aiitî f* aen^rfïu$3 |SËX18ïe rh

Figure 1.11: Creation of plasmici constructs to knockout pvdQ. pvdQ was amplified by PCR from the genomic DNA of P. aeruginosa PAOl. Primers for the PCR contain introduced MM and HmdIII sites to facilitate insertion of the gene into the E. coli plasmid, pT7-7. A gentamycin resistant cassette from pUCGm was excised by Smal digestion and inserted into the similarly blunt ended EcoRY digested ???-7/pvdQ. pvdQ.Gm cassette is then transferred to the plasmid pEX18Tc via XbaVHindIIl digest. This pEX18Tc construct is then transformed into E. coli SMlO, which is used for biparental mating with P. aeruginosa PAOl according to the procedure of Hoang et al. (1998). Gentamycin resistant, tetracycline sensitive, sucrose sensitive P. aeruginosa conjugants were selected. Successful replacement of the chromosomal copy of the pvdQ gene with the gentamycin insertion construct was confirmed by Southern hybridization.

30 As mentioned previously little is known about the structure-functional relationship of PvdA and various other NMOs. An alignment of several monooxygenases reveals a series of conserved and semi-conserved residues, which could be important for catalysis or substrate binding (Figure 1.12). The sequence alignment reveals that all enzymes possess a K69 except for the Bordetella pertussis hydroxylase AIcA, which exhibits A69. AIcA is involved in the synthesis of the siderophore alcalignin and is thought to be responsible for the hydroxylation of L-l,4-diaminobutane (also known as putrescine), which lacks a 1-carboxyl substituent (Brickman et al, 2007).

Therefore a PvdA K69A variant previously created in the lab and a K69R mutant constructed during this project were selected for characterization to determine the importance of the positively charged sidechain in this position. In the Bayer-Villiger monooxygenase, 19 residues upstream of the NADPH binding motif (GXGXXG/A) is a histidine residue that appears to be important for catalysis. In cyclohexanone monooxygenase, this His residue when replaced with GIn causes a 10-fold reduction in activity (Cheesman et al., 2003), while in 4-hydroxyacetophenone monooxygenase, the His to Ala replacement makes the enzyme inactive (Fraaije et al, 2002). In PvdA and homologues, there is also a conserved histidine residue upstream of a GXGXXG/A motif. Therefore the P. aeruginosa PAOl PvdA, H 189A variant previously created in the lab was further characterized.

31 (D S=! X) o O ? < > (2 a O cu fe < S-H < e O Oh ti •?—f (U Ph ? 53 ce d C #c C-C! O ?, '(? Q < > o eu •S 3 < So 55 2 J s o Ss. (U •S M-H e Só Ss. O s cu O Ss. a. s-, O CS ? &î ? < S-I (? Ss. -t-H CU S »5» CC > Vi O ¿?- C <& ? X) Oh d ? 3 (U S ce (U o> -? S-I W) (U S > ? ? ? (U X »5 ?? Ö O O ft. U cd cd O 3 1Qh S3 Ph 'toû O Ö H ö a ? (U CN < C (U W) toû X) .g t3 (U ? Oh mm t3 Si, ? cd X! Û0 XS Q o co td CN (U X! T3 Sh d cd CC (U 3 (N I •? ? S ?a (U toû .2 S-H C ? W (U e CN X) s (U PQ H-1 ? + E C Q 00 O O ? < ? fe e ^> o C-C! cd P, •^? CC B -4—t JO a ë Wi Ì Ch t O • mi O ¦^-^ JU H • ¦¦? (U ? 9 ? XJ < t3 (U 3 (U •.-? CC 00 B CN a (U >ï s Ss. S-H ? CC X) 3 (U (D +H (U -a X) O O d (U O (U C Sh ? o e 3 3 '-ß CT 1 Ö (U (U (D << O S-H ì•?—I 00 «5 ? Ph ? m0ìMOU)WW«hH^ IHNNHilOimOllflO ifUf^CM

HBVHH m ffj™"n^^l víinvvn^Tp-oip HkEUCCCCUUMCCI IdIlUSUbIlMkIHMi UBIslBllü

Ot tn sc M Z (5 Ä ? O 13 in OT U Kt ? ? in ?? u u ? H H u ¦ OTHOTHOTUtLXOtCC OT (J U >* UKtKtKtEUUUM U U ZB > KCZHt-ICCk-IHi-IZ ft Hl MHH uzzuuajxaiu BC CC OT OT P* M CC ccccccccccXiaoascc OT Ui Kt Kt Kt Bi OT U MP-HHHU33UE OT H OT CC 33 KC KC m; HHHHB H K H *t Xt W H TETTT «t M M KE 33 ft CX T CC MMM)4Wí6 (JCGM W bu ¦ ¦ U Kt CX CC 1 W ] I I I «SWS I CC ce U Bt Bi H 1 Kt e ? P* K >=t ] CC CC Ut U BS Kt 1 CC rtUUCCfïUUUP OT CG 3E M Kt X M M S» CC H Ot OT U E ft HHZH U U ft Kt ft U Ot U H Kt CC Kt Kt kc ?? EE E CC Kt U OT OT OT OT ce p. ot HJ p" h tn u oc HHMP* P* U 33 ? H ? M P* H Ol ft CC CC CC CC M BC ? ? ? ? m u u a a ? u Ku Kt P* P* Kt ? e µ ?» :X U KC OT OT Bi 3 SC ft CX M p< a. a. ? ? OTHOTW CG BG M kC Kt H Z H ? :X KC CG CC CC BC CX CX BC ¡E¡ ?» MMU U UHH H ?» I Kt OT Ut W W H ft U U K Si KïS sa Kt X P* K P* M pi CX U (t ut tn H a Bl Bl Bl H P- p* HUHM Kt Kt H P* Kt « K CC 3B H H CC CC ? CC CC H U CC CX C* Bi Bt CC Kt ft os et oc in sssas K ? ? a IOTOTOTU CU Z Z U H Bt Qt ri¡ ft Id 4 M tn H tJ µ| |J Di H CC UHUU? Kt CU Bt ft CC BC H KKE- OT E CC I OT ? kî ? >* I H M H U CC CC H UM E s ¡sa-j-gip Bi H XiKSSEBHKtHE H !" Z 3 Z ß ? ??- ; § f|'-?| IP K Bi CC U a ? Bi BC ft Kt OTIH ? g > » ^ [? H OT ft I U ¡il MMMM I H U U U M CC CC Uu Im Iu CC U B-* m ex m ce m a: MUP-M CC U H U M CX M X 33 Kt U OT CC CC CC E M H Ut U Z CX U U U U Kt U U ...... CX rw p-i ? PH H E M M U NU H UJtpmtL ? u ? u ex ? t_l H M m; üüHgpuilímut HP-CXCXHBSUaGMftU OT OT OT Kt O u zuocuuu ( UUUKUCG33CGUIZU U U U CC CC Z Z Z CG Ui CG ttïKKUHZHS OTOTOTKtUi-IHMP-BGU OT Kt Kt U CC M M M CG P* M ??"??*??????>?( ¦g'g'SWWWIS'gg U U 1x1 U "" IfiBÎMUKfiJKâBSIK E !BrSnWnCx ccaeuortKHKat C« U CUtO lu lu lu K UEBC U U U Kt BC Kt st Kt st U OT lululululup>-p>-p»liui ecaeeecHccotccUHW ** Kt Kt Kt H m OT OT > U Z >flf>a;rt;uuun;i -KUUUUftuOidil ESTE S-SSSg £S 3 ¦yapS¦»¡¡¦¿"¦fftffejIBl »g UBI ? Kt Kt Kt Kt Cl KC ? (3 U) U) (3 ? (J iïTSr u ? TT SSfTtIS B BSÏS MMUU U H Kt HZUZ . . ? U ft Bt Bt OT OT Bi IUUCCUUUKtUZ I M H CC U U U H I J. J. J- ? ?? Ü U UUUUUKtOTKtCCI '¦J-g-E.f.f.f-ag¿iftce ?" J" G mu ~~- — —·—"—, t-, [_ HjT '

HHI b^ l«X Uu JH CC 06 CX CX M « K: UU OT U UUUl---. . u ? 5; e * a u B u ? ? h U U U Z Z Z CC I ? íj u ? w o« a CC H H CC uucsaa; ' - ? ? u< w »ß ««-«fifi«!. ¦MHnHMHnnn ~.§_£I_§jLg ! KE H ?* 06 ? ZUHUU GG GC CC CC CC M u e» M ce p ex g ce ' ??????-,-,-,-™ Ot tn « h Ot UUbuMluaCCGBCHOT H H H H H m «WWW KKHQXUDiSi^n P- p> P* ¡> p> KtOTUUUUOTUH' ? ? ) ? ? ? ? ? ? ?» ^OTUkCUIMUWMi II) 1 BS MBCftftOiMZBCOTI 1I)IIIIIIOTi œ youcï^M miîi WMHftUUUUMCuU UUiSOTPiOTCXOTMUU HHH«H3Ï3UÏIE ^^«¦¦Ç OT gt OT ¡? ? Ot H ?* M Kt MUMMUU MtlUhJ?[3Bll3U| H P„J£LHJä PÌ u f w ' rww ....

3?1?2???2?2?2? SR

CC CS K U K OT Pi tO ?«?* o H t-1 M M H HHH BC U ID < kj¡ m ¡e « ÜH» Kt ?> H UUUOlU ?» ?» ?» ü !>? JmW m je Bt OTRI ZUZU OT OTT^ K U K A ? ui M 33 M Kt OT OT U st U tí I ?! w 33 at ? ? ce ce ce OT CU E . - - - Kt 33 H K M U Z ?« ¡S OT ?? U ce ?? m Kt U OT OT ? ? m is SC CX ? M OT U µ| µ| a ;> a BC U BQ Kt 66 ft ggSËSSSSSEg S S» tï K 5» UUU m u u ?? Iu ?? UWUUftOtUBlftECU UUU a: w ? Kt Kt E rt e as ex as T^SnBFSn !zwffl? flfluu RJtWWS fa] Ü» UJ WKtKtKEUBiUPtUOTZ Kt OT ?H

OTXU eCCCCCCCOTCuBiPiEMBi U LP OTJ 33KXICSiJKbIiCSIH Bt M 1 Bt U ? „ MEUOTHII I I ) 1 I I I ftOT Kt1 1 e? ex ?* tS ¡Sc rs? M CS OT K CC UtCXCCCCUKXUKtOTZM UU ?? flu sa m ? X hi X Uri at H « H U ZOTZ Ib Id IM IU Hi UUU OT U LP U U U OT U CG tj KE BflttMUUni HBBBS w iJÍ *t TOT The hypotheses in relation to PvdA for this project are as follows:

1: The positive charge side chain of lysine 69 interacts with the negatively charged carboxyl group of L-ornithine

2: The histidine 189 is essential for PvdA catalysis

1.9 Significance of research

With the emergence of antibiotic resistant bacterial species the need for new and more powerful antibiotics is paramount. This requires the discovery of new antibiotic targets such as enzymes involved in virulence factor pathways. As previously highlighted, P. aeruginosa is an opportunistic pathogen of growing concern that produce several virulence factors. One of these, pyoverdine, has a synthesis pathway that is poorly characterized. This presents an opportunity to elucidate possible antibiotic targets by characterizing enzymes shown to be essential to pyoverdine synthesis, such as the L- ornithine N5-hydroxylase PvdA and Ntn-hydrolase PvdQ. Specifically PvdA is an attractive antibiotic target because amine-hydroxylating FMOs found in humans are distinct and do not react on primary amines such as L-ornithine or L-lysine (Ziegler, 2002). An extensive understanding of a pathogens virulence is essential for successful therapeutic development.

34 Chapter 2 Materials and Methods 2.1 Chemicals

L-Ornithine, NADPH, FAD+, L-lysine, 1-4-diaminobutane, hydroxylamine, 1- naphthylamine, and trichloroacetic acid were purchased from Sigma-Aldrich (Oakville, ON) Ni-NTA superflow resin was purchased from Qiagen (Mississauga, ON). All other chemicals were of analytical grade and were purchased from Fisher Scientific (Nepean,

ON) unless otherwise indicated.

2.2 Media and Solutions

Appendix ?? summarizes the components of all media and solutions.

2.3 Bacterial Strains and Plasmids

Bacterial strains used for DNA propagation or protein expression were E. coli DH5a (Invitrogen, Burlington, ON), E. coli Rosetta2 (DE3) (Novagen, EMD, Biosciences Inc., San Diego, CA, USA), E. coli BL21 (DE3) (Stratagene, La Jolla, CA, USA), and P. aeruginosa PAOl. These strains were obtained from laboratory stocks unless otherwise stated. The pvdQ gene was previously cloned into the pT7-7 expression vector at the Ndel and Hindlll restriction sites and transformed into both E. coli Rosetta 2

(DE3) and E. coli JM109 (Stratagene, La Jolla, CA, USA) cells (S. Seah, personal communication). The pvdQ knockout strains were previously created in the Seah lab.

The pvdA gene was previously inserted into the pET28a expression vector (EMD, Biosciences Inc., San Diego, CA, USA) (Li & Seah, 2006). PvdA with lysine 69 replaced with alanine (K69A) and histidine 189 replaced with alanine (H 189A) were constructed

35 previously in the lab (S. Seah, personal communication). The pvdA_K69R was constructed via site directed mutagenesis during this study.

Bacterial cultures were routinely grown at 370C in Luria-Berani (LB) agar or LB broth containing kanamycin (50 µg/mL in agar or 100 µg/mL in broth; pET28a), chloramphenicol (34 µg/mL; Rosetta 2), ampicillin (100 µg/mL; pT7-7), tetracycline (110 µg/mL), or gentamycin (300 µg/mL) where appropriate. Bacterial stock cultures were prepared by mixing 0.5 mL of overnight bacterial culture with 0.5 mL of 50% glycerol in a sterile 1.5 mL screw-cap tube and stored at -80 0C.

2.4 Plasmid DNA Purification for DNA Sequencing and Cloning

Plasmid DNA for DNA sequencing and cloning were extracted from 6mL of overnight culture and purified using the Bio Basic EZ-10 Spin Column Plasmid DNA Minipreps Kit (Bio Basic Inc., Markham, ON) according to instructions provided by the manufacturer.

2.5 Removal of the pvdQ Signal Peptide Sequence and Insertion of leaderless pvdQ into pET28a

The pvdQ gene contained on pT7-7 was amplified by PCR to remove the N- terminal signal peptide sequence using the following sense and antisense primers: 5' GATGCCGGTCCAGGCCCATATGCCGCGGCCGACCG 3' and 5' CGGTCGGCC

GCGGCATATGGGCCTGGACCGGCATC 3'. PCR mixtures consisted of 10X high fidelity buffer containing 2.5 mM MgCl2 (Roche Diagnostics, Laval, QC), 10X Pfx enhancer solution (Invitrogen, Burlington, ON), 0.4mM of deoxynucleoside triphosphate (dNTP), 100 pmol of each mutagenic oligonucleotide, 10 ng of pT7-7 plasmid DNA

36 containing the pvdQ gene, 0.5 U Platinum Pfx DNA polymerase (Invitrogen, Burlington, ON), and deionized water. The following amplification profile was employed: hot start 94 0C (2 minutes), followed by 30 cycles of 940C (30 seconds), 5O0C (30 seconds), 680C (1 minute 20 seconds) and a final extension of 68 0C (10 minutes) with a hold at 4 0C.

PCR product was subjected to DNA sequencing to confirm that the truncated version of pvdQ had been amplified, which was performed at the Guelph Molecular Supercentre, University of Guelph.

The leaderless pvdQ and purified pET28a plasmid were digested with Ndel and Hinein restriction enzymes for 3 hours at 37 0C and then subjected to agarose gel electrophoresis. DNA was gel purified using the QIAEX II Gel Extraction Kit (Qiagen, Inc., Mississauga, ON) according to the manufacturer's instructions. The extracted DNA fragment was ligated in 1.5 ml microfuge tubes using 0.1 U of T4 DNA ligase (Life Technologies, Inc., Gaithersburg, MD, USA), T4 ligation buffer, with a vector to insert ratio of 1:1 in a total volume of 15 µ?. The ligation mixture was incubated at 15 0C overnight. The ligation mixture was desalted prior to electroporation into E. coli DH5oc cells using a Millipore 0.025 micron nitrocellulose filter over cold sterile 10 % (v/v) glycerol for 30 minutes.

2.6 Creation of/>v

Primers to create the K69R substitution were designed in accordance with the QuikChange™ Site-Directed Mutagensis protocol. Primers contained non-overlapping sequences at the 3' end and complementary sequences at the 5' end. Sense and antisense primers are as follows: 5' TTCCTCAGGGACCTGGTATCCCTGCGCAATCCAACCA

37 GTC 3' and 5' CCAGGTCCCTGAGGAAGGAAATCTGCAACTCGCTCTGGCTG 3'

(the underlined nucleotides correspond to the change from the lysine codon AAG to an alanine codon). PCR mixtures consisted of 1OX Pfu buffer (StratageneL La Jolla, CA,

USA), 2 mM of deoxynucleoside triphosphate (dNTP), 100 ng each of sense and antisense mutagenic oligonucleotide, 10 ng of pET28a plasmid containing ihepvdA gene, 10 U Pfu DNA polymerase (Stratagene, La Jolla, CA, USA), and deionized water. The following amplification profile was employed: hot start 95 0C (1 minute) followed by 12 cycles of 95 0C (1 minute), 55 0C (1 minute), 72 0C (1 minute) per kb of plasmid template (7 minutes) with a 10 minute extension at 72 0C and a final hold at 4 0C. Five units of the restriction enzyme Dpnl (Invitrogen, Burlington, ON) were added to the PCR product for overnight digestion at 37 0C. PCR product was subjected to DNA sequencing to confirm that correct pvdA_K69R mutation had been amplified, which was completed at the

Guelph Molecular Supercentre, University of Guelph.

2.7 Transformation by Electroporation

One µ? of plasmid DNA and 25µ1 of electrocompetent cells (DH5a, BL21 (DE3) or Rosetta2 (DE3)) were added into a sterile electroporation cuvette. The electrical settings on the Gene Puiser™ electroporator (Bio-Rad, Hercules, CA, USA) were as follows: voltage - 1.25 kV, capacitance - 25 µ?, and pulse resistance - 200 ohms. Five hundred µ? of SOC media was added directly to the cuvette to resuspend transformed cells and then transferred to a sterile tube for a 1 hour incubation at 37 0C while shaking. The culture was inoculated on a LB agar plate with appropriate antibiotics and grown overnight at 37 0C.

38 2.8 Analysis of Plasmid DNA Transformants by Restriction Digest

Plasmid DNA was purified according to the protocol in section 2.5.1 from overnight culture containing putative /?v¿/A_K69R_pET28a or pvdQjpET2&a and digested with combined with restriction enzymes Hindlll (New England Biolabs) and Ndel (New England Biolabs) overnight at 37°C. After digests were complete, products were subjected to agarose gel electrophoresis.

2.9 Agarose Gel Electrophoresis

Agarose gels (1%W/V) were prepared and DNA sample and electrophoresis loading buffer was added in a ratio of 1:10. The O'GeneRuler 1 kb DNA Ladder (Fermentas, Hanover, MD, USA) consisting of ladders from 250bp to 10 kbp was used as a marker. Electrophoresis was carried out at 100 V for 1 hour and 15 minutes. Agarose gels were stained in ethidium bromide for 30 minutes followed by visualization under

UV light.

2.10 Protein Expression

2.10.1 Mini Expression Studies

Over production of proteins were initially optimized using small volume (3 mL) cultures. Cells containing recombinant pvdQ or pvdA were grown in LB broth containing the appropriate antibiotics overnight at 37 0C. Overnight cultures were used to inoculate 4 sterile test tubes containing 3mL of LB broth. When an ODôoo of 0.6-0.8 was reached, the cells in 2 of the tubes were induced with 1 µ? IPTG. A pair of induced and un-induced culture were incubated at 15 0C and the other pair at 37 0C, overnight.

39 Five hundred µ? of cells grown at 37 0C and 1 rnL of cells grown at 15 0C were pelleted via centrifugation (5000 rpm for 10 minutes) in a 1.5 rnL microfuge tube. The supernatant was discarded and the cell pellets resuspended, via vortex or pipetting, in 50

µ? BPER™ II Bacterial Protein Extraction Reagent (Pierce) for the purpose of cell lysis. After vortexing for 1 minute, resultant soluble and insoluble fractions were separated by centrifugation (13 000 rpm for 5 minutes). The supernatant containing soluble proteins was transferred into a separate 1.5 mL microfuge tube and 10 µ? of 2X SDS-PAGE loading buffer was added. The insoluble fraction was resuspended, via vortex or pipetting, in 25 µ? of sterile water. Next 25 µ? of 2X SDS-PAGE loading buffer was added. AU fractions were boiled for 2 minutes followed by a short centrifugation pulse

(10 000 rpm for 5 seconds). Fifteen µ? of the soluble fraction and 10 µ? of the insoluble fraction was subjected to SDS-PAGE to assess protein expression and solubility.

2.10.2 Large Scale Protein Overexpression

One colony of an E. coli Rosetta (DE3) culture containing /Jvd!A_pET28a (LB agar, 50 µg/mL kanamycin) or E. coli BL21 (DE3) culture containing pvdQ_pET2Sa (LB agar, 50 µg/mL kanamycin) was inoculated into 25 mL of LB broth containing the appropriate antibiotics and the culture was grown overnight in a 37 0C shaking incubator. Fifteen mL of the overnight culture was transferred to 1 L LB broth containing appropriate antibiotics and grown at 37 0C while shaking. When an ODöoo between 0.6 and 0.8 was achieved 1 µ? IPTG was added to induce protein expression and the culture was transferred to 15 0C (PvdA) or kept at 37 0C (PvdQ) to grow with shaking overnight. Bacterial cells were centrifuged at 10 000 rpm for 20 minutes and then frozen at -20 0C.

40 2.11 Purification of His-tagged PvdA by Ni-NTA Chromatography

Buffer containing 50 mM sodium phosphate and 300 mM NaCl (pH 8) was used throughout the purification unless otherwise stated. Cell pellet from a 1 L culture was resuspended in buffer containing 20 mM imidazole and the cells were lysed via French Press at 16 000 psi. The soluble crude extract was separated from the cell debris by centrifugation at 18 000 rpm for 20 minutes. Three mL of Ni-NTA resin (Qiagen) was equilibrated with buffer containing 20 mM imidazole and then incubated with the crude cell extract (approximately 10 mL) for 1 hour at 4 0C. The suspension was then added to a column and washed with 50 mL of buffer containing 20 mM imidazole and 3 mL of buffer containing 50 mM imidazole. The His-tagged PvdA protein was eluted via increasing concentrations of imidazole as follows: 3 mL of buffer containing 100 mM imidazole and 9 mL of buffer containing 200 mM imidazole. Three mL fractions were collected and placed on ice and 10 ul of each fraction was subjected to SDS-PAGE

(section 2.13). Fractions containing PvdA-His were pooled and changed to storage buffer containing 100 mM potassium phosphate, 100 mM sodium citrate, and 1 mM DTT (pH 8) by repeated dilution in the Amicon filtration unit with an YMlO filter. Purified PvdA- His was stored at -80 0C.

2.12 Sodium Dodecyl Sulfate-polyacrylamide Gel Electrophoresis

Protein samples were combined with 2X SDS-PAGE loading buffer, boiled for 2 minutes, and loaded on 12.5 % separating gel combined with a 5 % stacking gel. The

BenchMark™ Protein Ladder (Invitrogen) containing protein from 10 to 220 kDa was used as a molecular mass marker. SDS-PAGE was carried out at 10 mA for 2 hours. Gels

41 were stained in SDS-PAGE staining solution for 30 minutes and destained overnight in SDS-PAGE destaining solution.

2.13 Determination of Protein Concentration

A series of Bovine Serum Albumin (BSA) solutions, from 0.095 mg/mL to 0.95 mg/mL, containing 1 mM DTT, were made by diluting 2 mg/mL BSA stock solution. A 20 µ? aliquot of each BSA dilution or protein sample was mixed with 980 µ? of 1 X

Bradford dye in a plastic cuvette. The absorbance of the mixture was measured in duplicate at 595 nm using a Varían Cary 3 spectrophotometer. Protein sample concentration was determined from the BSA standard curve.

2.14 Detection of Pyoverdine via Spectrophotometric Analysis.

P. aeruginosa PAOl cultures were grown in 6 mL of Casamino Acid (CAS) iron limiting media containing the appropriate antibiotics for 24 and 48 hours at 37 0C. One mL from each culture was centrifuged at 13 500 rpm for 5 minutes. The supernatant was diluted by half and added to a plastic cuvette. Scans from 350 nm to 550 nm were performed using a Cary-??? spectrophotometer to visualize a peak in absorbance at 405 nm, which is characteristic of pyoverdine. Another 1 mL of the P. aeruginosa PAOl cultures previously described in this section was subjected to centrifugation at 13 500 rpm for 5 minutes. Fifty µ? of supernatant and 950 µ? CAS media were combined in a plastic cuvette and absorbance at 405 nm (wavelength characteristic of pyoverdine) was recorded using a Varian Cary-3 spectrophotometer equipped with a thermojacketed cuvette holder. ODöoo readings of each culture after 24 and 48 hours were also recorded. Pyoverdine concentration was calculated with extinction coefficient 2.0 ? IO4 L»mol"

42 '•cm"1 (Meyer & Abdallah, 1978). P. aeruginosa PAOl cultures grown in 6 rnL CAS broth containing the appropriate antibiotics were subjected to serial dilutions. Fifty µ? of each dilution (IO"4, IO"5, IO"6) were plated on CAS agar plates containing the appropriate antibiotics and individual colonies were counted after 24 hours and 48 hours of growth. Plate counts were compared to OD405 and ODóoo readings described in this section.

Culture supernatants were examined under UV light to observe if the characteristic fluorescence emitted by pyoverdine was present.

2.15 Kinetic Assays of PvdA

Kinetic assays were performed at least in duplicate at 25 0C using a Varian Cary-3 spectrophotometer at 340 nm equipped with a thermojacketed cuvette holder. The routine assay of PvdA followed that detailed by Li and Seah, 2006 and contained 300 µ? NADPH, 50 µ? FAD+, 2 niM L-ornithine, 20 µg PvdA wild type or 40 µg of the K69A PvdA variant (enzyme concentrations were chosen to ensure the NADPH oxidation trace was linear), 100 mM sodium phosphate buffer (pH 8) filled to 1 rnL with sterile water and was initiated by the addition of PvdA. L-lysine and L-2,4-diaminobutane were also tested at the concentration of 2 mM. Specific activity of PvdA was calculating by determining the rate of NADPH oxidation at 340 nm. The extinction coefficient was taken to be 6300 M"1 cm"1 (Horecker & Kornberg, 1948). Assays to determine kinetic parameters were completed under similar conditions, however, either the concentration of L-ornithine, NADPH, or FAD+ was varied to determine their respective apparent Km values. Specific activity versus substrate concentration data was fitted to the Michaelis-

43 Menten equation by non-linear regression using the Graph Pad Prism program (GraphPad Software Inc., La Jolla, CA, USA).

2.16 Determination of Stoichiometry of Hydrogen Peroxide or N5-Hydroxyornithine

Production

Reactions conditions were similar to the routine PvdA reaction consisting of 300 µ? NADPH, 50 µ? FAD+, 2 mM L-ornithine, 200 µg PvdA, 100 mM sodium phosphate buffer (pH 8) filled to 4 mL with sterile water. The reaction master mix was then divided. One mL of the reaction mixture was aliquoted into a plastic cuvette and the reaction was initiated by the addition of 200 µg PvdA, completed at 25 0C, and monitored by a Varían Cary-3 spectrophotometer at 340 nm. The amount of NADPH oxidized over 5 minutes was calculated from the change in absorbance using the extinction coefficient 6300 M" '•cm'1. The remaining reaction mixture (3mL) was kept in a 25 0C water bath and the reaction was initiated by 200 µg PvdA and timed for 5 minutes.

2.16.1 Hydrogen Peroxide Detection

The ferrithiocyanate system was utilized to detect the presence of hydrogen peroxide (Hildebrandt et al, 1978). One and a half mL of the reaction mixture housed in the 25 0C water bath was quenched with an equal volume of trichloroacetic acid and then centrifuged at 13 500 rpm for 5 minutes. The supernatant was treated with 1.4 mM ferrous ammonium sulfate and 1.4 M potassium thiocyanate, incubated at 25 0C for 10 minutes, and then the absorbance was read at 480 nm. Hydrogen peroxide concentrations of the PvdA sample were determined through a standard curve created by making a series

44 of dilutions from the 9.7 M hydrogen peroxide stock solutions using sterile water, ranging in concentration from 5 µ? to 100 µ?.

2.16.2 N5-Hydroxyornithine Detection

The presence of N -hydroxyornithine was detected using the iodine oxidation assay (Tomlinson et al, 1971). One mL of the PvdA reaction mixture at 25 0C was stopped by the addition of 67 mM perchloric acid and the mixturecentrifuged for 5 minutes at 13 500 rpm. One mL of the supernatant was incubated with 1 % sulfanilic acid in 25 % glacial acetic acid and 1.3 % iodine in glacial acetic acid for 5 minutes at 25 0C.

Excess iodine was then reduced using 9.5 mM sodium thiosulfate followed by the addition of 0.6 % oc-napthylamine in 30 % glacial acetic acid. After a 30 minute incubation at 25 0C absorbance was read at 520nm. The hydroxyornithine concentrations of the PvdA sample were determined via a standard curve created by making a series of dilutions from the 33 M hydroxylamine stock solution using sterile water, ranging in concentration from 5 µ? to 100 µ?.

2.17 Dissociation Constants for Cofactors NADP+ and FAD+

Dissociation constants (Kj) for NADP+ and FAD+ were determined via fluorescence-titration. Quenching of tryptophan residue fluorescence was examined using a Photon Technology International Fluorescence System equipped with FeIiX 32 software, with excitation at 280 nm and emission at 330 nm (Li & Seah, 2006). Increasing amounts of NADP+ or FAD+ were added (in 5 µ? increments) to a mixture of 6

µg PvdA and 100 mM sodium phosphate buffer (pH 8) filled to a volume of 250 µ? with

45 sterile water. The change in fluorescence versus the cofactor concentration data were fitted to the following equation (Wang and Seah, 2005):

AF = AF^x +[L] ,AF = F0-F Kd + [L]

2.18 Spectral scans of PvdA wild-type and H189A variant enzyme reaction Assays were performed at 25 0C. Ten mg enzyme were pre-incubated with 60

µ? FAD and then combined in a 1:1 ratio with 10 mM L-ornithine, 360 µ? NADPH, 0.1 M potassium phosphate buffer (pH 8.0) to a total volume of 1 mL. Spectrophotometric scans took place over 18 seconds and span 350 nm to 550 nm.

2.19 Homology Modeling

The amino acid sequence of PvdA (NCBI) was entered into the Phyre structural prediction web server (Kelley & Sternberg, 2009) to predict a structure of PvdA. Residues 4-430 were used. Model quality was assessed using the MetaMQAPII web server, which provided a global distance test total score (GDT-TS) and a root mean square deviation (RMSD) values. All images were generated via PyMOL (DeLano,

2002).

46 Chapter 3: Cloning ??pvdQ and expression and analysis of PvdQ

PvdQ is an Ntn-hydrolase thought to be involved in biosynthesis of the siderophore pyoverdine. Examination of the P. aeruginosa PAOl genome demonstrates that ihe, pvdQ gene is located in the pyoverdine (PVD) gene cluster downstream of pvdA

(Visca et al., 2007). In addition, systematic knockout studies of several putative pyoverdine biosynthesis genes, including pvdQ, exhibit a pyoverdine negative phenotype

(Oschsner et al. 2002; Lamont & Martin, 2003). Results of these knockout studies should be interpreted with caution, however, as knockouts were not created via in-frame insertions and intact gene complementation of pyoverdine deficiencies have not been illustrated. Though PvdQ has demonstrated N-acyl homoserine acylase activity, its function in regards to pyoverdine synthesis is not known (Huang et ah, 2003). In this thesis pyoverdine production in pvdQ knockout strain of P. aeruginosa PAOl was analyzed. This knockout was previously constructed by insertion of a Smal digested gentamycin gene cassette in the Ndel and Hinàlll restrictions sites of the pvdQ gene (S. Seah, personal communication).

Overexpression of the pvdQ gene in E. coli and P. aeruginosa hosts were also attempted to facilitate purification and analysis of the encoded enzyme. For this purpose, two expression plasmid constructs containing the full length pvdQ gene previously constructed in the lab were used (S. seah, personal communication). For expression in E. coli, the pvdQ gene amplified by PCR was inserted into the NdeVHindUl sites of the plasmid pT7-7, (Tabor & Richardson, 1985) downstream of the T7 promoter. For expression in P. aeruginosa the gene has been inserted into the broad host range vector pVLT31 (de Lorenzo et al, 1993) downstream of a tac promoter. In this thesis, pvdQ

47 was also inserted into the plasmid pET28a to express a protein with an N-terminal polyhistidine tag.

3.1 Analysis of pyoverdine production in pvdQ knockout strain of P. aeruginosa

PAOl.

The following strains were cultured in CAS iron limiting media and analyzed for production of fluorescent pyoverdine: P. aeruginosa PAOl wild-type, pvdQ knockout strain (pvdQ::Gm), pvdQ knockout strain containing an intact pvdQ gene in a plasmid (pvdQy.Gm +pvdQ _pVLT31), and knockout strain containing the plasmid pVLT31 as a control (pvdQy.Gm + pVLT31).

Since the pyoverdine siderophore is secreted out into the supernatant and it produces a green fluorescence upon excitation by UV light, its production in culture supernatant can be directly observed after UV light illumination. From visual analysis, fluorescent pyoverdine was not produced by the pvdQ knockout strain. However, fluorescence was restored in the knockout strain that contained the pvdQ gene in a plasmid (Figure 3.1). This observation was further confirmed via spectral scans of culture supernatant for which a characteristic pyoverdine absorbance peak at 405 nm was only observed in the wild-type and the knockout strain containing the pvdQ _pVLT3 1 plasmid (Figure 3.2).

Pyoverdine production was quantified through OD40S readings, using the extinction coefficient 2.0 ? IO4 L . mol"1, cm"1 (Meyer & Abdallah, 1978) (Table 3.1). Pyoverdine concentrations were compared to cell culture counts to determine per cell production. The concentration of supernatant pyoverdine and pyoverdine per cell was virtually identical

48 for wild-type and complemented strains. It appears that lack of pyoverdine production is in fact due to the absence of PvdQ, confirming its involvement in pyoverdine biosynthesis.

3.2 Creation of leaderless/?vrfj2 and Subcloning into pET28a

The pvdQ gene was previously inserted into the pT7-7 expression vector at the Ndel and Hinalll restriction sites. pvdQ was amplified by PCR using a 5' primer that is downstream of the region encoding the signal peptide sequence. This ensures that an N- terminal histidine tag fusion of PvdQ will not be removed by signal peptidase. pvdQ lacking the signal peptide sequence was then inserted into pET28a at the Ndel and HindlU sites. The recombinant plasmid was analyzed through restriction digest using Ndel and HindlU restriction enzymes creating two DNA fragments of expected size: 5369bp and 2289bp (Figure 3.3) and by DNA sequence analysis.

49 Figure 3.1: Analysis of fluorescence in the supernatant of P. aeruginosa PAOl in iron limiting media. (A) wild-type, (B) pvdQr.Gm (C) pvdQv.Gm + /?vä?ß_PVLT31, and (D) pvdQ ::Gm + pVLT31. Strains were grown overnight at 37 0C in Casamino Acid (CAS) broth. One mL of each overnight culture was centrifuged at 13 500 rpm for 5 minutes and the supernatant was transferred to a sterile 1.5mL microcentrifuge tube. Centrifuge tubes containing supernatant were placed on a UV transilluminator for fluorescence analysis

50 2.5

m ? I 15 "Wild-type o m " pvdQ::Gm + pvdQ PVLT31 ' pvdQ::Gm 0.5 pvdQ:;GM-PVLT31

200 300 400 500 600 Wavelength (?m)

Figure 3.2: Spectral scans of culture supernatant of P. aeruginosa PAOl. Spectra trace for culture supernatant of wild-type (black), pvdQy.Gm (blue), pvdQ ::Gm + £>vâfg_pVLT31 (red) and pvdQ::Gm + pVLT31 (green) were grown overnight at 37 0C in Casamino Acid (CAS) broth. One mL of each overnight culture was centrifuged at 13 500 rpm for 5 minutes to separate supernatant and cell pellet fractions. Supernatant was diluted by half and added to a plastic cuvette. Scans were performed using a Cary-BIO spectrophotometer. An absorbance peak at 405 nm, characteristic of pyoverdine, can be observed in the wild-type mdpvdQ ::Gm + pvdQjpVLT31 strains.

51 Table 3.1: Pyoverdine production in P. aeruginosa PAOl

Pyoverdine concentration was calculated from absorbance of culture supernatants at 405 nm using extinction coefficient 2.0 ? IO4 L · mol"1· cm"1. Serial dilutions of P. aeruginosa PAOl cultures (10" for pvdQ.'.Gm + pvdQ _pVLT31; 10" for wild-type) were spread on CAS agar and the number of colonies were counted after 48 hours of growth at 37 0C.

P. aeruginosa strain Amount of pyoverdine per 1 Amount of pyoverdine per mL supernatant (µ????) IO6 cells (nmol)

Wild-type 640 ± 40 1.40 ±0.09 pvdQ::Gm+ pvdQjpVLT3l 620 ±40 1.10 ±0.02

52 3.3 Mini-expression studies ofpvdQ

Mini-expression studies were completed with E. coli Rosetta 2 (DE3) cells containing full length pvdQ inserted in pT7-7, E. coli BL21 (DE3) cells containing leaderless pvdQ inserted pET28a in E. coli BL21 (DE3) cells, and P. aeruginosa PAOl pvdQ/.Gm containing the full length pvdQ inserted in pVLT31 to determine which expression system would be suitable for PvdQ overexpression and purification. Unfortunately overproduced soluble PvdQ was not observed in these systems when the bacteria were grown in both LB broth and LB broth supplemented with 1 M Sorbitol and 2.5 mM glycine betaine. The full length PvdQ protein appeared to be in the form of insoluble protein fractions in the E. coli expression system (Figure 3.4) while the PvdQ variant lacking the signal peptide was not significantly overproduced (Figure 3.5). It appeared that full length PvdQ was not significantly overexproduced in P. aeruginosa (Figure 3.6). Due to time constraints, the overproduction of PvdQ was therefore not optimized further.

53 bp 6000 5000 5369 bp 400-0 3500 3000 2500 2289 bp 2000

Figure 3.3: Agarose gel electrophoresis of Ndel/Hindlll restriction digest of the recombinant plasmid pET28a containing pvdQ with the signal peptide sequence removed. Lane 1, a 1 kb DNA ladder with corresponding fragment sizes indicated to the left of the gel (pET28a: 5369 bp, pvdQ: 2289 bp). Lane 2, the digestion products of pvdQ_pET28a.

54 Figure 3.4: Coomassie-Blue stained SDS-polyacrylaniide gel of soluble and insoluble fractions of E. coli Rosetta 2 (DE3) expressing full length pvdQ in E. coli Rosetta 2 (DE3). Lane 1 contains a protein marker with corresponding molecular masses indicated. The gel was loaded with the following samples: insoluble and soluble fraction (lanes 2 and 3) of culture grown at 37 0C with 1 mM IPTG induction, insoluble and soluble fraction (lanes 4 and 5) of culture grown at 15 0C with 1 mM IPTG induction, insoluble and soluble fraction (lanes 6 and 7) of culture grown at 37 0C, insoluble and soluble fraction (lanes 8 and 9) of culture grown at 15 0C. Expected posistions of ß (6OkDa) and a (18kDa) subunits are indicated by red arrows.

55 kDa

* Ik r

¡ip

Jr 's*

Figure 3.5: Coomassie-Blue stained SDS-polyacrylamide gel of soluble and insoluble fractions of E. coli BL21(DE3) expressing leaderless pvdQ. Lane 1 contains a protein marker with corresponding molecular masses indicated. The gel was loaded with the following samples: insoluble and soluble fraction (lanes 2 and 3) of culture grown at 15 0C, insoluble and soluble fraction (lanes 4 and 5) of culture grown at 37 0C, insoluble and soluble fraction (lanes 6 and 7) of culture grown at 150C with 1 mM IPTG induction, insoluble and soluble fraction (lanes 8 and 9) of culture grown at 37°C with ImM IPTG induction. Expected posistions of ß (6OkDa) and a (18kDa) subunits are indicated by red arrows.

56 kDa

90 80 70 60

50

40

30

25

20 «Mm«

Figure 3.6: Coomassie-Blue stained SDS-polyacrylamide gel showing the soluble and insoluble fractions of P. aeruginosa PAOl expressing full length pvdQ. Lane 1 contains a protein marker with corresponding molecular masses indicated. The gel was loaded with the following samples: insoluble and soluble fractions (lanes 2 and 3) of bacteria containing vector pVLT31 culture grown at 370C, insoluble and soluble fraction (lanes 4 and 5) of bacteria containing pvdQ gene grown at 370C, insoluble and soluble fraction (lanes 6 and 7) of bacteria culture containing pVLT31 plasmid vector grown at 370C with ImM IPTG induction, insoluble and soluble fraction (lanes 8 and 9) of bacteria containing pvdQ gene grown at 370C with 1 mM IPTG induction. It appears that there is no obvious overproduction of PvdQ. Expected posistions of ß (6OkDa) and a (18kDa) subunits are indicated by red arrows.

57 3.4 Discussion

PvdQ is an Ntn-hydrolase, which has been shown to have acylase activity towards the bacterial quorum sensing molecule, N-acyl homoserine lactone (Bokhove et al.,

2009). However, there is some controversy whether this is the physiological role of PvdQ. Huang et al. (2003) demonstrated that when E. coli cells expressing the recombinant pvdQ gene were incubated in media containing 3-oxo-C12-HSL there was a resulting decrease in this AHL and an increase of homoserine lactone products determined by liquid-chromatography-mass spectrometry analysis. However, pvdQ deletion mutants in P. aeruginosa grown in media with 3-oxo-C12-HSL as the sole energy and carbon source exhibited growth akin to P. aeruginosa PAOl wild-type. A later study identifies a PvdQ homolog, QuiP (PA1032), involved in 3-oxo-C12-HSL degradation in P. aeruginosa (Huang et al, 2006). QuiP has 21% amino acid similarity with PvdQ and 23% amino acid similarity with AiiD, a well characterized N- acylhomoserine lactone acylase from Ralstonia species. It is noteworthy that AHL- hydrolysis did not occur in the P. aeruginosa quiP mutant although the pvdQ gene was still intact and has been previously shown to exhibit AHL-acylase activity on 3-oxo-C12- HSL. Perhaps this was due to the fact that cultures were grown in MES media, which is not iron limiting, and pvdQ is not expressed. Nevertheless, these studies suggest that N- acylhomoserine lactone hydrolysis by PvdQ may be a secondary reaction and the physiological substrate of this enzyme is not N-acylhomoserine lactones. Indeed, previous studies with pvdQ knockout strains suggest pvdQ may be involved in pyoverdine siderophore biosynthesis, although complementation of the pyoverdine

58 negative phenotype by an intact gene in these knockouts have not been performed (Oschsner et al. 2002, Lamont & Martin, 2003).

To confirm its role in pyoverdine biosynthesis, a pvdQ knockout strain of P. aeruginosa PAOl was analyzed in this study. Visual detection via UV illumination and spectral scans of culture supernatant reveal pyoverdine fluorescence and characteristic absorptive features at 405nm in both the wild-type and pvdQ knockout strains that contain a plasmid copy of the intact pvdQ gene. Conversely, no green fluorescent product was produced by the pvdQ negative strain. These results confirm that pvdQ is required for pyoverdine synthesis. Since, pyoverdine is hypothesized to be synthesized as a membrane bound, acyl substituted precursor, it is possible that PvdQ is the acylase that cleave the acyl substituent, thereby releasing the nascent pyoverdine for further processing in the periplasm to produce the mature fluorescent chromophore of pyoverdine. Alternatively, PvdQ could hydrolyze a small amide substituent linked to pyoverdine chromophore, allowing other substituents to be added. In order to test these hypotheses, attempts were made to overexproduce and purify PvdQ.

The full length pvdQ gene when expressed in E. coli Rosetta 2 (DE3) cells resulted in the formation of insoluble protein. Similar results have been reported by

Huang et al. (2003). Conversely, there is no obvious overproduction of PvdQ protein in P. aeruginosa PAOl, using the expression plasmid pVLT31 containing the pvdQ gene.

In an effort to improve the expression of pvdQ, the sequence encoding the pvdQ signal peptide sequence was removed via PCR amplification and the leaderless pvdQ gene was inserted into the pET28a plasmid for expression in E. coli cells. Similar N-terminal His-

Tag construct has been made with the Ntn hydrolase, ?-glutamyltranspeptidase, which

59 was shown to be efficiently autocatalytically processed into a and ß subunits in the cytoplasm of E. coli (Susuki and Kumagai, 2002). The His-tag also facilitated the purification of ?-glutamyltranspeptidase by Ni-NTA chromatography. However, this strategy does not work with PvdQ as there is no obvious overexpression in the recombinant E. coli strain. It therefore appears that the overexpression of pvdQ requires further optimization but due to time constraints this was not pursued further in this thesis.

60 Chapter 4: Purification and Characterization of K69A, K69R, H189A, and Wild-type PvdA.

PvdA is a N5-hydroxylase involved in pyoverdine biosynthesis. Specifically PvdA catalyzes the hydroxylation of L-ornithine to N5-hydroxyornithine, which is then converted to N5-formyl-N5-hydroxyornithine by transformylase PvdF before it is added to mature pyoverdine molecule. PvdA is a member of the N-hydroxylating monoxygenases (NMOs), a sub group of flavin-dependant monooxygenases, which catalyze the N- hydroxylation of primary amines in the presence of NADPH (Berkel et al., 2006). Unfortunately limited biochemical data is available for this group of enzymes and no crystal structures have been elucidated. This chapter describes the characterization of several PvdA mutants, based on conserved residues amongst NMOs. K69A and K69R variants of PvdA were created to determine if the positively charged lysine side chain is important for substrate interaction and the H 189A variant was created to determine the contribution of histidine 189 in catalysis. K69A and H189A variants were previously created in the lab but the K69R variant was constructed in this thesis.

4.1 Creation of the PvdA K69R replacement

The pvdA gene was previously inserted into the pET28a expression vector at the Ndel and Hindlll sites (Li & Seah, 2006). Site directed mutagenesis was employed to make a K69R variant of PvdA. The recombinant plasmid was analyzed through restriction digest using Ndel and Hindlll restriction enzymes generating two DNA fragments of expected size: 5369bp (pET28a) and 1278bp (pvdA) (Figure 4.1). DNA sequencing was completed to confirm the correct mutation was introduced.

61 bp 1 2 7126 6108 5090 4072 3054 2036 1636 1278 bp 1018

Figure 4.1: Agarose gel electrophoresis of Ndel/Hindlll restriction digest of the recombinant plasmid pET28a containing pvdA with the lysine 69 codon replaced with an arginine codon. Lane 1, a 1 kb DNA ladder with corresponding fragment sizes indicated to the left of the gel. Lane 2, the digestion products ofpvdAjpET2Sa.

62 4.2 Expression and purification of PvdA wild-type and mutants

PvdA was first overexpressed in E. coli Rosetta 2 (DE3) cells at 37 0C with a 3 hour IPTG induction, in accordance with the previously published protocol (Li & Seah, 2006). It was discovered, however, that variant purified protein yields could be increased by overnight induction at 15 0C as can be seen in Table 4.1. Mini-expression studies were used to verify that the majority of the soluble PvdA protein fractions occurred when cells were induced at 15 0C (Figure 4.2). Since recombinant PvdA contained an N-terminal histidine-tag, protein purification was completed via Ni-NTA resin column and PvdA was eluted at 100 rnM and 200 mM imidazole and pooled (Figure 4.3). The estimated molecular mass is 51 kDa which is consistent with the molecular mass of 51.6 kDa predicted from the PvdA amino acid sequence. Purified protein was stored in 100 mM potassium phosphate buffer containing 100 mM sodium citrate (pH 8.0) and 1 mM DTT at -80 0C without activity loss for at least 12 months.

63 Table 4.1: Yield of purified soluble wild-type, K69A and, H189A PvdA.

Induction conditions Wild-type yield K69A yield H189A yield (per L) (per L) (per L)

370C 21 mg 8mg 9mg 3 hours 150C 32 mg 43mg 31 mg overnight

64 Figure 4.2: Coomassie-Blue stained SDS-polyacrylamide gel showing the mini- expression studies of variant PvdA enzymes, a) K69A, b) K69R, e) H189A. Lane 1 contains a protein marker with corresponding molecular masses indicated. The gel was loaded with the following samples: soluble and insoluble fraction (lanes 2 and 3, respectively) of culture grown at 150C, soluble and insoluble fractions (lanes 4 and 5, respectively) of culture grown at 370C, soluble and insoluble fractions (lanes 6 and 7, respectively) of culture grown at 150C with ImM IPTG induction, soluble and insoluble fraction (lanes 8 and 9, respectively) of culture grown at 370C with ImM IPTG induction. A thick band corresponding to PvdA (51.6 kDa) is observed in the soluble fraction of lane 6 (red asterisck to the left of band).

65 a) 1234567 89

b) 1 23 456789

220 160

C)

kDa 1234567 89

160 120 100 90 80 70 60 50 40

66 kDa 1

220 160 120 100 90 80 70 60 50

40

30

25

20

Figure 4.3: Coomassie-Blue stained SDS-polyacrylamide gel showing purified PvdA wild-type and K69A, K69R, and H189A variant enzymes. Lane 1 contains a protein marker. The gel was loaded with the following samples: purified PvdA wild-type (lane 2), purified K69A variant (lane 3), purified K69R variant (lane 4), and purified H 189A variant (lane 5).

67 4.3 Substrate specificity and kinetic parameters of PvdA wild-type, K69A, and

K69R mutants.

Previously it has been shown that wild-type PvdA catalyzed oxidation of NADPH is activated approximately 5-fold in the presence of L-ornithine and 3.9 fold in the presence of the non-substrate effector, L-lysine (Li and Seah, 2006). Activation of

NADPH oxidation by these compounds in the two K69 mutants were examined and compared to the wild-type enzyme. For both PvdA wild-type and K69R the highest specific activity was observed in the presence of L-ornithine, although the activity of K69R was about 5-fold lower than the wild-type (Table 4.2). In the presence of 4mM of

L-lysine, the NADPH oxidation activity of PvdA increased about 10-fold and 5-fold, for the wild-type PvdA and K69R mutant, respectively. Interestingly, in the K69A mutant, the NADPH oxidation activity is not activated in the presence of 4 mM L-ornithine or L- lysine. Since it is hypothesized that K69 may be involved in interaction with the a- carboxyl group of L-ornithine, NADPH oxidation activity in the presence of L-2,4- diaminobutane, which is similar to L-ornithine except for the lack of a carboxyl group, was examined. There was some inhibition of NADPH oxidation activity for the wild- type and K69R mutant in the presence of 4 mM diaminobutane. However, NADPH oxidation in the K69A mutant is not activated nor inhibited by diaminobutane. Overall it appears that the positive charge residue at position 69 in PvdA is important for NADPH oxidation activation by L-ornithine or L-lysine, but its replacement with alanine is not sufficient to enhance its activity with 2,4-diaminobutane.

68 Table 4.2: NADPH oxidation activity of PvdA wild-type, K69A, and K69R mutant in the presence of various effectors. Assays were performed at 25 0C with 20 µg enzyme (wild-type and K69R) or 4(^g enzyme (K69A), 4mM effectors, 300µ? NADPH, 50 µ? FAD+, 0. 1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL.

Specific activities ? 103 (µ???? min mg )

No effectors L-ornithine L-lysine 2,4-diaminobutane

Wild-type 38 ± 2 830 ± 20 420 ± 10 1.2 + 0.1

K69A 40 ± 3 41 ± 1 37 ± 3 36 ± 2

K69R 27 ±1 170 ±15 100 ±5 4.0 ±0.1

69 Table 4.3: Kinetic parameters for PvdA wild-type and K69R variant using L- ornithine as substrate. Assays were performed in triplicate at 25 0C with 20 µg enzyme, 300 µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL.

PvdA Enzyme Km,app (µ?)r K^^Z X„ IUin4 kcat /Km (s1) (M1· s"1) Wild-type 340 ± 20 600 ± 30 180 ±10

K69R 8400 ±820 110 ±3 1.3 ±0.1

70 Table 4.4: Kinetic parameters for PvdA wild-type and K69R variant using L-lysine as an effector. Assays were performed in triplicate at 25 0C with 20 µg enzyme, 300 µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL.

PvdA EnzymeJ Km.aDD (µ?)vr ' K1 . A_ IUin4 kcat /K? m,apprr vl «,cat,app. a ?? cat m (O (M"' -s"1] Wild-type 67 ±7 150 ±3 220 ±21

K69R 910 ±90 30 ± 1 3.3 ±0.3

71 3 0.6

0.5 1.5 2 2.5 3 3.5 45 Time (min)

Figure 4.4: Example of a progress curve of the PvdA NADPH oxidation activity.

The assay was performed at 25 0C with 20 µg PvdA wildtype, 2 mM L-ornithine, 300 µ? NADPH, 50 µ? FAD+, and 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL. The amount of enzyme is adjusted to ensure that the progress curve remains linear over 5 minutes, which facilitates the accurate measurement of the initial reaction velocity.

72 0.8p

~ 0.4-

12 3 4 L-ornithine (mM)

Figure 4.5: Example plot of initial velocity versus L-ornithine concentration for PvdA wild-type. Assays were performed in triplicate at 25 0C with 20 µg enzyme, 300 µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL. The data were fitted via non-linear regression to the Michaelis-Menten equation using Graph Pad Prism software (GraphPad Softwards Inc., La Jolla, CA).

73 The NADPH oxidation rate in varying concentrations of L-ornithine or L-lysine was determined for the wild-type and K69R mutant and the data were fitted to a

Michealis-Menten equation (Tables 4.3 and 4.4). A typical progress curve is shown in Figure 4.4 and an example plot of initial reaction velocity versus substrate concentration can be seen in Figure 4.5. Kinetic parameters of wild-type enzyme were in agreement with those previously reported (Li and Seah, 2006). The K69R mutant possessed approximately 25-fold and 14-fold higher apparent Km values for L-ornithine and L- lysine, respectively. This mutant enzyme exhibited apparent kcat values that were approximately 5-fold lower than PvdA wild-type for both substrates.

For the K69A mutant, NADPH oxidation activity appeared constant with increasing L-ornithine concentrations until above 6 mM where increased NADPH oxidation activity was observed. Therefore a plot of NADPH oxidation versus L- ornithine concentration cannot be fitted to a Michealis-Menten equation (Figure 4.6).

The data were fitted to the Hill-equation with a Hill coefficient of 1.2, indicating a slight positive cooperative reaction. Similar kinetics were observed for L-lysine with a higher

Hill coefficient of 3. 1 (Figure 4.7).

Chemical rescue of K69A oxidation activity at concentrations of L-ornithine below 6 mM was attempted via the addition of 20 mM or 40 mM guanidine hydrochloride, however, activity remained similar to that observed in the absence of guanidine hydrochloride.

74 a)

0.35

~ 0.3 5 0.25 .§ 0.2 1 0.15 U :1 0.1 <* 0.05

20 -10 60 80 100 Í20 L-ornithine (inM) b)

0.8

0.6

T 0.4 a B > 0.2

Si

319 4.8 -0.2 *>*

-0.4 log [S] Figure 4.6 Kinetic analysis of K69A activity in the presence of L-ornithine. Assays were performed at 25 0C with 40 µg enzyme, 300 µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL. a) Initial reaction velocity versus L-ornithine concentration does not fit typical the Michaelis-Menten equation and appears to be sigmoidal. b) K69A data fitted to the Hill equation.

75 a)

0.3

tu 0.25 B 0.2

.£ 0.15 ? ß

S5 0.1 • · *d % 0.05

0 10 20 30 40 50 60 70 80 90 L-ïysine (????) b)

1.2

1 ,/ 0.8 -

0.6 V 0.4 ^ 0.2 / O -0.2 4 4.6 4.7 4.8 4.9 -0.4 0.6 log [S]

Figure 4.7: Kinetic analysis of K69A activity in the presence of L-lysine. Assays were performed at 25 0C with 40 µg enzyme, 300 µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL. a) Initial reaction velocity versus L- lysine concentration does not fit typical the Michaelis-Menten equation and appears to be sigmoidal. b) K69A data fitted to the Hill equation.

76 Table 4.5: Apparent Kn, values for cofactors NADPH and FAD+ in PvdA wild-type, K69A, and K69R mutants. Assays were performed in triplicate at 25 0C with 20 \ig enzyme (wild-type and K69R) or 40 µg (K69A), 2 mM L-ornithine, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL.

PvdA Enzymes Km¡ app NAdph (µ?) Km, app FAD+ (µ?)

Wild-type 118 ±5.0 13 ± 1

K69A 37 ± 3 7.6 ± 0.7

K69R 280 ±27 47 ± 3 Apparent Km values were also determined for cofactors NADPH and FAD+ (Table 4.5) using saturating concentrations of L-ornithine. Cofactor kinetic parameters of wild- type enzyme are in agreement with those previously recorded in the Seah laboratory (Li and Seah, 2006). K69A possessed apparent K1n values approximately 3-fold (NADPH) and 2-fold (FAD+) lower than wild-type enzyme while K69R exhibited apparent Km values approximately 2-fold (NADPH) and 4-fold (FAD+) higher.

4.4 N -hydroxyornithine and hydrogen peroxide production efficiency for PvdA wildtype, K69A, and K69R variants.

The oxidation of NADPH by PvdA can generate either N5-hydroxyornithine or hydrogen peroxide. The amount of N5-hydroxyornithine produced from the PvdA reaction in the presence of L-ornithine was determined using the iodine oxidation assay, which produces a pink color in the presence of hydroxylamine. Hydrogen peroxide production was quantified via the ferrithio-cyanate system, which produces an orange- brown color when hydrogen peroxide is present. The amounts of hydroxyornithine or hydrogen peroxide produced were correlated with the amount of NADPH oxidized using a spectrophotometer to determine coupling efficiency. Wild-type PvdA produced hydroxyornithine with an efficiency of 92 % ± 3 %, which is in good agreement with the previously reported value of 96 % ± 2 % (Li and Seah, 2006) (Table 4.6). The K69R variant exhibited similar coupling efficiency (90 % ± 2%). In contrast, the K69A variant exhibited a lower coupling efficiency, as only 63 % ± 1 % of NADPH oxidized generates N -hydroxyornithine. K69A coupling efficiency was also examine at L-ornithine

78 concentrations above 6mM, yielding similar results. PvdA wild-type, K69A and K69R variants coupling efficiencies were also tested with L-lysine, 2,4-diaminobutane but all the consumed NADPH were being channeled towards hydrogen peroxide production.

4.5 Dissociation constants for cofactors NADPH and FAD+ in the K69 variants of

PvdA.

The dissociation constants of NADP+ and FAD+ were determined for PvdA wild- type and mutant enzymes through fluorescence titration measured with a fluorimeter due to quenching of the intrinsic tryptophan fluorescence upon cofactor binding (Table 4.7). An example of plot of a change in fluorescence versus cofactor concentration is shown in Figure 4.8. The dissociation constant for FAD+ appears to be unchanged in the K69 variants but NADP+ dissociation constants were increased by about 2-fold compared to the wild-type.

79 Table 4.6: N -hydroxyornithine and hydrogen peroxide production efficiency. Efficiency was determined by comparing N5-hydroxyornithine and hydrogen peroxide production to the amount of NADPH that was oxidized during the PvdA reaction. Assays were performed in triplicate at 25 0C with 200 µg enzyme, 4 mM L-ornithine, 300 µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of 1 mL.

PvdA enzyme Hydroxyornithine Hydrogen peroxide efficiency ( % ) efficiency ( % )

WT 92 ±3 8.0 ±0.1

K69A 63 ± 1 37 ± 5

K69R 90 ± 2 10.0 ± 0.2

80 Table 4.7 Dissociation constants of NADP+ and FAD+ for PvdA wild-type, K69A, K69R, and H189A mutants determined via fluorescence titration. Assays were performed in triplicate at 250C with starting mixture of 0.6 µ g of enzyme and 0.1 M sodium phosphate buffer to a final volume of 250 µ?. Increasing concentrations of FAD+ or NADP+ were added in 5µ1 increments until fluorescence quenching could no longer be observed. The enzyme was excited at 280nm with emission at 330nm.

PvdA Enzyme Kd NADP+ (µ?) Kd FAD+ (µ?)

Wild-type 45 ±4 8.2 ±0.8

K69A 100 ± 10 7.8 ± 0.5

K69R 84 ± 8 7.8 ± 0.7

81 10000-1

FAD+ (mM)

Figure 4.8: Plot of change in fluorescence versus FAD+ concentration for PvdA wild- type. Assays were performed at 250C with starting mixture of 0.6 µg of enzyme and 0.1 M sodium phosphate buffer to a final volume of 250 µ?. Increasing concentrations of FAD+ or NADP+ were added in 5µ1 increments until fluorescence quenching could no longer be observed. The enzyme was excited at 280nm with emission at 330nm. The data were fitted via non-linear regression to the equation listed in section 2.17 (page 48)

82 4.6 Kinetic parameters and cofactor dissociation constants in the PvdA H189A variant.

The NADPH oxidation activity of the H 189A mutant was examined in the presence of various substrates (Table 4.8). H189A exhibited the highest specific activity in the presence of L-lysine, though activity with all substrates was between 3 and 12 fold lower than observed with PvdA wild-type. In addition, the only kinetic data that could be fitted to the Michaelis-Menten equation was that determined in the presence of L-lysine. The apparent Km value for L-lysine was approximately 5-fold higher than that of PvdA wild-type enzyme (Table 4.9). The catalytic efficiency was however lower by approximately 4-fold.

Dissociations constants for NADP+ and FAD+, determined by fluorescence titration, were 250 ± 24 µ? and 21 ± 1 µ?, respectively. These values are greater than the wild-type by about 5-fold and 3-fold, respectively.

4.7 N5-hydroxyornithine and hydrogen peroxide production efficiency for H189A variant.

The amounts of N5-hydroxyornithine and hydrogen peroxide production in relation to the amount of NADPH oxidized for the H 189A variant was determined. It was observed that about 3% and 12% of NADPH utilized is used to form N5- hydroxyornithine and hydrogen peroxide, respectively. The relationship of hydrogen peroxide production and NADPH oxidation was thus not stoichiometric (Table 4.6).

83 Table 4.8: NADPH oxidation activity of PvdA H189A variant. Assays were performed in triplicate at 250C with 20 µg (wild-type) or 8(tyg enzyme (H189A), 4mM substrate, 300µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total

volume of 1 mL.

TS, p ri ______Specific activity ? 10 (µ?t??? min mg ) No effectors L-ornithine L-lysine 2,4-diaminobutane Wild-type 38 ±2 830 ± 20 420 ± 10 1.2±0.1

H189A 100 ±6 700 ± 50 150 ±4 2.0 ±0.1

84 Table 4.9: Kinetic parameters for PvdA H189A mutant with L-lysine as an effector. Assays were performed in triplicate at 250C with 20 µ g (wild-type) or 80 µg (H 189A), 300µ? NADPH, 50 µ? FAD+, 0.1 M sodium phosphate buffer (pH 8.0) in a total volume of ImL.

Km,app{]iM) k XlO k /K XlO

-1 -1 -1 (s ) (M «s ) Wild-type 67 ± 7 150 + 3 220 ±21

H189A 30 ±3 18 ±1 60 ±0.6

85 4.8 Determination of reduced flavin stability in H189A mutant

The fact that production of N5-hydroxyornithine or hydrogen peroxide formation is not stoichiometric in relation to the amount of NADPH oxidized, suggests that reduced flavin or other flavin intermediates in the reaction catalyzed by PvdA is more stable in the H189A variant. Spectrophotometric scans were performed to compare the wild-type and the H189A variant (Figure 4.9 and Figure 4.10). Figure 4.9 illustrates that by 20 seconds, PvdA wild-type had already oxidized the flavin species characterized by a peak at 450 nm. In contrast, in the mutant H 189A a peak at 380 nm increases slowly over several hours indicating that the C(4a)-hydroperoxyflavin intermediate accumulates slowly. The accumulation of the oxidized flavin species (at 450 nm) over time (Figure 4.1 1) was calculated to be 1.9 ? 103 s"1, which is approximately 3000 fold higher than 0.6 s"1 previously reported for PvdA wild-type (Meneely et al, 2009).

86 ? H-*

Oh O Oh

O Oh

Oh Q

00

Q. cd >> tí

S ee < ? +-* Z S o ce 03 -M o O U -t—> ? S" C/2 00 ?3 K (U W

oumqjosqy .wueqjosqy

OO 00

e

1? St' Xt C C 9 O fi o « a» S O

Vl

aoireqjosqy ssuBqjosqy U s ce "1 hour U O "2 hours *3 hours '4 hours

350 400 450 500 550 Wavelength (nm)

Figure 4.10: Spectral scans of the H189A PvdA varaint enzyme reaction. Assays were performed at 25 C. Ten mg enzyme was pre-incubated with 60 µ? FAD and then combined in a 1:1 ratio with 10 mM L-ornithine, 360 µ? NADPH, 0.1 M potassium phosphate buffer (pH 8.0) to a total volume of 1 mL. The peak observed at 380 nm is characteristic of C(4a)-hydroxyflavin intermediate formation and the peak at 450 nm is indicative of oxidized flavin species.

89 0.5 0.45 0.4 0.35 it e 0.3 ß 0.25 o 0.2 < 0.15 O.i 0.05 0 0.5 1.5 2 2.5 3 3.5 4.5 Time (Hours)

Figure 4.11: Plot of absorbance at 450 nm versus time in the H189A variant.. Assays were performed at 250C. Ten mg enzyme was pre-incubated with 60 µ? FAD and then combined in a 1:1 ratio with 1OmM L-ornithine, 360µ? NADPH, 0.1 M potassium phosphate buffer (pH 8.0) to a total volume of 1 mL. The production of oxidized flavin species, characterized by an increase in absorbance at 450nm, occurs gradually over several hours.

90 4.9 Homology Modeling of the PvdA Structure

A model of PvdA from amino acid residues 4-430, was created via the Phyre structural prediction web server (Kelley & Sternberg, 2009). The predicted structure was based on the crystal structure of a fellow Class B flavin-dependent monooxygenase, Phenylacetone monooxgenase (PAMO) from Thermobifida fusca (PDB: 1W4X), which shares 11% sequence identity with PvdA. Ten models were generated (Table 4.10) and the lW4X-based model was chosen and validated using the following parameters: E- value and MetaMQAPII (Model Quality Assessment Programs). The model exhibited an ?-value of 5.8 ? 10" ,the lowest of all models generated. As an ?-value approaches zero the more significant the match is and the more similar the generated model is to the original crystal structure on which it is based. MetaMQAPII illustrated that the model had a global distance test total score (GDT-TS), which is a CASP measure of protein model quality, of 42.112 and a root mean square deviation (RMSD) of 4.498 À deviation from the original PAMO structure. Generally GDT-TS scores of 60 and above and RMSD scores below 2 À are indicative of a high quality protein model (Shi et al., 2009). This indicates that this PvdA model should be interpreted with caution.

The crystal structure of PAMO exhibits a FAD+ binding domain and a NADPH binding domain, each with a nucleotide binding Rossmann fold (Malito et al, 2004). The PvdA model exhibits a similar structural arrangement that can be seen in a superimposition with the original PAMO crystal structure (Figure 4.12) The active site of PAMO is located in a cleft between the NADPH and FAD binding domains (Malito et al., 2004). Domain movements, specifically the rotation of the NADPH domain, are employed to facilitate interaction of substrate with cofactors NADPH and FAD in this

91 cleft (Malito et al, 2004, Mirza et al, 2009). Inspection of the PvdA model reveals that both K69 and H 189 are present on the interface between the putative NADPH and FAD binding domains (Figure 4.13). H189 is part of the putative NADPH binding domain and corresponds exactly to the conserved H173 of PAMO. H173 is important for PAMO catalysis though it is predicted to be involved in domain movement coordination rather than catalysis directly (Malito et al, 2004). K69 is part of the putative FAD binding domain and corresponds to a tyrosine residue that is conserved amongst BVMOs. To date, this tyrosine has not been identified as an important residue for BVMO catalysis. Superimposition of the PvdA model and the PAMO crystal structure reveals several regions that do not overlap well. There are several alpha helices present in the PAMO crystal structure that appear to be absent from the PvdA model. This could be due to the fact that PAMO possesses 542 amino acid residues, which is 99 residues more than PvdA, and that only residues 4-430 of PvdA were modeled. The majority of these helicies unique to PAMO are in fact made up of amino acid residues between 470 and 542.

92 Table 4.10: PvdA Models generated by the Phyre structural prediction web server.

Model PDB Proteins Organisms % amino SCOP accession acid code number sequence identity with PvdA

clx4xA 1W4X Phenylacetone T. Fusca 11% monooxygenase

c2gvcA 2GVC FMO S. pombe 12%

cldxID IDXI Dihydrolipoamide Pisum sativum 12% dehydrogenase

claogB IAOG Trypanothione Trypanosoma 12% reductase cruzi

c2nvkX 2NVK Thioredoxin Drosophila 14% reductase melanogaster

c2eq8A 2EQ8 Lipoamide Thermus 12% dehydrogenase thermophilus

clv59B 1V59 Lipoamide Saccharomyces 10% dehydrogenase cerevisiae

c2cfyC 2CFY Thioredoxin Homo sapiens 12% reductase

c31adA 31AD Lipoamide Azotobacter 14% dehydrogenase vinelandii

c2hqmA 2HQM Glutathione Saccharomyces 12% reductase cerevisiae

93 A B

Figure 4.12: Structural superimposition of Phenylacetone monooxygenase (PAMO) from Thermobifida fusca and a model of PvdA from P. aeruginosa PAOl. (A) A model of PvdA (magenta) based on the structure of PAMO superimposed over the original PAMO crystal structure (cyan, PDB 1W4X). (B) The identified NADPH and FAD binding domains of PAMO are depicted in red and blue respectively. The corresponding domains in the PvdA model are highlighted in orange (FAD+) and green (NADPH). A molecule of FAD crystallized with PAMO is depicted in yellow.

94 Hlo9 /?

??&,&f Kb9 ,>

Figure 4.13: Interface between putative NADPH and FAD+ binding domains in a model of PvdA based on the crystal structure of PAMO (PDB 1W4X). Residues corresponding to the NADPH binding domain and FAD+ binding domain in PAMO are colored green and orange respectively. Residues targeted for mutagenesis in this thesis are highlighted; K69 (red) appears to be part of the FAD+ binding domain and H 189 (blue) is part of the NADPH binding domain. Both residues are close to interface between the two domains. A molecule of FAD that was crystallized with PAMO and included in this model (yellow sticks).

95 4.10 Discussion

PvdA is an N-hydroxylating monooxygenase (NMO) which catalyses the conversion of L-ornithine to N5-hydroxyornithine. N5-Hydroxyornithine is an amino acid precursor of the peptide portion of pyoverdine and is involved in the chelation of iron in this siderophore. Unfortunately little biochemical data is known about NMOs and no crystal structures have been solved. In this thesis structure-function relationship of PvdA was probed via substitution of conserved residues.

Among ornithine and lysine hydroxylases, the residues corresponding to position 69 of PvdA are lysines but are replaced with alanine in a 1 ,4-diaminobutane hydroxylase in Bordetella pertusis. We hypothesize that the net positive charge of the lysine amine side chain interacts with the negatively charged 1-carboxyl substituent of ornithine or lysine substrate. This positive charged residue is not necessary in 1,4-diaminobutane hydroxylase since diaminobutane lacks the carboxyl subtituent. To test the hypothesis, K69A and K69R PvdA variants of PvdA were created. The K69A variant has a 5-fold decrease in NADPH oxidation activity compared to wild-type PvdA. In addition, unlike the wild-type enzyme, the K69A NADPH oxidation rate is not enhanced in the presence of up to 6 mM of effectors (L-lysine and L-ornithine). However, it appears that when the threshold concentration of 6 mM L-ornithine or L-lysine is reached, NADPH oxidation activity increases. In comparison, in the K69R variant, NADPH oxidation by L-ornithne or L-lysine is similar to the wild-type enzyme. The importance of the positive charge is evident due to the fact that the arginine variant was able to restore NADPH oxidation activity and N-hydroxyornithine activity to levels within the same order of magnitude as wild-type PvdA. Overall the results support the hypothesis that a positive charged

96 residue at position 69 is important for interaction with L-ornithine or L-lysine. However, K69A variant is not activated by 1 ,4-diaminobutane and is not able to hydroxylate this compound. It is possible that other structural or residue differences between L-ornithine and 1,4-diaminobutane hydroxylases governs the specificity for 1,4-diaminobutane.

PvdA was modeled based on the structure of phenylacetone monooxygenase (PAMO) from Thermobifida fusca. PAMO is a Baeyer-Villiger monooxygenase (BVMO) which catalyses the conversion of phenylacetone to phenylacetate (Malito et al., 2004). BVMOs and NMOs are both Class B flavin-dependant monooxygenases possessing some sequence similarity as well as equivalent structural features reflected in sequence motifs (Berkel et al., 2006). However, it should be noted that this model has to be interpreted with caution given that the substrates of PvdA and phenylacetone monooxygenase are structurally different and the overall reaction catalyzed by the two enzymes are also different. Examination of the PvdA model shows that K69 is part of the FAD+ binding domain and corresponds to a tyrosine that is conserved amongst BVMOs. Though conserved, this tyrosine has not been identified as an important residue for catalysis. K69 is present on the interface between the FAD+ and NADPH binding domains where substrate binding is predicted to occur. Perhaps domain movements during catalysis orient this lysine residue so that it can interact with L-ornithine, but without a structure of PvdA with bound substrate, this is currently speculative.

BVMOs possess a signature motif of highly conserved residues located between the NADPH and FAD+ binding domains. Specifically a conserved histidine residue has been shown to be essential to catalysis. For example a histidine to glutamine substitution in cyclohexanone monooxygenase (CHMO) caused a 10-fold reduction in enzyme

97 activity and a substitution from histidine to alanine in 4-hydroxyacetophenone monooxygenase resulted in enzyme inactivation (Cheesman et al, 2003, Fraaije et al, 2002). This conserved residue is proposed to be indirectly involved with catalysis due to its significant distance from both the NADPH and FAD+ binding sites (Malito et al, 2004). It is proposed that this conserved histidine residue is involved with coordinating domain movements during catalysis. Specifically it is thought that the conserved histidine is involved with stabilizing a linker segment spanning the NADPH and FAD+ binding domains that is necessary for rotation of the NADPH binding domain and for NADPH binding (Mirza et al, 2009). In the PvdA model histidine 189 superimposes exactly with the conserved histidine 173 of PAMO. PAMO was crystallized with a bound FAD+ molecule revealing that histidine 173 was 16 Á away from FAD+ (Malito et al, 2004).

Results from the H 189A PvdA variant illustrate a 12-fold reduction in NADPH oxidation in the presence of L-ornithine. In addition spectrophotometric scans revealed a slow accumulation of a C (4a)-hydroperoxyflavin intermediate of several hours. In comparison, accumulation of C (4a)-hydroperoxyflavin in PvdA wild-type occurs rapidly in the millisecond range (Meneely et al, 2009). It is possible that the histidine to alanine mutation results in a stable peroxyflavin and subsequent slow transformation to the C (4a)-hydroperoxyflavin. It is also possible that histidine mediates the proton transfer from the terminal amino group of L-ornithine to the peroxyflavin to form the hydroperoxyflavin, and therefore its replacement with a neutral alanine residue resulted in this step being rate limiting.

Overall, the results indicate that both K69 and H 189 are important for PvdA function but further experimentation is required to determine their specific roles.

98 Chapter 5 General Conclusions and Future Work

In this thesis the involvement of PvdQ in pyoverdine was confirmed. The absence of pyoverdine in P. aeruginosa pvdQ knockout strains could be restored when an intact pvdQ gene was introduced in the knockout strain on a plasmid, revealing that the pvdQ is essential for pyoverdine biosynthesis. This observation augments previous pvdQ knockout studies, which failed to include gene complementation experiments. Elucidating the specific role of PvdQ in pyoverdine biosynthesis would require the purification of the protein for in-vitro analysis or the isolation and analysis of pyoverdine intermediates in the knockout strain.

Minimal biochemical and structural data are available for the N5-hydroxylase

PvdA. Therefore this thesis included the investigation of several PvdA residues that are conserved among NMOs in an attempt to identify residues important for catalysis or substrate binding. The K69A variant of PvdA exhibited unusual kinetics in that at least 6 rnM of L-ornithine is required to enhance its NADPH oxidation activity. In addition N - hydroxyornithine production efficiency was reduced by approximately 1.4-fold in comparison to the wild-type PvdA. NADPH oxidation activity and N5-hydroxyornithine production efficiency could be restored to levels within the same order of magnitude as the wild-type in the K69R variant. Although the K69A variant does not utilize 1,4- diaminobutane as substrate as originally predicted, the results nevertheless suggest that a positively charged residue may be important for L-ornithine or L-lysine binding. This could be confirmed by determining the dissociation constants for these compounds in the wild-type and K69A variant, by isothermal calorimetry for example. Also it might be helpful to compare kinetic constants based on N -hydroxyornithine formation rather than

99 NADPH oxidation activity. Also circular dichroism spectroscopy can be applied to ensure that there are no large changes in the structure of the enzyme due to the replacement of lysine 69 in the variants.

Modelling of PvdA reveals that H 189 corresponds to H 173 in PAMO, a strictly conserved histidine among BVMOs that has been shown to be important for catalysis. H 189A variant has a 12-fold decrease in NADPH oxidation activity compared to wild- type PvdA as well as a marked decrease in the rate of formation of the hydroperoxyflavin production. One possible role of the histidine residue is in mediating the proton transfer to the peroxyflavin intermediate to form the hydroperoxyflavin. It may be useful to determine the pH profile of the catalyzed reaction to determine if the pKa of the catalytic acid/base of histidine is lost in the H 189A mutant. Also replacements of H 189 to other residues that can mediate proton transfers, such as aspartate and glutamate, may provide additional evidence of the role of H 189 in catalysis.

Although attempts have been made to crystallize PvdA, they have not been successful (Meneely, 2007). However the interesting variants of PvdA with altered properties that have been created in this thesis could form a good starting point to understand the molecular basis for substrate recognition and catalysis in this enzyme.

100 References

Ackerley, D. F. and Lamont, I. L. (2004). Characterization and Genetic Manipulation of

Peptide Synthetases in Pseudomonas aeruginosa PAOl in Order to Generate Novel Pyoverdines. ChemBiol. 11, 971-80.

Andrews, S.C., Robinson, A.K., and Rodriguez-Quinones, F. (2003). Bacterial iron homeostasis. FEMS Microbiol Rev. 27, 215-37

Ankenbauer, R., Sriyosachati, S. and Cox, CD. [1985). Effects of siderophores on the growth of Pseudomonas aeruginosa in human serum and transferrin. Infect Immun.

49,132-40.

Archibald, F. (1983) Lactobacillus plantarum, an organism not requiring iron. FEMS

Microbiol. Lett. 19, 29-32.

Baeyer, A and Villiger, V. (1899). Effect of Caro's Reagent on Ketones. Ber. Dtsch.

Chem. Ges. 32, 3625-3633.

Berkel, W. J. H, Kamerbeek, N. M., and Fraaije, M. W. (2006) Flavoprotein monooxygenases, a diverse class of oxidative biocatalysts. /. Biotechnol. 124, 670-698.

Bokhove, M., Jimenez, P. N., Quax, W. J., and Dijkstra, B. W. (2009). The quorum- quenching N-acyl homoserine lactone acylase PvdQ is an Ntn-hydrolase with an unusual substrate-binding pocket. Proc Natl Acad Sci USA. 107, 686-691.

Brannigan, J.A., Dodson, G., Duggleby, H.J., Moody, P.C.E., Smith, J.L, Tomchick, D.R., and Murzin, A.G. [1995). A protein catalytic framework with an N-terminal nucleophile is capable of self-activation. Nature. 378, 416-19.

101 Bullen, JJ, Rogers, HJ., and Griffiths, E. 1978. Role of iron in bacterial infection. Curr

Top Microbiol Immun. 80, 1-35.

Butler, A. (2003). Iron acquisition: straight up or on the rocks?. Nat Struc Biol. 10, 240-

41.

Budzikiewicz, H. (1997). Siderophores of fluorescent Pseudomonads. Z. Naturforsch. 52,

713-20

Byers, B. R. and Arceneaux, J. E. L. (1998). Microbial iron transport: iron acquisition by pathogenic microorganisms. Met Ions Biol Syst. 35, 37-66.

Cashman, J. R. and Zhang, J. (2006). Human Flavin-Containing Monooxygenases. Annu.

Rev. Pharmacol. Toxicol. 46, 65-100.

Cheesman , M. J., Byron Kneller, M. and Rettie, A. E. (2003) Critical role of histidine residues in cyclohexanone monooxygenase expression, cofactor binding and catalysis. Chem. Biol. Interact. 146 , 157-164.

Choi, H. S., Kim, J. K., Cho, E. H., Kim, Y. C, Kim, J., and Kim, S. W. (2003) A novel flavin-containing monooxygenase from Methylophaga sp. strain SKl and its indigo synthesis in Escherichia coli. Biochem Biophys Res Commun. 306, 930-936.

Clarke, T. E., Tari, L. W., and Vogel, H. 2001 Structural Biology of Bacterial Iron Uptake Systems. Curr Top Med Chem. 1, 7-30.

Clarke-Pearson, M. and Brady, S. F. (2008). Paerucumarin, a New Metabolite Produced by the pvc Gene Cluster from Pseudomonas aeruginosa. J. Bacteriol. 190, 6927-6930.

102 Cornells, P. and Matthijs, S. (2002). Diversity of siderophore mediated iron uptake systems in fluorescent Pseudomonads: not only pyoverdines. Environ Microbiol. 4, 787-

98.

Cornelissen, C. (2003). Transferrin-iron uptake by Gram-negative bacteria. Front Biosci.

8, 836-47.

Cowart, R.E. and Foster, B.G. (1985) Differential effects of iron on the growth of Listeria monocytogenes: minimum requirements and mechanism of acquisition. /. Inf. Dis. 151,

721-730. de Keyzer, J., van der Does, C. and Driessen, A. J. M. (2003). The bacterial translocase: a dynamic protein channel complex. Cell Molec Life Sci. 60, 2034-52. de Lorenzo, V., Eltis L., Kessler B., and Timmis K.N. (1993). Analysis of Pseudomonas gene products using lacflPtrp-lac plasmids and transposons that confer conditional phenotypes. Gene 15,17-24.

Duitman, E.H., Hamoen, L.W., Rembold, M., Venema, G., Seitz, H., Saenger, W., Bernhard, F., Reinhardt, R., Schmidt, M., Ullrich, C, Stein, T., Leenders, F. and Vater, J. (1999). The mycosubtilin synthetase of Bacillus subtilis ATCC6633: a multifunctional hybrid between a peptide synthetase, an amino transferase, and a fatty acid synthase.

Proc Natl Acad Sci USA. 96, 13294-99.

Entsch, B. and van Berkel, W. J. H. (1995) Structure and mechanism of para- hydroxybenzoate hydroxylase. FASEB J. 9, 476-483.

103 Faraldo-Gomez, J.D and Sansoni, M.S. (2003). Acquisition of Siderophores in Gram- Negative Bacteria. Nat Rev Mol Cell Bio. 4, 105-16

Firlit, P. (2006). The Role of PvdMNO in the Biosynthesis of Pyoverdine, A Siderophore of Pseudomonas Aeruginosa PAOl. Masters Thesis, University of Guelph

Fraaije, M. W., Kamerbeek, N. M., van Berkel, W. J. H., Janssen, D. B. (2002) Identification of a Baeyer-Villiger monooxygenase sequence motif. FEBS Lett. 518, 43-

47.

Gillam, A.H., Lewis, A.G. and Andersen, R. J. (1971). Quantitative determination of hydroxamic acids. Anal. Chem. 53, 841-44.

Hildebrandt, A. G., Roots, L., Tjoe, M., and Heinemeyer, G. (1978). Methods Enzymol.

52, 342-350.

Hoang ,T.T., Karkhoff-Schweizer, R.R., Kutchma, AJ. and Schweizer, H.P. (1998). A broad-host-range FIp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 212, 77-86.

Hoang,T.T., Karkhoff-Schweizer, R.R., Kutchma, AJ. and Schweizer, H.P. (1998). A broad-host-range FIp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 212, 77-86.

104 Hohlneicher, U., Schafer, M., Fuchs, R. and Budzikiewicz, H. (2001). Ferribactins as the biosynthetic precursors of the Pseudomonas siderophores pyoverdines. Z. Naturforsch.

56,308-31.

Horecker, B. L. and Kornberg, A. (1948). The Extinction Coeffcients of the Reduced

Band of Pyridine Nucleotides. J. Biol. Chem. 175, 385-390

Huang, JJ, Han, J-L, Zhang, L-H., and Leadbetter, J.R. (2003). Utilization of Acyl-

Homoserine Lactone Quorum Signals for Growth by a Soil Pseudomonas and Pseudomonas aeruginosa PAOl. Appi Environ Microbiol. 69, 5941-49.

Huang, JJ. , Petersen, A., Whiteley, M., and Leadbetter, J.R. (2006). Identification of QuiP, the Product of Gene PA 1032, as the Second Acyl-Homoserine Lactone Acylase of

Pseudomonas aeruginosa PAOl. Appi Environ Microbiol. 72, 1 190-97.

James, H.E, Beare, P.A., Martin, L.W., and Lamont, LL. (2005). Mutational analysis of a bifunctional ferrisiderophore receptor and signal-transducing protein from Pseudomonas aeruginosa. J. Bacteriol. 187, 4514-20.

Krithika, R., Marathe, U., Saxena, P., Ansari, M.Z., Mohanty, D., and Gokhale, R.S.

(2006). A genetic locus required for iron acquisition in Mycobacterium tuberculosis.

Proc Natl Acad Sci USA. 103, 2069-74.

Kumar, S., Suresh, CG., Brannigan, J.A., Dodson, G.G., and Gaikwad, S.M. (2007). Bile salt hydrolase, the member of Ntn-hydrolase family: Differential modes of structural and functional transitions during denaturation. IUBMB Life. 59, 1 18-25.

105 Lamont, LL and Martin, L.W. (2003). Identification and characterization of novel pyoverdine synthesis genes in Pseudomonas aeruginosa. Microbiol. 149, 833-42.

Lehoux, D. E., Sanschagrin, F., and Levesque, R. C. (2000). Genomics of the 35-kb pvd locus and analysis of novel pvdIJK genes implicated in pyoverdine biosynthesis in Pseudomonas aeruginosa. Microbiol. Lett. 190, 141-46.

Li, G. and Seah, S.Y.K. (2006). Heterologous Expression, Purification, and Characterization of an L-Ornithine N5-Hydroxylase Involved in Pyoverdine Siderophore Biosynthesis in Pseudomonas aeruginosa. J. Bacteriol. 188, 7205-10.

Lin,Y-H., Xu, J-L., Hu, J., Wang, L-H., Ong, S.L., Leadbetter, J.R., and Zhang, L-H. (2003). Acyl-homoserine lactone acylase from Ralstonia strain XJ12B represents a novel and potent class of quorum-quenching enzymes. MoI Microbiol. 47, 849-60.

Luo, M., Fadeev, E.A., and Grooves, J.T. (2005). Mycobactin-mediated iron acquisition within Macrophages. Nat Chem Biol. 1, 149-153.

Lyczak, J. B., C. L. Cannon, and G. B. Pier. (2000). Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microb Infect. 2, 1051-60.

Macheroux, P., Plattner, H. J., Romaguera, ?., Diekmann, H. (1993) FAD and substrate analogs as probes for lysine N6-hydroxylase from Escherichia coli EN 222. Eur. J.

Biochem. 213, 995-1002.

Malito, E., Andrea, A., Fraaije, M. W., and Mattevi, A. (2004) Crystal structure of a Baeyer-Villiger monooxygenase. Proc Natl Acad Sci USA. 101, 13157-13162.

106 Martinez, J.S., Zhang, G.P., Holt, P.D., Jung, H.-T., Carrano, C.J., Haygood, M.G., and

Butler, A. (2000). Self-assembling Amphiphilic Siderophores from Marine Bacteria.

Science. 287, 1245-47.

Martinez, J.S., Carter-Franklin, J.N., Mann, E.L., Martin, J.D., Haygood, M.G., and

Bulter, A. (2003). Structure and membrane affinity of a suite of amphiphilic siderophores produced by a marine bacterium. Proc Natl Acad Sci USA. 100, 3754-3759.

Marx, J.J.M. (2002). Iron and infection: competition between host and microbes for a precious element. Best Prac Res Clin Haematol. 15, 41 1-26.

Massey, V. (1994). Activation of molecular oxygen by flavins and flavoproteins. J. Biol

Chem. 269, 22459-22462.

Massey, V. (2000). The chemical and biological versatility of riboflavin. Biochem Soc

Trans. 28, 283-296.

Meneely, K. M. (2007). The Biochemistry of Siderophore Biosynthesis. Doctor of

Philosophy Thesis, University of Kansas.

Meneely, K. M., Barr, E. W., Bollinger, J. M., and Lamb, A. L. (2009). Kinetic mechanism of ornithine hydroxylase (PvdA) from Pseudomonas aeruginosa: substrate triggering of O2 addition but not Flavin reduction. Biochem. 48, 4371^-376.

Meyer, J. M., Neeley, A., Stintzi, Georges, C, and Holder, I. A. (1996). Pyoverdin Is Essential for Virulence of Pseudomonas aeruginosa. Infect Immun. 64, 518-23.

107 Meyer, J.M., Stintzi, ?., De Vos, D., Cornells, P., Tappe, R., Taraz, K. and

Budzikiewicz, H. (1997). Use of siderophores to type Pseudomonads: the three

Pseudomonas aeruginosa pyoverdine systems. Microbiol. 143, 35-43.

Mossialos, D., Ochsner, U., Baysse, C, Chablain, P., Pirnay, J-P., Koedam, N.,

Budzikiewicz, H., Fernández, D.U., Schäfer, Ravel, J., and Cornells, P. (2002).

Identification of new, conserved, non-ribosomal peptide synthetases from fluorescent pseudomonads involved in the biosynthesis of the siderophore pyoverdine. Molecular

Microbiol. 45, 1673-85.

Oinonen, C. and Rouvinen, J. (2000). Structural comparison of Ntn-hydrolases. Protein

Sci. 9, 2329-37.

Ochsner, U.A., Wilderman, P.J. Vasil, A.I., and Vasil, M.L. (2002). GeneChip® expression analysis of the iron starvation response in Pseudomonas aeruginosa: identification of novel pyoverdine biosynthesis genes. MoI Microbiol. 45, 1277-1287.

Palfey, B. A., and Massey, V. (1998) Flavin-Dependent Enzymes. Comprehensive

Biological Catalysis. 83-154, Academic Press, San Diego, CA.

Park, S-Y., Kang, H-O., Jang, H-S., Lee, J-K., Koo, B-T., and Yum, D-Y. (2005).

Identification of Extracellular ./V-Acylhomoserine Lactone Acylase from a Streptomyces sp. and Its Application to Quorum Quenching. Appi Environ Microbiol. 71, 2632-41.

Patriquin, G.M., Banin, E., Gilmor, C, Tuchman, R., Greenberg, P., and Poole, K.

(2007). Influence of quorum-sensing and iron twitching motility and biofilm formation in Pseudomonas aeruginosa. J. Bacteriol. 190, 662-671.

108 Pearson, J.P., Pesci, E.C., and Iglewski, B.H. (1997). Roles oí Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. J. Bacteriol. 179, 5756-67.

Philson, S.B. and Llinas, M. (1982). Siderochromes from Pseudomonasfluorescens. II. Structural homology as revealed by NMR spectroscopy. J Biol Chem. 257, 8086-90.

Pohlmann, V. and Marahiel, M. (2008). d-Amino group hydroxylation of L-ornithine during coelichelin biosynthesis. Org Biomol Chem. 6, 1843-1848.

Poole, K. and McKay, G.A. (2003). Iron Acquisition and its Control in Pseudomonas Aeruginosa: Many Roads Lead to Rome. Front Biosci. 8, 661-686.

Posey, J.E. and Gherardini, F.C. (2000) Lack of a role for iron in the Lyme disease pathogen. Science 288, 1651-1653.

Ravel, J. and Cornells, P. (2003). Genomics of pyoverdine-mediated iron uptake in pseudomonads. Trends Microbiol. 11, 195-200.

Roberts, S.M. and Wan, P.W.H. (1998) Enzyme-catalysed B aeyer-Villiger oxidations. J. MoI Catal B Enzym. 4, 1 1 1-136.

Schlenk, D. (1998). Occurrence of flavin-containing monooxygenases in non-mammalian eukaryotic organisms. Comp Biochem Physiol C. 121, 185-195

Shi, S. Y., Pei, J., Sadreyev, R. L, Kinch, L. N., Majumdar, J. T., Cheng, H., Kim, B. H., and Grishin, N. V. (2009). Analysis of CASP8 targets, predictions and assessment methods. Database. 2009, 1-18.

109 Sio, CF., Otten, L.G., Cool, R.H., Diggle, S.P., Braun, P.G., Bos, R., Daykin, M.,

Cámara, M., Williams, P. and Quax, WJ. (2006). Quorum Quenching by an N-Acyl-

Homoserine Lactone Acylase from Pseudomonas aeruginosa PAOl. Infect Immun. 74,

1673-1682.

Smith, E.E., Sims, E.H., Spencer, D.H., Kaul, R., and Olson, M.V. (2005). Evidence for diversifying selection at the pyoverdine locus of Pseudomonas aeruginosa. J. Bacteriol.

187,2138-47.

Spencer, D.H., Kas, A., Smith, E.E., Raymond, C.K., Sims, E.H., Hastings,M., Burns, J.L, Kaul, Rajinder, K., and Olson, M. V. (2003). Whole-genome sequence variation among multiple isolates of Pseudomonas aeruginosa. J. Bacteriol. 185, 1316-1325.

Stintzi, A., Cornells, P., Hohnadel, D., Meyer, J.-M., Dean, C, Poole, K., Kourambas, S. and Krishnapillai, V. (1996). Novel pyoverdine biosynthesis gene(s) of Pseudomonas aeruginosa?AO. Microbiol. 142, 1181-1190.

Stintzi, A., Johnson, Z., Stonehouse, M., Ochsner, U., Meyer, J.-M., Vasil, M. L. and Poole, K. (1999). The pvc gene cluster of Pseudomonas aeruginosa: role in synthesis of the pyoverdine chromophore and regulation by PtxR and PvdS. J. Bacteriol. 181,4118-

4124.

Suresh, CG., Pundle, A.V., SivaRaman, H., Rao, K.N., Brannigan, J.A., McVey, CE.,

Verma, CS., Dauter, Z., Dodson, E.J., and Dodson, G.G. (1999). Penicillin V Acylase crystal structure reveals new Ntn-hydrolase family members. Nat Struc Biol. 6, 414-416.

110 Suzuki, H. and Kumagai, H. (2002). Autocatalytic Processing of ?

Glutamyltranspeptidase. J Biol Chem. 277, 43536-43543.

Tabor, S. and Richarson, C. C. (1985). A bacteriophage T 7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Natl. Acad. Sci. USA.

82, 1074-1078.

Tang, H.B., DiMango, E., Bryan, R., Gambello, M., Iglewski, B.H., Goldberg, J.B., and Prince, A. 1996. Contribution of specific Pseudomonas aeruginosa virulence factors to pathogenesis of pneumonia in a neonatal mouse model of infection. Infect Immun. 64, 37-

43.

Tiariath, ?., Socha, D., Valvano, M. ?., and Viswanatha, T. (1993). Construction and

Biochemical Characterization of Recombinant Cytoplasmic Forms of the IucD Protein (Lysine:N6-Hydroxylase) Encoded by the pColV-K30 Aerobactin Gene Cluster. /.

Bacteriol. 175, 589-596.

Tomlinson, G., Cruickshank, W. H., and Viswanatha, T. (1971). Sensitivity of Substituted Hydroxylamines to Determinationby Iodine Oxidation. Anal Biochem. 44,

670-679.

Vandenende, C. S., Vlasschaert, M., and Seah, S. Y. K. (2004). Functional

Characterization of an Aminotransferase Required foe Pyoverdine Siderophore Biosynthesis in Pseudomonas aeruginosa PAOl. J. Bacteriol. 186, 5596-5602.

Visca, P., Imperi, F., and Lamont, LL. (2006). Pyoverdine siderophores: from biogenesis to biosignificance. Trends Microbiol. 15, 22-30.

Ill Voelkert, E., and D. R. Grant. (1970). Determination of homoserine as the lactone. Anal

Biochem. 34, 131-7.

Walsh, C. (1979). Enzymatic Reaction Mechanisms. San Francisco; Freeman.Walsh, C-

T. and Chen, Y-CJ. (1988) Enzymatic Baeyer-Villiger oxidations by flavin-dependent monooxygenases. Angew Chem Int Ed Engl. 27, 333-343

Wandersman, C. and Delepelaire, P. (2004). Bacterial Iron Sources: From Siderophores to Hemophores. Anna Rev Microbiol. 58, 61 1-47.

Wang, W. and Seah, S. Y. K. (2005). Purification and Biochemical Characterization of a

Pyruvate-Specific Class II Aldolase, Hpal. Biochem. 44, 9447-9455.

Williams, P. and Griffiths, E.X1992). Bacterial transferring receptors - structure, function and contribution to virulence. Med Microbiol Immunol. 181, 301-22.

Winkelmann G. (1991) Handbook of Microbial Iron Chelates. Boca Ranton, FL; CRC

Press.

Winkelmann G, and Carrano CJ. (1997). Transition Metals in Microbial Metabolism.

Harwood Acad. Pubi; The Netherlands.

Woolridge, K. G. and Williams, P. H. (1993). Iron uptake mechanisms of pathogenic bacteria. FEMS Microbiol Rev. 12, 325-348.

112 Appendix I - Expression of a D70N PvdA Variant

The expression and purification of a PvdA mutant, D70N, which was previously created in the Seah lab, was attempted. Soluble protein yield was approximately 8C^g per L. Expressions of D70N in both LB and LB supplemented with IM Sorbitol and 2.5mM glycine betaine confirmed that the majority of protein was in the form of insoluble inclusion bodies (Figure I-1). Therefore this mutant was not characterized further.

113 2 8 kDa 220 160 120 100 m ¦>«**%» 90 80 70 60

/S 50 SSS

40 &***&&.

Tjj^^W^^^ ?, 30 ¿gPMtj^ S^* JiMfW.

25 #*» ^w *WNè

tämmEE SB m

Figure I-I: Coomassie-Blue stained SDS-poIyacrylamide gel showing the BPERII mini-expression of PvdA D70N variant. Lane 1 contains a protein marker with the molecular masses indicated. The gel was loaded with the following samples: insoluble and soluble fraction (lanes 2 and 3, respectively) of culture grown at 15°C, insoluble and soluble fraction (lanes 4 and 5, respectively) of culture grown at 370C, insoluble and soluble fraction (lanes 6 and 7, respectively) of culture grown at 150C with ImM IPTG induction, insoluble and soluble fraction (lanes 8 and 9, respectively) of culture grown at 370C with ImM IPTG induction. A thick band corresponding to PvdA (51.6 kDa) is observed in the insoluble fraction of lane 8.

114 Appendix II - Amino Acid Sequence of PvdQ

11 20. 30. AO. 51 61 MGMRTVLTGL agmllgsmmp vqadmprptg laadirwtay GVPHIRAKDE rglgygigya 7.0 81 91 101 111 12 C) YARDNACLLA EEIVTARGER aryfgsegks saeldnlpsd ifyawlnqpe alqafwqaqt 131 140. 150. 16 C) 170. 181 PAVRQLLEGY aagfnrflre adgkttsclg qpwlraiatd dllrltrrll VEGGVGQFAD 191 20.0 210. 221 231 241 ALVAAAPPGA ekvalsgeqa fqvaeqrrqr frlergsnai avgsersadg KGMLLANPHF 25.0 261 271 281 291 301 PWNGAMRFYQ mhltipgrld VMGASLPGLP wnigfsrhl awthtvdtss hftlyrlald 310 321 33.0 341 351 361 pkdprrylvd grslpleeks vaievrgadg klsrvehkvy QSIYGPLWW pgkldwnrse 3 7.0 3 81 3 91 4 00. 410 421 AYALRDANLE NTRVLQQWYS INQASDVADL RRRVEALQGI PWVNTLAADE QGNALYMNQS 431 441 45.0 461 47j0 481 WPYLKPELI PACAIPQLVA EGLPALQGQD SRCAWSRDPA AAQAGITPAA QLPVLLRRDF 491 501 511 521 531 541 VQNSNDSAWL TNPASPLQGF SPLVSQEKPI GPRARYALSR LQGKQPLEAK TLEEMVTANH 55^ 56£ 571 58.0 5 90. 601 VFSADQVLPD LLRLCRDNQG EKSLARACAA LAQWDRGANL DSGSGFVYFQ RFMQRFAELD 611 621 631 641 651 661 GAWKEPFDAQ RPLDTPQGIA LDRPQVATQV RQALADAAAE VEKSGIPDGA RWGDLQVSTR 671 681 691 701 711 721 GQERIAIPGG DGHFGVYNAI QSVRKGDHLE WGGTSYIQL VTFPEEGPKA RGLLAFSQSS

731 741 751 761 DPRSPHYRDQ TELFSRQQWQ TLPFSDRQID ADPQLQRLS I RE

Figure H-I: Amino Acid Sequence ofpvdQ. The pvdQ ?-terminal signal peptide, which is comprised of amino acids 1 through 23, is bolded. The start site for the truncated version oípvdQ is highlighted in red. The sequence was retrieved through the UniProtKB online server.

Appendix III: Media and Solutions

115 2X SDS-PAGE Loading Buffer 0.5 M Tris-HCl ph 6.8 2.5 mL

10% SDS 4.0 mL Glycerol 2.0 mL DTT 0.23 g Bromophenol blue 5.0 mg Distilled water was added to a final volume of 1OmL.

2OmM Imidazole Equilibration Buffer NaH2PO4 · H2O 6.9 g NaCl 17.54 g Imidazole L36g Distilled water was added to a final volume of IL and pH was adjusted to pH 8.0. The Buffer was suction filtered through filter paper.

5OmM Imidazole Wash Buffer

NaH2PO4 · H2O 6.9 g NaCl 17.54 g Imidazole 3.4 g Distilled water was added to a final volume of IL and pH was adjusted to pH 8.0. The Buffer was suction filtered through filter paper.

IQOmM Imidazole Elution Buffer

NaH2PO4 · H2O 6.9 g NaCl 17.54 g Imidazole 6.8 g

116 Distilled water was added to a final volume of IL and pH was adjusted to pH 8.0. The Buffer was suction filtered through filter paper.

20OmM Imidazole Elution Buffer

NaH2PO4 · H2O 6.9 g NaCl 17.54 g Imidazole 13.6 g Distilled water was added to a final volume of IL and pH was adjusted to pH 8.0. The Buffer was suction filtered through filter paper.

Enzyme Storage Buffer Kh2PO4 1.4g Na3C6H5O7 . 2H2O 29.4g Distilled water was added to a final volume of IL and pH was adjusted to pH 8.0. The Buffer was suction filtered through filter paper.

5X Bradford Dye Coomassie Brilliant Blue G250 lOOmg 85% Phosphoric Acid 100 rnL 95% Ethanol 50 mL The dye was dissolved in the ethanol and then phosphoric acid was added. Distilled water was added to a final volume of 20OmL. The solution was filtered through suction filtration.

5X SDS-PAGE Running Buffer Tris 15 g Glycine 72 g SDS 5 g Distilled water was added to a final volume of IL.

117 5OX TAE Buffer

Tris 242 g Glacial Acetic Acid 57.1 mL

Na2EDTA · 2H2O 37.2 g Distilled water was added to a final volume of IL.

Agarose Gel Electrophoresis IPX Loading Buffer Bromophenol Blue 25 mg 10% SDS 20 µ? 0.5 M EDTA (pH 8.0) 100 µ? Glycerol 3 mL

Distilled water was added to a final volume of lOmL.

Luria-Bertani Agar Tryptone (Difco) 10 g Yeast Extract 5 g NaCl 10 g Agar 15 g Distilled water was added to a final volume of 1 L. The mixture was autoclaved for 20 minutes at 1210C.

Luria-Bertani Broth Tryptone (Difco) 10 g Yeast Extract 5 g NaCl 10 g Distilled water was added to a final volume of IL. The mixture was autoclaved for 20 minutes at 1210C.

118 Casamino Acid Broth

Casamino acids (Difco) 5g 80OmL distilled water MgSO4 0.244g 100ml distilled water Kh2PO4 + K2HPO4 0.7g + 1.3g 100ml distilled water Agar 15 g Components were autoclaved separately for 20 minutes at 1210C .Components were mixed after they were autoclaved. Agar was added and the IL mixture was autoclaved again at 1210C.

Casamino Acid Agar Casamino acids (Difco) 5g 80OmL distilled water MgSO4 0.244g 100ml distilled water Kh2PO4 + K2HPO4 0.7g + 1.3g 100ml distilled water Components were autoclaved separately for 20 minutes at 1210C .Components were mixed after they were autoclaved.

SDS-PAGE Staining Solution

Methanol 20OmL

Acetic Acid 4OmL Coomassie Brilliant Blue R250 0.4 g Distilled water was added to a final volume of 60OmL.

SDS-PAGE Destaining Solution

Methanol 200 mL

Acetic Acid 200 mL

Distilled water was added to a final volume of 2L.

119 SOC Media

Tryptone 3g Yeast Extract 0.75 g NaCl 0.075g KCl 0.279 g MgC12 0.306 g MgS04 0.369 g Glucose 0.54 g Distilled water was added to a final volume of 150 mL. The mixture was autoclaved for 20 minutes at 1210C.

120