DOCSLIB.ORG

Serpinb2 Regulates Immune Response in Kidney Injury and Aging

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Serpinb2 Regulates Immune Response in Kidney Injury and Aging BASIC RESEARCH www.jasn.org SerpinB2 Regulates Immune Response in Kidney Injury and Aging Payel Sen,1 Alexandra Helmke,1 Chieh Ming Liao,1 Inga Sörensen-Zender,1 Song Rong,1 Jan-Hinrich Bräsen,2 Anette Melk,3 Hermann Haller,1 Sibylle von Vietinghoff,1 and Roland Schmitt1 Departments of 1Nephrology and Hypertension and 2Pathology and 3Pediatric Nephrology and Gastroenterology, Medical School Hannover, Hannover, Germany ABSTRACT Background Expression of SerpinB2, a regulator of inflammatory processes, has been described in the context of macrophage activation and cellular senescence. Given that mechanisms for these processes interact and can shape kidney disease, it seems plausible that SerpinB2 might play a role in renal aging, injury, and repair. Methods We subjected SerpinB2 knockout mice to ischemia-reperfusion injury or unilateral ureteral ob- struction. We performed phagocyte depletion to study SerpinB2’s role beyond the effects of macro- phages and transplanted bone marrow from knockout mice to wild-type mice and vice versa to dissect cell type–dependent effects. Primary tubular cells and macrophages from SerpinB2 knockout and wild- type mice were used for functional studies and transcriptional profiling. Results Cultured senescent tubular cells, kidneys of aged mice, and renal stress models exhibited upreg- ulation of SerpinB2 expression. Functionally, lack of SerpinB2 in aged knockout mice had no effect on the magnitude of senescence markers but associated with enhanced kidney damage and fibrosis. In stress models, inflammatory cell infiltration was initially lower in knockout mice but later increased, leading to an accumulation of significantly more macrophages. SerpinB2 knockout tubular cells showed significantly reduced expression of the chemokine CCL2. Macrophages from knockout mice exhibited reduced phago- cytosis and enhanced migration. Macrophage depletion and bone marrow transplantation experiments validated the functional relevance of these cell type–specific functions of SerpinB2. Conclusions SerpinB2 influences tubule-macrophage crosstalk by supporting tubular CCL2 expression and regulating macrophage phagocytosis and migration. In mice, SerpinB2 expression seems to be needed for coordination and timely resolution of inflammation, successful repair, and kidney homeostasis during aging. Implications of SerpinB2 in human kidney disease deserve further exploration. JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2019101085 CKD is a major clinical problem and a growing understood but includes a cascade of cell- public health burden worldwide. Despite intensive autonomous responses and a complex crosstalk research, the number of therapeutic targets to pre- vent the development of CKD is limited. A com- Received October 22, 2019. Accepted February 9, 2020. mon element in many forms of CKD is a prolonged Published online ahead of print. Publication date available at or repetitive damage to tubular cells. When tubular www.jasn.org. cells are injured, they activate a survival program Correspondence: Dr. Roland Schmitt, Department of Nephrol- that can be adaptive and restore epithelial integrity ogy, Hannover Medical School, Carl Neuberg Strasse 1, 30625 or maladaptive, leading to the transition from AKI Hannover, Germany. Email: [email protected] to CKD.1 The tubular survival program is incompletely Copyright © 2020 by the American Society of Nephrology JASN 31: ccc–ccc,2020 ISSN : 1046-6673/3105-ccc 1 BASIC RESEARCH www.jasn.org with surrounding stromal and immune cells.2–4 The mononu- Significance Statement clear phagocyte system, in particular macrophages, plays an im- portant role in this crosstalk because they have emerged as key Injured tubular cells activate a kidney survival program that includes players in both the initial injury process and the subsequent complex crosstalk between tubular cells and macrophages. The recovery.5 authors show that SerpinB2, known to be expressed in activated fl macrophages, is also upregulated in stressed tubular cells. By An integral cell program that can promote both in amma- subjecting knockout mice lacking SerpinB2 to renal stress, they tion and failed recovery is cellular senescence, a persistent cell show that SerpinB2 promotes proreparative adaptation of the cycle arrest that occurs in the kidney with age and chronic and kidney by two cell type–specific mechanisms: it enhances expres- acute damage.6–10 We were interested in the role of SerpinB2 sion of the chemokine CCL2 in tubular cells, which supports tran- (or plasminogen activator inhibitor-2 [PAI-2]), a protein sient intrarenal leukocyte accumulation, and it regulates function of fl macrophages by activating phagocytosis and inhibiting migration. implicated in the interplay between cellular senescence, in am- These functions are crucial for timely resolution of inflammation, – mation, and maladaptive repair.11 13 SerpinB2 was first de- successful repair, and kidney homeostasis during aging. These scribed as a secreted protein inhibiting extracellular urokinase findings suggest that SerpinB2 merits further exploration for its role plasminogen activator (uPA), but it was later recognized that in the human kidney in acute and chronic disease. SerpinB2 also affects a variety of intracellular functions.14–16 fl SerpinB2 is known as a regulator of in ammatory processes used for vehicle-injected mice. For unilateral IR surgery, mice 17–21 with a strong expression in activated macrophages. Ser- were anesthetized with isoflurane, and after a midabdominal fl pinB2 has been associated with a number of extrinsic in am- incision, the left renal pedicle was clamped for 27 minutes matory and autoimmune conditions, including asthma and while mice were kept on a warming plate at 37°C. Mice were 17,18,22 infections, but there are no data so far on a potential euthanized after 3, 7, 14, and 21 days to extract kidneys. Bi- involvement in kidney disease. Here, we investigated the role lateral IR followed the same protocol, but ischemia was re- of SerpinB2 in kidney aging and injury. stricted to 18 minutes to ensure survival. After bilateral IR, blood was collected at days 3, 7, and 14 for measurement of serum creatinine and urea with an automated system (Beck- METHODS man Analyzer; Beckman Instruments GmbH). For bone mar- row (BM) transplantation, lethal irradiations (10 Gy) were Mice 2/2 1/2 performed in 6-week-old wild-type and SerpinB2 mice. SerpinB2 mice from Jackson Laboratory (B6.129S1-Ser- Mice were reconstituted with 13106 unfractionized BM cells 23 pinb2tm1Dgi/J; JAX stock #007234) were mated together to from both genotypes to obtain four recipient groups. Six weeks generate both homozygous Serpinb2 knockout and homozy- later, the BM-reconstituted recipients underwent UUO gous Serpinb2 wild-type littermates, thereby ensuring an surgery. identical genetic background. With these mice, a homozygous line was maintained for each genotype to obtain mice for ex- Primary Tubular Epithelial Cells 2 2 perimental conditions. Mice were housed under standard Kidneys of male wild-type and SerpinB2 / mice were conditions to breed wild-type and knockout mice. Genotyp- extracted and dissected into small pieces for digestion in ing PCR was done according to the Jackson Laborator- 0.125% collagenase type 1 solution (ThermoFisher Scientific) y–recommended protocol. Male mice between 3 and 4 or 22 in M199 medium at 37°C for 45 minutes. The solution was and 24 months (aged cohort) were used for experiments. All then passed through a 40-mm cell strainer, and passed tubules experimental protocols were in agreement with institutional were plated in REGM2 media (Promocell GmbH). When out- and legislator regulations and approved by the local authorities. growing primary tubular epithelial cells (PTECs) were 80% confluent, they were either subjected to g-irradiation (10 Gy) Unilateral Ureteral Obstruction, Ischemia-Reperfusion for induction of senescence as previously described24,25 or Surgery, and Bone Marrow Transplantation treated with phorbol 12-myristate 13-acetate (PMA) at The mice used were 3- to 4-month-old male wild-type and 100 ng/ml (Peprotech). For siRNA experiments, specific 2/2 SerpinB2 mice, and they were used for unilateral ureteral mouse Ccl2 or scrambled control siRNA (both Sigma- obstruction (UUO) and ischemia-reperfusion (IR) experi- Aldrich) was used at 25 nM with TransIT-S2 as transfection ments. For UUO, mice were anesthetized with isoflurane, reagent (Mirus Bio LLC). Efficient knockdown was verified by and the left ureter was ligated after a midabdominal incision. quantitative RT-PCR. Mice were euthanized at 3, 7, and 14 days postsurgery to extract the kidneys. Representative kidney sections were snap frozen in Senescence-Associated b-Galactosidase Staining 2 2 liquid nitrogen for RNA and protein isolation, kept in 4% PFA PTECs from wild-type and SerpinB2 / kidneys were cul- overnight for paraffin embedding, or used to prepare single- tured and plated in six-well plates until 80% confluent. They cell suspensions for flow cytometry. For phagocytic cell deple- were fixed with 2% formaldehyde and 0.2% glutaraldehyde tion, 0.1 ml/10 g body wt of liposomal clodronate (Liposoma) in PBS buffer for 10 minutes, permeabilized with 1% Triton was injected 24 hours before surgery. Control liposomes were X-100,washedwithPBS,andincubatedat37°Covernight 2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH Table 1. List of primers used for RT-PCR Gene Primer Forward Primer Reverse SerpinB2 CTG CTA CCC GAA GGT TCT GGA AGC AAC AGG AGC ATG C Ngal TGA AGG AAC GTT TCA CCC GCT TTG ACA GGA AAG ATG GAG TGG CAG ACA aSma GTG CTA TGT CGC TCT GGA CTT TGA ATG AAA GAT GGC TGG AAG AGG GTC b-Actin CCT CTA TGC CAA CAC AGT GC CAT CGT ACT CCT GCT TGC TG Ccl2 TTT GAA TGT GAA GTT GAC CCG TAA GAA GTG CTT GAG GTG GTT GT GG Fn1 GTG TGG TTT GGA CGA ATT CCA CGT CAA ATA GCT GAC TCT TGG C tPA GATGAAGGTCTGGCTTTGGA TAT GGA AGG TTG GCA TCT CC uPA GCC CAC AGACCTGATGC AT TAGAGCCTT CTG GCC ACA CT uPAR AGG TGG TGA CAA GAG GCTGT AGC TCT GGTCCAAAGAGGTG Pai-1 GCCAGATTTATCATCAATGACTGGG GGAGAGGTGCACATCTTTCTCAAA G Mmp2 CTGATAACCTGGATGCCGTCGT TGC TTC CAAACTTCACGCTCTT with freshly prepared staining solution at pH 6.0 (40 mM citric Hannover Medical School transcriptomics facility.
Load more

Recommended publications
  • Characterisation of Serpinb2 As a Stress Response Modulator
    University of Wollongong Research Online University of Wollongong Thesis Collection 1954-2016 University of Wollongong Thesis Collections 2015 Characterisation of SerpinB2 as a stress response modulator Jodi Anne Lee University of Wollongong Follow this and additional works at: https://ro.uow.edu.au/theses University of Wollongong Copyright Warning You may print or download ONE copy of this document for the purpose of your own research or study. The University does not authorise you to copy, communicate or otherwise make available electronically to any other person any copyright material contained on this site. You are reminded of the following: This work is copyright. Apart from any use permitted under the Copyright Act 1968, no part of this work may be reproduced by any process, nor may any other exclusive right be exercised, without the permission of the author. Copyright owners are entitled to take legal action against persons who infringe their copyright. A reproduction of material that is protected by copyright may be a copyright infringement. A court may impose penalties and award damages in relation to offences and infringements relating to copyright material. Higher penalties may apply, and higher damages may be awarded, for offences and infringements involving the conversion of material into digital or electronic form. Unless otherwise indicated, the views expressed in this thesis are those of the author and do not necessarily represent the views of the University of Wollongong. Recommended Citation Lee, Jodi Anne, Characterisation of SerpinB2 as a stress response modulator, Doctor of Philosophy thesis, School of Biological Sciences, University of Wollongong, 2015. https://ro.uow.edu.au/theses/4538 Research Online is the open access institutional repository for the University of Wollongong.
    [Show full text]
  • Serpins—From Trap to Treatment
    MINI REVIEW published: 12 February 2019 doi: 10.3389/fmed.2019.00025 SERPINs—From Trap to Treatment Wariya Sanrattana, Coen Maas and Steven de Maat* Department of Clinical Chemistry and Haematology, University Medical Center Utrecht, Utrecht University, Utrecht, Netherlands Excessive enzyme activity often has pathological consequences. This for example is the case in thrombosis and hereditary angioedema, where serine proteases of the coagulation system and kallikrein-kinin system are excessively active. Serine proteases are controlled by SERPINs (serine protease inhibitors). We here describe the basic biochemical mechanisms behind SERPIN activity and identify key determinants that influence their function. We explore the clinical phenotypes of several SERPIN deficiencies and review studies where SERPINs are being used beyond replacement therapy. Excitingly, rare human SERPIN mutations have led us and others to believe that it is possible to refine SERPINs toward desired behavior for the treatment of enzyme-driven pathology. Keywords: SERPIN (serine proteinase inhibitor), protein engineering, bradykinin (BK), hemostasis, therapy Edited by: Marvin T. Nieman, Case Western Reserve University, United States INTRODUCTION Reviewed by: Serine proteases are the “workhorses” of the human body. This enzyme family is conserved Daniel A. Lawrence, throughout evolution. There are 1,121 putative proteases in the human body, and about 180 of University of Michigan, United States Thomas Renne, these are serine proteases (1, 2). They are involved in diverse physiological processes, ranging from University Medical Center blood coagulation, fibrinolysis, and inflammation to immunity (Figure 1A). The activity of serine Hamburg-Eppendorf, Germany proteases is amongst others regulated by a dedicated class of inhibitory proteins called SERPINs Paulo Antonio De Souza Mourão, (serine protease inhibitors).
    [Show full text]
  • Serpinb10, a Serine Protease Inhibitor, Is Implicated in UV-Induced Cellular Response
    International Journal of Molecular Sciences Article SerpinB10, a Serine Protease Inhibitor, Is Implicated in UV-Induced Cellular Response Hajnalka Majoros 1, Barbara N. Borsos 1, Zsuzsanna Ujfaludi 1 , Zoltán G. Páhi 1,Mónika Mórocz 2, Lajos Haracska 2, Imre Miklós Boros 3,4 and Tibor Pankotai 1,* 1 Institute of Pathology, Faculty of Medicine, University of Szeged, 1 Állomás utca, H-6725 Szeged, Hungary; [email protected] (H.M.); [email protected] (B.N.B.); [email protected] (Z.U.); [email protected] (Z.G.P.) 2 HCEMM-BRC Mutagenesis and Carcinogenesis Research Group, Institute of Genetics, Biological Research Centre, H-6726 Szeged, Hungary; [email protected] (M.M.); [email protected] (L.H.) 3 Department of Biochemistry and Molecular Biology, Faculty of Science and Informatics, University of Szeged, H-6726 Szeged, Hungary; [email protected] 4 Institute of Biochemistry, Biological Research Centre, H-6726 Szeged, Hungary * Correspondence: [email protected]; Tel.: +36-62-546-164 Abstract: UV-induced DNA damage response and repair are extensively studied processes, as any malfunction in these pathways contributes to the activation of tumorigenesis. Although several proteins involved in these cellular mechanisms have been described, the entire repair cascade has remained unexplored. To identify new players in UV-induced repair, we performed a microarray screen, in which we found SerpinB10 (SPB10, Bomapin) as one of the most dramatically upregulated SPB10 genes following UV irradiation. Here, we demonstrated that an increased mRNA level of is a general cellular response following UV irradiation regardless of the cell type.
    [Show full text]
  • SERPINB10 Contributes to Asthma by Inhibiting the Apoptosis of Allergenic Th2 Cells
    SERPINB10 Contributes to Asthma by Inhibiting the Apoptosis of Allergenic Th2 Cells Yuqing Mo Zhongshan Hospital Fudan University https://orcid.org/0000-0002-2185-0552 Ling Ye Zhongshan Hospital Fudan University Hui Cai Zhongshan Hospital Fudan University Guiping Zhu Zhongshan Hospital Fudan University Jian Wang Zhongshan Hospital Fudan University Mengchan Zhu Zhongshan Hospital Fudan University Xixi Song Zhongshan Hospital Fudan University Chengyu Yang Zhongshan Hospital Fudan University Meiling Jin ( [email protected] ) Department of Pulmonary and Critical Care Medicine, Zhongshan Hospital, Fudan University, No.180 Fenglin Road, Xuhui District, Shanghai 200032, China. https://orcid.org/0000-0001-6532-3191 Research Keywords: asthma, SERPINB10, Th2 response, apoptosis Posted Date: December 30th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-135747/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/18 Abstract Background: Serine peptidase inhibitor, clade B, member 10 (SERPINB10) contributes to allergic inammation in asthma. However, its role in the T-helper type 1 (Th1) /Th2 response of allergic asthma is not known. The goal of this study was to unveil the function of SERPINB10 in the Th2 response of allergic asthma and the mechanism by which SERPINB10 affects the viability of Th2 cells. Methods: Th2 cytokines and serum levels of house dust mite (HDM)-specic IgE in bronchoalveolar lavage uid were examined by ELISA in an HDM-induced asthma model. The number and apoptosis of Th1 and Th2 cells in mouse lungs were measured by ow cytometry. Naïve CD4 T cells from patients with asthma were cultured under appropriate polarizing conditions to generate Th1 and Th2 cells.
    [Show full text]
  • Suppression of the Invasion and Migration of Cancer Cells by SERPINB Family Genes and Their Derived Peptides
    238 ONCOLOGY REPORTS 27: 238-245, 2012 Suppression of the invasion and migration of cancer cells by SERPINB family genes and their derived peptides RUEY-HWANG CHOU1-4, HUI-CHIN WEN1,7, WEI-GUANG LIANG1,5, SHENG-CHIEH LIN1,5, HSIAO-WEI YUAN1, CHENG-WEN WU1,5,6 and WUN-SHAING WAYNE CHANG1 1National Institute of Cancer Research, National Health Research Institutes, Miaoli 35053; 2Center for Molecular Medicine, China Medical University Hospital, Taichung 40402; 3China Medical University, Taichung 40402; 4Department of Biotechnology, Asia University, Taichung 41354; 5College of Life Science, National Tsing Hua University, Hsinchu 30013; 6Institute of Biochemistry and Molecular Biology, National Yang Ming University, Taipei 11221, Taiwan, R.O.C. Received June 28, 2011; Accepted August 17, 2011 DOI: 10.3892/or.2011.1497 Abstract. Apart from SERPINB2 and SERPINB5, the roles SERPINB RCL-peptides may provide a reasonable strategy of the remaining 13 members of the human SERPINB family against lethal cancer metastasis. in cancer metastasis are still unknown. In the present study, we demonstrated that most of these genes are differentially Introduction expressed in tumor tissues compared to matched normal tissues from lung or breast cancer patients. Overexpression of Cancer metastasis is the leading cause of morbidity and each SERPINB gene effectively suppressed the invasiveness mortality in cancer patients. It is a highly complex process, and motility of malignant cancer cells. Among all of the genes, including cell detachment, migration, invasion, circulation in the SERPINB1, SERPINB5 and SERPINB7 genes were more blood vessels, adhesion, colonization at other sites and forma- potent, and the inhibitory effect was further enhanced by tion of secondary tumors (1).
    [Show full text]
  • View Preprint
    A peer-reviewed version of this preprint was published in PeerJ on 16 June 2015. View the peer-reviewed version (peerj.com/articles/1026), which is the preferred citable publication unless you specifically need to cite this preprint. Kumar A. 2015. Bayesian phylogeny analysis of vertebrate serpins illustrates evolutionary conservation of the intron and indels based six groups classification system from lampreys for ∼500 MY. PeerJ 3:e1026 https://doi.org/10.7717/peerj.1026 Bayesian phylogeny analysis of vertebrate serpins illustrates evolutionary conservation of the intron and indels based six groups classification system from lampreys for ~500 MY Abhishek Kumar The serpin superfamily is characterized by proteins that fold into a conserved tertiary structure and exploits a sophisticated and irreversible suicide-mechanism of inhibition. Vertebrate serpins can be conveniently classified into six groups (V1-V6), based on three independent biological features - genomic organization, diagnostic amino acid sites and rare indels. However, this classification system was based on the limited number of mammalian genomes available. In this study, several non-mammalian genomes are used to validate this classification system, using the powerful Bayesian phylogenetic method. PrePrints This method supports the intron and indel based vertebrate classification and proves that serpins have been maintained from lampreys to humans for about 500 MY. Lampreys have less than 10 serpins, which expanded into 36 serpins in humans. The two expanding groups V1 and V2 have SERPINB1/SERPINB6 and SERPINA8/SERPIND1 as the ancestral serpins, respectively. Large clusters of serpins are formed by local duplications of these serpins in tetrapod genomes. Interestingly, the ancestral HCII/SERPIND1 locus (nested within PIK4CA) possesses group V4 serpin (A2APL1, homolog of α2-AP/SERPINF2 ) of lampreys; hence, pointing to the fact that group V4 might have originated from group V2.
    [Show full text]
  • SERPINB10 Contributes to Asthma by Inhibiting the Apoptosis of Allergenic Th2 Cells
    Mo et al. Respir Res (2021) 22:178 https://doi.org/10.1186/s12931-021-01757-1 RESEARCH Open Access SERPINB10 contributes to asthma by inhibiting the apoptosis of allergenic Th2 cells Yuqing Mo†, Ling Ye†, Hui Cai, Guiping Zhu, Jian Wang, Mengchan Zhu, Xixi Song, Chengyu Yang and Meiling Jin* Abstract Background: Serine peptidase inhibitor, clade B, member 10 (SERPINB10) contributes to allergic infammation in asthma. However, its role in the T-helper type 2 (Th2) response of allergic asthma is not known. The goal of this study was to unveil the function of SERPINB10 in the Th2 response of allergic asthma and the mechanism by which SER- PINB10 afects the viability of Th2 cells. Methods: Th2 cytokines and serum levels of house dust mite (HDM)-specifc IgE in bronchoalveolar lavage fuid were examined by ELISA in an HDM-induced asthma model. The number and apoptosis of Th1 and Th2 cells in mouse lungs were measured by fow cytometry. Naïve CD4 T cells from patients with asthma were cultured under appropriate polarizing conditions to generate Th1 and Th2 cells. SERPINB10 expression in polarized Th1 and Th2 cells was quantifed by real-time reverse transcription-quantitative polymerase chain reaction. SERPINB10 expression was knocked down in human CD4 T cells with lentivirus. Results: Knockdown of SERPINB10 expression signifcantly diminished HDM-induced Th2 cytokine secretion and level of HDM-specifc IgE. After HDM exposure, SERPINB10-knockdown mice had diminished numbers of Th2 cells, but similar numbers of Th1 cells, compared with those in negative-control mice. Th2 cells of SERPINB10-knockdown mice were more susceptible to apoptosis than that of control mice.
    [Show full text]
  • Understanding the Role of Plasminogen Activator Inhibitor Type-2 (PAI-2, Serpinb2)
    University of Wollongong Research Online University of Wollongong Thesis Collection University of Wollongong Thesis Collections 2011 Understanding the role of plasminogen activator inhibitor type-2 (PAI-2, SerpinB2) in cancer: the relationship between biochemical properties and cellular function Blake J. Cochran University of Wollongong Recommended Citation Cochran, Blake J., Understanding the role of plasminogen activator inhibitor type-2 (PAI-2, SerpinB2) in cancer: the relationship between biochemical properties and cellular function, Doctor of Philosophy thesis, University of Wollongong. School of Biological Sciences, University of Wollongong, 2011. http://ro.uow.edu.au/theses/3300 Research Online is the open access institutional repository for the University of Wollongong. For further information contact Manager Repository Services: [email protected]. UNDERSTANDING THE ROLE OF PLASMINOGEN ACTIVATOR INHIBITOR TYPE-2 (PAI-2, SERPINB2) IN CANCER: THE RELATIONSHIP BETWEEN BIOCHEMICAL PROPERTIES AND CELLULAR FUNCTION A thesis submitted in fulfilment of the requirements for the award of the degree Doctor of Philosophy from University of Wollongong by Blake J. Cochran Bachelor of Biotechnology (Honours 1)(Advanced) School of Biological Sciences University of Wollongong 2011 CERTIFICATION I, Blake J. Cochran, declare that this thesis, submitted in fulfilment of the requirements for the award of Doctor of Philosophy, in the School of Biological Sciences, University of Wollongong, is wholly my own work unless otherwise referenced or acknowledged. The document has not been submitted for qualifications at any other academic institution. Blake J. Cochran 18 July 2011 I LIST OF PUBLICATIONS Cochran, B.J., Gunawardhana, L.P., Vine, K.L., Lee, J.A., Lobov, S. and Ranson, M. 2009.
    [Show full text]
  • Egg Serpins: the Chicken And/Or the Egg Dilemma Clara Dombre, Nicolas Guyot, Thierry Moreau, Philippe Monget, Mylène Da Silva, Joël Gautron, Sophie Réhault-Godbert
    Egg serpins: The chicken and/or the egg dilemma Clara Dombre, Nicolas Guyot, Thierry Moreau, Philippe Monget, Mylène da Silva, Joël Gautron, Sophie Réhault-Godbert To cite this version: Clara Dombre, Nicolas Guyot, Thierry Moreau, Philippe Monget, Mylène da Silva, et al.. Egg serpins: The chicken and/or the egg dilemma. Seminars in Cell and Developmental Biology, Elsevier, 2017, 62, pp.120-132. 10.1016/j.semcdb.2016.08.019. hal-01595204 HAL Id: hal-01595204 https://hal.archives-ouvertes.fr/hal-01595204 Submitted on 27 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License Seminars in Cell & Developmental Biology 62 (2017) 120–132 Contents lists available at ScienceDirect Seminars in Cell & Developmental Biology j ournal homepage: www.elsevier.com/locate/semcdb Review Egg serpins: The chicken and/or the egg dilemma a,b,c,d e f a,b,c,d Clara Dombre , Nicolas Guyot , Thierry Moreau , Philippe Monget , e e e,∗ Mylène Da Silva , Joël Gautron , Sophie Réhault-Godbert a INRA, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France b CNRS, UMR6175 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France c Université Franc¸ ois Rabelais de Tours, F-37041 Tours, France d IFCE, F-37380 Nouzilly, France e INRA, UR83 Recherches Avicoles, F-37380 Nouzilly, France f CEPR, UMR INSERM U1100, Faculté de Médecine, Université de Tours, 10 Bd.
    [Show full text]
  • Mechanisms of Gastrointestinal Allergic Disorders
    Mechanisms of gastrointestinal allergic disorders Nurit P. Azouz, Marc E. Rothenberg J Clin Invest. 2019;129(4):1419-1430. https://doi.org/10.1172/JCI124604. Review Series Gastrointestinal (GI) allergic disease is an umbrella term used to describe a variety of adverse, food antigen–driven, immune-mediated diseases. Although these diseases vary mechanistically, common elements include a breakdown of immunologic tolerance, a biased type 2 immune response, and an impaired mucosal barrier. These pathways are influenced by diverse factors such as diet, infections, exposure to antibiotics and chemicals, GI microbiome composition, and genetic and epigenetic elements. Early childhood has emerged as a critical period when these factors have a dramatic impact on shaping the immune system and therefore triggering or protecting against the onset of GI allergic diseases. In this Review, we will discuss the latest findings on the molecular and cellular mechanisms that govern GI allergic diseases and how these findings have set the stage for emerging preventative and treatment strategies. Find the latest version: https://jci.me/124604/pdf The Journal of Clinical Investigation REVIEW SERIES: ALLERGY Series Editor: Kari Nadeau Mechanisms of gastrointestinal allergic disorders Nurit P. Azouz and Marc E. Rothenberg Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA. Gastrointestinal (GI) allergic disease is an umbrella term used to describe a variety of adverse, food antigen–driven, immune- mediated diseases. Although these diseases vary mechanistically, common elements include a breakdown of immunologic tolerance, a biased type 2 immune response, and an impaired mucosal barrier.
    [Show full text]
  • Nucleotide Variations in Genes Encoding Plasminogen Activator Inhibitor-2 and Serine Proteinase Inhibitor B10 Associated with Prostate Cancer
    J Hum Genet (2005) 50: 507–515 DOI 10.1007/s10038-005-0285-1 ORIGINAL ARTICLE Go Shioji Æ Yoichi Ezura Æ Toshiaki Nakajima Kenji Ohgaki Æ Hiromichi Fujiwara Æ Yoshinobu Kubota Tomohiko Ichikawa Æ Katsuki Inoue Æ Taro Shuin Tomonori Habuchi Æ Osamu Ogawa Æ Taiji Nishimura Mitsuru Emi Nucleotide variations in genes encoding plasminogen activator inhibitor-2 and serine proteinase inhibitor B10 associated with prostate cancer Received: 2 May 2005 / Accepted: 25 July 2005 / Published online: 20 September 2005 Ó The Japan Society of Human Genetics and Springer-Verlag 2005 Abstract Genes encoding the serine proteinase inhibitor variations within SERPINB loci at 18q21 might be Bfamily(SERPINBs) are mainly clustered on human associated with risk of prostate cancer in Japanese men. chromosome 18 (18q21). Several serpins are known to A case-control study involving 292 prostate-cancer pa- affect malignant phenotypes of tumor cells, so aberrant tients and 384 controls revealed significant differences in genetic variants in this molecular family are candidates regard to distribution of four missense variations in genes for conferring susceptibility for risk of cancer. We encoding plasminogen activator inhibitor 2 (PAI2)and investigated whether eight selected non-synonymous SERPINB10. The most significant association was de- tected for the N120D polymorphism in the PAI2 gene À5 G. Shioji Æ Y. Ezura Æ T. Nakajima Æ K. Ohgaki (P=5.0·10 ); men carrying the 120-N allele (120-N/N H. Fujiwara Æ M. Emi and 120-N/D genotypes) carried a 2.4-fold increased risk Department of Molecular Biology, Institute of Gerontology, of prostate cancer (95% confidence interval 1.45–4.07).
    [Show full text]
  • SERPINB10 (NM 005024) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP313932 SERPINB10 (NM_005024) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human serpin peptidase inhibitor, clade B (ovalbumin), member 10 (SERPINB10) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 45.2 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_005015 Locus ID: 5273 UniProt ID: P48595, B2RC45 RefSeq Size: 1194 Cytogenetics: 18q22.1 RefSeq ORF: 1192 Synonyms: PI-10; PI10 Summary: This gene is a member of the serpin peptidase inhibitor, clade B family and is found in a cluster of other similar genes on chromosome 18. The protein encoded by this gene appears to help control the regulation of protease functions during hematopoiesis. Variations in this gene may increase the risk of prostate cancer. [provided by RefSeq, Dec 2015] Protein Families: Druggable Genome This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 SERPINB10 (NM_005024) Human Recombinant Protein – TP313932 Product images: Coomassie blue staining of purified SERPINB10 protein (Cat# TP313932).
    [Show full text]