Serpinb2 Regulates Immune Response in Kidney Injury and Aging

BASIC RESEARCH www.jasn.org

SerpinB2 Regulates Immune Response in Kidney Injury and Aging

Payel Sen,1 Alexandra Helmke,1 Chieh Ming Liao,1 Inga Sörensen-Zender,1 Song Rong,1 Jan-Hinrich Bräsen,2 Anette Melk,3 Hermann Haller,1 Sibylle von Vietinghoff,1 and Roland Schmitt1

Departments of 1Nephrology and Hypertension and 2Pathology and 3Pediatric Nephrology and Gastroenterology, Medical School Hannover, Hannover, Germany

ABSTRACT Background Expression of SerpinB2, a regulator of inflammatory processes, has been described in the context of macrophage activation and cellular senescence. Given that mechanisms for these processes interact and can shape kidney disease, it seems plausible that SerpinB2 might play a role in renal aging, injury, and repair. Methods We subjected SerpinB2 knockout mice to ischemia-reperfusion injury or unilateral ureteral obstruction. We performed phagocyte depletion to study SerpinB2’s role beyond the effects of macrophages and transplanted bone marrow from knockout mice to wild-type mice and vice versa to dissect cell type–dependent effects. Primary tubular cells and macrophages from SerpinB2 knockout and wild- type mice were used for functional studies and transcriptional profiling. Results Cultured senescent tubular cells, kidneys of aged mice, and renal stress models exhibited upregulation of SerpinB2 expression. Functionally, lack of SerpinB2 in aged knockout mice had no effect on the magnitude of senescence markers but associated with enhanced kidney damage and fibrosis. In stress models, inflammatory cell infiltration was initially lower in knockout mice but later increased, leading to an accumulation of significantly more macrophages. SerpinB2 knockout tubular cells showed significantly reduced expression of the chemokine CCL2. Macrophages from knockout mice exhibited reduced phagocytosis and enhanced migration. Macrophage depletion and bone marrow transplantation experiments validated the functional relevance of these cell type–specific functions of SerpinB2. Conclusions SerpinB2 influences tubule-macrophage crosstalk by supporting tubular CCL2 expression and regulating macrophage phagocytosis and migration. In mice, SerpinB2 expression seems to be needed for coordination and timely resolution of inflammation, successful repair, and kidney homeostasis during aging. Implications of SerpinB2 in human kidney disease deserve further exploration.

JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2019101085

CKD is a major clinical problem and a growing understood but includes a cascade of cell- public health burden worldwide. Despite intensive autonomous responses and a complex crosstalk research, the number of therapeutic targets to pre- vent the development of CKD is limited. A com- Received October 22, 2019. Accepted February 9, 2020. mon element in many forms of CKD is a prolonged Published online ahead of print. Publication date available at or repetitive damage to tubular cells. When tubular www.jasn.org. cells are injured, they activate a survival program Correspondence: Dr. Roland Schmitt, Department of Nephrol- that can be adaptive and restore epithelial integrity ogy, Hannover Medical School, Carl Neuberg Strasse 1, 30625 or maladaptive, leading to the transition from AKI Hannover, Germany. Email: [email protected] to CKD.1 The tubular survival program is incompletely Copyright © 2020 by the American Society of Nephrology

JASN 31: ccc–ccc,2020 ISSN : 1046-6673/3105-ccc 1 BASIC RESEARCH www.jasn.org with surrounding stromal and immune cells.2–4 The mononu- Significance Statement clear phagocyte system, in particular macrophages, plays an important role in this crosstalk because they have emerged as key Injured tubular cells activate a kidney survival program that includes players in both the initial injury process and the subsequent complex crosstalk between tubular cells and macrophages. The recovery.5 authors show that SerpinB2, known to be expressed in activated fl macrophages, is also upregulated in stressed tubular cells. By An integral cell program that can promote both in amma- subjecting knockout mice lacking SerpinB2 to renal stress, they tion and failed recovery is cellular senescence, a persistent cell show that SerpinB2 promotes proreparative adaptation of the cycle arrest that occurs in the kidney with age and chronic and kidney by two cell type–specific mechanisms: it enhances expres- acute damage.6–10 We were interested in the role of SerpinB2 sion of the chemokine CCL2 in tubular cells, which supports tran- (or plasminogen activator inhibitor-2 [PAI-2]), a protein sient intrarenal leukocyte accumulation, and it regulates function of fl macrophages by activating phagocytosis and inhibiting migration. implicated in the interplay between cellular senescence, in am- These functions are crucial for timely resolution of inflammation, – mation, and maladaptive repair.11 13 SerpinB2 was first de- successful repair, and kidney homeostasis during aging. These scribed as a secreted protein inhibiting extracellular urokinase findings suggest that SerpinB2 merits further exploration for its role plasminogen activator (uPA), but it was later recognized that in the human kidney in acute and chronic disease. SerpinB2 also affects a variety of intracellular functions.14–16 fl SerpinB2 is known as a regulator of in ammatory processes used for vehicle-injected mice. For unilateral IR surgery, mice 17–21 with a strong expression in activated macrophages. Ser- were anesthetized with isoflurane, and after a midabdominal fl pinB2 has been associated with a number of extrinsic in am- incision, the left renal pedicle was clamped for 27 minutes matory and autoimmune conditions, including asthma and while mice were kept on a warming plate at 37°C. Mice were 17,18,22 infections, but there are no data so far on a potential euthanized after 3, 7, 14, and 21 days to extract kidneys. Bi- involvement in kidney disease. Here, we investigated the role lateral IR followed the same protocol, but ischemia was re- of SerpinB2 in kidney aging and injury. stricted to 18 minutes to ensure survival. After bilateral IR, blood was collected at days 3, 7, and 14 for measurement of serum creatinine and urea with an automated system (Beck- METHODS man Analyzer; Beckman Instruments GmbH). For bone marrow (BM) transplantation, lethal irradiations (10 Gy) were Mice 2/2 1/2 performed in 6-week-old wild-type and SerpinB2 mice. SerpinB2 mice from Jackson Laboratory (B6.129S1-Ser- Mice were reconstituted with 13106 unfractionized BM cells 23 pinb2tm1Dgi/J; JAX stock #007234) were mated together to from both genotypes to obtain four recipient groups. Six weeks generate both homozygous Serpinb2 knockout and homozy- later, the BM-reconstituted recipients underwent UUO gous Serpinb2 wild-type littermates, thereby ensuring an surgery. identical genetic background. With these mice, a homozygous line was maintained for each genotype to obtain mice for ex- Primary Tubular Epithelial Cells 2 2 perimental conditions. Mice were housed under standard Kidneys of male wild-type and SerpinB2 / mice were conditions to breed wild-type and knockout mice. Genotyp- extracted and dissected into small pieces for digestion in ing PCR was done according to the Jackson Laborator- 0.125% collagenase type 1 solution (ThermoFisher Scientific) y–recommended protocol. Male mice between 3 and 4 or 22 in M199 medium at 37°C for 45 minutes. The solution was and 24 months (aged cohort) were used for experiments. All then passed through a 40-mm cell strainer, and passed tubules experimental protocols were in agreement with institutional were plated in REGM2 media (Promocell GmbH). When out- and legislator regulations and approved by the local authorities. growing primary tubular epithelial cells (PTECs) were 80% confluent, they were either subjected to g-irradiation (10 Gy) Unilateral Ureteral Obstruction, Ischemia-Reperfusion for induction of senescence as previously described24,25 or Surgery, and Bone Marrow Transplantation treated with phorbol 12-myristate 13-acetate (PMA) at The mice used were 3- to 4-month-old male wild-type and 100 ng/ml (Peprotech). For siRNA experiments, specific 2/2 SerpinB2 mice, and they were used for unilateral ureteral mouse Ccl2 or scrambled control siRNA (both Sigma- obstruction (UUO) and ischemia-reperfusion (IR) experi- Aldrich) was used at 25 nM with TransIT-S2 as transfection ments. For UUO, mice were anesthetized with isoflurane, reagent (Mirus Bio LLC). Efficient knockdown was verified by and the left ureter was ligated after a midabdominal incision. quantitative RT-PCR. Mice were euthanized at 3, 7, and 14 days postsurgery to extract the kidneys. Representative kidney sections were snap frozen in Senescence-Associated b-Galactosidase Staining 2 2 liquid nitrogen for RNA and protein isolation, kept in 4% PFA PTECs from wild-type and SerpinB2 / kidneys were cul- overnight for paraffin embedding, or used to prepare single- tured and plated in six-well plates until 80% confluent. They cell suspensions for flow cytometry. For phagocytic cell deple- were fixed with 2% formaldehyde and 0.2% glutaraldehyde tion, 0.1 ml/10 g body wt of liposomal clodronate (Liposoma) in PBS buffer for 10 minutes, permeabilized with 1% Triton was injected 24 hours before surgery. Control liposomes were X-100,washedwithPBS,andincubatedat37°Covernight

2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

Table 1. List of primers used for RT-PCR Gene Primer Forward Primer Reverse SerpinB2 CTG CTA CCC GAA GGT TCT GGA AGC AAC AGG AGC ATG C Ngal TGA AGG AAC GTT TCA CCC GCT TTG ACA GGA AAG ATG GAG TGG CAG ACA aSma GTG CTA TGT CGC TCT GGA CTT TGA ATG AAA GAT GGC TGG AAG AGG GTC b-Actin CCT CTA TGC CAA CAC AGT GC CAT CGT ACT CCT GCT TGC TG Ccl2 TTT GAA TGT GAA GTT GAC CCG TAA GAA GTG CTT GAG GTG GTT GT GG Fn1 GTG TGG TTT GGA CGA ATT CCA CGT CAA ATA GCT GAC TCT TGG C tPA GATGAAGGTCTGGCTTTGGA TAT GGA AGG TTG GCA TCT CC uPA GCC CAC AGACCTGATGC AT TAGAGCCTT CTG GCC ACA CT uPAR AGG TGG TGA CAA GAG GCTGT AGC TCT GGTCCAAAGAGGTG Pai-1 GCCAGATTTATCATCAATGACTGGG GGAGAGGTGCACATCTTTCTCAAA G Mmp2 CTGATAACCTGGATGCCGTCGT TGC TTC CAAACTTCACGCTCTT with freshly prepared staining solution at pH 6.0 (40 mM citric Hannover Medical School transcriptomics facility. Gene on- acid, Na phosphate buffer, 5 mM potassium ferrocyanide, tology analysis of microarray results was performed by using 5 mM potassium ferricyanide, 150 mM sodium chloride, the web-based DAVID 6.7 tool.26 Prism 8 (GraphPad Soft- 2 mM magnesium chloride, and 1 mg/ml X-gal prepared in ware) was used to generate heat maps. The original microarray dimethylformamide). For staining of whole kidneys, tissue data are available at the Gene Expression Omnibus database was incubated in the staining solution for 4 hours and then, with the accession number GSE139156. embedded with paraffin. Senescence-associated b-galactosidase (SA-b-gal)–positive area in 3-mmparaffin sections was deter- Histology and Immunostainings mined by normalizing the blue-stained area against the total For evaluation of histologic damage, deparaffinized sections number of cells/tubules using ImageJ software. In case of cos- were stained with hematoxylin/eosin and picosirius red stain- taining with SerpinB2 antibody, paraffin sections were cut and ing solution (Sigma-Aldrich). The picrosirius red staining was treated as described below. analyzed under polarized light, and the amount of birefrin- gence was quantified in ten randomly chosen nonoverlapping BM-Derived Macrophage Isolation fields (3200 magnification) using ImageJ software. For im- 2 2 Wild-type and SerpinB2 / mice were euthanized. BM was munostaining, cells were fixed in 4% PFA and permeabilized flushedfromfemurandtibiaandplatedinRPMImedia with Triton X-100 (0.1%), or 3-mmparaffin sections of mouse (Lonza) with 10% FCS and 100 ng/ml M-CSF (Peprotech). kidneys were deparaffinized and boiled in citrate buffer, pH Media were changed after 24 hours. Differentiated bone mar- 6.0, for antigen retrieval. For double-labeling studies, primary row–derived macrophages (BMDMs) were passaged on day 7 antibodies (Table 2) raised in different species were used in a and subsequently treated with LPS (100 ng/ml) and 20 ng/ml sequential fashion. Secondary fluorescence-labeled antibody IFN-g (both Peprotech) for M1-type macrophage stimulation. or the ABC Vectastain kit (Vector Laboratories) was used for detection. Staining for SerpinB2, fibronectin (Fn), and Real-Time PCR a-smooth muscle actin (aSMA) and costaining of SA-b-gal/ RNA was isolated from frozen kidney tissue or cultured cells SerpinB2, p21/SerpinB2, and Ki67/SerpinB2 were quantified using Nucleospin RNA Plus (Machery-Nagel) according to the in ten randomly chosen nonoverlapping fields (3200 magni- manufacturer’s instructions. Reverse transcription was per- fication) using ImageJ software or by counting tubular profiles formed with M-MLV-Reverse transcription (Promega) and under visual control. random primers (Promega). Amplified cDNA was used as a template for quantitative PCR. Levels of mRNA expression CCL2 ELISA were determined by quantitative RT-PCR using a Roche Light- Homogenized kidney lysates were centrifuged for 10 minutes cycler 480 System with SYBR green master mix and specific at 11,000 rcf. Supernatants were collected, and CCL2-content primers as described in Table 1. Melting curves were examined was assessed by a CCL2-specific ELISA performed according to verify that a single product was amplified. The threshold to the manufacturer’s instructions (R&D Systems). Absor- cycle (Ct) for each individual PCR was determined by the in- bance was measured at 495 nm on a Sunrise plate reader (Te- strument software, and Ct values obtained were normalized to can, Männerdorf, Switzerland). b-Actin gene expression. Quantification of gene expression was done according to the 22DDCt method. uPA Activity Assay The uPA activity assay was performed as recommended by the RNA Microarray manufacturer (Chemicon ECM600; Merck Millipore, Darm- RNA was isolated from PMA-treated PTECs (100 ng/ml for stadt, Germany). Briefly, homogenized kidney lysates were 24 hours). Microarray expression analysis was done at the centrifuged for 10 minutes at 11,000 rcf, and the supernatant

JASN 31: ccc–ccc,2020 SerpinB2 in AKI and Aging 3 BASIC RESEARCH www.jasn.org

Table 2. List of primary antibodies Biosciences) and counted on an LSR II Primary Antibodies Catalog No. Dilution Company (Becton-Dickinson). Data were analyzed – by FlowJo software (Tree Star Inc.). After SerpinB2 NBP1 3318 1:50 Novus Biologicals, CO 1 SerpinB2 M20-sc8174 1:50 Santa Cruz, CA gating for live CD45 events, myeloid cell aSMA 48938 1:200 Cell Signaling, MA populations were assessed using the Fn NBP1–91258 1:200 Novus Biologic, CO markersasdepictedinSupplemental CD45 550539 1:200 BD Bioscience, CA Figure 1. Absolute cell count was calcu- p21 M19-sc471 1:200 Santa Cruz, CA lated using the weight of renal tissue in Ki67 Sp6 1:200 ThermoFischer, MA relation to Trucount tube bead counts. was collected. To evaluate the levels of tissue-associated uPA Statistical Analyses activity, tissue extracts were incubated in 96-well microtiter Results are expressed as means6SEMs. Statistical signiﬁcance plates with the supplied chromogenic substrate. After incuba- was determined by unpaired t test and two-way ANOVA with tion at 37°C for 24 hours, absorbance was assessed at 405 nm Bonferroni correction for multiple comparisons (GraphPad using a Sunrise plate reader (Tecan), including a standard curve Software). Signiﬁcances are represented by asterisks with uPA-positive control (supplied with the kit) in each assay. (*P,0.05; **P,0.01; *** P,0.001). uPA activity was normalized for total protein content.

Coculture Transwell Assay RESULTS After stimulating with LPS (100 ng/ml) and 20 ng/ml IFN-g for 24 hours, BMDMs were starved overnight in RPMI media with Correlation between Tubular Cell Senescence and 1% FCS. The next day, 23105 BMDMs were plated in transwells SerpinB2 Expression (Corning) in a 12-well plate with 5-mm pore size with 0.53106 Cellular senescence as reflected by increased SA-b-gal activity 1 2 PTECs in the lower chamber in RPMI, 1% FCS, and 1% PS and expression of 16INK4A/p21 and gH2AX /Ki-67 nuclei medium. Cells were incubated at 37°C for 6 hours, and the (Figure 1, A–C, Supplemental Figure 2, A and B) was induced transwells were subsequently immersed in 4% PFA to fixthose in PTECs via g-irradiation.25 The senescence phenotype was cells that invaded to the bottom of the transwell. Bottom cells associated with a significant induction of SerpinB2 (Figure 1, C were stained using 0.1% solution of crystal violet in 70% etha- and D). In keeping with this finding, we observed significantly nol. For invasion of BMDMs against a CCL2 gradient, 10 ng/ml more SerpinB2 expression in kidneys from aged (24-month- recombinant CCL2 (Peprotech) was added to the bottom well old) mice compared with young (2-month-old) mice for 1 hour. The number of invaded cells was then counted by (Figure 1E). By immunostaining, SerpinB2 was mainly found imaging at 3200 magnification. in tubular cells (Supplemental Figure 2C), of which the major- ity exhibited colocalization with senescence markers SA-b-gal Phagocytosis Assay and p21 (Figure 1, F and G, Supplemental Figure 2, D and E). A 2 2 In total, 23105 BMDMs (wild type and SerpinB2 / ) were large proportion of tubules, which were, however, positive for plated in 12-well plates and stimulated with LPS (100 ng/ml) SA-b-gal and p21, was negative for SerpinB2 (Figure 1G, and 20 ng/ml IFN-g for 24 hours. Latex beads coated with FITC- Supplemental Figure 2E), indicating that SerpinB2 is not a rabbit IgG (Cayman Chemicals) were added in 1:500 dilution prerequisite for senescence. SerpinB2 was also highly ex- and incubated for 3 hours. Trypan blue (1:10) was added for pressed in kidneys of young mice stressed by common disease 2 minutes to quench the unphagocytosed latex beads on the cell models,renalIR,andUUOinjury(Figure1H).InUUO, surface. The cells were then fixed with 4% PFA for 20 minutes. tubular SerpinB2 expression correlated strongly with p21 The nuclei were stained using Hoechst stain. The amount of expression, whereas coexpression with Ki67 was rare phagocytosis was assessed by imaging at 3200 magnification. (Supplemental Figure 2, F–I).

2 2 Flow Cytometry SerpinB2 / Mice Show Increased Kidney Fibrosis and Representative tissue sections from contralateral and IR or Inflammation in Aging UUO kidneys were used for flow cytometry. Tissues were To explore the role of SerpinB2 during aging, we compared kid- 2 2 weighed and digested in 1.5 ml digestion mix (450 U/ml col- neys from old (22- to 24-month-old) wild-type and SerpinB2 / lagenase type 1, 250 U/ml collagenase type 11, 120 U/ml mice, a strain without known renal pathology.23 Interestingly, we hyaluronidase type 1, and 120 U/ml DNAse I; all ThermoScien- observed enhanced fibrosis as reflected by increased expression tific) at 37°C for 45 minutes to obtain a single-cell suspension. of aSma and Fn1 and a trend for increased collagen deposition Cells were incubated with staining mix on ice (MHCII-FITC, by picrosirius red staining (Figure 2, A–C). In the same kidneys, 1:500; CD206-PE, 1:100; CD11b-PERCP Cy5.5, 1:100; F4/80- we found no differences in senescence markers 16INK4A/p21 APC, 1:100; CD45.5–AF700, 1:100; and L/D-Qdot605, 1:500; (Figure 2C). Given the strong association of kidney fibrosis all antibodies are from Biolegend) in Trucount tubes (BD and inflammation, we analyzed the presence of inflammatory

4 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

A B C D E Con 40 20 15 ** *** Senes 30 15 *** *** ** 10 20 10 SerpinB2 SerpinB2 5 10 5 %of SA β gal+ area

0 0 0 Relative mRNA fold change Relative mRNA fold change SerpinB2 DAPI p16INK4a p21 SerpinB2 Con 2 yrs Senes 8 wks SAβgal F G H 60 Young * *** Old 10 ** 40

*** 20 *** 5 SerpinB2 %of total tubules 0 0 SerpinB2 SAβgal SerpinB2 SAβgal Relative mRNA fold change SAβgal IR SerpinB2 Con UUO

SerpinB2+ SAβgal

Figure 1. SerpinB2 is upregulated in senescent tubular epithelial cells. (A) Representative image for SA-b-gal staining and (B) quantification in nonsenescent (Con) versus g-irradiation–induced senescent (Senes) primary tubular cells (n55). (C) Quantitative RT-PCR of p16ink4a, p21, and SerpinB2 mRNA expression in control versus senescent PTECs (n54). (D) Representative immunofluorescence staining image for SerpinB2 in control versus senescent PTECs. DAPI, 49,6-diamidino-2-phenylindole. (E) Quantitative RT-PCR of SerpinB2 mRNA expression in kidneys from young (8-week-old) C57Bl/6J mice and old (2-year-old) C57Bl/6J mice (n55). (F) Repre- sentative images from young and old kidneys showing costaining of SA-b-gal activity (arrows mark SA-b-gal staining) and SerpinB2 1 1 2 1 immunohistochemistry (brown); red dotted lines mark SerpinB2 /SA-b-gal tubules and blue dotted lines mark SerpinB2 /SA-b-gal tubules in the higher-magnification image detail of old kidney. (G) Quantification of tubular colocalization in young and old kidneys (n56). (H) Quantitative RT-PCR of SerpinB2 mRNA in kidneys stressed by UUO and IR compared with control (n54). Values are given as means6SEMs. Unpaired t test two tailed. Original magnification, 3200 in A, D, and E. *P,0.05; **P,0.01; ***P,0.001.

2 2 2 2 cells by flow cytometry and found that aged SerpinB2 / kidneys wild-type and SerpinB2 / mice to UUO and IR. At 1 2 2 contained significantly more CD45 cells than wild-type kidneys 14 days of UUO, SerpinB2 / kidneys showed compara- 1 (Figure 2D). There were more total macrophages (CD11b -F4/ tively higher expression of the tubular damage markers neu- 1 80high), were significantly more M1 type (F4/80 -MHCIIhigh), trophil gelatinase–associated lipocalin, aSma, and Fn1 and 1 and was a trend for more M2-type macrophages (CD11b - increased levels of collagen in picrosirius red staining (Fig- 2 2 CD206high)inSerpinB2 / kidneys (Figure 2, E–G). To explore ure 3, A and B, Supplemental Figure 3C). Similar results the classic role of SerpinB2 as an inhibitor of the plasminogen were obtained at days 3 and 7 of UUO (Supplemental activation system, we examined the renal expressions of uPA, Figure 3, D and E). Flow cytometry revealed similar leuko- 2 2 uPA receptor, tissue plasminogen activator, PAI-1, and matrix cyte numbers in SerpinB2 / and wild-type kidneys at metalloproteinase-2 as well as the activity of uPA in the same 3 days of UUO (Figure 3, C–F), yet analysis of later time tissues, but we found no differences between wild-type and points revealed important differences. Wild-type kidneys 2 2 1 SerpinB2 / kidneys (Supplemental Figure 3, A and B). showed significantly more total CD45 leukocytes and macrophages on day 7. This pattern was reversed on day 14, with 2 2 SerpinB2 / Mice Exhibit Increased Renal Damage and asignificantly higher accumulation of inflammatory cells in 2 2 Altered Inflammation in UUO and IR Injury SerpinB2 / kidneys (Figure 3, C–F). No significant differ- To investigate the effect of SerpinB2 deficiency under acute ences were found in senescence markers (16INK4A/p21) be- renal stress conditions, we subjected 3- to 4-month-old tween the genotypes at any time point (data not shown), and

JASN 31: ccc–ccc,2020 SerpinB2 in AKI and Aging 5 BASIC RESEARCH www.jasn.org

AB WT 15 KO ** * 10

Positive stain (% of area) 0 PRed FN1 αSMA

C D E F G 8 WT 8 ** 6 4 * 3 KO * * 6 6 3 4 2 ** 4 4 2 2 1 2 2 1 (Normalised to WT) (Normalised to WT) (Normalised to WT) CD45+ cells/Kidney (Normalised to WT) CD11b+ F4/80hi /Kidney CD11b+ CD206 hi/Kidney CD11b+ MHCII hi/Kidney

Relative mRNA fold change 0 0 0 0 0 Fn1 αSma p16INK4a p21 WT KO WT KO WT KO WT KO

Figure 2. SerpinB2 in aging kidney is protective and prevents immune cell accumulation. (A) Representative images of picrosirius red (PRed) and immunofluorescence staining for Fn1 and aSMA and (B) quantification in kidneys of old (22- to 24-month-old) wild-type (WT) 2 2 and SerpinB2 / (knockout [KO]) mice (n56). DAPI, 49,6-diamidino-2-phenylindole. (C) Quantitative RT-PCR of mRNA for Fn1, aSma, p16INK4a, and p21 in kidneys of old WT and KO mice (n55). (D–G) Flow cytometry of kidney single-cell suspensions showing relative 1 1 1 counts for (D) total CD45 live leukocytes, (E) total macrophages (CD11b -F4/80high), (F) M1-type macrophages (F4/80 -MHCIIhigh), 1 and (G) M2-type macrophages (CD11b -CD206high) in the kidneys from old WT and KO mice (n56). Values are given as means6SEMs. Unpaired t test two tailed. Original magnification, 3200 in A. *P,0.05; **P,0.01. we also found no differences in the expression of key players expression in PTECs. SerpinB2 expression is very low in of the plasminogen activation system or in uPA activity PTECs at baseline. Despite potential off-target effects, we de- (Supplemental Figure 3, F and G). cided to use the well known SerpinB2 inducer PMA, which Comparable results were obtained in the IR model, reveal- promotes a strong SerpinB2 upregulation in PTECs ing enhanced expression of tubular damage and fibrosis (Figure 4A).27 We performed transcriptomic profiling of Ser- 2 2 2 2 markers in SerpinB2 / kidneys (Supplemental Figure 4) to- pinB2 / versus wild-type PTECs. Importantly, the lack of gether with significantly reduced functional recovery as SerpinB2 resulted in a suppressed expression of several cyto- judged by serum creatinine in mice with bilateral IR kines/chemokines known to be crucial in the tubule- (Supplemental Figure 5, A and B). Very similar to UUO, leu- inflammatory axis (Figure 4B). Focusing on CCL2, which is kocyte infiltration in IR kidneys was equal in both genotypes a key chemoattractant for kidney monocyte/macrophage in- 2 2 at day 3, whereas at day 7, SerpinB2 / kidneys exhibited filtration,28 we confirmed a significant reduction of CCL2 in 2 2 significantly fewer leukocytes, and on day 14, they had sig- SerpinB2 / PTECs on the mRNA and protein levels nificantly more than the wild type (Supplemental Figure 5, (Supplemental Figure 6, A and B). To test how this could con- C–F). No significant differences were found in senescence tribute to the reduced leukocyte infiltration seen at day 7 in markers (16INK4A/p21; data not shown) or selected compo- UUO and IR, PTECs and BMDMs were cocultured in trans- 2 2 nents of the plasminogen activation system (Supplemental wells (Figure 4C). SerpinB2 / PTECs attracted significantly Figure 5G). fewer BMDMs than wild-type PTECs (Figure 4D), supporting a role for reduced chemoattraction. A similar reduction in SerpinB2 Regulates Leukocyte Accumulation by BMDM attraction was seen when CCL2 was antagonized in Stimulating Tubular Chemoattractant Expression wild-type PTECs with Ccl2-specific siRNA (Supplemental To explore the observed differences in immune cell dynamics, Figure 6, C and D). In vivo, we also found significantly less 2 2 we addressed the effect of SerpinB2 on tubular chemokine CCL2 in SerpinB2 / kidneys at day 7 of UUO and IR, with a

6 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

A B

20 WT * KO 15 * *

5 Positive stain (% of area) 0 PRed FN1 αSMA

C D E F ) 6 ) ) 6 1.5 * 6 1.2 1.2 0.5 WT UUO ) * 6 KO UUO 0.4 * * WT Con 1.0 0.8 0.8 * KO Con

0.5 0.2 0.5 0.4 0.4

0.2 0.2 0.2 CD45+ cells/Kidney(×10 CD11b+ F4/80hi/Kidney(×10

0.0 0.0 F4/80+ MHCII hi/ Kidney(×10 0.0 0.0 37 14 37 14 37 14 CD11b+ CD206 hi/Kidney (×10 37 14 days days days days

Figure 3. SerpinB2 influences the outcome in UUO. (A) Representative images of picrosirius red (PRed) and immunofluorescence 2 2 staining for Fn1 and aSMA and (B) quantification in kidney sections from wild-type (WT) and SerpinB2 / (knockout [KO]) mice at 1 14 days after UUO (n55). DAPI, 49,6-diamidino-2-phenylindole. (C–F) Flow cytometry of (C) total CD45 live leukocytes, (D) total 1 1 macrophages (CD11b -F4/80high), (E) M1-type macrophages (F4/80high-MHCIIhigh), and (F) M2-type macrophages (CD11b - CD206high) in kidneys from WT and KO mice at indicated time points after UUO. Absolute counts of all cell populations in the contralateral (Con) kidneys are also shown for comparison. Values are given as means6SEMs (n55 for each group). Unpaired t test two tailed. Original magnification, 3200inA.*P,0.05.

2 2 congruent but nonsignificant decrease already at day 3 importantly, we observed that the phenotype of SerpinB2 / (Supplemental Figure 6, E and F). Apart from tubular cells, kidneys was rescued and even reversed after liposomal clodr- macrophages are major sources of CCL2 in inflamed kid- onate treatment (Figure 4G). After macrophage depletion, 2 2 neys.29 We, therefore, analyzed the effect of SerpinB2 on SerpinB2 / kidneys expressed significantly lower damage CCL2 expression in macrophages. Classic activation of markers neutrophil gelatinase–associated lipocalin, Fn1, and BMDMs with LPS and IFN-g, which resulted in strong Ser- aSma and had—in congruence with our tubular in vitro tran- pinB2 expression (Figure 4E), was not associated with differ- scriptomic data—significantly lower CCL2 expression than ences in CCL2 expression between activated wild-type and wild-type kidneys (Figure 4G). 2 2 SerpinB2 / BMDMs (Supplemental Figure 7A). Cell-Autonomous Effects of SerpinB2 in Macrophages Depletion of Macrophages before UUO Reverses the Although these data argue for specific effects of SerpinB2 in 2 2 Kidney Phenotype in SerpinB2 / Mice tubular cells, they also highlight the importance of macro- To specifically address the role of tubular SerpinB2 beyond the phages that seem to dominate the tissue response under effects of macrophages, we depleted mononuclear phagocytes normal conditions. To explore the role of macrophages in by liposomal clodronate and subsequently performed UUO more detail, we investigated cell-intrinsic effects of Ser- 2 2 surgery in wild-type and SerpinB2 / mice (Figure 4F). In pinB2 in isolated macrophages. We observed a significant addition to the expected reduction of kidney monocytes at reduction in the phagocytic capacity of isolated Ser- 2 2 3 days of UUO (Supplemental Figure 7, B and C), we found pinB2 / BMDMs (Figure 5, A and B). Additionally, we 2 2 an overall reduction in damage severity, which is a known found significantly faster migration of SerpinB2 / BMDMs featureofmacrophagedepletion(Figure4G).30 More when cells were challenged with recombinant CCL2 (Figure 5,

JASN 31: ccc–ccc,2020 SerpinB2 in AKI and Aging 7 BASIC RESEARCH www.jasn.org

A B C D WT PTECs -2 -1 0 1 2 KO PTECs WT KO 18 * 300 *** Ccl2 ** 16 Ccl7 ** Ccl12 200 14 Ccl24 Cxcl4 12 SerpinB2 100 Ccl9 BMDM No. of Invaded BMDM/field Ccl6 PTEC 10

Relative mRNA fold change 0 Cxcl2 WT KO Con TNFα PMA Cxcl7 Hypoxia WT BMDM KO BMDM WT KO

E F G WT Veh 10 * ** *** ** KO Veh LC 25 WT LC 8 ** *** 20 KO LC 6 15 WT/KO ** 10 4 SerpinB2 5 4 2 UUO ** 3 ** *

Relative mRNA fold change 0 2 ** Harvest 1 3 days Relative mRNA fold change 0 Con PMA Ngal Fn1αSma Ccl2 LPS+IFNγ

Figure 4. SerpinB2 regulates inﬂammatory crosstalk via upregulation of the chemoattractant pathway. (A) Quantitative RT-PCR to compare levels of SerpinB2 in PTECs after exposure to hypoxia, TNF-a, and PMA with control (Con; n54). (B) Heat map showing 2 2 differentially regulated chemokines and cytokines in PMA-treated PTECs from wild-type (WT) and SerpinB2 / (knockout [KO]) mice

(n52). Values represent the mean log2 (ratio) of gene expression from microarray data. (C) Schematic representation of coculture experiment with BMDMs in the upper chamber and PTECs in the lower chamber. (D) Quantiﬁcation of BMDMs invading the lower chamber as described in (C) (n53). (E) Quantitative RT-PCR of SerpinB2 mRNA in BMDMs after stimulation with LPS/IFN-g and PMA (n53). (F) Schematic representation of liposomal clodronate (LC) injection for depletion of phagocytic monocytes/macrophages 24 hours before UUO surgery. (G) Quantitative RT-PCR for neutrophil gelatinase–associated lipocalin (Ngal), Fn1, aSma, and Ccl2 mRNA in UUO kidneys from WT and KO mice after vehicle (Veh) or LC treatment (n54). Values are given as means6SEMs. (A and E) Unpaired t test two tailed and (D and G) two-way ANOVA with Bonferroni multiple comparison test. *P,0.05; **P,0.01; ***P,0.001.

C and D). Faster migration occurred despite unchanged in- wild-type kidneys (normal tubular CCL2 production) in com- 2 2 trinsic expression of the CCL2 receptor (Supplemental bination with SerpinB2 / BM (enhanced macrophage mi- Figure 7A). gration) (Figure 6, B–E, filled blue bars). Accordingly, we found the lowest immune infiltrate in the combination 2 2 BM Transplantation Reveals Unique Cell Type–Specific of SerpinB2 / kidneys (reduced tubular CCL2 production) Roles of SerpinB2 with wild-type BM (normal macrophage migration) (Figure 6, 2 2 BM transplantation from wild-type and SerpinB2 / mice B–E, open red bars). The intermediate immune infiltrate in into recipients of both genotypes followed by UUO 6 weeks wild-type recipients of wild-type BM (Figure 6, B–E, open later (Figure 6A) and analysis of kidneys from the resulting blue bars) was associated with the lowest degree of tubule- four groups of mice at 14 days allowed us to dissect cell interstitial damage (Figure 6, F–H, Supplemental Figure 8), type–dependent effects in kidney/tubular cells versus infiltrat- which highlights the balancing role of SerpinB2. Together, ing BM-derived cells. In support of distinct cell type–specific these findings indicate that SerpinB2 has distinct cell mechanisms, which regulate cell attraction and invasion, type–specific functions in tubular cells and macrophages, we found the highest amount of infiltrating immune cells in which regulate the delicate balance between inflammatory

8 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

A B C D 0.03 40 *** ** 30 0.02

0.01 10 Particle Intensity/total Dapi No. of Invaded BMDM/field 0.00 0 WT KO WT KO

phagocytosis migration

Figure 5. SerpinB2 in macrophages stimulates phagocytosis and reduces macrophage migration. (A) Representative images of 2 2 phagocytosed latex beads by LPS/IFN-g–stimulated BMDMs from wild-type (WT) and SerpinB2 / (knockout [KO]) mice, which are quantified in (B) (n58). (C) Representative images and (D) quantification of BMDMs stained with crystal violet from WT and KO mice in a transwell experiment with BMDMs in the upper chamber and recombinant CCL2 in the lower chamber (n58). Values are given as means6SEMs. (B and D) Unpaired t test two tailed. **P,0.01; ***P,0.001. influx/activation, tissue repair, and immune resolution damage-associated molecular patterns and neutrophil- (Figure 7). driven inflammation, 35,36,37 tubular cells drive the immune response by actively secreting chemoattractants.2 We found that SerpinB2 is instrumental for efficient tubular chemo- DISCUSSION kine synthesis. When SerpinB2 is lacking, synthesis of chemoattractants, in particular CCL2, is diminished, and Healing of the kidney requires a proreparative milieu to co- accumulation of inflammatory cells is strongly delayed, sim- ordinate immune cell activation, tubular repair, and resolu- ilar to results observed in a nematode infection model.34 tion of inflammation.3,5 WeintroduceSerpinB2asanovel Another important finding is that SerpinB2 is crucial for player in this triangle and demonstrate that SerpinB2 has ben- the prevention of progression from acute to persistent inflam- eficial effects for kidney outcome and healthy renal aging. mation. Our results suggest that the failure of this process is 2 2 There are many mechanistic concepts about possible func- due to macrophage dysfunction in SerpinB2 / mice. In tions of SerpinB2, which are surprisingly heterogeneous and agreement with a recent study, we observed uninhibited che- 2 2 so far, have not resulted in a clear consensus.11,17,19,21,31,32 In motactic migration in activated SerpinB2 / BM macro- vitro, we found that SerpinB2 was highly upregulated in cul- phages.21 We propose that the bifunctional regulation of tured PTECs after g-irradiation and after PMA treatment. In CCL2 activation in tubular cells, on the one hand, and inhi- vivo, SerpinB2 was upregulated in tubular cells by a variety of bition of macrophage migration, on the other hand, permit stressors, such as aging, UUO, and IR. Tubular SerpinB2 was regulatory fine tuning by which SerpinB2 can balance immune colocalized with markers of cellular senescence, but kidneys of cell invasion and inflammatory resolution.38,39 2 2 SerpinB2 / mice had no reduction in senescence. In contrast In addition to changes in migration, we found significantly 2 2 to previously described findings in other cell types,11,33 this reduced phagocytosis in activated SerpinB2 / BM macro- does not support a direct prosenescent role of SerpinB2 in the phages. Disturbed phagocytosis can result in chronic inflam- kidney; however, the situation might be different if the tubular mation and autoimmune disease.35,38 Of note, disturbed compartment is investigated in an isolated fashion. After mac- phagocytosis is also a major cause of chronic age-dependent rophage depletion, we found evidence for reduced tubular inflammation,40 which makes phagocytic dysfunction a likely 2 2 UUO damage in SerpinB2 / kidneys, suggesting an adverse contributor to the exacerbated kidney inflammation and fi- 2 2 effect of the protein on tubular cell integrity. Our findings brosis seen in old SerpinB2 / mice. Interestingly, another 2 2 suggest that these unfavorable effects are masked in the pres- study that has investigated SerpinB2 / peritoneal and not ence of macrophages, where beneficial immune regulatory BMDMs found no difference in phagocytosis.21 Tissue- and functions of SerpinB2 dominate the tissue response. site-dependent discrepancies in macrophages have been de- Broad agreement exists on the effect of SerpinB2 on scribed in different conditions (e.g., aging), and they might processes of the immune system.17–19,34 We extend these also explain heterogeneous responses between kidney and findings by providing several lines of evidence that SerpinB2 liver.41,42 is involved in the regulation of kidney inflammation. After Although SerpinB2 has been originally described as an the early AKI phase, which is dominated by the release of inhibitor of uPA/tissue plasminogen activator, published

JASN 31: ccc–ccc,2020 SerpinB2 in AKI and Aging 9 BASIC RESEARCH www.jasn.org

WT Kidney A B KO Kidney C D ) ) 6 6

) 2.0

6 * ** WT KO 1.2 1.2 *** Donor BM ** 1.5 * 0.8 0.8 *** 1.0

0.4 0.4 WT KO WT KO 0.5

UUO 14 days CD45+ cells/Kidney (×10 0.0 0.0 0.0 CD11b+ F4/80hi/Kidney (×10 WT BM KO BM WT BM KO BM F4/80+ MHCII hi/Kidney (×10 WT BM KO BM

E WT Kidney F G H ) 6 KO Kidney *** *** 6 ** 1.2 8 *** ** ** 8 * * 6 0.8 4 6

4 4 Ngal Fn1 0.4 2 * aSma * 2 2

0.0 Relative mRNA fold change 0 0 0 Relative mRNA fold change WT BM KO BM WT BM KO BM WT BM KO BM Relative mRNA fold change WT BM KO BM CD11b+ CD206 hi/Kidney (×10

Figure 6. SerpinB2 is important for balancing immune infiltration and adaptation. (A) Schematic representation of the BM transplantation model resulting in four separate groups: wild-type kidney (WT Kid)-WT BM, knockout (KO) Kid-WT BM, WT Kid-KO BM, and 1 1 KO Kid-KO BM. (B–E) Flow cytometry showing relative counts for (B) CD45 total live leukocytes, (C) total macrophages (CD11b -F4/ 1 1 80high), (D) M1-type (F4/80 -MHCIIhigh) macrophages, and (E) M2-type macrophages (CD11b -CD206high). (F–H) Quantitative RT-PCR for (F) neutrophil gelatinase–associated lipocalin (Ngal), (G) Fn1, and (H) aSma mRNA in kidneys of the four transplanted groups (n58 for WT Kid-WT BM and WT Kid-KO BM; n56 for KO Kid-WT BM and KO Kid-KO BM) normalized to the WT Kid-WT BM group. 2 2 SerpinB2 / is the KO. Values are given as means6SEMs. (B–H) Two-way ANOVA with Bonferroni multiple comparison test. *P,0.05; **P,0.01; ***P,0.001. evidence for the effect of SerpinB2 on plasminogen activation contains a premature stop codon in C57BL/6 wild-type mice 2 2 is controversial and by far, not as clear as for the SerpinB2 but not in SerpinB2 / mice, which might cause enhanced 2 2 paralog, PAI-1.31,43–46 In our study, we found no differences in SerpinB10 expression in SerpinB2 / mice.21 Potential effects uPA activity or expression of key members of the plasminogen of SerpinB10 in the kidney are completely unknown and 2 2 activation system in SerpinB2 / kidneys. Although this sug- should be investigated by follow-up studies. 2 2 gests that the kidney phenotype of SerpinB2 / mice is in- In summary, the results presented here emphasize crucial new dependent of plasminogen activation, it has to be noted that roles for SerpinB2 in kidney disease and renal aging. Although we measured total kidney levels of gene expression and uPA expression of SerpinB2 in isolated tubular cells may be poten- activity and thus, cannot rule out localized differences (e.g.,in tially maladaptive, we demonstrate that the immune-regulatory interstitial space). Schroder et al.46 recently demonstrated a effects of SerpinB2 dominate the outcome by determining a novel role for SerpinB2 in hemostasis, showing deregulated timely activation and subsequent resolution of kidney inflam- platelet activation and a hypercoagulation phenotype in Ser- mation. We show that SerpinB2 promotes proreparative adap- 2 2 pinB2 / mice. Although we did not observe differences in tation of the kidney by two cell type–specific mechanisms. (1) 2 2 platelet counts or renal fibrin deposition in SerpinB2 / mice SerpinB2 supports transient intrarenal leukocyte accumulation (data not shown), our experiments cannot exclude that subtle via enhanced expression of tubular CCL2. (2) SerpinB2 regulates differences in coagulation might have contributed to the ef- macrophage function by activating phagocytosis and inhibiting fects that we observed. migration. Our data suggest that these functions are crucial for a 2 2 An additional confounder in the SerpinB2 / phenotype timely coordination and resolution of inflammation, successful could be SerpinB10, a protease inhibitor from the same su- repair, and kidney homeostasis during aging. As such, SerpinB2 perfamily as SerpinB2, which has recently been implicated in may be regarded as a regulatory protein affecting various stages allergic asthma.47 Importantly, the coding gene for SerpinB10 from acute kidney disease to CKD and tissue fibrosis.

10 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

Macrophages/monocytes WT CCL2 KO SerpinB2

tubular CCL2-secretion↓ ? plasmin- tPA/uPA ogen plasmin Maladaptation Adaptation/ Repair

macrophage phagocytosis ↓ macrophage migration↑

Figure 7. SerpinB2 supports transient leukocyte accumulation and regulates macrophage function. Schematic representation of 2 2 functional activities of SerpinB2 in injured kidney/tubules from wild-type (WT) and SerpinB2 / (knockout [KO]) mice. tPA, tissue plasminogen activator, uPA, urokinase plasminogen activator. SerpinB2 from WT kidneys regulates CCL2 production which ensures timely immune cell migration and phagocytosis leading to adaptation or repair. Kidneys from KO mice have lower CCL2 production and exhibit macrophage dysfunctions like impaired phagocytosis and uninhibited migration leading to maladaptation post injury.

ACKNOWLEDGMENTS SUPPLEMENTAL MATERIAL

Technical assistance by Britta Gewecke is greatly appreciated. This article contains the following supplemental material online at Dr. Bräsen, Dr. Haller, Dr. Melk, Dr. Schmitt, and Dr. Sen de- http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2019101085/-/ signed the study; Dr. Helmke, Dr. Liao, Dr. Rong, Dr. Sen, and Dr. DCSupplemental. Sörensen-Zender carried out experiments; Dr. Schmitt, Dr. Sen, Supplemental Figure 1. Gating strategy for flow cytometry of and Dr. von Vietinghoff analyzed the data; Dr. Schmitt and Dr. Sen dissociated kidney cells. made the figures.Dr.Schmitt,Dr.Sen,andDr.vonVietinghoff Supplemental Figure 2. SerpinB2 and senescence markers in aged wrote the manuscript; and Dr. Bräsen, Dr. Haller, Dr. Helmke, Dr. and stressed kidneys. Liao,Dr.Melk,Dr.Rong,Dr.Schmitt,Dr.Sen,Dr.Sörensen- Supplemental Figure 3. Components of the plasminogen activa- Zender, and Dr. von Vietinghoff approved the final version of the tion system and markers of kidney damage and fibrosis in aged and 2 2 manuscript. SerpinB2 / kidneys after unilateral ureteral obstruction. Supplemental Figure 4. Markers of kidney damage and fibrosis in 2 2 SerpinB2 / kidneys after IR. DISCLOSURES Supplemental Figure 5. Components of the plasminogen activation system, markers of renal function and kidney leukocyte content 2 2 None. in SerpinB2 / kidneys after ischemia-reperfusion. Supplemental Figure 6. CCL2 expression and bone marrow–derived macrophage attraction of primary tubular epithelial 2 2 FUNDING cells from SerpinB2 / and wild-type kidneys and whole-kidney CCL2 expression in unilateral ureteral obstruction and ischemia- This work was supported by German Research Foundation grants SCHM reperfusion. 2146/6-1 and SFB738 (to Dr. Schmitt and Dr. Melk), the Dr. Werner Jackstädt Stiftung, and the Salisbury Cove Research Fund at MDI Biological Supplemental Figure 7. CCL and CCL2 receptor expression in Laboratory. Dr. Sen was supported by a Hannover Biomedical Research bone marrow–derived macrophage and leukocyte counts after lipo- School stipend. somal clodronate.

JASN 31: ccc–ccc,2020 SerpinB2 in AKI and Aging 11 BASIC RESEARCH www.jasn.org

Supplemental Figure 8. Markers of kidney damage and fibrosis in 21. Schroder WA, Hirata TD, Le TT, Gardner J, Boyle GM, Ellis J, et al.: kidneys from bone marrow transplantation experiments. SerpinB2 inhibits migration and promotes a resolution phase signature in large peritoneal macrophages. Sci Rep 9: 12421, 2019 22. Singhania A, Wallington JC, Smith CG, Horowitz D, Staples KJ, Howarth PH, et al.: Multitissue transcriptomics delineates the diversity REFERENCES of airway T cell functions in asthma. Am J Respir Cell Mol Biol 58: 261–270, 2018 1. Liu J, Kumar S, Dolzhenko E, Alvarado GF, Guo J, Lu C, et al.: Mo- 23. Dougherty KM, Pearson JM, Yang AY, Westrick RJ, Baker MS, Ginsburg lecular characterization of the transition from acute to chronic kid- D: The plasminogen activator inhibitor-2 gene is not required for nor- ney injury following ischemia/reperfusion. JCI Insight 2: 94716, mal murine development or survival. Proc Natl Acad Sci U S A 96: 2017 686–691, 1999 2. Qi R, Yang C: Renal tubular epithelial cells: The neglected mediator 24. Baisantry A, Bhayana S, Wrede C, Hegermann J, Haller H, Melk A, et al.: of tubulointerstitial fibrosis after injury. Cell Death Dis 9: 1126, The impact of autophagy on the development of senescence in primary 2018 tubular epithelial cells. Cell Cycle 15: 2973–2979, 2016 3. Bonventre JV, Yang L: Cellular pathophysiology of ischemic acute 25. Berkenkamp B, Susnik N, Baisantry A, Kuznetsova I, Jacobi C, kidney injury. JClinInvest121: 4210–4221, 2011 Sörensen-Zender I, et al.: In vivo and in vitro analysis of age-associated 4. Castrop H: The role of renal interstitial cells in proximal tubular re- changes and somatic cellular senescence in renal epithelial cells. PLoS generation. Nephron 141: 265–272, 2019 One 9: e88071, 2014 5. Huen SC, Cantley LG: Macrophages in renal injury and repair. Annu Rev 26. Huang W, Sherman BT, Lempicki RA: Systematic and integrative anal- Physiol 79: 449–469, 2017 ysis of large gene lists using DAVID bioinformatics resources. Nat 6. Jin H, Zhang Y, Ding Q, Wang SS, Rastogi P, Dai DF, et al.: Epithelial Protoc 4: 44–57, 2009 innate immunity mediates tubular cell senescence after kidney injury. 27. Petrova NV, Velichko AK, Razin SV, Kantidze OL: Small molecule com- JCI Insight 4: 125490, 2019 pounds that induce cellular senescence. Aging Cell 15: 999–1017, 2016 7. Schmitt R, Melk A: Molecular mechanisms of renal aging. Kidney Int 92: 28. Haller H, Bertram A, Nadrowitz F, Menne J: Monocyte chemoattractant 569–579, 2017 protein-1 and the kidney. Curr Opin Nephrol Hypertens 25: 42–49, 2016 8. Docherty MH, O’Sullivan ED, Bonventre JV, Ferenbach DA: Cellular 29. Xu L, Sharkey D, Cantley LG: Tubular GM-CSF promotes late MCP-1/ senescence in the kidney. JAmSocNephrol30: 726–736, 2019 CCR2-mediated fibrosis and inflammation after ischemia/reperfusion 9. Braun H, Schmidt BM, Raiss M, Baisantry A, Mircea-Constantin D, Wang injury. J Am Soc Nephrol 30: 1825–1840, 2019 S, et al.: Cellular senescence limits regenerative capacity and allograft 30. Kitamoto K, Machida Y, Uchida J, Izumi Y, Shiota M, Nakao T, et al.: survival. J Am Soc Nephrol 23: 1467–1473, 2012 Effects of liposome clodronate on renal leukocyte populations and 10. Lee DH, Wolstein JM, Pudasaini B, Plotkin M: INK4a deletion results in renal fibrosis in murine obstructive nephropathy. J Pharmacol Sci 111: improved kidney regeneration and decreased capillary rarefaction after 285–292, 2009 ischemia-reperfusion injury. Am J Physiol Renal Physiol 302: 31. Gardiner EE, Medcalf RL: Is plasminogen activator inhibitor type 2 really F183–F191, 2012 a plasminogen activator inhibitor after all? J Thromb Haemost 12: 11. Hsieh HH, Chen YC, Jhan JR, Lin JJ: The serine protease inhibitor 1703–1705, 2014 serpinB2 binds and stabilizes p21 in senescent cells. JCellSci130: 32. Lee NH, Cho A, Park SR, Lee JW, Sung Taek P, Park CH, et al.: SERPINB2 3272–3281, 2017 is a novel indicator of stem cell toxicity. Cell Death Dis 9: 724, 2018 12. Zhu Y, Tchkonia T, Pirtskhalava T, Gower AC, Ding H, Giorgadze N, 33. Sossey-Alaoui K, Pluskota E, Szpak D, Plow EF: The Kindlin2-p53-Ser- et al.: The Achilles’ heel of senescent cells: From transcriptome to se- pinB2 signaling axis is required for cellular senescence in breast cancer. nolytic drugs. Aging Cell 14: 644–658, 2015 Cell Death Dis 10: 539, 2019 13. Zhang H, Herbert BS, Pan KH, Shay JW, Cohen SN: Disparate effects of 34. Zhao A, Yang Z, Sun R, Grinchuk V, Netzel-Arnett S, Anglin IE, et al.: telomere attrition on gene expression during replicative senescence of SerpinB2 is critical to Th2 immunity against enteric nematode infection. human mammary epithelial cells cultured under different conditions. JImmunol190: 5779–5787, 2013 Oncogene 23: 6193–6198, 2004 35. Kundert F, Platen L, Iwakura T, Zhao Z, Marschner JA, Anders HJ: Im- 14. Croucher DR, Saunders DN, Lobov S, Ranson M: Revisiting the bi- mune mechanisms in the different phases of acute tubular necrosis. ological roles of PAI2 (SERPINB2) in cancer. Nat Rev Cancer 8: Kidney Res Clin Pract 37: 185–196, 2018 535–545, 2008 36. Rosin DL, Okusa MD: Dangers within: DAMP responses to damage and 15. Harris NLE, Vennin C, Conway JRW, Vine KL, Pinese M, Cowley MJ, cell death in kidney disease. JAmSocNephrol22: 416–425, 2011 et al.; Australian Pancreatic Cancer Genome Initiative: SerpinB2 regu- 37. Anders HJ: Immune system modulation of kidney regeneration-- lates stromal remodelling and local invasion in pancreatic cancer. On- mechanisms and implications. Nat Rev Nephrol 10: 347–358, 2014 cogene 36: 4288–4298, 2017 38. Serhan CN, Savill J: Resolution of inflammation: The beginning pro- 16. Ramnefjell M, Aamelfot C, Helgeland L, Akslen LA: Low expression of grams the end. Nat Immunol 6: 1191–1197, 2005 SerpinB2 is associated with reduced survival in lung adenocarcinomas. 39. Watanabe S, Alexander M, Misharin AV, Budinger GRS: The role of Oncotarget 8: 90706–90718, 2017 macrophages in the resolution of inflammation. JClinInvest129: 17. Lee JA, Cochran BJ, Lobov S, Ranson M: Forty years later and the role of 2619–2628, 2019 plasminogen activator inhibitor type 2/SERPINB2 is still an enigma. 40. Oishi Y, Manabe I: Macrophages in age-related chronic inflammatory Semin Thromb Hemost 37: 395–407, 2011 diseases. NPJ Aging Mech Dis 2: 16018, 2016 18. Schroder WA, Le TT, Major L, Street S, Gardner J, Lambley E, et al.: A 41. Schroder WA, Gardner J, Le TT, Duke M, Burke ML, Jones MK, et al.: physiological function of inflammation-associated SerpinB2 is regula- SerpinB2 deficiency modulates Th1∕Th2 responses after schistosome tion of adaptive immunity. J Immunol 184: 2663–2670, 2010 infection. Parasite Immunol 32: 764–768, 2010 19. Schroder WA, Major L, Suhrbier A: The role of SerpinB2 in immunity. 42. Linehan E, Dombrowski Y, Snoddy R, Fallon PG, Kissenpfennig A, Crit Rev Immunol 31: 15–30, 2011 Fitzgerald DC: Aging impairs peritoneal but not bone marrow-derived 20. Shea-Donohue T, Zhao A, Antalis TM: SerpinB2 mediated regulation of macrophage phagocytosis. Aging Cell 13: 699–708, 2014 macrophage function during enteric infection. Gut Microbes 5: 43. Kruithof EK, Baker MS, Bunn CL: Biological and clinical aspects of 254–258, 2014 plasminogen activator inhibitor type 2. Blood 86: 4007–4024, 1995

12 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

44. Siefert SA, Chabasse C, Mukhopadhyay S, Hoofnagle MH, Strickland 46. Schroder WA, Le TT, Gardner J, Andrews RK, Gardiner EE, DK, Sarkar R, et al.: Enhanced venous thrombus resolution in plas- Callaway L, et al.: SerpinB2 deficiency in mice reduces bleeding minogen activator inhibitor type-2 deficient mice. J Thromb Haemost times via dysregulated platelet activation. Platelets 30: 658–663, 12: 1706–1716, 2014 2019 45. Schroder WA, Anraku I, Le TT, Hirata TD, Nakaya HI, Major L, et al.: 47. Mo Y, Zhang K, Feng Y, Yi L, Liang Y, Wu W, et al.: Epithelial SER- SerpinB2 deficiency results in a stratum corneum defect and increased PINB10, a novel marker of airway eosinophilia in asthma, contributes to sensitivity to topically applied inflammatory agents. Am J Pathol 186: allergic airway inflammation. Am J Physiol Lung Cell Mol Physiol 316: 1511–1523, 2016 L245–L254, 2019

JASN 31: ccc–ccc,2020 SerpinB2 in AKI and Aging 13 Supplemental material Table of Contents

Figure S 1 Gating strategy for flow cytometry of dissociated kidney cells Figure S 2 SerpinB2 and senescence markers in aged and stressed kidneys Figure S 3 Components of the plasminogen activation system and markers of kidney damage and fibrosis in aged and SerpinB2-/- kidneys after UUO Figure S 4 Markers of kidney damage and fibrosis in SerpinB2-/- kidneys after IR Figure S 5 Components of the plasminogen activation system, markers of renal function and kidney leukocyte content in SerpinB2-/- kidneys after IR Figure S 6 CCL2 expression and BMDM attraction of PTEC from SerpinB2-/- and wildtype kidneys and whole kidney CCL2 expression in UUO and IR Figure S 7 CCL and CCR2 expression in BMDM and leukocyte counts after liposomal clodronate Figure S 8 Markers of kidney damage and fibrosis in kidneys from bone marrow transplantation experiments

Figure S1 Gating strategy for flow cytometric analysis of dissociated kidney cells. Live leukocytes were identified by CD45 expression, LD marker exclusion and scatter propeties. Among CD11b+ myeloid cells, subsets were defined according to MHCII,

F4/80 and CD206 expression.

Figure S2 (A) Representative image of immunofluorescent staining for Ki67 and

γH2AX in control versus senescent primary tubular epithelial cells (PTEC). (B)

Quantification of γH2AX+ and Ki67- PTEC as shown in (A), (n=3). (C) Representative immunohistochemical staining for SerpinB2 in young (8 weeks) versus old (2 years) mouse kidney. (D, E) Representative immunofluorescent staining for p21 and

SerpinB2 and quantification (E) in young (8 weeks) versus old (2 years) mouse kidney, (n=6). (F, G) Representative immunofluorescent staining for p21 and

SerpinB2 and quantification (G) in kidney of control versus unilateral ureteral obstruction (UUO), (n=5) (H, I) Representative immunofluorescent staining for Ki67

1 and SerpinB2 and quantification (I) in control versus UUO kidney, (n=5). Values are given as means ±SEMs. Unpaired t-test two tailed. *P<0.05, **P<0.01, *** P<0.001.

Figure S3 (A) Quantitative RT-PCR to quantify tPA, uPA, uPAR, Pai-1 and Mmp2 in kidneys from old WT and KO mice, (n=6). (B) uPA activity in kidney lysates from old

WT and KO mice, (n=4). (C-E) Quantitative RT-PCR of neutrophil gelatinase- associated lipocalin (Ngal), fibronectin (Fn1) and α smooth muscle actin (αSma) mRNA in kidneys from WT and KO mice at 14 days (C), 3 days (D) and 7days (E) post UUO, (n=5). (F) Quantitative RT PCR to quantify tPA, uPA, uPAR , Pai-1 and

Mmp2 in kidney from WT and KO mice at 14 days post UUO (n=6). (G) uPA activity in kidney lysates from old WT and KO mice at 14 days post UUO, (n=4). Wildtype =

WT, SerpinB2-/- = KO. Values are given as means ±SEMs. Unpaired t-test two tailed.

*P<0.05, **P<0.01, *** P<0.001.

Figure S4 (A-C) Quantitative RT-PCR of neutrophil gelatinase-associated lipocalin

(Ngal), fibronectin (Fn1) and α smooth muscle actin (αSma) mRNA in kidneys from

WT and KO mice at 3 (A), 7 (B) and 14 days (C) post unilateral IR, (n=5). (D, E)

Representative images of picrosirius red (PRed) and immunofluorescent staining for

FN1 and αSMA and quantification (E) in kidney sections from WT and KO mice at 14 days post unilateral IR, (n=5). Original magnification X 200 in D. Wildtype = WT,

SerpinB2-/- = KO. Values are given as means ±SEMs. Unpaired t-test two tailed.

*P<0.05, **P<0.01, *** P<0.001.

Figure S5 (A, B) Serum creatinine and serum urea measurements in WT and KO mice at indicated time points post bilateral ischemia reperfusion (IR) (n=4). (C-F)

Flow cytometry for total CD45+ live leucocytes (C), total macrophages (CD11b+-

F4/80high) (D), M1-type (F4/80+-MHCIIhigh) (E) and M2-type macrophages (CD11b+-

CD206high) (F) in kidneys from WT and KO mice at indicated time points post IR, 2

(n=5). (G) Quantitative RT PCR to quantify tPA, uPA, uPAR, Pai-1 and Mmp2 in kidneys from old WT and KO mice post IR (n=3). Unpaired t-test two tailed. Wildtype

= WT, SerpinB2-/- = KO. Values are given as means ±SEMs. *P<0.05, **P<0.01,

***P<0.001.

Figure S6 Quantitative RT-PCR of Ccl2 mRNA in phorbol 12-myristate 13-acetate

(PMA) treated primary tubular epithelial cells (PTEC) from WT and KO (n=3). (B)

ELISA quantification of CCL2 in PMA treated PTEC from WT and KO mice. (C)

Quantitative RT-PCR of Ccl2 in control or Ccl2 siRNA treated PTEC (n=3). (D)

Quantification of invading bone marrow derived macrophages (BMDM) in co-culture experiment with WT BMDM in upper chamber and control or Ccl2 siRNA treated

PTEC in lower chamber, (n=4). (E, F) ELISA quantification of CCL2 in kidney homogenates from WT and KO mice post UUO or IR at 3, 7 and 14 days. Wildtype =

WT, SerpinB2-/- = KO. Values are given as means ±SEMs (n=4 for each data point).

Two-way ANOVA with Bonferroni‘s multiple comparison test. *P<0.05, **P<0.01,

***P<0.001.

Figure S7 (A) Quantitative RT-PCR of Ccl2 and its receptor Ccr2 mRNA in bone marrow derived macrophages (BMDM) from WT and KO mice. (B, C) Flow cytometry for total intrarenal live leucocytes and M1-type -F4/80+MHCIIhigh macrophages, normalized to the mean of WT unilateral ureteral obstruction (UUO) kidney from vehicle injected mice. Kidneys from WT and KO mice injected with liposomal clodronate (LC) are compared to kidneys from vehicle (Veh) injected mice. Wildtype

= WT, SerpinB2-/- = KO. Values are given as means ±SEMs (n=4 for each data point).

Two-way ANOVA with Bonferroni‘s multiple comparison test. *P<0.05, **P<0.01,

***P<0.001.

Figure S8 (A, B) Quantification and representative images for picrosirius red (PRed) and immunofluorescence for fibronectin (FN1) and α smooth muscle actin (αSMA) in kidneys from bone marrow transplantation experiment from 4 separate groups (WT

Kid-WT BM), (KO Kid-WT BM), (WT Kid-KO BM) and (KO Kid-KO BM). Original magnifications X 200. Wildtype = WT, SerpinB2-/- = KO. Values are given as means

±SEMs. Two-way ANOVA with Bonferroni‘s multiple comparison test. *P<0.05,

**P<0.01, *** P<0.001

FigS1

F4/80

Live/Dead

SSC CD11c

CD45.2 FSC-A CD11b MHCII

MHCII CD206 FigS2 A B C D E control young young

Senes old old

young

Ki67 γH2AX DAPI SerpinB2 SerpinB2 p21 DAPI

F G H I Con Con

UUO UUO

SerpinB2 p21 DAPI SerpinB2 Ki67 DAPI

FigS3

A aged mice B C e 8 14days UUO

a h

c *** WT 6

d KO

A 4 N

R * **

e 2

a l

e 0 R C Ngal Fn1 αSma

D E F G e 8 e 14days g 6 3 days g

n 7 days

n a

WT a WT h

h KO c

c * KO

6 ***

d l

l 4

* A

4 A

N R

* R m

m 2

2 e

l e 0 e

R 0 R Ngal Fn1 αSma Ngal Fn1 αSma D FigS4

A B C

e 8

g n

a 14 days WT

h c

6 KO

o f ** A 4

N *

e 2

a l

e 0 R Ngal Fn1 αSma D E

WT WT WT )

a e

r 14 days

10 *

(

n days

i **

KO KO KO a

14 14 s

s o P 0 PRed FN1 αSMA PRed FN1FN αSMA FigS5 WT IR 6 1×10 KO IR B C D WT CON A KO CON * 5 6 y 8×10

4×10 e

n * y

* d e 3×106 i 5 n 6×10

K **

K /

6 l l

+ 2×10 5

e 4×105

c i D 6

1×10 h

C 1 r 2×105 0 G s s s y y y a a a d d d 3 7 0 4 R R 1 days days I I R I s s s s y y y y a a a a d d d d 3 7 4 1 1 2 E F G IR IR IR IR 14days FigS6

A B C 1.5×10-3 D d

400 l 100

i e

f *

*** /

v **

e M

l 80

300 -3 D

A 1.0×10

l B

2 60

/ m

200 e

e C

p 40 a

v -4 i

5.0×10 v

I l

100 f

e 20

. o

0 0.0 N 0 WTKO n A o A N A N R N C R i R i s i s n s o 2 l2 l c C c C C WT E * F * WT WT 800600 * KO 600 KO KO

* * l

l 600

m m

/ 400

C 400

L C

C 200 200 C C 200

0 00

s ss ss s s s y yy yy sy y y a aa aa ya a a d d d ad d d d d D 3 7 4 3 3 7 7 4 1 41 O O IRO IRO 1 O U U O U U U U IUR U U U U U FigS7

BMDM - in vitro LC Experimentes - in vivo

A B *** C e

g 2.0 4×106 ***

n WT

a y

h KO

1.5 n 6 d

d 3×10

A l

1.0 l 6 N

e 2×10

5 e

0.5 4 6

v 1×10

a l e 0.0 R 0 Ccl2 Ccr2 Veh LC

FigS8

) 20 a

A e * WT Kid-WT BM

) 20 15 KO Kid-WT BM

e WT Kid-WT BM * WT Kid-KO BM

* %

(

a KO Kid-KO BM

n f KO Kid-WT BM i 10

15 a

WT Kid-KO BM s

( v KO Kid-KO BM

i 5

n i

i 10

P s

e PRed FN1 αSMA v

i 5 B

i s

o WT Kid-WT BM KO Kid- WT BM WT Kid- KO BM KO Kid- KO BM

P 0

PRed FN1 αSMA

PRed

FN1

SMA