Mechanisms of Yki-Mediated Transcriptional Regulation of the Hippo Signaling Pathway

Mechanisms of Yki-mediated transcriptional regulation of the Hippo signaling pathway

by Yun Qing

A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy

Baltimore, Maryland

August, 2016

Abstract

The Hippo signaling pathway is a conserved pathway in regulating organ size.

Deregulation of the pathway also exerts crucial effects on cancer development. In

Drosophila, the Hippo pathway restricts tissue growth by inactivating transcriptional coactivator Yorkie (Yki). However, how Yki activates target gene transcription and the full scope of target genes are poorly understood. Here, I identified two sets of proteins involved in regulating Yki-mediated transcription and explored Yki target genes.

Firstly, Nuclear receptor coactivator 6 (Ncoa6), a subunit of the Trithorax-related (Trr) histone H3 lysine 4 (H3K4) methyltransferase complex, was identified as a Yki interacting-protein. Ncoa6 and Trr are required for normal tissue growth and expression of Yki target genes. Strikingly, artificial tethering of Ncoa6 to Scalloped (Sd) promotes tissue growth and Yki target expression even in the absence of Yki, underscoring the importance of Yki-mediated recruitment of Ncoa6 in transcriptional activation. To further examine the functional conservation of Ncoa6 in regulating the Hippo pathway, we generated the liver-specific Ncoa6 knockout mice to explore whether Ncoa6 inactivation will suppress the mutation of upstream tumor suppressors.

In addition to the Ncoa6-mediated recruitment of the H3K4 methyltransferase, two subunits of the mediator complex, Med13 (skd) and Med12 (kto), may also play important roles in the Yki-mediated transcriptional regulation of the Hippo pathway.

Both Med13 and Med12 interact with Yki. They are also functionally required for Hippo- mediated growth control and target gene expression.

To fully understand the target genes of the Hippo pathway, I identified Yki target genes in Drosophila S2 cells at the genome-wide level. By performing RNA-seq with RNAi knockdown of Yki, I discovered genes whose expression is down-regulated by Yki. A list of target genes was then uncovered by integrating the RNA-seq and previous published

ChIP-Seq data.

These findings shed light on Yki-mediated transcriptional regulation and uncovered a potential link between chromatin modification, mediator subunit functions, and tissue growth. The list of target genes might imply novel functions of the Hippo pathway.

Taken together, given the significant role of the Hippo pathway in cancer biology, the novel mechanisms discovered here may provide important implications for cancer therapy.

iii

Ph.D. DISSERTATION REFEREES FOR YUN QING

Duojia (DJ) Pan, Ph.D.

Bashour Distinguished Professor and Chair

Department of Physiology

Howard Hughes Medical Institute

UT Southwestern Medical Center

[Faculty sponsor and reader]

Sean Taverna, Ph.D.

Associate professor

Department of Pharmacology and Molecular Sciences

and the Center for Epigenetics

Johns Hopkins University School of Medicine

Baltimore, MD 21205

[Reader]

Table of Contents

Abstract ...... ii Table of Contents ...... v List of Tables ...... vi List of Figures ...... vii Chapter 1. Introduction ...... 1 Hippo signaling in Drosophila and mammalian system: components and regulation .... 2 Transcriptional regulation of the Hippo pathway: partners, targets, and mechanisms ... 3 Yki/YAP/TAZ in cancer: mouse models, human cancers, and targeting strategies ...... 6 References ...... 9 Chapter 2. The Hippo effector Yorkie activates transcription by interacting with a histone methyltransferase complex through Ncoa6 ...... 19 Introduction ...... 20 Materials and methods ...... 22 Results and Discussion ...... 25 Figures ...... 32 References ...... 48 Chapter 3. The Hippo effector Yorkie activates target gene transcription through Med13 and Med12 ...... 53 Introduction ...... 54 Materials and methods ...... 56 Results and discussions ...... 58 Figures ...... 63 References ...... 75 Chapter 4. Discovery of Yki target genes by integrating RNA-seq and ChIP-seq in Drosophila S2 cells ...... 81 Introduction ...... 82 Materials and Methods ...... 83 Results and discussions ...... 86 Figures ...... 89 References ...... 93 CURRICULUM VITAE ...... 95

List of Tables

Table.4.1. List of Yki binding genes that are down-regulated when Yki is depleted ..... 91

List of Figures

Chapter 2 Fig. 2.1. Identification of Ncoa6 as a positive regulator of the HRE activity from cell- based RNAi screen…...... 32 Fig. 2.2. Ncoa6 physically interacts with Yki and regulates HRE activity ...……...... 34 Fig. 2.3. Ncoa6 and Trr are required for normal tissue growth and expression of Hippo target genes in Drosophila imaginal discs...... 36 Fig. 2.4. Genetic interactions between Ncoa6-Trr and the Hippo pathway...... 38 Fig. 2.5. Ncoa6 and Trr are required for Hippo-mediated target gene expression...... 40 Fig. 2.6. Fusion of Ncoa6 with the DNA binding domain of Sd bypasses Yki to stimulate Hippo target gene and tissue growth...... 42 Fig. 2.7. Ncoa6, but not Yki, regulates global levels of H3K4 methylation...... 44 Fig. 2.8. Yki modulates local H3K4 methylation at Hippo target genes...... 46

Chapter 3 Fig. 3.1. skd and kto physically interact with Yki; skd regulates HRE activity...... 63 Fig. 3.2. skd is required for normal tissue growth and expression of Hippo target genes in Drosophila imaginal discs...... 65 Fig. 3.3. skd regulates tissue growth in the eye and genetically interacts with Hippo pathway...... 67 Fig. 3.4. kto is required for normal tissue growth and expression of Hippo target genes in Drosophila imaginal discs...... 69 Fig. 3.5. skd and kto are required for Hippo-mediated target gene expression...... 71 Fig. 3.6. RNAi knockdown of Cdk8 or CycC does not change the expression of the Hippo target gene diap1...... 73

Chapter 4 Fig. 4.1. RNA-seq analysis of gene expression changes in Drosophila S2 cells followed by depletion of Yki …………………………...... …………………..……………. 89

vii

Chapter 1

Introduction

One of the fundamental questions in biology is how organ size is properly regulated.

Why does mouse liver start to grow to its original size when part of it is removed? How is the growth of Drosophila organs like the wing stopped after a certain size is achieved?

The answers of the molecular mechanisms to these questions are still largely unknown.

The fruit fly Drosophila, a model organism that is relatively simple and easy to manipulate, has been used to approach mechanistic questions of how organ size is controlled. By undertaking genetic screens, researchers have discovered mutants that showed abnormal organ growth and tumor phenotypes (tumor suppressors). Some of these mutants were then mapped to an important biochemical pathway, the Hippo signaling pathway.

Hippo signaling in Drosophila and mammalian system: components and regulation

The Hippo signaling pathway is characterized by a central kinase cascade formed by four upstream tumor suppressors: Ste20-like kinase Hpo (Harvey et al., 2003; Jia et al., 2003;

Pantalacci et al., 2003; Udan et al., 2003; Wu et al., 2003), the WW-domain-containing protein Salvador (Sav) (Kango-Singh et al., 2002; Tapon et al., 2002), the NDR family kinase Warts (Wts) (Justice et al., 1995; Xu et al., 1995), and the adaptor protein Mob-as- tumor-suppressor (Mats) (Lai et al., 2005). Hpo, when bound to Sav, phosphorylates and activates Wts (Wu et al., 2003). Facilitated by Mats, Wts phosphorylates and inactivates the transcriptional coactivator Yorkie (Yki) (Huang et al., 2005). When phosphorylated by Wts, Yki binds to the 14-3-3 proteins and translocates from the nucleus to the cytoplasm (Dong et al., 2007; Oh and Irvine, 2008; Zhao et al., 2007). The regulatory components in the upstream of pathway also include the following proteins: the cell-

2 cortex complex of Merlin (Mer), Expanded (Ex), and Kibra (Genevet et al., 2010b); the cell polarity proteins Fat, Dachsous, Crumbs and Scribble; proteins that transduces mechanical cues such as spectrin (Deng et al., 2015) and F-actin (reviewed by Yu et al.,

2015).

The Hippo signaling pathway is highly conserved from Drosophila to mammals. In mammals, the corresponding orthologs of the Drosophila Hpo, Sav, Wts, and Mats are

Mammalian sterile 20-like 1/2 (Mst1 and Mst 2), Salvador (Sav1), Large tumor suppressor homolog 1/2 (Lats1 and Lats2), and MOB kinase activator 1A/B (MOB1A and MOB1B). The core kinase cascade formed by the above four proteins phosphorylates and inactivates the mammalian Yki orthologs Yes-associated protein (YAP) (Dong et al.,

2007; Zhao et al., 2007) and transcriptional co-activator with PDZ binding motif (TAZ)

(Lei et al., 2008). There are multiple mammalian orthologs of the upstream regulatory proteins, including the Neurofibromatosis 2 (Nf2) (Benhamouche et al., 2010; Zhang et al., 2010), the mammalian counterpart of Mer. Originally discovered in the mammalian system without cues from the Drosophila research, soluble ligands act through G-Protein

Coupled Receptors (GPCR) and Rho GTPases to enhance YAP/TAZ nuclear localization and increase transcriptional activities (Yu et al., 2012).

Transcriptional regulation of the Hippo pathway: partners, targets, and mechanisms

Yki, the core transcriptional co-activator, is required for normal tissue growth and overexpression of Yki results in massive tissue overgrowth phenotype (Huang et al.,

2005). Yki interacts with the key partner, DNA-binding transcription factor Scalloped

(Sd), to regulate the transcription of the Hippo pathway (Goulev et al., 2008; Wu et al.,

2008; Zhang et al., 2008a; Zhao et al., 2008). The transcriptional activity of Yki is regulated by the Tondu-domain-containing growth inhibitor (Tgi), which competes with

Yki for Sd binding, resulting in transcription repression (Guo et al., 2013; Koontz et al.,

2013).

In mammalian system, liver-specific transgenic overexpression of YAP results in strongly enlarged mouse liver (Camargo et al., 2007; Dong et al., 2007). Similar to their

Drosophila counterpart, TEAD family transcription factors (TEAD1–4), the mammalian orthologs of Sd, are critical partners of YAP/TAZ for transcriptional regulation (Chan et al., 2009; Ota and Sasaki, 2008; Zhang et al., 2009; Zhao et al., 2008). Vestigial-like family member 4 (Vgl4), one of the four mammalian orthologs of Tgi, competes with

YAP/TAZ for TEAD binding (Jiao et al., 2014; Zhang et al., 2014), suppressing the

YAP-induced tissue overgrowth (Koontz et al., 2013).

The downstream mechanisms by which Yki/YAP/TAZ activate target gene expression are still largely unknown. Here, I will first introduce the mechanisms of general transcription regulation and then the ones related to the Hippo pathway.

In eukaryotes, transcription regulation happens at minimally two intertwined levels: one level relates to transcription factors and transcription cofactors, and the other involves chromatin and its regulators (Lee and Young, 2013). The following paragraphs describe the steps in transcription regulation for the above two levels (Fuda et al., 2009).

Transcription factors typically first bind to the specific DNA elements and recruit the general transcription factors (GTF) and transcription coactivator, facilitating the binding

4 of the RNA polymerase II (Pol II) and preinitiation complex (PIC) formation. Pol II then begins to transcribe 20-50bp RNAs and pauses, and the RNA polymerase complex may escape from pausing, transiting to active elongation. After productive elongation, transcription is terminated, and the RNA of the gene is released.

The relationship between transcription and chromatin occurs at two levels. First, the basic unit of chromatin, the nucleosome, is regulated by ATP-dependent chromatin remodeling complex. For example, SWI/SNF family complexes mobilize nucleosomes, facilitating the access of the transcription apparatus to DNA. Second, the histone-modifying enzymes, including acetyltransferases, methyltransferases, and others, add or remove chemical groups on histones. This leads to changes in the compaction of DNA, which prevents or enhances binding of transcriptional factors to DNA.

Recent advances show that Yki interacts with GAGA factors (which may influence chromatin structure) and Brahma complex (one of the Drosophila SWI/SNF complexes) to regulate the transcription (Jin et al., 2013; Oh et al., 2013). YAP interacts with promoters (Lian et al., 2010) and distal enhancers (Galli et al., 2015; Stein et al., 2015;

Zanconato et al., 2015) to regulate target gene expression, through mechanisms of modulating chromatin looping and Pol II pausing release.

It is the effects of Yki/YAP/TAZ target genes that lead to the phenotypes related to the

Hippo pathway, underscoring the importance of the target genes in addition to the above binding partners of Yki/YAP/TAZ. In Drosophila, there are several classes of target genes of Yki: genes that regulate cell proliferation or survival like cyclin E and (Tapon et al., 2002) and diap1 (Wu et al., 2003); the upstream regulators of the Hippo signaling

5 pathway such as ex, kibra and Fj (Cho et al., 2006; Genevet et al., 2010b; Hamaratoglu et al., 2006); genes like E-Cadherin (Genevet et al., 2009) that represent potential cross- talks to other biological processes or signaling pathways. Another interesting example for the last class of genes is the recent identification of Cactus (Cact) as a direct target of Yki, which revealed an intriguing link between the Hippo pathway and innate immunity (Liu et al., 2016).

Yki/YAP/TAZ in cancer: mouse models, human cancers, and targeting strategies

In addition to the overgrowth phenotype, transgenic YAP overexpression in liver eventually results in cell transformation and development of hepatocellular carcinoma

(HCC), a liver cancer subtype arising from hepatocytes (Dong et al., 2007). Inactivation of upstream components like NF2/Mer (Benhamouche et al., 2010; Zhang et al., 2010) ,

Mst1/2 (Lu et al., 2010) or Sav1 (Lu et al., 2010) leads to similar phenotypes of HCC and bile duct tumors in mouse liver.

In addition to the mouse model in liver, multiple other mouse models have been employed to modulate the Hippo pathway components (reviewed by Yu et al., 2015), supporting the role of YAP/TAZ and upstream components as oncogenes and tumor suppressors, respectively. In human, few genetic alterations of the Hippo pathway have been discovered, including the well-characterized NF2/Mer mutation that leads to the

Neurofibromatosis 2. YAP/TAZ is highly expressed in the nucleus in multiple cancer types including the lung, breast, colon, liver, pancreas, ovary and many others. The elevated YAP/TAZ expression is associated with worse prognostic of patients of many cancer types, and the loss-of-function YAP/TAZ phenotypes include the impaired growth

6 of tumor cell lines and their xenografts (reviewed by Zanconato et al., 2016). Fusion of

YAP/TAZ with other genes has also been discovered in cancers, such as Epithelial hemangio-endothelioma (EHE) (Errani et al., 2011; Tanas et al., 2016; Zhang et al., 2009) and a subset of ependymal tumors (Pajtler et al., 2015; Parker et al., 2014). While

YAP/TAZ is prevailingly viewed as an oncogene, there are some pieces of evidence supporting YAP as a tumor suppressor in certain contexts like breast cancer (Yuan et al.,

2008) and multiple myeloma (Cottini et al., 2014). Interestingly, a missense mutation in

YAP (R331W) has been identified as a germline risk allele in lung adenocarcinomas with high incidence (Chen et al., 2015; Pan, 2015). High YAP/TAZ activity is also associated with drug resistance, including resistance to taxol, 5-fluorouracil, and doxorubicin, and

RAF- and MEK-targeted therapies (Cordenonsi et al., 2011; Lai et al., 2011; Lin et al.,

2015; Touil et al., 2014), and cancer relapse like the one in KRAS-driven colon and pancreatic cancers (Kapoor et al., 2014; Shao et al., 2014).

The above evidence suggests that Hippo pathway is an emerging and important target for cancer therapeutics. There are several ways to target the Hippo signaling pathway in cancers. Firstly, the interaction between YAP/Yki and TEAD/Sd can be inhibited. For instance, using small molecules like the FDA-approved drug verteporfin (VP), the transcription induced by YAP/TAZ and the YAP-overexpression induced liver overgrowth were successfully blocked (Liu-Chittenden et al., 2012). The YAP-TEAD interaction can also be abolished by using the peptide mimic of a YAP fragment that is critical for the interaction (Zhou et al., 2015), or a polypeptide mimicking Vgl4 that competes with YAP for binding to TEADs and suppresses tumor growth in gastric cancer mouse models (Jiao et al., 2014). Secondly, the YAP/TAZ phosphorylation can be

7 targeted, by inducing the LATS1/2 kinase activity directly or targeting the upstream signals like GPCR. Thirdly, the YAP/TAZ degradation can be induced (Guan et al.,

2013). Last but not least, disrupting other transcriptional mechanisms such as crucial target genes regulated by Yki/YAP/TAZ is also a potential targeting strategy.

Therefore, discovering the Yki-mediated transcriptional mechanisms is not only relevant to the understanding of the basic biology of the Hippo pathway, but also provides important implications for the development of cancer therapeutics.

Here, I discovered how two sets of Yki binding partners contribute to Yki-mediated transcription: the Nuclear receptor coactivator 6 (Ncoa6), a subunit of the Trithorax- related (Trr) histone H3 lysine 4 (H3K4) methyltransferase complexes; the Mediator complex subunit 13 (Med13) and Mediator complex subunit 12 (Med12). I also explored

Yki target genes by integrating RNA-seq and ChIP-seq in Drosophila S2 cells.

References

Benhamouche, S., Curto, M., Saotome, I., Gladden, A.B., Liu, C.H., Giovannini, M., and

McClatchey, A.I. (2010). Nf2/Merlin controls progenitor homeostasis and tumorigenesis in the liver. Genes Dev 24, 1718-1730.

Camargo, F.D., Gokhale, S., Johnnidis, J.B., Fu, D., Bell, G.W., Jaenisch, R., and

Brummelkamp, T.R. (2007). YAP1 increases organ size and expands undifferentiated progenitor cells. Curr Biol 17, 2054-2060.

Chan, S.W., Lim, C.J., Loo, L.S., Chong, Y.F., Huang, C., and Hong, W. (2009). TEADs mediate nuclear retention of TAZ to promote oncogenic transformation. J Biol Chem 284,

14347-14358.

Chen, H.Y., Yu, S.L., Ho, B.C., Su, K.Y., Hsu, Y.C., Chang, C.S., Li, Y.C., Yang, S.Y.,

Hsu, P.Y., Ho, H., et al. (2015). R331W Missense Mutation of Oncogene YAP1 Is a

Germline Risk Allele for Lung Adenocarcinoma With Medical Actionability. J Clin

Oncol 33, 2303-U2128.

Cho, E., Feng, Y., Rauskolb, C., Maitra, S., Fehon, R., and Irvine, K.D. (2006).

Delineation of a Fat tumor suppressor pathway. Nat Genet 38, 1142-1150.

Cordenonsi, M., Zanconato, F., Azzolin, L., Forcato, M., Rosato, A., Frasson, C., Inui,

M., Montagner, M., Parenti, A.R., Poletti, A., et al. (2011). The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell 147, 759-772.

Cottini, F., Hideshima, T., Xu, C., Sattler, M., Dori, M., Agnelli, L., ten Hacken, E.,

Bertilaccio, M.T., Antonini, E., Neri, A., et al. (2014). Rescue of Hippo coactivator

YAP1 triggers DNA damage-induced apoptosis in hematological cancers. Nat Med 20,

599-606.

Deng, H., Wang, W., Yu, J.Z., Zheng, Y.G., Qing, Y., and Pan, D.J. (2015). Spectrin regulates Hippo signaling by modulating cortical actomyosin activity. Elife 4.

Dong, J., Feldmann, G., Huang, J., Wu, S., Zhang, N., Comerford, S.A., Gayyed, M.F.,

Anders, R.A., Maitra, A., and Pan, D. (2007). Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 130, 1120-1133.

Errani, C., Zhang, L., Sung, Y.S., Hajdu, M., Singer, S., Maki, R.G., Healey, J.H., and

Antonescu, C.R. (2011). A Novel WWTR1-CAMTA1 Gene Fusion Is a Consistent

Abnormality in Epithelioid Hemangioendothelioma of Different Anatomic Sites. Gene

Chromosome Canc 50, 644-653.

Fuda, N.J., Ardehali, M.B., and Lis, J.T. (2009). Defining mechanisms that regulate RNA polymerase II transcription in vivo. Nature 461, 186-192.

Galli, G.G., Carrara, M., Yuan, W.C., Valdes-Quezada, C., Gurung, B., Pepe-Mooney, B.,

Zhang, T.H., Geeven, G., Gray, N.S., de Laat, W., et al. (2015). YAP Drives Growth by

Controlling Transcriptional Pause Release from Dynamic Enhancers. Mol Cell 60, 328-

337.

Genevet, A., Polesello, C., Blight, K., Robertson, F., Collinson, L.M., Pichaud, F., and

Tapon, N. (2009). The Hippo pathway regulates apical-domain size independently of its growth-control function. J Cell Sci 122, 2360-2370.

Genevet, A., Wehr, M.C., Brain, R., Thompson, B.J., and Tapon, N. (2010b). Kibra is a regulator of the Salvador/Warts/Hippo signaling network. Dev Cell 18, 300-308.

Goulev, Y., Fauny, J.D., Gonzalez-Marti, B., Flagiello, D., Silber, J., and Zider, A.

(2008). SCALLOPED interacts with YORKIE, the nuclear effector of the hippo tumor- suppressor pathway in Drosophila. Curr Biol 18, 435-441.

Guan, K.L., YU, F., and Ding, S. (2013). Inhibitors of hippo-yap signaling pathway

(Google Patents).

Guo, T., Lu, Y., Li, P., Yin, M.X., Lv, D., Zhang, W., Wang, H., Zhou, Z., Ji, H., Zhao,

Y., et al. (2013). A novel partner of Scalloped regulates Hippo signaling via antagonizing

Scalloped-Yorkie activity. Cell Res 23, 1201-1214.

Hamaratoglu, F., Willecke, M., Kango-Singh, M., Nolo, R., Hyun, E., Tao, C.Y., Jafar-

Nejad, H., and Halder, G. (2006). The tumour-suppressor genes NF2/Merlin and

Expanded act through Hippo signalling to regulate cell proliferation and apoptosis.

Nature Cell Biology 8, 27-U29.

Harvey, K.F., Pfleger, C.M., and Hariharan, I.K. (2003). The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis. Cell 114, 457-467.

Huang, J., Wu, S., Barrera, J., Matthews, K., and Pan, D. (2005). The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila Homolog of YAP. Cell 122, 421-434.

Jia, J.H., Zhang, W.S., Wang, B., Trinko, R., and Jiang, J. (2003). The Drosophila Ste20 family kinase dMST functions as a tumor suppressor by restricting cell proliferation and promoting apoptosis. Genes & Development 17, 2514-2519.

Jiao, S., Wang, H.Z., Shi, Z.B., Dong, A.M., Zhang, W.J., Song, X.M., He, F., Wang,

Y.C., Zhang, Z.Z., Wang, W.J., et al. (2014). A Peptide Mimicking VGLL4 Function

Acts as a YAP Antagonist Therapy against Gastric Cancer (vol 25, pg 166, 2014). Cancer

Cell 25, 406-406.

Jin, Y.Y., Xu, J.J., Yin, M.X., Lu, Y., Hu, L.X., Li, P.X., Zhang, P., Yuan, Z.Q., Ho,

M.S., Ji, H.B., et al. (2013). Brahma is essential for Drosophila intestinal stem cell proliferation and regulated by Hippo signaling. Elife 2.

Justice, R.W., Zilian, O., Woods, D.F., Noll, M., and Bryant, P.J. (1995). The Drosophila

Tumor-Suppressor Gene Warts Encodes a Homolog of Human Myotonic-Dystrophy

Kinase and Is Required for the Control of Cell-Shape and Proliferation. Genes &

Development 9, 534-546.

Kango-Singh, M., Nolo, R., Tao, C., Verstreken, P., Hiesinger, P.R., Bellen, H.J., and

Halder, G. (2002). Shar-pei mediates cell proliferation arrest during imaginal disc growth in Drosophila. Development 129, 5719-5730.

Kapoor, A., Yao, W., Ying, H., Hua, S., Liewen, A., Wang, Q., Zhong, Y., Wu, C.J.,

Sadanandam, A., Hu, B., et al. (2014). Yap1 activation enables bypass of oncogenic Kras addiction in pancreatic cancer. Cell 158, 185-197.

Koontz, L.M., Liu-Chittenden, Y., Yin, F., Zheng, Y., Yu, J., Huang, B., Chen, Q., Wu,

S., and Pan, D. (2013). The Hippo effector Yorkie controls normal tissue growth by antagonizing scalloped-mediated default repression. Dev Cell 25, 388-401.

Lai, D., Ho, K.C., Hao, Y., and Yang, X. (2011). Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. Cancer Res 71, 2728-2738.

Lai, Z.C., Wei, X.M., Shimizu, T., Ramos, E., Rohrbaugh, M., Nikolaidis, N., Ho, L.L., and Li, Y. (2005). Control of cell proliferation and apoptosis by Mob as tumor suppressor,

Mats. Cell 120, 675-685.

Lee, T.I., and Young, R.A. (2013). Transcriptional regulation and its misregulation in disease. Cell 152, 1237-1251.

Lei, Q.Y., Zhang, H., Zhao, B., Zha, Z.Y., Bai, F., Pei, X.H., Zhao, S., Xiong, Y., and

Guan, K.L. (2008). TAZ promotes cell proliferation and epithelial-mesenchymal transition and is inhibited by the hippo pathway. Mol Cell Biol 28, 2426-2436.

Lian, I., Kim, J., Okazawa, H., Zhao, J.G., Zhao, B., Yu, J.D., Chinnaiyan, A., Israel,

M.A., Goldstein, L.S.B., Abujarour, R., et al. (2010). The role of YAP transcription coactivator in regulating stem cell self-renewal and differentiation. Genes &

Development 24, 1106-1118.

Lin, L., Sabnis, A.J., Chan, E., Olivas, V., Cade, L., Pazarentzos, E., Asthana, S., Neel,

D., Yan, J.J., Lu, X., et al. (2015). The Hippo effector YAP promotes resistance to RAF- and MEK-targeted cancer therapies. Nat Genet 47, 250-256.

Liu-Chittenden, Y., Huang, B., Shim, J.S., Chen, Q., Lee, S.J., Anders, R.A., Liu, J.O., and Pan, D.J. (2012). Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes & Development 26, 1300-

1305.

Liu, B., Zheng, Y.G., Yin, F., Yu, J.Z., Silverman, N., and Pan, D.J. (2016). Toll

Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila. Cell 164,

406-419.

Lu, L., Li, Y., Kim, S.M., Bossuyt, W., Liu, P., Qiu, Q., Wang, Y.D., Halder, G.,

Finegold, M.J., Lee, J.S., et al. (2010). Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. P Natl Acad Sci USA 107, 1437-1442.

Oh, H., and Irvine, K.D. (2008). In vivo regulation of Yorkie phosphorylation and localization. Development 135, 1081-1088.

Oh, H., Slattery, M., Ma, L., Crofts, A., White, K.P., Mann, R.S., and Irvine, K.D. (2013).

Genome-wide association of Yorkie with chromatin and chromatin-remodeling complexes. Cell Rep 3, 309-318.

Ota, M., and Sasaki, H. (2008). Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development 135,

4059-4069.

Pajtler, K.W., Witt, H., Sill, M., Jones, D.T.W., Hovestadt, V., Kratochwil, F., Wani, K.,

Tatevossian, R., Punchihewa, C., Johann, P., et al. (2015). Molecular Classification of

Ependymal Tumors across All CNS Compartments, Histopathological Grades, and Age

Groups. Cancer Cell 27, 728-743.

Pan, D.J. (2015). YAPing Hippo Forecasts a New Target for Lung Cancer Prevention and

Treatment. J Clin Oncol 33, 2311-2313.

Pantalacci, S., Tapon, N., and Leopold, P. (2003). The Salvador partner Hippo promotes apoptosis and cell-cycle exit in Drosophila. Nature Cell Biology 5, 921-927.

Parker, M., Mohankumar, K.M., Punchihewa, C., Weinlich, R., Dalton, J.D., Li, Y., Lee,

R., Tatevossian, R.G., Phoenix, T.N., Thiruvenkatam, R., et al. (2014). C11orf95-RELA fusions drive oncogenic NF-kappaB signalling in ependymoma. Nature 506, 451-455.

Shao, D.D., Xue, W., Krall, E.B., Bhutkar, A., Piccioni, F., Wang, X., Schinzel, A.C.,

Sood, S., Rosenbluh, J., Kim, J.W., et al. (2014). KRAS and YAP1 converge to regulate

EMT and tumor survival. Cell 158, 171-184.

Stein, C., Bardet, A.F., Roma, G., Bergling, S., Clay, I., Ruchti, A., Agarinis, C.,

Schmelzle, T., Bouwmeester, T., Schubeler, D., et al. (2015). YAP1 Exerts Its

Transcriptional Control via TEAD-Mediated Activation of Enhancers. Plos Genet 11.

Tanas, M.R., Ma, S., Jadaan, F.O., Ng, C.K.Y., Weigelt, B., Reis-Filho, J.S., and Rubin,

B.P. (2016). Mechanism of action of a WWTR1(TAZ)-CAMTA1 fusion oncoprotein.

Oncogene 35, 929-938.

Tapon, N., Harvey, K.F., Bell, D.W., Wahrer, D.C.R., Schiripo, T.A., Haber, D.A., and

Hariharan, I.K. (2002). salvador promotes both cell cycle exit and apoptosis in

Drosophila and is mutated in human cancer cell lines. Cell 110, 467-478.

Touil, Y., Igoudjil, W., Corvaisier, M., Dessein, A.F., Vandomme, J., Monte, D., Stechly,

L., Skrypek, N., Langlois, C., Grard, G., et al. (2014). Colon cancer cells escape 5FU chemotherapy-induced cell death by entering stemness and quiescence associated with the c-Yes/YAP axis. Clin Cancer Res 20, 837-846.

Udan, R.S., Kango-Singh, M., Nolo, R., Tao, C.Y., and Halder, G. (2003). Hippo promotes proliferation arrest and apoptosis in the Salvador/Warts pathway. Nature Cell

Biology 5, 914-920.

Wu, S., Huang, J., Dong, J., and Pan, D. (2003). hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts. Cell 114, 445-456.

Wu, S., Liu, Y., Zheng, Y., Dong, J., and Pan, D. (2008). The TEAD/TEF family protein

Scalloped mediates transcriptional output of the Hippo growth-regulatory pathway. Dev

Cell 14, 388-398.

Xu, T.A., Wang, W.Y., Zhang, S., Stewart, R.A., and Yu, W. (1995). Identifying Tumor

Suppressors in Genetic Mosaics - the Drosophila Lats Gene Encodes a Putative Protein-

Kinase. Development 121, 1053-1063.

Yu, F.X., Zhao, B., and Guan, K.L. (2015a). Hippo Pathway in Organ Size Control,

Tissue Homeostasis, and Cancer. Cell 163, 811-828.

Yu, F.X., Zhao, B., Panupinthu, N., Jewell, J.L., Lian, I., Wang, L.H., Zhao, J., Yuan, H.,

Tumaneng, K., Li, H., et al. (2012). Regulation of the Hippo-YAP pathway by G-protein- coupled receptor signaling. Cell 150, 780-791.

Yuan, M., Tomlinson, V., Lara, R., Holliday, D., Chelala, C., Harada, T., Gangeswaran,

R., Manson-Bishop, C., Smith, P., Danovi, S.A., et al. (2008). Yes-associated protein

(YAP) functions as a tumor suppressor in breast. Cell Death Differ 15, 1752-1759.

Zanconato, F., Cordenonsi, M., and Piccolo, S. (2016). YAP/TAZ at the Roots of Cancer.

Cancer Cell 29, 783-803.

Zanconato, F., Forcato, M., Battilana, G., Azzolin, L., Quaranta, E., Bodega, B., Rosato,

A., Bicciato, S., Cordenonsi, M., and Piccolo, S. (2015). Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers drives oncogenic growth. Nature Cell

Biology 17, 1218-+.

Zhang, H., Liu, C.Y., Zha, Z.Y., Zhao, B., Yao, J., Zhao, S., Xiong, Y., Lei, Q.Y., and

Guan, K.L. (2009). TEAD transcription factors mediate the function of TAZ in cell growth and epithelial-mesenchymal transition. J Biol Chem 284, 13355-13362.

Zhang, L., Ren, F., Zhang, Q., Chen, Y., Wang, B., and Jiang, J. (2008a). The

TEAD/TEF family of transcription factor Scalloped mediates Hippo signaling in organ size control. Dev Cell 14, 377-387.

Zhang, N.L., Bai, H.B., David, K.K., Dong, J.X., Zheng, Y.G., Cai, J., Giovannini, M.,

Liu, P.T., Anders, R.A., and Pan, D.J. (2010). The Merlin/NF2 Tumor Suppressor

Functions through the YAP Oncoprotein to Regulate Tissue Homeostasis in Mammals.

Developmental Cell 19, 27-38.

Zhang, W.J., Gao, Y.J., Li, P.X., Shi, Z.B., Guo, T., Li, F., Han, X.K., Feng, Y., Zheng,

C., Wang, Z.Y., et al. (2014). VGLL4 functions as a new tumor suppressor in lung cancer

17 by negatively regulating the YAP-TEAD transcriptional complex. Cell Research 24, 331-

343.

Zhao, B., Wei, X., Li, W., Udan, R.S., Yang, Q., Kim, J., Xie, J., Ikenoue, T., Yu, J., Li,

L., et al. (2007). Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes & Development 21, 2747-2761.

Zhao, B., Ye, X., Yu, J., Li, L., Li, W., Li, S., Lin, J.D., Wang, C.Y., Chinnaiyan, A.M.,

Lai, Z.C., et al. (2008). TEAD mediates YAP-dependent gene induction and growth control. Genes Dev 22, 1962-1971.

Zhou, Z., Hu, T.S., Xu, Z.H., Lin, Z.H., Zhang, Z.S., Feng, T., Zhu, L.C., Rong, Y.P.,

Shen, H., Luk, J.M., et al. (2015). Targeting Hippo pathway by specific interruption of

YAP-TEAD interaction using cyclic YAP-like peptides. Faseb J 29, 724-732.

Chapter 2

The Hippo effector Yorkie activates transcription by interacting with a histone

methyltransferase complex through Ncoa6

Introduction

The eukaryotic DNA is wrapped around the octamer of histone proteins, including two of each H2A, H2B, H3 and H4 (Kornberg and Lorch, 1999). The protruded histone tails are substrates of multiple modifications, including methylation, acetylation, phosphorylation, ubiquitination, biotinylation, and ADP-ribosylation (Eissenberg and Shilatifard, 2010).

These post-translational modifications of histones are critical features in all eukaryotes.

Among these modifications, histone H3 lysine 4 (H3K4) methylation is a prevalent mark associated with transcriptional activation (Bernstein et al., 2002). There are four possible methylation states on H3K4: mono-, di- and trimethylation, and non-methylated.

Monomethylation of H3K4 (H3K4me1) is predominantly associated with enhancers; dimethylation of H3K4 (H3K4me2) is found at both promoters and enhancers; trimethylation of H3K4 (H3K4me3) is associated with enhancers (Ernst et al., 2011).

Set1 from the yeast S. cerevisiae is the first H3K4 methylase identified; it forms a complex named COMPASS (Complex Proteins Associated with Set1) with other proteins

(Miller et al., 2001). There are three COMPASS-like histone H3K4 methyltransferases in

Drosophila, including dSet1, Trithorax (Trx) and Trithorax-related (Trr) (Mohan et al.,

2011). Previous genetic analysis has suggested potential roles of Trx in the maintenance of Hox gene transcription and Trr in ecdysone receptor (EcR)-mediated gene transcription (Sedkov et al., 2003). Nuclear receptor coactivator 6 (Ncoa6) is a specific subunit of the Trr complex that is shared among Drosophila and mammals (Mohan et al.,

2011). Although the in vivo function of Ncoa6 remains unclear in Drosophila, its mammalian orthologue (also known as NRC, ASC-2, TRBP, PRIP and RAP250) is vital for embryonic development (Antonson et al., 2003; Kuang et al., 2002; Mahajan et al.,

2004; Zhu et al., 2003). The mammalian Ncoa6 could potentiate the activity of nuclear hormone receptors and other DNA-binding transcription factors, at least in part, by recruiting the H3K4 methyltransferases (Mahajan and Samuels, 2008). Interestingly, similar to YAP, the mammalian Ncoa6 is also known to be a pro-survival and anti- apoptotic gene (Mahajan et al., 2004) and is overexpressed in several cancer types such as breast, colon and lung cancers (Lee et al., 1999).

In this chapter, I identify Ncoa6 as a novel Yki-binding protein required for transcriptional regulation by the Hippo signaling pathway. I also demonstrate that Yki needs to interact with Ncoa6 to act as a transcriptional coactivator and that the Trr methyltransferase complex is functionally required for Hippo-mediated growth and gene expression. I further show that Yki, Ncoa6, and Trr are all essential for normal H3K4 methylation at Hippo target genes. In summary, Yki functions as a transcriptional coactivator by recruiting a H3K4 methyltransferase and modifying the chromatin state of target genes.

Materials and methods

Molecular cloning and mutagenesis

A full-length Ncoa6 cDNA corresponding to the BDGP annotated RD transcript was generated from mRNA of Drosophila third instar larvae, using SuperScript(R) III One-

Step RT-PCR System with Platinum Taq High Fidelity (Life Technologies, Carlsbad,

California). Mutations of PPxY motifs were generated in Ncoa6 using the QuikChange II

XL Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA), replacing tyrosine(Y) with alanine (A). Sd DNA binding domain was inserted to the N-terminal of Ncoa6 to generate Sd-Ncoa6. FLAG-tag was inserted to the N-terminal of Ncoa6, Ncoa63m, and

Sd-Ncoa6 and cloned into the attB-UAS vector.

Drosophila genetics

Flies with the following genotypes have been described previously: ykiB5,UAS-Yki

(Huang et al., 2005), hpo42−48 (Wu et al., 2003), fj-lacZ reporter fj9-II (Villano and Katz,

1995), UAS-Sd (Halder et al., 1998), UAS-Wts RNAi (Stock ID VDRC 106174). The

UAS-Ncoa6 RNAi and UAS-trr RNAi lines have been validated previously (Herz et al.,

2012) and were obtained from Bloomington Drosophila Stock Center (Stock ID 34964 and 29563). attB-UAS-Ncoa6 and attB-UAS-FLAG-SdDB-Ncoa6 transgenes were inserted into the 86Fa attP acceptor site by phiC31-mediated site-specific transformation

(Bischof et al., 2007).

For the MARCM experiments in Figure 2.5, the following clones were induced 48–60 hr after egg deposition and heat shocked at 37°C for 15 min:

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/+

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D hpo42−48; Tub-Gal4/+

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/UAS-Ncoa6RNAi

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D hpo42−48; Tub-Gal4/UAS-

Ncoa6RNAi

UAS-Dicer2/UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/UAS-

trrRNAi

UAS-Dicer2/UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D hpo42−48; Tub-

Gal4/UAS-trrRNAi

For the MARCM experiments in Figure 2.6A–D, the following clones were induced 72–

84hr after egg deposition and heat shocked at 37°C for 10 min:

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/+

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D ykiB5; Tub-Gal4/+

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/UAS-SdDB-Ncoa6

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D ykiB5; Tub-Gal4/UAS-SdDB-

Ncoa6

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D ykiB5; Tub-Gal4/UAS-Ncoa6

Drosophila cell culture, transfection, immunoprecipitation, immunofluorescence, and luciferase reporter assay

Drosophila S2R+ cells were cultured in Schneider's Drosophila Medium (Life

Technologies) supplemented with 10% fetal bovine serum and antibiotics. HA-Yki and

HA-YkiWM have been described previously (Huang et al., 2005). Luciferase assay was carried out using Dual Luciferase Assay System (Promega, Madison, WI) and an

FLUOstar Luminometer (BMG LabTechnologies, Germany). Transfection,

23 immunoprecipitation, and immunofluorescence staining of S2R+ cells were performed using standard protocols as described (Yin et al., 2013).

ChIP assays

ChIP assays were performed according to a previously described protocol (Wang et al.,

2009). Briefly, ∼5 × 106 (for ChIP assay with histone methylation antibodies) or 1.5 ×

107 (for CHIP assay with Yki or FLAG antibodies) S2R+ cells were cross-linked with 1% formaldehyde and sonicated to an average fragment size between 200 bp and 500 bp.

Two micrograms of control IgG or specific antibodies, including rabbit ɑ-H3K4me1

(8895, Abcam, England) and rabbit ɑ-H3K4me3 (8580, Abcam), and 50 µl of protein G agarose were used in each ChIP assay. The immunoprecipitated DNA was quantified using real-time PCR. All values were normalized to the input. The primers for analyzing the ChIP samples are provided as follows:

p1 Forward: TGTTCTTGTTGGTGCTGCTT

p1 Reverse: TTAATGCTGGCATGGTTTCA

p2 Forward: TAAAACTGGGGCTCACCTTG

p2 Reverse: TCGTGTTCACGGAAAATCAA

p3 (HRE) Forward: ACGAACACGAAGACCAAA

p3 (HRE) Reverse: CTCCAAGCCAGTTTGATT

p4 Forward: AAAAGAGGGAAGAGGGAGCA

p4 Reverse: GAATCGGAATCGGAACTTGA

p5 Forward: TCGCACTCGCCTCAATTAC

p5 Reverse: CAGCACCAACTTTTCGGAGT

Results and Discussion

We recently reported a genome-wide RNAi screen in Drosophila S2R+ cells using a luciferase reporter driven by a minimal Hippo Responsive Element (HRE) from the

Hippo target gene diap1 (Koontz et al., 2013). Briefly, Drosophila S2R+ cells were transfected with Yki- and Sd-expressing vectors, together with HRE-luciferase reporter and Pol III-Renilla expression vector as an internal control. Transfected cells were then seeded into individual dsRNA-containing 96-well plates. After RNAi depletion, HRE- luciferase reporter activity was measured and normalized to the Renilla control. This

RNAi screen allowed us to uncover both positive and negative regulators of the HRE- luciferase reporter. We have previously characterized a negative regulator from the screen, Tgi (Koontz et al., 2013). Here we focus on the positive transcriptional regulators

(Fig. 2.1.).

One of the positive regulators identified in our primary screen is Nuclear receptor coactivator 6 (Ncoa6), which was confirmed by repeating the RNAi experiment in triplicate using re-synthesized dsRNA (Fig. 2.1.B). Ncoa6 was especially promising because it contains three PPxY motifs (Fig. 2.2.A), which are well-known for interacting with WW domains. I then hypothesized that Ncoa6 might bind to two WW domains in

Yki to potentiate Yki-mediated transcriptional activation. Indeed, this was confirmed by coimmunoprecipitation of epitope-tagged Ncoa6 and Yki in Drosophila S2R+ cells (Fig.

2B). Furthermore, the interaction can be abolished either by mutating the three PPxY motifs in Ncoa6 (Ncoa63m) or the two WW domains in Yki (YkiWM) (Fig. 2.2.B), suggesting that it was mediated by Ncoa6’s PPxY motifs and Yki’s WW domains. In concurrence with this conclusion, I also showed that Ncoa63m failed to promote nuclear

25 translocation of Yki in S2R+ cells in co-transfection assays (Fig. 2.2.C). It is worth noting that recent independent work on Hippo pathway protein-protein interactome listed

Ncoa6 as one of 245 proteins that were co-immunoprecipitated by Yki (Kwon et al.,

2013).

Consistent with the screen results, overexpression of Ncoa6, but not the PPxY mutant

Ncoa63m, significantly enhanced Yki/Sd-mediated HRE reporter activity in Drosophila

S2R+ cells; the enhancement of HRE reporter activity by Ncoa6 was strongly suppressed by co-expression of the kinase Wts (Fig. 2.2.D). These results further combine to support the important role of Ncoa6-Yki interactions in Hippo-responsive transcriptional regulation. Consistent with this notion, chromatin immunoprecipitation (ChIP) uncovered that Ncoa6, similar to Yki, binds to the HRE site in the endogenous diap1 gene locus in

S2R+ cells (Fig. 2.2.E).

Because mutant alleles of Ncoa6 are not accessible, I utilized a previously validated transgenic RNAi line (Herz et al., 2012) to determine the in vivo role of Ncoa6 in tissue growth and Hippo target gene expression. Expression of UAS-Ncoa6 RNAi by the dpp-

Gal4 driver led to a large decrease in the width of the dpp-expression domain in adult wings, which corresponds to the region bordered by vein L3 and L4 (Fig. 2.3.A).

Examination of 3rd instar larval wing imaginal discs showed a corresponding drop in the expression levels of diap1 and four-jointed (fj), which are well described as Hippo pathway target genes (Figs. 2.3.B-C, E-F). These results suggest that Ncoa6 is required for normal tissue growth and expression of Hippo target genes in vivo.

Next, I examined the genetic interactions between Ncoa6 and the Hippo pathway.

Overexpression of Yki or RNAi of Wts by the GMR-Gal4 increased eye size (Fig. 2.4.D and Fig. 2.4.G), which can be suppressed by RNAi knockdown of Ncoa6 (Fig. 2.4.E and

Fig. 2.4.H). On the other hand, the phenotype of small eye size induced by Sd overexpression can be further exacerbated by knockdown of Ncoa6 (Figs. 2.4.J-K).

Mosaic Analysis with a Repressible Cell Marker (MARCM) (Lee and Luo, 1999) was further applied to investigate the requirement of Ncoa6 in hpo mutant clones. Ncoa6 knockdown in hpo mutant clones suppressed the overgrowth as well as the elevated

Diap1 expression (Figs. 2.5.A-D), and actually led to a decrease in Diap1 expression, like wild type clones with Ncoa6 knockdown (Figs. 2.5.C-D). These discoveries further support a significant role for Ncoa6 in Hippo-mediated growth control and gene expression.

The physical interactions between Yki and Ncoa6, as well as the requirement for Ncoa6 in tissue growth and Hippo target gene expression, suggest that Yki may serve as a transcriptional coactivator by interacting with Ncoa6. Since Sd is the primary DNA- binding transcription partner for Yki, I proposed to fuse the DNA-binding domain of Sd with Ncoa6 so that it may directly bind to Hippo target genes and therefore stimulate their transcription in a Yki-independent fashion. I examined this fusion construct (SdDB-

Ncoa6) in Drosophila wing discs with the MARCM technique. Consistent with the reported results (Huang et al., 2005), yki mutant clones grew poorly, and the rarely recovered clones exhibited decreased Diap1 levels (Fig. 2.6.A-B). MARCM clones expressing the fusion protein showed rounded clone morphology and drastically increased Diap1 levels (Fig. 2.6.C). Moreover, only the SdDB-Ncoa6 fusion protein

27 rescued the growth defect and the reduced Diap1 expression in yki mutant clone (Fig.

2.6.D). In fact, yki mutant clones with SdDB-Ncoa6 overexpression and wild type clones with SdDB-Ncoa6 overexpression were indistinguishable in terms of clone size and

Diap1 expression (Fig. 2.6.C-D). Therefore, the SdDB-Ncoa6 fusion protein displays gain-of-function activity in a Yki-independent way (e.g. bypass the requirement for Yki).

Similarly, the SdDB-Ncoa6 fusion protein strongly stimulated the HRE-luciferase reporter in S2R+ cells which cannot be suppressed by co-expression of Wts (Fig. 2.6.E).

The results above suggest that Yki activates gene expression, at least in part, by recruiting

Ncoa6. Since Ncoa6 is a specific subunit of the Trr methyltransferase complex, I investigated whether Trr, which is the catalytic subunit of the methyltransferase complex, is also essential for Hippo-mediated growth control and gene expression. Similarly, expression of UAS-trr RNAi by the dpp-Gal4 driver led to a huge decrease in the width of the dpp-expression domain in adult wings and a corresponding decline in the Hippo target genes diap1 and fj (Fig. 2.3.B, D, and G). Trr knockdown also suppressed eye overgrowth induced by Yki overexpression (Fig.2.4.D,F) and aggravated the small eye size induced by Sd overexpression (Fig.2.4.J,L), although it did not suppress eye overgrowth caused by Wts RNAi in a visible manner (Fig.2.4.I). I also utilized MARCM to investigate the requirement of Trr in hpo mutant clones. Like Ncoa6, Trr knockdown suppressed the enhanced Diap1 expression and also the overgrowth in hpo mutant clones

(Fig.2.5.E–F). Altogether, these results suggest that the Trr methyltransferase complex is involved in Hippo-mediated growth control and target gene expression.

In Drosophila, the Trr methyltransferase complex mostly influences histone H3K4 monomethylation with little effect on H3K4 di- or trimethylation (Herz et al., 2012;

Kanda et al., 2013). To figure out whether histone H3K4 methylation is involved in growth regulation of Yki, Ncoa6, and Trr in the Hippo pathway, I first checked the global levels of histone H3K4 methylation in Drosophila wing imaginal discs. Previous findings suggested that using the en-Gal4 driver, RNAi knockdown of Trr resulted in a significant decrease in H3K4me1 in the posterior compartment of the wing imaginal discs, while it marginally affected H3K4me2 and H3K4me3 levels (Herz et al., 2012; Mohan et al.,

2011). I also confirmed previously published results that RNAi knockdown of Ncoa6 in the posterior compartment of the wing imaginal disc weakly decreases H3K4me1 levels

(Herz et al., 2012) (Fig.2.7.A). Then I further examined H3K4me2 and H3K4me3 levels in these imaginal discs and observed a very small reduction in H3K4me3 levels and no discernible changes in H3K4me2 levels (Fig. 2.7.B-C). However, no changes in the global levels of H3K4me1, H3K4me2 or H3K4me3 can be detected in mutant clones of yki in the wing imaginal discs (Fig. 2.7.D-F).

Provided that the effect on the global level of H3K4 methylation by Yki is negligible, I then explored if Yki regulates local H3K4 methylation on Hippo target genes. H3K4 methylation exhibits different patterns on genome: H3K4 monomethylation is commonly enriched at enhancers and actively transcribed introns, while H3K4 trimethylation is concentrated at active promoters and transcription start site (TSS)-proximal regions

(Heintzman et al., 2007; Kharchenko et al., 2011). A genome-wide analysis in

Drosophila S2 cells discovered that two Hippo target genes, diap1, and ex, show such differential pattern of enrichment of H3K4me1 and H3K4me3 at the respective sites

(Herz et al., 2012) (Fig. 2.8.A). To analyze the contribution of Yki, Ncoa6, and Trr to

H3K4 methylation, we knocked down each protein and did ChIP experiment with

29 antibodies against H3K4me1 and H3K4me3 in S2R+ cells. RNAi knockdown of Yki,

Ncoa6 or Trr all decreased H3K4me3 level in the TSS-proximal region of diap1 and ex

(Fig.2.8.B), where H3K4me3 mostly enriches in normal condition (Herz et al., 2012) (Fig.

2.8.A). RNAi knockdown of Yki, Ncoa6 or Trr also resulted in a decrease of H3K4me1 in an upstream region of diap1 or ex and the intronic HRE of diap1, which usually shows the strongest H3K4me1 enrichment (Herz et al., 2012) (Fig. 2.8.C). Taken together, these data are consistent with the conclusion that Yki activates transcription of target genes by interacting with the Trr methyltransferase complex and further changing the chromatin state of the target loci.

Although the upstream inputs into the Hippo pathway keep being discovered and expanded, all of them converge on the transcriptional coactivator Yki. Thus, understanding the molecular mechanisms by which Yki regulates tissue growth and target gene expression has important implications for developmental and cancer biology. Past studies have established that Yki functions mainly as a coactivator for Sd and that Yki promotes tissue growth by antagonizing Sd’s repressor function (Koontz et al., 2013; Wu et al., 2008). By identifying Ncoa6 as a novel Yki-binding cofactor required for the expression of Yki target genes, I have extended the previous work and provided new insights into the regulation of the Hippo pathway. The ability of the SdDB-Ncoa6 fusion protein to rescue the growth and transcriptional defects in yki mutant clones highlights the importance of Ncoa6 recruitment in the transcriptional output of the Hippo pathway.

Further results extend our understanding of transcription regulation of Yki that Ncoa6 probably recruits the Trr methyltransferase complex to target genes and then modulates local H3K4 methylation. Consistent with this notion, a recent genome-wide chromatin-

30 binding analysis revealed a correlation between Yki-bound chromatin and peaks of

H3K4me3 modification in Drosophila wing discs and embryos (Oh et al., 2013).

Previously, we found that the liver overgrowth phenotypes induced by loss of Nf2 were greatly suppressed by homozygous and heterozygous deletion of YAP in mice (Zhang et al., 2010). If Ncoa6 plays a similar role in regulating the Hippo signaling pathway in the mammalian system, we would expect that homozygous or heterozygous deletion of

Ncoa6 could similarly suppress the loss of Nf2 phenotypes. However, the one-month-old littermates did not show any difference of overall growth phenotypes between Nf2 mutant liver and the Nf2 Ncoa6+/- liver (data not shown). Currently, we are examining whether homozygous deletion of Ncoa6 will suppress the Nf2 mutant phenotype.

It is worth noting that, the mammalian Ncoa6 has also been reported to potentiate the activity of nuclear receptors by interacting with the histone acetyltransferase CBP/p300 and several RNA binding proteins (CAPER, CoAA, and PIMT) (Mahajan and Samuels,

2008). Whether other mechanisms also contribute to the function of Ncoa6 in Yki- mediated growth control is open for further investigation. Given the significant implication of the Hippo pathway in biology and the clinic, further investigations on the molecular mechanism of Ncoa6 will advance our knowledge of developmental growth control and inspire the development of novel therapeutic strategies.

Figures

Fig. 2.1. Identification of Ncoa6 as a positive regulator of the HRE activity from cell- based RNAi screen.

(A) Identification of Ncoa6 as a positive regulator of HRE activity from the primary

RNAi screen. The scatter plot highlights genes whose RNAi resulted in a decrease in

Yki/Sd-induced HRE reporter activity, with each gene represented by a single dot. The locations of Ncoa6 (CG14023), sd, and yki are marked. (B) Validation of Ncoa6 as a positive regulator of HRE activity. Luciferase activity was measured in triplicates in

Drosophila S2R+ cells transfected with Yki, Sd, HRE-Luciferase, and Pol III-Renilla expression vectors, together with dsRNA of GFP (control) or Ncoa6. Error bars represent standard deviations. (C) A list of primary hits from the RNAi screen with Z-scores of less than −2.26.

Fig. 2.2. Ncoa6 physically interacts with Yki and regulates HRE activity.

(A) Schematic protein structure of Drosophila Ncoa6 and its human orthologue, which contain three and two PPxY motifs, respectively. (B) S2R+ cells expressing the indicated constructs were subjected to immunoprecipitation as indicated. Note the physical interactions between Ncoa6 and Yki, and absence of interactions between Ncoa63m and

Yki or between Ncoa6 and YkiWM. (C) Drosophila S2R+ cells co-transfected with HA-

Yki and FLAG-Ncoa6 or FLAG-Ncoa63m constructs were stained for the indicated epitopes. Cells with or without FLAG expression are marked by arrowheads and arrows, respectively. Both FLAG-Ncoa6 and FLAG-Ncoa63m were localized to the nucleus

(arrowheads), while HA-Yki was more concentrated in the cytoplasm (arrows). FLAG-

Ncoa6, but not FLAG-Ncoa63m, induced nuclear accumulation of HA-Yki (compare arrowheads in the merged channel). (D) Luciferase activity was measured in triplicates in Drosophila S2R+ cells transfected with the indicated constructs. Ncoa6, but not

Ncoa63m, enhanced Yki/Sd-mediated activation of HRE-luciferase reporter. This enhancement was suppressed by co-expression of Wts. Error bars represent standard deviations. (E)Drosophila S2R+ cells expressing FLAG-tagged Ncoa6 were subjected to

ChIP analysis using control IgG, antibodies against FLAG or antibodies against endogenous Yki. The enrichment of HRE at the endogenous diap1 locus was measured by real-time PCR. Both Yki and FLAG-Ncoa6 bound to the diap1 HRE.

Fig. 2.3. Ncoa6 and Trr are required for normal tissue growth and expression of

Hippo target genes in Drosophila imaginal discs.

(A) RNAi knockdown of Ncoa6 and Trr by dpp-Gal4 resulted in decreased area of the dpp expression domain in adult wings. The pictures were taken at the same magnification. The graph shows quantification of the dpp expression domain (green area in the schematic drawing) relative to the entire wing area (mean ± SEM, n = 14,

***p<0.001). The complete genotypes are UAS-Dicer2; dpp-Gal4 UAS-GFP (control),

UAS-Dicer2; dpp-Gal4 UAS-GFP/UAS-Ncoa6RNAi (Ncoa6 RNAi), and UAS-

Dicer2; dpp-Gal4 UAS-GFP/UAS-trrRNAi (trr RNAi). (B–G) RNAi knockdown of

Ncoa6 or Trr resulted in decreased expression of Hippo target genes. Wing discs expressing UAS-GFP only (B and E), UAS-GFP plus Ncoa6 RNAi (C and F), or UAS-

GFP plus trr RNAi (D and G) were stained for Diap1 (B–D) or fj-lacZ (E–G). Note the reduction of Diap1 and fj-lacZ levels upon Ncoa6 or Trr RNAi. The complete genotypes are: UAS-Dicer2; dpp-Gal4 UAS-GFP (B), UAS-Dicer2; dpp-Gal4 UAS-GFP/UAS-

Ncoa6RNAi (C), UAS-Dicer; dpp-Gal4 UAS-GFP/UAS-trr RNAi (D), UAS-Dicer2; fj- lacZ; dpp-Gal4 UAS-GFP (E), UAS-Dicer2; fj-lacZ; dpp-Gal4 UAS-GFP/UAS-Ncoa6

RNAi (F), and UAS-Dicer2; fj-lacZ; dpp-Gal4 UAS-GFP/UAS-trr RNAi (G).

Fig. 2.4. Genetic interactions between Ncoa6-Trr and the Hippo pathway.

Adult eye images of the indicated genotypes, all taken at the same magnification. (A)

GMR-Gal4/+. Wild-type control. (B) GMR-Gal4/+; UAS-Ncoa6 RNAi/+. RNAi knockdown of Ncoa6 resulted in a mild decrease in eye size (compare B to A). (C) UAS-

Dicer2/+; GMR-Gal4/+; UAS-trr RNAi/+. RNAi knockdown of Trr resulted in no visible effects on eye size (compare C to A). (D) GMR-Gal4 UAS-Yki/+. Overexpression of Yki resulted in an increase in eye size (compare D to A). (E) GMR-Gal4 UAS-Yki/+; UAS-

Ncoa6 RNAi/+. RNAi knockdown of Ncoa6 suppressed eye overgrowth induced by Yki overexpression (compare E to D). (F) UAS-Dicer2/+; GMR-Gal4 UAS-Yki/+; UAS-trr

RNAi/+. RNAi knockdown of Trr suppressed eye overgrowth induced by Yki overexpression (compare F to D). (G) UAS-Wts RNAi/+; GMR-Gal4/+. RNAi knockdown of Wts resulted in an increase in eye size (compare G to A). (H) UAS-Wts

RNAi/+; GMR-Gal4/ UAS-Ncoa6 RNAi. RNAi knockdown of Ncoa6 suppressed eye overgrowth induced by Wts knockdown (compare H to G). (I) UAS-Dicer2/+; UAS-Wts

RNAi/+; GMR-Gal4/ UAS-trr RNAi. RNAi knockdown of Trr did not obviously suppress eye overgrowth caused by Wts knockdown. (J) GMR-Gal4 UAS-Sd/+.

Overexpression of Sd resulted in a decrease in eye size (compare J to A). (K) GMR-Gal4

UAS-Sd/+; UAS-Ncoa6 RNAi/+. RNAi knockdown of Ncoa6 enhanced the small eye phenotype caused by Sd overexpression (compare K to J). (L) UAS-Dicer2/+; GMR-

Gal4 UAS-Sd/+; UAS-trr RNAi/+. RNAi knockdown of Trr enhanced the small eye phenotype caused by Sd overexpression (compare L to J).

Fig. 2.5. Ncoa6 and Trr are required for Hippo-mediated target gene expression.

Wing discs containing GFP-marked MARCM clones were stained for Diap1 (red). For each genotype, the left-most panel shows low magnification view of the wing disc

(Hoechst + GFP), while the remaining three panels show higher magnification view of the same wing disc (GFP, Diap1, and GFP + Diap1). (A–F) Wing discs containing GFP- marked MARCM clones (green) of WT control (A), hpo mutant (B), Ncoa6 RNAi

(C), hpo mutant with Ncoa6 RNAi (D), Trr RNAi (E), and hpo mutant with Trr RNAi

(F). Note the increased Diap1 levels in hpo mutant clones and the decreased Diap1 levels in Ncoa6 RNAi or Trr RNAi clones. Also, note the decreased Diap1 levels in hpo mutant clones with Ncoa6 RNAi or Trr RNAi.

Fig. 2.6. Fusion of Ncoa6 with the DNA binding domain of Sd bypasses Yki to stimulate Hippo target gene and tissue growth.

(A–E) Wing discs containing GFP-marked MARCM clones (green) of WT control

(A), ykiB5 (B), SdDB-Ncoa6 overexpression (C), and ykiB5 with SdDB-Ncoa6 overexpression (D) were stained for Diap1 (red). For each genotype, the left-most panel shows low magnification view of the wing disc (Hoechst + GFP), while the remaining three panels show higher magnification view of the same wing disc (GFP, Diap1, and

GFP + Diap1). Note the decreased Diap1 expression and undergrowth of ykiB5 clones (B).

SdDB-Ncoa6 overexpression resulted in elevated Diap1 levels in ykiB5 clones (D). (E)

Luciferase activity was measured in triplicates in Drosophila S2R+ cells transfected with the indicated constructs. Error bars represent standard deviations. Note the Wts- insensitive stimulation of the HRE-luciferase reporter by SdDB-Ncoa6.

Fig. 2.7. Ncoa6, but not Yki, regulates global levels of H3K4 methylation.

(A–C) Wing discs with Ncoa6 RNAi in the posterior compartment were stained for mono-, di-, and tri-methylation of H3K4 as indicated. Note the subtle decrease of

H3K4me1 (A) and H3K4me3 (C), but not H3K4me2 (B), in the GFP-marked posterior compartment. The complete genotype is UAS-Dicer2; en-Gal4 UAS-GFP; UAS-

Ncoa6RNAi. (D–F) Wing discs containing ykiB5 mutant clones were stained for

H3K4me1, H3K4me2, and H3K4me3 as indicated. Note the normal levels of H3K4me1,

H3K4me2, and H3K4me4 in yki mutant clones (arrows, GFP-negative) compared to the wild-type neighbors (GFP-positive).

Fig. 2.8. Yki modulates local H3K4 methylation at Hippo target genes.

(A) Schematic view of diap1 and ex genomic loci analyzed by ChIP. Transcriptional start site is labeled as +1, and p1–p5 are a series of primer sets encompassing following regions of diap1 and ex: diap1: p1: −1951 ∼ −1813, p2: +228 ∼ +377, p3: +3993 ∼

+4104; ex: p4: −749 ∼ −608, p5: +249 ∼ +393. Note that p3 covers the diap1 HRE. Also shown are the profiles of H3K4me1 (blue line) and H3K4me3 (red line) binding derived from a previously published ChIP-Seq analysis in S2 cells (Herz et al., 2012). (B and C)

RNAi knockdown of Yki, Ncoa6 or Trr resulted in decreased H3K4me3 (B) and

H3K4me1 (C) modification on Hippo target genes. ChIP analysis of H3K4me1 or

H3K4me3 were performed in Drosophila S2R+ cells treated with dsRNA of GFP

(control), Yki, Ncoa6, or Trr. Chromatin was precipitated by control IgG or antibodies against H3K4me1 and H3K4me3. The enrichment of ChIP products on diap and ex was measured by real-time PCR using the indicated primers. ***p<0.001, **p<0.01,*p<0.05.

References

Antonson, P., Schuster, G.U., Wang, L., Rozell, B., Holter, E., Flodby, P., Treuter, E.,

Holmgren, L., and Gustafsson, J.A. (2003). Inactivation of the nuclear receptor coactivator RAP250 in mice results in placental vascular dysfunction. Mol Cell Biol 23,

1260-1268.

Bernstein, B.E., Humphrey, E.L., Erlich, R.L., Schneider, R., Bouman, P., Liu, J.S.,

Kouzarides, T., and Schreiber, S.L. (2002). Methylation of histone H3 Lys 4 in coding regions of active genes. Proc Natl Acad Sci U S A 99, 8695-8700.

Bischof, J., Maeda, R.K., Hediger, M., Karch, F., and Basler, K. (2007). An optimized transgenesis system for Drosophila using germ-line-specific phi C31 integrases. P Natl

Acad Sci USA 104, 3312-3317.

Eissenberg, J.C., and Shilatifard, A. (2010). Histone H3 lysine 4 (H3K4) methylation in development and differentiation. Dev Biol 339, 240-249.

Ernst, J., Kheradpour, P., Mikkelsen, T.S., Shoresh, N., Ward, L.D., Epstein, C.B., Zhang,

X., Wang, L., Issner, R., Coyne, M., et al. (2011). Mapping and analysis of chromatin state dynamics in nine human cell types. Nature 473, 43-49.

Halder, G., Polaczyk, P., Kraus, M.E., Hudson, A., Kim, J., Laughon, A., and Carroll, S.

(1998). The Vestigial and Scalloped proteins act together to directly regulate wing- specific gene expression in Drosophila. Genes & Development 12, 3900-3909.

Heintzman, N.D., Stuart, R.K., Hon, G., Fu, Y., Ching, C.W., Hawkins, R.D., Barrera,

L.O., Van Calcar, S., Qu, C., Ching, K.A., et al. (2007). Distinct and predictive

48 chromatin signatures of transcriptional promoters and enhancers in the human genome.

Nat Genet 39, 311-318.

Herz, H.M., Mohan, M., Garruss, A.S., Liang, K., Takahashi, Y.H., Mickey, K., Voets,

O., Verrijzer, C.P., and Shilatifard, A. (2012). Enhancer-associated H3K4 monomethylation by Trithorax-related, the Drosophila homolog of mammalian

Mll3/Mll4. Genes Dev 26, 2604-2620.

Kanda, H., Nguyen, A., Chen, L., Okano, H., and Hariharan, I.K. (2013). The Drosophila

Ortholog of MLL3 and MLL4, trithorax related, Functions as a Negative Regulator of

Tissue Growth. Mol Cell Biol 33, 1702-1710.

Kharchenko, P.V., Alekseyenko, A.A., Schwartz, Y.B., Minoda, A., Riddle, N.C., Ernst,

J., Sabo, P.J., Larschan, E., Gorchakov, A.A., Gu, T., et al. (2011). Comprehensive analysis of the chromatin landscape in Drosophila melanogaster. Nature 471, 480-485.

Koontz, L.M., Liu-Chittenden, Y., Yin, F., Zheng, Y., Yu, J., Huang, B., Chen, Q., Wu,

S., and Pan, D. (2013). The Hippo effector Yorkie controls normal tissue growth by antagonizing scalloped-mediated default repression. Dev Cell 25, 388-401.

Kornberg, R.D., and Lorch, Y. (1999). Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 98, 285-294.

Kuang, S.Q., Liao, L., Zhang, H., Pereira, F.A., Yuan, Y.H., DeMayo, F.J., Ko, L., and

Xu, J.M. (2002). Deletion of the cancer-amplified coactivator AIB3 results in defective placentation and embryonic lethality. Journal of Biological Chemistry 277, 45356-45360.

Kwon, Y., Vinayagam, A., Sun, X., Dephoure, N., Gygi, S.P., Hong, P., and Perrimon, N.

(2013). The Hippo Signaling Pathway Interactome. Science 342, 737-740.

Lee, S.K., Anzick, S.L., Choi, J.E., Bubendorf, L., Guan, X.Y., Jung, Y.K., Kallioniemi,

O.P., Kononen, J., Trent, J.M., Azorsa, D., et al. (1999). A nuclear factor, ASC-2, as a cancer-amplified transcriptional coactivator essential for ligand-dependent transactivation by nuclear receptors in vivo. Journal of Biological Chemistry 274, 34283-34293.

Lee, T., and Luo, L. (1999). Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron 22, 451-461.

Mahajan, M.A., Das, S., Zhu, H., Tomic-Canic, M., and Samuels, H.H. (2004). The nuclear hormone receptor coactivator NRC is a pleiotropic modulator affecting growth, development, apoptosis, reproduction, and wound repair. Mol Cell Biol 24, 4994-5004.

Mahajan, M.A., and Samuels, H.H. (2008). Nuclear receptor coactivator/coregulator

NCoA6(NRC) is a pleiotropic coregulator involved in transcription, cell survival, growth and development. Nucl Recept Signal 6, e002.

Miller, T., Krogan, N.J., Dover, J., Erdjument-Bromage, H., Tempst, P., Johnston, M.,

Greenblatt, J.F., and Shilatifard, A. (2001). COMPASS: a complex of proteins associated with a trithorax-related SET domain protein. Proc Natl Acad Sci U S A 98, 12902-12907.

Mohan, M., Herz, H.M., Smith, E.R., Zhang, Y., Jackson, J., Washburn, M.P., Florens, L.,

Eissenberg, J.C., and Shilatifard, A. (2011). The COMPASS Family of H3K4 Methylases in Drosophila. Mol Cell Biol 31, 4310-4318.

Oh, H., Slattery, M., Ma, L., Crofts, A., White, K.P., Mann, R.S., and Irvine, K.D. (2013).

Genome-wide association of Yorkie with chromatin and chromatin-remodeling complexes. Cell Rep 3, 309-318.

Sedkov, Y., Cho, E., Petruk, S., Cherbas, L., Smith, S.T., Jones, R.S., Cherbas, P.,

Canaani, E., Jaynes, J.B., and Mazo, A. (2003). Methylation at lysine 4 of histone H3 in ecdysone-dependent development of Drosophila. Nature 426, 78-83.

Villano, J.L., and Katz, F.N. (1995). 4-Jointed Is Required for Intermediate Growth in the

Proximal-Distal Axis in Drosophila. Development 121, 2767-2777.

Wang, W., Huang, L., Huang, Y., Yin, J.W., Berk, A.J., Friedman, J.M., and Wang, G.

(2009). Mediator MED23 links insulin signaling to the adipogenesis transcription cascade.

Dev Cell 16, 764-771.

Wu, S., Liu, Y., Zheng, Y., Dong, J., and Pan, D. (2008). The TEAD/TEF family protein

Scalloped mediates transcriptional output of the Hippo growth-regulatory pathway. Dev

Cell 14, 388-398.

Yin, F., Yu, J.Z., Zheng, Y.G., Chen, Q., Zhang, N.L., and Pan, D.J. (2013). Spatial

Organization of Hippo Signaling at the Plasma Membrane Mediated by the Tumor

Suppressor Merlin/NF2. Cell 154, 1342-1355.

Zhang, N.L., Bai, H.B., David, K.K., Dong, J.X., Zheng, Y.G., Cai, J., Giovannini, M.,

Liu, P.T., Anders, R.A., and Pan, D.J. (2010). The Merlin/NF2 Tumor Suppressor

Functions through the YAP Oncoprotein to Regulate Tissue Homeostasis in Mammals.

Developmental Cell 19, 27-38.

Zhu, Y.J., Crawford, S.E., Stellmach, V., Dwivedi, R.S., Rao, M.S., Gonzalez, F.J., Qi,

C., and Reddy, J.K. (2003). Coactivator PRIP, the peroxisome proliferator-activated receptor-interacting protein, is a modulator of placental, cardiac, hepatic, and embryonic development. Journal of Biological Chemistry 278, 1986-1990.

Chapter 3

The Hippo effector Yorkie activates target gene transcription through Med13 and

Med12

Introduction

The mediator is a conserved multiprotein complex from yeast to human that is composed of around 30 subunits (Bjorklund and Gustafsson, 2005; Conaway et al., 2005; Kim and

Lis, 2005). It possesses a variety of functions in transcriptional regulation (Malik and

Roeder, 2010). One of the key functions of the mediator complex is the recruitment of

RNA polymerase II (Pol II): it acts as a bridge between the general RNA Pol II machinery and the gene- and tissue-specific transcriptional factors. It then regulates the preinitiation complex (PIC) formation, and acts at other post-recruitment steps, including but not limited to productive transcription elongation complex (TEC) formation (Donner et al., 2010; Guglielmi et al., 2007; Malik et al., 2007). In addition, there are a few reports regarding the regulation of gene expression at the chromatin level by the mediator complex in different contexts: the mediator can assemble with (Black et al., 2006) or compete with histone modification factors (Sharma and Fondell, 2002); the mediator also promotes epigenetic silencing by facilitating the recruitment of G9a H3K9 methyltransferase (Ding et al., 2008), and a mediator subunit is required for the dissociation of the Polycomb Repressive Complex 2 (PRC2) that represses gene expression by methylating H3K27 (Englert et al., 2015).

The mediator complex is composed of core subunits including the head, middle, and tail modules, and the kinase module that includes the Med12, Med13, Cdk8 and Cyclin C

(CycC) subunits (Conaway and Conaway, 2011). The Cdk8 kinase module can act as a transcriptional repressor. For example, it phosphorylates the pol II C-terminal domain

(CTD) (Hengartner et al., 1998) and cyclin H subunit of TFIIH (Akoulitchev et al., 2000), and precludes the RNA Pol II binding with the core mediator (Knuesel et al., 2009). In

54 other contexts, it can act as a transcriptional activator, for instance, by stimulating the transcriptional elongation through the recruitment of positive transcription elongation factor b (P-TEFb) (Donner et al., 2010). The two subunits of the kinase module, mediator complex subunits 13 and 12 (Med13 and Med12), have been implicated in regulating transcription of multiple physiological contexts. In Drosophila, Med13 and Med12, encoded by skuld (skd) and kohtalo (kto), are required for specific developmental processes (Boube et al., 2000; Janody et al., 2003; Treisman, 2001) and regulate transcription of the signaling pathways including Wingless (Carrera et al., 2008), Notch

(Janody and Treisman, 2011), and Hedgehog (Mao et al., 2014). These two proteins are also required for the heart/muscle -derived signaling to control obesity in Drosophila

(Lee et al., 2014), and they regulate gene expression in contexts such as hematopoiesis

(Gobert et al., 2010) and innate immunity (Kuuluvainen et al., 2014).

As mentioned in Chapter 1, eukaryotic transcription is regulated by multiple steps. In addition to the recruitment of histone H3K4 methyltransferase by Ncoa6, much is unknown about the Yki-mediated transcriptional regulation of the Hippo pathway.

Considering the importance of the Hippo signaling pathway in tumorigenesis, understanding other transcriptional mechanisms could provide clues for developing cancer therapies targeting the Hippo pathway. Here, I show that Yki activates target gene transcription through another two proteins: Med13 (skd) and Med12 (kto).

Materials and methods

Molecular cloning and mutagenesis

A full-length skd and kto cDNA corresponding to the BDGP annotated RD and RA transcripts was cloned based on the constructs gifted from Jessica Treisman (Janody et al.,

2003) . Mutations of PPxY motifs were generated using the QuikChange Lightning Site-

Directed Mutagenesis Kit (Agilent, Santa Clara, CA), replacing tyrosine(Y) with alanine

(A). FLAG-tag was inserted to the N-terminal of skd, skd2m, kto, and ktom and cloned into the attB-UAS vector.

Drosophila genetics

Flies with the following genotypes have been described previously: ykiB5,UAS-Yki

(Huang et al., 2005), hpo42−48 (Wu et al., 2003), fj-lacZ reporter fj9-II (Villano and Katz,

1995), UAS-Wts RNAi (stock ID VDRC 106174). The UAS-skd RNAi (I) and (II) were obtained from Bloomington Drosophila Stock Center (BDSC) (stock ID 34630) and

NIG-FLY (stock ID 9936R-1); UAS-skd RNAi refers to UAS-skd RNAi (I). The UAS- kto RNAi was obtained from BDSC (stock ID 34588); the UAS-Cdk8 RNAi (I), (II) and

(III) were obtained from NIG-FLY (stock ID 10572R-1 and 10572R-3) and BDSC (stock

ID 35342); the UAS-CycC RNAi (I) and (II) were obtained from VDRC (stock ID

27937) and BDSC (stock ID 33753).

For the MARCM experiments in Figure 5, the following clones were induced 48–60 hr after egg deposition and heat shocked at 37°C for 15 min:

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/+

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D hpo42−48; Tub-Gal4/+

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/UAS-skdRNAi

UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D hpo42−48; Tub-Gal4/UAS-skdRNAi

UAS-Dicer2/UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D; Tub-Gal4/UAS-

ktoRNAi

UAS-Dicer2/UAS-GFP hs-FLP; FRT42D, Tub-Gal80/FRT42D hpo42−48; Tub-

Gal4/UAS-ktoRNAi

Drosophila cell culture, transfection, immunoprecipitation, immunofluorescence, and luciferase reporter assay

Drosophila S2R+ cells were cultured in Schneider's Drosophila Medium (Life

Technologies) supplemented with 10% fetal bovine serum and antibiotics. HA-Yki and

HA-YkiWM have been described previously (Huang et al., 2005). Luciferase assay was carried out using Dual Luciferase Assay System (Promega, Madison, WI) and an

FLUOstar Luminometer (BMG LabTechnologies, Germany). Transfection, immunoprecipitation, and immunofluorescence staining of S2R+ cells were performed using standard protocols as described (Yin et al., 2013).

Results and discussions

In a genome-wide RNAi screen in Drosophila S2R+ cells with a minimal Hippo

Responsive Element (HRE) from the Hippo target gene diap1 (Koontz et al., 2013), skuld

(skd) was identified as one of the positive regulators. The results were confirmed by using three different skd dsRNAs and their mixtures (Fig. 3.1.C). skd (Med13) is particularly interesting because it contains two PPxY motifs, which present well- established binding partners for WW domains. Because Yki contains two WW domains, I hypothesized the potential interaction between Yki and skd. Indeed, epitope-tagged skd and Yki coimmunoprecipitated with each other in Drosophila S2R+ cells (Fig. 3.1.A).

The interaction was abolished by mutating the two PPxY motifs in skd (skd2m) or the two

WW domains in Yki (YkiWM), suggesting that the skd-Yki interaction was mediated by the PPxY motifs of skd and the WW domains of Yki.

Consistent with our observation that RNAi knockdown of skd reduced the HRE reporter activity, overexpression of skd potently enhanced Yki/Sd-mediated HRE reporter activity in S2R+ cells (Fig. 3.1.D). It is interesting that weaker enhancement was also observed by overexpression of skd2m, suggesting that other factors may contribute to the enhancement of reporter activity in addition to the direct interaction between Yki and skd.

Next, I examined whether skd is required for Hippo target gene expression and tissue growth in vivo using transgenic RNAi lines. The RNAi lines were first validated for the knockdown efficiency in the 3rd instar wing discs: expression of UAS-skd RNAi by the engrailed (en)-Gal4 driver resulted in an obvious decrease in the skd protein level in the posterior compartments, which corresponds to the en expression region. Skd RNAi

58 with the same driver caused a decrease in the expression of diap1 and four-jointed (fj), two well-characterized Hippo target genes (Fig 3.2.B-E).

Expression of UAS-skd RNAi by the Vestigial (Vg)-Gal4 or Nubbin (Nub)-Gal4 driver resulted in decreased wing size compared to the control or tiny wing phenotypes (Fig.

3.2.A). RNAi knockdown of skd by GMR-Gal4 driver resulted in small eye phenotype

(Fig. 3.3.B-C). Furthermore, overexpression of Yki resulted in big eye phenotype (Fig.

3.3.D), which can be suppressed by knockdown of skd (Fig. 3.3.E-F). Similarly, knockdown of Wts resulted in big eyes with folded surfaces, whereas knockdown of both

Wts and skd led to smaller eyes with smooth surfaces (Fig. 3.3.H-I).

These eye phenotypes support the genetic interactions between skd and the Hippo pathway. To further investigate these genetic interactions, I used Mosaic Analysis with a

Repressible Cell Marker (MARCM) (Lee and Luo, 1999) to examine the requirement of skd in hpo mutant clones.

Skd knockdown suppressed the overgrowth of hpo mutant clones and the up-regulated

Diap1 expression in the clones (Fig. 3.5.A-D). In fact, hpo mutant clones with skd knockdown showed a decrease in Diap1 expression, similar to wild type clones with skd knockdown (Fig. 3.5.C-D). These findings further implicate skd in Hippo-mediated growth control and gene expression.

Skd (Med13) and kto (Med12) are two subunits of the kinase module of the mediator complex; expression profiling of gene-knockdown Drosophila cell lines and yeast mutants revealed that the gene-expression programs regulated by Med13 and Med12 are closely correlated, suggesting they act in concert in gene regulation (Kuuluvainen et al.,

2014; van de Peppel et al., 2005). Therefore I hypothesized that Yki also activates gene expression through kto.

I first examined the requirement of kto in activating Hippo pathway target gene expression. Similar to skd, expression of UAS-kto RNAi by the en-Gal4 driver resulted in a significant decrease in Diap1 and expanded (ex) protein levels (Fig.3.4.B-E). RNAi knockdown of kto by the Vg-Gal4 driver also strongly decreased the wing size

(Fig.3.4.A). I also used MARCM to examine the requirement of kto in hpo mutant clones.

Similar to skd, kto knockdown suppressed the elevated Diap1 expression in hpo mutant clones (Fig.3.5.E-F). Taken together, these results implicate kto in regulating the Hippo pathway target genes expression.

Interestingly, kto also contains a PPxY motif, raising a possibility that it can interact with

Yki through the PPxY-WW interaction. Indeed, kto interacts with Yki in S2R+ cells, and this interaction can be largely abolished by mutating the WW domain of Yki (Fig.3.1.B).

However, mutating the PPxY motif of kto only partially blocked the interaction between kto and Yki, suggesting that other factor(s) may contribute to this interaction. Since skd physically interacts with both Yki (Fig.3.1.A) and kto (Janody et al., 2003) , it is highly possible that skd provides an additional bridge between kto and Yki.

The results presented above suggest that Yki activates transcription through skd and kto.

Because skd and kto are in the Cdk8 kinase module of the mediator complex, I examined the requirement of Cdk8 and CycC, the other two subunits of kinase module, in regulating the Hippo signaling pathway. RNAi Knockdown of Cdk8 with three different lines or CycC with two different lines did not change the expression of Hippo target gene

60 diap1 (Fig. 3.6.A-F). These results are in alignment with the emerging evidence that

Med12-Med13 and Cdk8-CycC showed distinct gene expression patterns in Drosophila

(Carrera et al., 2008; Gobert et al., 2010; Kuuluvainen et al., 2014; Loncle et al., 2007;

Mao et al., 2014), even though studies in yeast suggest that these four subunits form a stable subcomplex and their mutants share similar transcriptional profiles (Bjorklund and

Gustafsson, 2005; van de Peppel et al., 2005).

Specific subunits of the mediator complex function as specific adaptors to link gene- specific transcriptional factors to the mediator complex. For instance, Med15 interacts with Smad2/3 and is required for TGFβ/Nodal signaling (Kato et al., 2002); Med13 interacts with Pygo and is required for Wg target gene expression (Carrera et al., 2008);

MED19/MED26 act as a mediator interface for RE1 silencing transcription factor

(REST) (Ding et al., 2009). My results suggest that the Med13 and Med12 may act as a bridge to link Yki to the mediator complex.

Interestingly, out of the known 19 proteins that interact with skd (Chen et al., 2012;

Guruharsha et al., 2011), PAX transcription activation domain interacting protein (PTIP) is one of the few proteins that are not subunits of the mediator complex. Similar to Ncoa6,

PTIP is also a specific subunit of the Trr histone H3K4 methyltransferase complex. It is highly possible that skd and kto also associate with the Trr complex through PTIP. Do skd and kto also affect histone H3K4 methylation? Do skd and kto recruit the Trr complex or affect the stability of the Trr complex? As Yki has also been shown to recruit the Trr complex by Ncoa6 in the previous chapter, it would be of great interest to examine how the Ncoa6 and skd/kto coordinate with each other in regulating the Hippo signaling pathway.

Finally, it would be intriguing to examine whether the mammalian Med12 and Med13 function similarly to regulate the Hippo signaling pathway. Given that the importance of the Hippo signaling in developmental and cancer biology, the novel mechanism of Yki- mediated transcriptional regulation by Med13 and Med12 could provide novel directions for inhibiting the oncogenic activity of Yki, which is highly relevant to cancer therapies.

Figures

Fig. 3.1. skd and kto physically interact with Yki; skd regulates HRE activity.

(A-B) S2R+ cells expressing the indicated constructs were subjected to immunoprecipitation as indicated. Note the physical interactions between skd/kto and

Yki, and absence of interactions between skd2m and Yki or between skd and YkiWM. (C)

Validation of skd as a positive regulator of HRE activity. Luciferase activity was measured in triplicates in S2R+ cells transfected with Yki, Sd, HRE-Luciferase, and Pol

III-Renilla expression vectors, together with dsRNAs of GFP (control) or skd. Error bars represent standard deviations. (D) Luciferase activity was measured in triplicates in

Drosophila S2R+ cells transfected with the indicated constructs. skd enhanced Yki/Sd- mediated activation of HRE-luciferase reporter. This enhancement was partially suppressed by mutating the PPxY motifs of skd. Error bars represent standard deviations.

Fig. 3.2. skd is required for normal tissue growth and expression of Hippo target genes in Drosophila imaginal discs.

(A) RNAi knockdown of skd by Vg-Gal4 (left panel) and Nub-gal4 (bottom right) resulted in decreased wing size or tiny wing phenotype. The graph shows quantification of the wing size relative to the control (Vg-gal4/+) for the samples in the left panel

(mean+SEM, n=15, *** p<0.001). The complete genotypes are: UAS-Dicer2; Vg-Gal4/+

(top wing), UAS-Dicer2; Vg-Gal4 /UAS-skdRNAi (I) (middle wing), UAS-Dicer2; Vg-

Gal/UAS-skdRNAi (II) (bottom wing), and Nub-gal4/skdRNAi (II) (bottom right). (B-E)

RNAi knockdown of skd resulted in decreased expression of Hippo target genes. Wing discs expressing UAS-GFP only (B and D) or, UAS-GFP plus skd RNAi (C and E) were stained for Diap1 (B and C) or fj-lacZ (D and E). Note the reduction of Diap1 and fj-lacZ levels upon skd RNAi. The complete genotypes are UAS-Dicer2; en-Gal4 UAS-GFP (B),

UAS-Dicer2; en-Gal4 UAS-GFP/UAS-skdRNAi (C), UAS-Dicer2; fj-lacZ; en-Gal4

UAS-GFP (D), and UAS-Dicer2; fj-lacZ; en-Gal4 UAS-GFP/UAS-skdRNAi (E).

Fig. 3.3. skd regulates tissue growth in the eye and genetically interacts with Hippo pathway.

Adult eye images of the indicated genotypes, all taken at the same magnification. (A)

GMR-Gal4/+. Wild-type control. (B-C) GMR-Gal4/+; UAS-skdRNAi (I) or (II) /+.

RNAi knockdown of skd resulted in a decrease in eye size (compare B or C to A). (D)

GMR-Gal4 UAS-Yki/+. Overexpression of Yki resulted in an increase in eye size

(compare D to A). (E-F) GMR-Gal4 UAS-Yki/+; UAS-skdRNAi (I) or (II)/+. RNAi knockdown of skd suppressed eye overgrowth induced by Yki overexpression (compare

E or F to D). (G) UAS-WtsRNAi/+; GMR-Gal4/+. RNAi knockdown of Wts resulted in an increase in eye size (compare G to A). (H-I) UAS-WtsRNAi/+; GMR-Gal4/ UAS- skdRNAi (I) or (II)/+. RNAi knockdown of skd suppressed eye overgrowth induced by

Wts knockdown (compare H or I to G).

Fig. 3.4. kto is required for normal tissue growth and expression of Hippo target genes in Drosophila imaginal discs.

(A) RNAi knockdown of kto by Vg-Gal4 resulted in decreased wing size. The graph shows quantification of the wing size relative to the control (Vg-gal4/+) (mean+SEM, n=15, *** p<0.001). The complete genotypes are UAS-Dicer2; Vg-Gal4/+ (top wing) and UAS-Dicer2; Vg-Gal4 /UAS-ktoRNAi (bottom wing).

(B-E) RNAi knockdown of kto resulted in decreased expression of Hippo target genes.

Wing discs expressing UAS-GFP only (B and D) or, UAS-GFP plus kto RNAi (C and E) were stained for Diap1 (B and C) or ex (D and E). Note the reduction of Diap1 and ex levels upon kto RNAi. The complete genotypes are UAS-Dicer2; en-Gal4 UAS-GFP (B and D) and UAS-Dicer2; en-Gal4 UAS-GFP/UAS-ktoRNAi (C and E).

Fig. 3.5. skd and kto are required for Hippo-mediated target gene expression.

Wing discs containing GFP-marked MARCM clones were stained for Diap1 (red). For each genotype, the left-most panel shows low magnification view of the wing disc

(C), hpo mutant with skd RNAi (D), kto RNAi (E), and hpo mutant with kto RNAi (F).

Note the increased Diap1 levels in hpo mutant clones and the decreased Diap1 levels in skd RNAi or kto RNAi clones. Also, note the decreased Diap1 levels in hpo mutant clones with skd RNAi or kto RNAi.

Fig. 3.6. RNAi knockdown of Cdk8 or CycC does not change the expression of the

Hippo target gene diap1.

Wing discs expressing UAS-GFP only (A), UAS-GFP plus Cdk8 RNAi (B-D), UAS-

GFP plus CycC RNAi (E-F) were stained for Diap1. The complete genotypes are UAS-

Dicer2; en-Gal4 UAS-GFP (A), UAS-Dicer2; en-Gal4 UAS-GFP/UAS-Cdk8RNAi (I)-

(III) (B-D), and UAS-Dicer2; en-Gal4 UAS-GFP/UAS-CycCRNAi (I)-(II) (E-F).

References

Akoulitchev, S., Chuikov, S., and Reinberg, D. (2000). TFIIH is negatively regulated by cdk8-containing mediator complexes. Nature 407, 102-106.

Bjorklund, S., and Gustafsson, C.M. (2005). The yeast Mediator complex and its regulation. Trends Biochem Sci 30, 240-244.

Black, J.C., Choi, J.E., Lombardo, S.R., and Carey, M. (2006). A mechanism for coordinating chromatin modification and preinitiation complex assembly. Mol Cell 23,

809-818.

Boube, M., Faucher, C., Joulia, L., Cribbs, D.L., and Bourbon, H.M. (2000). Drosophila homologs of transcriptional mediator complex subunits are required for adult cell and segment identity specification. Genes & Development 14, 2906-2917.

Carrera, I., Janody, F., Leeds, N., Duveau, F., and Treisman, J.E. (2008). Pygopus activates Wingless target gene transcription through the mediator complex subunits

Med12 and Med13. P Natl Acad Sci USA 105, 6644-6649.

Chen, J.D., Ezzeddine, N., Waltenspiel, B., Albrecht, T.R., Warren, W.D., Marzluff,

W.F., and Wagner, E.J. (2012). An RNAi screen identifies additional members of the

Drosophila Integrator complex and a requirement for cyclin C/Cdk8 in snRNA 3 '-end formation. Rna 18, 2148-2156.

Conaway, R.C., and Conaway, J.W. (2011). Function and regulation of the Mediator complex. Curr Opin Genet Dev 21, 225-230.

Conaway, R.C., Sato, S., Tomomori-Sato, C., Yao, T., and Conaway, J.W. (2005). The mammalian Mediator complex and its role in transcriptional regulation. Trends Biochem

Sci 30, 250-255.

Ding, N., Tomomori-Sato, C., Sato, S., Conaway, R.C., Conaway, J.W., and Boyer, T.G.

(2009). MED19 and MED26 Are Synergistic Functional Targets of the RE1 Silencing

Transcription Factor in Epigenetic Silencing of Neuronal Gene Expression. Journal of

Biological Chemistry 284, 2648-2656.

Ding, N., Zhou, H., Esteve, P.O., Chin, H.G., Kim, S., Xu, X., Joseph, S.M., Friez, M.J.,

Schwartz, C.E., Pradhan, S., et al. (2008). Mediator links epigenetic silencing of neuronal gene expression with x-linked mental retardation. Mol Cell 31, 347-359.

Donner, A.J., Ebmeier, C.C., Taatjes, D.J., and Espinosa, J.M. (2010). CDK8 is a positive regulator of transcriptional elongation within the serum response network. Nat Struct Mol

Biol 17, 194-U199.

Englert, N.A., Luo, G., Goldstein, J.A., and Surapureddi, S. (2015). Epigenetic modification of histone 3 lysine 27: mediator subunit MED25 is required for the dissociation of polycomb repressive complex 2 from the promoter of cytochrome P450

2C9. J Biol Chem 290, 2264-2278.

Gobert, V., Osman, D., Bras, S., Auge, B., Boube, M., Bourbon, H.M., Horn, T., Boutros,

M., Haenlin, M., and Waltzer, L. (2010). A Genome-Wide RNA Interference Screen

Identifies a Differential Role of the Mediator CDK8 Module Subunits for GATA/RUNX-

Activated Transcription in Drosophila. Mol Cell Biol 30, 2837-2848.

Guglielmi, B., Soutourina, J., Esnault, C., and Werner, M. (2007). TFIIS elongation factor and Mediator act in conjunction during transcription initiation in vivo. P Natl Acad

Sci USA 104, 16062-16067.

Guruharsha, K.G., Rual, J.F., Zhai, B., Mintseris, J., Vaidya, P., Vaidya, N., Beekman, C.,

Wong, C., Rhee, D.Y., Cenaj, O., et al. (2011). A Protein Complex Network of

Drosophila melanogaster. Cell 147, 690-703.

Hengartner, C.J., Myer, V.E., Liao, S.M., Wilson, C.J., Koh, S.S., and Young, R.A.

(1998). Temporal regulation of RNA polymerase II by Srb10 and Kin28 cyclin- dependent kinases. Mol Cell 2, 43-53.

Janody, F., Martirosyan, Z., Benlali, A., and Treisman, J.E. (2003). Two subunits of the

Drosophila mediator complex act together to control cell affinity. Development 130,

3691-3701.

Janody, F., and Treisman, J.E. (2011). Requirements for Mediator Complex Subunits

Distinguish Three Classes of Notch Target Genes at the Drosophila Wing Margin. Dev

Dynam 240, 2051-2059.

Kato, Y., Habas, R., Katsuyama, Y., Naar, A.M., and He, X. (2002). A component of the

ARC/Mediator complex required for TGF beta/Nodal signalling. Nature 418, 641-646.

Kim, Y.J., and Lis, J.T. (2005). Interactions between subunits of Drosophila mediator and activator proteins. Trends Biochem Sci 30, 245-249.

Knuesel, M.T., Meyer, K.D., Bernecky, C., and Taatjes, D.J. (2009). The human CDK8 subcomplex is a molecular switch that controls Mediator coactivator function. Genes &

Development 23, 439-451.

Koontz, L.M., Liu-Chittenden, Y., Yin, F., Zheng, Y., Yu, J., Huang, B., Chen, Q., Wu,

S., and Pan, D. (2013). The Hippo effector Yorkie controls normal tissue growth by antagonizing scalloped-mediated default repression. Dev Cell 25, 388-401.

Kuuluvainen, E., Hakala, H., Havula, E., Sahal Estime, M., Ramet, M., Hietakangas, V., and Makela, T.P. (2014). Cyclin-dependent kinase 8 module expression profiling reveals requirement of mediator subunits 12 and 13 for transcription of Serpent-dependent innate immunity genes in Drosophila. J Biol Chem 289, 16252-16261.

Lee, J.H., Bassel-Duby, R., and Olson, E.N. (2014). Heart- and muscle-derived signaling system dependent on MED13 and Wingless controls obesity in Drosophila. P Natl Acad

Sci USA 111, 9491-9496.

Lee, T., and Luo, L. (1999). Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron 22, 451-461.

Loncle, N., Boube, M., Joulia, L., Boschiero, C., Werner, M., Cribbs, D.L., and Bourbon,

H.M. (2007). Distinct roles for Mediator Cdk8 module subunits in Drosophila development. EMBO J 26, 1045-1054.

Malik, S., Barrero, M.J., and Jones, T. (2007). Identification of a regulator of transcription elongation as an accessory factor for the human Mediator coactivator. P

Natl Acad Sci USA 104, 6182-6187.

Malik, S., and Roeder, R.G. (2010). The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation. Nature Reviews Genetics 11, 761-772.

Mao, F.F., Yang, X.F., Fu, L., Lv, X.D., Zhang, Z., Wu, W.Q., Yang, S.Q., Zhou, Z.C.,

Zhang, L., and Zhao, Y. (2014). The Kto-Skd Complex Can Regulate ptc Expression by

Interacting with Cubitus interruptus (Ci) in the Hedgehog Signaling Pathway. Journal of

Biological Chemistry 289, 22333-22341.

Sharma, D., and Fondell, J.D. (2002). Ordered recruitment of histone acetyltransferases and the TRAP/Mediator complex to thyroid hormone-responsive promoters in vivo. P

Natl Acad Sci USA 99, 7934-7939.

Treisman, J. (2001). Drosophila homologues of the transcriptional coactivation complex subunits TRAP240 and TRAP230 are required for identical processes in eye-antennal disc development. Development 128, 603-615. van de Peppel, J., Kettelarij, N., van Bakel, H., Kockelkorn, T.T.J.P., van Leenen, D., and

Holstege, F.C.P. (2005). Mediator expression profiling epistasis reveals a signal transduction pathway with antagonistic submodules and highly specific downstream targets. Mol Cell 19, 511-522.

Villano, J.L., and Katz, F.N. (1995). 4-Jointed Is Required for Intermediate Growth in the

Proximal-Distal Axis in Drosophila. Development 121, 2767-2777.

Yin, F., Yu, J.Z., Zheng, Y.G., Chen, Q., Zhang, N.L., and Pan, D.J. (2013). Spatial

Organization of Hippo Signaling at the Plasma Membrane Mediated by the Tumor

Suppressor Merlin/NF2. Cell 154, 1342-1355.

Chapter 4

Discovery of Yki target genes by integrating RNA-seq and ChIP-seq in Drosophila

S2 cells

Introduction

As described in the first chapter, the Yki target genes are crucial, as they are directly responsible for Hippo pathway related phenotypes. Although some direct target genes of

Yki have been identified, the full set of Yki target genes is not completely known. Some efforts have been put into the identification of the genome-wide Yki binding sites on

DNA using ChIP-seq (Oh et al., 2013). Without the information of gene expression, it is hard to draw a conclusion about the real Yki target genes. Here I have identified genes whose expression is down-regulated by Yki, using RNA-seq combined with RNA interference as well as the ChIP-seq data, to provide further evidence of the Yki target genes in Drosophila cells.

Materials and Methods

RNAi interference and RNA-seq

S2 cells (Invitrogen) were cultured in 25-degree incubator in 6-well plates. The knockdown efficiency of Yki was optimized. The cells were transfected with dsRNA using the Effectene reagent (QIAGEN) (Zhou et al., 2013), and cell pellets were collected

5 days after transfection. Two replicates were performed at different time points for dsRNAs targeting Yki, GFP along with the WT control, respectively. RNA was extracted using RNeasy Plus (QIAGEN). Library was prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina). DNA was then sequenced using the Illumina HiSeq

2500.

Primers for synthesizing Yki dsRNA (Zhang and Cohen, 2013) :

Forward:

CACTTAATACGACTCACTATAGGGAGACAGCAGCCAACAATCCGAATG

Reverse:

CACTTAATACGACTCACTATAGGGAGATCATTCTGCTTTATTCGCTCG

RNA-seq analysis

Mapping of the sequencing reads to the Drosophila genome (UCSC, dm3) was performed using Tophat2 (Kim et al., 2013). The quality of the reads was examined using samtools and Picard tools. Reads that mapped to the mitochondrial DNA were removed and reads with quality scores that equal to 50 were kept. Count-based differential analysis

83 of gene expression was performed (Anders et al., 2013), considering the total output of the locus without the potential presence of isoform diversity. The tool htseq-count of the

Python package HTSeq was used under the default union-counting mode to count the number of reads in individual genes. DESeq2 (Love et al., 2014) was applied to discover the differentially expressed genes. The genes that have mean counts greater than 0.5 were kept. Adjusted p-value of 0.05 was set as a cutoff value; genes with log2 fold change

(comparing Yki knockdown to WT) smaller than -0.5 or bigger than 0.5 were considered as hits.

ChIP-seq analysis

The sequencing reads from ChIP-seq data (GSE46305) (Oh et al., 2014) were mapped to the Drosophila genome (UCSC, dm6) by Bowtie2. The quality of the reads was examined using samtools and Picard tools; reads with quality scores bigger than 10 were kept. Peaks were called by comparing two ChIP samples (Yki anti-sera associated chromatin) to the control sample (input chromatin) using Macs2 (Zhang et al., 2008b) with a q-value cutoff of 1×10-5. The genomic coordinates of the Yki peaks from the previously analyzed results (Oh et al., 2014) using the same data were converted from dm3 to dm6 using the UCSC liftOver tool. For the above two peak sets, overlapping significance was examined with hypergeometric test, and the p-value was generated (Zhu et al., 2010). The peaks were annotated with gene symbols using the “ChIPseeker” (Yu et al., 2015b) and “org.Dm.eg.db” packages in R.

Integrating the RNA-seq and ChIP-seq Data

The Gene Set Enrichment Analysis (GSEA) preranked list was generated from the hits of the RNA-seq experiments based on the log2 fold change of the expression level. Genes with the biggest decreased expression were ranked top. Gene sets were constructed with

Yki binding genes and non-Yki binding genes from the ChIP-Seq data. The analysis was performed using 1,000 permutations to calculate enrichment significance.

Results and discussions

To explore genes whose expression is regulated by Yki, I conducted expression analysis by RNA sequencing (RNA-seq) combined with RNA interference (RNAi) using

Drosophila S2 cells. Cells were treated with dsRNAs targeting mRNAs of Yki and GFP

(Fig. 4.1.A). Cells with the same manipulation except for adding any dsRNA were the

WT control. Comparing Yki knockdown with the WT control, 278 genes were identified as top differentially expressed genes, including 117 up-regulated and 161 down-regulated genes. As a control, when the GFP knockdown experiment is compared with the WT using the same cutoff criteria, no differentially expressed gene was discovered, suggesting that there are no false positives generated from the RNAi procedure.

To understand the Yki binding regions in S2 cells, in-house ChIP-Seq analysis procedures were performed to analyze the reported Yki ChIP-Seq data (Oh et al., 2014).

The results were then compared with the previously published peak list generated from the same Yki ChIP-Seq data (Oh et al., 2014). 1497 out of 1523 Yki binding peaks from in-house analysis were enriched in the published Yki ChIP-seq peak list (p<0.00001); this published Yki ChIP-seq peak list was therefore used for the following analysis.

The Yki binding peaks were annotated by gene symbols. The individual differentially expressed genes from the RNA-seq experiments were examined to determine whether they co-existed on the list of Yki binding genes from the ChIP-Seq experiments.

To determine whether the gene list of Yki binding is correlated with the transcriptional change when Yki is knocked down, Gene Set Enrichment Analysis (GSEA) was performed (Subramanian et al., 2005). Indeed, genes with decreased expression in Yki

86 knockdown cells were highly enriched for Yki binding genes (p<0.00001) (Fig. 4.1.C).

Interestingly, genes with increased expression in Yki knockdown cells were also highly enriched in non-Yki binding genes (p<0.00001).

It is of note that the raw reads from the RNA-seq experiments are highly duplicated (10 million reads (~20%-24%) remain if deduplicated), indicating potential over-sequencing problems. But since we are interested in the differentially expressed genes, we still kept the raw data sets for the following analysis. The mapping rates are high (~96%), and

~15% of the mapped reads aligned multiple times. The uniquely mapped reads were kept.

For the differential analysis using DESeq2, lowly expressed genes were removed (mean expression smaller than or equal to 0.5 for 4 samples), resulting 11432 out of 16612 genes (69%) left for further analysis.

From the genes whose expression is down-regulated when Yki is depleted, Yki is ranked as the top one gene (log2 fold change: -1.86; adjusted P-value: 1.71×10-39), which confirms the depletion of Yki. By intersecting the ChIP-seq peak list and the top decreased expressed genes from the RNA-seq, some interesting genes were discovered

(Table 3.1.). Among these genes, classical target genes like Diap1 were not present, which may be due to incomplete Yki depletion. However, our data did detect the classical target kibra (Genevet et al., 2010a), and another Hippo pathway downstream regulator

Tgi. Some other interesting genes were also discovered, like the genes that are responsible for metabolic processes, including enzymes like glutathione S-transferases

GstE2 and GstD1, and Glucose-6-phosphate dehydrogenase Zw. These genes may provide implications for possible novel functions of the Hippo signaling pathway. Further experiments like RT-PCR (to verify the gene expression data) and ChIP-qPCR (to verify

87 the ChIP-seq data) should be conducted to verify the target genes generated from this analysis.

Figures

Fig. 4.1. RNA-seq analysis of gene expression changes in Drosophila S2 cells followed by depletion of Yki

(A) Western blotting with the antibody against Yki after treatment of the indicated dsRNAs. The actin bands serve as loading controls.

(B) Log2 fold change of gene expression is plotted against the mean gene expression (normalized counts of the mapped reads), comparing Yki knockdown and the WT control. Red points represent the genes with adjusted p-value <0.01.

(C) GSEA of the correlation between Yki binding and expression changes. Genes were ordered according to the fold change. Genes that decrease in Yki knockdown are significantly enriched for Yki binding genes (Enrichment Score (ES) = 0.2595672; p<0.00001; FDR q-value <0.00001).

A dsYkidsGFP WT

Yki

actin

C Yki Gene Set Enrichment Analysis

Enrichment Score (ES)

Downregulated in Yki knockdown

Ranked List Metric

Upregulated in Yki knockdown

Rank in Ordered Dataset

Table.4.1. List of Yki binding genes that are downregulated when Yki is depleted

Gene log2 Fold Adjusted Gene log2 Fold Adjusted symbol Change P-value symbol Change P-value GstE2 -1.565 1.23787E-24 Pde8 -0.642 3.28497E-08 nkd -1.400 9.38583E-20 CR45108 -0.639 0.000438594 Ncc69 -1.370 5.98021E-17 sog -0.626 5.80114E-06 CG14253 -1.342 3.22627E-33 CG2065 -0.622 1.60994E-05 aru -1.232 2.62514E-09 CG10639 -0.610 5.62665E-07 CG6836 -1.187 1.6298E-12 CG7408 -0.610 0.000157122 Galt -1.116 3.49761E-14 AGBE -0.594 1.92055E-08 Galphaf -1.057 1.25585E-06 GstE8 -0.593 3.31038E-07 GstE3 -1.046 5.9209E-12 Reg-2 -0.588 3.70142E-05 Zw -1.043 1.7167E-13 Chd64 -0.581 7.76536E-07 kibra -1.029 1.32776E-18 Atf3 -0.580 4.35544E-06 CG9331 -1.017 7.27034E-16 Indy -0.579 2.23083E-08 mfas -0.972 7.89259E-17 CG31710 -0.571 0.019674989 Tgi -0.956 2.0129E-13 CG11357 -0.569 1.06666E-07 ClC-a -0.955 1.17533E-17 Inos -0.565 5.12232E-09 CG5001 -0.912 8.94109E-08 CG9416 -0.564 1.43711E-07 CG31038 -0.910 1.82047E-10 CecB -0.562 0.023402537 CG32425 -0.881 1.05532E-14 lbm -0.560 0.010677393 Oscillin -0.847 2.83451E-08 CG42788 -0.555 1.16301E-05 mdy -0.833 2.37201E-05 CG31098 -0.554 4.79715E-05 CG42663 -0.818 1.96547E-09 Syx4 -0.553 0.006393094 CG33056 -0.814 7.23071E-11 Tret1-1 -0.551 6.22261E-07 Glycogenin -0.802 2.32836E-12 AnxB10 -0.549 5.62665E-07 fax -0.796 0.00054259 CG3940 -0.548 0.033287189 pyd3 -0.793 3.55632E-12 CG10737 -0.546 6.28613E-07 Swim -0.768 5.10329E-12 Tsf3 -0.546 0.000827021 Spn42Db -0.765 0.001396986 kermit -0.545 0.000229723 CG7778 -0.758 1.00943E-09 RhoGDI -0.545 8.38515E-08 GstD1 -0.752 5.74444E-15 CG11961 -0.537 2.00957E-06 Pax -0.731 2.49706E-12 S6k -0.534 6.22261E-07 yellow-f -0.721 5.34461E-13 CG43143 -0.532 0.005192013 CG9328 -0.719 1.4313E-09 GstE12 -0.530 1.19665E-05 Cat -0.715 2.63869E-11 CG43340 -0.525 0.00843699 CG6656 -0.686 8.41816E-05 Gale -0.522 5.62665E-07 ppa -0.678 0.000168599 Act42A -0.519 1.21937E-06 GstE7 -0.677 6.22944E-10 CG8177 -0.519 0.000231294 grass -0.669 7.62515E-05 pinta -0.516 0.001953441 CG11739 -0.661 1.45774E-05 c(2)M -0.516 0.029687982 CG10960 -0.660 3.37759E-11 CecA1 -0.515 0.028056136 CG9743 -0.658 2.02706E-06 CG8080 -0.514 0.01453345 CG42240 -0.648 0.000203612 Adgf-A -0.507 0.002552204 CG42806 -0.647 0.00014442 CG10863 -0.501 0.001160058

References

Anders, S., McCarthy, D.J., Chen, Y., Okoniewski, M., Smyth, G.K., Huber, W., and

Robinson, M.D. (2013). Count-based differential expression analysis of RNA sequencing data using R and Bioconductor. Nat Protoc 8, 1765-1786.

Genevet, A., Wehr, M.C., Brain, R., Thompson, B.J., and Tapon, N. (2010a). Kibra Is a

Regulator of the Salvador/Warts/Hippo Signaling Network. Dev Cell 18, 300-308.

Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013).

TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14.

Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15.

Oh, H., Slattery, M., Ma, L., Crofts, A., White, K.P., Mann, R.S., and Irvine, K.D. (2013).

Genome-wide association of Yorkie with chromatin and chromatin-remodeling complexes. Cell Rep 3, 309-318.

Oh, H., Slattery, M., Ma, L., White, K.P., Mann, R.S., and Irvine, K.D. (2014). Yorkie promotes transcription by recruiting a histone methyltransferase complex. Cell Rep 8,

449-459.

Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A.,

Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al. (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545-15550.

Yu, G., Wang, L.G., and He, Q.Y. (2015b). ChIPseeker: an R/Bioconductor package for

ChIP peak annotation, comparison and visualization. Bioinformatics 31, 2382-2383.

Zhang, W., and Cohen, S.M. (2013). The Hippo pathway acts via p53 and microRNAs to control proliferation and proapoptotic gene expression during tissue growth. Biol Open 2,

822-828.

Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E.,

Nussbaum, C., Myers, R.M., Brown, M., Li, W., et al. (2008b). Model-based Analysis of

ChIP-Seq (MACS). Genome Biol 9.

Zhou, R., Mohr, S., Hannon, G.J., and Perrimon, N. (2013). Inducing RNAi in

Drosophila cells by transfection with dsRNA. Cold Spring Harb Protoc 2013, 461-463.

Zhu, L.J., Gazin, C., Lawson, N.D., Pages, H., Lin, S.M., Lapointe, D.S., and Green, M.R.

(2010). ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 11, 237.

CURRICULUM VITAE

Educational History: Ph.D. 2016 Program in the Biochemistry, Cellular Johns Hopkins expected and Molecular Biology (BCMB) University School Mentor: Duojia Pan Ph.D. of Medicine M.H.S. 2016 Health Science in Biostatistics Johns Hopkins Bloomberg School of Public B.S. 2010 Biosciences University of Science and Technology of China Professional Experience: Research 2011/05-2016/06 Lab of Duojia Pan Johns Hopkins assistant University Summer Intern 2015/06-2015/08 Functional Genentech Genomics/Discovery oncology Summer 2009/07-2010/06 Lab of Xiaodong Wang National Institute of intern; and Xiaoguang Lei Biological Sciences, research Beijing assistant Research 2008/10-2009/06 Lab of Xuebiao Yao University of Science assistant and Technology of China

Selected Awards and Honors:

 2016 Paul Ehrlich Award (Johns Hopkins Young Investigators’ Award)  2015 Nominee, Chinese Government Award for Outstanding Self-Financed Students Abroad  2010-2012 Fellowship, BCMB Graduate Program, Johns Hopkins University  2010 Undergraduate merit award of the university and the province (3%)  2009 Outstanding Student Scholarship  2008 Zhang Zongzhi Sci-Tech Scholarship  2007 Outstanding Student Scholarship  2006 Outstanding Freshman Scholarship

Peer Reviewed Publications: Deng, H., Wang, W., Yu, J., Zheng, Y., Qing, Y., and Pan, D. (2015). Spectrin regulates Hippo signaling by modulating cortical actomyosin activity. eLife 2015;4:e06567. Qing, Y., Yin, F., Wang, W., Zheng, Y., Guo, P., Schozer, F., Deng, H., and Pan, D. (2014) The Hippo effector Yorkie activates transcription by interacting with a histone methyltransferase complex through Ncoa6. eLife 2014;3:e02564.

Conferences and presentations:

 2016 Poster presentation, the Johns Hopkins Young Investigators’ Day (invited)  2016 57th Annual Drosophila Research Conference at TAGC, Orlando, FL (selected for poster presentation; withdrawn)  2014 HHMI Science Meeting, Chevy Chase, Maryland (invited)  2013 54th Annual Drosophila Research Conference, Washington, D.C.  2011 Poster award (2nd prize), BCMB graduate program recruitment event

Services and leadership:

 2011-2013 Graduation Representative of Graduate Student Association (GSA), Johns Hopkins University School of Medicine  Organized nomination of the marshals, teaching award recipient and student speaker in the graduation ceremony  2011-2012 member of the BCMB lecture committee  Helped to nominate the outside speakers