Effects of Timolol on MYOC, OPTN, and WDR36 RNA Levels

OPHTHALMIC MOLECULAR GENETICS

SECTION EDITOR: JANEY L. WIGGS, MD, PhD Effects of Timolol on MYOC, OPTN, and WDR36 RNA Levels

Frank W. Rozsa, PhD; Kathleen Scott, BS; Hemant Pawar, PhD; Sayoko Moroi, MD, PhD; Julia E. Richards, PhD

Objectives: To evaluate if timolol affects expression of dexamethasone, and dexamethasone plus timolol had a neg- 3 open-angle glaucoma genes and to study its ability to ligible effect on OPTN and WDR36 RNA levels. modulate dexamethasone-induced up-regulation of MYOC. Conclusions: Timolol can reduce MYOC RNA levels in HTM cultures from some individuals. Timolol does not Methods: We used quantitative polymerase chain re- alter OPTN or WDR36 levels or ameliorate MYOC induc- action assay of glaucoma gene transcript levels from hu- tion by dexamethasone in vitro. man trabecular meshwork (HTM) cultures exposed to 3 different doses of timolol. Three HTM cell cultures were Clinical Relevance: It remains to be determined whether grown with or without 1 of 3 timolol doses in the pres- timolol could reduce production of misfolded myocilin ence or absence of dexamethasone. protein by HTM cells in individuals with MYOC missense mutations. A broader survey of interindividual varia- Results: All 3 concentrations of timolol reduced MYOC tion in response to timolol as well as mechanistic stud- RNA levels in 1 HTM culture compared with an untreated ies are still needed before potential therapeutic control and showed negligible effects in the other 2 cul- implications can be explored. tures. Timolol had no effect on dexamethasone-induced MYOC transcript levels in any of the 3 cultures. Timolol, Arch Ophthalmol. 2008;126(1):86-93

LAUCOMA IS A MAJOR fects on trabecular meshwork cells.13-16 Al- cause of blindness world- though the clinical effects of timolol on wide.1 Although the IOP reduction are well established, little pathogenesis of glau- is known about the potential effects of coma is not known, this timolol on expression of glaucoma genes. diseaseG is characterized by excavation of If induction of glaucoma genes has the po- the optic nerve, resulting in progressive vi- tential to affect disease pathologic fea- sual field loss that can lead to blindness. tures, then it is important to know whether Four major prospective glaucoma clini- glaucoma medications used to treat pa- cal trials have demonstrated that el- tients can affect expression levels of glau- evated intraocular pressure (IOP) is a risk coma gene transcripts or products in rel- factor for glaucoma progression.2-5 Both evant tissue types. lowering IOP to an appropriate target level6 There are 3 known open-angle glau- and minimizing IOP fluctuation while re- coma (OAG) genes, myocilin (MYOC, Men- ceiving glaucoma treatment2,7 are impor- delian Inheritance of Man [MIM] 601652), tant glaucoma treatment outcomes. optineurin (OPTN, MIM 602432), and WD A glaucoma medical therapy com- repeat-containing protein 36 (WDR36,MIM monly used to lower IOP is timolol, a non- 609669).17-21 Induction of MYOC has been selective ␤-adrenergic receptor antago- observed in a cell culture model of steroid nist or ␤-blocker. The main mechanism of glaucoma22 and in native human trabecu- action of the ␤-blockers is to decrease lar meshwork (HTM) from patients with aqueous humor flow,8 resulting in lower- primary and secondary OAG23; however, it Author Affiliations: ing IOP. Although the primary IOP- is not known whether problems resulting Departments of Ophthalmology 24,25 and Visual Sciences (Drs Rozsa, lowering effects of timolol do not operate from misfolded myocilin protein can be 9 ␤ Pawar, Moroi, and Richards and on trabecular outflow, -adrenergic re- aggravated by increased expression in in- Ms Scott) and Epidemiology ceptors are present on trabecular mesh- dividuals with MYOC missense mutations. (Dr Richards), University of work cells.10-12 Long-term use of timolol Little is known about conditions that might Michigan, Ann Arbor. causes functional and morphological ef- influence levels of expression of OPTN and

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 86

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 WDR36 or whether individuals with specific glaucoma gene mutations respond differently to specific therapies. Table 1. Primers Used for PCR and/or Sequencing Herein we present data on transcript levels of 3 OAG of EIF4E, GAPDH, MYOC, OPTN, and WDR36 genes, MYOC, OPTN, and WDR36, in response to timo- ؅ ؅ lol in primary cultures of HTM cells. We also evaluate Gene Primer Sequence (5 to 3 ) Orientation Use the effect of timolol on transcript levels in the presence EIF4E GTGATGATGTATGTGGCGCTG (Forward) qPCR of dexamethasone. We present evidence that timolol has GCTTGACGCAGTCTCCTATGA (Reverse) GAPDH AAGGTGAAGGTCGGAGTCAAC (Forward) qPCR a variable effect on MYOC levels in the absence of dexa- CCTGGAAGATGGTGATGGGAT (Reverse) methasone and that expression of OPTN and WDR36 un- MYOC TATCTCAGGAGTGGAGAGGGA (Forward) qPCR dergo little change in the presence of either of the thera- CTGGCTGATGAGGTCATACTC (Reverse) peutic agents tested. OPTN AAGGAGCAACTGGCATTGCAG (Forward) qPCR TATGTCAGGCAGAACCTCTCC (Reverse) WDR36 GACACTGCTCTCAACCTTCTG (Forward) qPCR METHODS AGGAGTACTGGCTCTGAAGGA (Reverse) MYOC CAGGCTTAACTGCAGAACCA (Forward) PCR CELL CULTURES promoter CTGAAGGTATACTGGCATCG (Reverse) MYOC ACTGTGTTTCTCCACTCTGG (Forward) Sequencing promoter TTCTGAGAAGAGTTCCCCAG (Forward) Eyes were obtained from the Michigan Eye Bank (Ann Arbor), CTGGGGAACTCTTCTCAGAA (Reverse) which carried out informed consent and confirmed that none GTACACACACTTACACCAGG (Reverse) of the donors had been diagnosed with glaucoma. These stud- TGGTCATTGGCCTTCCTGA (Reverse) ies were carried out according to a protocol approved by the University of Michigan institutional review board for human Abbreviations: PCR, polymerase chain reaction; qPCR, quantitative PCR. subjects research. Primary cell cultures of HTM cells, designated HTM10M, HTM12F, and HTM17F, were grown from HTM tissue samples RNA using intron-spanning primers (Table 1) and an interca- from a 10-year-old white boy (HTM10M), a 12-year-old white lating dye in iQ SYBR Green Supermix reaction mixture (Bio- girl (HTM12F), and a 17-year-old white girl (HTM17F).26 The Rad Laboratories, Hercules, California). Thermal cycling con- subject previously listed as being 16 years old26,27 has been re- ditions were 10 minutes at 95°C followed by 45 cycles of 30 assigned an age of 10 years based on review of records. Cor- seconds at 95°C, 30 seconds at 58°C, 30 seconds at 75°C, and neoscleral buttons28 were transferred to Optisol29 at 9 hours, 6 a final extension step for 6 minutes at 72°C performed in an hours 45 minutes, and 13 hours 25 minutes post mortem, re- iCycler (BioRad) with an optical module. Each PCR product spectively. Human trabecular meshwork was dissected from the was confirmed to be a single band by melt curve analysis and corneoscleral button and cultured as previously described.26 visualization on agarose gel (data not shown). Six replicates Deaths of all 3 donors were accidental and the Michigan Eye were performed for each gene and condition assayed, except Bank considered their medical and ocular histories to be un- for the MYOC gene where 6 replicates were carried out from remarkable. Cells from the fifth passage were grown in Dul- each of 2 different culture wells for each timolol concentra- becco modified Eagle medium containing 15% fetal calf se- tion in the timolol-only experiment. Cycle threshold (C ) val- rum, supplemented with 1 ng/mL of basic fibroblast growth T ues were determined using iCycler Optical System Software 3.0 factor (bFGF) at 37°C under 10% carbon dioxide to conflu- (BioRad) with the default settings for a PCR baseline sub- ency, after which the cells were maintained for 1 week in 10% tracted curve fit model. The glyceraldehyde 3-phosphate de- fetal calf serum without bFGF. Cells were incubated at 0.1µM, hydrogenase gene (GAPDH) values showed little variation across 1.0µM, or 10µM timolol30 with 100nM dexamethasone,19 com- all samples (absolute C range, 15.62-17.42; mean, 16.38) and binations of both drugs, or vehicle in Dulbecco modified Eagle T did not vary substantially in response to different treatment con- medium containing 10% fetal calf serum without bFGF for 21 ditions when normalized to the eukaryotic translation initia- days, with media changes 3 times per week. The 21-day pe- tion factor 4E gene (EIF4E) as the control. riod that we used in previous dexamethasone experiments26,27 was selected as a model for long-term treatment. A 1555–base pair (bp) region containing 1400 bp immedi- STATISTICAL ANALYSIS ately 5Ј to the reported MYOC translation start site was ampli- fied by polymerase chain reaction (PCR) (Table 1) and se- The fold change for MYOC, WDR36, and OPTN levels in drug- quenced as previously reported.26 No sequence changes were treated cell cultures relative to levels in untreated cell cultures detected in the MYOC coding region or splice sites for any of used values normalized to GAPDH control levels. The mean (SD) 26 the 3 HTM cell cultures, as previously described. CT for replicates of each individual cell culture and the com- Total RNA was prepared from cells harvested using Trizol posite average of 3 cell cultures were calculated for each gene. (Invitrogen, Carlsbad, California) and purified over RNAeasy col- The CT is exponentially related to copy number, with error bars -⌬⌬C umns (Qiagen, Valencia, California) according to the manufac- represented by the fold change calculation (2 T) plus and mi- turer’s protocol. The RNA quality and quantity were evaluated nus the standard deviation. by spectrophotometry and gel electrophoresis. Total RNA was reverse transcribed to complementary DNA (cDNA) using the RESULTS High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, California) according to the manufacturer’s directions. Three HTM cultures were grown with no drug, with timo- QUANTITATIVE PCR lol, with timolol plus dexamethasone, or with dexamethasone. Levels of gene transcripts were evaluated by quan- Transcript levels were evaluated by quantitative PCR using the titative PCR and comparisons were made between transcript comparative threshold method. The PCR reactions were car- levels under the different treatments for each cell culture ried out on cDNA templates corresponding to 16.66 ng of total and for the composite data for each cell culture.

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 87

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 When considered separately, the 3 individual HTM A MYOC cultures responded differently to timolol (Figure 2). For 30.0 GAPDH samples treated with timolol only, MYOC levels changed 25.0 substantially, relative to untreated samples, for HTM10M but showed no appreciable change for HTM17F or 20.0 T HTM12F (Figure 2A and B). For HTM10M, the MYOC 15.0 level dropped by more than 11-fold in response to 0.1µM Mean C 10.0 timolol, 9.2-fold in response to 1µM timolol, and 5.6-

5.0 fold in response to 10µM timolol, with error bars over- lapping between the 3 conditions. HTM17F and HTM12F 0.0 Timolol None 0.1µM 1.0µM 10µM 0.1µM 1.0µM 10µM None showed less than 2-fold change in response to any timo- Dexamethasone None None None None 100nM 100nM 100nM 100nM lol concentration. The 3 separate HTM cultures ex- pressed different baseline levels of MYOC RNA as well B OPTN as different levels of response to dexamethasone 30.0 GAPDH (Figure 2A). The selective effect of timolol on HTM10M 25.0 did not represent an unusually high baseline level being restored to normal since HTM10M started out with the 20.0 T lowest baseline level and then dropped even further in 15.0 response to timolol (Figure 2). Error bars indicate that Mean C 10.0 the variability in the data for each cell culture and condition is low, with increased variability for the com- 5.0 bined data reflecting that data have been combined from 0.0 cell cultures that individually produce very different val- Timolol None 0.1µM 1.0µM 10µM 0.1µM 1.0µM 10µM None Dexamethasone None None None None 100nM 100nM 100nM 100nM ues (Figure 1A and Figure 2).

OPTN AND WDR36 RNA LEVELS C WDR36 30.0 GAPDH

25.0 OPTN CT values for each of the 3 timolol concentrations were comparable with the mean normalized CT values 20.0

T for the untreated cells, with differences in RNA levels be- 15.0 tween treated and untreated conditions falling with the

Mean C 10.0 range of experimental error (Figure 1B). The 3 cell cultures not only showed a similar lack of response but also 5.0 showed similar baseline values when untreated 0.0 (Figure 3A). For each HTM culture, there were negli- Timolol None 0.1µM 1.0µM 10µM 0.1µM 1.0µM 10µM None Dexamethasone None None None None 100nM 100nM 100nM 100nM gible differences between cell cultures treated with dexamethasone and the same cell culture treated with dexamethasone plus timolol (Figure 3B and C). For all Figure 1. Mean gene expression levels for human trabecular meshwork samples HTM10M, HTM12F, and HTM17F for MYOC (A), OPTN (B), and conditions tested, OPTN findings for each of the 3 sepa- WDR36 (C) with reference to GAPDH. Quantitative polymerase chain reaction rate HTM cultures agreed with the findings for the com- cycle threshold (CT) values indicate expression level on y-axis. Drug posite data set (Figure 3). We regard the differences ob- treatments are indicated on the x-axis. Error bars indicate standard deviation. served herein to be within the range of error of the experimental system. MYOC RNA LEVELS Similarly, we found that mean WDR36 CT values were unchanged by exposure to dexamethasone, timolol, or When data from the 3 HTM cultures were pooled, the the combination of the 2 (Figure 1C and Figure 4). In mean CT values for combined data for each condition addition, the values for the 3 different cell cultures were did not vary significantly across conditions, except that all comparable with each other and within the range of a much lower CT value for MYOC in the presence of experimental error (Figure 4). dexamethasone reflects the expected higher level of MYOC RNA in the presence of dexamethasone MYOC REGULATORY SEQUENCE VARIANTS (Figure 1A). MYOC response to dexamethasone did not appear to differ with the presence or absence of We carried out PCR amplification of a fragment contain- timolol or vary between different timolol concentra- ing 1550 bp of sequence 5Ј of the reported MYOC trans- tions (Figure 1A), while similar GAPDH values across lation start site19 and assigned genotypes for previously all cultures indicated that comparable amounts of RNA reported sequence variants31-37 at 10 positions across the were present in each sample. Inclusion of timolol along region (Table 2). We observed 2 apparent haplotypes, with dexamethasone gave a negligible difference in designated as haplotype 1, GACC13GTT, and haplo- MYOC RNA levels between cells grown with or without type 2, GGCC15ATT, consisting of variants at the posi- dexamethasone, whether evaluated for individual cul- tions of single-nucleotide polymorphisms and 1 length tures or composite data for all cultures (Figure 1A and polymorphism shown in Table 2. HTM10M and HTM12F Figure 2A and C). were both heterozygous across the region, each having

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 88

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 A Untreated 0.1µM Timolol + 0.1µM Dexamethasone 0.1µM Timolol 1.0µM Timolol + 0.1µM Dexamethasone 14.0 1.0µM Timolol 10.0µM Timolol + 0.1µM Dexamethasone 10.0µM Timolol 0.1µM Dexamethasone

12.0

10.0

8.0 )

GAPDH

– 6.0 MYOC ( T C ∆ 4.0

2.0

0.0

–2.0 HTM10M HTM12F HTM17F HTM(ALL) Cell Line

B C 9.0 9.0

7.0 7.0

5.0 5.0

3.0 3.0

1.0 1.0 Log2 (Fold Change) Log2 (Fold Change)

–1.0 –1.0

–3.0 –3.0

–5.O –5.O HTM10M HTM12F HTM17F HTM(ALL) HTM10M HTM12F HTM17F HTM(ALL) Cell Line Cell Line

Figure 2. MYOC expression in treated vs untreated human trabecular meshwork cultures HTM10M, HTM12F, and HTM17F and all cultures (HTM[ALL]). A, Mean

difference in cycle threshold (⌬CT)(MYOC−GAPDH ). B and C, Fold change in MYOC level (treated vs untreated) is shown in response to timolol (B) and dexamethasone plus timolol (C). Error bars indicate standard deviation.

both haplotype 1 and haplotype 2, while HTM17F was COMMENT homozygous for haplotype 1. Thus, across this proximal promoter region the haplotypes are the same for An important novel finding of this study is the substan- HTM10M and HTM12F and different for HTM17F tial reduction of MYOC expression in response to timo- (Table 2). lol in 1 of 3 cultures tested. When we look at the aver-

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 89

12.0

10.0

8.0 )

GAPDH

– 6.0 OPTN ( T C ∆ 4.0

2.0

0.0

–2.0 HTM10M HTM12F HTM17F HTM(ALL) Cell Line

B C 9.0 9.0

7.0 7.0

5.0 5.0

3.0 3.0

1.0 1.0 Log2 (Fold Change) Log2 (Fold Change)

–1.0 –1.0

–3.0 –3.0

–5.O –5.O HTM10M HTM12F HTM17F HTM(ALL) HTM10M HTM12F HTM17F HTM(ALL) Cell Line Cell Line

Figure 3. OPTN expression in treated vs untreated human trabecular meshwork cultures HTM10M, HTM12F, and HTM17F and all cultures (HTM[ALL]). A, Mean

difference in cycle threshold (⌬CT)(OPTN−GAPDH ). B and C, Fold change in OPTN level (treated vs untreated) is shown in response to timolol (B) and dexamethasone plus timolol (C). Error bars indicate standard deviation.

age level of MYOC RNA in the composite data set, we ences in MYOC RNA levels ranging from more than a see little difference in MYOC levels with or without 5-fold decrease to more than an 11-fold decrease across timolol; however, when we consider the data for the the range of timolol concentrations tested. Although separate cell cultures, 2 cultures remained unchanged this is a large decrease, the MYOC transcript is only de- by timolol exposure while HTM10M showed differ- creased and not eliminated.

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 90

12.0

10.0

8.0 )

GAPDH

–

6.0 WDR36 ( T C ∆ 4.0

2.0

0.0

–2.0 HTM10M HTM12F HTM17F HTM(ALL) Cell Line

B C 9.0 9.0

7.0 7.0

5.0 5.0

3.0 3.0

1.0 1.0 Log2 (Fold Change) Log2 (Fold Change)

–1.0 –1.0

–3.0 –3.0

–5.O –5.O HTM10M HTM12F HTM17F HTM(ALL) HTM10M HTM12F HTM17F HTM(ALL) Cell Line Cell Line

Figure 4. WDR36 expression in treated vs untreated human trabecular meshwork cultures HTM10M, HTM12F, and HTM17F and all cultures (HTM[ALL]). A, Mean

difference in cycle threshold (⌬CT)(WDR36−GAPDH ). B and C, Fold change in WDR36 level (treated vs untreated) is shown in response to timolol (B) and dexamethasone plus timolol (C). Error bars indicate standard deviation.

A curious accompanying observation is that timolol by which timolol reduces MYOC expression in culture had no effect on dexamethasone-induced MYOC RNA HTM10M might be unrelated to the mechanism by which level increases in any of the 3 cell cultures tested, not even dexamethasone induces MYOC in that same culture, but the HTM10M culture that showed a decrease in MYOC we cannot be sure until the pathways mediating each level in response to timolol alone. Thus, the mechanism change are elucidated.

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 91

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 sponse to timolol, had the same promoter region diplo- Table 2. MYOC Promoter Region Sequence Variants type as HTM12F, which showed negligible reaction to in 3 HTM Cell Cultures timolol. HTM17F and HTM12F, which had very similar responses to timolol, share one haplotype but differ at Position Change HTM10M HTM17F HTM12F the second haplotype. Additional sequencing and func- −1333 G→A G/G G/G G/G tional studies would be needed to evaluate changes in −1081 A→G A/G A/A A/G other potential regulatory sequences further from the tran- −1000 C→G C/C C/C C/C −387 C→T C/C C/C C/C scription start site or in unidentified enhancer se- −342 Length variant 13/15 13/13 13/15 quences, but the underlying basis for the response dif- −306 G→A G/A G/G G/A ference of HTM10M could reside elsewhere in the genome. −255 T→C T/T T/T T/T It is curious that the cell culture that responds to timo- −224 T→C T/T T/T T/T lol comes from a male donor, HTM10M, while the 2 cell cultures that do not respond come from female donors Abbreviation: HTM, human trabecular meshwork. HTM12F and HTM17F. However, IOP-lowering effects of timolol are not thought to be differential according to sex,45 and it would be premature to conclude any asso- Our dexamethasone data are consistent with our pre- ciation of MYOC timolol responsiveness with sex or other vious observations that HTM10M had the largest MYOC characteristics based on so few samples. changes in response to dexamethasone and that the ap- Our use of cultured cells has the disadvantage that it parently smaller MYOC response of HTM17F is in part might fail to mimic responses in vivo and the advantage due to the fact that it started out with a higher baseline that it separates out the HTM cell responses to timolol value in untreated cells. Based on our experience, the from responses to secondary factors such as elevated IOP variation in dexamethasone-induced MYOC levels, with or altered aqueous composition. In addition, the study’s and without timolol, is consistent with what we usually limited scope encompasses only the 3 known OAG genes observe in experiments involving no timolol.26,27 All of even though it is clear that there are many additional yet- the MYOC values obtained in both treated and un- to-be-identified glaucoma genes whose expression we will treated samples fall within the range of values normally eventually want to evaluate. These experiments do not seen in our cell cultures from unaffected individuals and tell us what effect the altered RNA level might have on suggest that timolol is not blocking or reducing MYOC accumulation of myocilin protein over time. induction by dexamethasone. It would appear that use of timolol might not be of In contrast to the variable effect on MYOC RNA levels, any assistance in bringing MYOC RNA levels back down timolol had negligible effects on levels of OPTN or WDR36 into the normal range in the presence of dexametha- RNA. Similarly, dexamethasone had little effect on their sone. Since the pathways by which MYOC induction oc- RNA levels, and this situation was not altered in the pres- curs are not well characterized, it is unclear whether timo- ence of timolol. The very small differences observed rep- lol might be used to limit the induction of MYOC by other resent the range of expected variability of the experimen- mechanisms discussed by other groups such as sheer tal techniques. Thus, we conclude that within the limits stress, oxidative stress, or the misfolded protein re- of this particular cell culture and assay system, neither dexa- sponse to presence of MYOC missense mutations.26,46-48 methasone nor timolol altered levels of OPTN or WDR36 In summary, timolol caused reduced expression of RNA over a 3-week course of treatment. MYOC in 1 of 3 HTM cultures. It is unclear whether timo- Thus, our results from a limited sample size suggest lol could play a role in preventing or delaying onset of that timolol exerts consistent but different effects on the myocilin-based glaucoma by reducing the amount of ab- RNA levels from 3 OAG genes in HTM. Selective bio- errant myocilin protein in individuals with MYOC mu- logical effects of ␤-blocker therapy have been demon- tations; down-regulation of MYOC would not be pre- strated in other tissues. For instance, in congestive heart dicted to be a problem since a reduction or loss of myocilin failure, ␤-blocker treatment improves cardiac function has been reported to cause no identifiable abnormali- by altering myocardial gene expression with time- ties.49-52 Mechanistic studies, determination of the preva- dependent biological effects in cardiomyocytes.38,39 In- lence of the timolol-MYOC effect, and evaluation of in teractions between ␤-adrenergic receptors and nitric ox- vivo responses will all be needed before deciding whether ide signaling have been shown at both biochemical and timolol treatment will have valid applications in pre- transcriptional expression levels in various tissues that symptomatic juvenile glaucoma in individuals with caus- include endothelium40 and ocular ciliary processes.41,42 ative MYOC mutations. The ␤-blockers have also been shown to increase subconjunctival collagen density by regulating expression Submitted for Publication: October 30, 2006; final re- of specific matrix metalloproteinases and tissue inhibi- vision received February 30, 2007; accepted May 18, 2007. tors of metalloproteinases.43,44 Correspondence: Julia E. Richards, PhD, Department of Evaluation of more than a thousand bases of se- Ophthalmology and Visual Sciences, University of Michi- quence proximal to the MYOC transcription start site in- gan, 1000 Wall St, Ann Arbor, MI 48105 (richj@umich dicated that sequence differences in the proximal pro- .edu). moter region of MYOC are not responsible for the observed Author Contributions: Drs Richards and Rozsa had ac- timolol-response differences between HTM10M and the cess to all of the data and take full responsibility for the other 2 HTM cultures. HTM10M, with its decrease in re- findings.

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 92

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 Financial Disclosure: None reported. 24. Zhou Z, Vollrath D. A cellular assay distinguishes normal and mutant TIGR/ myocilin protein. Hum Mol Genet. 1999;8(12):2221-2228. Funding/Support: This work was supported by grants 25. Gobeil S, Rodrigue MA, Moisan S, et al. Intracellular sequestration of hetero- EY07003 (core grant, Kellogg Eye Center) and EY09580 oligomers formed by wild-type and glaucoma-causing myocilin mutants. Invest (Dr Richards) from the National Institutes of Health, un- Ophthalmol Vis Sci. 2004;45(10):3560-3567. 26. Rozsa FW, Reed DM, Scott KM, et al. Gene expression profile of human trabec- restricted grants from Research to Prevent Blindness, Inc ular meshwork cells in response to long-term dexamethasone exposure. Mol Vis. to the Kellogg Eye Center, and the Van Arnam Glau- 2006;12:125-151. coma Research Fund of the University of Michigan De- 27. Rozsa FW, Scott KM, Pawar H, Samples JR, Wirtz MK, Richards JE. Differential expression profile prioritization of positional candidate glaucoma genes: the GLC1C partment of Ophthalmology and Visual Sciences. locus. Arch Ophthalmol. 2007;125(1):117-127. 28. Rhee DJ, Tamm ER, Russell P. Donor corneoscleral buttons: a new source of trabecular meshwork for research. Exp Eye Res. 2003;77(6):749-756. REFERENCES 29. Lindstrom RL, Kaufman HE, Skelnik DL, et al. Optisol corneal storage medium. Am J Ophthalmol. 1992;114(3):345-356. 1. Quigley HA, Broman AT. The number of people with glaucoma worldwide in 2010 30. Phillips CI, Bartholomew RS, Levy AM, Grove J, Vogel R. Penetration of timolol and 2020. Br J Ophthalmol. 2006;90(3):262-267. eye drops into human aqueous humour: the first hour. Br J Ophthalmol. 1985; 2. Nouri-Mahdavi K, Hoffman D, Coleman AL, et al. Predictive factors for glauco- 69(3):217-218. matous visual field progression in the Advanced Glaucoma Intervention Study. 31. Colomb E, Nguyen TD, Bechetoille A, et al. Association of a single nucleotide poly- Ophthalmology. 2004;111(9):1627-1635. morphism in the TIGR/MYOCILIN gene promoter with the severity of primary 3. Gordon MO, Beiser JA, Brandt JD, et al. The Ocular Hypertension Treatment Study: open-angle glaucoma. Clin Genet. 2001;60(3):220-225. baseline factors that predict the onset of primary open-angle glaucoma. Arch 32. Alward WL, Kwon YH, Khanna CL, et al. Variations in the myocilin gene in pa- Ophthalmol. 2002;120(6):714-720. tients with open-angle glaucoma. Arch Ophthalmol. 2002;120(9):1189-1197. 4. Leskea MC, Heijl A, Hyman L, et al. Factors for progression and glaucoma treat- 33. Polansky JR, Juster R, Spaeth G. Association of the myocilin mt.1 promoter vari- ment: the Early Manifest Glaucoma Trial. Curr Opin Ophthalmol. 2004;15(2): ant with the worsening of glaucomatous disease over time. Clin Genet. 2003; 102-106. 64(1):18-27. 5. Niziol LM, Musch DC, Gillespie BW, Lichter PR. Baseline factors associated with 34. Fan BJ, Leung YF, Pang CP, et al. Polymorphisms in the myocilin promoter un- IOP mean and variability during long-term treatment for newly-diagnosed open- related to the risk and severity of primary open-angle glaucoma. J Glaucoma. angle glaucoma [ARVO abstract 3451]. Invest Ophthalmol Vis Sci. 2006;47 2004;13(5):377-384. (suppl):program 3451. 35. Leung YF, Tam PO, Baum L, et al. TIGR/MYOC proximal promoter GT-repeat poly- 6. Palmberg P. How clinical trial results are changing our thinking about target morphism is not associated with myopia. Hum Mutat. 2000;16(6):533. pressures. Curr Opin Ophthalmol. 2002;13(2):85-88. 36. Saura M, Cabana M, Ayuso C, Valverde D. Mutations including the promoter re- 7. Asrani S, Zeimer R, Wilensky J, et al. Large diurnal fluctuations in intraocular gion of myocilin/TIGR gene. Eur J Hum Genet. 2005;13(3):384-387. pressure are an independent risk factor in patients with glaucoma. J Glaucoma. 37. Kirstein L, Cvekl A, Chauhan BK, Tamm ER. Regulation of human myocilin/TIGR 2000;9(2):134-142. gene transcription in trabecular meshwork cells and astrocytes: role of up- 8. Coakes RL, Brubaker RF. The mechanism of timolol in lowering intraocular pres- stream stimulatory factor. Genes Cells. 2000;5(8):661-676. sure in the normal eye. Arch Ophthalmol. 1978;96(11):2045-2048. 38. Yasumura Y, Takemura K, Sakamoto A, et al. Changes in myocardial gene ex- 9. Prichard BN. The second Lilly Prize Lecture, University of Newcastle, July 1977: pression associated with beta-blocker therapy in patients with chronic heart failure. beta-adrenergic receptor blockade in hypertension, past, present and future. Br J Card Fail. 2003;9(6):469-474. J Clin Pharmacol. 1978;5(5):379-399. 39. Shahrara S, Sylven C, Drvota V. Subtype specific downregulation of thyroid hor- 10. Wax MB, Molinoff PB, Alvarado J, Polansky J. Characterization of beta- mone receptor mRNA by beta-adrenoreceptor blockade in the myocardium. Biol adrenergic receptors in cultured human trabecular cells and in human trabecu- Pharm Bull. 2000;23(11):1303-1306. lar meshwork. Invest Ophthalmol Vis Sci. 1989;30(1):51-57. 40. Jayachandran M, Hayashi T, Sumi D, et al. Up-regulation of endothelial nitric ox- 11. Elena PP, Denis P, Kosina-Boix M, et al. Beta adrenergic binding sites in the hu- ide synthase through beta(2)-adrenergic receptor—the role of a beta-blocker with man eye: an autoradiographic study. J Ocul Pharmacol. 1990;6(2):143-149. NO-releasing action. Biochem Biophys Res Commun. 2001;280(3):589-594. 12. Stamer WD, Huang Y, Seftor RE, et al. Cultured human trabecular meshwork cells 41. Liu R, Flammer J, Luscher TF, Haefliger IO. Beta-adrenergic agonist-induced ni- express functional alpha 2A adrenergic receptors. Invest Ophthalmol Vis Sci. 1996; trite production in isolated pig ciliary processes. Graefes Arch Clin Exp Ophthalmol. 37(12):2426-2433. 1998;236(8):613-616. 13. Wiederholt M, Schafer R, Wagner U, Lepple-Wienhues A. Contractile response 42. Liu R, Flammer J, Haefliger IO. Forskolin upregulation of NOS I protein expres- of the isolated trabecular meshwork and ciliary muscle to cholinergic and ad- sion in porcine ciliary processes: a new aspect of aqueous humor regulation. renergic agents. Ger J Ophthalmol. 1996;5(3):146-153. Klin Monatsbl Augenheilkd. 2002;219(4):281-283. 14. Friedman Z, Bloom E, Polansky JR. Adrenergic drug effects on cyclic AMP in cul- 43. Ito T, Ohguro H, Mamiya K, et al. Effects of antiglaucoma drops on MMP and tured human trabecular meshwork cells. Ophthalmic Res. 1999;31(1):53-58. TIMP balance in conjunctival and subconjunctival tissue. Invest Ophthalmol Vis 15. Kawa JE, Higginbotham EJ, Chang IL, Yue BY. Effects of antiglaucoma medica- Sci. 2006;47(3):823-830. tions on bovine trabecular meshwork cells in vitro. Exp Eye Res. 1993;57(5): 44. Mietz H, Schlotzer-Schrehardt U, Strassfeld C, Krieglstein GK. Effect of latano- 557-565. prost and timolol on the histopathology of the rabbit conjunctiva. Invest Oph- 16. Sibayan SA, Latina MA, Sherwood ME, et al. Apoptosis and morphologic changes thalmol Vis Sci. 2001;42(3):679-687. in drug-treated trabecular meshwork cells in vitro. Exp Eye Res. 1998;66(5): 45. Hedman K, Alm A, Gross RL. Pooled-data analysis of three randomized, double- 521-529. masked, six-month studies comparing intraocular pressure-reducing effects of 17. Sheffield VC, Stone EM, Alward WL, et al. Genetic linkage of familial open angle latanoprost and timolol in patients with ocular hypertension. J Glaucoma. 2003; glaucoma to chromosome 1q21-q31. Nat Genet. 1993;4(1):47-50. 12(6):463-465. 18. Stone EM, Fingert JH, Alward WLM, et al. Identification of a gene that causes 46. Polansky JR, Fauss DJ, Zimmerman CC. Regulation of TIGR/MYOC gene ex- primary open angle glaucoma. Science. 1997;275(5300):668-670. pression in human trabecular meshwork cells. Eye. 2000;14:503-514. 19. Nguyen TD, Chen P, Huang WD, et al. Gene structure and properties of TIGR, an 47. Liu Y, Vollrath D. Reversal of mutant myocilin non-secretion and cell killing: im- olfactomedin-related glycoprotein cloned from glucocorticoid-induced trabec- plications for glaucoma. Hum Mol Genet. 2004;13(11):1193-1204. ular meshwork cells. J Biol Chem. 1998;273(11):6341-6350. 48. Vollrath D, Liu Y. Temperature sensitive secretion of mutant myocilins. Exp Eye 20. Rezaie T, Child A, Hitchings R, et al. Adult-onset primary open-angle glaucoma Res. 2006;82(6):1030-1036. caused by mutations in optineurin. Science. 2002;295(5557):1077-1079. 49. Wiggs JL, Vollrath D. Molecular and clinical evaluation of a patient hemizygous 21. Monemi S, Spaeth G, DaSilva A, et al. Identification of a novel adult-onset pri- for TIGR/MYOC. Arch Ophthalmol. 2001;119(11):1674-1678. mary open-angle glaucoma (POAG) gene on 5q22.1. Hum Mol Genet. 2005; 50. Lam DS, Leung YF, Chua JK, et al. Truncations in the TIGR gene in individuals 14(6):725-733. with and without primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2000; 22. Polansky JR, Fauss DJ, Chen P, et al. Cellular pharmacology and molecular bi- 41(6):1386-1391. ology of the trabecular meshwork inducible glucocorticoid response gene product. 51. Gould DB, Miceli-Libby L, Savinova OV, et al. Genetically increasing Myoc ex- Ophthalmologica. 1997;211(3):126-139. pression supports a necessary pathologic role of abnormal proteins in glaucoma. 23. Lu¨tjen-Drecoll E, May CA, Polansky JR, et al. Localization of the stress proteins Mol Cell Biol. 2004;24(20):9019-9025. alpha B-crystallin and trabecular meshwork inducible glucocorticoid response 52. Kim BS, Savinova OV, Reedy MV, et al. Targeted disruption of the myocilin gene protein in normal and glaucomatous trabecular meshwork. Invest Ophthalmol (Myoc) suggests that human glaucoma-causing mutations are gain of function. Vis Sci. 1998;39(3):517-525. Mol Cell Biol. 2001;21(22):7707-7713.

(REPRINTED) ARCH OPHTHALMOL / VOL 126 (NO. 1), JAN 2008 WWW.ARCHOPHTHALMOL.COM 93