Whole Exome Sequencing Identifies a Novel Mutation in the PITX3 Gene, Causing Autosomal Dominant Congenital Cataracts in a Chine

Available online at www.annclinlabsci.org 92 Annals of Clinical & Laboratory Science, vol. 47, no. 1, 2017 Whole Exome Sequencing Identifies a veNo l Mutation in the PITX3 Gene, Causing Autosomal Dominant Congenital Cataracts in a Chinese Family

Hui Liu1,*, Hankui Liu2,*, Junxiang Tang1, Qiongfen Lin2, Yuxiu Sun1, Chaohong Wang1, Huanming Yang2, Muhammad Riaz Khan3, Mohamud Walid Peerbux4, Sohail Ahmad4, Ihtisham Bukhari3,5, and Jiansheng Zhu1

1Maternity and Child Health Hospital of Anhui Province, The Maternal and Child Health Clinical College, Anhui Medical University, Hefei, China, 2BGI-Shenzhen, Shenzhen, China, 3School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, China, 4Al-Shifa Tr ust Eye Hospital, Rawalpindi, Pakistan, and 5Department of Biochemistry, King Saud University, Riyadh, Kingdom of Saudi Arabia

Abstract. Background. Congenital cataract is the cloudiness of the eye’s natural lens and is a primary cause of congenital vision loss. It accounts for almost 10% of childhood vision loss worldwide. Methods. A four generation Chinese family having seven affected individuals was recruited for the current study. Exome sequencing was performed to identify the genetic cause of congenital cataract. Results. Analysis of data identified a veno l frameshift mutation, c.608delC (p.A203fs), in the PITX3 gene. This mutation was only observed in the affected individuals while the unaffected members of the familyas well as 100 ethnically matched normal controls did not contain this deletion. Conclusion. These findings suggest that p.A203fs is the cause of cataracts in the recruited family. This information would be further helpful in the genetic diagnosis of cataract and in the genetic counseling of similar patients.

Key words: Cataract, Blindness, Vision loss, PITX3 gene, Frame-shift Mutation.

Introduction CRYBAl/A3,CRYBA4, CRYBBl, CRYBB2, CRYBB3, CRYGC, CRYGD, CRYGS); three membrane pro- Cataract is an opacity or cloudiness of the eye's lens tein genes (GJA3, GJA8, MIP); three transcription and causes childhood blindness in about 10% of regulatory factor genes (PITX3, MAF, HSF4); one the worlds' population. It occurs in about 1-to-6 cytoskeletal protein gene (BSFP2); one chromatin cases per 10,000 live births [1-3]. Clinically, it is a modifying protein-4B gene (CHMP4B); one recep- heterogeneous lens disorder which may occur in an tor tyrosine kinase gene (EPHA2), and the Nance- isolated fashion or with any syndrome, such as Horan syndrome gene NHS [1,4,6-16]. Down syndrome, Wilson’s disease, and myotonic dystrophy, et cetera [4,5]. Most isolated cataracts A family with congenital cataracts was enrolled are inherited in an autosomal dominant fashion de- from Anhui, China, and whole exome sequence spite the possibilities of X-linked and autosomal analysis revealed a novel pathogenic mutation in a recessive inheritance [4,5]. Dominant inheritance known gene. is most common as compared to others. Materials and methods To date, more than 20 genes have been reported to have an association with congenital cataracts, in- Clinical evaluation. A four-generation, 31-member, cluding ten crystallin genes (CRYAA, CRYAB, Chinese Han family from the Anhui Province of China with congenital cataracts was enrolled from the Maternity *These authors contributed equally to this study. Address and Child Health Hospital of Anhui Province (Figure correspondence to Ihtisham Bukhari, Department of Biochemistry, 1). Eleven members of the pedigree were collected for King Saud University, Riyadh, Kingdom of Saudi Arabia, e mail: [email protected], or Jiansheng Zhu, Maternity and Child this study, including seven affected individuals (II:2, Health Hospital of Anhui Province, The Maternal and Child Health II:5, III:2, III:4, III:12, IV:1, IV:6), and four unaffected Clinical College, Anhui Medical University, Hefei, China; e mail: [email protected] individuals (III:8, III:9, IV:2, IV:7 ). All the recruited (affected and unaffected) individuals underwent detailed

Figure 1. (A) Pedigrees of the Chinese Han family with congenital cataract. Affected individuals are indicated by fully shaded and proband by an arrow. (B) Sequencing analysis of c.608delC (p.A203fs) mutation in the PITX3 gene. ophthalmic examinations, including acuity, slit lamp ex- net/). Low-quality SNP calls and indels were filtered out by amination, fundoscopy, and intraocular pressure mea- criteria established by [32]: the quality of consensus score surement. One hundred unrelated, ethnically matched, should be ≥20, the depth of sequencing ≥4 and ≤500, copy normal controls were also recruited from the general number ≥2 and the distance between two adjacent SNPs population of the same region. A 5-10 ml of peripheral should be ≥5 bp. blood samples were collected from all affected and normal individuals in EDTA tubes, and Genomic DNA Then, the known polymorphic loci were filtered out by using was extracted from the leukocytes by using the public databases including dbSNP (http://www.ncbi.nlm. GentraPuregene Blood Kit (Qiagen, GmbH, Germany) nih.gov/projects/SNP/snp_summary.cgi), 1000 Genome while the quantity and purity of the extracted DNA was Project data (1000genomes release_20100804, http:// tested using ultraviolet spectrometry (ActGene Inc, www.1000genomes.org), HapMap (2010-08_ Taipei, Taiwan). phaseII+III,http://hapmap.ncbi.nlm.nih.gov/) and YH project (http://yh.genomics.org.cn/). By using in-house data- The project was thoroughly explained to participants bases, we effectively reduced system errors and polymorphic and informed written consents were taken from all par- loci in Chinese populations. Finally, the list of potential can- ticipants for the use of their blood samples for current didate genes with variation was obtained. Only the muta- analysis. All the experimental and sampling procedures tions in genes which are already known to cause autosomal were approved by the Ethical review Committee of dominant cataracts in human or animal models were chosen Maternal and Child Health Hospital Hefei and Anhui for validation studies. After performing several genes, only Medical University, Anhui, PR China. All the proce- PITX3 fulfilled the criteria of candidate gene. The following dures were performed in accordance with the ethical set of primers was used for identification of the PITX3 muta- standard of 1964 Helsinki declaration and its later tion in all individuals of the family: forward primer, amendments or comparable ethical standards. CGTGCTGTTTGGCTTTGAGC; reverse primer, CCTTTCCATTCGCCTTCAACTC. Whole Exome Sequencing and candidate gene analysis. Whole exome sequencing was performed by BGI- PCR products were sequenced by ABI Prism BigDye ShenZhen by using exome capture chip NimbleGen Terminator v3.1 Cycle Sequencing Kit (ABI,Foster City, SeqCap EZ v2.0. All operations including library prepa- CA, USA) and analyzed on an ABI 3700XL genetic ration, hybridization, capture, washing, and amplifica- analyzer. tion were accomplished in strict accordance with the manufacturer's instructions. The purified DNA libraries Results were sequenced on the Hiseq2000 platform with a read length of 90 base pairs. Clinical findings. A 10-year-old girl was enrolled in the Maternity and Child Health Hospital of Anhui Map reading and variant analysis. Reads were aligned Province, Anhui, Hefei, China with a complaint of bi- to the hg19 reference genome (NCBI build 37.1) using SOAPaligner. Single nucleotide variations (SNVs) were lateralcataracts andnormaleyevision(OD:4.3,OS:4.3). called using SOAPsnp (v2.21) and insertion and dele- There was no evidence of systemic abnormalities asso- tion by BWA (http://bio-bwa.sourceforge. ciated with the congenital cataracts of this affected girl. 94 Annals of Clinical & Laboratory Science, vol. 47, no. 1, 2017

A family clinical history of cataracts showed two and with a conserved homeodomain required for affected individuals in the family, who had previ- DNA binding [1]. The protein, encoded by PITX3, ously undergone bilateral (II: 2) or unilateral (III: has 99% amino-acid homology with the murine 12) cataract surgery. There were total nine affected PITX3 protein, where the homeodomain is 100% individuals in this pedigree with different cataract- identical and about 70% identical with the other associated symptoms, including nystagmus and members of the family PITX1 and PITX2 [17,18]. poor visual acuity in one affected individual (IV:1), left eye, posterior, subcapsular cataract in another PITX3 mRNA is detected in the lens placode and (III:2), and one case diagnosed with bilateral, pos- forming lens pit in 10 dpc in mouse embryos. With terior, subcapsular cataract (III:4). Medical records progressing embryonic development and after of the patients revealed that the opacity appeared birth, it is also expressed in the midbrain, tongue, either at birth or developed during the first few incisor primordia, condensing mesenchyme around months of life and progressed with the age. the sternum and vertebrae, and in the head muscles [17]. This expression study of PITX3 in mice dem- Mutation analysis. The analyses of the whole onstrates its role in the development of the mesen- exome sequence data of three patients (II: 5, IV: 1, cephalic dopaminergic system. IV: 6) and one unaffected individual (IV: 7) identified several variants. A prioritization scheme was As PITX3 is involved in the formation of lens, this applied to identify the pathogenic mutations in the protein should have a great role in eye morphology. patients; only mutations shared by patients and not Mutations in this gene have been reported in some shared by normal control were selected for further non-eye disorders but, until now, not many muta- validation processes. tions in PITX3 have been reported in cataract patients [17,19-27]. A deletion mutation in the All SNPs and short frameshift coding insertions or PITX3 gene was reported to cause autosomal-dom- deletions (indels) were compared and filtered inant, congenital cataracts in a Belgo-Romanian against exome data from dbSNP, 1000 Genome family [1]. It is also reported that a mutation in the Project data, HapMap and YH project, respectively. PITX3 gene has caused anterior segment dysgenesis We finally focused on non-synonymous mutations, (ASMD) along with congenital posterior polar cat- splice site acceptor, donor site mutations, and in- aract, even within the members of same family [7]. dels that were more likely to be pathogenic. In the Six different mutations in the PITX3 gene have initial stage, we focused on the variants in known been discovered in 14 different families having con- genes causing cataracts and selected a c.608delC genital cataracts, but 17-bp duplication (p.A203fs) in the PITX3 gene that was observed in c.640_656dup were found as most common, ac- three patients but not in unaffected individuals. No counting for more than half of the families [7,18- mutation was seen in other genes already known to 21,23,24]. Cataract with ASD is only reported in cause autosomal dominant congenital cataract ex- association with this duplication. cept PITX3 (Figure 1 B). This variant was further checked in all normal and affected members of the A 17-bp duplication c.640-656dup was reported in family. The variant was co-segregated in affected in- a Han Chinese family with posterior polar cataract dividuals and absent in the unaffected individuals - it was the first PITX3 mutation found in a Chinese in this family. Furthermore, this variant was absent pedigree [19]. In the current study, we found a nov- in 100 ethnically-matched, unrelated controls col- el mutation c.608delC in a Han Chinese family lected from the general population of the Anhui. with autosomal-dominant, congenital cataracts. The c.608delC variant (p.A203fs) seems to be Discussion pathogenic because in the studied pedigree, it is segregated only to patients with congenital cata- PITX3 is a transcription regulatory factor gene, lo- racts and was not found in the both unaffected cated on 10q24.32, having 5 exons. It encodes a family members and the 100 unrelated, ethnically- protein containing 302 amino acids, within the matched controls. Patients in this pedigree have paired-like class of homeobox transcription factors, little variation in phenotype; phenotypic variability Frameshift deletion in PITX3 Causing Autosomal Dominant Congenital Cataracts 95 can be ascribed to modifier genes. The current re- 12. Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M, Cui B, Xia Y, Liu J, Hu L, Zhao G, Hayden sults may provide new insights into the cause and MR, Kong X. Mutant DNA-binding domain of HSF4 is associated diagnosis of congenital cataracts in Chinese with autosomal dominant lamellar and Marner cataract. Nat populations. Genet 2002;31: 276-278. 13. Ma X, Li FF, Wang SZ, Gao C, Zhang M, Zhu SQ.Anew mutation in BFSP2 (G1091A) causes autosomal dominant congenital Acknowledgment lamellar cataracts. Mol Vis 2008;14: 1906-1911. 14. Shiels A, Bennett TM, Knopf HL, Yamada K, Yoshiura K, Niikawa We highly acknowledge the participation of the patients and normal members of the family in the current study. N, Shim S, Hanson PI. CHMP4B,anovel gene for autosomal dominant cataracts linked to chromosome 20q. Am J Hum Genet 2007;81: 596-606. References 15. Shiels A, Bennett TM, Knopf HL, Maraini G, Li A, Jiao X, Hejtmancik JF. The EPHA2 gene is associated with cataracts linked to chromosome 1p. Mol Vis 2007;14: 2042-2055. 1. Verdin H, Sorokina EA, Meire F, Casteels I, de Ravel T, 16. Li A, Li B, Wu L, Yang L, Chen N, Ma Z. Identificationofanovel Semina EV, De Baere E. Novel and recurrent PITX3 mutations NHS mutation in a Chinese family with Nance-Horan syndrome. in Belgian families with autosomal dominant congenital cata- Curr Eye Res 2015; 40: 434-438. ract and anterior segment dysgenesis have similar phenotypic 17. Semina EV, Ferrell RE, Mintz-Hittner HA, Bitoun P, Alward WL, and functional characteristics. Orphanet J Rare Dis 2014; 9: Reiter RS, Funkhauser C, Daack-Hirsch S, Murray JC.Anovel 26. homeobox gene PITX3 is mutated in families with autosomal- 2. Guo Y, Yuan L, Yi J, Xiao J, Xu H, Lv H, Xiong W, Zheng W, dominant cataracts and ASMD. Nat Genet 1998;19: 167-170. Guan L, Zhang J, Xiang H, Qi Y, Deng H. Identificationofa 18. Zhao CM, Peng LY, Li L, Liu XY, Wang J, Zhang XL, Yuan F, Li GJA3 mutation in a Chinese family with congenital nuclear RG, Qiu XB, Yang YQ. PITX2 Loss-of-Function Mutation cataract using exome sequencing. Indian.JBiochem Biophys Contributes to Congenital Endocardial Cushion Defect and 2013; 50: 253-258. Axenfeld-Rieger Syndrome. PLoS One 2015;10: e0124409. 3. Santana A, Waiswo M. The genetic and molecular basis of con- 19. Berry V, Yang Z, Addison PK, Francis PJ, Ionides A, Karan G, genital cataract. Arq Bras Oftalmol 2011;74: 136-142. Jiang L, Lin W, Hu J, Yang R, Moore A, Zhang K, Bhattacharya 4. Santana A, Waiswol M, Arcieri ES, Cabral de Vasconcellos JP, SS. Recurrent 17 bp duplication in PITX3 is primarily associated Barbosa de Melo M. Mu tation analysis of CRYAA, CRYGC, with posterior polar cataract (CPP4).JMedGenet 2004; 41: e109. and CRYGD associated with autosomal dominant congenital 20. Addison PK, Berry V, Ionides AC, Francis PJ, Bhattacharya SS, cataract in Brazilian families. Mol Vis 2009;15: 793-800. Moore AT. Posterior polar cataract is the predominant conse- 5. Huang B, He W. Molecular characteristics of inherited con- quence of a recurrent mutation in the PITX3gene. Br J Ophthalmol genital cataracts. EurJMedGenet 2010;53: 347-357. 2005;89: 138-141. 6. Xia XY, Wu QY, An LM, Li WW, Li N, Li TF, Zhang C, Cui 21. Finzi S, Li Y, Mitchell TN, Farr A, Maumenee IH, Sallum JM, YX, Li XJ, Xue CY.Anovel P20R mutation in the alpha-B Sundin O. Posterior polar cataract: genetic analysis of a large fam- crystallin gene causes autosomal dominant congenital posteri- ily. Ophthalmic Genet 2005;26: 125-130. or polar cataracts in a Chinese family. BMC Ophthalmol 22. Burdon KP, McKay JD, Wirth MG, Russell-Eggit IM, Bhatti S, 2014;14: 108. Ruddle JB, Dimasi D, Mackey DA, Craig JE. The PITX3 gene in 7. Gu Z, Ji B, Wan C, He G, Zhang J, Zhang M, Feng G, He L, posterior polar congenital cata ract in Australia. Mol Vis 2006;12: Gao L. A splice site mutation in CRYBA1/A3 causing autoso- 367-371. mal dominant posterior polar cataract in a Chinese pedigree. 23. Bidinost C, Matsumoto M, Chung D, Salem N, Zhang K, Stockton Mol Vis 2010;16: 154-160. DW, Khoury A, Megarbane A, Bejjani BA, Traboulsi EI. 8. Bennett TM, Mackay DS, Knopf HL, Shiels A. A novel mis- Heterozygous and homozygous mutations in PITX3 in a large sense mutation in the gene for gap-junction protein alpha3 Lebanese family with posterior polar cataracts and neurodevelop- (GJA3) associated with autosomal dominant "nuclear punc- mental abnormalities. Invest Ophthalmol Vis Sci 2006;47: tate" cataracts linked to chromosome 13q. Mol Vis 2004;10: 1274-1280. 376-382. 24. Summers KM, Withers SJ, Gole GA, Piras S, Taylor PJ. Anterior 9. Chen C, Sun Q, Gu M, Liu K, Sun Y, Xu X. A novel Cx50 segment mesenchymal dysgenesis in a large Australian family is (GJA8) p.H277Y mutation associated with autosomal domi- associated with the recurrent 17 bp duplication in PITX3. Mol Vis nant congenital cataract identified with targeted next-genera- 2008;14: 2010-2015. tion sequencing. Graefes. Arch Clin Exp Ophthalmol 25. Withers SJ, Gole GA, Summers KM. Autosomal dominant cata- 2015;253: 915-924. racts and Peters anomaly in a large Australian family. Clin Genet 10. Francis P, Chung JJ, Yasui M, Berry V, Moore A, Wyatt MK, 1999; 55: 240-247. Wistow G, Bhattacharya SS, Agre P. Functional impairment of 26. Aldahmesh MA, Khan AO, Mohamed J, Alkuraya FS. Novel reces- lens aquaporin in two families with dominantly inherited cata- sive BFSP2 and PITX3 mutations: insights into mutational mecha- racts. Hum Mol Genet 2000;9: 2329-2334. nisms from consanguineous populations. Genet Med 2011;13: 11. Hansen L, Eiberg H, Rosenberg T. Novel MAF mutation in a 978-981. family with congenital cataract-microcornea syndrome. Mol 27. Berry V, Francis PJ, Prescott Q, Waseem NH, Moore AT, Vis 2007;13: 2019-2022. Bhattacharya SS. A novel 1-bp deletion in PITX3 causing congenital posterior polar cataract. Mol Vis 2011;17: 1249-1253.