Hindawi International Journal of Genomics Volume 2017, Article ID 4798474, 11 pages https://doi.org/10.1155/2017/4798474

Research Article Chimeric in Deletions and Duplications Associated with Intellectual Disability

Sonia Mayo, Sandra Monfort, Mónica Roselló, Carmen Orellana, Silvestre Oltra, Alfonso Caro-Llopis, and Francisco Martínez

Unidad de Genética, Hospital Universitario y Politécnico La Fe, Avenida de Fernando Abril Martorell 106, 46026 Valencia, Spain

Correspondence should be addressed to Francisco Martínez; [email protected]

Received 23 November 2016; Revised 7 March 2017; Accepted 4 April 2017; Published 24 May 2017

Academic Editor: Mohamed Salem

Copyright © 2017 Sonia Mayo et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

We report on three nonrelated patients with intellectual disability and CNVs that give rise to three new chimeric genes. All the genes forming these fusion transcripts may have an important role in central nervous system development and/or in expression regulation, and therefore not only their deletion or duplication but also the resulting chimeric gene may contribute to the phenotype of the patients. Deletions and duplications are usually pathogenic when affecting dose-sensitive genes. Alternatively, a chimeric gene may also be pathogenic by different gain-of-function mechanisms that are not restricted to dose- sensitive genes: the emergence of a new polypeptide that combines functional domains from two different genes, the deregulated expression of any coding sequence by the promoter region of a neighboring gene, and/or a putative dominant-negative effect due to the preservation of functional domains of partially truncated . Fusion oncogenes are well known, but in other pathologies, the search for chimeric genes is disregarded. According to our findings, we hypothesize that the frequency of fusion transcripts may be much higher than suspected, and it should be taken into account in the array-CGH analyses of patients with intellectual disability.

1. Introduction promoter region of a neighboring gene and/or a putative dominant-negative effect due to the preservation of func- According to Kaye [1], chromosomal translocations and tional domains of partially truncated proteins. The observed fusion oncogenes are the most frequent type of somatic phenotype then may be a consequence of the CNV itself, but DNA alteration in cancer, detected in 282 of the 384 vali- the chimeric gene might contribute and modify it, as in those dated cancer genes. Interstitial deletion can also generate cases with a wide spectrum phenotype associated to similar fusion genes as described by Tomlins et al. [2] in prostate CNVs with different breakpoints. cancer [3], and although rare, fusion transcript has also been Until now, few cases have been documented in the litera- described due to tandem duplication as described by Jones ture with intellectual disability (ID) due to fusion transcripts, et al. in pilocytic astrocytomas [4]. all of them occurred de novo. Four were caused by chromo- Chimeric genes can have different possible consequences: somal translocations that generated more than one fusion when due to a deletion, not only the loss of a fully functional transcript [5–8], and another case was due to an interstitial copy of the gene is especially relevant for haploinsufficient deletion [9]. genes, but also the gain-of-function of the chimeric gene. This paper describes three nonrelated patients with ID The new fusion might be pathogenic due to different and different CNVs detected by array-CGH, generating dif- mechanisms: the emergence of a new polypeptide that ferent chimeric genes confirmed by different strategies. All combines functional domains from two different genes, the the genes forming the fusion transcript might have an impor- deregulated expression of any coding sequence by the tant role in the central nervous system (CNS) development 2 International Journal of Genomics and/or in gene expression regulation and therefore may average spacing between primers was 5 kb (Figure 1(a)). PCR contribute to the phenotype of both patients. reactions for each forward-reverse pair of primers were proc- essed on a PTC-200 thermocycler (BIO-RAD laboratories) 2. Material and Methods (Supplementary Table 1). The study was approved by the Ethical Committee on Clinical 2.5. Enzyme Digestion. A total of 8 μl of the long template ° Research of the authors’ hospital, and written informed PCR product were digested 1 hour at 55 C with 1X digestion consent was obtained from all participants. This research was buffer 3 (New England Biolabs, Hitchin, UK) and 10U of BstXI carried out according to the principles of the Declaration of (New England Biolabs) for patient 1. Fragment analysis was Helsinki. All positions in this study are based on the UCSC performed with a 12% polyacrylamide gel electrophoresis. Genome Browser, National Center for Biotechnology Infor- According to the digestion pattern, a new set of primers mation (NCBI) build 37, hg19. was designed to amplify the approximately 1500 bp breakpoint-containing fragment with a specific PCR program 2.1. Sample Collection. Genomic DNA from the patients, their (Supplementary Table 1, Figure 1(a)). parents, and healthy controls was isolated from peripheral For patient 3, a total of 8 μl of the long template PCR blood using QIAamp DNA Mini Kit and the QIAcube auto- product (Supplementary Table 1) were double digested 1 ° mated extractor (QIAGEN, Hilden, Germany). DNA quality hour at 37 C with 1X digestion buffer Tango (Fermentas, and concentration were measured using the NanoDrop Burlington, Ontario, Canada) and 5 U of RsaI (Fermenta) ND-1000 Spectrophotometer (NanoDrop Technologies, ° and PstI (New England Biolabs). Fragment analysis was Rockland, DE, USA), and it was stored at −20 C. performed with a 12% polyacrylamide gel electrophoresis. Ficoll gradient centrifugation was used to isolate mononu- clear cells from peripheral blood from the patients and healthy 2.6. Fusion Transcript Detection. cDNA status was assessed by controls, following the manufacturer’s recommendations quantitative PCR using the constitutive gene glyceraldehyde- (Lymphoprep AXIS-SHIELD PoCAS). Once purified, mono- 3-phosphate dehydrogenase (GAPDH) as control. Sequenc- nuclear cells were lysed in RLT buffer and total RNA was ing reaction and analyses were performed according to routine isolated using the RNasy kit (QIAGEN), as recommended by protocol on an ABI-3130XL Genetic Analyzer with the BigDye the manufacturer. RNA quality and concentration were mea- Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). sured also with the NanoDrop ND-1000 spectrophotometer. Primer sequence, amplified size, and the PCR reagents and Total RNA was reversely transcribed in a final volume of program are detailed in Supplementary Table 1. 40 μl, following themanufacturer’sguidelines (Geneamp Gold RNA PCR Core Kit, Applied Biosystems, Foster City, CA, 2.7. Sequencing. Sequencing reaction and analyses were per- ° USA), and immediately stored at −80 C. formed according to routine protocol on an ABI-3130XL Genetic Analyzer with the BigDye Terminator v1.1 Cycle 2.2. Microarray. Whole genome dosage analysis was per- Sequencing Kit (Applied Biosystems). formed by oligo-CGH-array (44K: G4426B Agilent Technolo- gies, Palo Alto, CA, USA) and/or targeted custom array for ID 3. Results and autism (manuscript in preparation). Array hybridization and scanning were performed following the manufacturer’s 3.1. Clinical Description specifications. The data were analyzed using the DNA analyt- ics 4.0 software (Agilent Technologies). 3.1.1. Patient 1. The patient was the second-born child of healthy nonconsanguineous parents, a 29-year-old mother 2.3. Quantitative PCR Analysis. Real-time PCR assays were and a 34-year-old father. He was born to term by normal performedontheLightCycler480(Roche,Basel,Switzerland). delivery after abortion risk in the first trimester. His birth Reagents andprograms ofthePCR,aswellassequence andsize weight was 3382 g (50th percentile), his length was 47 cm of each amplicon, are available in Supplementary Table 1 (25th percentile), and his head circumference was 33 cm available online at https://doi.org/10.1155/2017/4798474. (25–50th percentile). Neonatal malnutrition, gastroesopha- Standard curves were generated from 2-fold serial dilutions geal reflux, and persistent vomiting required one-month of 60 ng female DNA. Reactions were done in triplicate, and admission at hospital. Clinical examination at 21 months of melting curve analyses were performed to assess the specificity age noted some dysmorphic features such as hypertrichosis, of the primers. low anterior hairline, hypotelorism, downslanted palpebral fissures, epicanthus, anomalous teeth implantation, micro- 2.4. Characterization of the Breakpoints. A method based on gnathia, and dysmorphic, rotated, and low-set ears. His Primer walking by long template PCR [10] was used to locate weight and height were in 3rd percentile, and he had micro- the breakpoint in patient 1. Starting from the array-CGH cephaly (<3rd percentile) and treated plagiocephaly. As results, eight forward primers (LIMS1_F1-8) were designed congenital anomalies, he has aberrant origin of coronary in the 42 kb interval between the normal dosage probe and artery and renal pyelectasis. He has mild intellectual disabil- the deleted probe in LIMS1 (chr2:109258450-109300532) ity and motor and speech development delay, he could not sit and five reverse primers (RANBP2_R1-5) were designed in alone until the age of 14 months, and at the age of examina- the 24 kb interval between the deleted probe and the normal tion, he could not walk alone despite attending a centre for dosage probe in RANBP2 (chr2:109380702-109405259). The early developmental therapy and physiotherapy. He has axial International Journal of Genomics 3

Scale 100 kb hg19 109,200,000 109,250,000 109,300,000 109,350,000 109,400,000 chr2: User Supplied Track User Track Bands Localized by FISH Mapping Clones 2q12.3 RefSeq Genes LIMS1 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) RANBP2 ))))))))))))))))))))))))))))))))))))) ))))))))))))) LIMS1 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) CCDC138 LIMS1 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) CCDC138 LIMS1 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) CCDC138 LIMS1 )) )))))))))))))))))))))))))))))))))))))))))))))))))))) CCDC138 LIMS1 ))))))))))))))))))))))))) Database of Genomic Variants: Structural Variant Regions (CNV, Inversion, In/del) esv2720498 dgv1234e1 esv2658253 nsv527491 esv23794 dgv153e55 esv2661412 nsv834328 esv2720505 nsv521122 esv1476912 esv993250 Agilent 44K (CGH Array) 1 dup 0 -1 del Primers

LIMS1_ F1 F2 F3 F4 F5 F6 F7 F8 RANBP2_R1 R2 R3 R4 R5

LIMS1_F3.5 RANBP2_R3.5 (a)

Scale 500 kb hg19 chr6: 157,200,000 157,300,000 157,400,000 157,500,000 157,600,000 157,700,000 157,800,000 157,900,000 158,000,000 User Supplied Track User Track Chromosome Bands Localized by FISH Mapping Clones 6q25.3 ARID1B ))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) RefSeq Genes TMEM242 (((((( ZDHHC14 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) ARID1B ))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) ZDHHC14 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) MIR4466 MIR3692 Database of Genomic Variants: Structural Variant Regions (CNV, Inversion, In/del) nsv823884 nsv523413 esv272891 esv1041952 esv5688 esv2732971 nsv349938 esv28761 esv33371 nsv519889 nsv507370 nsv5556 esv271459 esv27020 esv2666999 esv2660140 esv2124670 esv2732982 dgv1071n67 esv508436 esv2673117 esv2732972 nsv886795 esv33003 esv1286652 esv2732974 esv2732980 nsv509155 nsv509156 nsv820493 esv2610603 esv22447 esv2076685 esv4246 esv3496 esv3990 esv1113682 dgv1073e201 esv2732981 nsv349327 esv996138 esv2127993 esv6974 esv2732977 esv273971 nsv349208 esv270746 nsv339114 esv274649 esv2732976 esv33442 esv5900 esv2732979

Agilent 44K (CGH Array) 1 dup 0 -1 del

qPCR (-DDCp) 1 del 0 -1 dup Ex5 Ex6 Ex1 Ex2 Ex3 Ex4 (b)

Scale 50 kb hg19 chr6: 56,920,000 56,930,000 56,940,000 56,950,000 56,960,000 56,970,000 56,980,000 56,990,000 57,000,000 57,010,000 57,020,000 57,030,000 57,040,000 57,050,000 57,060,000 57,070,000 User Supplied Track User Track Chromosome Bands Localized by FISH Mapping Clones 6p12.1 6p11.2 RefSeq Genes KIAA1586 )) )))))) ZNF451 ))))))))))))))) BAG2 )) )))))))))))))) KIAA1586 )) )))))) ZNF451 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) )))))))))))))))))))))))))))) RAB23 (((((((((((((((((((( KIAA1586 )) )))))) ZNF451 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) )))))))))))))))))))))))))))) RAB23 (((((((((((((((((((( KIAA1586 )) )))))) LOC101927211 (((((((((((((((((((((((((((((((((((((((((((((( (((((((((((((((((((((((((((((( ( RAB23 (((((((((((((((((((( RAB23 (((((((((((((((((((( RAB23 (((((((((((((((((((( RAB23 (((((((((((((((((((( Database of Genomic Variants: Structural Variant Regions (CNV, Inversion, In/del) nsv885913 nsv5316 esv2732127 nsv462949 esv2669750 esv2673413 nsv526143 esv27854 nsv350038 Agilent 44K custom (CGH Array) 1 dup 0

-1 del

PCR flanking segmental duplication hr6: 56954800 chr6:56911303

KIAA1586_F2 R1 ZNF451_F3 R3 (c)

Figure 1: Representation of the CNVs in patient 1 (a), patient 2 (b), and patient 3 (c). CNVs are showed by a black box above and the grey dashed box. Refseq genes and the CNVs annotated in the region are indicated in the middle. Diagram of the array-CGH results and the strategies to detect the chimeric gene are showed below: the primers used to locate the breakpoint in patient 1 (a), the qPCR results in the exons of affected genes of patient 2 (b), and the primers flanking the segmental duplication in patient 3 (c).

hypotonia. In addition, he shows increased pain threshold, 3.1.2. Patient 2. The female patient was the first-born child of sound hypersensitivity, and anomalous behaviour such as unrelated parents, a 25-year-old mother and a 23-year-old avoidance of physical contact. father. Her mother is healthy, and her father and paternal 4 International Journal of Genomics grandmother are diagnosed of bipolar disorder. She has a located in the same 15 nucleotide stretch present in two differ- healthy brother. After 42 weeks of pregnancy, she was born ent Alu elements (Figures 2(a) and 2(b)). by caesarean section due to lack of expansion. Her birth weight was 2740 g (10–25th percentile). She had neonatal 3.2.3. Identification of the Fusion Transcript. According to the eating disorders, and she did not cry until her first year of Refseq database, LIMS1 encodes five different isoforms, all of age. Clinical examination at 5 years of age noted some dys- them with 10 exons, where the last 9 exons are common morphic features such as microcephaly, round face, hypertri- (exon 7 to 15). The ten exons from all the isoforms are cod- chosis, low anterior hairline, sparse hair with abundant hair ing, except isoform b, which has two variants with alternative fall, hypotelorism, synophrys, small and low-set ears, concave noncoding first exon (exons 2 and 3). RANBP2 contains 29 nasal ridge, thick lips, widely spaced teeth, and micrognathia. coding exons. LIMS1 is disrupted between the first exon of Her weight and height were low (3–10th percentile), and she all isoforms and the second exon (exon 7), while RANBP2 has no significant congenital anomalies, apart from abnormal is disrupted between exons 25 and 26. Fusion transcript pigmentation of the skin, dystrophic toenails, clinodactyly, LIMS1 (isoform b variant 2)-RANBP2 was detected and con- and short fingers. She has moderate intellectual disability firmed by sequencing (Figure 3) in patient RNA but not in with motor and speech delay. She could not walk until the control RNA (specific primers and PCR conditions in age of 18 months, and at the age of examination, she has poor Supplementary Table 1). The resulting chimeric transcript coordination and begins to talk with speech therapist’s help. possess an open reading frame corresponding to exons 27 She attends a regular school with personalized support. She to 29 of RANBP2 giving a 260-aa hypothetical protein which has no sleep disorder and is sociable. contains the conserved domain of cyclophilin_ABH_like, implicated in protein folding processes. 3.1.3. Patient 3. The female patient was born from unrelated healthy parents, a 22-year-old mother and a 27-year-old 3.2.4. Patient 2. The array-CGH showed that two of the four father. As family antecedents, her parents had two previous probes located in ARID1B were deleted (A_14_P111041 abortions and one child, who only lived 48 h, born after the and A_14_P106263). The next distal conserved probe patient. After 38 weeks of pregnancy, she was born by caesar- was in ZDHHC14, which is orientated in the same direc- ean section due to lack of dilation. Her birth weight was tion and could also be partially deleted (region 5q25.3). – – 2750 g (25 50th percentile), and her length was 48 cm (25 The proximal breakpoint is contained in a 193 kb interval ffi 50th percentile). She had neonatal feeding di culties with (chr6:157192799-157386210); while the distal breakpoint is an Apgar score of 6/9. Clinical examination at 5 years of located in a 623 kb interval (chr6:157454197-158076922). age noted some dysmorphic features such as prominent fore- The big size of these regions did not allow locating pre- fi head, big ears, hypotelorism, downslanted palpebral ssures, cisely the breakpoints of the deletion by long template epicanthus, strabismus, depressed nasal root, anteverted PCR, as in patient 1. In this case, a new strategy was per- fl nares, long philtrum, and malar attening. As congenital formed. By qPCR analysis of exons 5 and 6 of ARID1B anomalies, she presents agenesis of corpus callosum and an gene, and of exons 1, 2, 3, and 4 of ZDHHC14 gene, we inguinal hernia. She has moderate intellectual disability and could refine the breakpoint locations between the exons autism, with motor and speech delay. She could not walk 5 and 6 of ARID1B gene and between the exons 1 and 2 until the age of 14 months, and at the age of examination, of ZDHHC14 gene (Figure 1(b)). Both parents of the she has poor coordination and only speaks single words. patient showed normal dosage for all the amplicons, con- She also has sleep disorder and aggressiveness towards others firming that the deletion occurred de novo in the patient and herself. (Figure 2(c)). 3.2. Laboratory Findings 3.2.5. Identification of the Fusion Transcript. According to the ff 3.2.1. Patient 1. The array-CGH showed deleted two contig- Refseq database, ARID1B gene encodes two di erent iso- uous probes, one located in LIMS1 (A_14_P129225) and forms, in which exon 3 is alternatively spliced: isoform 2 with one located in RANBP2 (A_14_P113906), two genes with 20 exons (2249 aa) and isoform 1 with 19 exons (2236 aa). the same orientation in (2q12.3). On the other hand, ZDHHC14 gene, with 9 exons, encodes also for two different isoforms differing in the last exon. 3.2.2. Characterization of the Breakpoints. LIMS1F2- Fusion transcript between exon 5 of ARID1B and exon 2 of RANBP2R4 PCR and LIMS1F3-RANBP2R4 PCR showed ZDHHC14 was detected by RT-PCR in patient’s RNA. This specific bands for the patient, and not for his parents, of new transcript was absent in control RNA. Subsequent approximately 11 kb and 6 kb, respectively (data not show). sequence analysis confirmed the presence of the fusion prod- The digestion pattern of the LIMS1F2-RANBP2R4 product uct (Figure 3). Primer sequence and technical information PCRwithBstXIallowed narrowingdownthebreakpoint inter- are provided in Supplementary Table 1. val. A new set of primers (LIMS1F3.5-RANBP2R3.5) yielded a Although the resulting chimera of ARID1B and 1666 bp amplicon specifically for the patient and not for his ZDHHC14 is not in the same reading frame, the transcript parents. The sequencing of this amplicon allowed to locate would codify for a 722-aa hypothetical protein. The first the breakpoint in LIMS1 at chr2:109274856-109274870 and 679 amino acids coded by the 5′ region of ARID1B, while the breakpoint in RANBP2 at chr2:109397243-109397257, the 43 remaining amino acids of the C-terminal end would corresponding to a 122.4 kb deletion. Both breakpoints are correspond to a new peptidic sequence. International Journal of Genomics 5

BstXI (479) (143) (511) (810) (1876) (716) (3376) (794) (1583) (232)(721) LIMS1 RANBP2 LIM1S_F2 LIM1S_F3 LIM1S_F3.5 RANBP2_R3.5 RANBP2_R4

LIMS1 ref seq TGGCAAGATCTTGGCTCACTGCAACCTCCGCCTCC CAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACT RANBP2 ref seq (reverse complement) TGGTGCCATCTTGGCTCACC GCAACCTCCGCCTCC TGGGTTCAAGCGATTCTCCTGCCCCAGCCTCCCGAGTAGCTGGGATT

LIMS1_F3.5 500 510 520 530 540 550 560 570 580 590 600 AAG TTTTGGGGGGGGGGGGGGG TTCCT T TT TCCCCCCCCCC TA TA T GG AAT TTT CC A TAAA TCCCC G TCCCCC T GGGGGGG TTAAA TT TCCC T CCCCCTCCC GGGGGGA TA TA TT

RANBP2_R3.5 (reverse complement) 150 160 170 180 190 200 210 220 230 240 250 GGA TTTT G TTC TTTTTGGCCAAAAAAAA GGGGGG C T TC G T GGGGCCCCCCCCCCCCCCCCCCCCCCCCCCC TTTTT GG G T GC TTTT GGGAAA GG TTTT G A GC T GG AAA TGGG T G TT

(a)

Query LIMS1 (807bp) subjectRANBP2 (1680bp) Score= 311 bits (168), Expect = 2e-88 Chimera_gDNA (1666pb) Identities= 256/298 (86%), Gaps = 7/298 (2%) Alu Sp Alu Sx Strand= plus/plus F3.5 R3.5 LIMS1 512 tttcttttcctttttcttttttGAAATGGAGTTTTGTTCTTGTTGTCCAGGCTGGAGTGC 571 ||||| ||||||||||||||||| ||||||| |||||||||||||||||||||| RANBP2 529 TTTC-TTT-CTTTTT-TTTTTTGAGACGGAGTTTCACTCTTGTTGCCCAGGCTGGAGTGC 585 LIMS1 572 AGTGGCAAGATCTTGGCTCACTGCAACCTCCGCCTCCCAGGTTCAAGTGATTCTCCTGCC 631 | |||| ||| ||| ||| ||| |||| ||| ||| |||| || |||| ||| | ||| ||| || ||| RANBP2 586 AATGGTGCCATCTTGGCTCACCGCAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCC 645 LIMS1 (807pb) LIMS1 632 TCAGCCTCCCAAGTAGCTGGGACTACAGGCATGTGCCACCACACCCGGCTAATTTTGAAT 691 Alu Sq |||| || |||| ||| |||||| ||||||||| ||||||||||||| |||||||||| | F3.5 RANBP2 646 CCAGCCTCCCGAGTAGCTGGGATTACAGGCATATGCCACCATGCCTGGTTAATTTTGTAT 705 LIMS1 692 TTTTACTAGAGACGAGGTTT-TACCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCA 750 |||| | |||| |||||||||| | ||| |||||||| ||||||| | | ||||| ||||||| | | RANBP2 706 TTTTAGTAGAGACGGGGTTTCT-CCATGTTGGTCAGGCTGGTCTTGAACTCCTGACCTC- 763 LIMS1 751 AGTA-ATCCACTGTCCTCAGCCTCCCAAAGTCCTGGGATTACAGGCGTGAGCCACTGC 807 (1680pb) |||||||| |||| |||| |||||| | |||| |||||||| |||||||||||||| RNBP2 RANBP2 64 AGGAGATGCGCTCACCTCGGCCTCACAAAGTGCTGGGATTACAGGCGTGAGCCACTGC 821 Alu Sx1Alu Sx Alu Sp Alu Sx R3.5 (b) 1.4 1.2 1 0.8 0.6 2–ΔΔCt 0.4 0.2 0 ARID1BE5 ARID1BE6 ZDHHC14E2 ZDHHC14E3 ZDHHC14E4 ZDHHC14E1 Exons Patient Father Mother (c)

Figure 2: (a) Digestion pattern of LIMS1F2-RANBP2R4 amplicon with BstXI. The size of each fragment is showed in brackets, the black box represents the 15 nt match between both genes, and primers are indicated as black arrows (above). The sequence of the breakpoint is showed below with the 15 nt squared in white letters and in a black box in the reference sequence and in a black empty box in the sequencing sequence. (b) (Left) BLAST from LIMS1 and RANBP2 sequences at that region. The matched nucleotides are white in a black box. (Right) representation of the Alu elements contained in the breakpoint regions. The black box represents the 15 nt sequence showed left. (c) qPCR results of exons 5 and 6 of ARID1B gene and of exons 1, 2, 3, and 4 of ZDHHC14 gene. 6 International Journal of Genomics

Patient 1 Patient 2

Ex1-6 Ex26 Ex27 Ex28 Ex29 Ex1 Ex5 Ex2 Ex3 Ex9a-b LIMS1 RANBP2 ARID1B …. …. ZDHHC14 LIMS1E2F RANBP2E26-27R ARID1BE5F ZDHHC14E2R ZDHHC14E3R (a) GCCCTGATAAATAAAAATTTCCAATGGGCAAATACTGGAGCAGCTGTGTTTGGAACAC Ref seq GAAAGACCATCAAGTTTACCACTGTCCGTACCTGGCGGTGAAAATCACCCCTGCCAT 30 40 50 60 70 80 90 100 110 120 130 140 G CCCTTG A AA A TA AAAA TTTCC AA TGG GCCCC AAA T AT GG A G A GTTTTT G G GGA A CCA G AAAGG ACC ATTTTTTTTT C AA ACC A C GGG CCAC CG CGGGGAAAA TC A CCCC TT CCA

(b)

Max Total Query E Max Max Total Query E Max Accession Description score score coverage value ident Accession Description score score coverage value ident Transcripts Transcripts NM_006267.4 RANBP2 152 152 47% 5E-35 100% NM_153746.1 ZDHHC14 584 584 83% 5E-166 99% NM_004987.4 LIMS1 73.1 73.1 22% 4E-11 100% NM_024630.2 ZDHHC14 584 584 83% 5E-166 99% Genomic sequences MN_020732.3 ARID1B 63.9 63.9 10% 3E-09 95% NT_022171.15 Chr2,GRCh37.p2 152 227 70% 5E-35 100% MN_017519.2 ARID1B 63.9 63.9 10% 3E-09 95% NW_001838822.1 152 227 70% 5E-35 100% Genomic sequences NT_025741.15 Chr6,GRCh37.p2 294 651 93% 1E-78 100% NW_001838991.2 ZDHHC14 292 582 83% 4E-78 100% NW_001838990.2 ARID1B 63.9 63.9 10% 3E-09 95%

Color key for alignment scores Color key for alignment scores <40 40-50 50-80 80-200 >=200 <40 40-50 50-80 80-200 >=200 Query Query 301 60 90 120 150 1 70 140 210 280 350

(c)

Figure 3: (a) Schematic representation of both chimeric genes in patients 1 and 2 and the primers used for its cDNA sequencing. (b) Sequence from RT-PCR cDNA, which confirm the presence of the fusion transcripts. A light-gray box underlines the 5′end of the chimeric gene formed by LIMS1 in patient 1 and ARID1B in patient 2, and a dark-grey dashed box indicates the 3′end genes (RANBP2 in patient 1 and ZDHHC14 in patient 2). (c) BLAST from these sequences confirming that there are no other annotated regions in genome with such sequences (BLAST conditions: Database Human genomic plus transcript; optimize for highly similar sequences with a word size of 24).

3.2.6. Patient 3. Thecustom array-CGHshowed that44probes 4. Discussion located in KIAA1586 were duplicated. The proximal break- point is contained in a 4.1 kb interval within KIAA1586 We report the results of breakpoint analysis in three patients (chr6: 56911417-56915520), while the distal breakpoint is with intellectual disability associated with congenital anoma- located in a 150 kb interval (chr6: 56920035-57070165) that lies carrying different chimeric genes. contains four genes. A segmental duplication is located in both The fusion transcript of patient 1 is generated from intervals (chr6:56911304-56913080 and chr6:56954801- LIMS1 first exon to RANBP2 exon 26. The identification of 56956578), and the distal one is contained in ZNF451, which the breakpoints inside Alu elements allows us to hypothesize is orientated in the same direction than KIAA1586 that the fusion gene was generated by a nonallelic homolo- (Figure 1(c)). gous recombination due to the high By PCR with specific primers of each region flanking the (Figure 2). segmental duplication (ZNF451_F3-KIAA1586_R1), we LIMS1 encodes for a highly conserved protein composed could amplify the fusion fragment in the patient and her of five LIM domains arranged in tandem [11, 12]. Different father. The sequence of both ends of the amplicon revealed studies support that LIMS1 participates in focal adhesion, that the 5′region belongs to ZNF451 while the 3′end is from signal transduction between the extracellular matrix and KIAA1586. The digestion pattern of the PCR product with the intracellular network, and formation and maintenance RsaI y PstI helped confirm the chimeric transcript (Figure 4). of neuronal polarity [13–16]. On the other hand, RANBP2 The confirmation of the specific chimeric transcript in is a component of the nuclear pore complex [17] with a wide this case is not possible by RT-PCR due to the high homology range of functions, such as facilitation of protein traffic and of the sequence between the first exons of ZNF451and sumoylation [18], energy maintenance in neurons [19–21], KIAA1586 genes. or chromosomal stability [22]. Some missense mutations in International Journal of Genomics 7

AAGGGCCGCTCCTCCTTTGAAGAGGTTTTGCGTCTCT ZNF451 TTGTACAGCATGGGTTTCCAAAGCAGAAGAGAGTGTTTTATGATGTAT GAGGGCTGCCCCTCTTTTGAAGCGGTTTT:CGTCTCT KIAA15861 TTGGACAGAATGGGTTTCTAAAGCAGAAGGGAGTGTTTTATGATATAT AAGGGCCGCTCCTCCTTTGAAGAGGTTTTGCGTCTCT Patient TTGGACAGAATGGGTTTCTAAAGCAGAAGGGAGTGTTTTATGATATAT AAGGGCCGCTCCTCCTTTGAAGAGGTTTTGCGTCTCT Father TTGGACAGAATGGGTTTCTAAAGCAGAAGGGAGTGTTTTATGATATAT 230 240 250 1720 1730 1740 1750 1760 AAGGGCCGCTCCTCCTTTGAAGAGGTTTTGCGTCTCT TTGGACAGAATGGGTTTCTAAAGCAGAAGGGAGTGTTTTATGATATAT ...... 󳴆󳴆󳴆󳴆 󳴆 ...... 󳴆󳴆 󳴆 󳴆

XF‒2605‒F1 Fragment base #180. Base 180 of 277 Patient XF‒2605‒R1 Fragment base #275. Base 275 of 385 TCCTCC TTTGAAG A TTAA AGC AGGG AAG A GGT T CCT CCTTTG AAG A AATT T C G T C TT CCC T A CC

CGM‒3093‒F1 Fragment base #176. Base 176 of 263 ‒ ‒ TCCTCC TTTG AAG A Father TTAAAGCACGM 3093 R1 GGGFragment AA base #317.G Base 317 A of 428GGT T CCT CCTTTG AAG A AATTT C G T C TT CCC T A CC

(a) Segmental duplication

(63) (701) (475) (253) (132) (91) (219) ZNF451 (1934bp) F3 R3 Chimera (1942bp) F3 (713) (318) R1 KIAA1586 (1894bp) F2 R1

(b)

Promoter Ex1 Ex2 Ex3 Ex4 ZNF451 KIAA1586

ZNF451_F3 KIAA1586_R1 (c)

Figure 4: (a) Sequences from both ends of the ZNF451-KIAA1586 chimera. (b) Digestion pattern of PCR amplicons of ZNF451, KIAA1586 and the chimera with RsaI and PstI. The size of each fragment is showed in brackets, the yellow box represents the segmental duplication, and PCR’s primers are indicated as black arrows. (c) Schematic representation of chimeric gene according to these results.

RANBP2 are associated to acute necrotizing encephalopathy dominant-negative effector, by blocking ligands from [23, 24]. Consequently, both genes have important but differ- RANBP2 or by generating a misfolding of them. Also, the ent roles in CNS development, so that their deletion may be expression of this new protein product would be deregulated, pathogenic and contribute to the patient’s phenotype. No as it will be controlled from the promoter sequences (and copy number variations (CNV) comprising only these two transcription factors) of LIMS1 gene, which has a different genes are documented (Figure 1(a)). Although much larger expression pattern (Figure 5(a)). deletions are recorded in different databases, which include In relation with the chimeric gene of patient 2, it contains total or partially LIMS1 and RANBP2 among other genes exons 1 to 5 of ARID1B gene and all the ZDHHC14 exons, (DGV esv2720498; DECIPHER case 252497; and ISCA cases except the first one. ARID1B forms part of a family of pro- nssv579951), none of them are compatible with the genera- teins with DNA-binding capacity, implicated in the control tion of a chimeric gene. of cell growth, differentiation, and development [25]. In con- In addition to the effect due to haploinsufficiency of trast, not much is known about ZDHHC14, besides that it the respective genes, the fusion gene may also conceivably encodes for a zinc finger, and therefore is implicated in gene participate in the phenotype in different ways. The result- expression regulation. ing chimeric transcript contains the conserved domain of ARID1B is associated with the Coffin-Siris syndrome cyclophilin_ABH_like, implicated in protein folding pro- [26–28], and the clinical features of the patient 2 are com- cesses. The chimeric protein might interfere the function patible with this diagnosis (mainly the neonatal eating disor- of RANBP2, by competing for its ligands, acting as a ders, ID, motor and speech delay, hypertrichosis, synophrys, 8 International Journal of Genomics

300 250 200

TPM 150 100 50

0

land

Skin

Lung

Brain

Testis

Spleen

Retina

Muscle

Prostate

UTterus

Adrenal

GI_tract

Placenta

Nervous

Pancreas

Cartilage

Stomach

Lymph_node

Bone_marrow

Genitoirinary

Pituitary_g Peripheral_nerv

LIMS1 RANBP2 (a) 200

160

120

TPM 80

40

0

Skin

Liver

Lung

Brain

Testis

Ovary

Spleen

Retina

Breast

Muscle

Prostate

Thyroid

Placenta

Nervous

Pancreas

Cartilage

Stomach

ymph_node

L

Head_n_neck

Bone_marrow Peripheral_nerv

ARID1B ZDHHC14 (b) 210 180 150 120

TPM 90 60 30

0

Eye

Skin

Liver

Lung

Brain

Colon

Testis

Retina

Kidney

Prostate

Adrenal

Placenta

Vascular

Nervous

Pancreas

Cartilage

Stomach

Lymph_node

Genitoirinary Peripheral_nerv

ZNF451 KIAA1586 (c)

Figure 5: Differential expression pattern in the most relevant tissues from LIMS1 and RAMBP2 (a); ARID1B and ZDHHC14 (b); and ZNF451and KIAA1586 (c) (GeneHub-GEPIS). TPM (transcript per million). dystrophic toenails, clinodactyly, and short fingers). There- skin, while she does not present other features associated fore, the haploinsufficiency of ARID1B explains these clinical to Coffin-Siris syndrome as corpus callosum abnormalities signs in patient 2. However, this case also presents micro- or hypotonia. This is consistent with the broad clinical vari- gnathia, hypotelorism, and abnormal pigmentation of the ability associated to ARID1B mutations, which led Santen International Journal of Genomics 9 and Clayton-Smith [28] to propose that other genetic factors experience, focusing in deletions with breakpoints within might modify the phenotype of ARID1B haploinsufficiency. regions of <315 kb in patients with ID and/or ASD, we esti- In our case, this factor might well be the generation of fusion mated that 41 out of 68 (60%) deletions could lead to a transcripts. In this regard, Backx et al. [7] described a patient fusion transcripts. All the selected cases tested, present in with a balanced translocation t(6;14)(q25.3;q13.2), which this paper, were confirmed, yielding a minimal proportion generated reciprocal in-frame fusion transcripts of ARID1B of 3% of deletions that generate new chimeric genes. Hope- and MRPP3, and presented intellectual disability and agene- fully, new technologies will help in the identification of pos- sis of corpus callosum. sible fusion transcripts generated by CNVs and a more Patient 3 is the only case we present with a chimeric gene precise estimation of its frequency. due to an inherited duplication. As in patient 1, the fusion Chimeric genes derived from CNVs have been occasion- gene could be generated by a nonallelic homologous recom- ally described associated to other pathologies besides cancer bination mediated by a segmental duplication. [33, 34]. As far as we know, only five cases have been docu- The chimera generated by the duplication contains the mented in the literature with intellectual disability associated promoter region of ZNF451 and most of the coding region with de novo fusion transcripts. Four of them were caused by of KIAA1586 whereas the 5’UTR region and the first two chromosomal translocations generating two reciprocal coding exons included in the segmental duplication may be fusion transcripts [5–8] and one due to an interstitial deletion of either gene (Figure 2). Therefore, the expression of the chi- similar to the cases we present in this work [9]. meric gene, mainly constituted by KIAA1586, would be regu- Therefore, this is the first report on chimeric genes gener- lated by the promoter region of ZNF45, and since both genes ated by CNVs (microdeletions and microduplications) in have different expression patterns, the expression of this pro- three unrelated patients with intellectual disability. tein product would be deregulated. Both KIAA1586 and ZNF451 encode for transcriptional 5. Conclusions factors with wide gene expression (Figure 5(c)). Bucan et al. [29] considered KIAA1586 as an autism susceptibility gene, Nowadays, array-CGH analyses are widely used in the study since it was deleted in 5 out of 1771 unrelated patients with of ID and/or congenital anomalies, but only the loss or gain autism spectrum disorders (ASD) and in none of the 2538 of genetic dosage is usually sought, and in many cases, the controls, although the same deletion can also be found in regions containing the breakpoints are not well defined. unaffected relatives (siblings and parents). Pinto et al. [30] Theoretically, the occurrence or not of a chimeric gene considered KIAA1586 as a candidate gene for ASD in the may explain the different clinical consequences of similar analysis for rare CNV (<1% frequency). However, the loss microdeletions or microduplications, since the breakpoints of one copy of KIAA1586 mediated by this segmental dupli- could be different and so the consequences. Therefore, the cation will always be accompanied by a significant deregula- possibility of generating a new chimeric gene, which may tion of the expression of ZNF451, which would be under the well be responsible or contribute to the phenotype observed, control of the promoter of KIAA1586 (Figure 1(c)). Since the also should be taken into consideration in array CGH- expression patterns of both genes are very different, ectopic analyses. We hypothesize that formation of fusion tran- expression of this gene, not only the haploinsufficiency of scripts due to CNVs in ID patients may be a mechanism that KIAA1586, might well be responsible for the presumed asso- should be taken into account in the array-CGH analyses ciation to autism. from now on. In spite of the consequences of the deletion and the duplication mediated by the segmental duplication are quite Conflicts of Interest different, the inherited duplication of patient 3 might also be a predisposing factor for neurodevelopmental disorder, The authors declare that they have no competing interests. as previously proposed for the deletion [30, 31]. In 2012 Holt et al. tried to systematically investigate the Acknowledgments generation of fusion transcripts derived from rare CNVs This study was supported by Grants PI11/00389 and PI14/ associated with ASD in patients and controls [32]. Focusing 00350 (ISCIII-Acción Estratégica en Salud 2013-2016; on CNVs with a population frequency <1% and a size FEDER-Fondo Europeo de Desarrollo Regional) and Funda- >30 kb, they estimated that 134 out of 2382 (5.6%) rare ción Ramón Areces. Sonia Mayo was supported by IIS La Fe/ CNVs present in 889 ASD patients could lead to a fusion Fundación Bancaja fellowship. The authors are grateful for transcripts and they found a similar frequency to that in the collaboration of the patients and their families. controls. They tested five selected duplications but only fi ff one fusion transcript was con rmed in a ected and unaf- References fected subjects. They concluded that there is no evidence that fusion genes generated by CNVs lead to ASD suscepti- [1] F. J. Kaye, “Mutation-associated fusion cancer genes in bility. Evaluation of the generation of chimeric genes associ- solid tumors,” Molecular Cancer Therapeutics, vol. 8, no. 6, ated with pathologies as ASD and ID, with a low rate of pp. 1399–1408, 2009. recurrence and a large diversity of CNVs, is not easy, espe- [2] S. A. Tomlins, D. R. Rhodes, S. Perner et al., “Recurrent fusion cially for duplications, which could be integrated in different of TMPRSS2 and ETS transcription factor genes in prostate loci or in different orientations. On the contrary, in our cancer,” Science, vol. 310, no. 5748, pp. 644–648, 2005. 10 International Journal of Genomics

[3] M. Yoshimoto, A. M. Joshua, S. Chilton-Macneill et al., [17] N. Yokoyama, N. Hayashi, T. Seki et al., “A giant nucleopore “Three-color FISH analysis of TMPRSS2/ERG fusions in protein that binds ran/TC4,” Nature, vol. 376, no. 6536, prostate cancer indicates that genomic microdeletion of chro- pp. 184–188, 1995. mosome 21 is associated with rearrangement,” Neoplasia, [18] A. Pichler, A. Gast, J. S. Seeler, A. Dejean, and F. Melchior, vol. 8, no. 6, pp. 465–469, 2006. “The nucleoporin RanBP2 has SUMO1 E3 ligase activity,” Cell, [4] D. T. Jones, S. Kocialkowski, L. Liu et al., “Tandem duplication vol. 108, no. 1, pp. 109–120, 2002. producing a novel oncogenic BRAF fusion gene defines the [19] Y. Cai, B. B. Singh, A. Aslanukov, H. Zhao, and P. A. Ferreira, majority of pilocytic astrocytomas,” Cancer Research, vol. 68, “The docking of kinesins, KIF5B and KIF5C, to ran-binding no. 21, pp. 8673–8677, 2008. protein 2 (RanBP2) is mediated via a novel RanBP2 domain,” [5] H. G. Nothwang, H. G. Kim, J. Aoki et al., “Functional hemizyg- The Journal of Biological Chemistry, vol. 276, no. 45, osity of PAFAH1B3 due to a PAFAH1B3-CLK2 fusion gene in a pp. 41594–41602, 2001. femalewithmentalretardation,ataxiaandatrophyofthebrain,” [20] A. Aslanukov, R. Bhowmick, M. Guruju et al., “RanBP2 mod- Human Molecular Genetics, vol. 10, no. 8, pp. 797–806, 2001. ulates Cox11 and hexokinase I activities and haploinsuffi- [6] M. B. Ramocki, J. Dowling, I. Grinberg et al., “Reciprocal ciency of RanBP2 causes deficits in glucose metabolism,” fusion transcripts of two novel Zn-finger genes in a female PLoS Genetics, vol. 2, no. 10, article e177, 2006. with absence of the corpus callosum, ocular colobomas and a [21] K. I. Cho, Y. Cai, H. Yi, A. Yeh, A. Aslanukov, and P. A. Fer- balanced translocation between 2p24 and reira, “Association of the kinesin binding domain of RanBP2 9q32,” European Journal of Human Genetics, vol. 11, no. 7, to KIF5B and KIF5C determines mitochondria localization pp. 527–534, 2003. and function,” Traffic, vol. 8, no. 12, pp. 1722–1735, 2007. [7] L. Backx, E. Seuntjens, K. Devriendt, J. Vermeesch, and H. Van [22] M. M. Dawlaty, L. Malureanu, K. B. Jeganathan, E. Kao, Esch, “A balanced translocation t(6;14)(q25.3;q13.2) leading and C. Sustmann, “Resolution of sister centromeres requires to reciprocal fusion transcripts in a patient with intellectual RanBP2-mediated SUMOylation of topoisomerase IIalpha,” disability and agenesis of corpus callosum,” Cytogenetic and Cell, vol. 133, no. 1, pp. 103–115, 2008. – Genome Research, vol. 132, no. 3, pp. 135 143, 2011. [23] D. E. Neilson, R. M. Eiben, S. Waniewski et al., “Autosomal [8] M. Moysés-Oliveira, R. S. Guilherme, V. A. Meloni et al., dominant acute necrotizing encephalopathy,” Neurology, “X-linked intellectual disability related genes disrupted by vol. 61, no. 2, pp. 226–230, 2003. ” balanced X-autosome translocations, American Journal of [24] D. E. Neilson, M. D. Adams, O. CMD et al., “Infection-trig- Medical Genetics. Part B, Neuropsychiatric Genetics, vol. 168, gered familial or recurrent cases of acute necrotizing encepha- – no. 8, pp. 669 677, 2015. lopathy caused by mutations in a component of the nuclear [9] K. Hackmann, S. Matko, E. M. Gerlach et al., “Partial deletion pore, RANBP2,” American Journal of Human Genetics, of GLRB and GRIA2 in a patient with intellectual disability,” vol. 84, no. 1, pp. 44–51, 2009. – European Journal of Human Genetics, vol. 21, no. 1, pp. 112 [25] D. Wilsker, A. Patsialou, P. B. Dallas, and E. Moran, “ARID 114, 2013. proteins: a diverse family of DNA binding proteins implicated [10] A. C. Chinault and J. Carbon, “Overlap hybridization in the control of cell growth, differentiation and development,” screening: isolation and characterization of overlapping Cell Growth & Differentiation, vol. 13, no. 3, pp. 95–106, 2002. DNA fragments surrounding the leu2 gene on yeast chromo- [26] Y. Tsurusaki, N. Okamoto, H. Ohashi et al., “Mutations some III,” Gene, vol. 5, no. 2, pp. 111–126, 1979. affecting components of the SWI/SNF complex cause [11] A. Rearden, “A new LIM protein containing an autoepitope Coffin-Siris syndrome,” Nature Genetics, vol. 44, no. 4, homologous to “senescent cell antigen”,” Biochemical and pp. 376–378, 2012. Biophysical Research Communications, vol. 201, no. 3, [27] G. W. Santen, E. Aten, Y. Sun et al., “Mutations in SWI/SNF pp. 1124–1131, 1994. chromatin remodeling complex gene ARID1B cause Coffin- [12] C. Wu, “The PINCH-ILK-parvin complexes: assembly, Siris syndrome,” Nature Genetics, vol. 44, no. 4, pp. 379–380, functions and regulation,” Biochimica et Biophysica Acta, 2012. vol. 1692, no. 2-3, pp. 55–62, 2004. [28] G. W. Santen, J. Clayton-Smith, and ARID1B-CSS consor- [13] F. Li, Y. Zhang, and C. Wu, “Integrin-linked kinase is localized tium, “The ARID1B phenotype: what we have learned so to cell–matrix focal adhesions but not cell-cell adhesion sites far,” American Journal of Medical Genetics. Part C, Seminars and the focal adhesion localization of integrin-linked kinase in Medical Genetics, vol. 166C, no. 3, pp. 276–289, 2014. is regulated by the PINCH-binding ANK repeats,” Journal of [29] M. Bucan, B. S. Abrahams, K. Wang et al., “Genome-wide Cell Science, vol. 112, Part 24, pp. 4589–4599, 1999. analyses of exonic copy number variants in a family-based [14] C. Wu, “Integrin-linked kinase and PINCH: partners in reg- study point to novel autism susceptibility genes,” PLoS Genet- ulation of cell–extracellular matrix interaction and signal ics, vol. 5, no. 6, article e1000536, 2009. transduction,” Journal of Cell Science, vol. 112, Part 24, [30] D. Pinto, A. T. Pagnamenta, L. Klei et al., “Functional impact pp. 4485–4489, 1999. of global rare copy number variation in autism spectrum dis- [15] S. Li, R. Bordoy, F. Stanchi et al., “PINCH1 regulates cell– orders,” Nature, vol. 466, no. 7304, pp. 368–372, 2010. matrix and cell-cell adhesions, cell polarity and cell survival [31] A. Bailey, A. Le Couteur, I. Gottesman et al., “Autism as a during the peri-implantation stage,” Journal of Cell Science, strongly genetic disorder: evidence from a British twin study,” vol. 118, Part 13, pp. 2913–2921, 2005. Psychological Medicine, vol. 25, no. 1, pp. 63–77, 1995. [16] A. Jatiani, P. Pannizzo, E. Gualco, L. Del-Valle, and D. [32] R. Holt, N. H. Sykes, I. C. Conceição et al., “CNVs leading to Langford, “Neuronal PINCH is regulated by TNF-α and is fusion transcripts in individuals with autism spectrum disor- required for neurite extension,” Journal of Neuroimmune der,” European Journal of Human Genetics, vol. 20, no. 11, Pharmacology, vol. 6, no. 3, pp. 330–340, 2011. pp. 1141–1147, 2012. International Journal of Genomics 11

[33] H. C. Cheung, S. A. Yatsenko, M. Kadapakkam et al., “Consti- tutional tandem duplication of 9q34 that truncates EHMT1 in a child with ganglioglioma,” Pediatric Blood & Cancer, vol. 58, no. 5, pp. 801–805, 2012. [34] J. Oliveira, M. E. Oliveira, W. Kress et al., “Expanding the MTM1 mutational spectrum: novel variants including the first multi-exonic duplication and development of a locus-specific database,” European Journal of Human Genetics, vol. 21, no. 5, pp. 540–549, 2013. International Journal of Peptides

Advances in BioMed Stem Cells International Journal of Research International International Genomics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Virolog y http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal of Nucleic Acids

=RRORJ\ International Journal of Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 201 http://www.hindawi.com Volume 2014

Submit your manuscripts at https://www.hindawi.com

Journal of The Scientific Signal Transduction World Journal Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Genetics Anatomy International Journal of Biochemistry Advances in Research International Research International Microbiology Research International Bioinformatics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Enzyme International Journal of Molecular Biology Journal of Archaea Research Evolutionary Biology International Marine Biology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014